#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
HIVEP3	59269	hgsc.bcm.edu	37	1	42041241	42041241	+	Silent	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr1:42041241C>T	ENST00000372583.1	-	5	6066	c.5181G>A	c.(5179-5181)ccG>ccA	p.P1727P	HIVEP3_ENST00000429157.2_Silent_p.P1727P|HIVEP3_ENST00000460604.1_5'UTR|HIVEP3_ENST00000372584.1_Silent_p.P1727P|HIVEP3_ENST00000247584.5_Silent_p.P1727P	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	1727					positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				TGATCCTCGCCGGCTCCCCTC	0.557																																					p.P1727P		Atlas-SNP	.											.	HIVEP3	235	.	0			c.G5181A						.						151.0	161.0	158.0					1																	42041241		2203	4300	6503	SO:0001819	synonymous_variant	59269	exon5			CCTCGCCGGCTCC	AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.5181G>A	chr1.hg19:g.42041241C>T		64.0	0.0		27.0	15.0	NM_024503	A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Silent	SNP	ENST00000372583.1	hg19	CCDS463.1																																																																																			.	.		0.557	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000016978.1	NM_024503	
DMRTA2	63950	hgsc.bcm.edu	37	1	50886867	50886867	+	Silent	SNP	C	C	G			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr1:50886867C>G	ENST00000404795.3	-	2	734	c.342G>C	c.(340-342)gcG>gcC	p.A114A	DMRTA2_ENST00000418121.1_Silent_p.A114A	NM_032110.2	NP_115486.1	Q96SC8	DMTA2_HUMAN	DMRT-like family A2	114					cerebral cortex regionalization (GO:0021796)|dopaminergic neuron differentiation (GO:0071542)|neuron fate specification (GO:0048665)|positive regulation of neuroblast proliferation (GO:0002052)|skeletal muscle cell differentiation (GO:0035914)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|lung(4)|pancreas(1)	6						GCCTGCGCAGCGCCACCTGCG	0.701																																					p.A114A	Colon(196;1651 2045 3292 36497 38236)|Esophageal Squamous(2;257 258 11567 27043 43804)	Atlas-SNP	.											.	DMRTA2	17	.	0			c.G342C						.						3.0	4.0	4.0					1																	50886867		1831	3584	5415	SO:0001819	synonymous_variant	63950	exon2			GCGCAGCGCCACC	AJ301580	CCDS44141.1	1p33	2008-08-04			ENSG00000142700	ENSG00000142700			13908	protein-coding gene	gene with protein product		614804				11863363	Standard	NM_032110		Approved		uc010onb.2	Q96SC8	OTTHUMG00000007884	ENST00000404795.3:c.342G>C	chr1.hg19:g.50886867C>G		31.0	0.0		30.0	14.0	NM_032110	Q5TFQ3	Silent	SNP	ENST00000404795.3	hg19	CCDS44141.1																																																																																			.	.		0.701	DMRTA2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351074.1	NM_032110	
DOCK7	85440	hgsc.bcm.edu	37	1	63001217	63001217	+	Silent	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr1:63001217C>T	ENST00000340370.5	-	28	3482	c.3465G>A	c.(3463-3465)ttG>ttA	p.L1155L	DOCK7_ENST00000251157.5_Silent_p.L1186L	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	1186					activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						CAAGTCCTGCCAAATAATGCT	0.388																																					p.L1186L		Atlas-SNP	.											.	DOCK7	184	.	0			c.G3558A						.						120.0	114.0	116.0					1																	63001217		2203	4300	6503	SO:0001819	synonymous_variant	85440	exon29			TCCTGCCAAATAA		CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.3465G>A	chr1.hg19:g.63001217C>T		126.0	0.0		120.0	54.0	NM_001271999	Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	Silent	SNP	ENST00000340370.5	hg19	CCDS30734.1	.	.	.	.	.	.	.	.	.	.	C	9.420	1.082775	0.20309	.	.	ENSG00000116641	ENST00000454575	.	.	.	5.05	4.14	0.48551	.	.	.	.	.	T	0.62502	0.2433	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61008	-0.7149	4	.	.	.	.	11.5973	0.50981	0.0:0.8512:0.0:0.1488	.	.	.	.	S	358	.	.	G	-	1	0	DOCK7	62773805	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.813000	0.55636	1.349000	0.45751	0.650000	0.86243	GGC	.	.		0.388	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036806.1	NM_033407	
CIART	148523	hgsc.bcm.edu	37	1	150255801	150255801	+	Missense_Mutation	SNP	C	C	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr1:150255801C>A	ENST00000290363.5	+	1	573	c.124C>A	c.(124-126)Cat>Aat	p.H42N	C1orf51_ENST00000369095.1_Missense_Mutation_p.H42N|C1orf51_ENST00000369094.1_Intron|C1orf51_ENST00000469255.1_3'UTR	NM_144697.2	NP_653298.1	Q8N365	CIART_HUMAN		42					circadian regulation of gene expression (GO:0032922)|locomotor rhythm (GO:0045475)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|E-box binding (GO:0070888)			endometrium(3)|large_intestine(2)|lung(3)|urinary_tract(2)	10	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			CAAGGGGGCCCATGGGCCCAG	0.592																																					p.H42N		Atlas-SNP	.											.	C1orf51	35	.	0			c.C124A						.						106.0	110.0	109.0					1																	150255801		2203	4300	6503	SO:0001583	missense	148523	exon1			GGGGCCCATGGGC																												ENST00000290363.5:c.124C>A	chr1.hg19:g.150255801C>A	ENSP00000290363:p.His42Asn	162.0	0.0		191.0	20.0	NM_144697	B2RD43|D3DV01|Q8N795|Q96MG6	Missense_Mutation	SNP	ENST00000290363.5	hg19	CCDS949.1	.	.	.	.	.	.	.	.	.	.	C	10.55	1.382243	0.24944	.	.	ENSG00000159208	ENST00000369095;ENST00000290363	.	.	.	4.57	0.571	0.17352	.	0.982616	0.08334	N	0.961898	T	0.13500	0.0327	L	0.47716	1.5	0.09310	N	1	B	0.29037	0.231	B	0.25405	0.06	T	0.30090	-0.9990	9	0.46703	T	0.11	2.389	3.3205	0.07048	0.1821:0.5235:0.0:0.2944	.	42	Q8N365	CA051_HUMAN	N	42	.	ENSP00000290363:H42N	H	+	1	0	C1orf51	148522425	0.000000	0.05858	0.000000	0.03702	0.893000	0.52053	0.316000	0.19469	-0.046000	0.13446	0.563000	0.77884	CAT	.	.		0.592	C1orf51-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035058.1		
SPTA1	6708	hgsc.bcm.edu	37	1	158637739	158637739	+	Silent	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr1:158637739C>T	ENST00000368147.4	-	15	2127	c.1947G>A	c.(1945-1947)gaG>gaA	p.E649E		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	649					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					AGTGACCACCCTCAATCATCT	0.468																																					p.E649E		Atlas-SNP	.											.	SPTA1	720	.	0			c.G1947A						.						150.0	144.0	146.0					1																	158637739		1871	4099	5970	SO:0001819	synonymous_variant	6708	exon15			ACCACCCTCAATC	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.1947G>A	chr1.hg19:g.158637739C>T		79.0	0.0		106.0	72.0	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Silent	SNP	ENST00000368147.4	hg19	CCDS41423.1																																																																																			.	.		0.468	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
COPA	1314	hgsc.bcm.edu	37	1	160264344	160264344	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr1:160264344G>A	ENST00000241704.7	-	25	2835	c.2606C>T	c.(2605-2607)gCt>gTt	p.A869V	COPA_ENST00000368069.3_Missense_Mutation_p.A878V	NM_001098398.1|NM_004371.3	NP_001091868.1|NP_004362.2	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha	869					COPI coating of Golgi vesicle (GO:0048205)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|pancreatic juice secretion (GO:0030157)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(2)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(2)	46	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CTTGCCAAGAGCATCATCCCC	0.478																																					p.A878V		Atlas-SNP	.											.	COPA	181	.	0			c.C2633T						.						171.0	157.0	162.0					1																	160264344		2203	4300	6503	SO:0001583	missense	1314	exon25			CCAAGAGCATCAT	U24105	CCDS1202.1, CCDS41424.1	1q23.2	2014-01-30			ENSG00000122218	ENSG00000122218		"""WD repeat domain containing"", ""Endogenous ligands"""	2230	protein-coding gene	gene with protein product	"""proxenin"", ""xenin"""	601924				8647451	Standard	NM_004371		Approved	HEP-COP	uc001fvv.4	P53621	OTTHUMG00000033111	ENST00000241704.7:c.2606C>T	chr1.hg19:g.160264344G>A	ENSP00000241704:p.Ala869Val	212.0	0.0		234.0	133.0	NM_001098398	Q5T201|Q8IXZ9	Missense_Mutation	SNP	ENST00000241704.7	hg19	CCDS1202.1	.	.	.	.	.	.	.	.	.	.	G	12.43	1.936846	0.34189	.	.	ENSG00000122218	ENST00000368069;ENST00000241704	T;T	0.41758	0.99;0.99	5.63	-0.861	0.10676	Coatomer, alpha subunit, C-terminal (1);	0.695420	0.14586	N	0.310560	T	0.05318	0.0141	N	0.04508	-0.205	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.001	T	0.42258	-0.9462	10	0.19590	T	0.45	0.528	6.2016	0.20579	0.4413:0.1238:0.4348:0.0	.	869;878	P53621;P53621-2	COPA_HUMAN;.	V	878;869	ENSP00000357048:A878V;ENSP00000241704:A869V	ENSP00000241704:A869V	A	-	2	0	COPA	158530968	0.002000	0.14202	0.627000	0.29227	0.991000	0.79684	0.333000	0.19768	-0.149000	0.11215	0.555000	0.69702	GCT	.	.		0.478	COPA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080638.1	NM_004371	
CR2	1380	hgsc.bcm.edu	37	1	207651318	207651318	+	Silent	SNP	T	T	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr1:207651318T>A	ENST00000367058.3	+	15	3003	c.2814T>A	c.(2812-2814)acT>acA	p.T938T	CR2_ENST00000367057.3_Silent_p.T997T|CR2_ENST00000458541.2_Silent_p.T911T|CR2_ENST00000367059.3_Silent_p.T876T	NM_001877.4	NP_001868.2	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus) receptor 2	938	Sushi 15. {ECO:0000255|PROSITE- ProRule:PRU00302}.				B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	complement binding (GO:0001848)|complement receptor activity (GO:0004875)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(3)|endometrium(4)|kidney(3)|large_intestine(12)|lung(26)|ovary(1)|pancreas(1)|prostate(1)|skin(12)|upper_aerodigestive_tract(3)|urinary_tract(1)	69						CTGTTGTAACTCTGGAGTGTG	0.493																																					p.T997T		Atlas-SNP	.											.	CR2	164	.	0			c.T2991A						.						125.0	113.0	117.0					1																	207651318		2203	4300	6503	SO:0001819	synonymous_variant	1380	exon16			TGTAACTCTGGAG	M26004	CCDS1478.1, CCDS31007.1	1q32	2014-09-17			ENSG00000117322	ENSG00000117322		"""CD molecules"", ""Complement system"""	2336	protein-coding gene	gene with protein product		120650					Standard	NM_001006658		Approved	CD21	uc001hfv.3	P20023	OTTHUMG00000036307	ENST00000367058.3:c.2814T>A	chr1.hg19:g.207651318T>A		196.0	0.0		163.0	40.0	NM_001006658	C9JHD2|Q13866|Q14212|Q53EL2|Q5BKT9|Q5SR46|Q5SR48	Silent	SNP	ENST00000367058.3	hg19	CCDS1478.1																																																																																			.	.		0.493	CR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000088274.1	NM_001877	
NCKAP5	344148	hgsc.bcm.edu	37	2	133554289	133554289	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr2:133554289C>T	ENST00000409261.1	-	12	1194	c.821G>A	c.(820-822)cGt>cAt	p.R274H	NCKAP5_ENST00000405974.3_Missense_Mutation_p.R274H|NCKAP5_ENST00000409213.1_Missense_Mutation_p.R274H|NCKAP5_ENST00000317721.6_Missense_Mutation_p.R274H	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	274										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						ATCCAAGAGACGTGAGTGAAG	0.403																																					p.R274H		Atlas-SNP	.											.	NCKAP5	322	.	0			c.G821A						.						62.0	59.0	60.0					2																	133554289		1851	4103	5954	SO:0001583	missense	344148	exon12			AAGAGACGTGAGT	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.821G>A	chr2.hg19:g.133554289C>T	ENSP00000387128:p.Arg274His	62.0	0.0		48.0	10.0	NM_207481	B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	hg19	CCDS46418.1	.	.	.	.	.	.	.	.	.	.	C	13.58	2.278775	0.40294	.	.	ENSG00000176771	ENST00000409261;ENST00000409213;ENST00000317721;ENST00000405974;ENST00000537661	T;T;T;T	0.51071	2.67;0.72;2.67;0.72	5.35	-0.767	0.11016	.	.	.	.	.	T	0.26955	0.0660	N	0.19112	0.55	0.09310	N	1	B;B	0.28667	0.017;0.219	B;B	0.22880	0.004;0.042	T	0.15321	-1.0441	9	0.59425	D	0.04	.	4.9132	0.13833	0.1321:0.5078:0.0:0.3601	.	274;274	O14513-2;O14513	.;NCKP5_HUMAN	H	274	ENSP00000387128:R274H;ENSP00000386952:R274H;ENSP00000380603:R274H;ENSP00000385692:R274H	ENSP00000380603:R274H	R	-	2	0	NCKAP5	133270759	0.994000	0.37717	0.023000	0.16930	0.875000	0.50365	1.593000	0.36686	-0.245000	0.09625	0.655000	0.94253	CGT	.	.		0.403	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481	
NCKAP5	344148	hgsc.bcm.edu	37	2	133721442	133721442	+	Splice_Site	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr2:133721442C>T	ENST00000409261.1	-	8	803	c.430G>A	c.(430-432)Gaa>Aaa	p.E144K	NCKAP5_ENST00000405974.3_Splice_Site_p.E144K|NCKAP5_ENST00000409213.1_Splice_Site_p.E144K|NCKAP5_ENST00000317721.6_Splice_Site_p.E144K	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	144										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						GACAGCTTTTCCTGAAGCAAG	0.418																																					p.E144K		Atlas-SNP	.											.	NCKAP5	322	.	0			c.G430A						.						136.0	130.0	132.0					2																	133721442		1859	4093	5952	SO:0001630	splice_region_variant	344148	exon8			GCTTTTCCTGAAG	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.430-1G>A	chr2.hg19:g.133721442C>T		64.0	0.0		50.0	32.0	NM_207481	B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	hg19	CCDS46418.1	.	.	.	.	.	.	.	.	.	.	C	19.18	3.777863	0.70107	.	.	ENSG00000176771	ENST00000409261;ENST00000409213;ENST00000317721;ENST00000405974;ENST00000537661;ENST00000542834	T;T;T;T	0.50813	2.71;0.73;2.71;0.73	5.0	5.0	0.66597	.	.	.	.	.	T	0.52108	0.1714	N	0.19112	0.55	0.32317	N	0.562927	B;P;D	0.67145	0.361;0.72;0.996	B;B;P	0.61874	0.308;0.423;0.895	T	0.61008	-0.7149	9	0.87932	D	0	.	15.4984	0.75677	0.0:1.0:0.0:0.0	.	119;144;144	O14513-3;O14513-2;O14513	.;.;NCKP5_HUMAN	K	144;144;144;144;144;119	ENSP00000387128:E144K;ENSP00000386952:E144K;ENSP00000380603:E144K;ENSP00000385692:E144K	ENSP00000380603:E144K	E	-	1	0	NCKAP5	133437912	1.000000	0.71417	0.993000	0.49108	0.621000	0.37620	4.934000	0.63491	2.765000	0.95021	0.650000	0.86243	GAA	.	.		0.418	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481	Missense_Mutation
CFLAR	8837	hgsc.bcm.edu	37	2	201994647	201994647	+	Missense_Mutation	SNP	T	T	C			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr2:201994647T>C	ENST00000309955.3	+	2	574	c.59T>C	c.(58-60)aTg>aCg	p.M20T	CFLAR_ENST00000342795.5_Missense_Mutation_p.M20T|CFLAR_ENST00000340870.5_Missense_Mutation_p.M20T|CFLAR_ENST00000355558.4_Missense_Mutation_p.M20T|CFLAR_ENST00000440180.1_Missense_Mutation_p.M20T|CFLAR_ENST00000341222.6_Missense_Mutation_p.M20T|CFLAR_ENST00000443227.1_Intron|CFLAR_ENST00000341582.6_Missense_Mutation_p.M20T|CFLAR_ENST00000395148.2_Missense_Mutation_p.M20T|CFLAR_ENST00000494258.1_5'Flank|CFLAR_ENST00000423241.2_Missense_Mutation_p.M20T|CFLAR_ENST00000457277.1_Missense_Mutation_p.M20T	NM_001202515.1|NM_003879.5	NP_001189444.1|NP_003870.4	O15519	CFLAR_HUMAN	CASP8 and FADD-like apoptosis regulator	20	DED 1. {ECO:0000255|PROSITE- ProRule:PRU00065}.|Interaction with FADD.|Interaction with caspase-8 propeptide.|Interaction with caspase-8.|Not proteolytically processed and involved in apoptosis inhibition.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of myoblast fusion (GO:1901740)|positive regulation of catalytic activity (GO:0043085)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of necroptotic process (GO:0060544)|regulation of satellite cell proliferation (GO:0014842)|skeletal muscle atrophy (GO:0014732)|skeletal muscle tissue development (GO:0007519)|skeletal muscle tissue regeneration (GO:0043403)|skeletal myofibril assembly (GO:0014866)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|ripoptosome (GO:0097342)	cysteine-type peptidase activity (GO:0008234)|death effector domain binding (GO:0035877)|enzyme activator activity (GO:0008047)|protease binding (GO:0002020)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|stomach(1)	13						GAGAAGGAGATGCTGCTCTTT	0.473																																					p.M20T	Pancreas(16;548 657 22190 32864 42338)	Atlas-SNP	.											.	CFLAR	37	.	0			c.T59C						.						206.0	198.0	201.0					2																	201994647		2203	4300	6503	SO:0001583	missense	8837	exon2			AGGAGATGCTGCT	AF005774	CCDS2337.1, CCDS46487.1, CCDS56157.1, CCDS56158.1, CCDS59436.1	2q33-q34	2014-01-30			ENSG00000003402	ENSG00000003402		"""Endogenous ligands"""	1876	protein-coding gene	gene with protein product		603599		CASP8AP1		9208847, 9217161	Standard	NM_003879		Approved	CASH, Casper, CLARP, FLAME, FLIP, I-FLICE, MRIT, c-FLIP	uc002uxb.4	O15519	OTTHUMG00000132819	ENST00000309955.3:c.59T>C	chr2.hg19:g.201994647T>C	ENSP00000312455:p.Met20Thr	122.0	0.0		121.0	73.0	NM_001202516	B4DJE0|B7Z9F9|O14673|O14674|O14675|O15137|O15138|O15356|O15510|O43618|O43619|O43620|O60458|O60459|Q53TS6|Q54AF1|Q96TE4|Q9UEW1	Missense_Mutation	SNP	ENST00000309955.3	hg19	CCDS2337.1	.	.	.	.	.	.	.	.	.	.	T	2.837	-0.241379	0.05906	.	.	ENSG00000003402	ENST00000309955;ENST00000341222;ENST00000355558;ENST00000340870;ENST00000341582;ENST00000342795;ENST00000395148;ENST00000441224;ENST00000433445;ENST00000423241;ENST00000425030;ENST00000417748;ENST00000440180;ENST00000457277	T;T;T;T;T;T;T;T;T	0.40756	3.86;1.02;1.02;3.74;4.14;1.04;3.86;1.02;3.74	5.72	-4.07	0.03975	DEATH-like (2);Death effector (3);	0.839620	0.11140	N	0.595376	T	0.21062	0.0507	N	0.17082	0.46	0.09310	N	1	B;B;B;B;B;B;B	0.14012	0.002;0.007;0.007;0.009;0.001;0.001;0.002	B;B;B;B;B;B;B	0.17098	0.01;0.007;0.007;0.012;0.006;0.006;0.017	T	0.33420	-0.9869	10	0.13108	T	0.6	-0.4969	9.532	0.39200	0.0:0.5189:0.1257:0.3553	.	20;20;20;20;20;20;20	C9JK38;O15519-11;O15519-8;O15519;O15519-12;O15519-2;E9PAP3	.;.;.;CFLAR_HUMAN;.;.;.	T	20	ENSP00000312455:M20T;ENSP00000339335:M20T;ENSP00000347757:M20T;ENSP00000339326:M20T;ENSP00000345807:M20T;ENSP00000342809:M20T;ENSP00000399420:M20T;ENSP00000406775:M20T;ENSP00000411535:M20T	ENSP00000312455:M20T	M	+	2	0	CFLAR	201702892	0.008000	0.16893	0.001000	0.08648	0.621000	0.37620	-0.035000	0.12205	-0.768000	0.04626	0.460000	0.39030	ATG	.	.		0.473	CFLAR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256276.3	NM_003879	
KCNE4	23704	hgsc.bcm.edu	37	2	223917618	223917618	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr2:223917618C>T	ENST00000281830.3	+	2	554	c.223C>T	c.(223-225)Cgt>Tgt	p.R75C	KCNE4_ENST00000488477.2_Intron|KCNE4_ENST00000604125.1_Missense_Mutation_p.R24C			Q8WWG9	KCNE4_HUMAN	potassium voltage-gated channel, Isk-related family, member 4	75						apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	voltage-gated potassium channel activity (GO:0005249)			large_intestine(2)|lung(5)|ovary(2)|skin(1)	10		Renal(207;0.0183)|Lung NSC(271;0.137)|all_lung(227;0.175)		Epithelial(121;4.48e-11)|all cancers(144;2.88e-08)|Lung(261;0.00688)|LUSC - Lung squamous cell carcinoma(224;0.008)		CCTGGAGTCCCGTGCGGCCGG	0.612																																					p.R75C		Atlas-SNP	.											.	KCNE4	21	.	0			c.C223T						.						50.0	47.0	48.0					2																	223917618		2203	4298	6501	SO:0001583	missense	23704	exon2			GAGTCCCGTGCGG	AY065987	CCDS2456.1, CCDS2456.2	2q36.1	2008-02-05			ENSG00000152049	ENSG00000152049		"""Potassium channels"""	6244	protein-coding gene	gene with protein product		607775				10219239, 12670483	Standard	NM_080671		Approved	MiRP3	uc002vnl.5	Q8WWG9	OTTHUMG00000133161	ENST00000281830.3:c.223C>T	chr2.hg19:g.223917618C>T	ENSP00000281830:p.Arg75Cys	46.0	0.0		41.0	32.0	NM_080671	B7Z275|Q53SM4|Q96CC4	Missense_Mutation	SNP	ENST00000281830.3	hg19		.	.	.	.	.	.	.	.	.	.	C	16.82	3.229551	0.58777	.	.	ENSG00000152049	ENST00000281830	.	.	.	6.17	6.17	0.99709	.	0.814657	0.11678	N	0.540137	T	0.36026	0.0952	N	0.14661	0.345	0.24173	N	0.99562	B	0.06786	0.001	B	0.06405	0.002	T	0.26950	-1.0088	9	0.66056	D	0.02	-3.963	14.9567	0.71120	0.0:0.9326:0.0:0.0674	.	24	Q8WWG9	KCNE4_HUMAN	C	24	.	ENSP00000281830:R24C	R	+	1	0	KCNE4	223625862	0.495000	0.26051	0.058000	0.19502	0.281000	0.26958	3.636000	0.54317	2.941000	0.99782	0.655000	0.94253	CGT	.	.		0.612	KCNE4-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000330997.2	NM_080671	
CUL3	8452	hgsc.bcm.edu	37	2	225367700	225367700	+	Silent	SNP	T	T	C	rs371616108		TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr2:225367700T>C	ENST00000264414.4	-	10	1805	c.1467A>G	c.(1465-1467)caA>caG	p.Q489Q	CUL3_ENST00000409777.1_Silent_p.Q465Q|CUL3_ENST00000344951.4_Silent_p.Q423Q|CUL3_ENST00000409096.1_Silent_p.Q465Q	NM_003590.4	NP_003581.1	Q13618	CUL3_HUMAN	cullin 3	489					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|COPII vesicle coating (GO:0048208)|cyclin catabolic process (GO:0008054)|embryonic cleavage (GO:0040016)|ER to Golgi vesicle-mediated transport (GO:0006888)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation (GO:0007369)|integrin-mediated signaling pathway (GO:0007229)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic metaphase plate congression (GO:0007080)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|stem cell division (GO:0017145)|stress fiber assembly (GO:0043149)|trophectodermal cellular morphogenesis (GO:0001831)|Wnt signaling pathway (GO:0016055)	Cul3-RING ubiquitin ligase complex (GO:0031463)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|nucleus (GO:0005634)|polar microtubule (GO:0005827)	POZ domain binding (GO:0031208)			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	46		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)		CCTGTAGATGTTGCCTGAATT	0.383																																					p.Q495Q		Atlas-SNP	.											.	CUL3	96	.	0			c.A1485G						.	T		1,4405	2.1+/-5.4	0,1,2202	298.0	276.0	283.0		1467	0.6	1.0	2		283	0,8600		0,0,4300	no	coding-synonymous	CUL3	NM_003590.3		0,1,6502	CC,CT,TT		0.0,0.0227,0.0077		489/769	225367700	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	8452	exon10			TAGATGTTGCCTG	U58089	CCDS2462.1, CCDS58751.1	2q36.2	2011-05-24			ENSG00000036257	ENSG00000036257			2553	protein-coding gene	gene with protein product		603136				8681378, 17192413	Standard	NM_003590		Approved		uc002vny.3	Q13618	OTTHUMG00000133167	ENST00000264414.4:c.1467A>G	chr2.hg19:g.225367700T>C		94.0	0.0		61.0	11.0	NM_001257198	A8K536|B8ZZC3|O75415|Q569L3|Q9UBI8|Q9UET7	Silent	SNP	ENST00000264414.4	hg19	CCDS2462.1																																																																																			.	.		0.383	CUL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256871.2		
CHL1	10752	hgsc.bcm.edu	37	3	443359	443359	+	Missense_Mutation	SNP	G	G	A	rs574347521		TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr3:443359G>A	ENST00000256509.2	+	27	4078	c.3436G>A	c.(3436-3438)Gat>Aat	p.D1146N	CHL1_ENST00000397491.2_Missense_Mutation_p.D1130N	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	0					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		GTCAGTAAAAGATGAAACCTT	0.303																																					p.D1146N		Atlas-SNP	.											.	CHL1	242	.	0			c.G3436A						.						90.0	94.0	93.0					3																	443359		2203	4300	6503	SO:0001583	missense	10752	exon27			GTAAAAGATGAAA	AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.3436G>A	chr3.hg19:g.443359G>A	ENSP00000256509:p.Asp1146Asn	85.0	0.0		57.0	16.0	NM_006614	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000256509.2	hg19	CCDS2556.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.993571	0.93167	.	.	ENSG00000134121	ENST00000256509;ENST00000397491	D;D	0.87887	-2.31;-2.31	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	D	0.93618	0.7962	M	0.77486	2.375	0.80722	D	1	D;D	0.89917	0.995;1.0	D;D	0.83275	0.958;0.996	D	0.94110	0.7370	10	0.66056	D	0.02	.	18.7377	0.91761	0.0:0.0:1.0:0.0	.	1130;1146	O00533;O00533-2	CHL1_HUMAN;.	N	1146;1130	ENSP00000256509:D1146N;ENSP00000380628:D1130N	ENSP00000256509:D1146N	D	+	1	0	CHL1	418359	1.000000	0.71417	0.963000	0.40424	0.941000	0.58515	8.702000	0.91338	2.417000	0.82017	0.585000	0.79938	GAT	.	.		0.303	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207155.2	NM_006614	
CASR	846	hgsc.bcm.edu	37	3	121981009	121981009	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr3:121981009G>A	ENST00000490131.1	+	4	1499	c.1127G>A	c.(1126-1128)gGt>gAt	p.G376D	CASR_ENST00000296154.5_Missense_Mutation_p.G376D|CASR_ENST00000498619.1_Missense_Mutation_p.G376D	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	376					anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	TTTCTGAGAGGTCACGAAGAA	0.498																																					p.G376D		Atlas-SNP	.											.	CASR	190	.	0			c.G1127A						.						95.0	88.0	90.0					3																	121981009		2203	4300	6503	SO:0001583	missense	846	exon4			TGAGAGGTCACGA	U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.1127G>A	chr3.hg19:g.121981009G>A	ENSP00000418685:p.Gly376Asp	139.0	0.0		104.0	47.0	NM_001178065	Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Missense_Mutation	SNP	ENST00000490131.1	hg19	CCDS3010.1	.	.	.	.	.	.	.	.	.	.	G	5.693	0.312334	0.10789	.	.	ENSG00000036828	ENST00000490131;ENST00000498619;ENST00000296154	D;D;D	0.89196	-2.48;-2.48;-2.48	5.93	1.63	0.23807	Extracellular ligand-binding receptor (1);	0.593444	0.17548	N	0.170270	T	0.69351	0.3101	N	0.03608	-0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.56721	-0.7932	10	0.24483	T	0.36	.	3.6669	0.08260	0.1474:0.2317:0.5025:0.1184	.	376;376	E7ENE0;P41180	.;CASR_HUMAN	D	376	ENSP00000418685:G376D;ENSP00000420194:G376D;ENSP00000296154:G376D	ENSP00000296154:G376D	G	+	2	0	CASR	123463699	0.973000	0.33851	0.343000	0.25615	0.316000	0.28119	1.549000	0.36212	0.747000	0.32809	0.655000	0.94253	GGT	.	.		0.498	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355761.1	NM_000388	
ATR	545	hgsc.bcm.edu	37	3	142232443	142232443	+	Missense_Mutation	SNP	C	C	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr3:142232443C>A	ENST00000350721.4	-	26	4662	c.4541G>T	c.(4540-4542)tGt>tTt	p.C1514F	ATR_ENST00000383101.3_Missense_Mutation_p.C1450F	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	1514					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						CATAATGCTACAGCAGGTGAA	0.363								Other conserved DNA damage response genes																													p.C1514F		Atlas-SNP	.											.	ATR	285	.	0			c.G4541T						.						106.0	95.0	98.0					3																	142232443		2203	4300	6503	SO:0001583	missense	545	exon26			ATGCTACAGCAGG	U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.4541G>T	chr3.hg19:g.142232443C>A	ENSP00000343741:p.Cys1514Phe	297.0	0.0		209.0	65.0	NM_001184	Q59HB2|Q7KYL3|Q93051|Q9BXK4	Missense_Mutation	SNP	ENST00000350721.4	hg19	CCDS3124.1	.	.	.	.	.	.	.	.	.	.	C	18.11	3.549679	0.65311	.	.	ENSG00000175054	ENST00000350721;ENST00000383101	T;T	0.20738	2.05;2.05	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.52386	0.1731	M	0.82323	2.585	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.57359	-0.7825	10	0.59425	D	0.04	-14.5197	18.9138	0.92496	0.0:1.0:0.0:0.0	.	1514	Q13535	ATR_HUMAN	F	1514;1450	ENSP00000343741:C1514F;ENSP00000372581:C1450F	ENSP00000343741:C1514F	C	-	2	0	ATR	143715133	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.818000	0.86416	2.472000	0.83506	0.491000	0.48974	TGT	.	.		0.363	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353995.2	NM_001184	
FRYL	285527	hgsc.bcm.edu	37	4	48512111	48512111	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr4:48512111C>T	ENST00000503238.1	-	56	8358	c.8359G>A	c.(8359-8361)Gat>Aat	p.D2787N	FRYL_ENST00000264319.7_Missense_Mutation_p.D183N|FRYL_ENST00000507873.2_Missense_Mutation_p.D183N|FRYL_ENST00000537810.1_Missense_Mutation_p.D2787N|FRYL_ENST00000358350.4_Missense_Mutation_p.D2787N			O94915	FRYL_HUMAN	FRY-like	2787					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)			p.D2787N(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						TTGTATGTATCCAGGTGTTCT	0.438																																					p.D2787N		Atlas-SNP	.											FRYL,NS,carcinoma,0,1	FRYL	242	.	1	Substitution - Missense(1)	lung(1)	c.G8359A						.						80.0	80.0	80.0					4																	48512111		1863	4113	5976	SO:0001583	missense	285527	exon59			ATGTATCCAGGTG	AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.8359G>A	chr4.hg19:g.48512111C>T	ENSP00000426064:p.Asp2787Asn	70.0	0.0		58.0	25.0	NM_015030	O95640|Q8WTZ5|Q9NT40	Missense_Mutation	SNP	ENST00000503238.1	hg19	CCDS43227.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.740223	0.89573	.	.	ENSG00000075539	ENST00000503238;ENST00000358350;ENST00000537810;ENST00000264319;ENST00000507873	T;T;T	0.30182	1.55;1.55;1.54	5.93	5.93	0.95920	.	0.000000	0.64402	U	0.000001	T	0.61800	0.2376	M	0.80028	2.48	0.80722	D	1	D;D;D	0.89917	0.997;0.999;1.0	D;D;D	0.91635	0.928;0.967;0.999	T	0.63800	-0.6555	10	0.87932	D	0	.	20.3397	0.98756	0.0:1.0:0.0:0.0	.	2787;2787;183	O94915;F5GX82;O94915-2	FRYL_HUMAN;.;.	N	2787;2787;2787;183;183	ENSP00000426064:D2787N;ENSP00000351113:D2787N;ENSP00000441114:D2787N	ENSP00000264319:D183N	D	-	1	0	FRYL	48206868	1.000000	0.71417	1.000000	0.80357	0.270000	0.26580	7.407000	0.80029	2.803000	0.96430	0.585000	0.79938	GAT	.	.		0.438	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369265.2		
TRIM60	166655	hgsc.bcm.edu	37	4	165962559	165962559	+	Silent	SNP	A	A	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr4:165962559A>T	ENST00000512596.1	+	3	1551	c.1335A>T	c.(1333-1335)acA>acT	p.T445T	TRIM60_ENST00000508504.1_Silent_p.T445T|TRIM60_ENST00000341062.5_Silent_p.T445T	NM_152620.2	NP_689833.1	Q495X7	TRI60_HUMAN	tripartite motif containing 60	445	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.			T -> I (in Ref. 2; AAI00986). {ECO:0000305}.		intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(3)|large_intestine(6)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	29	all_hematologic(180;0.221)	Prostate(90;0.0959)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.0844)		ATTGTTTCACAGAAGCCGTTT	0.348																																					p.T445T		Atlas-SNP	.											.	TRIM60	73	.	0			c.A1335T						.						63.0	68.0	66.0					4																	165962559		2202	4300	6502	SO:0001819	synonymous_variant	166655	exon4			TTTCACAGAAGCC	AK093201	CCDS3808.1	4q32.3	2013-01-09	2011-01-25	2004-11-17	ENSG00000176979	ENSG00000176979		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	21162	protein-coding gene	gene with protein product			"""ring finger protein 129"", ""tripartite motif-containing 60"""	RNF129, RNF33			Standard	NM_152620		Approved	FLJ35882	uc003iqy.1	Q495X7	OTTHUMG00000161262	ENST00000512596.1:c.1335A>T	chr4.hg19:g.165962559A>T		84.0	0.0		82.0	20.0	NM_001258025	Q8NA35	Silent	SNP	ENST00000512596.1	hg19	CCDS3808.1																																																																																			.	.		0.348	TRIM60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364325.1	NM_152620	
PDE8B	8622	hgsc.bcm.edu	37	5	76633096	76633096	+	Silent	SNP	G	G	C			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr5:76633096G>C	ENST00000264917.5	+	6	798	c.753G>C	c.(751-753)ctG>ctC	p.L251L	PDE8B_ENST00000340978.3_Silent_p.L251L|PDE8B_ENST00000342343.4_Silent_p.L231L|PDE8B_ENST00000333194.4_Silent_p.L251L|PDE8B_ENST00000346042.3_Silent_p.L251L	NM_003719.3	NP_003710.1	O95263	PDE8B_HUMAN	phosphodiesterase 8B	251					cAMP catabolic process (GO:0006198)|cyclic nucleotide metabolic process (GO:0009187)|negative regulation of insulin secretion (GO:0046676)|negative regulation of steroid hormone biosynthetic process (GO:0090032)|phosphorelay signal transduction system (GO:0000160)	cytosol (GO:0005829)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)		GMDS/PDE8B(2)	NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(10)|lung(15)|ovary(1)|prostate(2)|skin(3)	40		all_lung(232;0.00043)|Lung NSC(167;0.00114)|Ovarian(174;0.0107)|Prostate(461;0.0605)		OV - Ovarian serous cystadenocarcinoma(54;2.21e-49)|Epithelial(54;5.82e-43)|all cancers(79;4.06e-38)	Caffeine(DB00201)|Ketotifen(DB00920)	ATAATGAACTGATTCAAATAG	0.318																																					p.L251L		Atlas-SNP	.											.	PDE8B	103	.	0			c.G753C						.						66.0	66.0	66.0					5																	76633096		2203	4299	6502	SO:0001819	synonymous_variant	8622	exon6			TGAACTGATTCAA	AF079529	CCDS4037.1, CCDS34190.1, CCDS34191.1, CCDS34192.1, CCDS34193.1	5q14.1	2008-05-15			ENSG00000113231	ENSG00000113231	3.1.4.17	"""Phosphodiesterases"""	8794	protein-coding gene	gene with protein product		603390				9784418	Standard	NM_003719		Approved		uc003kfa.3	O95263	OTTHUMG00000102170	ENST00000264917.5:c.753G>C	chr5.hg19:g.76633096G>C		162.0	0.0		130.0	18.0	NM_001029852	Q5J7V7|Q86XK8|Q8IUJ7|Q8IUJ8|Q8IUJ9|Q8IUK0|Q8N3T2	Silent	SNP	ENST00000264917.5	hg19	CCDS4037.1																																																																																			.	.		0.318	PDE8B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000220015.3	NM_003719	
DMGDH	29958	hgsc.bcm.edu	37	5	78320120	78320120	+	Silent	SNP	G	G	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr5:78320120G>A	ENST00000255189.3	-	14	2252	c.2224C>T	c.(2224-2226)Ctg>Ttg	p.L742L	DMGDH_ENST00000540686.1_Silent_p.L362L|DMGDH_ENST00000380311.4_Silent_p.L541L	NM_013391.2	NP_037523.2	Q9UI17	M2GD_HUMAN	dimethylglycine dehydrogenase	742					amino-acid betaine catabolic process (GO:0006579)|choline metabolic process (GO:0019695)|glycine catabolic process (GO:0006546)|glycine metabolic process (GO:0006544)	mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|dimethylglycine dehydrogenase activity (GO:0047865)|electron carrier activity (GO:0009055)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(2)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	34		all_lung(232;0.000638)|Lung NSC(167;0.00173)|Ovarian(174;0.0262)|Prostate(461;0.192)		OV - Ovarian serous cystadenocarcinoma(54;6.52e-45)|Epithelial(54;5.96e-40)|all cancers(79;3.56e-35)		AAATATTCCAGTCCAGCTTCC	0.318																																					p.L742L		Atlas-SNP	.											.	DMGDH	88	.	0			c.C2224T						.						104.0	102.0	103.0					5																	78320120		2202	4297	6499	SO:0001819	synonymous_variant	29958	exon14			ATTCCAGTCCAGC	AF111858	CCDS4044.1	5q14.1	2008-02-05			ENSG00000132837	ENSG00000132837	1.5.99.2		24475	protein-coding gene	gene with protein product		605849				10767172, 11231903	Standard	NM_013391		Approved		uc003kfs.3	Q9UI17	OTTHUMG00000108159	ENST00000255189.3:c.2224C>T	chr5.hg19:g.78320120G>A		292.0	0.0		239.0	88.0	NM_013391	B2RBN0|B4E1J9	Silent	SNP	ENST00000255189.3	hg19	CCDS4044.1																																																																																			.	.		0.318	DMGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226963.3	NM_013391	
PCDHA3	56145	hgsc.bcm.edu	37	5	140181914	140181914	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr5:140181914G>A	ENST00000522353.2	+	1	1132	c.1132G>A	c.(1132-1134)Gac>Aac	p.D378N	PCDHA3_ENST00000532566.2_Missense_Mutation_p.D378N|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA2_ENST00000520672.2_Intron|PCDHA1_ENST00000394633.3_Intron	NM_018906.2	NP_061729.1	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3	378	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.D378N(2)		NS(1)|breast(1)|endometrium(16)|kidney(3)|large_intestine(19)|lung(36)|ovary(7)|prostate(8)|skin(3)|stomach(1)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTCCGACCGCGACTCAGGAGT	0.493																																					p.D378N		Atlas-SNP	.											PCDHA3_ENST00000522353,colon,carcinoma,0,2	PCDHA3	396	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1132A						.						122.0	116.0	118.0					5																	140181914		2203	4300	6503	SO:0001583	missense	56145	exon1			GACCGCGACTCAG	AF152481	CCDS54915.1	5q31	2010-11-26				ENSG00000255408		"""Cadherins / Protocadherins : Clustered"""	8669	other	complex locus constituent	"""KIAA0345-like 11"""	606309				10380929	Standard	NM_018906		Approved	PCDH-ALPHA3		Q9Y5H8		ENST00000522353.2:c.1132G>A	chr5.hg19:g.140181914G>A	ENSP00000429808:p.Asp378Asn	116.0	0.0		81.0	10.0	NM_031497	O75286	Missense_Mutation	SNP	ENST00000522353.2	hg19	CCDS54915.1	.	.	.	.	.	.	.	.	.	.	g	16.27	3.075079	0.55646	.	.	ENSG00000255408	ENST00000522353;ENST00000532566	T;T	0.74002	-0.8;-0.8	4.79	4.79	0.61399	Cadherin (4);Cadherin-like (1);	0.000000	0.43579	U	0.000559	D	0.92721	0.7686	H	0.99391	4.545	0.46874	D	0.999235	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96159	0.9114	10	0.87932	D	0	.	18.1862	0.89793	0.0:0.0:1.0:0.0	.	378;378	Q9Y5H8-2;Q9Y5H8	.;PCDA3_HUMAN	N	378	ENSP00000429808:D378N;ENSP00000434086:D378N	ENSP00000429808:D378N	D	+	1	0	PCDHA3	140162098	1.000000	0.71417	0.656000	0.29637	0.011000	0.07611	9.869000	0.99810	2.378000	0.81104	0.467000	0.42956	GAC	.	.		0.493	PCDHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372848.2	NM_018906	
ADAMTS2	9509	hgsc.bcm.edu	37	5	178562943	178562943	+	Silent	SNP	G	G	A	rs370799965		TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr5:178562943G>A	ENST00000251582.7	-	13	2153	c.2052C>T	c.(2050-2052)gaC>gaT	p.D684D		NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	684	Cys-rich.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.D684D(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		GGCTGAAGGCGTCCTTGTAGG	0.637																																					p.D684D		Atlas-SNP	.											ADAMTS2,colon,carcinoma,0,3	ADAMTS2	190	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2052T						.	G		1,4405	2.1+/-5.4	0,1,2202	86.0	78.0	80.0		2052	-1.9	1.0	5		80	0,8600		0,0,4300	no	coding-synonymous	ADAMTS2	NM_014244.4		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		684/1212	178562943	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	9509	exon13			GAAGGCGTCCTTG	AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.2052C>T	chr5.hg19:g.178562943G>A		108.0	1.0		94.0	47.0	NM_014244		Silent	SNP	ENST00000251582.7	hg19	CCDS4444.1																																																																																			.	.		0.637	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253507.1	NM_014244	
HIST1H1C	3006	hgsc.bcm.edu	37	6	26056402	26056402	+	Missense_Mutation	SNP	C	C	G			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr6:26056402C>G	ENST00000343677.2	-	1	297	c.255G>C	c.(253-255)aaG>aaC	p.K85N		NM_005319.3	NP_005310.1	P16403	H12_HUMAN	histone cluster 1, H1c	85	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(4)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	34						TCACCAGGCTCTTGAGACCAA	0.542																																					p.K85N		Atlas-SNP	.											HIST1H1C,right_upper_lobe,carcinoma,0,1	HIST1H1C	80	.	0			c.G255C						.						114.0	118.0	117.0					6																	26056402		2203	4300	6503	SO:0001583	missense	3006	exon1			CAGGCTCTTGAGA	X57129	CCDS4577.1	6p21.3	2012-10-02	2006-10-11	2003-02-21	ENSG00000187837	ENSG00000187837		"""Histones / Replication-dependent"""	4716	protein-coding gene	gene with protein product		142710	"""H1 histone family, member 2"", ""histone 1, H1c"""	H1F2		2759094, 12408966	Standard	NM_005319		Approved	H1.2, H1s-1, H1c	uc003nfw.3	P16403	OTTHUMG00000016140	ENST00000343677.2:c.255G>C	chr6.hg19:g.26056402C>G	ENSP00000339566:p.Lys85Asn	87.0	0.0		127.0	15.0	NM_005319	A8K4I2	Missense_Mutation	SNP	ENST00000343677.2	hg19	CCDS4577.1	.	.	.	.	.	.	.	.	.	.	C	14.92	2.680689	0.47886	.	.	ENSG00000187837	ENST00000343677	T	0.28255	1.62	5.63	2.93	0.34026	Histone H1/H5 (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.050070	0.85682	D	0.000000	T	0.50394	0.1613	M	0.91406	3.205	0.47214	D	0.999353	D	0.89917	1.0	D	0.87578	0.998	T	0.59941	-0.7359	10	0.87932	D	0	-6.336	10.4421	0.44472	0.0:0.7895:0.0:0.2105	.	85	P16403	H12_HUMAN	N	85	ENSP00000339566:K85N	ENSP00000339566:K85N	K	-	3	2	HIST1H1C	26164381	0.997000	0.39634	0.993000	0.49108	0.233000	0.25261	0.622000	0.24433	0.435000	0.26365	-0.136000	0.14681	AAG	.	.		0.542	HIST1H1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043372.1	NM_005319	
ZKSCAN3	80317	hgsc.bcm.edu	37	6	28333341	28333341	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr6:28333341G>A	ENST00000377255.3	+	7	1193	c.896G>A	c.(895-897)gGc>gAc	p.G299D	ZKSCAN3_ENST00000341464.5_Missense_Mutation_p.G151D|ZKSCAN3_ENST00000252211.2_Missense_Mutation_p.G299D	NM_001242894.1	NP_001229823.1	Q9BRR0	ZKSC3_HUMAN	zinc finger with KRAB and SCAN domains 3	299					autophagy (GO:0006914)|lysosome organization (GO:0007040)|negative regulation of autophagy (GO:0010507)|negative regulation of cellular senescence (GO:2000773)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(4)|large_intestine(3)|lung(8)|pancreas(1)|skin(2)|stomach(2)|urinary_tract(1)	21						GAACAGGAGGGCAGGCTACAA	0.507																																					p.G299D		Atlas-SNP	.											.	ZKSCAN3	50	.	0			c.G896A						.						96.0	89.0	92.0					6																	28333341		2203	4300	6503	SO:0001583	missense	80317	exon6			AGGAGGGCAGGCT	U71601	CCDS4650.1, CCDS56408.1	6p22.1	2013-01-09	2007-02-20	2007-02-20		ENSG00000189298		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13853	protein-coding gene	gene with protein product		612791	"""zinc finger protein 306"", ""zinc finger protein 309"""	ZNF306, ZNF309		10520746, 22531714	Standard	NM_024493		Approved	Zfp47, ZF47, ZSCAN35	uc003nle.4	Q9BRR0	OTTHUMG00000014521	ENST00000377255.3:c.896G>A	chr6.hg19:g.28333341G>A	ENSP00000366465:p.Gly299Asp	103.0	0.0		148.0	56.0	NM_024493	B2R8W2|B3KVC0|H7BXX1|Q5VXH3|Q92972|Q9H4T3	Missense_Mutation	SNP	ENST00000377255.3	hg19	CCDS4650.1	.	.	.	.	.	.	.	.	.	.	.	14.20	2.463493	0.43736	.	.	ENSG00000189298	ENST00000252211;ENST00000341464;ENST00000377255	T;T;T	0.06218	3.43;3.33;3.43	3.26	0.255	0.15561	.	.	.	.	.	T	0.01222	0.0040	N	0.12831	0.26	0.22081	N	0.999379	B	0.22541	0.071	B	0.23716	0.048	T	0.46952	-0.9154	9	0.56958	D	0.05	.	8.0074	0.30334	0.0975:0.4585:0.444:0.0	.	299	Q9BRR0	ZKSC3_HUMAN	D	299;151;299	ENSP00000252211:G299D;ENSP00000341883:G151D;ENSP00000366465:G299D	ENSP00000252211:G299D	G	+	2	0	ZKSCAN3	28441320	0.000000	0.05858	0.965000	0.40720	0.906000	0.53458	-0.682000	0.05185	-0.088000	0.12506	0.555000	0.69702	GGC	.	.		0.507	ZKSCAN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040189.3	NM_024493	
MOCS1	4337	hgsc.bcm.edu	37	6	39895145	39895145	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr6:39895145G>A	ENST00000340692.5	-	2	176	c.173C>T	c.(172-174)tCc>tTc	p.S58F	MOCS1_ENST00000373188.2_Missense_Mutation_p.S58F|MOCS1_ENST00000373175.4_Missense_Mutation_p.S29F|MOCS1_ENST00000425303.2_Missense_Mutation_p.S58F|MOCS1_ENST00000308559.7_Missense_Mutation_p.S58F|MOCS1_ENST00000373195.3_Intron|MOCS1_ENST00000432280.2_Missense_Mutation_p.S29F|MOCS1_ENST00000373186.4_Missense_Mutation_p.S58F			Q9NZB8	MOCS1_HUMAN	molybdenum cofactor synthesis 1	58	Molybdenum cofactor biosynthesis protein A.				Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|molybdopterin synthase complex (GO:0019008)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|cyclic pyranopterin monophosphate synthase activity (GO:0061597)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	21	Ovarian(28;0.0355)|Colorectal(47;0.196)					GAGGAAGGCGGAGAAGGGGGC	0.652																																					p.S58F	NSCLC(84;861 1413 23785 24908 42279)|Melanoma(182;611 2047 9114 11847 26639)	Atlas-SNP	.											.	MOCS1	87	.	0			c.C173T						.						30.0	31.0	31.0					6																	39895145		2203	4299	6502	SO:0001583	missense	4337	exon1			AAGGCGGAGAAGG	AJ224328	CCDS4846.1, CCDS43460.1	6p21.2	2012-05-08			ENSG00000124615	ENSG00000124615			7190	protein-coding gene	gene with protein product		603707				9731530, 10053004	Standard	NM_001075098		Approved	MOCOD	uc003opb.3	Q9NZB8	OTTHUMG00000014656	ENST00000340692.5:c.173C>T	chr6.hg19:g.39895145G>A	ENSP00000344794:p.Ser58Phe	56.0	0.0		49.0	20.0	NM_005943	B3KPT7|B4DTP1|O14940|O14941|O75710|Q5J7W0|Q5TCE1|Q5TCE2|Q5TCE6|Q5TCE9|Q5TCF0|Q5TCF1|Q8N418|Q9NZB7|Q9UEM1	Missense_Mutation	SNP	ENST00000340692.5	hg19		.	.	.	.	.	.	.	.	.	.	G	25.7	4.668156	0.88348	.	.	ENSG00000124615	ENST00000373186;ENST00000308559;ENST00000373175;ENST00000373188;ENST00000340692;ENST00000425303;ENST00000432280	T;T;T	0.34859	1.34;1.35;1.35	5.44	5.44	0.79542	Aldolase-type TIM barrel (1);	0.000000	0.85682	D	0.000000	T	0.36524	0.0970	N	0.19112	0.55	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.79784	0.993;0.976;0.987;0.986	T	0.10706	-1.0618	9	.	.	.	-23.7002	19.2062	0.93730	0.0:0.0:1.0:0.0	.	58;58;58;58	Q9NZB8-5;Q9NZB8;Q9NZB8-8;Q9NZB8-6	.;MOCS1_HUMAN;.;.	F	58;58;29;58;58;58;29	ENSP00000309843:S58F;ENSP00000344794:S58F;ENSP00000416478:S58F	.	S	-	2	0	MOCS1	40003123	1.000000	0.71417	0.969000	0.41365	0.632000	0.37999	8.594000	0.90836	2.703000	0.92315	0.591000	0.81541	TCC	.	.		0.652	MOCS1-005	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000040476.2	NM_005943	
TFAP2D	83741	hgsc.bcm.edu	37	6	50683121	50683121	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr6:50683121C>T	ENST00000008391.3	+	2	560	c.332C>T	c.(331-333)aCc>aTc	p.T111I		NM_172238.3	NP_758438.2			transcription factor AP-2 delta (activating enhancer binding protein 2 delta)											NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(26)|ovary(6)|pancreas(1)|prostate(5)|stomach(1)	60	Lung NSC(77;0.0334)					GGGGAGCCCACCGACTTTATT	0.632																																					p.T111I		Atlas-SNP	.											.	TFAP2D	144	.	0			c.C332T						.						106.0	98.0	100.0					6																	50683121		2203	4300	6503	SO:0001583	missense	83741	exon2			AGCCCACCGACTT	AY028376	CCDS4933.1	6p12.3	2008-02-05	2004-10-26	2004-10-27		ENSG00000008197			15581	protein-coding gene	gene with protein product		610161	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)-like 1"""	TFAP2BL1		11733187	Standard	NM_172238		Approved		uc003paf.3	Q7Z6R9		ENST00000008391.3:c.332C>T	chr6.hg19:g.50683121C>T	ENSP00000008391:p.Thr111Ile	113.0	0.0		91.0	55.0	NM_172238		Missense_Mutation	SNP	ENST00000008391.3	hg19	CCDS4933.1	.	.	.	.	.	.	.	.	.	.	C	13.25	2.180237	0.38511	.	.	ENSG00000008197	ENST00000008391	D	0.97232	-4.3	5.21	5.21	0.72293	.	0.163968	0.56097	D	0.000039	D	0.88716	0.6512	N	0.08118	0	0.48135	D	0.99959	B	0.19583	0.037	B	0.17098	0.017	D	0.85264	0.1052	10	0.39692	T	0.17	-19.3103	15.4919	0.75611	0.0:0.8614:0.1386:0.0	.	111	Q7Z6R9	AP2D_HUMAN	I	111	ENSP00000008391:T111I	ENSP00000008391:T111I	T	+	2	0	TFAP2D	50791080	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.833000	0.69349	2.590000	0.87494	0.655000	0.94253	ACC	.	.		0.632	TFAP2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040881.1	NM_172238	
PDE10A	10846	hgsc.bcm.edu	37	6	165827145	165827145	+	Silent	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr6:165827145C>T	ENST00000366882.1	-	14	1246	c.1092G>A	c.(1090-1092)acG>acA	p.T364T	PDE10A_ENST00000354448.4_Silent_p.T364T|PDE10A_ENST00000539869.2_Silent_p.T374T			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A	364	GAF 2.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)			breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	GGATGTTCCGCGTGGTGTAGC	0.483																																					p.T374T	Esophageal Squamous(22;308 615 5753 12038 40624)	Atlas-SNP	.											.	PDE10A	154	.	0			c.G1122A						.						88.0	71.0	76.0					6																	165827145		2203	4300	6503	SO:0001819	synonymous_variant	10846	exon13			GTTCCGCGTGGTG	AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000366882.1:c.1092G>A	chr6.hg19:g.165827145C>T		125.0	0.0		90.0	57.0	NM_001130690	Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	Silent	SNP	ENST00000366882.1	hg19																																																																																				.	.		0.483	PDE10A-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000043031.1		
ABCB5	340273	hgsc.bcm.edu	37	7	20738174	20738174	+	Splice_Site	SNP	G	G	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr7:20738174G>A	ENST00000404938.2	+	17	2806		c.e17+1		ABCB5_ENST00000258738.6_Splice_Site	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5						antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						AATTATAACCGTAAGTAAAAT	0.368																																					.		Atlas-SNP	.											.	ABCB5	357	.	0			c.2154+1G>A						.						46.0	45.0	45.0					7																	20738174		2202	4299	6501	SO:0001630	splice_region_variant	340273	exon17			ATAACCGTAAGTA	U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.2154+1G>A	chr7.hg19:g.20738174G>A		81.0	0.0		65.0	16.0	NM_001163941	A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Splice_Site	SNP	ENST00000404938.2	hg19	CCDS55090.1	.	.	.	.	.	.	.	.	.	.	G	15.84	2.953200	0.53293	.	.	ENSG00000004846	ENST00000404938;ENST00000258738	.	.	.	5.35	5.35	0.76521	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5882	0.84745	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ABCB5	20704699	1.000000	0.71417	1.000000	0.80357	0.582000	0.36321	3.288000	0.51739	2.777000	0.95525	0.591000	0.81541	.	.	.		0.368	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000326736.2	NM_178559	Intron
TEX15	56154	hgsc.bcm.edu	37	8	30705184	30705184	+	Missense_Mutation	SNP	C	C	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr8:30705184C>A	ENST00000256246.2	-	1	1424	c.1350G>T	c.(1348-1350)agG>agT	p.R450S	TEX15_ENST00000523186.1_5'Flank	NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	450					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)					NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		GATCCTGACCCCTATCTTCAA	0.333																																					p.R450S		Atlas-SNP	.											.	TEX15	350	.	0			c.G1350T						.						178.0	176.0	177.0					8																	30705184		2203	4299	6502	SO:0001583	missense	56154	exon1			CTGACCCCTATCT	AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.1350G>T	chr8.hg19:g.30705184C>A	ENSP00000256246:p.Arg450Ser	101.0	0.0		64.0	47.0	NM_031271		Missense_Mutation	SNP	ENST00000256246.2	hg19	CCDS6080.1	.	.	.	.	.	.	.	.	.	.	C	11.52	1.664268	0.29604	.	.	ENSG00000133863	ENST00000256246	T	0.10192	2.9	5.51	-4.84	0.03151	.	1.145370	0.06457	N	0.728725	T	0.04272	0.0118	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.11329	0.006	T	0.42732	-0.9434	10	0.87932	D	0	.	0.5054	0.00587	0.3815:0.1853:0.2462:0.187	.	450	Q9BXT5	TEX15_HUMAN	S	450	ENSP00000256246:R450S	ENSP00000256246:R450S	R	-	3	2	TEX15	30824726	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.172000	0.09868	-0.498000	0.06632	-0.300000	0.09419	AGG	.	.		0.333	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376193.1		
TMEM246	84302	hgsc.bcm.edu	37	9	104238798	104238798	+	Missense_Mutation	SNP	A	A	C			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr9:104238798A>C	ENST00000374851.1	-	4	1724	c.577T>G	c.(577-579)Tat>Gat	p.Y193D	RP11-490D19.6_ENST00000424154.1_RNA|TMEM246_ENST00000374848.3_Missense_Mutation_p.Y193D|TMEM246_ENST00000374847.1_Missense_Mutation_p.Y193D|RP11-490D19.6_ENST00000450109.1_RNA|RP11-490D19.6_ENST00000431507.1_RNA|RP11-490D19.6_ENST00000425734.1_RNA			Q9BRR3	TM246_HUMAN	transmembrane protein 246	193						integral component of membrane (GO:0016021)											TCCAGGCAATAGACATAGTCC	0.502																																					p.Y193D		Atlas-SNP	.											.	.	.	.	0			c.T577G						.						100.0	80.0	87.0					9																	104238798		2203	4300	6503	SO:0001583	missense	84302	exon2			GGCAATAGACATA	BC006115	CCDS6757.1	9q31.1	2012-04-02	2012-04-02	2012-04-02	ENSG00000165152	ENSG00000165152			28180	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 125"""	C9orf125		12477932	Standard	NM_032342		Approved	MGC12992	uc004bbm.3	Q9BRR3	OTTHUMG00000020381	ENST00000374851.1:c.577T>G	chr9.hg19:g.104238798A>C	ENSP00000363984:p.Tyr193Asp	94.0	0.0		81.0	19.0	NM_032342	Q49AQ4	Missense_Mutation	SNP	ENST00000374851.1	hg19	CCDS6757.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.211481	0.79240	.	.	ENSG00000165152	ENST00000374848;ENST00000374847;ENST00000374851	.	.	.	5.95	5.95	0.96441	.	0.059762	0.64402	D	0.000002	T	0.62085	0.2399	L	0.43152	1.355	0.48452	D	0.999653	D	0.60160	0.987	P	0.52217	0.693	T	0.65849	-0.6068	9	0.87932	D	0	-11.3887	15.587	0.76491	1.0:0.0:0.0:0.0	.	193	Q9BRR3	CI125_HUMAN	D	193	.	ENSP00000363980:Y193D	Y	-	1	0	C9orf125	103278619	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.005000	0.93587	2.266000	0.75297	0.528000	0.53228	TAT	.	.		0.502	TMEM246-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053444.1	NM_032342	
LRIT1	26103	hgsc.bcm.edu	37	10	85994095	85994095	+	Missense_Mutation	SNP	T	T	C			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr10:85994095T>C	ENST00000372105.3	-	3	650	c.629A>G	c.(628-630)tAt>tGt	p.Y210C		NM_015613.2	NP_056428.1	Q9P2V4	LRIT1_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 1	210	LRRCT.					integral component of endoplasmic reticulum membrane (GO:0030176)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|skin(1)	23						AACCAGGTCATAGAGTCGGCA	0.537																																					p.Y210C		Atlas-SNP	.											.	LRIT1	73	.	0			c.A629G						.						84.0	86.0	85.0					10																	85994095		2203	4300	6503	SO:0001583	missense	26103	exon3			AGGTCATAGAGTC	AB031547	CCDS7373.1	10q23	2013-02-11	2007-06-19	2007-06-19	ENSG00000148602	ENSG00000148602		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	23404	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 9"""		"""leucine rich repeat containing 21"""	LRRC21		10777785	Standard	NM_015613		Approved	PAL, DKFZP434K091, FIGLER9	uc001kcz.1	Q9P2V4	OTTHUMG00000018632	ENST00000372105.3:c.629A>G	chr10.hg19:g.85994095T>C	ENSP00000361177:p.Tyr210Cys	163.0	0.0		168.0	46.0	NM_015613	Q0QD41|Q9Y4N7	Missense_Mutation	SNP	ENST00000372105.3	hg19	CCDS7373.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.983868	0.74474	.	.	ENSG00000148602	ENST00000372105	T	0.52754	0.65	5.91	5.91	0.95273	Cysteine-rich flanking region, C-terminal (1);	0.123192	0.56097	D	0.000022	T	0.62829	0.2460	M	0.69248	2.105	0.80722	D	1	D	0.69078	0.997	P	0.58928	0.848	T	0.63024	-0.6729	10	0.42905	T	0.14	.	15.3309	0.74208	0.0:0.0:0.0:1.0	.	210	Q9P2V4	LRIT1_HUMAN	C	210	ENSP00000361177:Y210C	ENSP00000361177:Y210C	Y	-	2	0	LRIT1	85984075	1.000000	0.71417	0.999000	0.59377	0.948000	0.59901	3.167000	0.50793	2.254000	0.74563	0.533000	0.62120	TAT	.	.		0.537	LRIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049109.1	NM_015613	
GLUD1	2746	hgsc.bcm.edu	37	10	88818994	88818994	+	Missense_Mutation	SNP	A	A	G			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr10:88818994A>G	ENST00000277865.4	-	10	1411	c.1315T>C	c.(1315-1317)Tac>Cac	p.Y439H	GLUD1_ENST00000544149.1_Missense_Mutation_p.Y306H|GLUD1_ENST00000537649.1_Missense_Mutation_p.Y272H|GLUD1_ENST00000465164.1_5'Flank	NM_005271.3	NP_005262.1	P00367	DHE3_HUMAN	glutamate dehydrogenase 1	439					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamine metabolic process (GO:0006541)|positive regulation of insulin secretion (GO:0032024)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)|tricarboxylic acid metabolic process (GO:0072350)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|identical protein binding (GO:0042802)|leucine binding (GO:0070728)|NAD+ binding (GO:0070403)			endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(11)|prostate(1)	22					Hexachlorophene(DB00756)	CACTCAAAGTAAGATACTGTC	0.373																																					p.Y439H		Atlas-SNP	.											.	GLUD1	30	.	0			c.T1315C						.						184.0	179.0	181.0					10																	88818994		2203	4299	6502	SO:0001583	missense	2746	exon10			CAAAGTAAGATAC	M20867	CCDS7382.1	10q23.2	2010-03-17			ENSG00000148672	ENSG00000148672	1.4.1.3		4335	protein-coding gene	gene with protein product		138130		GLUD		2757358	Standard	NM_005271		Approved	GDH	uc001keh.3	P00367	OTTHUMG00000018666	ENST00000277865.4:c.1315T>C	chr10.hg19:g.88818994A>G	ENSP00000277865:p.Tyr439His	165.0	0.0		141.0	15.0	NM_005271	B3KV55|B4DGN5|Q5TBU3	Missense_Mutation	SNP	ENST00000277865.4	hg19	CCDS7382.1	.	.	.	.	.	.	.	.	.	.	A	25.5	4.644235	0.87859	.	.	ENSG00000148672	ENST00000277865;ENST00000394415;ENST00000537649;ENST00000535802;ENST00000513510;ENST00000544149	D;D;D	0.96830	-4.14;-4.14;-4.14	5.66	5.66	0.87406	Glutamate/phenylalanine/leucine/valine dehydrogenase, C-terminal (2);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.98548	0.9515	M	0.92317	3.295	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.99719	1.1009	10	0.87932	D	0	-9.0102	16.3294	0.83004	1.0:0.0:0.0:0.0	.	306;439	B4DGN5;P00367	.;DHE3_HUMAN	H	439;396;272;138;371;306	ENSP00000277865:Y439H;ENSP00000439291:Y272H;ENSP00000444732:Y306H	ENSP00000277865:Y439H	Y	-	1	0	GLUD1	88808974	1.000000	0.71417	0.996000	0.52242	0.982000	0.71751	8.957000	0.93082	2.317000	0.78254	0.524000	0.50904	TAC	.	.		0.373	GLUD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049188.1	NM_005271	
SORCS3	22986	hgsc.bcm.edu	37	10	106976760	106976760	+	Missense_Mutation	SNP	T	T	G			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr10:106976760T>G	ENST00000369701.3	+	19	2841	c.2614T>G	c.(2614-2616)Ttc>Gtc	p.F872V	SORCS3_ENST00000369699.4_Missense_Mutation_p.F158V	NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	872	PKD. {ECO:0000255|PROSITE- ProRule:PRU00151}.				learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		CTACGCAAACTTCAGCCCCAT	0.512																																					p.F872V	NSCLC(116;1497 1690 7108 13108 14106)	Atlas-SNP	.											.	SORCS3	282	.	0			c.T2614G						.						164.0	124.0	137.0					10																	106976760		2203	4300	6503	SO:0001583	missense	22986	exon19			GCAAACTTCAGCC	AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.2614T>G	chr10.hg19:g.106976760T>G	ENSP00000358715:p.Phe872Val	82.0	0.0		104.0	19.0	NM_014978	Q5VXF9|Q9NQJ2	Missense_Mutation	SNP	ENST00000369701.3	hg19	CCDS7558.1	.	.	.	.	.	.	.	.	.	.	T	15.42	2.828444	0.50845	.	.	ENSG00000156395	ENST00000369701;ENST00000369699	T;T	0.60299	0.2;0.2	5.87	5.87	0.94306	PKD domain (4);	0.058143	0.64402	D	0.000001	T	0.44286	0.1286	N	0.19112	0.55	0.50039	D	0.999841	B	0.14012	0.009	B	0.20577	0.03	T	0.31779	-0.9931	9	.	.	.	.	16.5764	0.84681	0.0:0.0:0.0:1.0	.	872	Q9UPU3	SORC3_HUMAN	V	872;158	ENSP00000358715:F872V;ENSP00000358713:F158V	.	F	+	1	0	SORCS3	106966750	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	2.669000	0.46825	2.371000	0.80710	0.533000	0.62120	TTC	.	.		0.512	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050221.1	NM_014978	
SORCS1	114815	hgsc.bcm.edu	37	10	108412294	108412294	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr10:108412294G>A	ENST00000263054.6	-	18	2328	c.2321C>T	c.(2320-2322)tCc>tTc	p.S774F	SORCS1_ENST00000369698.1_Missense_Mutation_p.S309F|SORCS1_ENST00000344440.6_Missense_Mutation_p.S774F	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	774					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		GCAATTATTGGAAACCACCTT	0.468																																					p.S774F		Atlas-SNP	.											.	SORCS1	534	.	0			c.C2321T						.						112.0	106.0	108.0					10																	108412294		2203	4300	6503	SO:0001583	missense	114815	exon18			TTATTGGAAACCA	AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.2321C>T	chr10.hg19:g.108412294G>A	ENSP00000263054:p.Ser774Phe	84.0	0.0		100.0	49.0	NM_001206572	A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	ENST00000263054.6	hg19	CCDS7559.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.482881	0.84747	.	.	ENSG00000108018	ENST00000369698;ENST00000263054;ENST00000344440	T;T;T	0.67523	-0.27;-0.27;-0.27	5.74	5.74	0.90152	VPS10 (1);PKD domain (1);	0.000000	0.85682	D	0.000000	T	0.81735	0.4885	M	0.75777	2.31	0.45979	D	0.998792	D;D;D;D;D	0.58620	0.972;0.983;0.983;0.972;0.983	P;D;D;P;D	0.65684	0.825;0.937;0.915;0.866;0.937	T	0.80571	-0.1323	9	.	.	.	-16.8758	19.9145	0.97053	0.0:0.0:1.0:0.0	.	774;774;774;774;774	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2	.;.;.;SORC1_HUMAN;.	F	309;774;774	ENSP00000358712:S309F;ENSP00000263054:S774F;ENSP00000345964:S774F	.	S	-	2	0	SORCS1	108402284	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.448000	0.80631	2.709000	0.92574	0.655000	0.94253	TCC	.	.		0.468	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	NM_052918	
ADAM12	8038	hgsc.bcm.edu	37	10	127797193	127797193	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr10:127797193C>T	ENST00000368679.4	-	8	1028	c.719G>A	c.(718-720)cGa>cAa	p.R240Q	ADAM12_ENST00000368676.4_Missense_Mutation_p.R240Q	NM_003474.4	NP_003465.3	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12	240	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cell adhesion (GO:0007155)|epidermal growth factor receptor signaling pathway (GO:0007173)|myoblast fusion (GO:0007520)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(7)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		CTCTATTAATCGCTGCTTAAC	0.353																																					p.R240Q		Atlas-SNP	.											ADAM12_ENST00000368679,NS,carcinoma,0,3	ADAM12	388	.	0			c.G719A						.						194.0	172.0	179.0					10																	127797193		2203	4300	6503	SO:0001583	missense	8038	exon8			ATTAATCGCTGCT	AF023476	CCDS7653.1, CCDS7654.1	10q26	2008-07-29	2008-07-29		ENSG00000148848	ENSG00000148848		"""ADAM metallopeptidase domain containing"""	190	protein-coding gene	gene with protein product	"""meltrin alpha"""	602714	"""a disintegrin and metalloproteinase domain 12 (meltrin alpha)"""			9417060, 18342566	Standard	NM_003474		Approved	MCMPMltna, MLTN	uc001ljk.2	O43184	OTTHUMG00000019243	ENST00000368679.4:c.719G>A	chr10.hg19:g.127797193C>T	ENSP00000357668:p.Arg240Gln	122.0	0.0		112.0	12.0	NM_021641	O60470|Q5JRP0|Q5JRP1|Q6P9E3|Q6UWB0	Missense_Mutation	SNP	ENST00000368679.4	hg19	CCDS7653.1	.	.	.	.	.	.	.	.	.	.	C	35	5.544275	0.96488	.	.	ENSG00000148848	ENST00000368679;ENST00000368676;ENST00000448723	D;D;T	0.87256	-2.23;-2.23;-0.14	5.17	5.17	0.71159	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.64402	D	0.000001	D	0.95239	0.8456	M	0.92077	3.27	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.998;0.998;0.998;1.0	D	0.95922	0.8931	10	0.72032	D	0.01	.	18.8656	0.92290	0.0:1.0:0.0:0.0	.	237;240;237;240	O43184-3;O43184-2;O43184-4;O43184	.;.;.;ADA12_HUMAN	Q	240;240;237	ENSP00000357668:R240Q;ENSP00000357665:R240Q;ENSP00000391268:R237Q	ENSP00000357665:R240Q	R	-	2	0	ADAM12	127787183	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.651000	0.83577	2.678000	0.91216	0.655000	0.94253	CGA	.	.		0.353	ADAM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050961.1		
ZBED5	58486	hgsc.bcm.edu	37	11	10874768	10874768	+	Silent	SNP	T	T	C			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr11:10874768T>C	ENST00000432999.2	-	3	2223	c.1725A>G	c.(1723-1725)agA>agG	p.R575R	ZBED5_ENST00000525350.1_Intron|ZBED5_ENST00000413761.2_Silent_p.R575R	NM_001143667.1|NM_021211.3	NP_001137139.1|NP_067034.2	Q49AG3	ZBED5_HUMAN	zinc finger, BED-type containing 5	575							DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)	4						taaatggatttctaacccaag	0.373																																					p.R575R		Atlas-SNP	.											.	ZBED5	50	.	0			c.A1725G						.						57.0	51.0	53.0					11																	10874768		692	1591	2283	SO:0001819	synonymous_variant	58486	exon3			TGGATTTCTAACC	AF205601		11p15.3	2013-05-03			ENSG00000236287	ENSG00000236287		"""Zinc fingers, BED-type"""	30803	protein-coding gene	gene with protein product		615251				10607616, 23533661	Standard	NM_021211		Approved	Buster1	uc009ygh.3	Q49AG3	OTTHUMG00000150341	ENST00000432999.2:c.1725A>G	chr11.hg19:g.10874768T>C		87.0	0.0		41.0	14.0	NM_021211	B2RCC1|Q05D82|Q86WW3|Q9NT24|Q9UBJ4	Silent	SNP	ENST00000432999.2	hg19																																																																																				.	.		0.373	ZBED5-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000317691.1	NM_021211	
BDNF	627	hgsc.bcm.edu	37	11	27679589	27679589	+	Missense_Mutation	SNP	C	C	G			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr11:27679589C>G	ENST00000525528.1	-	1	1616	c.523G>C	c.(523-525)Ggc>Cgc	p.G175R	BDNF-AS_ENST00000502161.2_RNA|BDNF-AS_ENST00000499008.3_RNA|BDNF-AS_ENST00000532965.1_RNA|BDNF_ENST00000439476.2_Missense_Mutation_p.G175R|BDNF_ENST00000395983.3_Missense_Mutation_p.G175R|BDNF_ENST00000533131.1_Missense_Mutation_p.G175R|BDNF-AS_ENST00000501176.2_RNA|BDNF_ENST00000532997.1_Missense_Mutation_p.G175R|BDNF_ENST00000356660.4_Missense_Mutation_p.G175R|BDNF_ENST00000525950.1_Missense_Mutation_p.G175R|BDNF_ENST00000533246.1_Missense_Mutation_p.G175R|BDNF-AS_ENST00000500662.2_RNA|BDNF_ENST00000314915.6_Missense_Mutation_p.G183R|BDNF-AS_ENST00000530313.1_RNA|BDNF_ENST00000395981.3_Missense_Mutation_p.G175R|BDNF_ENST00000395986.2_Missense_Mutation_p.G190R|BDNF_ENST00000418212.1_Missense_Mutation_p.G175R|BDNF_ENST00000584049.1_5'UTR|BDNF-AS_ENST00000499568.2_RNA|BDNF_ENST00000395980.2_Missense_Mutation_p.G175R|BDNF_ENST00000420794.1_Missense_Mutation_p.G175R|BDNF_ENST00000395978.3_Missense_Mutation_p.G175R|BDNF_ENST00000438929.1_Missense_Mutation_p.G257R|BDNF_ENST00000530861.1_Missense_Mutation_p.G175R|BDNF-AS_ENST00000530686.1_RNA	NM_170735.5	NP_733931.1	P23560	BDNF_HUMAN	brain-derived neurotrophic factor	175					axon extension (GO:0048675)|axon guidance (GO:0007411)|axon target recognition (GO:0007412)|behavioral fear response (GO:0001662)|chronic inflammatory response (GO:0002544)|circadian rhythm (GO:0007623)|dendrite development (GO:0016358)|dendrite extension (GO:0097484)|feeding behavior (GO:0007631)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glutamate secretion (GO:0014047)|inner ear development (GO:0048839)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neuron recognition (GO:0008038)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of synapse assembly (GO:0051965)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of retinal cell programmed cell death (GO:0046668)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|response to anesthetic (GO:0072347)|response to fluoxetine (GO:0014076)|response to hormone (GO:0009725)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to vitamin A (GO:0033189)|taste bud development (GO:0061193)|ureteric bud development (GO:0001657)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	growth factor activity (GO:0008083)			breast(1)|large_intestine(3)|lung(2)	6						TTCAGTTGGCCTTTTGATACA	0.498																																					p.G257R		Atlas-SNP	.											.	BDNF	63	.	0			c.G769C						.						216.0	212.0	213.0					11																	27679589		2202	4299	6501	SO:0001583	missense	627	exon3			GTTGGCCTTTTGA	AB038670	CCDS7865.1, CCDS7866.1, CCDS44558.1, CCDS41628.1	11p14.1	2014-01-30			ENSG00000176697	ENSG00000176697		"""Endogenous ligands"""	1033	protein-coding gene	gene with protein product	"""neurotrophin"""	113505				2236018, 1889806, 17942328, 17493809	Standard	NM_170731		Approved		uc009yje.3	P23560	OTTHUMG00000178797	ENST00000525528.1:c.523G>C	chr11.hg19:g.27679589C>G	ENSP00000437138:p.Gly175Arg	95.0	0.0		63.0	18.0	NM_001143810	A7LA85|A7LA92|D3DQZ2|Q598Q1|Q6DN19|Q6YNR2|Q6YNR3|Q9BYY7|Q9UC24	Missense_Mutation	SNP	ENST00000525528.1	hg19	CCDS7866.1	.	.	.	.	.	.	.	.	.	.	C	15.83	2.948306	0.53186	.	.	ENSG00000176697	ENST00000439476;ENST00000525528;ENST00000395986;ENST00000533131;ENST00000356660;ENST00000418212;ENST00000533246;ENST00000530861;ENST00000395983;ENST00000438929;ENST00000395980;ENST00000532997;ENST00000395981;ENST00000395978;ENST00000525950;ENST00000314915;ENST00000420794	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.67345	-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26	6.08	6.08	0.98989	Nerve growth factor-related (4);	0.000000	0.85682	D	0.000000	T	0.82213	0.4988	M	0.65498	2.005	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.991;1.0	D;D;D;P;D	0.97110	1.0;0.992;0.998;0.698;0.998	T	0.82043	-0.0653	10	0.87932	D	0	-11.5486	20.6721	0.99693	0.0:1.0:0.0:0.0	.	204;257;183;175;190	P23560-5;P23560-4;P23560-2;P23560;P23560-3	.;.;.;BDNF_HUMAN;.	R	175;175;190;175;175;175;175;175;175;257;175;175;175;175;175;183;175	ENSP00000389345:G175R;ENSP00000437138:G175R;ENSP00000379309:G190R;ENSP00000432727:G175R;ENSP00000349084:G175R;ENSP00000400502:G175R;ENSP00000432376:G175R;ENSP00000435564:G175R;ENSP00000379307:G175R;ENSP00000414303:G257R;ENSP00000379304:G175R;ENSP00000435805:G175R;ENSP00000379305:G175R;ENSP00000379302:G175R;ENSP00000432035:G175R;ENSP00000320002:G183R;ENSP00000389564:G175R	ENSP00000320002:G183R	G	-	1	0	BDNF	27636165	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.818000	0.86416	2.894000	0.99253	0.591000	0.81541	GGC	.	.		0.498	BDNF-016	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388135.1	NM_170735	
MRPL21	219927	hgsc.bcm.edu	37	11	68658837	68658837	+	Silent	SNP	G	G	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr11:68658837G>T	ENST00000362034.2	-	7	589	c.580C>A	c.(580-582)Cgg>Agg	p.R194R	MRPL21_ENST00000450904.2_Silent_p.R109R	NM_181514.1|NM_181515.1	NP_852615.1|NP_852616.1	Q7Z2W9	RM21_HUMAN	mitochondrial ribosomal protein L21	194					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			large_intestine(1)|lung(6)|prostate(1)	8			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			CTGTTTATCCGGAGGACAGTC	0.473																																					p.R194R		Atlas-SNP	.											.	MRPL21	13	.	0			c.C580A						.						198.0	195.0	196.0					11																	68658837		2200	4294	6494	SO:0001819	synonymous_variant	219927	exon7			TTATCCGGAGGAC	AK096756	CCDS8186.1, CCDS44662.1	11q13.3	2012-09-13			ENSG00000197345	ENSG00000197345		"""Mitochondrial ribosomal proteins / large subunits"""	14479	protein-coding gene	gene with protein product		611834				11551941	Standard	NM_181514		Approved		uc001ooi.3	Q7Z2W9	OTTHUMG00000167893	ENST00000362034.2:c.580C>A	chr11.hg19:g.68658837G>T		88.0	0.0		47.0	12.0	NM_181514	A6NKU0|C9JPR2	Silent	SNP	ENST00000362034.2	hg19	CCDS8186.1																																																																																			.	.		0.473	MRPL21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396856.1	NM_181512	
GRAMD1B	57476	hgsc.bcm.edu	37	11	123474218	123474218	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr11:123474218G>A	ENST00000529750.1	+	8	1033	c.706G>A	c.(706-708)Gtg>Atg	p.V236M	GRAMD1B_ENST00000456860.2_Missense_Mutation_p.V243M|GRAMD1B_ENST00000322282.7_Missense_Mutation_p.V236M	NM_020716.1	NP_065767.1	Q3KR37	GRM1B_HUMAN	GRAM domain containing 1B	236						integral component of membrane (GO:0016021)|membrane (GO:0016020)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.32e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0394)		CGAGGACTACGTGCCCCCTGA	0.597																																					p.V236M		Atlas-SNP	.											.	GRAMD1B	122	.	0			c.G706A						.						84.0	79.0	80.0					11																	123474218		2004	4179	6183	SO:0001583	missense	57476	exon8			GACTACGTGCCCC	AB033027	CCDS53720.1, CCDS66253.1, CCDS66254.1	11q24.1	2005-11-02				ENSG00000023171			29214	protein-coding gene	gene with protein product						10574462	Standard	NM_001286564		Approved	KIAA1201	uc001pyx.2	Q3KR37		ENST00000529750.1:c.706G>A	chr11.hg19:g.123474218G>A	ENSP00000436500:p.Val236Met	101.0	0.0		59.0	11.0	NM_020716	Q6UW85|Q9ULL9	Missense_Mutation	SNP	ENST00000529750.1	hg19	CCDS53720.1	.	.	.	.	.	.	.	.	.	.	G	31	5.078155	0.94000	.	.	ENSG00000023171	ENST00000539133;ENST00000456860;ENST00000322282;ENST00000529750;ENST00000529432;ENST00000534764	T;T;T;T;T	0.36699	1.63;1.65;1.65;1.67;1.24	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.58250	0.2109	M	0.65498	2.005	0.80722	D	1	D;D;D;D	0.71674	0.998;0.998;0.997;0.997	P;D;P;P	0.67231	0.892;0.95;0.743;0.836	T	0.55140	-0.8187	10	0.35671	T	0.21	.	18.8312	0.92141	0.0:0.0:1.0:0.0	.	196;243;236;243	B7Z4N9;F5H572;Q3KR37;E7EPH8	.;.;GRM1B_HUMAN;.	M	243;243;236;236;196;232	ENSP00000402457:V243M;ENSP00000325628:V236M;ENSP00000436500:V236M;ENSP00000432987:V196M;ENSP00000434214:V232M	ENSP00000325628:V236M	V	+	1	0	GRAMD1B	122979428	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.617000	0.98361	2.436000	0.82500	0.491000	0.48974	GTG	.	.		0.597	GRAMD1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387404.2	XM_370660	
JAM3	83700	hgsc.bcm.edu	37	11	134014848	134014848	+	Missense_Mutation	SNP	C	C	T	rs549604639		TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr11:134014848C>T	ENST00000299106.4	+	5	730	c.571C>T	c.(571-573)Cgc>Tgc	p.R191C	JAM3_ENST00000529443.2_Missense_Mutation_p.R236C|JAM3_ENST00000441717.3_Missense_Mutation_p.R140C|JAM3_ENST00000524969.1_3'UTR			Q9BX67	JAM3_HUMAN	junctional adhesion molecule 3	191	Ig-like C2-type.				adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|establishment of cell polarity (GO:0030010)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|myelination (GO:0042552)|myeloid progenitor cell differentiation (GO:0002318)|neutrophil homeostasis (GO:0001780)|regulation of actin cytoskeleton organization by cell-cell adhesion (GO:0090138)|regulation of neutrophil chemotaxis (GO:0090022)|spermatid development (GO:0007286)|transmission of nerve impulse (GO:0019226)	cell-cell contact zone (GO:0044291)|desmosome (GO:0030057)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|paranodal junction (GO:0033010)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	integrin binding (GO:0005178)	p.R236C(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)	10	all_hematologic(175;0.127)	all_cancers(12;1.06e-21)|all_epithelial(12;3.37e-16)|all_lung(97;7.03e-06)|Lung NSC(97;1.67e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0506)|Esophageal squamous(93;0.0566)		Epithelial(10;1.55e-09)|BRCA - Breast invasive adenocarcinoma(10;1.35e-08)|all cancers(11;2.81e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00402)|Lung(977;0.245)		TCCCAGATTTCGCAATTCTTC	0.502																																					p.R191C		Atlas-SNP	.											JAM3,NS,carcinoma,-1,1	JAM3	41	.	1	Substitution - Missense(1)	endometrium(1)	c.C571T						.						128.0	108.0	115.0					11																	134014848		2201	4297	6498	SO:0001583	missense	83700	exon5			AGATTTCGCAATT	AF356518	CCDS8494.1, CCDS55799.1, CCDS8494.2	11q25	2013-01-29			ENSG00000166086	ENSG00000166086		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15532	protein-coding gene	gene with protein product		606871					Standard	NM_032801		Approved	JAM-C, JAMC	uc001qhb.3	Q9BX67	OTTHUMG00000167130	ENST00000299106.4:c.571C>T	chr11.hg19:g.134014848C>T	ENSP00000299106:p.Arg191Cys	200.0	0.0		71.0	22.0	NM_032801	B3KWG9|Q8WWL8|Q96FL1	Missense_Mutation	SNP	ENST00000299106.4	hg19	CCDS8494.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.41|12.41	1.929059|1.929059	0.34002|0.34002	.|.	.|.	ENSG00000166086|ENSG00000166086	ENST00000299106;ENST00000441717;ENST00000532165|ENST00000529443	T|T	0.63580|0.70045	-0.05|-0.45	5.06|5.06	4.16|4.16	0.48862|0.48862	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);|.	0.799060|.	0.11759|.	N|.	0.532275|.	T|T	0.58481|0.58481	0.2125|0.2125	N|N	0.24115|0.24115	0.695|0.695	0.34201|0.34201	D|D	0.673119|0.673119	D;D|.	0.65815|.	0.995;0.995|.	P;P|.	0.54706|.	0.759;0.759|.	T|T	0.65059|0.65059	-0.6260|-0.6260	10|6	0.37606|.	T|.	0.19|.	.|.	13.4923|13.4923	0.61402|0.61402	0.0:0.9249:0.0:0.075|0.0:0.9249:0.0:0.075	.|.	140;191|.	B3KWG9;Q9BX67|.	.;JAM3_HUMAN|.	C|L	236;140;37|144	ENSP00000395742:R140C|ENSP00000431883:S144L	ENSP00000299106:R236C|.	R|S	+|+	1|2	0|0	JAM3|JAM3	133520058|133520058	0.014000|0.014000	0.17966|0.17966	0.853000|0.853000	0.33588|0.33588	0.074000|0.074000	0.17049|0.17049	0.586000|0.586000	0.23894|0.23894	1.155000|1.155000	0.42497|0.42497	-0.142000|-0.142000	0.14014|0.14014	CGC|TCG	.	.		0.502	JAM3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000393303.4	NM_032801	
ACAN	176	hgsc.bcm.edu	37	15	89401573	89401573	+	Silent	SNP	G	G	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr15:89401573G>A	ENST00000561243.1	+	11	5757	c.5757G>A	c.(5755-5757)tcG>tcA	p.S1919S	ACAN_ENST00000559004.1_Silent_p.S1919S|ACAN_ENST00000439576.2_Silent_p.S1919S|ACAN_ENST00000352105.7_Silent_p.S1919S			P16112	PGCA_HUMAN	aggrecan	1909	CS-2.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			GCCTGCCCTCGGGAGCATATT	0.527																																					p.S1919S		Atlas-SNP	.											.	ACAN	220	.	0			c.G5757A						.						67.0	71.0	70.0					15																	89401573		1975	4154	6129	SO:0001819	synonymous_variant	176	exon12			GCCCTCGGGAGCA	M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.5757G>A	chr15.hg19:g.89401573G>A		90.0	0.0		123.0	64.0	NM_001135	Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Silent	SNP	ENST00000561243.1	hg19	CCDS53970.1																																																																																			.	.		0.527	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416267.2	NM_001135	
NOL3	8996	hgsc.bcm.edu	37	16	67209000	67209000	+	Silent	SNP	G	G	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr16:67209000G>A	ENST00000568146.1	+	4	713	c.660G>A	c.(658-660)taG>taA	p.*220*	NOL3_ENST00000268605.7_3'UTR|NOL3_ENST00000564053.1_3'UTR|NOL3_ENST00000432069.2_3'UTR|KIAA0895L_ENST00000563831.2_5'Flank			O60936	NOL3_HUMAN	nucleolar protein 3 (apoptosis repressor with CARD domain)	0					apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of gene expression (GO:0010468)|response to hypoxia (GO:0001666)|response to injury involved in regulation of muscle adaptation (GO:0014876)|RNA splicing (GO:0008380)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|sarcoplasm (GO:0016528)	identical protein binding (GO:0042802)|RNA binding (GO:0003723)			ovary(1)	1		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.0335)|all cancers(182;0.184)		ATGCTGGATAGGACCTGGGAT	0.612																																					p.X220X		Atlas-SNP	.											.	NOL3	6	.	0			c.G660A						.						88.0	90.0	89.0					16																	67209000		2018	4190	6208	SO:0001819	synonymous_variant	8996	exon4			TGGATAGGACCTG	AF043244	CCDS42176.1, CCDS58473.1, CCDS61960.1	16q22.1	2008-08-27				ENSG00000140939			7869	protein-coding gene	gene with protein product		605235				9560245	Standard	NM_001276312		Approved	ARC, NOP30, MYP, CARD2	uc010vjd.3	O60936		ENST00000568146.1:c.660G>A	chr16.hg19:g.67209000G>A		56.0	0.0		41.0	25.0	NM_001185057	B4DFL0|O60937	Silent	SNP	ENST00000568146.1	hg19	CCDS58473.1																																																																																			.	.		0.612	NOL3-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000422746.1		
MBTPS1	8720	hgsc.bcm.edu	37	16	84118638	84118638	+	Silent	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr16:84118638C>T	ENST00000343411.3	-	10	1731	c.1236G>A	c.(1234-1236)ggG>ggA	p.G412G	MBTPS1_ENST00000569770.1_5'UTR	NM_003791.2	NP_003782.1	Q14703	MBTP1_HUMAN	membrane-bound transcription factor peptidase, site 1	412	Peptidase S8.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cholesterol metabolic process (GO:0008203)|endoplasmic reticulum unfolded protein response (GO:0030968)|lipid metabolic process (GO:0006629)|lysosome organization (GO:0007040)|proteolysis (GO:0006508)|regulation of transcription factor import into nucleus (GO:0042990)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(10)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						CAACACTGGTCCCTGAGAGGG	0.602											OREG0023982	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G412G		Atlas-SNP	.											.	MBTPS1	85	.	0			c.G1236A						.						89.0	75.0	80.0					16																	84118638		2200	4300	6500	SO:0001819	synonymous_variant	8720	exon10			ACTGGTCCCTGAG	D42053	CCDS10941.1	16q24	2008-08-04	2005-08-17		ENSG00000140943	ENSG00000140943			15456	protein-coding gene	gene with protein product		603355	"""membrane-bound transcription factor protease, site 1"""			9809072, 10944850	Standard	NM_003791		Approved	S1P, KIAA0091, SKI-1, PCSK8	uc002fhi.3	Q14703	OTTHUMG00000137639	ENST00000343411.3:c.1236G>A	chr16.hg19:g.84118638C>T		206.0	0.0	1226	153.0	39.0	NM_003791	A8K6V8|Q24JQ2|Q9UF67	Silent	SNP	ENST00000343411.3	hg19	CCDS10941.1																																																																																			.	.		0.602	MBTPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269080.2	NM_003791	
PIEZO1	9780	hgsc.bcm.edu	37	16	88781068	88781068	+	IGR	SNP	G	G	C			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr16:88781068G>C	ENST00000301015.9	-	0	8072				CTU2_ENST00000312060.5_Missense_Mutation_p.E425D|CTU2_ENST00000453996.2_Missense_Mutation_p.E425D|CTU2_ENST00000567949.1_Missense_Mutation_p.E496D|CTU2_ENST00000378384.3_Missense_Mutation_p.E338D|MIR4722_ENST00000578292.1_RNA	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1						cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						CCCTGACTGAGACCCGGACAC	0.692																																					p.E425D		Atlas-SNP	.											.	CTU2	66	.	0			c.G1275C						.						32.0	34.0	34.0					16																	88781068		2188	4292	6480	SO:0001628	intergenic_variant	348180	exon12			GACTGAGACCCGG	D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776		chr16.hg19:g.88781068G>C		132.0	0.0		79.0	47.0	NM_001012759	A6NHT9|A7E2B7|Q0KKZ9	Missense_Mutation	SNP	ENST00000301015.9	hg19	CCDS54058.1	.	.	.	.	.	.	.	.	.	.	G	9.722	1.159838	0.21454	.	.	ENSG00000174177	ENST00000378384;ENST00000312060;ENST00000453996	T;T;T	0.17854	2.25;2.52;2.52	4.21	3.22	0.36961	.	1.163850	0.06508	U	0.737540	T	0.13628	0.0330	L	0.43152	1.355	0.09310	N	1	P;P;P	0.38922	0.589;0.589;0.651	B;B;B	0.33392	0.163;0.163;0.115	T	0.10428	-1.0630	10	0.15952	T	0.53	.	8.4764	0.33016	0.1195:0.0:0.8805:0.0	.	338;425;425	Q2VPK5-3;Q2VPK5-5;Q2VPK5	.;.;CTU2_HUMAN	D	338;425;425	ENSP00000367635:E338D;ENSP00000308617:E425D;ENSP00000388320:E425D	ENSP00000308617:E425D	E	+	3	2	CTU2	87308569	0.004000	0.15560	0.006000	0.13384	0.012000	0.07955	0.121000	0.15667	2.053000	0.61076	0.462000	0.41574	GAG	.	.		0.692	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000345699.4	NM_014745	
ELAC2	60528	hgsc.bcm.edu	37	17	12905669	12905669	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr17:12905669C>T	ENST00000338034.4	-	14	1465	c.1226G>A	c.(1225-1227)gGc>gAc	p.G409D	ELAC2_ENST00000395962.2_Missense_Mutation_p.G390D|ELAC2_ENST00000609345.1_5'Flank|ELAC2_ENST00000426905.3_Missense_Mutation_p.G369D	NM_018127.6|NM_173717.1	NP_060597.4|NP_776065.1	Q9BQ52	RNZ2_HUMAN	elaC ribonuclease Z 2	409					mitochondrial tRNA 3'-trailer cleavage, endonucleolytic (GO:0072684)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|skin(1)	23						GAGGGTGGGGCCCTCCTTCTG	0.562																																					p.G409D		Atlas-SNP	.											.	ELAC2	48	.	0			c.G1226A						.						77.0	75.0	76.0					17																	12905669		2203	4300	6503	SO:0001583	missense	60528	exon14			GTGGGGCCCTCCT	AF304370	CCDS11164.1, CCDS54093.1	17p11.2	2013-05-24	2013-05-24		ENSG00000006744	ENSG00000006744	3.1.26.11		14198	protein-coding gene	gene with protein product	"""tRNase Z (long form)"""	605367	"""elaC (E. coli) homolog 2"", ""elaC homolog 2 (E. coli)"""			10986046, 16636667, 21559454	Standard	NM_018127		Approved	FLJ10530, HPC2	uc010vvr.2	Q9BQ52	OTTHUMG00000058764	ENST00000338034.4:c.1226G>A	chr17.hg19:g.12905669C>T	ENSP00000337445:p.Gly409Asp	78.0	0.0		91.0	50.0	NM_018127	B4DPL9|Q6IA94|Q9HAS8|Q9HAS9|Q9NVT1	Missense_Mutation	SNP	ENST00000338034.4	hg19	CCDS11164.1	.	.	.	.	.	.	.	.	.	.	C	9.658	1.143353	0.21205	.	.	ENSG00000006744	ENST00000426905;ENST00000338034;ENST00000395962;ENST00000457438	T;T;T	0.63580	0.37;-0.05;-0.04	5.67	-3.94	0.04130	.	1.051740	0.07264	N	0.867941	T	0.44477	0.1295	L	0.48642	1.525	0.09310	N	1	B;B;B;B;B;B;B;B	0.23249	0.032;0.0;0.031;0.01;0.018;0.031;0.006;0.082	B;B;B;B;B;B;B;B	0.25140	0.013;0.002;0.047;0.017;0.021;0.013;0.014;0.058	T	0.30534	-0.9975	10	0.12430	T	0.62	-1.9754	1.6937	0.02857	0.3552:0.3366:0.095:0.2132	.	369;392;390;207;409;169;394;37	B4DPL9;E9PGJ0;G5E9D5;E7ES68;Q9BQ52;B3KSU9;B4DT15;Q9BQ52-3	.;.;.;.;RNZ2_HUMAN;.;.;.	D	369;409;390;87	ENSP00000405223:G369D;ENSP00000337445:G409D;ENSP00000379291:G390D	ENSP00000337445:G409D	G	-	2	0	ELAC2	12846394	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.194000	0.09559	-0.409000	0.07553	-0.224000	0.12420	GGC	.	.		0.562	ELAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129934.5		
DRG2	1819	hgsc.bcm.edu	37	17	18003031	18003031	+	Missense_Mutation	SNP	T	T	C			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr17:18003031T>C	ENST00000225729.3	+	5	599	c.461T>C	c.(460-462)gTg>gCg	p.V154A	DRG2_ENST00000583355.1_Intron|DRG2_ENST00000395726.4_Missense_Mutation_p.V154A	NM_001388.4	NP_001379.1	P55039	DRG2_HUMAN	developmentally regulated GTP binding protein 2	154	OBG-type G. {ECO:0000255|PROSITE- ProRule:PRU01047}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	14	all_neural(463;0.228)					AAGGGAGAGGTGCAGAGGTCC	0.637																																					p.V154A		Atlas-SNP	.											.	DRG2	27	.	0			c.T461C						.						45.0	35.0	38.0					17																	18003031		2201	4300	6501	SO:0001583	missense	1819	exon5			GAGAGGTGCAGAG	X80754	CCDS11191.1	17p13-p12	2008-07-18	2001-11-28		ENSG00000108591	ENSG00000108591			3030	protein-coding gene	gene with protein product		602986	"""developmentally regulated GTP-binding protein 2"""			9605870, 7929244	Standard	NM_001388		Approved		uc002gsh.2	P55039	OTTHUMG00000059399	ENST00000225729.3:c.461T>C	chr17.hg19:g.18003031T>C	ENSP00000225729:p.Val154Ala	101.0	0.0		153.0	65.0	NM_001388	B2R8G5|Q53Y50|Q9BWB2	Missense_Mutation	SNP	ENST00000225729.3	hg19	CCDS11191.1	.	.	.	.	.	.	.	.	.	.	T	27.8	4.859704	0.91433	.	.	ENSG00000108591	ENST00000395726;ENST00000225729	T;T	0.16196	2.36;2.36	5.6	5.6	0.85130	Small GTP-binding protein domain (1);GTP-binding domain, HSR1-related (1);	0.053371	0.64402	D	0.000001	T	0.09818	0.0241	N	0.02286	-0.61	0.80722	D	1	P;P	0.50066	0.931;0.879	P;P	0.48063	0.565;0.478	T	0.36720	-0.9736	10	0.09338	T	0.73	-11.3592	15.7656	0.78123	0.0:0.0:0.0:1.0	.	154;154	A8MZF9;P55039	.;DRG2_HUMAN	A	154	ENSP00000379076:V154A;ENSP00000225729:V154A	ENSP00000225729:V154A	V	+	2	0	DRG2	17943756	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.905000	0.87416	2.132000	0.65825	0.383000	0.25322	GTG	.	.		0.637	DRG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132075.3	NM_001388	
MYCBPAP	84073	hgsc.bcm.edu	37	17	48586029	48586029	+	Silent	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr17:48586029C>T	ENST00000323776.5	+	1	285	c.123C>T	c.(121-123)ggC>ggT	p.G41G	MYCBPAP_ENST00000419930.1_Silent_p.G41G|RP11-94C24.6_ENST00000502300.1_lincRNA|MYCBPAP_ENST00000436259.2_Silent_p.G4G	NM_032133.4	NP_115509.4			MYCBP associated protein											breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(8)|ovary(4)|pancreas(1)|skin(2)|urinary_tract(2)	31	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;1.23e-09)			TGGTGCCGGGCGGCACCATGA	0.617																																					p.G41G		Atlas-SNP	.											.	MYCBPAP	135	.	0			c.C123T						.						14.0	15.0	14.0					17																	48586029		2200	4292	6492	SO:0001819	synonymous_variant	84073	exon1			GCCGGGCGGCACC	BC028393	CCDS32680.2	17q21.33	2004-02-19			ENSG00000136449	ENSG00000136449			19677	protein-coding gene	gene with protein product		609835				12151104	Standard	NM_032133		Approved	AMAP-1, DKFZp434N1415	uc010wmr.2	Q8TBZ2	OTTHUMG00000157184	ENST00000323776.5:c.123C>T	chr17.hg19:g.48586029C>T		158.0	0.0		242.0	39.0	NM_032133		Silent	SNP	ENST00000323776.5	hg19	CCDS32680.2																																																																																			.	.		0.617	MYCBPAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347814.1	NM_032133	
PPM1E	22843	hgsc.bcm.edu	37	17	57046925	57046925	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr17:57046925C>T	ENST00000308249.2	+	4	938	c.809C>T	c.(808-810)gCa>gTa	p.A270V	RP11-579O24.3_ENST00000582080.1_RNA	NM_014906.4	NP_055721.3	Q96MI6	PPM1M_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1E	0					protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|manganese ion binding (GO:0030145)			biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Medulloblastoma(34;0.127)|all_neural(34;0.237)		BRCA - Breast invasive adenocarcinoma(1;5.76e-11)			GCTTACTTTGCAGTGTTTGAT	0.468																																					p.A270V		Atlas-SNP	.											.	PPM1E	97	.	0			c.C809T						.						180.0	147.0	158.0					17																	57046925		2203	4300	6503	SO:0001583	missense	22843	exon4			ACTTTGCAGTGTT	AB028995	CCDS11613.1	17q24.2	2012-04-17	2010-03-05		ENSG00000175175	ENSG00000175175		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19322	protein-coding gene	gene with protein product	"""partner of PIX 1"", ""nuclear calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1E (PP2C domain containing)"""			11864573, 10470851	Standard	NR_048561		Approved	POPX1, KIAA1072, PP2CH, CaMKP-N	uc002iwx.4	Q8WY54		ENST00000308249.2:c.809C>T	chr17.hg19:g.57046925C>T	ENSP00000312411:p.Ala270Val	141.0	0.0		175.0	27.0	NM_014906	Q8N8J9|Q96DB8	Missense_Mutation	SNP	ENST00000308249.2	hg19	CCDS11613.1	.	.	.	.	.	.	.	.	.	.	C	31	5.077124	0.94000	.	.	ENSG00000175175	ENST00000308249;ENST00000443121	T	0.11277	2.79	5.49	5.49	0.81192	.	0.046830	0.85682	D	0.000000	T	0.45975	0.1369	M	0.92738	3.34	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.996	T	0.57294	-0.7836	10	0.87932	D	0	-22.1143	19.7268	0.96166	0.0:1.0:0.0:0.0	.	279;270	Q8WY54-3;Q8WY54-2	.;.	V	270;121	ENSP00000312411:A270V	ENSP00000312411:A270V	A	+	2	0	PPM1E	54401707	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.017000	0.70805	2.727000	0.93392	0.563000	0.77884	GCA	.	.		0.468	PPM1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445458.1	NM_014906	
RNF213	57674	hgsc.bcm.edu	37	17	78319225	78319225	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr17:78319225G>A	ENST00000582970.1	+	29	7233	c.7090G>A	c.(7090-7092)Gac>Aac	p.D2364N	RNF213_ENST00000508628.2_Missense_Mutation_p.D2413N|RNF213_ENST00000336301.6_Missense_Mutation_p.D437N	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	2364					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.D2413N(1)|p.D437N(1)		NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			CTTCAATGTCGACTTTGATAA	0.552																																					p.D2364N		Atlas-SNP	.											RNF213_ENST00000411702,colon,carcinoma,0,2	RNF213	766	.	2	Substitution - Missense(2)	large_intestine(2)	c.G7090A						.						68.0	67.0	68.0					17																	78319225		2203	4300	6503	SO:0001583	missense	57674	exon29			AATGTCGACTTTG	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.7090G>A	chr17.hg19:g.78319225G>A	ENSP00000464087:p.Asp2364Asn	67.0	1.0		82.0	31.0	NM_001256071	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	hg19	CCDS58606.1	.	.	.	.	.	.	.	.	.	.	G	5.617	0.298637	0.10622	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T	0.21361	2.01	5.01	0.769	0.18492	.	0.211870	0.38548	N	0.001643	T	0.10465	0.0256	L	0.28054	0.825	0.20926	N	0.99982	B	0.16166	0.016	B	0.20767	0.031	T	0.26258	-1.0108	10	0.16896	T	0.51	.	3.5721	0.07921	0.2694:0.106:0.5163:0.1084	.	437	Q63HN8	RN213_HUMAN	N	2364;2413;437	ENSP00000338218:D437N	ENSP00000338218:D437N	D	+	1	0	RNF213	75933820	0.096000	0.21769	0.361000	0.25849	0.086000	0.17979	0.370000	0.20433	0.372000	0.24591	0.655000	0.94253	GAC	.	.		0.552	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914	
ASXL3	80816	hgsc.bcm.edu	37	18	31319066	31319066	+	Missense_Mutation	SNP	G	G	C			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr18:31319066G>C	ENST00000269197.5	+	11	1698	c.1698G>C	c.(1696-1698)gaG>gaC	p.E566D		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	566					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						CTGCAGTAGAGACCAGTACCC	0.418																																					p.E566D		Atlas-SNP	.											.	ASXL3	405	.	0			c.G1698C						.						72.0	67.0	69.0					18																	31319066		1906	4133	6039	SO:0001583	missense	80816	exon11			AGTAGAGACCAGT	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.1698G>C	chr18.hg19:g.31319066G>C	ENSP00000269197:p.Glu566Asp	104.0	0.0		89.0	17.0	NM_030632	Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	hg19	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	G	11.75	1.731791	0.30684	.	.	ENSG00000141431	ENST00000269197	T	0.25749	1.78	5.47	3.65	0.41850	.	0.428496	0.23638	N	0.046058	T	0.42063	0.1186	L	0.59436	1.845	0.33312	D	0.566174	D	0.69078	0.997	D	0.72625	0.978	T	0.53012	-0.8498	10	0.42905	T	0.14	.	8.8524	0.35208	0.2317:0.0:0.7683:0.0	.	566	Q9C0F0	ASXL3_HUMAN	D	566	ENSP00000269197:E566D	ENSP00000269197:E566D	E	+	3	2	ASXL3	29573064	1.000000	0.71417	0.995000	0.50966	0.218000	0.24690	3.182000	0.50910	0.760000	0.33108	0.467000	0.42956	GAG	.	.		0.418	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2		
MUC16	94025	hgsc.bcm.edu	37	19	8999473	8999473	+	Missense_Mutation	SNP	A	A	G			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr19:8999473A>G	ENST00000397910.4	-	56	40905	c.40702T>C	c.(40702-40704)Tac>Cac	p.Y13568H	MUC16_ENST00000380951.5_Missense_Mutation_p.Y209H	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13570	SEA 10. {ECO:0000255|PROSITE- ProRule:PRU00188}.			Missing (in Ref. 3; AAK74120). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGCTCCCAGTATAGCTGCTCT	0.587																																					p.Y13568H		Atlas-SNP	.											.	MUC16	4315	.	0			c.T40702C						.						185.0	156.0	165.0					19																	8999473		2010	4189	6199	SO:0001583	missense	94025	exon56			CCCAGTATAGCTG	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.40702T>C	chr19.hg19:g.8999473A>G	ENSP00000381008:p.Tyr13568His	100.0	0.0		104.0	17.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	.	12.09	1.833078	0.32421	.	.	ENSG00000181143	ENST00000397910;ENST00000380951	T;T	0.52057	0.68;0.68	3.48	3.48	0.39840	SEA (2);	.	.	.	.	T	0.69637	0.3133	M	0.89287	3.02	.	.	.	D;D	0.89917	1.0;0.984	D;D	0.91635	0.999;0.946	T	0.79193	-0.1904	8	0.87932	D	0	-11.9353	8.5336	0.33349	1.0:0.0:0.0:0.0	.	21213;13568	Q8WXI7;B5ME49	MUC16_HUMAN;.	H	13568;209	ENSP00000381008:Y13568H;ENSP00000370338:Y209H	ENSP00000370338:Y209H	Y	-	1	0	MUC16	8860473	0.989000	0.36119	0.658000	0.29665	0.071000	0.16799	2.729000	0.47327	1.599000	0.50093	0.454000	0.30748	TAC	.	.		0.587	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
DOCK6	57572	hgsc.bcm.edu	37	19	11363512	11363512	+	Silent	SNP	C	C	A	rs370478141		TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr19:11363512C>A	ENST00000294618.7	-	3	266	c.255G>T	c.(253-255)ctG>ctT	p.L85L		NM_020812.3	NP_065863.2	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	85					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(8)|liver(2)|lung(9)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	39						GCTGCAGCAGCAGCTCCAAGT	0.632																																					p.L85L		Atlas-SNP	.											.	DOCK6	104	.	0			c.G255T						.						26.0	29.0	28.0					19																	11363512		1894	4109	6003	SO:0001819	synonymous_variant	57572	exon3			CAGCAGCAGCTCC		CCDS45975.1	19p13.2	2011-08-04			ENSG00000130158	ENSG00000130158			19189	protein-coding gene	gene with protein product		614194				12432077	Standard	NM_020812		Approved	KIAA1395, ZIR1	uc002mqs.5	Q96HP0		ENST00000294618.7:c.255G>T	chr19.hg19:g.11363512C>A		100.0	0.0		97.0	16.0	NM_020812	A6H8X5|Q7Z7P4|Q9P2F2	Silent	SNP	ENST00000294618.7	hg19	CCDS45975.1																																																																																			.	.		0.632	DOCK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453155.1	NM_020812	
JUND	3727	hgsc.bcm.edu	37	19	18391859	18391859	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr19:18391859C>T	ENST00000252818.3	-	1	573	c.436G>A	c.(436-438)Gat>Aat	p.D146N	MIR3188_ENST00000583494.1_RNA	NM_005354.4	NP_005345.3	P17535	JUND_HUMAN	jun D proto-oncogene	146					aging (GO:0007568)|cellular response to calcium ion (GO:0071277)|circadian rhythm (GO:0007623)|osteoblast development (GO:0002076)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to light stimulus (GO:0009416)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to organic cyclic compound (GO:0014070)|response to peptide hormone (GO:0043434)|transcription from RNA polymerase II promoter (GO:0006366)	chromatin (GO:0000785)|nucleus (GO:0005634)|protein complex (GO:0043234)	double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			lung(2)|prostate(1)	3						TTGTGTAAATCCTCCAGGGCC	0.746																																					p.D146N		Atlas-SNP	.											.	JUND	6	.	0			c.G436A						.						14.0	15.0	15.0					19																	18391859		2197	4290	6487	SO:0001583	missense	3727	exon1			GTAAATCCTCCAG		CCDS32959.1	19p13.2	2013-01-10				ENSG00000130522		"""basic leucine zipper proteins"""	6206	protein-coding gene	gene with protein product	"""transcription factor jun-D"", ""JunD-FL isoform"", ""activator protein 1"""	165162				2112242, 1903194	Standard	NM_005354		Approved	AP-1	uc002nip.2	P17535		ENST00000252818.3:c.436G>A	chr19.hg19:g.18391859C>T	ENSP00000252818:p.Asp146Asn	16.0	0.0		43.0	9.0	NM_005354	Q53EK9	Missense_Mutation	SNP	ENST00000252818.3	hg19	CCDS32959.1	.	.	.	.	.	.	.	.	.	.	.	31	5.098638	0.94197	.	.	ENSG00000130522	ENST00000252818	T	0.36878	1.23	3.06	3.06	0.35304	Jun-like transcription factor (1);	0.072212	0.52532	U	0.000073	T	0.43433	0.1247	L	0.34521	1.04	0.58432	D	0.999998	D	0.76494	0.999	D	0.67900	0.954	T	0.20874	-1.0262	10	0.32370	T	0.25	.	11.9982	0.53216	0.0:1.0:0.0:0.0	.	146	P17535	JUND_HUMAN	N	146	ENSP00000252818:D146N	ENSP00000252818:D146N	D	-	1	0	JUND	18252859	1.000000	0.71417	0.979000	0.43373	0.966000	0.64601	5.015000	0.64035	1.741000	0.51731	0.537000	0.68136	GAT	.	.		0.746	JUND-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466318.2	NM_005354	
SUGP2	10147	hgsc.bcm.edu	37	19	19136612	19136612	+	Missense_Mutation	SNP	T	T	C			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr19:19136612T>C	ENST00000601879.1	-	3	842	c.545A>G	c.(544-546)gAg>gGg	p.E182G	SUGP2_ENST00000452918.2_Missense_Mutation_p.E182G|SUGP2_ENST00000337018.6_Missense_Mutation_p.E182G|SUGP2_ENST00000600377.1_Missense_Mutation_p.E196G|SUGP2_ENST00000598202.1_5'UTR|SUGP2_ENST00000456085.2_Intron			Q8IX01	SUGP2_HUMAN	SURP and G patch domain containing 2	182					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						CTCCAAACACTCTTTCTCAAT	0.537																																					p.E182G		Atlas-SNP	.											.	SUGP2	107	.	0			c.A545G						.						104.0	92.0	96.0					19																	19136612		2203	4300	6503	SO:0001583	missense	10147	exon3			AAACACTCTTTCT	AB002363	CCDS12392.1	19p13	2013-01-28	2010-08-10	2010-08-10	ENSG00000064607	ENSG00000064607		"""G patch domain containing"""	18641	protein-coding gene	gene with protein product		607993	"""splicing factor, arginine/serine-rich 14"""	SFRS14		12594045	Standard	NM_014884		Approved	KIAA0365	uc002nkx.2	Q8IX01		ENST00000601879.1:c.545A>G	chr19.hg19:g.19136612T>C	ENSP00000472286:p.Glu182Gly	140.0	0.0		561.0	96.0	NM_014884	C9JI71|O15071|O60369|Q5JPH7|Q8WUF7	Missense_Mutation	SNP	ENST00000601879.1	hg19	CCDS12392.1	.	.	.	.	.	.	.	.	.	.	T	17.61	3.432609	0.62844	.	.	ENSG00000064607	ENST00000337018;ENST00000330854;ENST00000452918	T;T;T	0.12255	2.7;2.7;2.7	4.93	4.93	0.64822	.	0.522677	0.17456	N	0.173602	T	0.23611	0.0571	N	0.24115	0.695	0.80722	D	1	D;D	0.71674	0.998;0.964	D;P	0.78314	0.991;0.637	T	0.02728	-1.1118	10	0.87932	D	0	-15.9326	12.3088	0.54918	0.0:0.0:0.0:1.0	.	182;182	A8K5G0;Q8IX01	.;SUGP2_HUMAN	G	182	ENSP00000337926:E182G;ENSP00000332373:E182G;ENSP00000389380:E182G	ENSP00000332373:E182G	E	-	2	0	SUGP2	18997612	0.996000	0.38824	0.988000	0.46212	0.920000	0.55202	4.243000	0.58721	1.860000	0.53959	0.260000	0.18958	GAG	.	.		0.537	SUGP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464627.1	NM_001017392	
ZNF729	100287226	hgsc.bcm.edu	37	19	22499343	22499343	+	Missense_Mutation	SNP	C	C	G			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr19:22499343C>G	ENST00000601693.1	+	4	3242	c.3124C>G	c.(3124-3126)Cat>Gat	p.H1042D	ZNF729_ENST00000357491.6_Missense_Mutation_p.H1014D			A6NN14	ZN729_HUMAN	zinc finger protein 729	1042					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|lung(32)|ovary(3)	41						TAAGATAATTCATACTGGGGA	0.343																																					p.H1042D		Atlas-SNP	.											.	ZNF729	78	.	0			c.C3124G						.																																			SO:0001583	missense	100287226	exon4			ATAATTCATACTG		CCDS59368.1	19p12	2014-02-14			ENSG00000196350	ENSG00000196350		"""Zinc fingers, C2H2-type"", ""-"""	32464	protein-coding gene	gene with protein product							Standard	NM_001242680		Approved		uc021urs.1	A6NN14	OTTHUMG00000182938	ENST00000601693.1:c.3124C>G	chr19.hg19:g.22499343C>G	ENSP00000469582:p.His1042Asp	44.0	0.0		53.0	8.0	NM_001242680	M0QY45	Missense_Mutation	SNP	ENST00000601693.1	hg19	CCDS59368.1	.	.	.	.	.	.	.	.	.	.	.	13.16	2.155070	0.38021	.	.	ENSG00000196350	ENST00000357491	T	0.67698	-0.28	0.996	0.996	0.19844	.	.	.	.	.	D	0.82462	0.5042	H	0.95917	3.74	.	.	.	.	.	.	.	.	.	D	0.84488	0.0609	6	0.87932	D	0	.	7.3662	0.26774	0.0:1.0:0.0:0.0	.	.	.	.	D	1014	ENSP00000350085:H1014D	ENSP00000350085:H1014D	H	+	1	0	ZNF729	22291183	0.362000	0.24980	0.007000	0.13788	0.007000	0.05969	1.948000	0.40303	0.416000	0.25844	0.416000	0.27883	CAT	.	.		0.343	ZNF729-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464396.1	XM_496301	
ARHGAP33	115703	hgsc.bcm.edu	37	19	36278734	36278734	+	Silent	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr19:36278734C>T	ENST00000007510.4	+	21	3411	c.3267C>T	c.(3265-3267)atC>atT	p.I1089I	ARHGAP33_ENST00000378944.5_Silent_p.I925I|AC002398.5_ENST00000433059.1_lincRNA|ARHGAP33_ENST00000314737.5_Silent_p.I928I			O14559	RHG33_HUMAN	Rho GTPase activating protein 33	1089					protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|Rac GTPase activator activity (GO:0030675)			endometrium(7)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	37						ACTATGAGATCGGGGCAAGTG	0.652																																					p.I928I		Atlas-SNP	.											.	ARHGAP33	102	.	0			c.C2784T						.						35.0	37.0	36.0					19																	36278734		2203	4299	6502	SO:0001819	synonymous_variant	115703	exon21			TGAGATCGGGGCA	AY044864	CCDS12477.1, CCDS54254.1	19q13.13	2011-06-29	2010-02-19	2010-02-19		ENSG00000004777		"""Rho GTPase activating proteins"""	23085	protein-coding gene	gene with protein product		614902	"""sorting nexin 26"""	SNX26		12297274, 12461558	Standard	NM_052948		Approved	FLJ39019, TCGAP	uc002obs.2	O14559		ENST00000007510.4:c.3267C>T	chr19.hg19:g.36278734C>T		225.0	0.0		638.0	30.0	NM_052948	O14552|O14560|Q6ZSP6|Q96CP3|Q9NT23	Silent	SNP	ENST00000007510.4	hg19																																																																																				.	.		0.652	ARHGAP33-201	KNOWN	basic	protein_coding	protein_coding		NM_052948	
AKT2	208	hgsc.bcm.edu	37	19	40746009	40746009	+	Silent	SNP	G	G	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr19:40746009G>T	ENST00000392038.2	-	7	880	c.582C>A	c.(580-582)gtC>gtA	p.V194V	AKT2_ENST00000311278.6_Silent_p.V194V|AKT2_ENST00000579047.1_Silent_p.V132V|AKT2_ENST00000424901.1_Silent_p.V194V	NM_001243027.1|NM_001243028.1|NM_001626.4	NP_001229956.1|NP_001229957.1|NP_001617.1	P31751	AKT2_HUMAN	v-akt murine thymoma viral oncogene homolog 2	194	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of Ral GTPase activity (GO:0032859)|apoptotic process (GO:0006915)|carbohydrate transport (GO:0008643)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|fat cell differentiation (GO:0045444)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|insulin receptor signaling pathway (GO:0008286)|intracellular protein transmembrane transport (GO:0065002)|mammary gland epithelial cell differentiation (GO:0060644)|membrane organization (GO:0061024)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|peripheral nervous system myelin maintenance (GO:0032287)|positive regulation of cell motility (GO:2000147)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)|protein localization to plasma membrane (GO:0072659)|regulation of cell cycle arrest (GO:0071156)|regulation of cell migration (GO:0030334)|regulation of translation (GO:0006417)|signal transduction (GO:0007165)	cell cortex (GO:0005938)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|kidney(3)|large_intestine(9)|lung(10)|prostate(2)|skin(1)	27			Lung(22;0.000499)			CTGTGTGAGCGACTTCATCCT	0.622			A		"""ovarian, pancreatic """																																p.V194V		Atlas-SNP	.		Dom	yes		19	19q13.1-q13.2	208	v-akt murine thymoma viral oncogene homolog 2		E	.	AKT2	53	.	0			c.C582A						.						181.0	175.0	177.0					19																	40746009		2203	4300	6503	SO:0001819	synonymous_variant	208	exon7			GTGAGCGACTTCA	M77198	CCDS12552.1	19q13.1-q13.2	2013-01-10			ENSG00000105221	ENSG00000105221	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	392	protein-coding gene	gene with protein product		164731				1409633	Standard	NM_001626		Approved		uc002onf.3	P31751	OTTHUMG00000137375	ENST00000392038.2:c.582C>A	chr19.hg19:g.40746009G>T		90.0	0.0		158.0	123.0	NM_001626	B2RBD8|Q05BV0|Q0VAN0|Q0VAN1|Q68GC0	Silent	SNP	ENST00000392038.2	hg19	CCDS12552.1																																																																																			.	.		0.622	AKT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268029.1	NM_001626	
MIA	8190	hgsc.bcm.edu	37	19	41281480	41281480	+	Silent	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr19:41281480C>T	ENST00000263369.3	+	1	199	c.33C>T	c.(31-33)atC>atT	p.I11I	MIA_ENST00000594436.1_Silent_p.I11I|RAB4B-EGLN2_ENST00000594136.1_5'Flank|MIA_ENST00000597784.1_Silent_p.I11I|MIA-RAB4B_ENST00000600729.1_Silent_p.I11I|RAB4B_ENST00000357052.2_5'Flank|RAB4B_ENST00000594800.1_5'Flank	NM_006533.3	NP_006524.1	Q16674	MIA_HUMAN	melanoma inhibitory activity	11					cell proliferation (GO:0008283)	extracellular space (GO:0005615)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)	4			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)	GBM - Glioblastoma multiforme(1328;0.0199)		TTGGTGTCATCATCTTGCTGT	0.612																																					p.I11I		Atlas-SNP	.											.	MIA	16	.	0			c.C33T						.						185.0	157.0	166.0					19																	41281480		2203	4300	6503	SO:0001819	synonymous_variant	8190	exon2			TGTCATCATCTTG	X75450	CCDS12566.1	19q13.2	2012-10-15			ENSG00000261857	ENSG00000261857			7076	protein-coding gene	gene with protein product		601340				7923218, 8661134	Standard	NM_006533		Approved	CD-RAP	uc021uuu.1	Q16674		ENST00000263369.3:c.33C>T	chr19.hg19:g.41281480C>T		62.0	0.0		122.0	74.0	NM_001202553	Q6FHV3	Silent	SNP	ENST00000263369.3	hg19	CCDS12566.1																																																																																			.	.		0.612	MIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463162.1		
PVR	5817	hgsc.bcm.edu	37	19	45150523	45150523	+	Missense_Mutation	SNP	G	G	C			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr19:45150523G>C	ENST00000425690.3	+	2	407	c.108G>C	c.(106-108)caG>caC	p.Q36H	PVR_ENST00000344956.4_Missense_Mutation_p.Q36H|CTB-171A8.1_ENST00000590796.1_RNA|PVR_ENST00000406449.4_Missense_Mutation_p.Q36H|PVR_ENST00000403059.4_Missense_Mutation_p.Q36H	NM_006505.3	NP_006496.3	P15151	PVR_HUMAN	poliovirus receptor	36	Ig-like V-type.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|regulation of immune response (GO:0050776)|susceptibility to natural killer cell mediated cytotoxicity (GO:0042271)|susceptibility to T cell mediated cytotoxicity (GO:0060370)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|receptor activity (GO:0004872)			large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	6	Lung NSC(12;0.00608)|all_lung(12;0.0148)	Medulloblastoma(540;0.0425)|Ovarian(192;0.0728)|Prostate(69;0.081)|all_neural(266;0.112)		Epithelial(262;0.000601)		CGCCCACCCAGGTGCCCGGCT	0.652																																					p.Q36H		Atlas-SNP	.											.	PVR	23	.	0			c.G108C						.						12.0	12.0	12.0					19																	45150523		2179	4262	6441	SO:0001583	missense	5817	exon2			CACCCAGGTGCCC	BC015542	CCDS12640.1, CCDS46105.1, CCDS46106.1, CCDS46107.1	19q13.2	2013-01-29			ENSG00000073008	ENSG00000073008		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9705	protein-coding gene	gene with protein product	"""nectin-like 5"""	173850		PVS		2170108	Standard	XM_005259120		Approved	CD155, HVED, Necl-5, NECL5, Tage4	uc002ozm.3	P15151	OTTHUMG00000151527	ENST00000425690.3:c.108G>C	chr19.hg19:g.45150523G>C	ENSP00000402060:p.Gln36His	67.0	0.0		83.0	12.0	NM_001135769	B4DTS9|P15152|Q15267|Q15268|Q96BJ1	Missense_Mutation	SNP	ENST00000425690.3	hg19	CCDS12640.1	.	.	.	.	.	.	.	.	.	.	G	15.16	2.752036	0.49362	.	.	ENSG00000073008	ENST00000344956;ENST00000425690;ENST00000406449;ENST00000403059	T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16	4.79	-1.49	0.08718	Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.438380	0.04845	N	0.441376	T	0.70579	0.3240	M	0.66939	2.045	0.09310	N	1	D;D;D;D	0.76494	0.999;0.991;0.991;0.992	D;D;D;D	0.71870	0.972;0.972;0.958;0.975	T	0.54918	-0.8221	10	0.40728	T	0.16	.	0.7982	0.01070	0.2916:0.1557:0.3815:0.1713	.	36;36;36;36	P15151-2;P15151-3;P15151-4;P15151	.;.;.;PVR_HUMAN	H	36	ENSP00000340870:Q36H;ENSP00000402060:Q36H;ENSP00000383907:Q36H;ENSP00000385344:Q36H	ENSP00000340870:Q36H	Q	+	3	2	PVR	49842363	0.107000	0.21998	0.000000	0.03702	0.054000	0.15201	0.374000	0.20501	-0.475000	0.06852	-0.373000	0.07131	CAG	.	.		0.652	PVR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000323017.2	NM_006505	
MYBPC2	4606	hgsc.bcm.edu	37	19	50957538	50957538	+	Silent	SNP	G	G	A	rs558923030	byFrequency	TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr19:50957538G>A	ENST00000357701.5	+	18	1977	c.1926G>A	c.(1924-1926)ccG>ccA	p.P642P		NM_004533.3	NP_004524.3	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type	642	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		CAGACCCCCCGGAGGCTGTGC	0.647													g|||	7	0.00139776	0.0	0.0	5008	,	,		14805	0.0		0.0	False		,,,				2504	0.0072				p.P642P		Atlas-SNP	.											.	MYBPC2	103	.	0			c.G1926A						.						38.0	40.0	39.0					19																	50957538		1994	4154	6148	SO:0001819	synonymous_variant	4606	exon18			CCCCCCGGAGGCT		CCDS46152.1	19q13.33	2013-02-11	2001-11-28		ENSG00000086967	ENSG00000086967		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7550	protein-coding gene	gene with protein product	"""fast-type muscle myosin-binding-protein C"""	160793	"""myosin-binding protein C, fast-type"""			8375400	Standard	NM_004533		Approved	MYBPCF, MYBPC, MGC163408	uc002psf.2	Q14324		ENST00000357701.5:c.1926G>A	chr19.hg19:g.50957538G>A		103.0	0.0		44.0	31.0	NM_004533	A1L4G9	Silent	SNP	ENST00000357701.5	hg19	CCDS46152.1																																																																																			.	.		0.647	MYBPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464751.1	NM_004533	
HAO1	54363	hgsc.bcm.edu	37	20	7915180	7915180	+	Silent	SNP	C	C	A	rs200105698		TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr20:7915180C>A	ENST00000378789.3	-	2	291	c.240G>T	c.(238-240)acG>acT	p.T80T		NM_017545.2	NP_060015.1	Q9UJM8	HAOX1_HUMAN	hydroxyacid oxidase (glycolate oxidase) 1	80	FMN hydroxy acid dehydrogenase. {ECO:0000255|PROSITE-ProRule:PRU00683}.				cellular nitrogen compound metabolic process (GO:0034641)|fatty acid alpha-oxidation (GO:0001561)|glycolate catabolic process (GO:0046296)|glyoxylate metabolic process (GO:0046487)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	(S)-2-hydroxy-acid oxidase activity (GO:0003973)|FMN binding (GO:0010181)|glycolate oxidase activity (GO:0008891)|glyoxylate oxidase activity (GO:0047969)|long-chain-(S)-2-hydroxy-long-chain-acid oxidase activity (GO:0052853)|medium-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052854)|receptor binding (GO:0005102)|very-long-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052852)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36						GCTGCATGGCCGTAGCCCCCA	0.532																																					p.T80T		Atlas-SNP	.											.	HAO1	71	.	0			c.G240T						.						106.0	95.0	99.0					20																	7915180		2203	4300	6503	SO:0001819	synonymous_variant	54363	exon2			CATGGCCGTAGCC	AL021879	CCDS13100.1	20p12	2005-01-10			ENSG00000101323	ENSG00000101323	1.1.3.15		4809	protein-coding gene	gene with protein product		605023		GOX1		9891009	Standard	NM_017545		Approved	GOX	uc002wmw.1	Q9UJM8	OTTHUMG00000031841	ENST00000378789.3:c.240G>T	chr20.hg19:g.7915180C>A		89.0	0.0		92.0	17.0	NM_017545	Q14CQ0|Q9UPZ0|Q9Y3I7	Silent	SNP	ENST00000378789.3	hg19	CCDS13100.1																																																																																			.	C|0.999;G|0.001		0.532	HAO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077926.2		
DZANK1	55184	hgsc.bcm.edu	37	20	18393405	18393405	+	Silent	SNP	G	G	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr20:18393405G>A	ENST00000358866.6	-	12	1339	c.1317C>T	c.(1315-1317)ttC>ttT	p.F439F	DZANK1_ENST00000262547.5_Silent_p.F439F|DZANK1_ENST00000329494.5_Silent_p.F441F|DZANK1_ENST00000357236.4_Silent_p.F325F|DZANK1_ENST00000487128.1_5'UTR			Q9NVP4	DZAN1_HUMAN	double zinc ribbon and ankyrin repeat domains 1	439							zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(10)	19						CAGATGGGTAGAAGAGGCCAA	0.512																																					p.F439F		Atlas-SNP	.											.	DZANK1	65	.	0			c.C1317T						.						179.0	168.0	171.0					20																	18393405		1931	4132	6063	SO:0001819	synonymous_variant	55184	exon13			TGGGTAGAAGAGG	AK001462	CCDS46582.1	20p11.23	2013-01-11	2011-10-03	2011-10-03	ENSG00000089091	ENSG00000089091		"""Ankyrin repeat domain containing"""	15858	protein-coding gene	gene with protein product	"""ankyrin repeat domain 64"""		"""chromosome 20 open reading frame 12"""	C20orf84, C20orf12			Standard	NM_001099407		Approved	FLJ10600, dJ568F9.2, FLJ30892, bA189K21.8, ANKRD64	uc002wqq.4	Q9NVP4	OTTHUMG00000031968	ENST00000358866.6:c.1317C>T	chr20.hg19:g.18393405G>A		98.0	0.0		159.0	42.0	NM_001099407	B7ZLZ4|Q4F7X1|Q5QPD9|Q5QPE0|Q68DN8|Q6ZMX9|Q96NF0|Q9H1E0|Q9H442	Silent	SNP	ENST00000358866.6	hg19	CCDS46582.1	.	.	.	.	.	.	.	.	.	.	G	7.067	0.567605	0.13560	.	.	ENSG00000089091	ENST00000358866	.	.	.	5.51	2.18	0.27775	.	.	.	.	.	T	0.58250	0.2109	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53180	-0.8475	4	.	.	.	-19.4079	9.2005	0.37256	0.3459:0.0:0.6541:0.0	.	.	.	.	F	238	.	.	S	-	2	0	C20orf12	18341405	1.000000	0.71417	1.000000	0.80357	0.627000	0.37826	1.389000	0.34453	0.703000	0.31848	-0.143000	0.13931	TCT	.	.		0.512	DZANK1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000471926.1	NM_001099407	
NINL	22981	hgsc.bcm.edu	37	20	25434223	25434223	+	Missense_Mutation	SNP	G	G	C			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr20:25434223G>C	ENST00000278886.6	-	24	4086	c.4013C>G	c.(4012-4014)gCc>gGc	p.A1338G	NINL_ENST00000464285.1_5'UTR|NINL_ENST00000422516.1_Missense_Mutation_p.A989G	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like	1338					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						CACCAGGTGGGCGTTCTCCAC	0.557																																					p.A1338G		Atlas-SNP	.											.	NINL	148	.	0			c.C4013G						.						96.0	85.0	89.0					20																	25434223		2203	4300	6503	SO:0001583	missense	22981	exon24			AGGTGGGCGTTCT		CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.4013C>G	chr20.hg19:g.25434223G>C	ENSP00000278886:p.Ala1338Gly	126.0	0.0		115.0	26.0	NM_025176	A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	Missense_Mutation	SNP	ENST00000278886.6	hg19	CCDS33452.1	.	.	.	.	.	.	.	.	.	.	G	17.13	3.309595	0.60414	.	.	ENSG00000101004	ENST00000278886;ENST00000422516	T;T	0.48201	0.82;0.82	4.89	3.92	0.45320	.	0.152963	0.41823	N	0.000808	T	0.67477	0.2897	M	0.80183	2.485	0.24110	N	0.995841	B;D;D	0.69078	0.412;0.983;0.997	B;D;D	0.66716	0.104;0.943;0.946	T	0.62364	-0.6870	10	0.49607	T	0.09	-12.3693	14.0661	0.64831	0.0:0.1525:0.8475:0.0	.	989;1338;129	Q9Y2I6-2;Q9Y2I6;Q9HAD5	.;NINL_HUMAN;.	G	1338;989	ENSP00000278886:A1338G;ENSP00000410431:A989G	ENSP00000278886:A1338G	A	-	2	0	NINL	25382223	1.000000	0.71417	0.962000	0.40283	0.113000	0.19764	5.303000	0.65738	1.263000	0.44181	0.655000	0.94253	GCC	.	.		0.557	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078445.3	NM_025176	
XKR7	343702	hgsc.bcm.edu	37	20	30584708	30584708	+	Silent	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr20:30584708C>T	ENST00000562532.2	+	3	1362	c.1188C>T	c.(1186-1188)gcC>gcT	p.A396A		NM_001011718.1	NP_001011718.1	Q5GH72	XKR7_HUMAN	XK, Kell blood group complex subunit-related family, member 7	396						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	34			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			TGGAGAACGCCGCGCTCACCG	0.597																																					p.A396A		Atlas-SNP	.											.	XKR7	62	.	0			c.C1188T						.						62.0	56.0	58.0					20																	30584708		2203	4300	6503	SO:0001819	synonymous_variant	343702	exon3			GAACGCCGCGCTC	AY534245	CCDS33459.1	20q11.21	2014-07-16	2006-01-12		ENSG00000260903	ENSG00000260903			23062	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 7"", ""chromosome 20 open reading frame 159"""	C20orf159			Standard	NM_001011718		Approved	dJ310O13.4	uc002wxe.3	Q5GH72	OTTHUMG00000032198	ENST00000562532.2:c.1188C>T	chr20.hg19:g.30584708C>T		69.0	0.0		78.0	17.0	NM_001011718	Q9NUG5	Silent	SNP	ENST00000562532.2	hg19	CCDS33459.1																																																																																			.	.		0.597	XKR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078597.3	NM_001011718	
ZNF334	55713	hgsc.bcm.edu	37	20	45130323	45130323	+	Missense_Mutation	SNP	G	G	C			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr20:45130323G>C	ENST00000347606.4	-	5	1837	c.1655C>G	c.(1654-1656)aCc>aGc	p.T552S	ZNF334_ENST00000457685.2_Missense_Mutation_p.T514S|ZNF334_ENST00000593880.1_Missense_Mutation_p.T575S	NM_018102.4	NP_060572.3	Q9HCZ1	ZN334_HUMAN	zinc finger protein 334	552					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0122)				CCTGCAGTAGGTTCTCCCACA	0.458																																					p.T552S		Atlas-SNP	.											.	ZNF334	101	.	0			c.C1655G						.						167.0	158.0	161.0					20																	45130323		2203	4300	6503	SO:0001583	missense	55713	exon5			CAGTAGGTTCTCC	AK001331	CCDS33480.1, CCDS74736.1	20q13.12	2013-09-20			ENSG00000198185	ENSG00000198185		"""Zinc fingers, C2H2-type"", ""-"""	15806	protein-coding gene	gene with protein product							Standard	NM_018102		Approved	bA179N14.1	uc002xsc.4	Q9HCZ1	OTTHUMG00000032654	ENST00000347606.4:c.1655C>G	chr20.hg19:g.45130323G>C	ENSP00000255129:p.Thr552Ser	60.0	0.0		77.0	15.0	NM_018102	Q5T6U2|Q9NVW4	Missense_Mutation	SNP	ENST00000347606.4	hg19	CCDS33480.1	.	.	.	.	.	.	.	.	.	.	G	8.084	0.773123	0.16051	.	.	ENSG00000198185	ENST00000457685;ENST00000347606	T;T	0.27402	1.67;1.67	2.88	0.567	0.17325	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.17789	0.0427	N	0.16016	0.355	0.09310	N	1	B;B;B	0.14438	0.01;0.01;0.01	B;B;B	0.10450	0.005;0.005;0.005	T	0.24368	-1.0162	9	0.44086	T	0.13	.	9.7278	0.40342	0.0:0.5911:0.4089:0.0	.	514;552;575	B3KQ93;Q9HCZ1;Q8N3P8	.;ZN334_HUMAN;.	S	514;552	ENSP00000402582:T514S;ENSP00000255129:T552S	ENSP00000255129:T552S	T	-	2	0	ZNF334	44563730	0.000000	0.05858	0.957000	0.39632	0.912000	0.54170	-0.370000	0.07523	0.522000	0.28464	0.491000	0.48974	ACC	.	.		0.458	ZNF334-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079575.1		
NCOA3	8202	hgsc.bcm.edu	37	20	46268408	46268408	+	Missense_Mutation	SNP	C	C	G			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr20:46268408C>G	ENST00000371998.3	+	15	2986	c.2795C>G	c.(2794-2796)cCt>cGt	p.P932R	NCOA3_ENST00000372004.3_Missense_Mutation_p.P932R|NCOA3_ENST00000371997.3_Missense_Mutation_p.P927R|NCOA3_ENST00000341724.6_Missense_Mutation_p.P862R			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	932					androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						AGAATGGAACCTATGAATTCA	0.493																																					p.P932R		Atlas-SNP	.											.	NCOA3	156	.	0			c.C2795G						.						126.0	135.0	132.0					20																	46268408		2203	4300	6503	SO:0001583	missense	8202	exon15			TGGAACCTATGAA	AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.2795C>G	chr20.hg19:g.46268408C>G	ENSP00000361066:p.Pro932Arg	102.0	0.0		161.0	46.0	NM_181659	A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Missense_Mutation	SNP	ENST00000371998.3	hg19	CCDS13407.1	.	.	.	.	.	.	.	.	.	.	C	11.98	1.801183	0.31869	.	.	ENSG00000124151	ENST00000340189;ENST00000341724;ENST00000372004;ENST00000371998;ENST00000371997	T;T;T;T	0.02525	4.26;4.62;4.63;4.31	5.89	4.88	0.63580	.	0.240010	0.36409	N	0.002616	T	0.05823	0.0152	M	0.61703	1.905	0.21897	N	0.999481	B;B;B;B;B;B	0.14805	0.005;0.006;0.011;0.005;0.008;0.005	B;B;B;B;B;B	0.15870	0.005;0.01;0.014;0.006;0.014;0.006	T	0.14448	-1.0472	10	0.51188	T	0.08	-8.9246	17.7823	0.88527	0.1305:0.8695:0.0:0.0	.	932;927;936;932;932;932	A8K0W8;Q9Y6Q9-3;Q59EE8;Q0IIN7;Q9Y6Q9-5;Q9Y6Q9	.;.;.;.;.;NCOA3_HUMAN	R	932;862;932;932;927	ENSP00000342123:P862R;ENSP00000361073:P932R;ENSP00000361066:P932R;ENSP00000361065:P927R	ENSP00000345671:P932R	P	+	2	0	NCOA3	45701815	0.076000	0.21285	0.381000	0.26106	0.795000	0.44927	3.505000	0.53356	2.782000	0.95742	0.557000	0.71058	CCT	.	.		0.493	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080405.1	NM_006534	
CRYZL1	9946	hgsc.bcm.edu	37	21	34994363	34994363	+	Missense_Mutation	SNP	T	T	G			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr21:34994363T>G	ENST00000381554.3	-	4	241	c.156A>C	c.(154-156)gaA>gaC	p.E52D	CRYZL1_ENST00000381540.3_Missense_Mutation_p.E52D|CRYZL1_ENST00000413017.2_Missense_Mutation_p.E52D|CRYZL1_ENST00000445393.1_Missense_Mutation_p.E52D|AP000304.12_ENST00000429238.1_Intron|CRYZL1_ENST00000290244.5_Missense_Mutation_p.E52D|CRYZL1_ENST00000361534.2_Missense_Mutation_p.E76D	NM_145858.2	NP_665857.2	O95825	QORL1_HUMAN	crystallin, zeta (quinone reductase)-like 1	52					quinone metabolic process (GO:1901661)	cytosol (GO:0005829)	NADP binding (GO:0050661)|NADPH:quinone reductase activity (GO:0003960)|zinc ion binding (GO:0008270)			lung(1)|prostate(1)|urinary_tract(1)	3						TCATCTTCATTTCTGCCAGAA	0.328																																					p.E52D		Atlas-SNP	.											.	CRYZL1	16	.	0			c.A156C						.						78.0	82.0	81.0					21																	34994363		2202	4298	6500	SO:0001583	missense	9946	exon4			CTTCATTTCTGCC	AF029689	CCDS13633.2	21q22.1	2008-07-31			ENSG00000205758	ENSG00000205758			2420	protein-coding gene	gene with protein product	"""quinone reductase-like 1"""	603920				10191096	Standard	NM_145858		Approved	QOH-1, 4P11	uc021wio.1	O95825	OTTHUMG00000065954	ENST00000381554.3:c.156A>C	chr21.hg19:g.34994363T>G	ENSP00000370966:p.Glu52Asp	387.0	0.0		313.0	119.0	NM_145858	B2RDX1|B3KQ77|Q96DY0|Q9NVY7	Missense_Mutation	SNP	ENST00000381554.3	hg19	CCDS13633.2	.	.	.	.	.	.	.	.	.	.	T	10.78	1.446999	0.25987	.	.	ENSG00000205758	ENST00000381554;ENST00000290244;ENST00000381540;ENST00000445393;ENST00000361534;ENST00000452332;ENST00000431177;ENST00000413017	T;T;T;T;T;T;T	0.41400	3.61;1.0;3.61;1.0;3.61;3.61;3.61	4.95	2.52	0.30459	GroES-like (1);Alcohol dehydrogenase GroES-like (1);	0.052099	0.85682	D	0.000000	T	0.24353	0.0590	L	0.27944	0.81	0.80722	D	1	B;B;B	0.16396	0.017;0.003;0.017	B;B;B	0.18263	0.021;0.021;0.021	T	0.06092	-1.0846	10	0.13853	T	0.58	-17.7987	6.8537	0.24028	0.0:0.1783:0.0:0.8217	.	52;52;76	O95825;A6NND8;A6NHJ8	QORL1_HUMAN;.;.	D	52;52;52;52;76;52;52;52	ENSP00000370966:E52D;ENSP00000290244:E52D;ENSP00000370951:E52D;ENSP00000399730:E52D;ENSP00000355075:E76D;ENSP00000405510:E52D;ENSP00000389209:E52D	ENSP00000290244:E52D	E	-	3	2	CRYZL1	33916233	1.000000	0.71417	0.994000	0.49952	0.929000	0.56500	2.117000	0.41939	0.237000	0.21200	0.383000	0.25322	GAA	.	.		0.328	CRYZL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141282.2	NM_145858	
GGT5	2687	hgsc.bcm.edu	37	22	24628913	24628913	+	Silent	SNP	G	G	C			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr22:24628913G>C	ENST00000327365.4	-	4	890	c.474C>G	c.(472-474)ccC>ccG	p.P158P	GGT5_ENST00000418439.2_Missense_Mutation_p.L83V|GGT5_ENST00000398292.3_Silent_p.P158P|GGT5_ENST00000263112.7_Silent_p.P126P	NM_001099781.1|NM_004121.2	NP_001093251.1|NP_004112.2	P36269	GGT5_HUMAN	gamma-glutamyltransferase 5	158					arachidonic acid metabolic process (GO:0019369)|cellular amino acid metabolic process (GO:0006520)|glutathione biosynthetic process (GO:0006750)|glutathione metabolic process (GO:0006749)|inflammatory response (GO:0006954)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|small molecule metabolic process (GO:0044281)	anchored component of external side of plasma membrane (GO:0031362)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(3)|skin(3)	28						GCTGCGCCCAGGGCAGGCGGC	0.701																																					p.P158P		Atlas-SNP	.											.	GGT5	61	.	0			c.C474G						.						20.0	22.0	21.0					22																	24628913		2182	4269	6451	SO:0001819	synonymous_variant	2687	exon4			CGCCCAGGGCAGG	M64099	CCDS13825.1, CCDS42989.1, CCDS42990.1	22q11.23	2008-03-25	2008-03-10	2008-03-10	ENSG00000099998	ENSG00000099998		"""Gamma-glutamyltransferases"""	4260	protein-coding gene	gene with protein product		137168	"""gamma-glutamyltransferase-like activity 1"""	GGTLA1		1676842, 8095916, 18357469	Standard	NM_004121		Approved	GGT-REL	uc002zzp.4	P36269	OTTHUMG00000150796	ENST00000327365.4:c.474C>G	chr22.hg19:g.24628913G>C		84.0	0.0		78.0	36.0	NM_001099781	Q53XM9|Q6GMP0|Q96FC1|Q9UFM5	Silent	SNP	ENST00000327365.4	hg19	CCDS13825.1	.	.	.	.	.	.	.	.	.	.	G	15.12	2.738833	0.49045	.	.	ENSG00000099998	ENST00000418439	T	0.25912	1.77	4.32	0.819	0.18785	.	.	.	.	.	T	0.11623	0.0283	.	.	.	0.23704	N	0.997069	P	0.43094	0.799	B	0.37731	0.257	T	0.13469	-1.0508	8	0.17369	T	0.5	-37.4935	3.3472	0.07140	0.2141:0.0:0.4922:0.2937	.	83	E7EUG3	.	V	83	ENSP00000392146:L83V	ENSP00000392146:L83V	L	-	1	2	GGT5	22958913	0.051000	0.20477	1.000000	0.80357	0.997000	0.91878	-0.958000	0.03857	0.570000	0.29347	0.585000	0.79938	CTG	.	.		0.701	GGT5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000320119.1	NM_004121	
TCF20	6942	hgsc.bcm.edu	37	22	42610029	42610029	+	Missense_Mutation	SNP	G	G	C			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr22:42610029G>C	ENST00000359486.3	-	1	1419	c.1283C>G	c.(1282-1284)cCt>cGt	p.P428R	TCF20_ENST00000335626.4_Missense_Mutation_p.P428R	NM_005650.1	NP_005641.1	Q9UGU0	TCF20_HUMAN	transcription factor 20 (AR1)	428					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(13)|lung(22)|ovary(5)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(5)	66						ATGAGAATTAGGACTGGGCAT	0.478																																					p.P428R		Atlas-SNP	.											.	TCF20	164	.	0			c.C1283G						.						129.0	128.0	128.0					22																	42610029		2203	4300	6503	SO:0001583	missense	6942	exon1			GAATTAGGACTGG	U19345	CCDS14032.1, CCDS14033.1	22q13.3	2011-02-08			ENSG00000100207	ENSG00000100207			11631	protein-coding gene	gene with protein product	"""stromelysin-1 platelet-derived growth factor-responsive element binding protein"""	603107				9730594, 10995766	Standard	NM_005650		Approved	AR1, SPBP	uc003bcj.1	Q9UGU0	OTTHUMG00000150920	ENST00000359486.3:c.1283C>G	chr22.hg19:g.42610029G>C	ENSP00000352463:p.Pro428Arg	119.0	0.0		111.0	26.0	NM_181492	A9JX12|O14528|Q13078|Q4V353|Q9H4M0	Missense_Mutation	SNP	ENST00000359486.3	hg19	CCDS14033.1	.	.	.	.	.	.	.	.	.	.	G	16.03	3.006874	0.54361	.	.	ENSG00000100207	ENST00000359486;ENST00000335626	T;T	0.32988	1.43;1.43	6.17	6.17	0.99709	.	0.000000	0.64402	D	0.000005	T	0.50548	0.1622	L	0.46157	1.445	0.80722	D	1	D;D	0.71674	0.998;0.996	D;P	0.67382	0.951;0.895	T	0.38415	-0.9662	10	0.66056	D	0.02	-14.8461	19.0599	0.93085	0.0:0.0:1.0:0.0	.	428;428	Q9UGU0-2;Q9UGU0	.;TCF20_HUMAN	R	428	ENSP00000352463:P428R;ENSP00000335561:P428R	ENSP00000335561:P428R	P	-	2	0	TCF20	40939973	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.227000	0.65305	2.941000	0.99782	0.655000	0.94253	CCT	.	.		0.478	TCF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320531.1	NM_181492	
FAM47A	158724	hgsc.bcm.edu	37	X	34149696	34149696	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chrX:34149696G>A	ENST00000346193.3	-	1	751	c.700C>T	c.(700-702)Cat>Tat	p.H234Y		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	234	Pro-rich.									NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						GGGCGGAGATGGGACACTCCA	0.642																																					p.H234Y		Atlas-SNP	.											.	FAM47A	249	.	0			c.C700T						.						32.0	34.0	33.0					X																	34149696		2201	4298	6499	SO:0001583	missense	158724	exon1			GGAGATGGGACAC	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.700C>T	chrX.hg19:g.34149696G>A	ENSP00000345029:p.His234Tyr	101.0	0.0		101.0	22.0	NM_203408	A8K8I9|Q8TAA0	Missense_Mutation	SNP	ENST00000346193.3	hg19	CCDS43926.1	.	.	.	.	.	.	.	.	.	.	G	4.051	0.007073	0.07866	.	.	ENSG00000185448	ENST00000346193	T	0.13538	2.58	0.235	-0.47	0.12131	.	.	.	.	.	T	0.13114	0.0318	N	0.19112	0.55	0.09310	N	1	D	0.62365	0.991	P	0.59115	0.852	T	0.29671	-1.0004	8	0.59425	D	0.04	.	.	.	.	.	234	Q5JRC9	FA47A_HUMAN	Y	234	ENSP00000345029:H234Y	ENSP00000345029:H234Y	H	-	1	0	FAM47A	34059617	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	-0.342000	0.07801	-2.362000	0.00609	-2.407000	0.00222	CAT	.	.		0.642	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408	
GRIA3	2892	hgsc.bcm.edu	37	X	122598767	122598767	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chrX:122598767G>A	ENST00000371251.1	+	13	2180	c.2128G>A	c.(2128-2130)Gag>Aag	p.E710K	GRIA3_ENST00000542149.1_Missense_Mutation_p.E710K|GRIA3_ENST00000371256.5_Missense_Mutation_p.E710K|GRIA3_ENST00000264357.5_Missense_Mutation_p.E710K|AL356213.1_ENST00000577653.1_RNA			P42263	GRIA3_HUMAN	glutamate receptor, ionotropic, AMPA 3	710					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)			breast(2)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|pancreas(2)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	57					Lithium(DB01356)	GAAATCAGCGGAGCCATCTGT	0.463																																					p.E710K		Atlas-SNP	.											.	GRIA3	386	.	0			c.G2128A						.						82.0	76.0	78.0					X																	122598767		2203	4300	6503	SO:0001583	missense	2892	exon13			TCAGCGGAGCCAT	U10301	CCDS14604.1, CCDS14605.1, CCDS76017.1	Xq25	2012-08-29	2012-02-03		ENSG00000125675	ENSG00000125675		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4573	protein-coding gene	gene with protein product		305915	"""glutamate receptor, ionotrophic, AMPA 3"""	GLUR3		1319477, 10644433	Standard	NM_007325		Approved	GluA3, GLURC, MRX94	uc004etr.4	P42263	OTTHUMG00000022685	ENST00000371251.1:c.2128G>A	chrX.hg19:g.122598767G>A	ENSP00000360297:p.Glu710Lys	317.0	0.0		233.0	104.0	NM_000828	D3DTF1|Q4VXD5|Q4VXD6|Q9HDA0|Q9HDA1|Q9HDA2|Q9P0H1	Missense_Mutation	SNP	ENST00000371251.1	hg19	CCDS14604.1	.	.	.	.	.	.	.	.	.	.	G	14.23	2.473484	0.43942	.	.	ENSG00000125675	ENST00000264357;ENST00000542149;ENST00000371256;ENST00000371251	T;T;T;T	0.37584	1.19;1.19;1.19;1.19	5.12	5.12	0.69794	Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.40322	0.1112	N	0.05510	-0.035	0.80722	D	1	D;D	0.63046	0.992;0.99	D;D	0.76071	0.987;0.979	T	0.47407	-0.9120	10	0.36615	T	0.2	.	16.5308	0.84357	0.0:0.0:1.0:0.0	.	710;710	P42263;P42263-2	GRIA3_HUMAN;.	K	710	ENSP00000264357:E710K;ENSP00000446146:E710K;ENSP00000360302:E710K;ENSP00000360297:E710K	ENSP00000264357:E710K	E	+	1	0	GRIA3	122426448	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	9.864000	0.99589	2.104000	0.64026	0.415000	0.27848	GAG	.	.		0.463	GRIA3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058854.1	NM_000828	
GPR50	9248	hgsc.bcm.edu	37	X	150348392	150348392	+	Missense_Mutation	SNP	G	G	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chrX:150348392G>T	ENST00000218316.3	+	2	406	c.337G>T	c.(337-339)Gtc>Ttc	p.V113F	GPR50-AS1_ENST00000454196.1_RNA|AF003625.3_ENST00000602313.1_lincRNA	NM_004224.3	NP_004215.2	Q13585	MTR1L_HUMAN	G protein-coupled receptor 50	113					cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|identical protein binding (GO:0042802)|melatonin receptor activity (GO:0008502)			breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(6)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	38	Acute lymphoblastic leukemia(192;6.56e-05)					GCTGAGTGTGGTCGGCTCCAT	0.542																																					p.V113F		Atlas-SNP	.											.	GPR50	195	.	0			c.G337T						.						179.0	173.0	175.0					X																	150348392		2202	4298	6500	SO:0001583	missense	9248	exon2			AGTGTGGTCGGCT	U52219	CCDS44012.1	Xq28	2012-08-21			ENSG00000102195	ENSG00000102195		"""GPCR / Class A : Orphans"""	4506	protein-coding gene	gene with protein product		300207				9933574, 18400093	Standard	NM_004224		Approved	H9, Mel1c	uc010ntg.2	Q13585	OTTHUMG00000024166	ENST00000218316.3:c.337G>T	chrX.hg19:g.150348392G>T	ENSP00000218316:p.Val113Phe	223.0	0.0		193.0	93.0	NM_004224	Q0VGG3|Q3ZAR0	Missense_Mutation	SNP	ENST00000218316.3	hg19	CCDS44012.1	.	.	.	.	.	.	.	.	.	.	G	12.22	1.873626	0.33069	.	.	ENSG00000102195	ENST00000535473;ENST00000218316	T	0.71817	-0.6	4.21	3.32	0.38043	GPCR, rhodopsin-like superfamily (1);	0.058042	0.64402	D	0.000002	T	0.72036	0.3411	L	0.42245	1.32	0.43724	D	0.996202	D;D	0.54397	0.957;0.966	P;D	0.63877	0.852;0.919	T	0.71185	-0.4667	10	0.48119	T	0.1	-23.3117	5.317	0.15860	0.2498:0.0:0.7502:0.0	.	66;113	F5H1S3;Q13585	.;MTR1L_HUMAN	F	66;113	ENSP00000218316:V113F	ENSP00000218316:V113F	V	+	1	0	GPR50	150099050	1.000000	0.71417	0.994000	0.49952	0.158000	0.22134	5.070000	0.64376	1.838000	0.53458	0.523000	0.50628	GTC	.	.		0.542	GPR50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060874.1	NM_004224	
PCNX	22990	hgsc.bcm.edu	37	14	71514665	71514666	+	Frame_Shift_Ins	INS	-	-	T	rs374611988		TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr14:71514665_71514666insT	ENST00000304743.2	+	22	4748_4749	c.4302_4303insT	c.(4303-4305)ttgfs	p.L1435fs	PCNX_ENST00000238570.5_Frame_Shift_Ins_p.L1435fs|PCNX_ENST00000439984.3_Frame_Shift_Ins_p.L1324fs	NM_014982.2	NP_055797.2	Q96RV3	PCX1_HUMAN	pecanex homolog (Drosophila)	1435						integral component of membrane (GO:0016021)				NS(2)|biliary_tract(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(14)|liver(2)|lung(40)|ovary(1)|prostate(7)|skin(2)|urinary_tract(1)	87			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		AGACCATGCTGTTGGATCTCTT	0.356																																					p.L1434fs		Atlas-Indel,Pindel	.											.	PCNX	198	.	0			c.4302_4303insT						.																																			SO:0001589	frameshift_variant	22990	exon22			.	AF233450, AB018348	CCDS9806.1	14q24.2	2014-07-03							19740	protein-coding gene	gene with protein product			"""pecanex-like 1 (Drosophila)"""	PCNXL1		9244429, 15777640	Standard	NM_014982		Approved	KIAA0995, KIAA0805, pecanex	uc001xmo.2	Q96RV3		ENST00000304743.2:c.4304dupT	chr14.hg19:g.71514667_71514667dupT	ENSP00000304192:p.Leu1435fs	63.0	0.0		74.0	13.0	NM_014982	B2RTR6|O94897|Q96AI7|Q9Y2J9	Frame_Shift_Ins	INS	ENST00000304743.2	hg19	CCDS9806.1																																																																																			.	.		0.356	PCNX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412479.1	NM_014982	
OR11H1	81061	hgsc.bcm.edu	37	22	16448905	16448905	+	Frame_Shift_Del	DEL	G	G	-			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr22:16448905delG	ENST00000252835.4	-	1	900	c.900delC	c.(898-900)ttcfs	p.F300fs		NM_001005239.1	NP_001005239.1	Q8NG94	O11H1_HUMAN	olfactory receptor, family 11, subfamily H, member 1	300						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(4)|skin(1)	11	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.208)		Kidney(3;0.00216)|KIRC - Kidney renal clear cell carcinoma(3;0.00244)|Lung(27;0.0724)|COAD - Colon adenocarcinoma(3;0.211)		TAAGGGGATTGAAGAGTGGGG	0.428																																					p.N301fs		Atlas-INDEL	.											.	OR11H1	44	.	0			c.901delA						.						1.0	1.0	1.0					22																	16448905		111	219	330	SO:0001589	frameshift_variant	81061	exon1			.	AP000535, AF399611	CCDS74807.1	22q11.1	2012-08-09			ENSG00000130538	ENSG00000130538		"""GPCR / Class A : Olfactory receptors"""	15404	protein-coding gene	gene with protein product						12213199	Standard	NM_001005239		Approved	OR22-1	uc011agd.2	Q8NG94	OTTHUMG00000030069	ENST00000252835.4:c.900delC	chr22.hg19:g.16448905delG	ENSP00000252835:p.Phe300fs	353.0	0.0		331.0	22.0	NM_001005239	Q6IEX0|Q96R32	Frame_Shift_Del	DEL	ENST00000252835.4	hg19	CCDS33594.1																																																																																			.	.		0.428	OR11H1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074923.2	NM_001005239	
RYR2	6262	hgsc.bcm.edu	37	1	237540701	237540702	+	Frame_Shift_Ins	INS	-	-	CA			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr1:237540701_237540702insCA	ENST00000366574.2	+	8	859_860	c.542_543insCA	c.(541-546)ctcatcfs	p.I182fs	RYR2_ENST00000360064.6_Frame_Shift_Ins_p.I180fs|RYR2_ENST00000542537.1_Frame_Shift_Ins_p.I166fs	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	182	MIR 2. {ECO:0000255|PROSITE- ProRule:PRU00131}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GGAGATGACCTCATCTTAGTTA	0.436																																					p.L181fs		Atlas-Indel,Pindel	.											.	RYR2	1273	.	0			c.542_543insCA						.																																			SO:0001589	frameshift_variant	6262	exon8			.	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.543_544dupCA	chr1.hg19:g.237540702_237540703dupCA	ENSP00000355533:p.Ile182fs	74.0	0.0		87.0	18.0	NM_001035	Q15411|Q546N8|Q5T3P2	Frame_Shift_Ins	INS	ENST00000366574.2	hg19	CCDS55691.1																																																																																			.	.		0.436	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
OR11H12	440153	hgsc.bcm.edu	37	14	19378493	19378493	+	Frame_Shift_Del	DEL	C	C	-			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr14:19378493delC	ENST00000550708.1	+	1	972	c.900delC	c.(898-900)ttcfs	p.F300fs		NM_001013354.1|NM_001197287.1	NP_001013372.1|NP_001184216.1	B2RN74	O11HC_HUMAN	olfactory receptor, family 11, subfamily H, member 12	300						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	22	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CCCCACTCTTCAATCCCCTTA	0.423																																					p.F300fs		Atlas-INDEL	.											.	OR11H12	58	.	0			c.899delT						.						6.0	6.0	6.0					14																	19378493		1056	2628	3684	SO:0001589	frameshift_variant	440153	exon1			.		CCDS32017.1	14q11.2	2013-01-25			ENSG00000257115	ENSG00000257115		"""GPCR / Class A : Olfactory receptors"""	30738	protein-coding gene	gene with protein product							Standard	NM_001013354		Approved		uc010tkp.2	B2RN74	OTTHUMG00000170298	ENST00000550708.1:c.900delC	chr14.hg19:g.19378493delC	ENSP00000449002:p.Phe300fs	326.0	0.0		265.0	19.0	NM_001013354		Frame_Shift_Del	DEL	ENST00000550708.1	hg19	CCDS32017.1																																																																																			.	.		0.423	OR11H12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408402.1	NM_001013354	
ST6GALNAC3	256435	hgsc.bcm.edu	37	1	77093235	77093235	+	Frame_Shift_Del	DEL	C	C	-			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr1:77093235delC	ENST00000328299.3	+	4	870	c.722delC	c.(721-723)accfs	p.T241fs		NM_152996.2	NP_694541.2	Q8NDV1	SIA7C_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3	241					glycoprotein metabolic process (GO:0009100)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide metabolic process (GO:0006677)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	sialyltransferase activity (GO:0008373)	p.T241I(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|ovary(3)|prostate(1)|skin(2)	36						ATAAATGACACCTACTGCAAG	0.403																																					p.T241fs		Atlas-Indel,Pindel	.											.	ST6GALNAC3	71	.	1	Substitution - Missense(1)	lung(1)	c.721delA						.						155.0	149.0	151.0					1																	77093235		2203	4300	6503	SO:0001589	frameshift_variant	256435	exon4			.		CCDS672.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000184005	ENSG00000184005		"""Sialyltransferases"""	19343	protein-coding gene	gene with protein product	"""ST6GALNAC III"""	610133	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) C"""	SIAT7C			Standard	NM_152996		Approved		uc001dhh.2	Q8NDV1	OTTHUMG00000009615	ENST00000328299.3:c.722delC	chr1.hg19:g.77093235delC	ENSP00000329214:p.Thr241fs	30.0	0.0		30.0	11.0	NM_152996	Q6PCE0|Q6UX29|Q8N259	Frame_Shift_Del	DEL	ENST00000328299.3	hg19	CCDS672.1																																																																																			.	.		0.403	ST6GALNAC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026501.1	NM_152996	
RAB4B	53916	hgsc.bcm.edu	37	19	41286374	41286374	+	Frame_Shift_Del	DEL	T	T	-			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr19:41286374delT	ENST00000594800.1	+	3	342	c.182delT	c.(181-183)attfs	p.I61fs	RAB4B-EGLN2_ENST00000594136.1_Frame_Shift_Del_p.I61fs|MIA-RAB4B_ENST00000600729.1_3'UTR|RAB4B-EGLN2_ENST00000601949.1_Intron|RAB4B_ENST00000357052.2_Frame_Shift_Del_p.I61fs|RAB4B_ENST00000602069.1_3'UTR			P61018	RAB4B_HUMAN	RAB4B, member RAS oncogene family	61					glucose import (GO:0046323)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	insulin-responsive compartment (GO:0032593)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	GTP binding (GO:0005525)			endometrium(2)|kidney(3)|large_intestine(3)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	11			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			AAGCTACAGATTTGGGACACG	0.567																																					p.I61fs		Pindel	.											.	RAB4B	26	.	0			c.181delA						.						83.0	70.0	75.0					19																	41286374		2203	4300	6503	SO:0001589	frameshift_variant	53916	exon3			.	AF165522	CCDS33030.1	19q13.2	2012-10-15			ENSG00000167578	ENSG00000167578		"""RAB, member RAS oncogene"""	9782	protein-coding gene	gene with protein product	"""ras-related GTP-binding protein 4b"", ""small GTP binding protein RAB4B"""	612945					Standard	NM_016154		Approved	FLJ78649, MGC52123	uc002opd.2	P61018		ENST00000594800.1:c.182delT	chr19.hg19:g.41286374delT	ENSP00000470246:p.Ile61fs	131.0	0.0		331.0	111.0	NM_016154	P22750|Q7Z514|Q9HBR6	Frame_Shift_Del	DEL	ENST00000594800.1	hg19	CCDS33030.1																																																																																			.	.		0.567	RAB4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463168.1	NM_016154	
