#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
C1orf111	284680	hgsc.bcm.edu	37	1	162343882	162343882	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr1:162343882C>T	ENST00000367935.5	-	3	821	c.742G>A	c.(742-744)Gaa>Aaa	p.E248K	RP11-565P22.6_ENST00000431696.1_Intron	NM_182581.3	NP_872387.2	Q5T0L3	CA111_HUMAN	chromosome 1 open reading frame 111	248										central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)	11	all_hematologic(112;0.15)		BRCA - Breast invasive adenocarcinoma(70;0.0938)			CTAAGGTGTTCAGCAGGACTA	0.557																																					p.E248K		Atlas-SNP	.											.	C1orf111	26	.	0			c.G742A						.						165.0	174.0	171.0					1																	162343882		2203	4300	6503	SO:0001583	missense	284680	exon3			GGTGTTCAGCAGG	BC032957	CCDS1238.1	1q23.3	2008-02-05			ENSG00000171722	ENSG00000171722			27648	protein-coding gene	gene with protein product						12477932	Standard	NM_182581		Approved		uc001gbx.2	Q5T0L3	OTTHUMG00000031375	ENST00000367935.5:c.742G>A	chr1.hg19:g.162343882C>T	ENSP00000356912:p.Glu248Lys	108.0	0.0		117.0	28.0	NM_182581	Q6X961|Q8NEC3	Missense_Mutation	SNP	ENST00000367935.5	hg19	CCDS1238.1	.	.	.	.	.	.	.	.	.	.	C	12.61	1.989953	0.35131	.	.	ENSG00000171722	ENST00000367935	T	0.32988	1.43	4.71	-2.1	0.07210	.	1.795310	0.02923	N	0.138257	T	0.05227	0.0139	N	0.14661	0.345	0.23016	N	0.99843	B	0.17038	0.02	B	0.14023	0.01	T	0.26121	-1.0112	9	0.62326	D	0.03	-23.7402	1.1961	0.01875	0.1272:0.2943:0.2498:0.3288	.	248	Q5T0L3	CA111_HUMAN	K	248	ENSP00000356912:E248K	ENSP00000356912:E248K	E	-	1	0	C1orf111	160610506	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	0.126000	0.15769	-0.871000	0.04042	-0.302000	0.09304	GAA	.	.		0.557	C1orf111-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076791.2	NM_182581	
LYST	1130	hgsc.bcm.edu	37	1	235955200	235955200	+	Missense_Mutation	SNP	G	G	C			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr1:235955200G>C	ENST00000389794.3	-	12	4516	c.4342C>G	c.(4342-4344)Ctt>Gtt	p.L1448V	LYST_ENST00000389793.2_Missense_Mutation_p.L1448V|LYST_ENST00000536965.1_Intron			Q99698	LYST_HUMAN	lysosomal trafficking regulator	1448					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			CAAGATGAAAGCAGCCGATGG	0.493																																					p.L1448V		Atlas-SNP	.											.	LYST	370	.	0			c.C4342G						.						108.0	107.0	107.0					1																	235955200		2203	4300	6503	SO:0001583	missense	1130	exon12			ATGAAAGCAGCCG	U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.4342C>G	chr1.hg19:g.235955200G>C	ENSP00000374444:p.Leu1448Val	137.0	0.0		164.0	30.0	NM_000081	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	ENST00000389794.3	hg19	CCDS31062.1	.	.	.	.	.	.	.	.	.	.	G	16.53	3.150410	0.57151	.	.	ENSG00000143669	ENST00000389794;ENST00000389793	T;T	0.62498	0.02;0.02	5.76	4.85	0.62838	.	0.431693	0.25523	N	0.030084	T	0.71533	0.3351	L	0.54323	1.7	0.80722	D	1	D;D	0.65815	0.995;0.969	P;B	0.61800	0.894;0.421	T	0.71922	-0.4446	10	0.45353	T	0.12	.	13.5336	0.61635	0.0723:0.0:0.9277:0.0	.	1448;1448	Q99698-3;Q99698	.;LYST_HUMAN	V	1448	ENSP00000374444:L1448V;ENSP00000374443:L1448V	ENSP00000374443:L1448V	L	-	1	0	LYST	234021823	1.000000	0.71417	0.992000	0.48379	0.840000	0.47671	3.130000	0.50508	1.572000	0.49736	0.650000	0.86243	CTT	.	.		0.493	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5		
GPR137B	7107	hgsc.bcm.edu	37	1	236306038	236306038	+	Missense_Mutation	SNP	C	C	A	rs199613305		TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr1:236306038C>A	ENST00000366592.3	+	1	207	c.116C>A	c.(115-117)cCc>cAc	p.P39H	GPR137B_ENST00000366591.4_Missense_Mutation_p.P39H	NM_003272.3	NP_003263.1	O60478	G137B_HUMAN	G protein-coupled receptor 137B	39						integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|membrane (GO:0016020)				endometrium(2)|large_intestine(1)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.197)|Prostate(94;0.219)|Acute lymphoblastic leukemia(190;0.226)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)			GCCGTGCCCCCCTACGTGAAG	0.711																																					p.P39H		Atlas-SNP	.											.	GPR137B	57	.	0			c.C116A						.						61.0	44.0	50.0					1																	236306038		2203	4300	6503	SO:0001583	missense	7107	exon1			TGCCCCCCTACGT	AF027826	CCDS1609.1	1q42-q43	2012-08-10	2006-01-26	2006-01-26	ENSG00000077585	ENSG00000077585			11862	protein-coding gene	gene with protein product		604658	"""transmembrane 7 superfamily member 1 (upregulated in kidney)"""	TM7SF1		9521871	Standard	NM_003272		Approved		uc001hxq.3	O60478	OTTHUMG00000037994	ENST00000366592.3:c.116C>A	chr1.hg19:g.236306038C>A	ENSP00000355551:p.Pro39His	67.0	0.0		104.0	31.0	NM_003272	Q53EK7|Q5TAE6|Q6FHI3	Missense_Mutation	SNP	ENST00000366592.3	hg19	CCDS1609.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.086274	0.76642	.	.	ENSG00000077585	ENST00000366592;ENST00000366591;ENST00000391852	T;T	0.14266	2.52;2.52	4.8	2.89	0.33648	.	0.053259	0.85682	D	0.000000	T	0.32071	0.0817	M	0.77103	2.36	0.53005	D	0.999969	D	0.69078	0.997	D	0.63192	0.912	T	0.02477	-1.1153	10	0.56958	D	0.05	-14.0193	10.022	0.42048	0.0:0.7855:0.1385:0.0761	.	39	O60478	G137B_HUMAN	H	39;39;38	ENSP00000355551:P39H;ENSP00000355550:P39H	ENSP00000355550:P39H	P	+	2	0	GPR137B	234372661	1.000000	0.71417	0.967000	0.41034	0.893000	0.52053	5.645000	0.67909	0.437000	0.26423	-0.510000	0.04470	CCC	.	C|0.999;T|0.001		0.711	GPR137B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092761.1	NM_003272	
RYR2	6262	hgsc.bcm.edu	37	1	237774131	237774131	+	Missense_Mutation	SNP	C	C	T	rs528206995		TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr1:237774131C>T	ENST00000366574.2	+	36	5070	c.4753C>T	c.(4753-4755)Cgc>Tgc	p.R1585C	RYR2_ENST00000360064.6_Missense_Mutation_p.R1583C|RYR2_ENST00000542537.1_Missense_Mutation_p.R1569C	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1585	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GTGCCCCCCGCGCCTCCACGT	0.537													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16428	0.0		0.0	False		,,,				2504	0.0				p.R1585C		Atlas-SNP	.											.	RYR2	1273	.	0			c.C4753T						.						50.0	52.0	51.0					1																	237774131		1950	4124	6074	SO:0001583	missense	6262	exon36			CCCCCGCGCCTCC	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.4753C>T	chr1.hg19:g.237774131C>T	ENSP00000355533:p.Arg1585Cys	135.0	0.0		133.0	55.0	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	hg19	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.244925	0.79912	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.98345	-4.88;-4.86;-4.87	5.24	5.24	0.73138	.	0.192154	0.30501	N	0.009495	D	0.99029	0.9668	M	0.87682	2.9	0.80722	D	1	D	0.89917	1.0	D	0.68621	0.959	D	0.99709	1.1006	10	0.87932	D	0	.	19.0203	0.92912	0.0:1.0:0.0:0.0	.	1585	Q92736	RYR2_HUMAN	C	1585;1583;1569	ENSP00000355533:R1585C;ENSP00000353174:R1583C;ENSP00000443798:R1569C	ENSP00000353174:R1583C	R	+	1	0	RYR2	235840754	0.991000	0.36638	0.796000	0.32109	0.952000	0.60782	2.931000	0.48932	2.715000	0.92844	0.655000	0.94253	CGC	.	.		0.537	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
APOB	338	hgsc.bcm.edu	37	2	21229749	21229749	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr2:21229749T>C	ENST00000233242.1	-	26	10118	c.9991A>G	c.(9991-9993)Att>Gtt	p.I3331V		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	3331					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATGGCAGGAATAAAAATATGG	0.383																																					p.I3331V		Atlas-SNP	.											.	APOB	761	.	0			c.A9991G						.						91.0	95.0	94.0					2																	21229749		2203	4300	6503	SO:0001583	missense	338	exon26			CAGGAATAAAAAT	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.9991A>G	chr2.hg19:g.21229749T>C	ENSP00000233242:p.Ile3331Val	229.0	0.0		147.0	55.0	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	hg19	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	T	12.69	2.013063	0.35511	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.39056	1.1	5.41	3.05	0.35203	.	0.186486	0.37857	N	0.001919	T	0.60011	0.2236	M	0.80746	2.51	0.80722	D	1	P	0.46020	0.871	P	0.61722	0.893	T	0.56890	-0.7904	10	0.45353	T	0.12	.	9.1651	0.37046	0.0:0.2142:0.0:0.7858	.	3331	P04114	APOB_HUMAN	V	3331	ENSP00000233242:I3331V	ENSP00000233242:I3331V	I	-	1	0	APOB	21083254	1.000000	0.71417	0.972000	0.41901	0.927000	0.56198	3.354000	0.52254	0.364000	0.24374	0.533000	0.62120	ATT	.	.		0.383	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
AGBL5	60509	hgsc.bcm.edu	37	2	27282078	27282078	+	Missense_Mutation	SNP	C	C	A			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr2:27282078C>A	ENST00000360131.4	+	11	2054	c.1895C>A	c.(1894-1896)tCc>tAc	p.S632Y	AGBL5_ENST00000323064.8_Missense_Mutation_p.S632Y|AGBL5-IT1_ENST00000411862.1_RNA	NM_021831.5	NP_068603.4	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5	632					protein branching point deglutamylation (GO:0035611)|protein deglutamylation (GO:0035608)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	28	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTCTCCTGCTCCGAAAACACC	0.537																																					p.S632Y		Atlas-SNP	.											.	AGBL5	126	.	0			c.C1895A						.						90.0	97.0	94.0					2																	27282078		2203	4300	6503	SO:0001583	missense	60509	exon11			CCTGCTCCGAAAA	BC007415	CCDS1732.3, CCDS42665.1	2p23.3	2014-06-23			ENSG00000084693	ENSG00000084693			26147	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 5"""	615900				24022482	Standard	NM_001035507		Approved	FLJ21839, CCP5	uc002rie.3	Q8NDL9	OTTHUMG00000128406	ENST00000360131.4:c.1895C>A	chr2.hg19:g.27282078C>A	ENSP00000353249:p.Ser632Tyr	235.0	0.0		152.0	68.0	NM_021831	A2VDI7|B7WPG9|B7Z7I7|D6W548|Q53SW0|Q53SZ0|Q96IK8|Q9H6V0|Q9H8P8	Missense_Mutation	SNP	ENST00000360131.4	hg19	CCDS1732.3	.	.	.	.	.	.	.	.	.	.	C	24.3	4.521300	0.85600	.	.	ENSG00000084693	ENST00000323064;ENST00000360131	T;T	0.20463	2.27;2.07	5.76	5.76	0.90799	.	0.115252	0.64402	D	0.000008	T	0.45498	0.1345	L	0.53249	1.67	0.54753	D	0.999982	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.28235	-1.0050	10	0.87932	D	0	-10.9051	19.571	0.95419	0.0:1.0:0.0:0.0	.	632;632	Q8NDL9;Q8NDL9-3	CBPC5_HUMAN;.	Y	632	ENSP00000323681:S632Y;ENSP00000353249:S632Y	ENSP00000323681:S632Y	S	+	2	0	AGBL5	27135582	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.350000	0.73017	2.713000	0.92767	0.655000	0.94253	TCC	.	.		0.537	AGBL5-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000309033.1	NM_021831	
EML6	400954	hgsc.bcm.edu	37	2	55185121	55185121	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr2:55185121G>T	ENST00000356458.6	+	32	5201	c.4681G>T	c.(4681-4683)Gtg>Ttg	p.V1561L	EML6_ENST00000490828.1_3'UTR	NM_001039753.2	NP_001034842.2	Q6ZMW3	EMAL6_HUMAN	echinoderm microtubule associated protein like 6	1561						cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|endometrium(6)	7						GATGCTCTCCGTGGCCTTCGG	0.587																																					p.V1561L		Atlas-SNP	.											.	EML6	85	.	0			c.G4681T						.						41.0	38.0	39.0					2																	55185121		692	1591	2283	SO:0001583	missense	400954	exon32			CTCTCCGTGGCCT		CCDS46286.1	2p16.1	2013-01-10			ENSG00000214595	ENSG00000214595		"""WD repeat domain containing"""	35412	protein-coding gene	gene with protein product							Standard	NM_001039753		Approved	FLJ42562	uc002ryb.4	Q6ZMW3	OTTHUMG00000152035	ENST00000356458.6:c.4681G>T	chr2.hg19:g.55185121G>T	ENSP00000348842:p.Val1561Leu	52.0	0.0		30.0	11.0	NM_001039753	A8MUB5|B6ZDG7	Missense_Mutation	SNP	ENST00000356458.6	hg19	CCDS46286.1	.	.	.	.	.	.	.	.	.	.	G	15.81	2.942970	0.53079	.	.	ENSG00000214595	ENST00000356458	T	0.31510	1.49	5.39	5.39	0.77823	WD40 repeat-like-containing domain (2);	0.060486	0.64402	D	0.000003	T	0.27384	0.0672	L	0.31371	0.925	0.46356	D	0.999009	B	0.20550	0.046	B	0.21708	0.036	T	0.03060	-1.1077	10	0.30078	T	0.28	.	19.5039	0.95106	0.0:0.0:1.0:0.0	.	1561	Q6ZMW3	EMAL6_HUMAN	L	1561	ENSP00000348842:V1561L	ENSP00000348842:V1561L	V	+	1	0	EML6	55038625	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	7.586000	0.82596	2.679000	0.91253	0.491000	0.48974	GTG	.	.		0.587	EML6-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324997.3	XM_001725002	
SULT1C3	442038	hgsc.bcm.edu	37	2	108872149	108872149	+	Missense_Mutation	SNP	G	G	C			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr2:108872149G>C	ENST00000329106.2	+	4	521	c.521G>C	c.(520-522)gGa>gCa	p.G174A	SULT1C3_ENST00000376700.1_Missense_Mutation_p.G174A	NM_001008743.1	NP_001008743.1	Q6IMI6	ST1C3_HUMAN	sulfotransferase family, cytosolic, 1C, member 3	174					sulfur compound metabolic process (GO:0006790)	cytoplasm (GO:0005737)	alcohol sulfotransferase activity (GO:0004027)|aryl sulfotransferase activity (GO:0004062)			breast(1)|kidney(1)|large_intestine(1)|lung(8)|prostate(1)|skin(4)	16						TTCATGTCCGGAAAAGGTGAG	0.433																																					p.G174A		Atlas-SNP	.											SULT1C3,NS,carcinoma,0,1	SULT1C3	53	.	0			c.G521C						.						60.0	58.0	59.0					2																	108872149		2203	4299	6502	SO:0001583	missense	442038	exon4			TGTCCGGAAAAGG	BC146362	CCDS33267.1	2q12.3	2007-07-26			ENSG00000196228	ENSG00000196228		"""Sulfotransferases, cytosolic"""	33543	protein-coding gene	gene with protein product						14676822, 17425406	Standard	NM_001008743		Approved		uc010ywo.2	Q6IMI6	OTTHUMG00000153227	ENST00000329106.2:c.521G>C	chr2.hg19:g.108872149G>C	ENSP00000333310:p.Gly174Ala	74.0	0.0		37.0	20.0	NM_001008743	Q6IMI5	Missense_Mutation	SNP	ENST00000329106.2	hg19	CCDS33267.1	.	.	.	.	.	.	.	.	.	.	G	15.98	2.992432	0.54041	.	.	ENSG00000196228	ENST00000329106;ENST00000376700	T;T	0.02421	4.3;4.3	3.58	2.7	0.31948	Sulfotransferase domain (1);	0.224260	0.31188	N	0.008099	T	0.21962	0.0529	H	0.96833	3.89	0.43874	D	0.996483	D	0.89917	1.0	D	0.91635	0.999	T	0.08827	-1.0703	10	0.87932	D	0	.	10.091	0.42447	0.1001:0.0:0.8999:0.0	.	174	Q6IMI6	ST1C3_HUMAN	A	174	ENSP00000333310:G174A;ENSP00000365890:G174A	ENSP00000333310:G174A	G	+	2	0	SULT1C3	108238581	1.000000	0.71417	0.001000	0.08648	0.026000	0.11368	5.235000	0.65348	0.834000	0.34852	0.650000	0.86243	GGA	.	.		0.433	SULT1C3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330255.1	NM_001008743	
SCN9A	6335	hgsc.bcm.edu	37	2	167163101	167163101	+	Missense_Mutation	SNP	C	C	A			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr2:167163101C>A	ENST00000409435.1	-	3	385	c.386G>T	c.(385-387)aGc>aTc	p.S129I	SCN9A_ENST00000375387.4_Missense_Mutation_p.S130I|SCN9A_ENST00000303354.6_Missense_Mutation_p.S130I|SCN9A_ENST00000409672.1_Missense_Mutation_p.S129I			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	129					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GATGAGCATGCTGAATAAGGT	0.383																																					p.S129I		Atlas-SNP	.											.	SCN9A	296	.	0			c.G386T						.						70.0	70.0	70.0					2																	167163101		1938	4196	6134	SO:0001583	missense	6335	exon4			AGCATGCTGAATA	X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.386G>T	chr2.hg19:g.167163101C>A	ENSP00000386330:p.Ser129Ile	65.0	0.0		59.0	24.0	NM_002977	A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Missense_Mutation	SNP	ENST00000409435.1	hg19	CCDS46441.1	.	.	.	.	.	.	.	.	.	.	c	15.58	2.876801	0.51801	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435	D;D;D;D	0.97505	-4.41;-4.41;-4.41;-4.41	5.96	5.09	0.68999	.	0.232964	0.38492	N	0.001664	D	0.96775	0.8947	M	0.90650	3.135	0.44816	D	0.997822	B	0.09022	0.002	B	0.13407	0.009	D	0.95076	0.8209	10	0.87932	D	0	.	10.4649	0.44602	0.0:0.7977:0.0:0.2023	.	129	E7EUN6	.	I	129;130;130;129	ENSP00000386306:S129I;ENSP00000364536:S130I;ENSP00000304748:S130I;ENSP00000386330:S129I	ENSP00000304748:S130I	S	-	2	0	SCN9A	166871347	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.729000	0.47327	1.532000	0.49169	0.650000	0.86243	AGC	.	.		0.383	SCN9A-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333639.1	NM_002977	
TTN	7273	hgsc.bcm.edu	37	2	179544702	179544702	+	Missense_Mutation	SNP	C	C	G			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr2:179544702C>G	ENST00000591111.1	-	138	32772	c.32548G>C	c.(32548-32550)Gta>Cta	p.V10850L	TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.V11167L|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.V9923L|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin	0	Glu-rich.|Pro-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTTCTTCTACAAGATATTCT	0.398																																					p.V11167L		Atlas-SNP	.											.	TTN	18412	.	0			c.G33499C						.						140.0	127.0	131.0					2																	179544702		1893	4102	5995	SO:0001583	missense	7273	exon140			CTTCTACAAGATA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.32548G>C	chr2.hg19:g.179544702C>G	ENSP00000465570:p.Val10850Leu	150.0	0.0		85.0	24.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	C	5.618	0.298689	0.10622	.	.	ENSG00000155657	ENST00000342992	T	0.63255	-0.03	6.03	3.21	0.36854	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.50394	0.1613	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47649	-0.9101	8	0.87932	D	0	.	7.9829	0.30194	0.0:0.5059:0.4034:0.0907	.	10850	Q8WZ42	TITIN_HUMAN	L	9923	ENSP00000343764:V9923L	ENSP00000343764:V9923L	V	-	1	0	TTN	179252947	0.102000	0.21896	0.058000	0.19502	0.210000	0.24377	0.359000	0.20233	0.873000	0.35799	0.655000	0.94253	GTA	.	.		0.398	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
AOX1	316	hgsc.bcm.edu	37	2	201527688	201527688	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr2:201527688A>G	ENST00000374700.2	+	31	3780	c.3539A>G	c.(3538-3540)cAt>cGt	p.H1180R	AOX1_ENST00000485106.1_3'UTR	NM_001159.3	NP_001150.3	Q06278	AOXA_HUMAN	aldehyde oxidase 1	1180					inflammatory response (GO:0006954)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|vitamin B6 metabolic process (GO:0042816)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	2 iron, 2 sulfur cluster binding (GO:0051537)|aldehyde oxidase activity (GO:0004031)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|NAD binding (GO:0051287)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)			breast(5)|endometrium(3)|kidney(4)|large_intestine(13)|lung(38)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	81					Allopurinol(DB00437)|Aminocaproic Acid(DB00513)|Brimonidine(DB00484)|Famciclovir(DB00426)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Pyrazinamide(DB00339)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	ACGGGGGATCATAAGGTCAGT	0.493																																					p.H1180R		Atlas-SNP	.											.	AOX1	152	.	0			c.A3539G						.						114.0	105.0	108.0					2																	201527688		2203	4300	6503	SO:0001583	missense	316	exon31			GGGATCATAAGGT	AF017060	CCDS33360.1	2q33	2008-05-20			ENSG00000138356	ENSG00000138356			553	protein-coding gene	gene with protein product		602841				7570184	Standard	NM_001159		Approved	AO, AOH1	uc002uvx.3	Q06278	OTTHUMG00000154536	ENST00000374700.2:c.3539A>G	chr2.hg19:g.201527688A>G	ENSP00000363832:p.His1180Arg	89.0	0.0		54.0	24.0	NM_001159	O14765|Q53RR8|Q53TV3|Q9BYF0|Q9UPG6	Missense_Mutation	SNP	ENST00000374700.2	hg19	CCDS33360.1	.	.	.	.	.	.	.	.	.	.	A	16.75	3.209964	0.58343	.	.	ENSG00000138356	ENST00000374700;ENST00000260930;ENST00000439380	T;T;T	0.38560	1.13;1.13;1.13	5.91	4.76	0.60689	Aldehyde oxidase/xanthine dehydrogenase, molybdopterin binding (3);	0.113642	0.64402	N	0.000006	T	0.52565	0.1742	M	0.82056	2.57	0.58432	D	0.999993	B	0.28378	0.209	B	0.38500	0.275	T	0.55354	-0.8154	10	0.72032	D	0.01	-43.5327	12.0302	0.53394	0.9326:0.0:0.0674:0.0	.	1180	Q06278	ADO_HUMAN	R	1180;66;20	ENSP00000363832:H1180R;ENSP00000260930:H66R;ENSP00000413326:H20R	ENSP00000260930:H66R	H	+	2	0	AOX1	201235933	1.000000	0.71417	0.989000	0.46669	0.860000	0.49131	5.937000	0.70162	1.061000	0.40601	0.454000	0.30748	CAT	.	.		0.493	AOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335844.1	NM_001159	
EPHA4	2043	hgsc.bcm.edu	37	2	222428734	222428734	+	Silent	SNP	C	C	T			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr2:222428734C>T	ENST00000281821.2	-	3	581	c.540G>A	c.(538-540)ggG>ggA	p.G180G	EPHA4_ENST00000392071.4_Silent_p.G129G|EPHA4_ENST00000409938.1_Silent_p.G180G|EPHA4_ENST00000409854.1_Silent_p.G180G	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4	180	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		CCAGGTAAAACCCCTTTTTGC	0.512																																					p.G180G		Atlas-SNP	.											.	EPHA4	263	.	0			c.G540A						.						222.0	192.0	202.0					2																	222428734		2203	4300	6503	SO:0001819	synonymous_variant	2043	exon3			GTAAAACCCCTTT	L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.540G>A	chr2.hg19:g.222428734C>T		92.0	0.0		49.0	23.0	NM_004438	A8K2P1|B2R601|B7Z6Q8|Q2M380	Silent	SNP	ENST00000281821.2	hg19	CCDS2447.1																																																																																			.	.		0.512	EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256836.3		
SSUH2	51066	hgsc.bcm.edu	37	3	8665330	8665330	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr3:8665330C>T	ENST00000317371.4	-	18	2045	c.820G>A	c.(820-822)Gtg>Atg	p.V274M	SSUH2_ENST00000415132.1_Missense_Mutation_p.V274M|SSUH2_ENST00000544814.1_Missense_Mutation_p.V296M|SSUH2_ENST00000341795.3_Missense_Mutation_p.V274M			Q9Y2M2	SSUH2_HUMAN	ssu-2 homolog (C. elegans)	274						cytoplasm (GO:0005737)											GGGAAGTCCACGATGGGGTAC	0.632																																					p.V296M		Atlas-SNP	.											.	.	.	.	0			c.G886A						.						38.0	34.0	35.0					3																	8665330		2082	4021	6103	SO:0001583	missense	51066	exon11			AGTCCACGATGGG	AB024705	CCDS2568.1, CCDS58815.1	3p25.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000125046	ENSG00000125046			24809	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 32"""	C3orf32		20205943	Standard	NM_001256748		Approved	fls485, ssu-2	uc011atg.3	Q9Y2M2	OTTHUMG00000122075	ENST00000317371.4:c.820G>A	chr3.hg19:g.8665330C>T	ENSP00000324551:p.Val274Met	64.0	0.0		35.0	9.0	NM_001256748	A6NFA9|B3KS84|B7Z6E3|F5H2S5|Q7Z7K4	Missense_Mutation	SNP	ENST00000317371.4	hg19	CCDS2568.1	.	.	.	.	.	.	.	.	.	.	C	15.57	2.872522	0.51695	.	.	ENSG00000125046	ENST00000341795;ENST00000317371;ENST00000415132;ENST00000544814	T;T;T;T	0.45276	0.92;0.92;0.9;0.92	5.2	3.39	0.38822	.	0.422550	0.25166	N	0.032631	T	0.45054	0.1323	L	0.49126	1.545	0.09310	N	0.999994	D;D	0.67145	0.985;0.996	P;P	0.54706	0.695;0.759	T	0.22730	-1.0208	10	0.40728	T	0.16	-15.4044	6.9013	0.24285	0.0:0.7964:0.0:0.2036	.	296;274	F5H2S5;Q9Y2M2	.;CC032_HUMAN	M	274;274;274;296	ENSP00000339150:V274M;ENSP00000324551:V274M;ENSP00000410757:V274M;ENSP00000439378:V296M	ENSP00000324551:V274M	V	-	1	0	C3orf32	8640330	0.000000	0.05858	0.761000	0.31378	0.733000	0.41908	-0.064000	0.11636	1.187000	0.43000	0.591000	0.81541	GTG	.	.		0.632	SSUH2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337900.1	NM_015931	
LAMB2	3913	hgsc.bcm.edu	37	3	49162918	49162918	+	Splice_Site	SNP	C	C	A			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr3:49162918C>A	ENST00000418109.1	-	20	2653		c.e20-1		LAMB2_ENST00000464891.1_5'UTR|LAMB2_ENST00000305544.4_Splice_Site	NM_002292.3	NP_002283.3	P55268	LAMB2_HUMAN	laminin, beta 2 (laminin S)						astrocyte development (GO:0014002)|axon extension involved in regeneration (GO:0048677)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|metanephric glomerular basement membrane development (GO:0072274)|metanephric glomerular visceral epithelial cell development (GO:0072249)|neuromuscular junction development (GO:0007528)|retina development in camera-type eye (GO:0060041)|Schwann cell development (GO:0014044)|visual perception (GO:0007601)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-11 complex (GO:0043260)|laminin-3 complex (GO:0005608)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(15)|kidney(3)|large_intestine(6)|lung(21)|ovary(4)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CACTGGCAGGCTAGGAGCAAG	0.622																																					.		Atlas-SNP	.											.	LAMB2	156	.	0			c.2489-1G>T						.						19.0	18.0	18.0					3																	49162918		2196	4290	6486	SO:0001630	splice_region_variant	3913	exon20			GGCAGGCTAGGAG		CCDS2789.1	3p21.3-p21.2	2013-03-01			ENSG00000172037	ENSG00000172037		"""Laminins"""	6487	protein-coding gene	gene with protein product	"""laminin S"""	150325		LAMS		2922051, 10393422	Standard	NM_002292		Approved		uc003cwe.3	P55268	OTTHUMG00000156807	ENST00000418109.1:c.2489-1G>T	chr3.hg19:g.49162918C>A		150.0	0.0		121.0	39.0	NM_002292	Q16321	Splice_Site	SNP	ENST00000418109.1	hg19	CCDS2789.1	.	.	.	.	.	.	.	.	.	.	C	19.69	3.874737	0.72180	.	.	ENSG00000172037	ENST00000418109;ENST00000305544	.	.	.	6.08	6.08	0.98989	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.6634	0.99662	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	LAMB2	49137922	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	5.837000	0.69381	2.894000	0.99253	0.655000	0.94253	.	.	.		0.622	LAMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345939.1	NM_002292	Intron
DNAH1	25981	hgsc.bcm.edu	37	3	52361949	52361949	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr3:52361949A>G	ENST00000420323.2	+	6	1051	c.790A>G	c.(790-792)Atg>Gtg	p.M264V		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	264	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		GTGGATCAACATGGGCTTGGA	0.562																																					p.M264V		Atlas-SNP	.											.	DNAH1	534	.	0			c.A790G						.						70.0	71.0	71.0					3																	52361949		1954	4143	6097	SO:0001583	missense	25981	exon6			ATCAACATGGGCT	U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.790A>G	chr3.hg19:g.52361949A>G	ENSP00000401514:p.Met264Val	200.0	0.0		126.0	67.0	NM_015512	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	ENST00000420323.2	hg19	CCDS46842.1	.	.	.	.	.	.	.	.	.	.	A	12.49	1.954543	0.34471	.	.	ENSG00000114841	ENST00000420323	T	0.21932	1.98	5.68	3.13	0.36017	.	0.473742	0.19154	N	0.121366	T	0.22627	0.0546	M	0.65975	2.015	0.30529	N	0.76759	B;B	0.22146	0.064;0.065	B;B	0.29524	0.031;0.103	T	0.12091	-1.0561	10	0.35671	T	0.21	.	7.2366	0.26074	0.4649:0.4059:0.0:0.1292	.	264;264	C9JXH6;Q9P2D7-3	.;.	V	264	ENSP00000401514:M264V	ENSP00000401514:M264V	M	+	1	0	DNAH1	52336989	0.202000	0.23423	1.000000	0.80357	0.953000	0.61014	0.749000	0.26320	0.968000	0.38212	0.533000	0.62120	ATG	.	.		0.562	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512	
ACOX2	8309	hgsc.bcm.edu	37	3	58520174	58520175	+	Missense_Mutation	DNP	GC	GC	TT			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr3:58520174_58520175GC>TT	ENST00000302819.5	-	3	526_527	c.235_236GC>AA	c.(235-237)GCt>AAt	p.A79N	ACOX2_ENST00000459701.2_Missense_Mutation_p.A79N	NM_003500.3	NP_003491.1	Q99424	ACOX2_HUMAN	acyl-CoA oxidase 2, branched chain	79					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	3alpha,7alpha,12alpha-trihydroxy-5beta-cholestanoyl-CoA 24-hydroxylase activity (GO:0033791)|acyl-CoA dehydrogenase activity (GO:0003995)|acyl-CoA oxidase activity (GO:0003997)|flavin adenine dinucleotide binding (GO:0050660)|pristanoyl-CoA oxidase activity (GO:0016402)|receptor binding (GO:0005102)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|prostate(1)|skin(3)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(55;0.000194)|Kidney(10;0.00255)|KIRC - Kidney renal clear cell carcinoma(10;0.00268)|OV - Ovarian serous cystadenocarcinoma(275;0.156)		CCGCATGGCAGCCTTATAACGC	0.515																																					p.A79D|p.A79T		Atlas-SNP	.											.	ACOX2	53	.	0			c.C236A|c.G235A						.																																			SO:0001583	missense	8309	exon3			ATGGCAGCCTTAT|TGGCAGCCTTATA	X95190	CCDS33775.1	3p14.3	2012-07-13	2010-04-30		ENSG00000168306	ENSG00000168306	1.17.99.3		120	protein-coding gene	gene with protein product	"""trihydroxycoprostanoyl-CoA oxidase"", ""3-alpha,7-alpha,12-alpha-trihydroxy-5-beta-cholestanoyl-CoA 24-hydroxylase"""	601641	"""acyl-Coenzyme A oxidase 2, branched chain"""			8943006, 9070889	Standard	NM_003500		Approved	BRCACOX, BRCOX, THCCox	uc003dkl.3	Q99424	OTTHUMG00000159154	ENST00000302819.5:c.235_236delinsTT	chr3.hg19:g.58520174_58520175delinsTT	ENSP00000307697:p.Ala79Asn	160.0|159.0	0.0		116.0|118.0	50.0	NM_003500	A6NF16|B2R8U5	Missense_Mutation	SNP	ENST00000302819.5	hg19	CCDS33775.1																																																																																			.	.		0.515	ACOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353541.1		
CBLB	868	hgsc.bcm.edu	37	3	105459455	105459455	+	Missense_Mutation	SNP	C	C	A			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr3:105459455C>A	ENST00000264122.4	-	7	1187	c.866G>T	c.(865-867)tGc>tTc	p.C289F	CBLB_ENST00000405772.1_Missense_Mutation_p.C289F|CBLB_ENST00000545639.1_3'UTR|CBLB_ENST00000394027.3_Missense_Mutation_p.C311F|CBLB_ENST00000403724.1_Missense_Mutation_p.C289F	NM_170662.3	NP_733762.2	Q13191	CBLB_HUMAN	Cbl proto-oncogene B, E3 ubiquitin protein ligase	289	Cbl-PTB. {ECO:0000255|PROSITE- ProRule:PRU00839}.|SH2-like.				cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of alpha-beta T cell proliferation (GO:0046642)|negative regulation of T cell receptor signaling pathway (GO:0050860)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of T cell anergy (GO:0002669)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(2)|urinary_tract(2)	49						CAATCGAGTGCAACTTAACCG	0.368			Mis S		AML																																p.C289F	GBM(93;588 1337 9788 29341 43499)	Atlas-SNP	.		Rec	yes		3	3q13.11	868	Cas-Br-M (murine) ecotropic retroviral transforming sequence b		L	.	CBLB	118	.	0			c.G866T						.						107.0	90.0	96.0					3																	105459455		2203	4300	6503	SO:0001583	missense	868	exon7			CGAGTGCAACTTA	U26710	CCDS2948.1	3q	2013-07-09	2013-07-09		ENSG00000114423	ENSG00000114423		"""RING-type (C3HC4) zinc fingers"""	1542	protein-coding gene	gene with protein product		604491	"""Cas-Br-M (murine) ectropic retroviral transforming sequence b"", ""Cas-Br-M (murine) ecotropic retroviral transforming sequence b"""			7784085	Standard	XM_005247853		Approved	RNF56, Cbl-b	uc003dwc.3	Q13191	OTTHUMG00000150654	ENST00000264122.4:c.866G>T	chr3.hg19:g.105459455C>A	ENSP00000264122:p.Cys289Phe	93.0	0.0		54.0	21.0	NM_170662	A8K9S7|B7WNM4|Q13192|Q13193|Q3LIC0|Q63Z43|Q8IVC5	Missense_Mutation	SNP	ENST00000264122.4	hg19	CCDS2948.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676253	0.88445	.	.	ENSG00000114423	ENST00000264122;ENST00000394027;ENST00000403724;ENST00000405772	D;D;D;D	0.86562	-2.14;-2.14;-2.14;-2.14	5.92	5.92	0.95590	Adaptor protein Cbl, PTB domain (1);SH2 motif (2);Adaptor protein Cbl, SH2-like (1);	0.000000	0.85682	D	0.000000	D	0.94374	0.8191	M	0.83012	2.62	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	D	0.94288	0.7526	10	0.87932	D	0	-10.3674	20.3172	0.98658	0.0:1.0:0.0:0.0	.	311;289;289	E7ENW2;Q13191-3;Q13191	.;.;CBLB_HUMAN	F	289;311;289;289	ENSP00000264122:C289F;ENSP00000377595:C311F;ENSP00000384816:C289F;ENSP00000384938:C289F	ENSP00000264122:C289F	C	-	2	0	CBLB	106942145	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.479000	0.81095	2.801000	0.96364	0.650000	0.86243	TGC	.	.		0.368	CBLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319417.2	NM_170662	
PCDHA10	56139	hgsc.bcm.edu	37	5	140237151	140237151	+	Silent	SNP	C	C	T			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr5:140237151C>T	ENST00000307360.5	+	1	1518	c.1518C>T	c.(1516-1518)taC>taT	p.Y506Y	PCDHA9_ENST00000532602.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA10_ENST00000506939.2_Silent_p.Y506Y|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529619.1_Intron	NM_018901.2	NP_061724.1	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10	506	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(11)|cervix(1)|endometrium(11)|kidney(5)|large_intestine(13)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	79			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGTCGAGCTACGTGTCGGTGC	0.682																																					p.Y506Y		Atlas-SNP	.											.	PCDHA10	358	.	0			c.C1518T						.						66.0	72.0	70.0					5																	140237151		2196	4273	6469	SO:0001819	synonymous_variant	56139	exon1			GAGCTACGTGTCG	AF152475	CCDS34255.1, CCDS54921.1, CCDS75325.1	5q31	2010-11-26			ENSG00000250120	ENSG00000250120		"""Cadherins / Protocadherins : Clustered"""	8664	other	complex locus constituent	"""KIAA0345-like 4"", ""ortholog to mouse CNR8"""	606316		CNRS8		10380929	Standard	NM_018901		Approved	CNR8, CRNR8, CNRN8, PCDH-ALPHA10		Q9Y5I2	OTTHUMG00000163372	ENST00000307360.5:c.1518C>T	chr5.hg19:g.140237151C>T		92.0	0.0		63.0	32.0	NM_031859	A1L493|O75280|Q9NRU2	Silent	SNP	ENST00000307360.5	hg19	CCDS54921.1																																																																																			.	.		0.682	PCDHA10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372895.2	NM_018901	
PCDHB8	56128	hgsc.bcm.edu	37	5	140558018	140558018	+	Missense_Mutation	SNP	C	C	A			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr5:140558018C>A	ENST00000239444.2	+	1	648	c.403C>A	c.(403-405)Ctg>Atg	p.L135M	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	135					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCCAGTATTTCTGGACAAACA	0.438																																					p.L135M		Atlas-SNP	.											.	PCDHB8	199	.	0			c.C403A						.						33.0	52.0	45.0					5																	140558018		2196	4294	6490	SO:0001583	missense	56128	exon1			GTATTTCTGGACA	AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.403C>A	chr5.hg19:g.140558018C>A	ENSP00000239444:p.Leu135Met	1554.0	1.0		963.0	126.0	NM_019120	B9EGV1	Missense_Mutation	SNP	ENST00000239444.2	hg19	CCDS4250.1	.	.	.	.	.	.	.	.	.	.	c	6.300	0.423514	0.11928	.	.	ENSG00000120322	ENST00000239444	T	0.21543	2.0	4.25	-1.17	0.09648	Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.21022	0.0506	M	0.81112	2.525	0.09310	N	1	B	0.25441	0.126	B	0.23018	0.043	T	0.29088	-1.0023	9	0.33940	T	0.23	.	3.468	0.07557	0.1535:0.5299:0.1589:0.1578	.	135	Q9UN66	PCDB8_HUMAN	M	135	ENSP00000239444:L135M	ENSP00000239444:L135M	L	+	1	2	PCDHB8	140538202	0.000000	0.05858	0.115000	0.21578	0.793000	0.44817	-5.803000	0.00097	-0.307000	0.08804	0.585000	0.79938	CTG	.	.		0.438	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251816.2	NM_019120	
BTNL2	56244	hgsc.bcm.edu	37	6	32370894	32370894	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr6:32370894T>C	ENST00000374993.1	-	3	526	c.527A>G	c.(526-528)tAt>tGt	p.Y176C	BTNL2_ENST00000454136.3_Missense_Mutation_p.Y176C|BTNL2_ENST00000414363.1_Intron|BTNL2_ENST00000429232.2_Intron|BTNL2_ENST00000544175.1_Intron|BTNL2_ENST00000374995.3_Intron|BTNL2_ENST00000540315.1_Intron	NM_019602.1	NP_062548.1	Q9UIR0	BTNL2_HUMAN	butyrophilin-like 2 (MHC class II associated)	176	Ig-like V-type 2.					integral component of membrane (GO:0016021)				central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|prostate(1)|urinary_tract(1)	19						GTCTTCCCAATACACCTGGGG	0.602																																					p.Y176C		Atlas-SNP	.											.	BTNL2	50	.	0			c.A527G						.						57.0	56.0	56.0					6																	32370894		1509	2709	4218	SO:0001583	missense	56244	exon3			TCCCAATACACCT	AF186588		6p21.3	2014-01-14			ENSG00000204290	ENSG00000204290		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1142	protein-coding gene	gene with protein product		606000				10803852, 15735647	Standard	XM_006726138		Approved	HSBLMHC1, BTL-II, BTN7	uc003obg.1	Q9UIR0	OTTHUMG00000031102	ENST00000374993.1:c.527A>G	chr6.hg19:g.32370894T>C	ENSP00000364132:p.Tyr176Cys	151.0	0.0		170.0	100.0	NM_019602	A0PJV5|B0UYW9|B0V0N6|O98261|Q08E96|Q58R22|Q58R23|Q5JYF9|Q5MP42|Q5MP43|Q5RIF8|Q5SP08|Q5SP09|Q5SRW3|Q5SRW4|Q5SU36|Q95HK0	Missense_Mutation	SNP	ENST00000374993.1	hg19		.	.	.	.	.	.	.	.	.	.	T	15.04	2.714115	0.48622	.	.	ENSG00000204290	ENST00000468270;ENST00000374993	T	0.75589	-0.95	4.44	0.775	0.18527	CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.368040	0.04773	N	0.428473	T	0.65249	0.2673	L	0.60455	1.87	0.09310	N	1	D	0.63880	0.993	P	0.57204	0.815	T	0.47947	-0.9077	10	0.40728	T	0.16	.	3.7103	0.08417	0.0:0.2191:0.2186:0.5623	.	176	Q9UIR0	BTNL2_HUMAN	C	176	ENSP00000364132:Y176C	ENSP00000364132:Y176C	Y	-	2	0	BTNL2	32478872	0.000000	0.05858	0.001000	0.08648	0.326000	0.28443	-0.269000	0.08596	0.059000	0.16252	0.509000	0.49947	TAT	.	.		0.602	BTNL2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_019602	
CUL9	23113	hgsc.bcm.edu	37	6	43160821	43160821	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr6:43160821C>T	ENST00000252050.4	+	9	2347	c.2263C>T	c.(2263-2265)Ctt>Ttt	p.L755F	CUL9_ENST00000354495.3_Missense_Mutation_p.L645F|CUL9_ENST00000372647.2_Missense_Mutation_p.L755F	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	755					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						CCTGCGCCTCCTTTACCTGCT	0.547																																					p.L755F		Atlas-SNP	.											.	CUL9	248	.	0			c.C2263T						.						183.0	155.0	164.0					6																	43160821		2203	4300	6503	SO:0001583	missense	23113	exon9			CGCCTCCTTTACC	AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.2263C>T	chr6.hg19:g.43160821C>T	ENSP00000252050:p.Leu755Phe	75.0	0.0		87.0	54.0	NM_015089	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Missense_Mutation	SNP	ENST00000252050.4	hg19	CCDS4890.1	.	.	.	.	.	.	.	.	.	.	C	19.45	3.830562	0.71258	.	.	ENSG00000112659	ENST00000252050;ENST00000354495;ENST00000372647	T;T;T	0.56275	0.47;0.47;0.47	4.99	4.12	0.48240	Armadillo-like helical (1);Armadillo-type fold (1);	0.161948	0.42053	D	0.000779	T	0.35335	0.0928	N	0.24115	0.695	0.35424	D	0.793449	D;D	0.64830	0.994;0.994	P;P	0.59221	0.854;0.854	T	0.42666	-0.9438	10	0.51188	T	0.08	-14.8011	5.7408	0.18092	0.1409:0.6468:0.1364:0.0759	.	755;755	E9PEZ1;Q8IWT3	.;CUL9_HUMAN	F	755;645;755	ENSP00000252050:L755F;ENSP00000346490:L645F;ENSP00000361730:L755F	ENSP00000252050:L755F	L	+	1	0	CUL9	43268799	1.000000	0.71417	0.980000	0.43619	0.953000	0.61014	3.978000	0.56881	1.092000	0.41356	0.297000	0.19635	CTT	.	.		0.547	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	NM_015089	
MEP1A	4224	hgsc.bcm.edu	37	6	46797206	46797206	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr6:46797206T>C	ENST00000230588.4	+	10	1051	c.1042T>C	c.(1042-1044)Tat>Cat	p.Y348H		NM_005588.2	NP_005579.2	Q16819	MEP1A_HUMAN	meprin A, alpha (PABA peptide hydrolase)	348	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.				digestion (GO:0007586)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|meprin A complex (GO:0017090)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42			Lung(136;0.192)			GCAATTTTTCTATAAAATGAC	0.522																																					p.Y348H		Atlas-SNP	.											.	MEP1A	93	.	0			c.T1042C						.						117.0	126.0	123.0					6																	46797206		2203	4300	6503	SO:0001583	missense	4224	exon10			TTTTTCTATAAAA		CCDS4918.1	6p12-p11	2010-10-18			ENSG00000112818	ENSG00000112818	3.4.24.18		7015	protein-coding gene	gene with protein product		600388				7774936	Standard	NM_005588		Approved	PPHA	uc010jzh.1	Q16819	OTTHUMG00000014790	ENST00000230588.4:c.1042T>C	chr6.hg19:g.46797206T>C	ENSP00000230588:p.Tyr348His	131.0	0.0		120.0	34.0	NM_005588	A2RRM4|B0AZP9|B2RCS2|Q8TDC9|Q9H1R1	Missense_Mutation	SNP	ENST00000230588.4	hg19	CCDS4918.1	.	.	.	.	.	.	.	.	.	.	T	26.1	4.707349	0.89018	.	.	ENSG00000112818	ENST00000230588	T	0.03272	3.99	5.67	5.67	0.87782	Concanavalin A-like lectin/glucanase (1);MAM domain (5);	0.000000	0.85682	D	0.000000	T	0.17238	0.0414	M	0.90870	3.155	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.02837	-1.1104	10	0.54805	T	0.06	-24.1644	15.9259	0.79615	0.0:0.0:0.0:1.0	.	376;348	B7ZL91;Q16819	.;MEP1A_HUMAN	H	348	ENSP00000230588:Y348H	ENSP00000230588:Y348H	Y	+	1	0	MEP1A	46905165	1.000000	0.71417	0.995000	0.50966	0.959000	0.62525	6.276000	0.72601	2.164000	0.68074	0.528000	0.53228	TAT	.	.		0.522	MEP1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040803.1	NM_005588	
C6orf58	352999	hgsc.bcm.edu	37	6	127899881	127899881	+	Missense_Mutation	SNP	G	G	C			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr6:127899881G>C	ENST00000329722.7	+	2	364	c.352G>C	c.(352-354)Gat>Cat	p.D118H		NM_001010905.1	NP_001010905.1	Q6P5S2	CF058_HUMAN	chromosome 6 open reading frame 58	118						extracellular vesicular exosome (GO:0070062)				kidney(3)|large_intestine(3)|liver(1)|lung(7)|pancreas(1)	15				GBM - Glioblastoma multiforme(226;0.0405)|all cancers(137;0.156)		TGAATCTGGAGATCATATGTG	0.413																																					p.D118H		Atlas-SNP	.											.	C6orf58	35	.	0			c.G352C						.						228.0	212.0	218.0					6																	127899881		2203	4300	6503	SO:0001583	missense	352999	exon2			TCTGGAGATCATA	BC062712	CCDS34533.1	6q22.33	2011-12-13			ENSG00000184530	ENSG00000184530			20960	protein-coding gene	gene with protein product							Standard	NM_001010905		Approved		uc003qbh.4	Q6P5S2	OTTHUMG00000015530	ENST00000329722.7:c.352G>C	chr6.hg19:g.127899881G>C	ENSP00000328069:p.Asp118His	99.0	0.0		65.0	28.0	NM_001010905	B4E1I0|Q5VUP2	Missense_Mutation	SNP	ENST00000329722.7	hg19	CCDS34533.1	.	.	.	.	.	.	.	.	.	.	G	12.42	1.933092	0.34096	.	.	ENSG00000184530	ENST00000329722	T	0.55588	0.51	4.95	2.01	0.26516	.	0.290165	0.36628	N	0.002493	T	0.59418	0.2192	M	0.82923	2.615	0.35454	D	0.795954	D	0.89917	1.0	D	0.75020	0.985	T	0.62798	-0.6778	9	.	.	.	-12.8776	8.0287	0.30453	0.3607:0.0:0.6393:0.0	.	118	Q6P5S2	CF058_HUMAN	H	118	ENSP00000328069:D118H	.	D	+	1	0	C6orf58	127941574	0.057000	0.20700	0.101000	0.21167	0.183000	0.23260	0.140000	0.16056	0.427000	0.26145	0.591000	0.81541	GAT	.	.		0.413	C6orf58-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042152.1	NM_001010905	
GRM8	2918	hgsc.bcm.edu	37	7	126173751	126173751	+	Missense_Mutation	SNP	G	G	C			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr7:126173751G>C	ENST00000339582.2	-	9	2493	c.1685C>G	c.(1684-1686)cCc>cGc	p.P562R	GRM8_ENST00000444921.2_Missense_Mutation_p.P562R|GRM8_ENST00000358373.3_Missense_Mutation_p.P562R|GRM8_ENST00000480995.1_5'UTR			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8	562					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				GTTCATGTTGGGTCTCTGATC	0.527										HNSCC(24;0.065)																											p.P562R		Atlas-SNP	.											.	GRM8	377	.	0			c.C1685G						.						147.0	131.0	136.0					7																	126173751		2203	4300	6503	SO:0001583	missense	2918	exon8			ATGTTGGGTCTCT		CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.1685C>G	chr7.hg19:g.126173751G>C	ENSP00000344173:p.Pro562Arg	186.0	0.0		110.0	62.0	NM_000845	A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Missense_Mutation	SNP	ENST00000339582.2	hg19	CCDS5794.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.107689	0.77096	.	.	ENSG00000179603	ENST00000339582;ENST00000444921;ENST00000358373	D;D;D	0.91521	-2.86;-2.86;-2.86	5.8	5.8	0.92144	GPCR, family 3, nine cysteines domain (1);	0.000000	0.85682	D	0.000000	D	0.97648	0.9229	H	0.98754	4.32	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.98837	1.0753	10	0.87932	D	0	.	19.0428	0.93008	0.0:0.0:1.0:0.0	.	562;562	O00222-2;O00222	.;GRM8_HUMAN	R	562	ENSP00000344173:P562R;ENSP00000409790:P562R;ENSP00000351142:P562R	ENSP00000344173:P562R	P	-	2	0	GRM8	125960987	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	9.859000	0.99545	2.758000	0.94735	0.643000	0.83706	CCC	.	.		0.527	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059209.4		
CNTNAP2	26047	hgsc.bcm.edu	37	7	146825914	146825914	+	Nonsense_Mutation	SNP	G	G	T			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr7:146825914G>T	ENST00000361727.3	+	7	1585	c.1069G>T	c.(1069-1071)Gag>Tag	p.E357*		NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	357	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)			NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			GAAGAAATTAGAGCCCTCAAA	0.368										HNSCC(39;0.1)																											p.E357X		Atlas-SNP	.											.	CNTNAP2	392	.	0			c.G1069T						.						102.0	105.0	104.0					7																	146825914		2203	4300	6503	SO:0001587	stop_gained	26047	exon7			AAATTAGAGCCCT	AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.1069G>T	chr7.hg19:g.146825914G>T	ENSP00000354778:p.Glu357*	179.0	0.0		115.0	32.0	NM_014141	D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Nonsense_Mutation	SNP	ENST00000361727.3	hg19	CCDS5889.1	.	.	.	.	.	.	.	.	.	.	G	44	11.125238	0.99519	.	.	ENSG00000174469	ENST00000361727	.	.	.	5.64	5.64	0.86602	.	0.080948	0.47852	D	0.000210	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.15952	T	0.53	.	18.2754	0.90081	0.0:0.0:1.0:0.0	.	.	.	.	X	357	.	ENSP00000354778:E357X	E	+	1	0	CNTNAP2	146456847	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.697000	0.98697	2.674000	0.91012	0.655000	0.94253	GAG	.	.		0.368	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327668.1		
PSD3	23362	hgsc.bcm.edu	37	8	18730005	18730005	+	Silent	SNP	G	G	A			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr8:18730005G>A	ENST00000327040.8	-	3	471	c.369C>T	c.(367-369)ctC>ctT	p.L123L	PSD3_ENST00000523619.1_Silent_p.L58L|PSD3_ENST00000440756.2_Silent_p.L123L	NM_015310.3	NP_056125.3	Q9NYI0	PSD3_HUMAN	pleckstrin and Sec7 domain containing 3	123					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(8)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				Colorectal(111;0.0281)|READ - Rectum adenocarcinoma(644;0.183)		TTTGTTCCTTGAGATGACTTT	0.493																																					p.L123L		Atlas-SNP	.											.	PSD3	142	.	0			c.C369T						.						117.0	113.0	114.0					8																	18730005		1869	4102	5971	SO:0001819	synonymous_variant	23362	exon3			TTCCTTGAGATGA	AF243495	CCDS34854.1, CCDS43720.1	8p21.3	2013-01-10			ENSG00000156011	ENSG00000156011		"""Pleckstrin homology (PH) domain containing"""	19093	protein-coding gene	gene with protein product		614440					Standard	NM_206909		Approved	KIAA0942, HCA67, EFA6R, DKFZp761K1423	uc003wza.3	Q9NYI0	OTTHUMG00000163711	ENST00000327040.8:c.369C>T	chr8.hg19:g.18730005G>A		91.0	0.0		73.0	35.0	NM_015310	A6NFQ4|E9KL50|Q6B003|Q9Y2F1	Silent	SNP	ENST00000327040.8	hg19	CCDS43720.1																																																																																			.	.		0.493	PSD3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000374867.1	NM_015310	
ATP6V1B2	526	hgsc.bcm.edu	37	8	20068787	20068787	+	Missense_Mutation	SNP	A	A	C			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr8:20068787A>C	ENST00000276390.2	+	6	603	c.563A>C	c.(562-564)aAa>aCa	p.K188T		NM_001693.3	NP_001684.2	P21281	VATB2_HUMAN	ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2	188					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|proton-transporting V-type ATPase, V1 domain (GO:0033180)|ruffle (GO:0001726)	ATP binding (GO:0005524)|hydrogen ion transmembrane transporter activity (GO:0015078)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			endometrium(1)|kidney(2)|lung(5)|prostate(1)	9				Colorectal(74;0.0535)|COAD - Colon adenocarcinoma(73;0.211)	Gallium nitrate(DB05260)	AGGGGGCAGAAAATTCCTATC	0.463																																					p.K188T	Pancreas(119;1230 1726 3901 4036 31644)	Atlas-SNP	.											.	ATP6V1B2	34	.	0			c.A563C						.						116.0	103.0	108.0					8																	20068787		2203	4300	6503	SO:0001583	missense	526	exon6			GGCAGAAAATTCC	L35249	CCDS6014.1	8p21.3	2010-04-21	2006-01-13	2002-05-10	ENSG00000147416	ENSG00000147416	3.6.3.14	"""ATPases / V-type"""	854	protein-coding gene	gene with protein product		606939	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), beta polypeptide, 56/58kD, isoform 2"", ""ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 2"""	VPP3, ATP6B2		2145275, 14580332	Standard	NM_001693		Approved	VATB, Vma2, HO57	uc003wzp.3	P21281	OTTHUMG00000131073	ENST00000276390.2:c.563A>C	chr8.hg19:g.20068787A>C	ENSP00000276390:p.Lys188Thr	86.0	0.0		55.0	25.0	NM_001693	B2R5Z3|D3DSQ5|Q14544|Q15859|Q96IR0	Missense_Mutation	SNP	ENST00000276390.2	hg19	CCDS6014.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.38|19.38	3.817472|3.817472	0.70912|0.70912	.|.	.|.	ENSG00000147416|ENSG00000147416	ENST00000519667|ENST00000276390;ENST00000542368	.|T	.|0.78126	.|-1.15	5.65|5.65	5.65|5.65	0.86999|0.86999	.|ATPase, F1/V1/A1 complex, alpha/beta subunit, nucleotide-binding domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.86347|0.86347	0.5911|0.5911	M|M	0.67625|0.67625	2.065|2.065	0.80722|0.80722	D|D	1|1	.|D	.|0.67145	.|0.996	.|D	.|0.70487	.|0.969	D|D	0.87744|0.87744	0.2587|0.2587	5|10	.|0.87932	.|D	.|0	-1.2234|-1.2234	14.9989|14.9989	0.71455|0.71455	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|188	.|P21281	.|VATB2_HUMAN	D|T	177|188;62	.|ENSP00000276390:K188T	.|ENSP00000276390:K188T	E|K	+|+	3|2	2|0	ATP6V1B2|ATP6V1B2	20113067|20113067	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	9.282000|9.282000	0.95840|0.95840	2.277000|2.277000	0.76020|0.76020	0.528000|0.528000	0.53228|0.53228	GAA|AAA	.	.		0.463	ATP6V1B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253732.1	NM_001693	
ZNF703	80139	hgsc.bcm.edu	37	8	37553564	37553564	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr8:37553564G>A	ENST00000331569.4	+	1	296	c.67G>A	c.(67-69)Ggc>Agc	p.G23S		NM_025069.1	NP_079345.1	Q9H7S9	ZN703_HUMAN	zinc finger protein 703	23	Poly-Gly.				adherens junction assembly (GO:0034333)|cellular response to estradiol stimulus (GO:0071392)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of homotypic cell-cell adhesion (GO:0034111)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of cell cycle (GO:0051726)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|protein complex (GO:0043234)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)		FGFR1/ZNF703(2)	breast(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(1)|pancreas(1)	7			BRCA - Breast invasive adenocarcinoma(5;7.93e-25)|LUSC - Lung squamous cell carcinoma(8;1.05e-09)			cagcggcggcggcggGAAGAG	0.721																																					p.G23S		Atlas-SNP	.											.	ZNF703	16	.	0			c.G67A						.						3.0	4.0	4.0					8																	37553564		1484	3103	4587	SO:0001583	missense	80139	exon1			GGCGGCGGCGGGA	AK024361	CCDS6094.1	8p12	2008-05-02				ENSG00000183779			25883	protein-coding gene	gene with protein product						15897872	Standard	NM_025069		Approved	FLJ14299, ZNF503L	uc003xjy.1	Q9H7S9		ENST00000331569.4:c.67G>A	chr8.hg19:g.37553564G>A	ENSP00000332325:p.Gly23Ser	65.0	0.0		39.0	27.0	NM_025069	Q5XG76	Missense_Mutation	SNP	ENST00000331569.4	hg19	CCDS6094.1	.	.	.	.	.	.	.	.	.	.	g	13.99	2.400853	0.42613	.	.	ENSG00000183779	ENST00000331569;ENST00000397235	T	0.41758	0.99	3.58	2.65	0.31530	.	0.622662	0.15229	N	0.273541	T	0.23330	0.0564	L	0.34521	1.04	0.26094	N	0.980911	B	0.30211	0.273	B	0.20184	0.028	T	0.12889	-1.0530	10	0.15066	T	0.55	-10.3048	4.2354	0.10623	0.122:0.0:0.6475:0.2305	.	23	Q9H7S9	ZN703_HUMAN	S	23	ENSP00000332325:G23S	ENSP00000332325:G23S	G	+	1	0	ZNF703	37672722	0.995000	0.38212	1.000000	0.80357	0.753000	0.42808	3.802000	0.55553	0.780000	0.33566	0.461000	0.40582	GGC	.	.		0.721	ZNF703-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376683.2	NM_025069	
PREX2	80243	hgsc.bcm.edu	37	8	69030794	69030794	+	Missense_Mutation	SNP	C	C	A			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr8:69030794C>A	ENST00000288368.4	+	27	3613	c.3336C>A	c.(3334-3336)aaC>aaA	p.N1112K		NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	1112					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						GTGACTGCAACAGCAATAGGA	0.443																																					p.N1112K		Atlas-SNP	.											.	PREX2	614	.	0			c.C3336A						.						140.0	123.0	129.0					8																	69030794		2203	4300	6503	SO:0001583	missense	80243	exon27			CTGCAACAGCAAT	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.3336C>A	chr8.hg19:g.69030794C>A	ENSP00000288368:p.Asn1112Lys	69.0	0.0		50.0	24.0	NM_024870	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	ENST00000288368.4	hg19	CCDS6201.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.359913	0.82353	.	.	ENSG00000046889	ENST00000288368;ENST00000396539	T	0.39229	1.09	5.2	4.33	0.51752	.	0.000000	0.85682	D	0.000000	T	0.59487	0.2197	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.60063	-0.7336	10	0.48119	T	0.1	.	13.7303	0.62783	0.0:0.9254:0.0:0.0746	.	1112	Q70Z35	PREX2_HUMAN	K	1112;1117	ENSP00000288368:N1112K	ENSP00000288368:N1112K	N	+	3	2	PREX2	69193348	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.971000	0.49248	1.197000	0.43143	0.591000	0.81541	AAC	.	.		0.443	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170	
TRPA1	8989	hgsc.bcm.edu	37	8	72975718	72975718	+	Missense_Mutation	SNP	A	A	T			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr8:72975718A>T	ENST00000262209.4	-	5	848	c.641T>A	c.(640-642)aTg>aAg	p.M214K		NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	214					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	TATTATTTCCATGCATTCTTT	0.318																																					p.M214K		Atlas-SNP	.											.	TRPA1	256	.	0			c.T641A						.						93.0	88.0	90.0					8																	72975718		2203	4300	6503	SO:0001583	missense	8989	exon5			ATTTCCATGCATT	Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.641T>A	chr8.hg19:g.72975718A>T	ENSP00000262209:p.Met214Lys	69.0	0.0		41.0	25.0	NM_007332	A6NIN6	Missense_Mutation	SNP	ENST00000262209.4	hg19	CCDS34908.1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.468070	0.84533	.	.	ENSG00000104321	ENST00000523582;ENST00000262209	T;T	0.64618	-0.11;2.42	5.62	5.62	0.85841	Ankyrin repeat-containing domain (3);	0.153676	0.64402	D	0.000001	T	0.68458	0.3003	M	0.72894	2.215	0.80722	D	1	P	0.51351	0.944	P	0.47346	0.544	T	0.73845	-0.3854	10	0.72032	D	0.01	-21.1316	15.7734	0.78190	1.0:0.0:0.0:0.0	.	214	O75762	TRPA1_HUMAN	K	66;214	ENSP00000428151:M66K;ENSP00000262209:M214K	ENSP00000262209:M214K	M	-	2	0	TRPA1	73138272	1.000000	0.71417	1.000000	0.80357	0.858000	0.48976	7.594000	0.82698	2.260000	0.74910	0.528000	0.53228	ATG	.	.		0.318	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379079.2	NM_007332	
LRRC14	9684	hgsc.bcm.edu	37	8	145742465	145742465	+	5'Flank	SNP	C	C	A			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr8:145742465C>A	ENST00000292524.1	+	0	0				RECQL4_ENST00000428558.2_Missense_Mutation_p.R108L|RECQL4_ENST00000532237.1_5'UTR|LRRC14_ENST00000529022.1_5'Flank	NM_001272036.1|NM_014665.2	NP_001258965.1|NP_055480.1	Q15048	LRC14_HUMAN	leucine rich repeat containing 14											endometrium(1)|lung(3)|prostate(1)	5	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			GGCCTTGAGCCGCTGCCCGTA	0.677																																					p.R108L		Atlas-SNP	.											.	RECQL4	75	.	0			c.G323T						.						31.0	36.0	34.0					8																	145742465		2108	4222	6330	SO:0001631	upstream_gene_variant	9401	exon4			TTGAGCCGCTGCC	BC011377	CCDS6432.1	8q24.3	2012-08-20			ENSG00000160959	ENSG00000160959			20419	protein-coding gene	gene with protein product						7584026	Standard	NM_001272036		Approved	KIAA0014, LRRC14A	uc003zdk.3	Q15048	OTTHUMG00000165179		chr8.hg19:g.145742465C>A	Exception_encountered	86.0	0.0		57.0	4.0	NM_004260	A8K0A8|D3DWM8	Missense_Mutation	SNP	ENST00000292524.1	hg19	CCDS6432.1																																																																																			.	.		0.677	LRRC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382494.1	NM_014665	
TUBAL3	79861	hgsc.bcm.edu	37	10	5437418	5437418	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr10:5437418G>T	ENST00000380419.3	-	3	305	c.268C>A	c.(268-270)Cac>Aac	p.H90N	TUBAL3_ENST00000479328.1_Missense_Mutation_p.H50N	NM_024803.2	NP_079079.1	A6NHL2	TBAL3_HUMAN	tubulin, alpha-like 3	90					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(7)|prostate(2)|skin(3)	25						AGTGAACGGTGCTGGCCCGTC	0.597																																					p.H90N		Atlas-SNP	.											.	TUBAL3	54	.	0			c.C268A						.						136.0	135.0	135.0					10																	5437418		2203	4300	6503	SO:0001583	missense	79861	exon3			AACGGTGCTGGCC	AK025318	CCDS7066.2, CCDS53491.1	10p15.1	2007-03-15			ENSG00000178462	ENSG00000178462		"""Tubulins"""	23534	protein-coding gene	gene with protein product							Standard	NM_024803		Approved	FLJ21665	uc001ihy.3	A6NHL2	OTTHUMG00000017595	ENST00000380419.3:c.268C>A	chr10.hg19:g.5437418G>T	ENSP00000369784:p.His90Asn	123.0	0.0		98.0	38.0	NM_024803	B4DKL2|Q4QQJ5|Q9H6Z0	Missense_Mutation	SNP	ENST00000380419.3	hg19	CCDS7066.2	.	.	.	.	.	.	.	.	.	.	G	13.23	2.174832	0.38413	.	.	ENSG00000178462	ENST00000380419;ENST00000479328	T;T	0.66995	-0.24;-0.24	3.98	-2.09	0.07232	Tubulin/FtsZ, GTPase domain (4);	1.580760	0.03720	N	0.251702	T	0.55401	0.1918	L	0.31845	0.965	0.09310	N	0.999992	B;B	0.27679	0.185;0.048	B;B	0.23716	0.048;0.026	T	0.50874	-0.8776	10	0.87932	D	0	.	8.9977	0.36063	0.5836:0.0:0.4164:0.0	.	50;90	A6NHL2-2;A6NHL2	.;TBAL3_HUMAN	N	90;50	ENSP00000369784:H90N;ENSP00000418799:H50N	ENSP00000369784:H90N	H	-	1	0	TUBAL3	5427418	0.997000	0.39634	0.000000	0.03702	0.038000	0.13279	3.478000	0.53158	-0.494000	0.06669	-0.253000	0.11424	CAC	.	.		0.597	TUBAL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046548.2	NM_024803	
GLYAT	10249	hgsc.bcm.edu	37	11	58477472	58477472	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr11:58477472C>T	ENST00000344743.3	-	6	799	c.658G>A	c.(658-660)Gat>Aat	p.D220N	GLYAT_ENST00000529732.1_Missense_Mutation_p.D220N	NM_201648.2	NP_964011.2	Q6IB77	GLYAT_HUMAN	glycine-N-acyltransferase	220					acyl-CoA metabolic process (GO:0006637)|glycine metabolic process (GO:0006544)|monocarboxylic acid metabolic process (GO:0032787)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glycine N-acyltransferase activity (GO:0047961)|glycine N-benzoyltransferase activity (GO:0047962)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|autonomic_ganglia(1)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|urinary_tract(1)	16		Breast(21;0.0044)|all_epithelial(135;0.0157)			Glycine(DB00145)	TCCATTAGATCCCAGCACACA	0.552																																					p.D220N		Atlas-SNP	.											.	GLYAT	53	.	0			c.G658A						.						68.0	70.0	69.0					11																	58477472		2201	4295	6496	SO:0001583	missense	10249	exon6			TTAGATCCCAGCA	AF023466	CCDS7970.1, CCDS7971.1	11q12.1	2008-03-11					2.3.1.13		13734	protein-coding gene	gene with protein product		607424					Standard	NM_201648		Approved	GAT, ACGNAT	uc001nnb.3	Q6IB77		ENST00000344743.3:c.658G>A	chr11.hg19:g.58477472C>T	ENSP00000340200:p.Asp220Asn	107.0	0.0		70.0	32.0	NM_201648	O14833|Q96QK7	Missense_Mutation	SNP	ENST00000344743.3	hg19	CCDS7970.1	.	.	.	.	.	.	.	.	.	.	C	6.786	0.513932	0.12944	.	.	ENSG00000149124	ENST00000344743;ENST00000529732	T;T	0.16743	2.32;2.32	6.06	-12.0	0.00017	Acyl-CoA N-acyltransferase (2);Glycine N-acyltransferase, C-terminal (1);	5.117170	0.00166	N	0.000006	T	0.07548	0.0190	N	0.14661	0.345	0.58432	D	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.21449	-1.0245	10	0.25106	T	0.35	1.504	6.8105	0.23802	0.5564:0.2867:0.0:0.1569	.	220	Q6IB77	GLYAT_HUMAN	N	220	ENSP00000340200:D220N;ENSP00000431688:D220N	ENSP00000340200:D220N	D	-	1	0	GLYAT	58234048	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-3.725000	0.00382	-2.379000	0.00595	-1.181000	0.01715	GAT	.	.		0.552	GLYAT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394593.1		
ALG9	79796	hgsc.bcm.edu	37	11	111724383	111724383	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr11:111724383T>C	ENST00000531154.1	-	7	737	c.265A>G	c.(265-267)Ata>Gta	p.I89V	ALG9_ENST00000527228.1_5'UTR|ALG9_ENST00000524880.1_3'UTR|ALG9_ENST00000398006.2_Missense_Mutation_p.I89V	NM_024740.2	NP_079016.2	Q9H6U8	ALG9_HUMAN	ALG9, alpha-1,2-mannosyltransferase	260					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	dol-P-Man:Man(6)GlcNAc(2)-PP-Dol alpha-1,2-mannosyltransferase activity (GO:0052926)|dol-P-Man:Man(8)GlcNAc(2)-PP-Dol alpha-1,2-mannosyltransferase activity (GO:0052918)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;6.81e-07)|BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|all cancers(92;1.3e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0587)		AGAAATAGTATGAGGGCCATC	0.378																																					p.I260V		Atlas-SNP	.											.	ALG9	77	.	0			c.A778G						.						109.0	103.0	105.0					11																	111724383		1836	4081	5917	SO:0001583	missense	79796	exon8			ATAGTATGAGGGC		CCDS41714.1, CCDS53709.1, CCDS73379.1, CCDS73380.1	11q23	2013-02-26	2013-02-26	2004-08-26	ENSG00000086848	ENSG00000086848	2.4.1.259, 2.4.1.261	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	15672	protein-coding gene	gene with protein product	"""dolichyl-P-Man:Man(6)GlcNAc(2)-PP-dolichol alpha-1,2-mannosyltransferase"", ""dolichyl-P-Man:Man(8)GlcNAc(2)-PP-dolichol alpha-1,2-mannosyltransferase"", ""dol-P-Man dependent alpha-1,2-mannosyltransferase"""	606941	"""disrupted in bipolar affective disorder 1"", ""asparagine-linked glycosylation 9 homolog (yeast, alpha 1,2 mannosyltransferase)"", ""asparagine-linked glycosylation 9, alpha- 1,2-mannosyltransferase homolog (S. cerevisiae, alpha- 1,2-mannosyltransferase)"", ""asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae)"""	DIBD1		12030331, 15148656	Standard	NM_024740		Approved		uc021qql.1	Q9H6U8	OTTHUMG00000166819	ENST00000531154.1:c.265A>G	chr11.hg19:g.111724383T>C	ENSP00000435517:p.Ile89Val	292.0	0.0		170.0	37.0	NM_001077690	Q6ZMD5|Q7Z4R4|Q96GS7|Q96PB9|Q9H068	Missense_Mutation	SNP	ENST00000531154.1	hg19	CCDS41714.1	.	.	.	.	.	.	.	.	.	.	T	4.087	0.014093	0.07959	.	.	ENSG00000086848	ENST00000531154;ENST00000398006;ENST00000428306	T;T	0.61392	0.11;0.11	5.87	0.889	0.19212	.	0.423806	0.29722	N	0.011373	T	0.28732	0.0712	N	0.11201	0.11	0.09310	N	1	B;B;B;B	0.10296	0.0;0.0;0.003;0.0	B;B;B;B	0.12837	0.001;0.001;0.008;0.001	T	0.18272	-1.0342	10	0.09084	T	0.74	-0.4983	6.3005	0.21109	0.0:0.3361:0.1294:0.5345	.	89;260;493;260	B4DQI3;Q9H6U8-3;B4DYW0;Q9H6U8	.;.;.;ALG9_HUMAN	V	89;89;493	ENSP00000435517:I89V;ENSP00000381090:I89V	ENSP00000381090:I89V	I	-	1	0	ALG9	111229593	0.908000	0.30866	0.064000	0.19789	0.970000	0.65996	0.759000	0.26461	0.195000	0.20347	0.533000	0.62120	ATA	.	.		0.378	ALG9-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000391485.1	NM_024740	
CHD4	1108	hgsc.bcm.edu	37	12	6701152	6701152	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr12:6701152G>A	ENST00000357008.2	-	20	3183	c.3020C>T	c.(3019-3021)tCt>tTt	p.S1007F	CHD4_ENST00000544040.1_Missense_Mutation_p.S1000F|CHD4_ENST00000544484.1_Missense_Mutation_p.S1004F|CHD4_ENST00000309577.6_Missense_Mutation_p.S1007F	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	1007					ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)			central_nervous_system(2)	2						ATTCAGCAGAGACACCTGGTT	0.483																																					p.S1007F	Colon(32;586 792 4568 16848 45314)	Atlas-SNP	.											.	CHD4	539	.	0			c.C3020T						.						164.0	150.0	155.0					12																	6701152		2203	4300	6503	SO:0001583	missense	1108	exon20			AGCAGAGACACCT	X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.3020C>T	chr12.hg19:g.6701152G>A	ENSP00000349508:p.Ser1007Phe	133.0	0.0		83.0	41.0	NM_001273	Q8IXZ5	Missense_Mutation	SNP	ENST00000357008.2	hg19	CCDS8552.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.055626	0.75960	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464	D;D;D;D	0.94000	-3.33;-3.33;-3.33;-3.33	4.73	4.73	0.59995	SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.96473	0.8849	M	0.76727	2.345	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.997	D;D;D	0.83275	0.974;0.996;0.994	D	0.97038	0.9755	10	0.87932	D	0	.	17.8935	0.88879	0.0:0.0:1.0:0.0	.	1007;1007;1000	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	F	1004;1000;1007;1007;981	ENSP00000440392:S1004F;ENSP00000440542:S1000F;ENSP00000312419:S1007F;ENSP00000349508:S1007F	ENSP00000312419:S1007F	S	-	2	0	CHD4	6571413	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.591000	0.98241	2.450000	0.82876	0.563000	0.77884	TCT	.	.		0.483	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001273	
STYK1	55359	hgsc.bcm.edu	37	12	10783658	10783658	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr12:10783658A>G	ENST00000075503.3	-	5	957	c.437T>C	c.(436-438)cTc>cCc	p.L146P		NM_018423.2	NP_060893.2	Q6J9G0	STYK1_HUMAN	serine/threonine/tyrosine kinase 1	146	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|liver(1)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	26						TAAAGCCTTGAGAATAACACT	0.433										HNSCC(73;0.22)																											p.L146P		Atlas-SNP	.											.	STYK1	55	.	0			c.T437C						.						76.0	73.0	74.0					12																	10783658		2203	4300	6503	SO:0001583	missense	55359	exon5			GCCTTGAGAATAA	AF251059	CCDS8629.1	12p13.2	2005-01-21							18889	protein-coding gene	gene with protein product		611433				12841579	Standard	NM_018423		Approved	SuRTK106, DKFZp761P1010, NOK	uc001qys.2	Q6J9G0		ENST00000075503.3:c.437T>C	chr12.hg19:g.10783658A>G	ENSP00000075503:p.Leu146Pro	151.0	0.0		87.0	13.0	NM_018423	B2R9T2|Q52LR3|Q9BXY2|Q9NSH1	Missense_Mutation	SNP	ENST00000075503.3	hg19	CCDS8629.1	.	.	.	.	.	.	.	.	.	.	A	16.88	3.244107	0.59103	.	.	ENSG00000060140	ENST00000075503	D	0.84070	-1.8	5.45	5.45	0.79879	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.200757	0.33670	N	0.004667	D	0.88032	0.6328	L	0.56199	1.76	0.80722	D	1	D	0.64830	0.994	D	0.65874	0.939	D	0.88990	0.3414	10	0.72032	D	0.01	-2.1767	13.7446	0.62868	1.0:0.0:0.0:0.0	.	146	Q6J9G0	STYK1_HUMAN	P	146	ENSP00000075503:L146P	ENSP00000075503:L146P	L	-	2	0	STYK1	10674925	1.000000	0.71417	1.000000	0.80357	0.521000	0.34408	5.604000	0.67626	2.193000	0.70182	0.529000	0.55759	CTC	.	.		0.433	STYK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399622.1	NM_018423	
ACACB	32	hgsc.bcm.edu	37	12	109637211	109637211	+	Silent	SNP	C	C	A			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr12:109637211C>A	ENST00000338432.7	+	18	2751	c.2632C>A	c.(2632-2634)Cga>Aga	p.R878R	ACACB_ENST00000377848.3_Silent_p.R878R|ACACB_ENST00000377854.5_Silent_p.R878R			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	878					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	TCCCAGTTACCGAATTACCAT	0.522																																					p.R878R		Atlas-SNP	.											.	ACACB	330	.	0			c.C2632A						.						115.0	104.0	108.0					12																	109637211		2203	4300	6503	SO:0001819	synonymous_variant	32	exon17			AGTTACCGAATTA	U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.2632C>A	chr12.hg19:g.109637211C>A		115.0	0.0		80.0	42.0	NM_001093	A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Silent	SNP	ENST00000338432.7	hg19	CCDS31898.1																																																																																			.	.		0.522	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403077.1	NM_001093	
RB1	5925	hgsc.bcm.edu	37	13	48953788	48953788	+	Splice_Site	SNP	T	T	C			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr13:48953788T>C	ENST00000267163.4	+	14	1527		c.e14+2			NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1						androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(8)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	CTTAAATCAGTAAGTTAAAAA	0.433		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																											.		Atlas-SNP	.	yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	.	RB1	1068	.	23	Whole gene deletion(15)|Unknown(8)	bone(11)|breast(5)|central_nervous_system(2)|adrenal_gland(1)|eye(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)	c.1389+2T>C	GRCh37	CS023834	RB1	S		.						19.0	20.0	20.0					13																	48953788		2200	4300	6500	SO:0001630	splice_region_variant	5925	exon14	Familial Cancer Database		AATCAGTAAGTTA	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1389+2T>C	chr13.hg19:g.48953788T>C		310.0	0.0		72.0	49.0	NM_000321	A8K5E3|P78499|Q5VW46|Q8IZL4	Splice_Site	SNP	ENST00000267163.4	hg19	CCDS31973.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.096264	0.76870	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	.	.	.	4.75	4.75	0.60458	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.2452	0.65983	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	RB1	47851789	1.000000	0.71417	1.000000	0.80357	0.839000	0.47603	6.189000	0.72051	1.770000	0.52166	0.377000	0.23210	.	.	.		0.433	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000044884.1		Intron
VIPAS39	63894	hgsc.bcm.edu	37	14	77895420	77895420	+	Missense_Mutation	SNP	T	T	G			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr14:77895420T>G	ENST00000553888.1	-	18	1795	c.1285A>C	c.(1285-1287)Aat>Cat	p.N429H	VIPAS39_ENST00000557658.1_Missense_Mutation_p.N429H|VIPAS39_ENST00000448935.2_Missense_Mutation_p.N380H|VIPAS39_ENST00000556412.1_Missense_Mutation_p.N455H|VIPAS39_ENST00000327028.4_Missense_Mutation_p.N416H|VIPAS39_ENST00000343765.2_Missense_Mutation_p.N429H	NM_001193314.1|NM_001193317.1|NM_022067.3	NP_001180243.1|NP_001180246.1|NP_071350.2	Q9H9C1	SPE39_HUMAN	VPS33B interacting protein, apical-basolateral polarity regulator, spe-39 homolog	429					cell differentiation (GO:0030154)|endosome to lysosome transport (GO:0008333)|intracellular protein transport (GO:0006886)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|late endosome (GO:0005770)|recycling endosome (GO:0055037)											TCCACCAGATTGACATACTCC	0.443																																					p.N429H		Atlas-SNP	.											.	.	.	.	0			c.A1285C						.						131.0	102.0	112.0					14																	77895420		2203	4300	6503	SO:0001583	missense	63894	exon18			CCAGATTGACATA	AK022925	CCDS9862.1, CCDS53905.1	14q24.3-q31	2013-08-14	2012-07-24	2012-07-24	ENSG00000151445	ENSG00000151445			20347	protein-coding gene	gene with protein product	"""VPS33B interacting protein, apical-basolateral polarity regulator"""	613401	"""chromosome 14 open reading frame 133"""	C14orf133		20190753, 19109425, 22753090, 23002115, 23918659	Standard	NM_022067		Approved	VIPAR, VPS16B, SPE-39, SPE39, hSPE-39	uc001xtu.2	Q9H9C1		ENST00000553888.1:c.1285A>C	chr14.hg19:g.77895420T>G	ENSP00000452181:p.Asn429His	81.0	0.0		42.0	17.0	NM_001193314	B4DPI6|O95434|Q9H7E1|Q9H9I9	Missense_Mutation	SNP	ENST00000553888.1	hg19	CCDS9862.1	.	.	.	.	.	.	.	.	.	.	T	15.25	2.777664	0.49786	.	.	ENSG00000151445	ENST00000343765;ENST00000553888;ENST00000327028;ENST00000557658;ENST00000448935;ENST00000556412	T;T;T;T;T;T	0.51071	0.72;0.72;0.72;0.72;0.72;0.72	5.42	4.32	0.51571	.	0.306680	0.40469	N	0.001097	T	0.37758	0.1015	N	0.22421	0.69	0.35090	D	0.764222	P;P	0.40282	0.47;0.711	B;P	0.44359	0.273;0.447	T	0.52403	-0.8580	10	0.46703	T	0.11	-28.2457	9.9063	0.41377	0.0:0.0:0.3772:0.6228	.	380;429	B4DPI6;Q9H9C1	.;VIPAR_HUMAN	H	429;429;416;429;380;455	ENSP00000339122:N429H;ENSP00000452181:N429H;ENSP00000313098:N416H;ENSP00000452191:N429H;ENSP00000404815:N380H;ENSP00000451857:N455H	ENSP00000313098:N416H	N	-	1	0	VIPAR	76965173	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.521000	0.45563	2.047000	0.60756	0.533000	0.62120	AAT	.	.		0.443	VIPAS39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414008.1	NM_022067	
CDH1	999	hgsc.bcm.edu	37	16	68849486	68849486	+	Silent	SNP	G	G	A			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr16:68849486G>A	ENST00000261769.5	+	10	1580	c.1389G>A	c.(1387-1389)gaG>gaA	p.E463E	CDH1_ENST00000422392.2_Silent_p.E402E|CDH1_ENST00000562836.1_3'UTR|RP11-354M1.2_ENST00000563916.1_RNA	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	463	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.		E -> Q (in a gastric carcinoma sample).		adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.G441_E463del(1)|p.?(1)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		TACCTTTTGAGGTCTCTCTCA	0.493			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																												p.E463E		Atlas-SNP	.	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	.	CDH1	535	.	2	Unknown(1)|Deletion - In frame(1)	stomach(1)|breast(1)	c.G1389A						.						169.0	141.0	151.0					16																	68849486		2198	4300	6498	SO:0001819	synonymous_variant	999	exon10	Familial Cancer Database	HDGC	TTTTGAGGTCTCT	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.1389G>A	chr16.hg19:g.68849486G>A		154.0	0.0		73.0	34.0	NM_004360	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Silent	SNP	ENST00000261769.5	hg19	CCDS10869.1																																																																																			.	.		0.493	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268897.2	NM_004360	
ZFHX3	463	hgsc.bcm.edu	37	16	72821615	72821615	+	Silent	SNP	G	G	A			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr16:72821615G>A	ENST00000268489.5	-	10	11232	c.10560C>T	c.(10558-10560)ggC>ggT	p.G3520G	RP5-991G20.1_ENST00000563328.2_RNA|ZFHX3_ENST00000397992.5_Silent_p.G2606G|RP5-991G20.4_ENST00000569195.1_RNA|AC004943.1_ENST00000584072.1_RNA	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	3520	Poly-Gly.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				cgccgccgccgccaccgccgc	0.706																																					p.G3520G		Atlas-SNP	.											ZFHX3,NS,carcinoma,0,1	ZFHX3	404	.	0			c.C10560T						.						10.0	14.0	12.0					16																	72821615		1455	3158	4613	SO:0001819	synonymous_variant	463	exon10			GCCGCCGCCACCG	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.10560C>T	chr16.hg19:g.72821615G>A		6.0	0.0		10.0	5.0	NM_006885	D3DWS8|O15101|Q13719	Silent	SNP	ENST00000268489.5	hg19	CCDS10908.1																																																																																			.	.		0.706	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885	
KIAA0100	9703	hgsc.bcm.edu	37	17	26970215	26970215	+	Silent	SNP	G	G	C			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr17:26970215G>C	ENST00000528896.2	-	4	437	c.363C>G	c.(361-363)tcC>tcG	p.S121S	KIAA0100_ENST00000389003.3_5'UTR|KIAA0100_ENST00000544884.1_5'UTR	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	121						extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					ATGGGCTGAAGGACAGTTCCT	0.493																																					p.S121S		Atlas-SNP	.											.	KIAA0100	175	.	0			c.C363G						.						122.0	126.0	125.0					17																	26970215		2203	4300	6503	SO:0001819	synonymous_variant	9703	exon4			GCTGAAGGACAGT	D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.363C>G	chr17.hg19:g.26970215G>C		81.0	0.0		51.0	21.0	NM_014680	A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Silent	SNP	ENST00000528896.2	hg19	CCDS32595.1																																																																																			.	.		0.493	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390571.3	NM_014680	
NF1	4763	hgsc.bcm.edu	37	17	29592294	29592294	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr17:29592294G>A	ENST00000358273.4	+	36	5155	c.4772G>A	c.(4771-4773)aGt>aAt	p.S1591N	NF1_ENST00000356175.3_Missense_Mutation_p.S1570N	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	1591	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.|Lipid binding.				actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(4)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		AAAACGTTAAGTATTTTCTAC	0.338			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																											p.S1591N		Atlas-SNP	.	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	.	NF1	1586	.	12	Whole gene deletion(8)|Unknown(4)	soft_tissue(7)|autonomic_ganglia(2)|central_nervous_system(2)|lung(1)	c.G4772A						.						69.0	71.0	70.0					17																	29592294		2203	4297	6500	SO:0001583	missense	4763	exon36	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	CGTTAAGTATTTT		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.4772G>A	chr17.hg19:g.29592294G>A	ENSP00000351015:p.Ser1591Asn	148.0	0.0		90.0	34.0	NM_001042492	O00662|Q14284|Q14930|Q14931|Q9UMK3	Missense_Mutation	SNP	ENST00000358273.4	hg19	CCDS42292.1	.	.	.	.	.	.	.	.	.	.	G	6.328	0.428635	0.11987	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	T;T;T	0.59638	0.25;0.25;0.25	6.16	2.87	0.33458	Cellular retinaldehyde-binding/triple function, C-terminal (2);Armadillo-type fold (1);	0.204155	0.50627	N	0.000115	T	0.11965	0.0291	N	0.00066	-2.3	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.33394	-0.9870	10	0.02654	T	1	.	5.1909	0.15209	0.5174:0.0:0.4826:0.0	.	620;1570;1591	Q59FX3;P21359-2;P21359	.;.;NF1_HUMAN	N	1591;1570;1236	ENSP00000351015:S1591N;ENSP00000348498:S1570N;ENSP00000389907:S1236N	ENSP00000348498:S1570N	S	+	2	0	NF1	26616420	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.962000	0.63687	0.944000	0.37579	0.650000	0.86243	AGT	.	.		0.338	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267	
TAF15	8148	hgsc.bcm.edu	37	17	34149836	34149836	+	Splice_Site	SNP	A	A	C			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr17:34149836A>C	ENST00000588240.1	+	6	598	c.483A>C	c.(481-483)caA>caC	p.Q161H	AC015849.13_ENST00000589356.1_RNA|TAF15_ENST00000311979.3_Splice_Site_p.Q158H|TAF15_ENST00000592237.1_Splice_Site_p.Q70H|AC015849.19_ENST00000588415.1_RNA	NM_003487.3|NM_139215.2	NP_003478.1|NP_631961.1	Q16514	TAF12_HUMAN	TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa	0					chromatin organization (GO:0006325)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone H3 acetylation (GO:0043966)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of RNA biosynthetic process (GO:2001141)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)		TAF15/NR4A3(33)	lung(1)|ovary(1)|skin(2)|stomach(1)	5		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		ACCACACACAAGGTAAGATTT	0.363			T	"""TEC, CHN1, ZNF384"""	"""extraskeletal myxoid chondrosarcomas, ALL"""																																p.Q161H		Atlas-SNP	.		Dom	yes		17	17q11.1-q11.2	8148	"""TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa"""		"""L, M"""	.	TAF15	46	.	0			c.A483C						.						100.0	94.0	96.0					17																	34149836		2203	4300	6503	SO:0001630	splice_region_variant	8148	exon6			CACACAAGGTAAG	U51334	CCDS32623.1, CCDS59279.1	17q11.1-q11.2	2013-02-12	2002-08-29	2001-12-07		ENSG00000270647		"""RNA binding motif (RRM) containing"""	11547	protein-coding gene	gene with protein product		601574	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, N, 68kD (RNA-binding protein 56)"""	TAF2N		8954779, 9795213	Standard	NM_003487		Approved	hTAFII68, RBP56, Npl3	uc002hkd.4	Q92804		ENST00000588240.1:c.484+1A>C	chr17.hg19:g.34149836A>C		264.0	0.0		144.0	55.0	NM_139215	D3DPM5|Q15775|Q5T077	Missense_Mutation	SNP	ENST00000588240.1	hg19	CCDS32623.1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.067630	0.76301	.	.	ENSG00000172660	ENST00000311979	.	.	.	5.61	5.61	0.85477	.	.	.	.	.	T	0.77308	0.4111	M	0.76170	2.325	0.38470	D	0.947431	D;D	0.60575	0.98;0.988	D;D	0.74674	0.965;0.984	T	0.81046	-0.1110	8	0.59425	D	0.04	-4.2426	12.4866	0.55877	1.0:0.0:0.0:0.0	.	161;158	Q92804;Q92804-2	RBP56_HUMAN;.	H	161	.	ENSP00000309558:Q161H	Q	+	3	2	TAF15	31173949	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.420000	0.66441	2.252000	0.74401	0.533000	0.62120	CAA	.	.		0.363	TAF15-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449134.1	NM_139215	Missense_Mutation
POTEC	388468	hgsc.bcm.edu	37	18	14537872	14537872	+	Silent	SNP	A	A	G			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr18:14537872A>G	ENST00000358970.5	-	3	737	c.738T>C	c.(736-738)gcT>gcC	p.A246A	POTEC_ENST00000389891.4_5'UTR	NM_001137671.1	NP_001131143.1	B2RU33	POTEC_HUMAN	POTE ankyrin domain family, member C	246										NS(2)|breast(1)|endometrium(9)|kidney(13)|lung(14)|prostate(3)|skin(6)|soft_tissue(1)|urinary_tract(3)	52						CATTGTGGACAGCATAGTGTA	0.368																																					p.A246A		Atlas-SNP	.											.	POTEC	129	.	0			c.T738C						.						386.0	292.0	321.0					18																	14537872		692	1591	2283	SO:0001819	synonymous_variant	388468	exon3			GTGGACAGCATAG	BX649118	CCDS45835.1	18p11.21	2013-01-10	2008-11-26	2008-11-26	ENSG00000183206	ENSG00000183206		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33894	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 6"""		"""ANKRD26-like family B, member 2"""	A26B2			Standard	NM_001137671		Approved	POTE18, POTE-18, DKFZp686J0529, CT104.6	uc010dln.3	B2RU33	OTTHUMG00000162963	ENST00000358970.5:c.738T>C	chr18.hg19:g.14537872A>G		319.0	0.0		178.0	81.0	NM_001137671		Silent	SNP	ENST00000358970.5	hg19	CCDS45835.1																																																																																			.	.		0.368	POTEC-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371179.1	XM_496269	
GATA6	2627	hgsc.bcm.edu	37	18	19756976	19756976	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr18:19756976C>T	ENST00000269216.3	+	3	1473	c.1196C>T	c.(1195-1197)cCg>cTg	p.P399L	GATA6_ENST00000581694.1_Missense_Mutation_p.P399L|RP11-627G18.2_ENST00000578504.1_RNA	NM_005257.4	NP_005248.2	Q92908	GATA6_HUMAN	GATA binding protein 6	399					blood coagulation (GO:0007596)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac vascular smooth muscle cell differentiation (GO:0060947)|cellular response to BMP stimulus (GO:0071773)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to hypoxia (GO:0071456)|Clara cell differentiation (GO:0060486)|endodermal cell fate determination (GO:0007493)|in utero embryonic development (GO:0001701)|intestinal epithelial cell differentiation (GO:0060575)|liver development (GO:0001889)|lung saccule development (GO:0060430)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta1 production (GO:0032911)|negative regulation of transforming growth factor beta2 production (GO:0032912)|organ formation (GO:0048645)|outflow tract septum morphogenesis (GO:0003148)|pancreatic A cell differentiation (GO:0003310)|phospholipid metabolic process (GO:0006644)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to growth factor (GO:0070848)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)|tube morphogenesis (GO:0035239)|type B pancreatic cell differentiation (GO:0003309)|Type II pneumocyte differentiation (GO:0060510)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	18	all_cancers(21;0.00271)|all_epithelial(16;7.31e-05)|Ovarian(2;0.116)|Lung NSC(20;0.123)|all_lung(20;0.246)		STAD - Stomach adenocarcinoma(5;0.106)			ATCCAGACGCCGCTGTGGCGG	0.701																																					p.P399L	Colon(8;48 282 46199 46856)|Melanoma(177;170 2725 12489 26999)	Atlas-SNP	.											.	GATA6	35	.	0			c.C1196T						.						6.0	7.0	6.0					18																	19756976		1990	3985	5975	SO:0001583	missense	2627	exon3			AGACGCCGCTGTG	U66075	CCDS11872.1	18q11-q12	2013-01-25	2001-11-28		ENSG00000141448	ENSG00000141448		"""GATA zinc finger domain containing"""	4174	protein-coding gene	gene with protein product		601656	"""GATA-binding protein 6"""			8975704	Standard	XM_005258248		Approved		uc002ktt.2	Q92908	OTTHUMG00000131767	ENST00000269216.3:c.1196C>T	chr18.hg19:g.19756976C>T	ENSP00000269216:p.Pro399Leu	36.0	0.0		35.0	14.0	NM_005257	B0YJ17|P78327	Missense_Mutation	SNP	ENST00000269216.3	hg19	CCDS11872.1	.	.	.	.	.	.	.	.	.	.	C	19.78	3.891845	0.72524	.	.	ENSG00000141448	ENST00000269216	D	0.99711	-6.49	4.99	4.11	0.48088	Zinc finger, NHR/GATA-type (1);Zinc finger, GATA-type (5);	0.128964	0.53938	N	0.000050	D	0.99495	0.9820	H	0.96333	3.805	0.80722	D	1	B	0.12630	0.006	B	0.13407	0.009	D	0.99612	1.0981	10	0.87932	D	0	-26.1673	15.5461	0.76101	0.0:0.8614:0.1386:0.0	.	399	Q92908	GATA6_HUMAN	L	399	ENSP00000269216:P399L	ENSP00000269216:P399L	P	+	2	0	GATA6	18010974	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.808000	0.69165	1.325000	0.45301	0.558000	0.71614	CCG	.	.		0.701	GATA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254696.1	NM_005257	
CREB3L3	84699	hgsc.bcm.edu	37	19	4171379	4171379	+	Splice_Site	SNP	G	G	A	rs112561919		TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr19:4171379G>A	ENST00000078445.2	+	9	1122		c.e9-1		CREB3L3_ENST00000602147.1_Splice_Site|CREB3L3_ENST00000602257.1_Splice_Site|CREB3L3_ENST00000595923.1_Splice_Site|CREB3L3_ENST00000252587.3_Splice_Site	NM_001271995.1|NM_001271996.1|NM_032607.1	NP_001258924.1|NP_001258925.1|NP_115996.1	Q68CJ9	CR3L3_HUMAN	cAMP responsive element binding protein 3-like 3						positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|skin(2)|urinary_tract(3)	24				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0232)|STAD - Stomach adenocarcinoma(1328;0.18)		GTCTCCACCAGGTCCTGTTGC	0.607																																					.		Atlas-SNP	.											.	CREB3L3	53	.	0			c.973-1G>A						.						93.0	81.0	85.0					19																	4171379		2203	4300	6503	SO:0001630	splice_region_variant	84699	exon9			CCACCAGGTCCTG		CCDS12121.1, CCDS62498.1, CCDS62499.1, CCDS62500.1	19p13.3	2013-01-10				ENSG00000060566		"""basic leucine zipper proteins"""	18855	protein-coding gene	gene with protein product		611998				11353085	Standard	NM_032607		Approved	CREB-H	uc002lzl.4	Q68CJ9		ENST00000078445.2:c.976-1G>A	chr19.hg19:g.4171379G>A		96.0	0.0		115.0	27.0	NM_001271995	B2R7S6|B7ZL69|M0QYW7|Q6ZMC5|Q96TB9	Splice_Site	SNP	ENST00000078445.2	hg19	CCDS12121.1	.	.	.	.	.	.	.	.	.	.	G	14.32	2.499000	0.44455	.	.	ENSG00000060566	ENST00000078445;ENST00000381943;ENST00000252587	.	.	.	4.58	4.58	0.56647	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8629	0.70394	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CREB3L3	4122379	1.000000	0.71417	0.999000	0.59377	0.300000	0.27592	8.606000	0.90888	2.093000	0.63338	0.561000	0.74099	.	.	C|1.000		0.607	CREB3L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457922.1	NM_032607	Intron
ANO8	57719	hgsc.bcm.edu	37	19	17442017	17442017	+	Silent	SNP	G	G	T			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr19:17442017G>T	ENST00000159087.4	-	7	869	c.711C>A	c.(709-711)atC>atA	p.I237I		NM_020959.2	NP_066010.1	Q9HCE9	ANO8_HUMAN	anoctamin 8	237					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			autonomic_ganglia(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(3)	27						AGTAATCACAGATGTCATCTG	0.572																																					p.I237I		Atlas-SNP	.											.	ANO8	67	.	0			c.C711A						.						78.0	83.0	81.0					19																	17442017		2203	4300	6503	SO:0001819	synonymous_variant	57719	exon7			ATCACAGATGTCA	AB046843	CCDS32949.1	19p13.12	2014-04-09	2008-08-28	2008-08-28		ENSG00000074855		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	29329	protein-coding gene	gene with protein product		610216	"""KIAA1623"", ""transmembrane protein 16H"""	KIAA1623, TMEM16H		10997877, 24692353	Standard	NM_020959		Approved		uc002ngf.2	Q9HCE9		ENST00000159087.4:c.711C>A	chr19.hg19:g.17442017G>T		59.0	0.0		43.0	22.0	NM_020959	A6NIJ0	Silent	SNP	ENST00000159087.4	hg19	CCDS32949.1																																																																																			.	.		0.572	ANO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462943.1	XM_050644	
ZNF257	113835	hgsc.bcm.edu	37	19	22271464	22271464	+	Silent	SNP	T	T	C			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr19:22271464T>C	ENST00000594947.1	+	4	1056	c.912T>C	c.(910-912)acT>acC	p.T304T		NM_033468.2	NP_258429.2	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257	304					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|lung(4)	6		all_lung(12;0.0961)|Lung NSC(12;0.103)				CTACCCTTACTCAACATAAGA	0.393																																					p.T304T		Atlas-SNP	.											.	ZNF257	156	.	0			c.T912C						.						47.0	51.0	50.0					19																	22271464		2122	4249	6371	SO:0001819	synonymous_variant	113835	exon4			CCTTACTCAACAT	AF070651	CCDS46030.1	19p12	2014-02-14			ENSG00000197134	ENSG00000197134		"""Zinc fingers, C2H2-type"", ""-"""	13498	protein-coding gene	gene with protein product		606957				10585455	Standard	NM_033468		Approved	BMZF-4	uc010ecx.3	Q9Y2Q1	OTTHUMG00000182927	ENST00000594947.1:c.912T>C	chr19.hg19:g.22271464T>C		114.0	0.0		95.0	52.0	NM_033468	B3KPS4|E9PG34|Q8NE34	Silent	SNP	ENST00000594947.1	hg19	CCDS46030.1																																																																																			.	.		0.393	ZNF257-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464382.1		
ZNF350	59348	hgsc.bcm.edu	37	19	52468329	52468329	+	Silent	SNP	C	C	T			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr19:52468329C>T	ENST00000243644.4	-	5	1604	c.1377G>A	c.(1375-1377)ggG>ggA	p.G459G	HCCAT3_ENST00000595010.1_RNA|ZNF350_ENST00000600703.1_5'Flank|HCCAT3_ENST00000600253.1_RNA	NM_021632.3	NP_067645.3	Q9GZX5	ZN350_HUMAN	zinc finger protein 350	459					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(3)|kidney(3)|large_intestine(7)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0179)		GTGTAGTCGCCCCGTTAGCAG	0.532																																					p.G459G		Atlas-SNP	.											.	ZNF350	48	.	0			c.G1377A						.						90.0	77.0	82.0					19																	52468329		2203	4300	6503	SO:0001819	synonymous_variant	59348	exon5			AGTCGCCCCGTTA	AF295096	CCDS12845.1	19q13.41	2013-05-23			ENSG00000256683	ENSG00000256683		"""Zinc fingers, C2H2-type"", ""-"""	16656	protein-coding gene	gene with protein product		605422				11090615, 11161714	Standard	NM_021632		Approved	ZBRK1, ZFQR	uc002pyd.3	Q9GZX5	OTTHUMG00000182538	ENST00000243644.4:c.1377G>A	chr19.hg19:g.52468329C>T		100.0	0.0		76.0	10.0	NM_021632	Q96G73|Q9HAQ4	Silent	SNP	ENST00000243644.4	hg19	CCDS12845.1																																																																																			.	.		0.532	ZNF350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462278.1	NM_021632	
ITSN1	6453	hgsc.bcm.edu	37	21	35258604	35258604	+	Silent	SNP	G	G	A			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr21:35258604G>A	ENST00000381318.3	+	39	5145	c.4857G>A	c.(4855-4857)ccG>ccA	p.P1619P	ITSN1_ENST00000399367.3_Silent_p.P1614P|ITSN1_ENST00000437442.2_Silent_p.P1558P|AP000304.12_ENST00000429238.1_Intron|ITSN1_ENST00000381285.4_Silent_p.P1619P|ITSN1_ENST00000399326.3_3'UTR	NM_003024.2	NP_003015.2	Q15811	ITSN1_HUMAN	intersectin 1 (SH3 domain protein)	1619	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				apoptotic signaling pathway (GO:0097190)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|kinase activator activity (GO:0019209)|proline-rich region binding (GO:0070064)|protein complex scaffold (GO:0032947)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(26)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	67						AGAGCAACCCGTACTGTGAGG	0.473																																					p.P1619P		Atlas-SNP	.											.	ITSN1	166	.	0			c.G4857A						.						98.0	85.0	89.0					21																	35258604		2203	4300	6503	SO:0001819	synonymous_variant	6453	exon39			CAACCCGTACTGT	AF064244	CCDS33545.1, CCDS33546.1	21q22.1-q22.2	2013-01-10			ENSG00000205726	ENSG00000205726		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	6183	protein-coding gene	gene with protein product	"""SH3 domain protein-1A"", ""human intersectin-SH3 domain-containing protein SH3P17"", ""Src homology 3 domain-containing protein"", ""intersectin 1 short form variant, 11"", ""intersectin 1 short form variant 3"", ""intersectin short variant 12"""	602442		SH3D1A, ITSN		9799604, 9813051	Standard	NM_003024		Approved	SH3P17, MGC134948, MGC134949	uc002yta.1	Q15811	OTTHUMG00000065284	ENST00000381318.3:c.4857G>A	chr21.hg19:g.35258604G>A		166.0	0.0		113.0	51.0	NM_003024	A7Y322|A8CTX8|A8CTY3|A8CTY7|A8D7D0|A8DCP3|B4DTM2|E7ERJ1|E9PE44|E9PG01|E9PHV2|O95216|Q0PW94|Q0PW95|Q0PW97|Q14BD3|Q1ED40|Q20BK3|Q9UET5|Q9UK60|Q9UNK1|Q9UNK2|Q9UQ92	Silent	SNP	ENST00000381318.3	hg19	CCDS33545.1	.	.	.	.	.	.	.	.	.	.	G	6.083	0.383575	0.11524	.	.	ENSG00000205726	ENST00000381284	.	.	.	5.53	-11.1	0.00147	.	.	.	.	.	T	0.32255	0.0823	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42632	-0.9440	4	.	.	.	.	1.798	0.03065	0.2762:0.2896:0.2652:0.1691	.	.	.	.	I	299	.	.	V	+	1	0	ITSN1	34180474	0.000000	0.05858	0.283000	0.24790	0.864000	0.49448	-3.965000	0.00324	-3.109000	0.00242	-1.632000	0.00781	GTA	.	.		0.473	ITSN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000140070.4	NM_003024	
PWP2	5822	hgsc.bcm.edu	37	21	45534063	45534063	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr21:45534063G>A	ENST00000291576.7	+	4	357	c.230G>A	c.(229-231)gGc>gAc	p.G77D		NM_005049.2	NP_005040.2	Q15269	PWP2_HUMAN	PWP2 periodic tryptophan protein homolog (yeast)	77					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|signal transducer activity (GO:0004871)			cervix(1)|endometrium(6)|large_intestine(6)|lung(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(1)	21				STAD - Stomach adenocarcinoma(101;0.172)|Colorectal(79;0.2)		CCTGCAGGGGGCGATGCGCTG	0.612											OREG0026247	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G77D		Atlas-SNP	.											.	PWP2	64	.	0			c.G230A						.						97.0	87.0	90.0					21																	45534063		2203	4300	6503	SO:0001583	missense	5822	exon4			CAGGGGGCGATGC		CCDS33579.1	21q22.3	2013-01-10	2001-11-28	2006-11-24	ENSG00000241945	ENSG00000241945		"""WD repeat domain containing"""	9711	protein-coding gene	gene with protein product		601475	"""PWP2 (periodic tryptophan protein, yeast) homolog"""	PWP2H		8893822	Standard	NM_005049		Approved	EHOC-17, UTP1	uc002zeb.3	Q15269	OTTHUMG00000086893	ENST00000291576.7:c.230G>A	chr21.hg19:g.45534063G>A	ENSP00000291576:p.Gly77Asp	46.0	0.0	932	22.0	14.0	NM_005049	B2RAG8|Q96A77	Missense_Mutation	SNP	ENST00000291576.7	hg19	CCDS33579.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.939885	0.92526	.	.	ENSG00000241945	ENST00000291576	T	0.56611	0.45	4.64	4.64	0.57946	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);	0.000000	0.85682	D	0.000000	T	0.78616	0.4311	M	0.93016	3.37	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84472	0.0600	10	0.72032	D	0.01	-9.8646	15.6473	0.77065	0.0:0.0:1.0:0.0	.	77	Q15269	PWP2_HUMAN	D	77	ENSP00000291576:G77D	ENSP00000291576:G77D	G	+	2	0	PWP2	44358491	1.000000	0.71417	0.920000	0.36463	0.941000	0.58515	8.930000	0.92872	2.298000	0.77334	0.313000	0.20887	GGC	.	.		0.612	PWP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195736.3	NM_005049	
VSIG4	11326	hgsc.bcm.edu	37	X	65244890	65244890	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chrX:65244890A>G	ENST00000374737.4	-	6	1025	c.917T>C	c.(916-918)cTc>cCc	p.L306P	VSIG4_ENST00000412866.2_Missense_Mutation_p.L212P|VSIG4_ENST00000455586.2_Missense_Mutation_p.L306P	NM_001257403.1|NM_007268.2	NP_001244332.1|NP_009199.1	Q9Y279	VSIG4_HUMAN	V-set and immunoglobulin domain containing 4	306					complement activation, alternative pathway (GO:0006957)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of T cell proliferation (GO:0042130)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CTTCCGACAGAGCATGATATA	0.428																																					p.L306P		Atlas-SNP	.											.	VSIG4	54	.	0			c.T917C						.						117.0	83.0	94.0					X																	65244890		2203	4300	6503	SO:0001583	missense	11326	exon6			CGACAGAGCATGA	AJ132502	CCDS14383.1, CCDS48132.1, CCDS55435.1	Xq12-q13.3	2013-01-29			ENSG00000155659	ENSG00000155659		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17032	protein-coding gene	gene with protein product		300353				10899594, 11004523, 17016555, 17016562	Standard	NM_007268		Approved	Z39IG	uc004dwh.2	Q9Y279	OTTHUMG00000021727	ENST00000374737.4:c.917T>C	chrX.hg19:g.65244890A>G	ENSP00000363869:p.Leu306Pro	456.0	0.0		269.0	58.0	NM_001257403	Q6UXI4	Missense_Mutation	SNP	ENST00000374737.4	hg19	CCDS14383.1	.	.	.	.	.	.	.	.	.	.	A	10.72	1.430334	0.25726	.	.	ENSG00000155659	ENST00000374737;ENST00000455586;ENST00000412866	T;T;T	0.38401	1.32;1.14;1.84	4.29	4.29	0.51040	.	0.911156	0.09226	N	0.831161	T	0.49695	0.1572	L	0.54323	1.7	0.21915	N	0.999479	P;D;D;D;D	0.58620	0.948;0.974;0.971;0.983;0.976	P;P;P;P;P	0.58331	0.548;0.748;0.641;0.837;0.656	T	0.31806	-0.9930	10	0.62326	D	0.03	-2.0675	8.7612	0.34676	1.0:0.0:0.0:0.0	.	212;306;296;212;306	C9J1L3;Q9Y279-2;C9JH67;Q9Y279-3;Q9Y279	.;.;.;.;VSIG4_HUMAN	P	306;306;212	ENSP00000363869:L306P;ENSP00000411581:L306P;ENSP00000394143:L212P	ENSP00000363869:L306P	L	-	2	0	VSIG4	65161615	0.011000	0.17503	0.053000	0.19242	0.078000	0.17371	1.941000	0.40233	1.583000	0.49898	0.486000	0.48141	CTC	.	.		0.428	VSIG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056986.1	NM_007268	
REV3L	5980	hgsc.bcm.edu	37	6	111694495	111694495	+	Frame_Shift_Del	DEL	C	C	-			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr6:111694495delC	ENST00000358835.3	-	14	5517	c.5063delG	c.(5062-5064)ggafs	p.G1688fs	REV3L_ENST00000435970.1_Frame_Shift_Del_p.G1610fs|REV3L_ENST00000368805.1_Frame_Shift_Del_p.G1688fs|REV3L_ENST00000368802.3_Frame_Shift_Del_p.G1688fs			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	1688					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		TATAGCTTGTCCTGGAAAAAG	0.393								DNA polymerases (catalytic subunits)																													p.G1688fs		Atlas-Indel,Pindel	.											.	REV3L	386	.	0			c.5064delA						.						60.0	60.0	60.0					6																	111694495		2203	4299	6502	SO:0001589	frameshift_variant	5980	exon13			.	AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.5063delG	chr6.hg19:g.111694495delC	ENSP00000351697:p.Gly1688fs	114.0	0.0		61.0	22.0	NM_002912	O43214|Q5TC33	Frame_Shift_Del	DEL	ENST00000358835.3	hg19	CCDS5091.2																																																																																			.	.		0.393	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043695.1	NM_002912	
PCLO	27445	hgsc.bcm.edu	37	7	82390054	82390055	+	Frame_Shift_Ins	INS	-	-	T			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr7:82390054_82390055insT	ENST00000333891.9	-	24	15525_15526	c.15188_15189insA	c.(15187-15189)aagfs	p.K5063fs		NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TCTTGATCACCTTTTTTTGGGT	0.317																																					p.K5063fs		Atlas-Indel,Pindel	.											.	PCLO	1506	.	0			c.15189_15190insA						.																																			SO:0001589	frameshift_variant	27445	exon24			.	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.15189dupA	chr7.hg19:g.82390061_82390061dupT	ENSP00000334319:p.Lys5063fs	325.0	0.0		196.0	73.0	NM_033026		Frame_Shift_Ins	INS	ENST00000333891.9	hg19	CCDS47630.1																																																																																			.	.		0.317	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
TTN	7273	hgsc.bcm.edu	37	2	179544684	179544699	+	Frame_Shift_Del	DEL	ACTCTTCTTCTTCTTC	ACTCTTCTTCTTCTTC	-	rs368327166	byFrequency	TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	ACTCTTCTTCTTCTTC	ACTCTTCTTCTTCTTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr2:179544684_179544699delACTCTTCTTCTTCTTC	ENST00000591111.1	-	138	32775_32790	c.32551_32566delGAAGAAGAAGAAGAGT	c.(32551-32568)gaagaagaagaagagtacfs	p.EEEEEY10851fs	TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Frame_Shift_Del_p.EEEEEY11168fs|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342992.6_Frame_Shift_Del_p.EEEEEY9924fs|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin	0	Glu-rich.|Pro-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCATGAATGTACTCTTCTTCTTCTTCTACAAGATAT	0.417																																					p.11168_11173del		Atlas-INDEL	.											.	TTN	18412	.	0			c.33503_33518del						.																																			SO:0001589	frameshift_variant	7273	exon140			.	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.32551_32566delGAAGAAGAAGAAGAGT	chr2.hg19:g.179544684_179544699delACTCTTCTTCTTCTTC	ENSP00000465570:p.Glu10851fs	130.0	0.0		80.0	22.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Frame_Shift_Del	DEL	ENST00000591111.1	hg19																																																																																				.	.		0.417	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
GTF2B	2959	hgsc.bcm.edu	37	1	89318944	89318944	+	Frame_Shift_Del	DEL	A	A	-			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr1:89318944delA	ENST00000370500.5	-	7	1021	c.903delT	c.(901-903)cctfs	p.P301fs		NM_001514.5	NP_001505.1	Q00403	TF2B_HUMAN	general transcription factor IIB	301					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	nucleoplasm (GO:0005654)	core promoter binding (GO:0001047)|thyroid hormone receptor binding (GO:0046966)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	10		Lung NSC(277;0.123)		all cancers(265;0.0131)|Epithelial(280;0.0255)		TGAAGTCTGTAGGAAACAGAT	0.393																																					p.T302fs		Atlas-Indel,Pindel	.											.	GTF2B	32	.	0			c.904delA						.						170.0	172.0	171.0					1																	89318944		2203	4300	6503	SO:0001589	frameshift_variant	2959	exon7			.	M76766	CCDS715.1	1p22-p21	2010-03-23			ENSG00000137947	ENSG00000137947		"""General transcription factors"""	4648	protein-coding gene	gene with protein product		189963				1876184, 8162052	Standard	NM_001514		Approved	TFIIB	uc001dmo.4	Q00403	OTTHUMG00000010611	ENST00000370500.5:c.903delT	chr1.hg19:g.89318944delA	ENSP00000359531:p.Pro301fs	73.0	0.0		40.0	12.0	NM_001514	A8K1A7|Q5JS30	Frame_Shift_Del	DEL	ENST00000370500.5	hg19	CCDS715.1																																																																																			.	.		0.393	GTF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029279.1	NM_001514	
FBXO42	54455	hgsc.bcm.edu	37	1	16577608	16577609	+	Frame_Shift_Ins	INS	-	-	C			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr1:16577608_16577609insC	ENST00000375592.3	-	10	1926_1927	c.1710_1711insG	c.(1708-1713)ggccccfs	p.P571fs		NM_018994.1	NP_061867.1	Q6P3S6	FBX42_HUMAN	F-box protein 42	571										autonomic_ganglia(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	26		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00475)|all_lung(284;0.00671)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0193)|Colorectal(212;3.16e-07)|COAD - Colon adenocarcinoma(227;1.46e-05)|BRCA - Breast invasive adenocarcinoma(304;4.37e-05)|Kidney(64;0.000246)|KIRC - Kidney renal clear cell carcinoma(64;0.00336)|STAD - Stomach adenocarcinoma(313;0.0139)|READ - Rectum adenocarcinoma(331;0.0693)		GAGGCCGAGGGGCCTTTGGAGG	0.629																																					p.P571fs		Atlas-Indel,Pindel	.											.	FBXO42	53	.	0			c.1711_1712insG						.																																			SO:0001589	frameshift_variant	54455	exon10			.	BC063864	CCDS30613.1	1p36.23-p36.11	2008-02-05			ENSG00000037637	ENSG00000037637		"""F-boxes /  ""other"""""	29249	protein-coding gene	gene with protein product		609109				10718198	Standard	XM_006710698		Approved	KIAA1332, Fbx42	uc001ayg.3	Q6P3S6	OTTHUMG00000002218	ENST00000375592.3:c.1710_1711insG	chr1.hg19:g.16577608_16577609insC	ENSP00000364742:p.Pro571fs	91.0	0.0		31.0	23.0	NM_018994	B3KP30|Q5TEU8|Q86XI0|Q8N3N4|Q8N5F8|Q9BRM0|Q9P2L4	Frame_Shift_Ins	INS	ENST00000375592.3	hg19	CCDS30613.1																																																																																			.	.		0.629	FBXO42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006285.1		
ATG16L1	55054	hgsc.bcm.edu	37	2	234198547	234198548	+	Frame_Shift_Ins	INS	-	-	C			TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr2:234198547_234198548insC	ENST00000392017.4	+	13	1508_1509	c.1251_1252insC	c.(1252-1254)ctgfs	p.L418fs	SCARNA6_ENST00000515982.1_RNA|ATG16L1_ENST00000347464.5_Frame_Shift_Ins_p.L255fs|ATG16L1_ENST00000392020.4_Frame_Shift_Ins_p.L399fs|ATG16L1_ENST00000373525.5_Frame_Shift_Ins_p.L239fs|ATG16L1_ENST00000392018.1_Frame_Shift_Ins_p.L435fs	NM_001190266.1|NM_001190267.1|NM_030803.6	NP_001177195.1|NP_001177196.1|NP_110430.5	Q676U5	A16L1_HUMAN	autophagy related 16-like 1 (S. cerevisiae)	418					autophagic vacuole assembly (GO:0000045)|negative stranded viral RNA replication (GO:0039689)|protein homooligomerization (GO:0051260)|protein transport (GO:0015031)	autophagic vacuole (GO:0005776)|autophagic vacuole membrane (GO:0000421)|axoneme (GO:0005930)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(7)|prostate(3)|skin(1)	25		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0539)		Epithelial(121;1.53e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000379)|LUSC - Lung squamous cell carcinoma(224;0.00619)|Lung(119;0.00732)|GBM - Glioblastoma multiforme(43;0.11)		CTAAGTTCCTGCTGGACAATGC	0.554																																					p.L417fs		Pindel	.											.	ATG16L1	83	.	0			c.1251_1252insC						.																																			SO:0001589	frameshift_variant	55054	exon13			.	AK000897	CCDS2502.2, CCDS2503.2, CCDS54438.1	2q37.1	2014-02-12	2012-06-06	2005-09-13	ENSG00000085978	ENSG00000085978		"""WD repeat domain containing"""	21498	protein-coding gene	gene with protein product		610767	"""APG16 autophagy 16-like (S. cerevisiae)"", ""ATG16 autophagy related 16-like (S. cerevisiae)"", ""ATG16 autophagy related 16-like 1 (S. cerevisiae)"""	APG16L, ATG16L			Standard	NM_017974		Approved	WDR30, FLJ10035, ATG16A	uc002vty.3	Q676U5	OTTHUMG00000133619	ENST00000392017.4:c.1252dupC	chr2.hg19:g.234198548_234198548dupC	ENSP00000375872:p.Leu418fs	87.0	0.0		76.0	30.0	NM_030803	A3EXK9|A3EXL0|B6ZDH0|Q6IPN1|Q6UXW4|Q6ZVZ5|Q8NCY2|Q96JV5|Q9H619	Frame_Shift_Ins	INS	ENST00000392017.4	hg19	CCDS2503.2																																																																																			.	.		0.554	ATG16L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257069.2	NM_017974	
TTN	7273	hgsc.bcm.edu	37	2	179544684	179544702	+	Frame_Shift_Del	DEL	ACTCTTCTTCTTCTTCTAC	ACTCTTCTTCTTCTTCTAC	-	rs551754978|rs368327166	byFrequency	TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	ACTCTTCTTCTTCTTCTAC	ACTCTTCTTCTTCTTCTAC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr2:179544684_179544702delACTCTTCTTCTTCTTCTAC	ENST00000591111.1	-	138	32772_32790	c.32548_32566delGTAGAAGAAGAAGAAGAGT	c.(32548-32568)gtagaagaagaagaagagtacfs	p.VEEEEEY10850fs	TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Frame_Shift_Del_p.VEEEEEY11167fs|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342992.6_Frame_Shift_Del_p.VEEEEEY9923fs|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin	0	Glu-rich.|Pro-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCATGAATGTACTCTTCTTCTTCTTCTACAAGATATTCT	0.411																																					p.11167_11173del		Pindel	.											.	TTN	18412	.	0			c.33500_33518del						.																																			SO:0001589	frameshift_variant	7273	exon140			.	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.32548_32566delGTAGAAGAAGAAGAAGAGT	chr2.hg19:g.179544684_179544702delACTCTTCTTCTTCTTCTAC	ENSP00000465570:p.Val10850fs	140.0	0.0		88.0	23.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Frame_Shift_Del	DEL	ENST00000591111.1	hg19																																																																																				.	.		0.411	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
RERGL	79785	hgsc.bcm.edu	37	12	18241889	18242060	+	Splice_Site	DEL	GGCTGCAAAGCAAACAATCTAGATTTAGGGCTGTTATATTTTAGGAAACAGCTAATTTGGTTATGTGCATAAGGCTTTAGTTCTTAAACCAAAAATATTCAAGAATTAATAAAGACTTTAAAATTAGACCAAATTCTGTTCTAAATAGTAGTTAACAATATTTCCATGGTAC	GGCTGCAAAGCAAACAATCTAGATTTAGGGCTGTTATATTTTAGGAAACAGCTAATTTGGTTATGTGCATAAGGCTTTAGTTCTTAAACCAAAAATATTCAAGAATTAATAAAGACTTTAAAATTAGACCAAATTCTGTTCTAAATAGTAGTTAACAATATTTCCATGGTAC	-	rs376792404|rs542021705|rs545855054|rs370962289|rs576765194|rs562457289|rs531466257	byFrequency	TCGA-RC-A7S9-01A-11D-A33Q-10	TCGA-RC-A7S9-10A-02D-A33Q-10	GGCTGCAAAGCAAACAATCTAGATTTAGGGCTGTTATATTTTAGGAAACAGCTAATTTGGTTATGTGCATAAGGCTTTAGTTCTTAAACCAAAAATATTCAAGAATTAATAAAGACTTTAAAATTAGACCAAATTCTGTTCTAAATAGTAGTTAACAATATTTCCATGGTAC	GGCTGCAAAGCAAACAATCTAGATTTAGGGCTGTTATATTTTAGGAAACAGCTAATTTGGTTATGTGCATAAGGCTTTAGTTCTTAAACCAAAAATATTCAAGAATTAATAAAGACTTTAAAATTAGACCAAATTCTGTTCTAAATAGTAGTTAACAATATTTCCATGGTAC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	51aa8270-daf2-45af-b4a7-b80b053bada3	0a31c7e6-f1af-4ff5-8011-67d8e91a85d6	g.chr12:18241889_18242060delGGCTGCAAAGCAAACAATCTAGATTTAGGGCTGTTATATTTTAGGAAACAGCTAATTTGGTTATGTGCATAAGGCTTTAGTTCTTAAACCAAAAATATTCAAGAATTAATAAAGACTTTAAAATTAGACCAAATTCTGTTCTAAATAGTAGTTAACAATATTTCCATGGTAC	ENST00000229002.2	-	3	262_263	c.56_57delGTACCATGGAAATATTGTTAACTACTATTTAGAACAGAATTTGGTCTAATTTTAAAGTCTTTATTAATTCTTGAATATTTTTGGTTTAAGAACTAAAGCCTTATGCACATAACCAAATTAGCTGTTTCCTAAAATATAACAGCCCTAAATCTAGATTGTTTGCTTTGCAGCC	c.(55-57)ggt>g	p.G19fs	RERGL_ENST00000536890.1_Splice_Site_p.G18fs|RERGL_ENST00000538724.1_Splice_Site_p.G18fs|RERGL_ENST00000541632.1_5'UTR	NM_024730.2	NP_079006.1	Q9H628	RERGL_HUMAN	RERG/RAS-like	19	Small GTPase-like.				GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	GTP binding (GO:0005525)			endometrium(1)|large_intestine(5)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	17						TCACTGTAAGGGCTGCAAAGCAAACAATCTAGATTTAGGGCTGTTATATTTTAGGAAACAGCTAATTTGGTTATGTGCATAAGGCTTTAGTTCTTAAACCAAAAATATTCAAGAATTAATAAAGACTTTAAAATTAGACCAAATTCTGTTCTAAATAGTAGTTAACAATATTTCCATGGTACAAACAAATGA	0.304																																					p.19_20del		Pindel	.											.	RERGL	66	.	0			c.56_58del						.																																			SO:0001630	splice_region_variant	79785	exon3			.	AK026308	CCDS8679.1, CCDS66332.1	12p12.3	2014-08-12			ENSG00000111404	ENSG00000111404			26213	protein-coding gene	gene with protein product						24127187	Standard	NM_001286201		Approved	FLJ22655	uc001rdq.3	Q9H628	OTTHUMG00000168820	ENST00000229002.2:c.56-1GTACCATGGAAATATTGTTAACTACTATTTAGAACAGAATTTGGTCTAATTTTAAAGTCTTTATTAATTCTTGAATATTTTTGGTTTAAGAACTAAAGCCTTATGCACATAACCAAATTAGCTGTTTCCTAAAATATAACAGCCCTAAATCTAGATTGTTTGCTTTGCAGCC>-	chr12.hg19:g.18241889_18242060delGGCTGCAAAGCAAACAATCTAGATTTAGGGCTGTTATATTTTAGGAAACAGCTAATTTGGTTATGTGCATAAGGCTTTAGTTCTTAAACCAAAAATATTCAAGAATTAATAAAGACTTTAAAATTAGACCAAATTCTGTTCTAAATAGTAGTTAACAATATTTCCATGGTAC		95.0	0.0		57.0	12.0	NM_024730		In_Frame_Del	DEL	ENST00000229002.2	hg19	CCDS8679.1																																																																																			.	.		0.304	RERGL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000401198.1	NM_024730	Frame_Shift_Del
