#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ZNF436	80818	hgsc.bcm.edu	37	1	23689096	23689096	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr1:23689096C>T	ENST00000314011.4	-	4	915	c.779G>A	c.(778-780)aGc>aAc	p.S260N	ZNF436_ENST00000374608.3_Missense_Mutation_p.S260N	NM_001077195.1	NP_001070663.1	Q9C0F3	ZN436_HUMAN	zinc finger protein 436	260					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	19		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;5.97e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000977)|KIRC - Kidney renal clear cell carcinoma(1967;0.00336)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		AGAGCTCCGGCTGAAGCTTTT	0.512																																					p.S260N		Atlas-SNP	.											.	ZNF436	49	.	0			c.G779A						.						95.0	102.0	100.0					1																	23689096		2203	4300	6503	SO:0001583	missense	80818	exon4			CTCCGGCTGAAGC	AB051497	CCDS233.1	1p36	2013-01-08			ENSG00000125945	ENSG00000125945		"""Zinc fingers, C2H2-type"", ""-"""	20814	protein-coding gene	gene with protein product		611703				11214970	Standard	NM_001077195		Approved	KIAA1710, Zfp46	uc001bgt.3	Q9C0F3	OTTHUMG00000003232	ENST00000314011.4:c.779G>A	chr1.hg19:g.23689096C>T	ENSP00000313582:p.Ser260Asn	115.0	0.0		87.0	36.0	NM_001077195	Q658I9	Missense_Mutation	SNP	ENST00000314011.4	hg19	CCDS233.1	.	.	.	.	.	.	.	.	.	.	C	12.43	1.934183	0.34096	.	.	ENSG00000125945	ENST00000314011;ENST00000374609;ENST00000374608	T;T;T	0.33216	1.42;3.18;1.42	5.79	4.85	0.62838	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.079820	0.53938	D	0.000041	T	0.20292	0.0488	L	0.28274	0.84	0.29159	N	0.877876	B	0.16166	0.016	B	0.14023	0.01	T	0.04900	-1.0919	10	0.46703	T	0.11	-27.5095	8.2953	0.31982	0.0:0.7601:0.1576:0.0822	.	260	Q9C0F3	ZN436_HUMAN	N	260	ENSP00000313582:S260N;ENSP00000363737:S260N;ENSP00000363736:S260N	ENSP00000313582:S260N	S	-	2	0	ZNF436	23561683	0.001000	0.12720	1.000000	0.80357	0.984000	0.73092	0.017000	0.13399	2.739000	0.93911	0.655000	0.94253	AGC	.	.		0.512	ZNF436-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008908.1	NM_030634	
ARID1A	8289	hgsc.bcm.edu	37	1	27106592	27106592	+	Missense_Mutation	SNP	C	C	G			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr1:27106592C>G	ENST00000324856.7	+	20	6574	c.6203C>G	c.(6202-6204)tCg>tGg	p.S2068W	ARID1A_ENST00000540690.1_Missense_Mutation_p.S396W|ARID1A_ENST00000457599.2_Missense_Mutation_p.S1851W|ARID1A_ENST00000374152.2_Missense_Mutation_p.S1685W	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	2068					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		GCCAACATCTCGGGGCAGTTG	0.577			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.S2068W		Atlas-SNP	.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	ARID1A	842	.	0			c.C6203G						.						122.0	123.0	122.0					1																	27106592		2203	4300	6503	SO:0001583	missense	8289	exon20			ACATCTCGGGGCA	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.6203C>G	chr1.hg19:g.27106592C>G	ENSP00000320485:p.Ser2068Trp	32.0	0.0		38.0	17.0	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Missense_Mutation	SNP	ENST00000324856.7	hg19	CCDS285.1	.	.	.	.	.	.	.	.	.	.	C	18.69	3.677301	0.68042	.	.	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152;ENST00000540690	T;T;T;T	0.54071	1.21;1.21;1.21;0.59	5.1	4.19	0.49359	.	0.000000	0.85682	D	0.000000	T	0.72153	0.3425	M	0.78049	2.395	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.994;0.998;0.987	T	0.77091	-0.2716	10	0.87932	D	0	-1.431	14.2014	0.65707	0.0:0.9277:0.0:0.0723	.	1685;2068;1851	O14497-3;O14497;O14497-2	.;ARI1A_HUMAN;.	W	2068;1851;1685;396	ENSP00000320485:S2068W;ENSP00000387636:S1851W;ENSP00000363267:S1685W;ENSP00000442437:S396W	ENSP00000320485:S2068W	S	+	2	0	ARID1A	26979179	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.464000	0.80887	1.521000	0.48983	0.591000	0.81541	TCG	.	.		0.577	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
FGR	2268	hgsc.bcm.edu	37	1	27942229	27942229	+	Missense_Mutation	SNP	C	C	G			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr1:27942229C>G	ENST00000374005.3	-	8	1097	c.809G>C	c.(808-810)gGc>gCc	p.G270A	FGR_ENST00000545953.1_Missense_Mutation_p.G204A|FGR_ENST00000374004.1_Missense_Mutation_p.G270A|FGR_ENST00000399173.1_Missense_Mutation_p.G270A	NM_005248.2	NP_005239.1	P09769	FGR_HUMAN	FGR proto-oncogene, Src family tyrosine kinase	270	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood coagulation (GO:0007596)|defense response to Gram-positive bacterium (GO:0050830)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response-regulating cell surface receptor signaling pathway (GO:0002768)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell shape (GO:0008360)|regulation of innate immune response (GO:0045088)|regulation of phagocytosis (GO:0050764)|regulation of protein kinase activity (GO:0045859)|response to virus (GO:0009615)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|Fc-gamma receptor I complex binding (GO:0034988)|immunoglobulin receptor binding (GO:0034987)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphotyrosine binding (GO:0001784)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(4)	16		all_lung(284;2.05e-05)|Colorectal(325;3.46e-05)|Lung NSC(340;3.67e-05)|Renal(390;0.00121)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.25e-24)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00244)|KIRC - Kidney renal clear cell carcinoma(1967;0.0027)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		GCAGCCGGTGCCCAGCCGGCG	0.706																																					p.G270A		Atlas-SNP	.											.	FGR	39	.	0			c.G809C						.						12.0	14.0	13.0					1																	27942229		2190	4288	6478	SO:0001583	missense	2268	exon8			CCGGTGCCCAGCC	BC064382	CCDS305.1	1p36.2-p36.1	2014-06-25	2014-06-25		ENSG00000000938	ENSG00000000938		"""SH2 domain containing"""	3697	protein-coding gene	gene with protein product		164940	"""Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog"", ""v-fgr feline Gardner-Rasheed sarcoma viral oncogene homolog"", ""feline Gardner-Rasheed sarcoma viral oncogene homolog"""	SRC2		3922831	Standard	NM_001042729		Approved	c-fgr, p55c-fgr	uc001bom.3	P09769	OTTHUMG00000003516	ENST00000374005.3:c.809G>C	chr1.hg19:g.27942229C>G	ENSP00000363117:p.Gly270Ala	67.0	0.0		71.0	20.0	NM_001042729	D3DPL7|Q9UIQ3	Missense_Mutation	SNP	ENST00000374005.3	hg19	CCDS305.1	.	.	.	.	.	.	.	.	.	.	C	32	5.165854	0.94768	.	.	ENSG00000000938	ENST00000374005;ENST00000545953;ENST00000399173;ENST00000374004;ENST00000374003;ENST00000457296	D;D;D;D;D;D	0.90504	-2.68;-2.68;-2.68;-2.68;-2.68;-2.68	4.62	4.62	0.57501	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);SH2 motif (1);Protein kinase, catalytic domain (1);	0.094831	0.43747	D	0.000525	D	0.95987	0.8693	M	0.90369	3.11	0.53688	D	0.999976	D	0.65815	0.995	D	0.70935	0.971	D	0.96799	0.9588	10	0.87932	D	0	.	16.9239	0.86170	0.0:1.0:0.0:0.0	.	270	P09769	FGR_HUMAN	A	270;204;270;270;270;270	ENSP00000363117:G270A;ENSP00000445302:G204A;ENSP00000382126:G270A;ENSP00000363116:G270A;ENSP00000363115:G270A;ENSP00000407670:G270A	ENSP00000363115:G270A	G	-	2	0	FGR	27814816	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.813000	0.86123	2.508000	0.84585	0.561000	0.74099	GGC	.	.		0.706	FGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009772.1	NM_005248	
BAI2	576	hgsc.bcm.edu	37	1	32207460	32207460	+	Missense_Mutation	SNP	C	C	G			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr1:32207460C>G	ENST00000373658.3	-	9	1867	c.1526G>C	c.(1525-1527)gGc>gCc	p.G509A	BAI2_ENST00000398547.1_Missense_Mutation_p.G442A|BAI2_ENST00000373655.2_Missense_Mutation_p.G509A|BAI2_ENST00000257070.4_Missense_Mutation_p.G509A|BAI2_ENST00000398542.1_Missense_Mutation_p.G442A|BAI2_ENST00000398556.3_Missense_Mutation_p.G457A|BAI2_ENST00000398538.1_Missense_Mutation_p.G497A|BAI2_ENST00000527361.1_Missense_Mutation_p.G509A|BAI2_ENST00000440175.2_Missense_Mutation_p.G151A	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	509	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		GCAGGGGTAGCCCTGCGTGCC	0.647																																					p.G509A		Atlas-SNP	.											.	BAI2	128	.	0			c.G1526C						.						72.0	77.0	75.0					1																	32207460		2203	4299	6502	SO:0001583	missense	576	exon9			GGGTAGCCCTGCG	AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.1526G>C	chr1.hg19:g.32207460C>G	ENSP00000362762:p.Gly509Ala	62.0	0.0		50.0	16.0	NM_001703	B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Missense_Mutation	SNP	ENST00000373658.3	hg19	CCDS346.2	.	.	.	.	.	.	.	.	.	.	C	24.7	4.563253	0.86335	.	.	ENSG00000121753	ENST00000398556;ENST00000398547;ENST00000373658;ENST00000373655;ENST00000398542;ENST00000257070;ENST00000527361;ENST00000440175;ENST00000398538;ENST00000420125;ENST00000533175	T;T;T;T;T;T;T;T;T;T;T	0.23950	1.88;1.88;1.88;1.88;1.88;1.88;1.88;1.88;1.88;1.88;1.88	4.95	4.95	0.65309	.	0.000000	0.39759	N	0.001273	T	0.58148	0.2102	M	0.88241	2.94	0.58432	D	0.999999	D;D;D;D;D;D;D	0.71674	0.998;0.993;0.997;0.993;0.998;0.993;0.998	D;P;D;D;D;P;D	0.72982	0.979;0.873;0.965;0.979;0.979;0.873;0.979	T	0.66606	-0.5881	10	0.62326	D	0.03	.	17.3262	0.87248	0.0:1.0:0.0:0.0	.	442;509;497;151;442;509;509	A2A3C3;O60241-4;O60241-3;B4DKC3;A2A3C1;O60241-2;O60241	.;.;.;.;.;.;BAI2_HUMAN	A	457;442;509;509;442;509;509;151;497;447;488	ENSP00000381564:G457A;ENSP00000381555:G442A;ENSP00000362762:G509A;ENSP00000362759:G509A;ENSP00000381550:G442A;ENSP00000257070:G509A;ENSP00000435397:G509A;ENSP00000391071:G151A;ENSP00000381548:G497A;ENSP00000410921:G447A;ENSP00000437219:G488A	ENSP00000257070:G509A	G	-	2	0	BAI2	31980047	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	7.434000	0.80377	2.457000	0.83068	0.561000	0.74099	GGC	.	.		0.647	BAI2-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000381838.1	NM_001703	
FASLG	356	hgsc.bcm.edu	37	1	172633481	172633481	+	Silent	SNP	C	C	T	rs143306673		TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr1:172633481C>T	ENST00000367721.2	+	3	586	c.402C>T	c.(400-402)ccC>ccT	p.P134P	FASLG_ENST00000340030.3_Missense_Mutation_p.P119L	NM_000639.1	NP_000630.1	P48023	TNFL6_HUMAN	Fas ligand (TNF superfamily, member 6)	134					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell-cell signaling (GO:0007267)|cellular chloride ion homeostasis (GO:0030644)|endosomal lumen acidification (GO:0048388)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|immune response (GO:0006955)|inflammatory cell apoptotic process (GO:0006925)|necroptotic process (GO:0070266)|necroptotic signaling pathway (GO:0097527)|negative regulation of angiogenesis (GO:0016525)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to growth factor (GO:0070848)|response to lipopolysaccharide (GO:0032496)|retinal cell programmed cell death (GO:0046666)|signal transduction (GO:0007165)|T cell apoptotic process (GO:0070231)|transcription, DNA-templated (GO:0006351)	caveola (GO:0005901)|cytoplasmic membrane-bounded vesicle (GO:0016023)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	receptor binding (GO:0005102)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(12)|prostate(1)|skin(1)	19						CAGGCCACCCCAGTCCACCCC	0.378																																					p.P134P	Ovarian(28;486 876 30334 44033)	Atlas-SNP	.											.	FASLG	44	.	0			c.C402T						.	C		1,4405	2.1+/-5.4	0,1,2202	52.0	52.0	52.0		402	0.4	0.0	1	dbSNP_134	52	0,8600		0,0,4300	no	coding-synonymous	FASLG	NM_000639.1		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		134/282	172633481	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	356	exon3			CCACCCCAGTCCA	U11821	CCDS1304.1	1q23	2014-09-17	2005-01-07	2005-01-07	ENSG00000117560	ENSG00000117560		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"", ""Endogenous ligands"""	11936	protein-coding gene	gene with protein product		134638	"""tumor necrosis factor (ligand) superfamily, member 6"""	APT1LG1, TNFSF6		7826947, 9022072	Standard	NM_000639		Approved	FasL, CD178	uc001gis.3	P48023	OTTHUMG00000034841	ENST00000367721.2:c.402C>T	chr1.hg19:g.172633481C>T		121.0	0.0		196.0	43.0	NM_000639	Q9BZP9	Silent	SNP	ENST00000367721.2	hg19	CCDS1304.1	.	.	.	.	.	.	.	.	.	.	C	0.261	-0.999569	0.02128	2.27E-4	0.0	ENSG00000117560	ENST00000340030	.	.	.	4.78	0.362	0.16113	.	0.572869	0.17490	N	0.172362	T	0.18299	0.0439	.	.	.	0.39723	D	0.971497	B	0.33238	0.403	B	0.25405	0.06	T	0.06041	-1.0849	8	0.72032	D	0.01	-7.6123	3.5259	0.07759	0.161:0.4346:0.3133:0.0911	.	119	P48023-2	.	L	119	.	ENSP00000344739:P119L	P	+	2	0	FASLG	170900104	0.000000	0.05858	0.025000	0.17156	0.080000	0.17528	-1.570000	0.02140	0.174000	0.19809	-0.143000	0.13931	CCA	.	C|1.000;T|0.000		0.378	FASLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084276.1		
CAPN9	10753	hgsc.bcm.edu	37	1	230914797	230914797	+	Missense_Mutation	SNP	C	C	A	rs200401992		TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr1:230914797C>A	ENST00000271971.2	+	9	1145	c.1032C>A	c.(1030-1032)gaC>gaA	p.D344E	CAPN9_ENST00000366666.2_Missense_Mutation_p.D281E|RP11-99J16__A.2_ENST00000452640.1_RNA|RP11-99J16__A.2_ENST00000428480.1_RNA|RP11-99J16__A.2_ENST00000412344.1_RNA|CAPN9_ENST00000354537.1_Missense_Mutation_p.D318E	NM_006615.2	NP_006606.1	O14815	CAN9_HUMAN	calpain 9	344	Domain III.				digestion (GO:0007586)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	25	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)				TGGAGGAAGACGCGATCCACA	0.582																																					p.D344E		Atlas-SNP	.											.	CAPN9	116	.	0			c.C1032A						.						86.0	73.0	77.0					1																	230914797		2203	4300	6503	SO:0001583	missense	10753	exon9			GGAAGACGCGATC	AF022799	CCDS1586.1, CCDS31053.1	1q42.11-q42.3	2013-01-10	2004-11-11		ENSG00000135773	ENSG00000135773		"""EF-hand domain containing"""	1486	protein-coding gene	gene with protein product	"""novel calpain large subunit-4"""	606401	"""calpain 9 (nCL-4)"""			9524069, 10835488	Standard	XM_005273010		Approved	nCL-4, GC36	uc001htz.1	O14815	OTTHUMG00000037779	ENST00000271971.2:c.1032C>A	chr1.hg19:g.230914797C>A	ENSP00000271971:p.Asp344Glu	41.0	0.0		68.0	27.0	NM_006615	B1APS1|B1AQI0|Q9NS74	Missense_Mutation	SNP	ENST00000271971.2	hg19	CCDS1586.1	.	.	.	.	.	.	.	.	.	.	C	7.552	0.662995	0.14710	.	.	ENSG00000135773	ENST00000271971;ENST00000354537;ENST00000366666	T;T;T	0.15603	2.41;2.41;2.41	5.24	-10.5	0.00291	Peptidase C2, calpain, catalytic domain (1);	0.561206	0.20326	N	0.094523	T	0.09379	0.0231	L	0.35644	1.08	0.09310	N	1	B;P;B	0.37636	0.086;0.603;0.02	B;B;B	0.33846	0.012;0.171;0.007	T	0.03493	-1.1031	10	0.23302	T	0.38	.	16.2695	0.82607	0.0:0.7222:0.1565:0.1213	.	281;318;344	E7ESS6;O14815-2;O14815	.;.;CAN9_HUMAN	E	344;318;281	ENSP00000271971:D344E;ENSP00000346538:D318E;ENSP00000355626:D281E	ENSP00000271971:D344E	D	+	3	2	CAPN9	228981420	0.000000	0.05858	0.000000	0.03702	0.061000	0.15899	-0.547000	0.06055	-2.499000	0.00511	-1.119000	0.02030	GAC	.	C|0.999;T|0.001		0.582	CAPN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092179.1	NM_006615	
OR2T12	127064	hgsc.bcm.edu	37	1	248458788	248458789	+	Missense_Mutation	DNP	GG	GG	TA	rs570331659	byFrequency	TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr1:248458788_248458789GG>TA	ENST00000317996.1	-	1	91_92	c.92_93CC>TA	c.(91-93)gCC>gTA	p.A31V		NM_001004692.1	NP_001004692.1	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T, member 12	31						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(3)|large_intestine(3)|lung(25)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)			TCAAAACGGTGGCCAGAAGCAT	0.495																																					p.A31A|p.A31V		Atlas-SNP	.											.|OR2T12,NS,carcinoma,0,1	OR2T12	113	.	0			c.C93A|c.C92T						.																																			SO:0001583	missense	127064	exon1			AACGGTGGCCAGA|ACGGTGGCCAGAA	BK004485	CCDS31110.1	1q44	2012-08-09			ENSG00000177201	ENSG00000177201		"""GPCR / Class A : Olfactory receptors"""	19592	protein-coding gene	gene with protein product							Standard	NM_001004692		Approved		uc010pzj.2	Q8NG77	OTTHUMG00000040457	ENST00000317996.1:c.92_93delinsTA	chr1.hg19:g.248458788_248458789delinsTA	ENSP00000324583:p.Ala31Val	221.0|222.0	0.0		202.0	51.0	NM_001004692		Silent|Missense_Mutation	SNP	ENST00000317996.1	hg19	CCDS31110.1																																																																																			.	.		0.495	OR2T12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097353.1	NM_001004692	
CAD	790	hgsc.bcm.edu	37	2	27460247	27460247	+	Splice_Site	SNP	G	G	T			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr2:27460247G>T	ENST00000403525.1	+	27	4352	c.4208G>T	c.(4207-4209)gGa>gTa	p.G1403V	CAD_ENST00000264705.4_Splice_Site_p.G1466V			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTTCTCCCAGGATTGATTGAT	0.532																																					p.G1466V		Atlas-SNP	.											.	CAD	199	.	0			c.G4397T						.						77.0	78.0	77.0					2																	27460247		2203	4300	6503	SO:0001630	splice_region_variant	790	exon28			TCCCAGGATTGAT	D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.4208-1G>T	chr2.hg19:g.27460247G>T		62.0	0.0		43.0	18.0	NM_004341	O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Missense_Mutation	SNP	ENST00000403525.1	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.1|25.1	4.598426|4.598426	0.87055|0.87055	.|.	.|.	ENSG00000084774|ENSG00000084774	ENST00000458503|ENST00000264705;ENST00000403525	.|T;T	.|0.69806	.|-0.43;-0.43	5.09|5.09	5.09|5.09	0.68999|0.68999	.|Methylglyoxal synthase-like domain (1);Amidohydrolase 1 (1);	.|0.047590	.|0.85682	.|D	.|0.000000	D|D	0.89798|0.89798	0.6819|0.6819	H|H	0.99130|0.99130	4.44|4.44	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|1.0;1.0	D|D	0.94202|0.94202	0.7451|0.7451	5|9	.|.	.|.	.|.	.|.	17.0773|17.0773	0.86590|0.86590	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1403;1466	.|F8VPD4;P27708	.|.;PYR1_HUMAN	Y|V	118|1466;1403	.|ENSP00000264705:G1466V;ENSP00000384510:G1403V	.|.	D|G	+|+	1|2	0|0	CAD|CAD	27313751|27313751	1.000000|1.000000	0.71417|0.71417	0.942000|0.942000	0.38095|0.38095	0.931000|0.931000	0.56810|0.56810	9.255000|9.255000	0.95524|0.95524	2.365000|2.365000	0.80145|0.80145	0.561000|0.561000	0.74099|0.74099	GAT|GGA	.	.		0.532	CAD-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000324970.1		Missense_Mutation
SMEK2	57223	hgsc.bcm.edu	37	2	55825809	55825809	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr2:55825809C>T	ENST00000345102.5	-	4	965	c.664G>A	c.(664-666)Gtc>Atc	p.V222I	SMEK2_ENST00000407823.3_Missense_Mutation_p.V222I|SMEK2_ENST00000272313.5_Missense_Mutation_p.V222I	NM_001122964.1	NP_001116436	Q5MIZ7	P4R3B_HUMAN	SMEK homolog 2, suppressor of mek1 (Dictyostelium)	222					positive regulation of gluconeogenesis (GO:0045722)|protein dephosphorylation (GO:0006470)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)				kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	16			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			CATCCCACGACATCCATGATA	0.368																																					p.V222I		Atlas-SNP	.											.	SMEK2	86	.	0			c.G664A						.						96.0	94.0	95.0					2																	55825809		2203	4300	6503	SO:0001583	missense	57223	exon4			CCACGACATCCAT	AB037808	CCDS1855.1, CCDS46289.1, CCDS62913.1	2p16.1	2008-09-15			ENSG00000138041				29267	protein-coding gene	gene with protein product		610352				16085932, 18614045	Standard	NM_001122964		Approved	PSY2, FLFL2, KIAA1387, FLJ31474	uc002rzc.3	Q5MIZ7	OTTHUMG00000129336	ENST00000345102.5:c.664G>A	chr2.hg19:g.55825809C>T	ENSP00000339769:p.Val222Ile	94.0	0.0		137.0	46.0	NM_001122964	Q6P9B0|Q86XB8|Q9BQJ0|Q9BRK2|Q9H913|Q9P2G0	Missense_Mutation	SNP	ENST00000345102.5	hg19	CCDS46289.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.889305	0.91889	.	.	ENSG00000138041	ENST00000272313;ENST00000407823;ENST00000345102	T;T;T	0.47528	0.84;0.84;0.84	5.59	5.59	0.84812	Domain of unknown function DUF625 (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.57917	0.2086	M	0.62266	1.93	0.80722	D	1	B;B;B;P	0.39551	0.282;0.329;0.154;0.678	B;P;B;B	0.47075	0.247;0.536;0.249;0.437	T	0.52563	-0.8559	10	0.33141	T	0.24	-6.6529	19.5832	0.95478	0.0:1.0:0.0:0.0	.	222;222;222;222	Q5MIZ7-2;Q5MIZ7;Q5MIZ7-3;B4DKA9	.;P4R3B_HUMAN;.;.	I	222	ENSP00000272313:V222I;ENSP00000385912:V222I;ENSP00000339769:V222I	ENSP00000272313:V222I	V	-	1	0	SMEK2	55679313	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.814000	0.86154	2.621000	0.88768	0.655000	0.94253	GTC	.	.		0.368	SMEK2-002	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251483.1	NM_020463	
CFAP221	200373	hgsc.bcm.edu	37	2	120385299	120385299	+	Silent	SNP	G	G	A	rs202085071	byFrequency	TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr2:120385299G>A	ENST00000413369.3	+	16	1674	c.1587G>A	c.(1585-1587)tcG>tcA	p.S529S	PCDP1_ENST00000597189.1_3'UTR|PCDP1_ENST00000602047.1_Silent_p.S243S	NM_001271049.1	NP_001257978																Colorectal(110;0.196)					TCTCTGTGTCGCCCAAGGAGG	0.557													G|||	2	0.000399361	0.0	0.0	5008	,	,		13612	0.002		0.0	False		,,,				2504	0.0				p.S529S		Atlas-SNP	.											.	.	.	.	0			c.G1587A						.	G		0,4406		0,0,2203	110.0	113.0	112.0		729	-8.5	0.0	2		112	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	PCDP1	NM_001029996.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		243/555	120385299	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0	exon16			TGTGTCGCCCAAG																												ENST00000413369.3:c.1587G>A	chr2.hg19:g.120385299G>A		126.0	0.0		134.0	45.0	NM_001271049		Silent	SNP	ENST00000413369.3	hg19	CCDS33282.2	.	.	.	.	.	.	.	.	.	.	G	4.090	0.014659	0.07959	0.0	1.16E-4	ENSG00000163075	ENST00000443972;ENST00000413057	.	.	.	4.27	-8.54	0.00912	.	.	.	.	.	T	0.25195	0.0612	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.20042	-1.0287	4	.	.	.	2.1415	7.6382	0.28277	0.1542:0.0953:0.6558:0.0946	.	.	.	.	H	88;77	.	.	R	+	2	0	AC069154.2	120101769	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.881000	0.00715	-2.657000	0.00421	-0.140000	0.14226	CGC	.	G|0.999;A|0.001		0.557	PCDP1-006	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464236.1		
XIRP2	129446	hgsc.bcm.edu	37	2	168098387	168098387	+	Missense_Mutation	SNP	C	C	A			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr2:168098387C>A	ENST00000409728.1	+	9	1331	c.1242C>A	c.(1240-1242)gaC>gaA	p.D414E	XIRP2_ENST00000409043.1_Missense_Mutation_p.D381E|XIRP2_ENST00000409605.1_Missense_Mutation_p.D159E|XIRP2_ENST00000409273.1_Missense_Mutation_p.D159E|XIRP2_ENST00000295237.9_Missense_Mutation_p.D381E|XIRP2_ENST00000409195.1_Missense_Mutation_p.D381E|XIRP2_ENST00000420519.1_Missense_Mutation_p.D414E|XIRP2_ENST00000409756.2_Missense_Mutation_p.D381E	NM_001199143.1	NP_001186072.1	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	206					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						TTTATTCTGACAAAGAGATGA	0.368																																					p.D414E		Atlas-SNP	.											.	XIRP2	914	.	0			c.C1242A						.						123.0	117.0	119.0					2																	168098387		1834	4078	5912	SO:0001583	missense	129446	exon9			TTCTGACAAAGAG	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409728.1:c.1242C>A	chr2.hg19:g.168098387C>A	ENSP00000386619:p.Asp414Glu	50.0	0.0		57.0	19.0	NM_001199143	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409728.1	hg19	CCDS56143.1	.	.	.	.	.	.	.	.	.	.	C	18.17	3.564919	0.65651	.	.	ENSG00000163092	ENST00000409043;ENST00000409728;ENST00000409195;ENST00000409756;ENST00000420519;ENST00000295237;ENST00000409273;ENST00000409605	T;T;T;T;T;T;T;T	0.77489	-1.1;-1.1;4.13;-1.1;-1.1;4.13;4.17;-1.09	5.27	3.44	0.39384	.	0.292782	0.36815	N	0.002394	D	0.83294	0.5223	M	0.62723	1.935	0.27451	N	0.953436	D;D;D;P;P	0.71674	0.957;0.998;0.998;0.947;0.933	P;D;D;P;P	0.65573	0.526;0.913;0.936;0.673;0.597	T	0.75673	-0.3236	10	0.59425	D	0.04	-6.5178	9.7168	0.40278	0.0:0.8356:0.0:0.1644	.	206;381;414;206;159	A4UGR9;A4UGR9-4;A4UGR9-6;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.;.;.	E	381;414;381;381;414;381;159;159	ENSP00000386454:D381E;ENSP00000386619:D414E;ENSP00000386840:D381E;ENSP00000386724:D381E;ENSP00000415541:D414E;ENSP00000295237:D381E;ENSP00000387255:D159E;ENSP00000386981:D159E	ENSP00000295237:D381E	D	+	3	2	XIRP2	167806633	0.998000	0.40836	0.996000	0.52242	0.781000	0.44180	0.342000	0.19926	0.700000	0.31782	0.591000	0.81541	GAC	.	.		0.368	XIRP2-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333552.1	NM_152381	
XIRP2	129446	hgsc.bcm.edu	37	2	168106758	168106758	+	Silent	SNP	A	A	G			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr2:168106758A>G	ENST00000409195.1	+	9	8945	c.8856A>G	c.(8854-8856)gaA>gaG	p.E2952E	XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409273.1_Silent_p.E2730E|XIRP2_ENST00000295237.9_Silent_p.E2952E|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409756.2_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	2777					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						GAAAACGTGAAGAACTGCAAC	0.373																																					p.E2952E		Atlas-SNP	.											.	XIRP2	914	.	0			c.A8856G						.						93.0	91.0	91.0					2																	168106758		1826	4085	5911	SO:0001819	synonymous_variant	129446	exon9			ACGTGAAGAACTG	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.8856A>G	chr2.hg19:g.168106758A>G		177.0	0.0		136.0	37.0	NM_152381	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Silent	SNP	ENST00000409195.1	hg19	CCDS42769.1																																																																																			.	.		0.373	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381	
FSIP2	401024	hgsc.bcm.edu	37	2	186671281	186671281	+	Missense_Mutation	SNP	G	G	C			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr2:186671281G>C	ENST00000424728.1	+	17	17248	c.17248G>C	c.(17248-17250)Gaa>Caa	p.E5750Q	FSIP2_ENST00000343098.5_Missense_Mutation_p.E5839Q			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	5750										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						aaaagaagaggaagagagaga	0.368																																					p.E5839Q		Atlas-SNP	.											.	FSIP2	251	.	0			c.G17515C						.						54.0	51.0	52.0					2																	186671281		1815	4069	5884	SO:0001583	missense	401024	exon17			GAAGAGGAAGAGA	AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.17248G>C	chr2.hg19:g.186671281G>C	ENSP00000401306:p.Glu5750Gln	70.0	0.0		61.0	5.0	NM_173651	Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Missense_Mutation	SNP	ENST00000424728.1	hg19		.	.	.	.	.	.	.	.	.	.	G	12.36	1.915401	0.33815	.	.	ENSG00000188738	ENST00000343098;ENST00000424728	T;T	0.49139	0.79;0.79	4.66	-2.92	0.05615	.	.	.	.	.	T	0.26593	0.0650	N	0.19112	0.55	0.09310	N	1	.	.	.	.	.	.	T	0.21690	-1.0238	7	0.46703	T	0.11	.	1.1887	0.01860	0.4679:0.1467:0.242:0.1433	.	.	.	.	Q	5839;5750	ENSP00000344403:E5839Q;ENSP00000401306:E5750Q	ENSP00000344403:E5839Q	E	+	1	0	FSIP2	186379526	0.000000	0.05858	0.000000	0.03702	0.347000	0.29111	-1.723000	0.01866	-0.807000	0.04393	-0.216000	0.12614	GAA	.	.		0.368	FSIP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000332778.3	NM_173651	
CARF	79800	hgsc.bcm.edu	37	2	203834763	203834763	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr2:203834763G>A	ENST00000402905.3	+	10	1396	c.1075G>A	c.(1075-1077)Gta>Ata	p.V359I	CARF_ENST00000428585.1_Missense_Mutation_p.V283I|CARF_ENST00000545262.1_Missense_Mutation_p.V283I|CARF_ENST00000438828.2_Missense_Mutation_p.V359I|CARF_ENST00000414439.1_Missense_Mutation_p.V257I|CARF_ENST00000456821.2_3'UTR|CARF_ENST00000545253.1_Missense_Mutation_p.V271I|CARF_ENST00000320443.8_Missense_Mutation_p.V359I|WDR12_ENST00000477723.1_Intron	NM_001104586.1|NM_001282910.1|NM_001282911.1|NM_001282912.1	NP_001098056.1|NP_001269839.1|NP_001269840.1|NP_001269841.1	Q8N187	CARTF_HUMAN	calcium responsive transcription factor	359					cellular response to calcium ion (GO:0071277)|cellular response to potassium ion (GO:0035865)|positive regulation of transcription from RNA polymerase II promoter in response to calcium ion (GO:0061400)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)										GAAGAACTTGGTAGATGCTGG	0.313																																					p.V359I		Atlas-SNP	.											.	ALS2CR8	56	.	0			c.G1075A						.						116.0	109.0	111.0					2																	203834763		1823	4074	5897	SO:0001583	missense	79800	exon11			AACTTGGTAGATG	AB053309	CCDS42801.1, CCDS63091.1	2q33.3	2013-06-12	2013-06-12	2013-06-12	ENSG00000138380	ENSG00000138380			14435	protein-coding gene	gene with protein product	"""calcium-response factor"""	607586	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 8"""	ALS2CR8		11586298, 11832226	Standard	XM_005246858		Approved	FLJ21579, CaRF, NYD-SP24	uc002uzo.2	Q8N187	OTTHUMG00000154528	ENST00000402905.3:c.1075G>A	chr2.hg19:g.203834763G>A	ENSP00000384006:p.Val359Ile	275.0	0.0		262.0	60.0	NM_024744	B4E1W7|G3V1K7|Q8ND29|Q8WXC0|Q96J78|Q96Q38|Q96Q39|Q9H712	Missense_Mutation	SNP	ENST00000402905.3	hg19	CCDS42801.1	.	.	.	.	.	.	.	.	.	.	G	7.620	0.676562	0.14841	.	.	ENSG00000138380	ENST00000402905;ENST00000414439;ENST00000428585;ENST00000545253;ENST00000545262;ENST00000320443;ENST00000438828	.	.	.	5.26	3.14	0.36123	.	0.358910	0.26499	N	0.024038	T	0.13927	0.0337	N	0.03608	-0.345	0.20563	N	0.999884	B;B;B	0.09022	0.002;0.002;0.002	B;B;B	0.14578	0.011;0.011;0.005	T	0.22277	-1.0221	9	0.17369	T	0.5	-6.165	6.8921	0.24234	0.3049:0.0:0.6951:0.0	.	271;283;359	B4DIA7;G3V1K7;Q8N187	.;.;AL2S8_HUMAN	I	359;257;283;271;283;359;359	.	ENSP00000316224:V359I	V	+	1	0	ALS2CR8	203543008	1.000000	0.71417	0.943000	0.38184	0.995000	0.86356	1.754000	0.38369	1.175000	0.42826	0.650000	0.86243	GTA	.	.		0.313	CARF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335768.5	NM_001104586	
ZDBF2	57683	hgsc.bcm.edu	37	2	207174747	207174747	+	Nonsense_Mutation	SNP	G	G	A			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr2:207174747G>A	ENST00000374423.3	+	5	5881	c.5495G>A	c.(5494-5496)tGg>tAg	p.W1832*		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	1832							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						GGGAAAACATGGTCTCAGATA	0.413																																					p.W1832X		Atlas-SNP	.											.	ZDBF2	531	.	0			c.G5495A						.						79.0	78.0	78.0					2																	207174747		1881	4107	5988	SO:0001587	stop_gained	57683	exon5			AAACATGGTCTCA	AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.5495G>A	chr2.hg19:g.207174747G>A	ENSP00000363545:p.Trp1832*	96.0	0.0		74.0	20.0	NM_020923	Q6ZNP7|Q6ZSN8	Nonsense_Mutation	SNP	ENST00000374423.3	hg19	CCDS46501.1	.	.	.	.	.	.	.	.	.	.	G	48	14.249833	0.99786	.	.	ENSG00000204186	ENST00000374423	.	.	.	5.61	4.72	0.59763	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.7862	0.85575	0.0:0.1287:0.8713:0.0	.	.	.	.	X	1832	.	ENSP00000363545:W1832X	W	+	2	0	ZDBF2	206882992	0.999000	0.42202	0.998000	0.56505	0.998000	0.95712	1.491000	0.35583	1.360000	0.45960	0.644000	0.83932	TGG	.	.		0.413	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336458.1	NM_020923	
GPBAR1	151306	hgsc.bcm.edu	37	2	219127715	219127715	+	Missense_Mutation	SNP	T	T	G	rs536606884		TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr2:219127715T>G	ENST00000522678.1	+	2	1136	c.268T>G	c.(268-270)Ttg>Gtg	p.L90V	GPBAR1_ENST00000519574.1_Missense_Mutation_p.L90V|GPBAR1_ENST00000521462.1_Missense_Mutation_p.L90V|GPBAR1_ENST00000479077.1_Missense_Mutation_p.L90V	NM_001077191.1	NP_001070659.1	Q8TDU6	GPBAR_HUMAN	G protein-coupled bile acid receptor 1	90					cell surface bile acid receptor signaling pathway (GO:0038184)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid receptor activity (GO:0038181)|G-protein coupled bile acid receptor activity (GO:0038182)			cervix(1)|kidney(1)|large_intestine(1)|ovary(1)	4		Renal(207;0.0474)		Epithelial(149;7.19e-07)|all cancers(144;0.000131)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCTCGTCTACTTGGCTCCCAA	0.637																																					p.L90V		Atlas-SNP	.											.	GPBAR1	22	.	0			c.T268G						.						74.0	82.0	79.0					2																	219127715		2174	4262	6436	SO:0001583	missense	151306	exon2			GTCTACTTGGCTC	AB086170	CCDS46515.1	2q35	2012-08-08			ENSG00000179921	ENSG00000179921			19680	protein-coding gene	gene with protein product		610147				12419312	Standard	NM_170699		Approved	BG37, GPCR, TGR5, M-BAR, GPCR19, GPR131, MGC40597	uc010zjw.1	Q8TDU6	OTTHUMG00000155203	ENST00000522678.1:c.268T>G	chr2.hg19:g.219127715T>G	ENSP00000430886:p.Leu90Val	70.0	0.0		54.0	18.0	NM_170699	B3KV35	Missense_Mutation	SNP	ENST00000522678.1	hg19	CCDS46515.1	.	.	.	.	.	.	.	.	.	.	T	3.908	-0.020674	0.07634	.	.	ENSG00000179921	ENST00000479077;ENST00000522678;ENST00000519574;ENST00000521462	T;T;T;T	0.37411	1.2;1.2;1.2;1.2	5.15	-1.53	0.08611	GPCR, rhodopsin-like superfamily (1);	0.202370	0.27139	U	0.020752	T	0.13756	0.0333	N	0.16656	0.425	0.30568	N	0.763791	B	0.25312	0.123	B	0.26202	0.067	T	0.34625	-0.9821	10	0.02654	T	1	-5.0653	4.3523	0.11162	0.1371:0.5287:0.1401:0.1941	.	90	Q8TDU6	GPBAR_HUMAN	V	90	ENSP00000430698:L90V;ENSP00000430886:L90V;ENSP00000430202:L90V;ENSP00000428824:L90V	ENSP00000430698:L90V	L	+	1	2	GPBAR1	218835959	0.163000	0.22920	0.957000	0.39632	0.946000	0.59487	-1.043000	0.03535	-0.103000	0.12175	0.459000	0.35465	TTG	.	.		0.637	GPBAR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338767.3	NM_001077191	
EPHA4	2043	hgsc.bcm.edu	37	2	222347339	222347339	+	Missense_Mutation	SNP	G	G	T			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr2:222347339G>T	ENST00000281821.2	-	5	1092	c.1051C>A	c.(1051-1053)Cct>Act	p.P351T	EPHA4_ENST00000392071.4_Missense_Mutation_p.P300T|EPHA4_ENST00000409854.1_Missense_Mutation_p.P351T|EPHA4_ENST00000409938.1_Missense_Mutation_p.P351T	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4	351	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		GTATTCTGAGGGCTACTCCAT	0.502																																					p.P351T		Atlas-SNP	.											.	EPHA4	263	.	0			c.C1051A						.						133.0	146.0	141.0					2																	222347339		2203	4300	6503	SO:0001583	missense	2043	exon5			TCTGAGGGCTACT	L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.1051C>A	chr2.hg19:g.222347339G>T	ENSP00000281821:p.Pro351Thr	71.0	0.0		83.0	31.0	NM_004438	A8K2P1|B2R601|B7Z6Q8|Q2M380	Missense_Mutation	SNP	ENST00000281821.2	hg19	CCDS2447.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.990779	0.93106	.	.	ENSG00000116106	ENST00000281821;ENST00000409854;ENST00000409938;ENST00000392071;ENST00000443796	T;T;T;T;T	0.63096	0.02;0.02;0.02;0.02;-0.02	5.91	5.91	0.95273	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.86497	0.5947	H	0.95780	3.72	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89505	0.3767	10	0.87932	D	0	.	20.2983	0.98569	0.0:0.0:1.0:0.0	.	351	P54764	EPHA4_HUMAN	T	351;351;351;300;55	ENSP00000281821:P351T;ENSP00000386276:P351T;ENSP00000386829:P351T;ENSP00000375923:P300T;ENSP00000395917:P55T	ENSP00000281821:P351T	P	-	1	0	EPHA4	222055583	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.802000	0.96397	0.655000	0.94253	CCT	.	.		0.502	EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256836.3		
SPHKAP	80309	hgsc.bcm.edu	37	2	228855885	228855885	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr2:228855885G>A	ENST00000392056.3	-	11	4836	c.4790C>T	c.(4789-4791)cCg>cTg	p.P1597L	SPHKAP_ENST00000344657.5_Missense_Mutation_p.P1568L	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	1597						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		TCCCGTAGGCGGTCCAGATGC	0.572																																					p.P1597L		Atlas-SNP	.											.	SPHKAP	750	.	0			c.C4790T						.						59.0	58.0	58.0					2																	228855885		2203	4300	6503	SO:0001583	missense	80309	exon11			GTAGGCGGTCCAG		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.4790C>T	chr2.hg19:g.228855885G>A	ENSP00000375909:p.Pro1597Leu	100.0	0.0		92.0	24.0	NM_001142644	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	ENST00000392056.3	hg19	CCDS46537.1	.	.	.	.	.	.	.	.	.	.	A	0.114	-1.134243	0.01742	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.12255	2.7;2.7	6.17	-4.12	0.03916	A-kinase anchor 110kDa, C-terminal (1);	1.207290	0.05787	N	0.609652	T	0.02304	0.0071	N	0.00197	-1.87	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.39187	-0.9626	10	0.12766	T	0.61	.	4.0356	0.09729	0.4099:0.1064:0.3807:0.103	.	1597;1568	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	L	1597;1568	ENSP00000375909:P1597L;ENSP00000339886:P1568L	ENSP00000339886:P1568L	P	-	2	0	SPHKAP	228564129	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	0.269000	0.18589	-0.926000	0.03770	-0.254000	0.11334	CCG	.	.		0.572	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	NM_030623	
DNER	92737	hgsc.bcm.edu	37	2	230411752	230411752	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr2:230411752C>T	ENST00000341772.4	-	5	1038	c.904G>A	c.(904-906)Gtg>Atg	p.V302M		NM_139072.3	NP_620711.3	Q8NFT8	DNER_HUMAN	delta/notch-like EGF repeat containing	302					central nervous system development (GO:0007417)|endocytosis (GO:0006897)|glial cell differentiation (GO:0010001)|neuron migration (GO:0001764)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|skeletal muscle fiber development (GO:0048741)|synapse assembly (GO:0007416)	dendrite (GO:0030425)|early endosome (GO:0005769)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|clathrin binding (GO:0030276)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(1)|endometrium(7)|kidney(1)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	63		all_lung(227;0.00413)|Renal(207;0.0113)|Lung NSC(271;0.0211)|all_hematologic(139;0.105)|Acute lymphoblastic leukemia(138;0.175)		Epithelial(121;1.4e-11)|all cancers(144;7.7e-09)|LUSC - Lung squamous cell carcinoma(224;0.034)|Lung(119;0.0375)		CTGACCTTCACCACCAGAGTT	0.468																																					p.V302M		Atlas-SNP	.											.	DNER	129	.	0			c.G904A						.						141.0	119.0	126.0					2																	230411752		2203	4300	6503	SO:0001583	missense	92737	exon5			CCTTCACCACCAG	AY358891	CCDS33390.1	2q36.3	2006-10-26			ENSG00000187957	ENSG00000187957			24456	protein-coding gene	gene with protein product		607299				11950833, 11997712	Standard	NM_139072		Approved	UNQ26, bet	uc002vpv.3	Q8NFT8	OTTHUMG00000153637	ENST00000341772.4:c.904G>A	chr2.hg19:g.230411752C>T	ENSP00000345229:p.Val302Met	34.0	0.0		54.0	21.0	NM_139072	A6NP39|Q53R88|Q53TP7|Q53TQ5|Q8IYT0|Q8TB42|Q9NTF1|Q9UDM2	Missense_Mutation	SNP	ENST00000341772.4	hg19	CCDS33390.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.523852	0.85600	.	.	ENSG00000187957	ENST00000341772;ENST00000543700	D	0.87729	-2.29	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	D	0.90669	0.7073	L	0.34521	1.04	0.58432	D	0.999998	D	0.76494	0.999	D	0.80764	0.994	D	0.90652	0.4583	10	0.54805	T	0.06	.	20.0518	0.97629	0.0:1.0:0.0:0.0	.	302	Q8NFT8	DNER_HUMAN	M	302;30	ENSP00000345229:V302M	ENSP00000345229:V302M	V	-	1	0	DNER	230119996	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.427000	0.66483	2.744000	0.94065	0.650000	0.86243	GTG	.	.		0.468	DNER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331902.1	NM_139072	
KCNJ13	3769	hgsc.bcm.edu	37	2	233632998	233632998	+	Missense_Mutation	SNP	A	A	G			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr2:233632998A>G	ENST00000233826.3	-	3	1125	c.986T>C	c.(985-987)cTg>cCg	p.L329P	KCNJ13_ENST00000409779.1_3'UTR|GIGYF2_ENST00000409451.3_Intron|AC064852.4_ENST00000427571.1_RNA|GIGYF2_ENST00000409547.1_Intron|GIGYF2_ENST00000373563.4_Intron|KCNJ13_ENST00000410029.1_Missense_Mutation_p.L329P|GIGYF2_ENST00000373566.3_Intron|GIGYF2_ENST00000409196.3_Intron|GIGYF2_ENST00000409480.1_Intron|GIGYF2_ENST00000452341.2_Intron	NM_002242.4	NP_002233.2	O60928	KCJ13_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 13	329					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)	integral component of membrane (GO:0016021)	inward rectifier potassium channel activity (GO:0005242)			endometrium(3)|large_intestine(2)|lung(2)|stomach(1)|urinary_tract(1)	9		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0306)|Lung NSC(271;0.0908)		Epithelial(121;5.9e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000311)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)|GBM - Glioblastoma multiforme(43;0.0617)		TTTAGAAACCAGAGGAGTTGG	0.413																																					p.L329P		Atlas-SNP	.											.	KCNJ13	18	.	0			c.T986C						.						130.0	132.0	131.0					2																	233632998		2203	4300	6503	SO:0001583	missense	3769	exon3			GAAACCAGAGGAG	AJ006128	CCDS2498.1, CCDS54437.1	2q37	2014-01-28			ENSG00000115474	ENSG00000115474		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6259	protein-coding gene	gene with protein product		603208				9878260, 9620703, 16382105	Standard	NM_002242		Approved	Kir7.1, Kir1.4, LCA16	uc002vtp.3	O60928	OTTHUMG00000153292	ENST00000233826.3:c.986T>C	chr2.hg19:g.233632998A>G	ENSP00000233826:p.Leu329Pro	193.0	0.0		153.0	54.0	NM_002242	A0PGH1|O76023|Q53SA1|Q8N3Y4	Missense_Mutation	SNP	ENST00000233826.3	hg19	CCDS2498.1	.	.	.	.	.	.	.	.	.	.	A	12.02	1.812597	0.32053	.	.	ENSG00000115474	ENST00000233826;ENST00000410029	D;D	0.92048	-2.96;-2.96	6.17	3.87	0.44632	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.772320	0.12006	N	0.508323	D	0.89104	0.6620	L	0.51422	1.61	0.42359	D	0.992407	B	0.26041	0.14	B	0.34346	0.18	D	0.84729	0.0744	10	0.35671	T	0.21	.	6.5608	0.22485	0.8333:0.0:0.1667:0.0	.	329	O60928	IRK13_HUMAN	P	329	ENSP00000233826:L329P;ENSP00000386251:L329P	ENSP00000233826:L329P	L	-	2	0	KCNJ13	233341242	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.375000	0.52410	2.371000	0.80710	0.533000	0.62120	CTG	.	.		0.413	KCNJ13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257036.1	NM_002242	
COL6A3	1293	hgsc.bcm.edu	37	2	238256451	238256451	+	Splice_Site	SNP	C	C	G			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr2:238256451C>G	ENST00000295550.4	-	31	7480	c.7028G>C	c.(7027-7029)aGg>aCg	p.R2343T	COL6A3_ENST00000346358.4_Splice_Site_p.R2143T|COL6A3_ENST00000409809.1_Splice_Site_p.R2137T|COL6A3_ENST00000472056.1_Splice_Site_p.R1736T|COL6A3_ENST00000347401.3_Splice_Site_p.R2142T|COL6A3_ENST00000353578.4_Splice_Site_p.R2137T	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	2343	Collagen-like 5.|Triple-helical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		CAAACTTACCCTTCGGCCTCT	0.507																																					p.R2343T		Atlas-SNP	.											.	COL6A3	608	.	0			c.G7028C						.						146.0	113.0	124.0					2																	238256451		2203	4300	6503	SO:0001630	splice_region_variant	1293	exon31			CTTACCCTTCGGC	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.7029+1G>C	chr2.hg19:g.238256451C>G		55.0	0.0		43.0	10.0	NM_004369	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	hg19	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	C	17.86	3.492166	0.64074	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	D;D;D;D;D;D	0.93488	-3.23;-3.17;-3.17;-2.88;-3.17;-3.17	4.56	4.56	0.56223	.	0.000000	0.52532	D	0.000077	D	0.93871	0.8039	L	0.28054	0.825	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;0.999	D;D;D;D	0.91635	0.999;0.998;0.999;0.976	D	0.93711	0.7024	10	0.40728	T	0.16	.	16.5242	0.84326	0.0:1.0:0.0:0.0	.	1736;1736;2137;2343	E9PFQ6;B7ZMJ7;P12111-2;P12111	.;.;.;CO6A3_HUMAN	T	2343;2142;2137;1736;2137;2143	ENSP00000295550:R2343T;ENSP00000315609:R2142T;ENSP00000315873:R2137T;ENSP00000418285:R1736T;ENSP00000386844:R2137T;ENSP00000295546:R2143T	ENSP00000295550:R2343T	R	-	2	0	COL6A3	237921190	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	4.008000	0.57103	2.374000	0.81015	0.655000	0.94253	AGG	.	.		0.507	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	Missense_Mutation
CTNNB1	1499	hgsc.bcm.edu	37	3	41266097	41266097	+	Missense_Mutation	SNP	G	G	A	rs28931588|rs121913416|rs121913417		TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr3:41266097G>A	ENST00000349496.5	+	3	374	c.94G>A	c.(94-96)Gac>Aac	p.D32N	CTNNB1_ENST00000453024.1_Missense_Mutation_p.D25N|CTNNB1_ENST00000396183.3_Missense_Mutation_p.D32N|CTNNB1_ENST00000396185.3_Missense_Mutation_p.D32N|CTNNB1_ENST00000405570.1_Missense_Mutation_p.D32N	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	32			D -> A (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|D -> G (in PTR and hepatocellular carcinoma). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629}.|D -> Y (in PTR, hepatoblastoma and hepatocellular carcinoma; dbSNP:rs28931588). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:11703283, ECO:0000269|PubMed:9927029}.|Missing (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.D32Y(128)|p.D32N(82)|p.A5_A80del(53)|p.D32H(40)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.WQQQSYLD25?(5)|p.W25_D32del(4)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.S23_S33del(2)|p.V22_S33del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.Y30_S33del(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.S29_H36del(1)|p.D32del(1)|p.M14_S45del(1)|p.Q28_D32>H(1)|p.Q28fs*20(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.Y30_A97del(1)|p.W25_S33del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.Y30_A80del(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.D32fs*9(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.A5_I35del(1)|p.D32_H36del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		GTCTTACCTGGACTCTGGAAT	0.478	D32N(KE39_STOMACH)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.D32N	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,0,2	CTNNB1	4904	.	397	Substitution - Missense(250)|Deletion - In frame(120)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(3)|Complex - frameshift(1)	liver(155)|central_nervous_system(55)|endometrium(40)|stomach(36)|pancreas(28)|large_intestine(22)|pituitary(22)|skin(11)|ovary(9)|soft_tissue(4)|prostate(4)|small_intestine(2)|haematopoietic_and_lymphoid_tissue(2)|bone(2)|adrenal_gland(1)|biliary_tract(1)|urinary_tract(1)|lung(1)|NS(1)	c.G94A						.						92.0	77.0	82.0					3																	41266097		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	TACCTGGACTCTG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.94G>A	chr3.hg19:g.41266097G>A	ENSP00000344456:p.Asp32Asn	147.0	0.0		124.0	37.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	G	30	5.054970	0.93793	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.71567	0.3355	M	0.79614	2.46	0.80722	D	1	D	0.89917	1.0	D	0.72982	0.979	T	0.73824	-0.3861	10	0.87932	D	0	0.3843	19.9596	0.97236	0.0:0.0:1.0:0.0	.	32	P35222	CTNB1_HUMAN	N	25;32;32;32;32;25;32;32;32	ENSP00000400508:D25N;ENSP00000385604:D32N;ENSP00000412219:D32N;ENSP00000379486:D32N;ENSP00000344456:D32N;ENSP00000411226:D25N;ENSP00000379488:D32N;ENSP00000409302:D32N;ENSP00000401599:D32N	ENSP00000344456:D32N	D	+	1	0	CTNNB1	41241101	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.726000	0.93360	0.655000	0.94253	GAC	.	.		0.478	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
GSK3B	2932	hgsc.bcm.edu	37	3	119631579	119631579	+	Missense_Mutation	SNP	A	A	C			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr3:119631579A>C	ENST00000264235.8	-	6	1669	c.687T>G	c.(685-687)ttT>ttG	p.F229L	GSK3B_ENST00000316626.5_Missense_Mutation_p.F229L	NM_001146156.1|NM_002093.3	NP_001139628.1|NP_002084.2	P49841	GSK3B_HUMAN	glycogen synthase kinase 3 beta	229	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell migration (GO:0016477)|cellular response to interleukin-3 (GO:0036016)|cellular response to mechanical stimulus (GO:0071260)|circadian rhythm (GO:0007623)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial to mesenchymal transition (GO:0001837)|ER overload response (GO:0006983)|establishment of cell polarity (GO:0030010)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|fat cell differentiation (GO:0045444)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glycogen metabolic process (GO:0005977)|hippocampus development (GO:0021766)|hypermethylation of CpG island (GO:0044027)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|myoblast fusion (GO:0007520)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle hypertrophy (GO:0010614)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of glycogen (starch) synthase activity (GO:2000466)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of neuron maturation (GO:0014043)|negative regulation of neuron projection development (GO:0010977)|negative regulation of NFAT protein import into nucleus (GO:0051534)|negative regulation of protein binding (GO:0032091)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of type B pancreatic cell development (GO:2000077)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein binding (GO:0032092)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of stem cell differentiation (GO:2000738)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|protein localization to microtubule (GO:0035372)|protein phosphorylation (GO:0006468)|re-entry into mitotic cell cycle (GO:0000320)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of microtubule-based process (GO:0032886)|regulation of neuronal synaptic plasticity (GO:0048168)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|superior temporal gyrus development (GO:0071109)	beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|kinase activity (GO:0016301)|NF-kappaB binding (GO:0051059)|p53 binding (GO:0002039)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II transcription factor binding (GO:0001085)|tau-protein kinase activity (GO:0050321)|ubiquitin protein ligase binding (GO:0031625)			endometrium(1)|large_intestine(8)|lung(7)|prostate(2)	18				GBM - Glioblastoma multiforme(114;0.24)	Lithium(DB01356)	CAGTGGCTCCAAAGATCAACT	0.343																																					p.F229L		Atlas-SNP	.											.	GSK3B	119	.	0			c.T687G						.						69.0	69.0	69.0					3																	119631579		2203	4299	6502	SO:0001583	missense	2932	exon6			GGCTCCAAAGATC	BC012760	CCDS2996.1, CCDS54628.1	3q13.3	2008-02-15			ENSG00000082701	ENSG00000082701			4617	protein-coding gene	gene with protein product		605004				10486203	Standard	NM_002093		Approved		uc003edm.3	P49841	OTTHUMG00000133765	ENST00000264235.8:c.687T>G	chr3.hg19:g.119631579A>C	ENSP00000264235:p.Phe229Leu	66.0	0.0		85.0	21.0	NM_002093	D3DN89|Q9BWH3|Q9UL47	Missense_Mutation	SNP	ENST00000264235.8	hg19	CCDS54628.1	.	.	.	.	.	.	.	.	.	.	A	25.5	4.648256	0.87958	.	.	ENSG00000082701	ENST00000264235;ENST00000316626	T;T	0.62639	0.01;0.01	5.27	5.27	0.74061	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.52224	0.1721	N	0.00652	-1.29	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	T	0.74914	-0.3502	10	0.87932	D	0	-8.6308	15.347	0.74346	1.0:0.0:0.0:0.0	.	229;229	P49841;P49841-2	GSK3B_HUMAN;.	L	229	ENSP00000264235:F229L;ENSP00000324806:F229L	ENSP00000264235:F229L	F	-	3	2	GSK3B	121114269	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.003000	0.57061	2.212000	0.71576	0.460000	0.39030	TTT	.	.		0.343	GSK3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258240.2		
PCDH7	5099	hgsc.bcm.edu	37	4	30724818	30724818	+	Missense_Mutation	SNP	C	C	A			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr4:30724818C>A	ENST00000361762.2	+	1	2782	c.1774C>A	c.(1774-1776)Ctg>Atg	p.L592M	PCDH7_ENST00000543491.1_Missense_Mutation_p.L592M	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	592	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						TGGGGACATCCTGGTCAATAC	0.567																																					p.L592M		Atlas-SNP	.											.	PCDH7	215	.	0			c.C1774A						.						67.0	62.0	64.0					4																	30724818		2203	4300	6503	SO:0001583	missense	5099	exon1			GACATCCTGGTCA	AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.1774C>A	chr4.hg19:g.30724818C>A	ENSP00000355243:p.Leu592Met	54.0	0.0		38.0	11.0	NM_032457	O60246|O60247|Q4W5C4	Missense_Mutation	SNP	ENST00000361762.2	hg19	CCDS33971.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.17|14.17	2.456135|2.456135	0.43634|0.43634	.|.	.|.	ENSG00000169851|ENSG00000169851	ENST00000361762;ENST00000543491;ENST00000333135|ENST00000511884	T;T|.	0.51574|.	0.7;0.7|.	5.37|5.37	5.37|5.37	0.77165|0.77165	Cadherin (4);Cadherin-like (1);|.	.|.	.|.	.|.	.|.	T|T	0.43590|0.43590	0.1254|0.1254	L|L	0.27053|0.27053	0.805|0.805	0.36509|0.36509	D|D	0.869479|0.869479	P;P;P|.	0.47604|.	0.898;0.898;0.783|.	P;P;P|.	0.50314|.	0.601;0.601;0.637|.	T|T	0.46048|0.46048	-0.9219|-0.9219	9|5	0.52906|.	T|.	0.07|.	.|.	8.0026|8.0026	0.30306|0.30306	0.1614:0.7539:0.0:0.0847|0.1614:0.7539:0.0:0.0847	.|.	592;545;592|.	F5GWJ1;O60245-3;O60245|.	.;.;PCDH7_HUMAN|.	M|H	592;592;545|281	ENSP00000355243:L592M;ENSP00000441802:L592M|.	ENSP00000330302:L545M|.	L|P	+|+	1|2	2|0	PCDH7|PCDH7	30333916|30333916	0.997000|0.997000	0.39634|0.39634	0.999000|0.999000	0.59377|0.59377	0.989000|0.989000	0.77384|0.77384	2.457000|2.457000	0.45005|0.45005	2.793000|2.793000	0.96121|0.96121	0.655000|0.655000	0.94253|0.94253	CTG|CCT	.	.		0.567	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360366.1	NM_032457, NM_002589	
DCAF4L1	285429	hgsc.bcm.edu	37	4	41984023	41984023	+	Missense_Mutation	SNP	G	G	T			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr4:41984023G>T	ENST00000333141.5	+	1	311	c.214G>T	c.(214-216)Gac>Tac	p.D72Y		NM_001029955.3	NP_001025126.2	Q3SXM0	DC4L1_HUMAN	DDB1 and CUL4 associated factor 4-like 1	72								p.D72N(1)		breast(1)|endometrium(5)|kidney(6)|large_intestine(11)|lung(12)|prostate(1)|skin(1)	37						TTTGGCGAGCGACCGATTTAA	0.547																																					p.D72Y		Atlas-SNP	.											DCAF4L1,colon,carcinoma,0,1	DCAF4L1	70	.	1	Substitution - Missense(1)	large_intestine(1)	c.G214T						.						96.0	81.0	86.0					4																	41984023		2203	4300	6503	SO:0001583	missense	285429	exon1			GCGAGCGACCGAT	BC035027	CCDS33978.1	4p13	2013-01-09	2009-07-17	2009-07-17		ENSG00000182308		"""WD repeat domain containing"""	27723	protein-coding gene	gene with protein product			"""WD repeat domain 21B"""	WDR21B			Standard	NM_001029955		Approved		uc003gwk.2	Q3SXM0		ENST00000333141.5:c.214G>T	chr4.hg19:g.41984023G>T	ENSP00000327796:p.Asp72Tyr	107.0	0.0		96.0	4.0	NM_001029955	B3KVI3|Q3ZCW8|Q499Y5|Q9UFI0	Missense_Mutation	SNP	ENST00000333141.5	hg19	CCDS33978.1	.	.	.	.	.	.	.	.	.	.	G	4.057	0.008362	0.07912	.	.	ENSG00000182308	ENST00000333141	T	0.45668	0.89	0.688	-0.52	0.11935	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.182934	0.64402	D	0.000015	T	0.30293	0.0760	M	0.61703	1.905	0.19775	N	0.999956	B	0.29253	0.239	B	0.16289	0.015	T	0.12941	-1.0528	9	0.45353	T	0.12	.	.	.	.	.	72	Q3SXM0	DC4L1_HUMAN	Y	72	ENSP00000327796:D72Y	ENSP00000327796:D72Y	D	+	1	0	DCAF4L1	41678780	0.993000	0.37304	0.023000	0.16930	0.003000	0.03518	0.617000	0.24359	-0.335000	0.08451	-0.657000	0.03884	GAC	.	.		0.547	DCAF4L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360958.1	NM_001029955	
KIAA1109	84162	hgsc.bcm.edu	37	4	123267816	123267816	+	Missense_Mutation	SNP	A	A	G			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr4:123267816A>G	ENST00000264501.4	+	75	13145	c.12772A>G	c.(12772-12774)Atg>Gtg	p.M4258V	KIAA1109_ENST00000388738.3_Missense_Mutation_p.M4258V			Q2LD37	K1109_HUMAN	KIAA1109	4258					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						TAAATATGATATGCGCCGACT	0.358																																					p.M4258V		Atlas-SNP	.											.	KIAA1109	424	.	0			c.A12772G						.						169.0	153.0	158.0					4																	123267816		1852	4094	5946	SO:0001583	missense	84162	exon73			TATGATATGCGCC	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.12772A>G	chr4.hg19:g.123267816A>G	ENSP00000264501:p.Met4258Val	52.0	0.0		63.0	21.0	NM_015312	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	hg19	CCDS43267.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	23.8|23.8	4.462346|4.462346	0.84425|0.84425	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000306802|ENST00000264501;ENST00000388738;ENST00000438707	.|T;T;T	.|0.39406	.|2.06;2.06;1.08	5.84|5.84	5.84|5.84	0.93424|0.93424	.|.	.|0.041700	.|0.85682	.|N	.|0.000000	T|T	0.63046|0.63046	0.2478|0.2478	M|M	0.72894|0.72894	2.215|2.215	0.80722|0.80722	D|D	1|1	.|P;P	.|0.45715	.|0.811;0.865	.|P;P	.|0.60789	.|0.879;0.824	T|T	0.64719|0.64719	-0.6341|-0.6341	5|10	.|0.62326	.|D	.|0.03	.|.	16.2302|16.2302	0.82332|0.82332	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|4257;4258	.|Q2LD37-4;Q2LD37	.|.;K1109_HUMAN	M|V	633|4258;4258;927	.|ENSP00000264501:M4258V;ENSP00000373390:M4258V;ENSP00000410874:M927V	.|ENSP00000264501:M4258V	I|M	+|+	3|1	3|0	KIAA1109|KIAA1109	123487266|123487266	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.339000|9.339000	0.96797|0.96797	2.228000|2.228000	0.72767|0.72767	0.533000|0.533000	0.62120|0.62120	ATA|ATG	.	.		0.358	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
SLC1A3	6507	hgsc.bcm.edu	37	5	36686198	36686198	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr5:36686198G>A	ENST00000265113.4	+	10	1932	c.1456G>A	c.(1456-1458)Gga>Aga	p.G486R	CTD-2353F22.1_ENST00000510740.1_RNA|SLC1A3_ENST00000381918.3_Missense_Mutation_p.G441R	NM_004172.4	NP_004163.3	P43003	EAA1_HUMAN	solute carrier family 1 (glial high affinity glutamate transporter), member 3	486					auditory behavior (GO:0031223)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cranial nerve development (GO:0021545)|D-aspartate import (GO:0070779)|gamma-aminobutyric acid biosynthetic process (GO:0009449)|glutamate biosynthetic process (GO:0006537)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|neuromuscular process controlling balance (GO:0050885)|neurotransmitter uptake (GO:0001504)|positive regulation of synaptic transmission (GO:0050806)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|response to light stimulus (GO:0009416)|response to wounding (GO:0009611)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell projection (GO:0042995)|cell surface (GO:0009986)|fibril (GO:0043205)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	glutamate binding (GO:0016595)|high-affinity glutamate transmembrane transporter activity (GO:0005314)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(23)|skin(1)	41	all_lung(31;0.000245)		Epithelial(62;0.0444)|Lung(74;0.111)|all cancers(62;0.128)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CAACGTACTGGGAGACTCCCT	0.512																																					p.G486R		Atlas-SNP	.											.	SLC1A3	88	.	0			c.G1456A						.						91.0	91.0	91.0					5																	36686198		2203	4300	6503	SO:0001583	missense	6507	exon10			GTACTGGGAGACT		CCDS3919.1, CCDS54844.1	5p13	2013-05-22			ENSG00000079215	ENSG00000079215		"""Solute carriers"""	10941	protein-coding gene	gene with protein product	"""glutamate transporter variant EAAT1ex9skip"""	600111				7521911, 7698014	Standard	NM_004172		Approved	EAAT1, GLAST, EA6	uc003jkj.4	P43003	OTTHUMG00000090793	ENST00000265113.4:c.1456G>A	chr5.hg19:g.36686198G>A	ENSP00000265113:p.Gly486Arg	89.0	0.0		81.0	6.0	NM_004172	B2R5T3|Q4JCQ8	Missense_Mutation	SNP	ENST00000265113.4	hg19	CCDS3919.1	.	.	.	.	.	.	.	.	.	.	G	36	5.598926	0.96614	.	.	ENSG00000079215	ENST00000265113;ENST00000427100;ENST00000381918	T;T	0.68765	-0.35;-0.29	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	D	0.89770	0.6811	H	0.98370	4.215	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.93402	0.6761	10	0.87932	D	0	-13.2793	19.6689	0.95903	0.0:0.0:1.0:0.0	.	441;486	Q4JCQ8;P43003	.;EAA1_HUMAN	R	486;434;441	ENSP00000265113:G486R;ENSP00000371343:G441R	ENSP00000265113:G486R	G	+	1	0	SLC1A3	36721955	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.776000	0.99001	2.642000	0.89623	0.655000	0.94253	GGA	.	.		0.512	SLC1A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207579.2	NM_004172	
EPB41L4A	64097	hgsc.bcm.edu	37	5	111600696	111600696	+	Missense_Mutation	SNP	C	C	A			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr5:111600696C>A	ENST00000261486.5	-	6	727	c.451G>T	c.(451-453)Gac>Tac	p.D151Y		NM_022140.3	NP_071423	Q9HCS5	E41LA_HUMAN	erythrocyte membrane protein band 4.1 like 4A	151	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)				breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(2)|skin(1)	34		all_cancers(142;4.93e-06)|all_epithelial(76;2.28e-08)|Prostate(80;0.000244)|Colorectal(10;0.000788)|Ovarian(225;0.0448)|Lung NSC(167;0.126)|all_lung(232;0.135)		OV - Ovarian serous cystadenocarcinoma(64;6.24e-09)|Epithelial(69;1.43e-07)|all cancers(49;2.78e-05)|COAD - Colon adenocarcinoma(37;0.0467)|Colorectal(14;0.0791)		TTATATGGGTCATAATCTCCA	0.328																																					p.D151Y		Atlas-SNP	.											.	EPB41L4A	130	.	0			c.G451T						.						137.0	125.0	129.0					5																	111600696		1819	4078	5897	SO:0001583	missense	64097	exon6			ATGGGTCATAATC	AB030240	CCDS43350.1	5q21.3	2008-02-05			ENSG00000129595	ENSG00000129595			13278	protein-coding gene	gene with protein product		612141				10874211	Standard	XM_005272043		Approved	NBL4	uc003kpv.1	Q9HCS5	OTTHUMG00000162902	ENST00000261486.5:c.451G>T	chr5.hg19:g.111600696C>A	ENSP00000261486:p.Asp151Tyr	86.0	0.0		78.0	17.0	NM_022140	A4FUI6	Missense_Mutation	SNP	ENST00000261486.5	hg19	CCDS43350.1	.	.	.	.	.	.	.	.	.	.	C	18.74	3.687873	0.68271	.	.	ENSG00000129595	ENST00000261486	T	0.74002	-0.8	5.46	4.59	0.56863	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.000000	0.85682	D	0.000000	D	0.89996	0.6877	H	0.96430	3.82	0.40568	D	0.981277	D	0.89917	1.0	D	0.97110	1.0	D	0.92928	0.6361	10	0.87932	D	0	.	13.3554	0.60625	0.0:0.9224:0.0:0.0776	.	151	Q9HCS5	E41LA_HUMAN	Y	151	ENSP00000261486:D151Y	ENSP00000261486:D151Y	D	-	1	0	EPB41L4A	111628595	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	6.052000	0.71080	1.308000	0.44962	0.650000	0.86243	GAC	.	.		0.328	EPB41L4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370969.1		
ACSL6	23305	hgsc.bcm.edu	37	5	131324528	131324528	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr5:131324528G>A	ENST00000379240.1	-	6	700	c.547C>T	c.(547-549)Cct>Tct	p.P183S	ACSL6_ENST00000544770.1_Missense_Mutation_p.P92S|ACSL6_ENST00000379246.1_Missense_Mutation_p.P194S|ACSL6_ENST00000379249.3_Missense_Mutation_p.P183S|ACSL6_ENST00000543479.1_Missense_Mutation_p.P183S|ACSL6_ENST00000379255.1_Missense_Mutation_p.P148S|ACSL6_ENST00000431707.1_Missense_Mutation_p.P148S|ACSL6_ENST00000296869.4_Missense_Mutation_p.P208S|ACSL6_ENST00000379264.2_Missense_Mutation_p.P208S|ACSL6_ENST00000357096.1_Missense_Mutation_p.P148S|ACSL6_ENST00000379272.2_Missense_Mutation_p.P183S|ACSL6_ENST00000379244.1_Missense_Mutation_p.P183S			Q9UKU0	ACSL6_HUMAN	acyl-CoA synthetase long-chain family member 6	183					acyl-CoA metabolic process (GO:0006637)|cellular lipid metabolic process (GO:0044255)|cellular response to insulin stimulus (GO:0032869)|fatty acid transport (GO:0015908)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|neuroblast proliferation (GO:0007405)|neuron development (GO:0048666)|phospholipid biosynthetic process (GO:0008654)|positive regulation of neuron projection development (GO:0010976)|positive regulation of plasma membrane long-chain fatty acid transport (GO:0010747)|positive regulation of triglyceride biosynthetic process (GO:0010867)|response to gravity (GO:0009629)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|long-chain fatty acid-CoA ligase activity (GO:0004467)|protein homodimerization activity (GO:0042803)			NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	35		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			ATAGCCCCAGGGCCCAGGGTG	0.602																																					p.P208S		Atlas-SNP	.											.	ACSL6	169	.	0			c.C622T						.						125.0	122.0	123.0					5																	131324528		2203	4300	6503	SO:0001583	missense	23305	exon6			CCCCAGGGCCCAG	AB020644	CCDS34228.1, CCDS34229.1, CCDS56381.1, CCDS56382.1, CCDS56383.1	5q31	2008-02-05	2004-02-19	2004-02-20	ENSG00000164398	ENSG00000164398		"""Acyl-CoA synthetase family"""	16496	protein-coding gene	gene with protein product		604443	"""fatty-acid-Coenzyme A ligase, long-chain 6"""	FACL6		10502316, 10548543	Standard	NM_015256		Approved	KIAA0837, ACS2, LACS5, LACS2	uc003kvy.2	Q9UKU0	OTTHUMG00000150692	ENST00000379240.1:c.547C>T	chr5.hg19:g.131324528G>A	ENSP00000368542:p.Pro183Ser	42.0	0.0		35.0	10.0	NM_001009185	J3KPG3|O94924|O95829|Q108M9|Q108N0|Q4G191|Q86TN7	Missense_Mutation	SNP	ENST00000379240.1	hg19		.	.	.	.	.	.	.	.	.	.	G	12.86	2.064624	0.36470	.	.	ENSG00000164398	ENST00000379249;ENST00000379264;ENST00000379272;ENST00000357096;ENST00000379255;ENST00000296869;ENST00000379246;ENST00000379244;ENST00000544770;ENST00000379240;ENST00000431707;ENST00000543479;ENST00000434099;ENST00000430403	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.40225	1.04;1.04;1.04;1.04;1.04;1.04;1.04;1.04;1.04;1.04;1.04;1.04;1.04;1.04	5.79	5.79	0.91817	AMP-dependent synthetase/ligase (1);	0.156891	0.64402	D	0.000016	T	0.43545	0.1252	L	0.46670	1.46	0.51767	D	0.999936	B;B;B;B;B;B;B	0.19445	0.014;0.029;0.036;0.01;0.029;0.029;0.029	B;B;B;B;B;B;B	0.25405	0.025;0.036;0.06;0.042;0.02;0.053;0.036	T	0.20874	-1.0262	10	0.46703	T	0.11	.	20.0263	0.97523	0.0:0.0:1.0:0.0	.	183;183;173;183;148;208;208	Q9UKU0-3;Q9UKU0-6;B4DFW3;Q9UKU0;Q9UKU0-7;Q9UKU0-1;Q9UKU0-8	.;.;.;ACSL6_HUMAN;.;.;.	S	183;208;183;148;148;208;194;183;92;183;148;183;148;183	ENSP00000368551:P183S;ENSP00000368566:P208S;ENSP00000368574:P183S;ENSP00000349608:P148S;ENSP00000368557:P148S;ENSP00000296869:P208S;ENSP00000368548:P194S;ENSP00000368546:P183S;ENSP00000445154:P92S;ENSP00000368542:P183S;ENSP00000413329:P148S;ENSP00000442124:P183S;ENSP00000397507:P148S;ENSP00000398423:P183S	ENSP00000296869:P208S	P	-	1	0	ACSL6	131352427	1.000000	0.71417	0.999000	0.59377	0.447000	0.32167	4.936000	0.63506	2.735000	0.93741	0.655000	0.94253	CCT	.	.		0.602	ACSL6-004	NOVEL	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000132622.1	NM_015256	
SPOCK1	6695	hgsc.bcm.edu	37	5	136314459	136314459	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr5:136314459G>A	ENST00000394945.1	-	11	1373	c.1204C>T	c.(1204-1206)Cgg>Tgg	p.R402W	SPOCK1_ENST00000509978.1_5'Flank|SPOCK1_ENST00000282223.7_Missense_Mutation_p.R402W	NM_004598.3	NP_004589.1	Q08629	TICN1_HUMAN	sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1	402					cell adhesion (GO:0007155)|central nervous system neuron differentiation (GO:0021953)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron projection development (GO:0010977)|nervous system development (GO:0007399)|neurogenesis (GO:0022008)|neuron migration (GO:0001764)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|postsynaptic density (GO:0014069)|proteinaceous extracellular matrix (GO:0005578)|sarcoplasm (GO:0016528)	calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(2)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CCCAGCTCCCGTTCATATTCT	0.517																																					p.R402W		Atlas-SNP	.											.	SPOCK1	58	.	0			c.C1204T						.						145.0	126.0	133.0					5																	136314459		2203	4300	6503	SO:0001583	missense	6695	exon11			GCTCCCGTTCATA	AF231124	CCDS4191.1	5q31.2	2008-02-05	2005-11-04	2005-11-04	ENSG00000152377	ENSG00000152377			11251	protein-coding gene	gene with protein product		602264	"""sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican)"""	TIC1, SPOCK		9545645	Standard	NM_004598		Approved	testican-1	uc003lbp.3	Q08629	OTTHUMG00000129157	ENST00000394945.1:c.1204C>T	chr5.hg19:g.136314459G>A	ENSP00000378401:p.Arg402Trp	143.0	0.0		139.0	30.0	NM_004598	B3KSW3|Q59EW0|Q8N630|Q9UCL8	Missense_Mutation	SNP	ENST00000394945.1	hg19	CCDS4191.1	.	.	.	.	.	.	.	.	.	.	G	12.09	1.834025	0.32421	.	.	ENSG00000152377	ENST00000394945;ENST00000282223	T;T	0.47177	0.85;0.85	5.16	1.3	0.21679	.	0.370343	0.27622	N	0.018560	T	0.28797	0.0714	N	0.22421	0.69	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.18304	-1.0341	10	0.72032	D	0.01	.	5.4803	0.16719	0.1505:0.0:0.5737:0.2758	.	402	Q08629	TICN1_HUMAN	W	402	ENSP00000378401:R402W;ENSP00000282223:R402W	ENSP00000282223:R402W	R	-	1	2	SPOCK1	136342358	1.000000	0.71417	0.131000	0.22000	0.884000	0.51177	4.144000	0.58057	-0.056000	0.13221	0.557000	0.71058	CGG	.	.		0.517	SPOCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251222.1	NM_004598	
PCDHA1	56147	hgsc.bcm.edu	37	5	140167891	140167891	+	Silent	SNP	C	C	T	rs540450492		TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr5:140167891C>T	ENST00000504120.2	+	1	2016	c.2016C>T	c.(2014-2016)agC>agT	p.S672S	PCDHA1_ENST00000378133.3_Silent_p.S672S|PCDHA1_ENST00000394633.3_Intron	NM_018900.2	NP_061723.1	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1	672	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(34)|prostate(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(3)	70			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGTGGAGAGCGGCCAGGCGC	0.652													.|||	1	0.000199681	0.0	0.0	5008	,	,		16720	0.0		0.001	False		,,,				2504	0.0				p.S672S		Atlas-SNP	.											PCDHA1_ENST00000504120,NS,carcinoma,0,2	PCDHA1	387	.	0			c.C2016T						.						42.0	47.0	45.0					5																	140167891		2201	4300	6501	SO:0001819	synonymous_variant	56147	exon1			GGAGAGCGGCCAG	AF152479	CCDS54912.1, CCDS54913.1	5q31	2010-11-26				ENSG00000204970		"""Cadherins / Protocadherins : Clustered"""	8663	other	complex locus constituent	"""KIAA0345-like 13"""	606307				10380929	Standard	NM_018900		Approved			Q9Y5I3		ENST00000504120.2:c.2016C>T	chr5.hg19:g.140167891C>T		51.0	0.0		57.0	12.0	NM_031410	O75288|Q9NRT7	Silent	SNP	ENST00000504120.2	hg19	CCDS54913.1																																																																																			.	.		0.652	PCDHA1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389127.1	NM_018900	
EBF1	1879	hgsc.bcm.edu	37	5	158158108	158158108	+	Missense_Mutation	SNP	C	C	G			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr5:158158108C>G	ENST00000313708.6	-	11	1376	c.1094G>C	c.(1093-1095)cGg>cCg	p.R365P	EBF1_ENST00000517373.1_Missense_Mutation_p.R357P|EBF1_ENST00000518836.1_5'UTR|EBF1_ENST00000380654.4_Missense_Mutation_p.R334P	NM_024007.3	NP_076870.1	Q9UH73	COE1_HUMAN	early B-cell factor 1	365					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)		HMGA2/EBF1(2)	breast(3)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(18)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ACCAGGGTGCCGAGGAATGAC	0.438			T	HMGA2	lipoma																																p.R365P		Atlas-SNP	.		Dom	yes		5	5q34	1879	early B-cell factor 1		M	.	EBF1	110	.	0			c.G1094C						.						69.0	68.0	68.0					5																	158158108		2203	4300	6503	SO:0001583	missense	1879	exon11			GGGTGCCGAGGAA	AF208502	CCDS4343.1	5q34	2008-02-05	2006-09-26	2006-09-26	ENSG00000164330	ENSG00000164330			3126	protein-coding gene	gene with protein product		164343	"""early B-cell factor"""	EBF		8012110	Standard	NM_024007		Approved	OLF1	uc010jip.3	Q9UH73	OTTHUMG00000130304	ENST00000313708.6:c.1094G>C	chr5.hg19:g.158158108C>G	ENSP00000322898:p.Arg365Pro	29.0	0.0		34.0	8.0	NM_024007	Q8IW11	Missense_Mutation	SNP	ENST00000313708.6	hg19	CCDS4343.1	.	.	.	.	.	.	.	.	.	.	C	33	5.236483	0.95240	.	.	ENSG00000164330	ENST00000318060;ENST00000313708;ENST00000380654;ENST00000517373	T;T;T	0.44881	0.91;0.91;0.91	5.51	5.51	0.81932	Helix-loop-helix DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.70002	0.3174	M	0.85197	2.74	0.58432	D	0.999999	D;D;D;D	0.76494	0.998;0.998;0.999;0.999	D;D;D;D	0.74674	0.934;0.975;0.963;0.984	T	0.73448	-0.3979	10	0.62326	D	0.03	-5.5481	19.7818	0.96418	0.0:1.0:0.0:0.0	.	365;352;365;334	A8K0Z7;B4E2U8;Q9UH73;Q9UH73-2	.;.;COE1_HUMAN;.	P	365;365;334;357	ENSP00000322898:R365P;ENSP00000370029:R334P;ENSP00000428020:R357P	ENSP00000322898:R365P	R	-	2	0	EBF1	158090686	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.445000	0.80570	2.736000	0.93811	0.655000	0.94253	CGG	.	.		0.438	EBF1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000252649.1	NM_024007	
NPM1	4869	hgsc.bcm.edu	37	5	170837534	170837534	+	Missense_Mutation	SNP	A	A	G			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr5:170837534A>G	ENST00000296930.5	+	11	1151	c.850A>G	c.(850-852)Att>Gtt	p.I284V	NPM1_ENST00000351986.6_Missense_Mutation_p.I255V|NPM1_ENST00000517671.1_Missense_Mutation_p.I284V	NM_002520.6	NP_002511.1	P06748	NPM_HUMAN	nucleophosmin (nucleolar phosphoprotein B23, numatrin)	284	Required for nucleolar localization.				cell aging (GO:0007569)|CENP-A containing nucleosome assembly (GO:0034080)|centrosome cycle (GO:0007098)|DNA repair (GO:0006281)|intracellular protein transport (GO:0006886)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of centrosome duplication (GO:0010826)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|nucleocytoplasmic transport (GO:0006913)|nucleosome assembly (GO:0006334)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of translation (GO:0045727)|protein localization (GO:0008104)|protein oligomerization (GO:0051259)|regulation of centriole replication (GO:0046599)|regulation of eIF2 alpha phosphorylation by dsRNA (GO:0060735)|regulation of endodeoxyribonuclease activity (GO:0032071)|regulation of endoribonuclease activity (GO:0060699)|response to stress (GO:0006950)|ribosome assembly (GO:0042255)|signal transduction (GO:0007165)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle pole centrosome (GO:0031616)	histone binding (GO:0042393)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein kinase inhibitor activity (GO:0004860)|ribosomal large subunit binding (GO:0043023)|ribosomal small subunit binding (GO:0043024)|RNA binding (GO:0003723)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|unfolded protein binding (GO:0051082)		NPM1/ALK(632)	central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(4261)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	4269	Renal(175;0.000159)|Lung NSC(126;0.00576)|all_lung(126;0.00963)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TTTCCAGGCTATTCAAGATCT	0.289			"""T, F """	"""ALK, RARA, MLF1"""	"""NHL, APL, AML"""																																p.I284V		Atlas-SNP	.		Dom	yes		5	5q35	4869	"""nucleophosmin (nucleolar phosphoprotein B23, numatrin)"""		L	.	NPM1	5003	.	0			c.A850G						.						105.0	101.0	102.0					5																	170837534		1811	4077	5888	SO:0001583	missense	4869	exon11			CAGGCTATTCAAG	M26697	CCDS4376.1, CCDS4377.1, CCDS43399.1	5q35.1	2014-09-17			ENSG00000181163	ENSG00000181163			7910	protein-coding gene	gene with protein product	"""nucleolar phosphoprotein B23"", ""numatrin"", ""nucleophosmin/nucleoplasmin family, member 1"""	164040				8471164, 8122112	Standard	NM_002520		Approved	B23, NPM	uc003mbi.3	P06748	OTTHUMG00000130465	ENST00000296930.5:c.850A>G	chr5.hg19:g.170837534A>G	ENSP00000296930:p.Ile284Val	29.0	0.0		28.0	9.0	NM_002520	A8K3N7|B5BU00|D3DQL6|P08693|Q12826|Q13440|Q13441|Q14115|Q5EU94|Q5EU95|Q5EU96|Q5EU97|Q5EU98|Q5EU99|Q6V962|Q8WTW5|Q96AT6|Q96DC4|Q96EA5|Q9BYG9|Q9UDJ7	Missense_Mutation	SNP	ENST00000296930.5	hg19	CCDS4376.1	.	.	.	.	.	.	.	.	.	.	A	12.37	1.918739	0.33908	.	.	ENSG00000181163	ENST00000517671;ENST00000296930;ENST00000351986	T;T;T	0.50001	0.76;0.76;0.76	4.75	4.75	0.60458	.	0.313249	0.29730	U	0.011343	T	0.43233	0.1238	L	0.50919	1.6	0.80722	D	1	B;B	0.22080	0.01;0.064	B;B	0.23716	0.024;0.048	T	0.34976	-0.9807	10	0.39692	T	0.17	.	12.8646	0.57932	1.0:0.0:0.0:0.0	.	255;284	P06748-2;P06748	.;NPM_HUMAN	V	284;284;255	ENSP00000428755:I284V;ENSP00000296930:I284V;ENSP00000341168:I255V	ENSP00000296930:I284V	I	+	1	0	NPM1	170770139	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	5.601000	0.67606	1.916000	0.55485	0.397000	0.26171	ATT	.	.		0.289	NPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252858.2	NM_002520	
TRIM26	7726	hgsc.bcm.edu	37	6	30156977	30156977	+	Splice_Site	SNP	C	C	A			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr6:30156977C>A	ENST00000454678.2	-	9	1341		c.e9-1		TRIM26_ENST00000437089.1_Splice_Site|TRIM26_ENST00000453195.1_Splice_Site	NM_003449.4	NP_003440.1	Q12899	TRI26_HUMAN	tripartite motif containing 26						innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)	cytoplasm (GO:0005737)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)			lung(1)|ovary(2)	3						AGCAGCTTCCCTGGGGAGAAA	0.448																																					.		Atlas-SNP	.											.	TRIM26	74	.	0			c.905-1G>T						.						120.0	133.0	128.0					6																	30156977		1511	2709	4220	SO:0001630	splice_region_variant	7726	exon10			GCTTCCCTGGGGA	AB088090	CCDS4678.1	6p21.3	2013-01-09	2011-01-25	2001-11-23	ENSG00000234127	ENSG00000234127		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	12962	protein-coding gene	gene with protein product		600830	"""tripartite motif-containing 26"""	ZNF173		8530076	Standard	NM_003449		Approved	RNF95	uc003npt.3	Q12899	OTTHUMG00000031041	ENST00000454678.2:c.905-1G>T	chr6.hg19:g.30156977C>A		39.0	0.0		30.0	7.0	NM_003449	A6NG96|Q5SRL2	Splice_Site	SNP	ENST00000454678.2	hg19	CCDS4678.1	.	.	.	.	.	.	.	.	.	.	C	17.43	3.388320	0.61956	.	.	ENSG00000234127	ENST00000453195;ENST00000454678;ENST00000437089	.	.	.	5.76	5.76	0.90799	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.4618	0.75363	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TRIM26	30264956	1.000000	0.71417	0.666000	0.29783	0.992000	0.81027	2.566000	0.45948	2.713000	0.92767	0.453000	0.30009	.	.	.		0.448	TRIM26-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253442.1	NM_003449	Intron
DNAH8	1769	hgsc.bcm.edu	37	6	38795995	38795995	+	Silent	SNP	A	A	G	rs368262519		TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr6:38795995A>G	ENST00000359357.3	+	28	3722	c.3468A>G	c.(3466-3468)gaA>gaG	p.E1156E	DNAH8_ENST00000441566.1_Silent_p.E1156E|DNAH8_ENST00000449981.2_Silent_p.E1373E			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	1156					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						TTGAAGTTGAAGTAACCAAAG	0.343																																					p.E1373E		Atlas-SNP	.											.	DNAH8	1239	.	0			c.A4119G						.	A		0,4406		0,0,2203	119.0	120.0	120.0		4119	3.2	1.0	6		120	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	DNAH8	NM_001206927.1		0,1,6502	GG,GA,AA		0.0116,0.0,0.0077		1373/4708	38795995	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	1769	exon30			AGTTGAAGTAACC	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.3468A>G	chr6.hg19:g.38795995A>G		44.0	0.0		55.0	13.0	NM_001206927	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Silent	SNP	ENST00000359357.3	hg19																																																																																				.	.		0.343	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
TREM1	54210	hgsc.bcm.edu	37	6	41250178	41250178	+	Missense_Mutation	SNP	C	C	G	rs565227078		TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr6:41250178C>G	ENST00000244709.4	-	2	424	c.361G>C	c.(361-363)Gag>Cag	p.E121Q	TREM1_ENST00000334475.6_Missense_Mutation_p.E121Q|TREM1_ENST00000591620.1_Missense_Mutation_p.E121Q|TREM1_ENST00000589614.1_Missense_Mutation_p.E121Q	NM_018643.3	NP_061113.1	Q9NP99	TREM1_HUMAN	triggering receptor expressed on myeloid cells 1	121	Ig-like V-type.				blood coagulation (GO:0007596)|chemokine metabolic process (GO:0050755)|cytokine secretion involved in immune response (GO:0002374)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|neutrophil mediated killing of gram-negative bacterium (GO:0070945)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|scaffold protein binding (GO:0097110)			NS(1)|breast(2)|endometrium(2)|large_intestine(5)|lung(5)|skin(1)	16	Ovarian(28;0.0327)|Colorectal(47;0.196)					ATGTGAGGCTCCTTGGGAGGC	0.547																																					p.E121Q		Atlas-SNP	.											.	TREM1	38	.	0			c.G361C						.						75.0	58.0	64.0					6																	41250178		2203	4300	6503	SO:0001583	missense	54210	exon2			GAGGCTCCTTGGG	AF196329	CCDS4854.1, CCDS56427.1, CCDS59499.1	6p21.1	2013-01-11			ENSG00000124731	ENSG00000124731		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	17760	protein-coding gene	gene with protein product		605085				11922939, 10799849	Standard	NM_018643		Approved	TREM-1, CD354	uc003oqf.2	Q9NP99	OTTHUMG00000014674	ENST00000244709.4:c.361G>C	chr6.hg19:g.41250178C>G	ENSP00000244709:p.Glu121Gln	95.0	0.0		84.0	22.0	NM_001242590	B4DWG2|K7EJW1|Q53FL8|Q5T2C9|Q86YU1	Missense_Mutation	SNP	ENST00000244709.4	hg19	CCDS4854.1	.	.	.	.	.	.	.	.	.	.	C	9.740	1.164583	0.21538	.	.	ENSG00000124731	ENST00000244709;ENST00000334475	T;T	0.66099	-0.19;-0.19	4.37	0.483	0.16820	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	1.214900	0.05966	N	0.641400	T	0.28532	0.0706	L	0.40543	1.245	0.09310	N	1	B;B	0.25390	0.103;0.125	B;B	0.19391	0.015;0.025	T	0.28681	-1.0036	10	0.54805	T	0.06	-2.4557	4.262	0.10745	0.0:0.5478:0.1687:0.2835	.	121;121	Q9NP99-2;Q9NP99	.;TREM1_HUMAN	Q	121	ENSP00000244709:E121Q;ENSP00000334284:E121Q	ENSP00000244709:E121Q	E	-	1	0	TREM1	41358156	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.410000	0.21098	-0.024000	0.13941	0.591000	0.81541	GAG	.	.		0.547	TREM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040505.2	NM_018643	
COL9A1	1297	hgsc.bcm.edu	37	6	71009833	71009833	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr6:71009833C>T	ENST00000357250.6	-	4	370	c.212G>A	c.(211-213)aGa>aAa	p.R71K	COL9A1_ENST00000370496.3_Missense_Mutation_p.R71K	NM_001851.4	NP_001842.3	P20849	CO9A1_HUMAN	collagen, type IX, alpha 1	71	Laminin G-like.|Nonhelical region (NC4).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|organ morphogenesis (GO:0009887)|tissue homeostasis (GO:0001894)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(44)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)	80						GATAGCTCTTCTAGATGCTGC	0.373																																					p.R71K		Atlas-SNP	.											.	COL9A1	228	.	0			c.G212A						.						90.0	86.0	87.0					6																	71009833		2203	4300	6503	SO:0001583	missense	1297	exon4			GCTCTTCTAGATG		CCDS4971.1, CCDS47447.1	6q13	2013-05-07			ENSG00000112280	ENSG00000112280		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2217	protein-coding gene	gene with protein product		120210				1429648	Standard	NM_001851		Approved		uc003pfg.4	P20849	OTTHUMG00000014988	ENST00000357250.6:c.212G>A	chr6.hg19:g.71009833C>T	ENSP00000349790:p.Arg71Lys	129.0	0.0		144.0	51.0	NM_001851	Q13699|Q13700|Q5TF52|Q6P467|Q96BM8|Q99225|Q9H151|Q9H152|Q9Y6P2|Q9Y6P3	Missense_Mutation	SNP	ENST00000357250.6	hg19	CCDS4971.1	.	.	.	.	.	.	.	.	.	.	C	9.851	1.193720	0.22037	.	.	ENSG00000112280	ENST00000357250;ENST00000370496	T;T	0.02067	4.47;4.47	5.66	4.8	0.61643	Concanavalin A-like lectin/glucanase (1);Laminin G, thrombospondin-type, N-terminal (1);	0.693949	0.15450	N	0.261729	T	0.00552	0.0018	N	0.11892	0.195	0.80722	D	1	B	0.06786	0.001	B	0.08055	0.003	T	0.49418	-0.8942	10	0.18276	T	0.48	.	6.5798	0.22588	0.1466:0.6955:0.0:0.1579	.	71	P20849	CO9A1_HUMAN	K	71	ENSP00000349790:R71K;ENSP00000359527:R71K	ENSP00000349790:R71K	R	-	2	0	COL9A1	71066554	0.972000	0.33761	0.990000	0.47175	0.984000	0.73092	1.310000	0.33551	1.538000	0.49270	0.650000	0.86243	AGA	.	.		0.373	COL9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041131.2		
EEF1A1	1915	hgsc.bcm.edu	37	6	74227627	74227628	+	Missense_Mutation	DNP	GT	GT	AA			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	G|T	G|T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr6:74227627_74227628GT>AA	ENST00000316292.9	-	7	2285_2286	c.1294_1295AC>TT	c.(1294-1296)ACa>TTa	p.T432L	EEF1A1_ENST00000331523.2_Missense_Mutation_p.T432L|EEF1A1_ENST00000491404.1_Intron|EEF1A1_ENST00000309268.6_Missense_Mutation_p.T432L	NM_001402.5	NP_001393.1	P68104	EF1A1_HUMAN	eukaryotic translation elongation factor 1 alpha 1	432					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation elongation factor activity (GO:0003746)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(6)|prostate(2)|skin(3)	18						CACCGCAACTGTCTGTCTCATA	0.401											OREG0003893	type=REGULATORY REGION|Gene=BC038897|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.T432I|p.T432S		Atlas-SNP	.											.	EEF1A1	56	.	0			c.C1295T|c.A1294T						.																																			SO:0001583	missense	1915	exon8			GCAACTGTCTGTC|CAACTGTCTGTCT	BC019669	CCDS4980.1	6q14.1	2010-06-30	2004-11-19		ENSG00000156508	ENSG00000156508			3189	protein-coding gene	gene with protein product		130590	"""leukocyte receptor cluster (LRC) member 7"""	EF1A, EEF1A, LENG7		8812466, 10941842	Standard	NM_001402		Approved	EE1A1	uc003phj.3	P68104	OTTHUMG00000015031	ENST00000316292.9:c.1294_1295delinsAA	chr6.hg19:g.74227627_74227628delinsAA	ENSP00000339063:p.Thr432Leu	106.0	0.0	1151	96.0	28.0|29.0	NM_001402	P04719|P04720|Q6IQ15	Missense_Mutation	SNP	ENST00000316292.9	hg19	CCDS4980.1																																																																																			.	.		0.401	EEF1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041210.2	NM_001402	
MDN1	23195	hgsc.bcm.edu	37	6	90452952	90452952	+	Silent	SNP	C	C	G			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr6:90452952C>G	ENST00000369393.3	-	31	4480	c.4365G>C	c.(4363-4365)ctG>ctC	p.L1455L	MDN1_ENST00000428876.1_Silent_p.L1455L			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	1455					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TGGCCTGAACCAGAGGCCCAT	0.468																																					p.L1455L		Atlas-SNP	.											.	MDN1	478	.	0			c.G4365C						.						102.0	97.0	99.0					6																	90452952		2203	4300	6503	SO:0001819	synonymous_variant	23195	exon31			CTGAACCAGAGGC	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.4365G>C	chr6.hg19:g.90452952C>G		123.0	0.0		129.0	38.0	NM_014611	O15019|Q5T794	Silent	SNP	ENST00000369393.3	hg19	CCDS5024.1																																																																																			.	.		0.468	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2		
IGF2R	3482	hgsc.bcm.edu	37	6	160454117	160454117	+	Silent	SNP	A	A	C			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr6:160454117A>C	ENST00000356956.1	+	9	1337	c.1189A>C	c.(1189-1191)Aga>Cga	p.R397R		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	397					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)			breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	AGCAGCAGGAAGATACCACAA	0.438																																					p.R397R		Atlas-SNP	.											.	IGF2R	251	.	0			c.A1189C						.						96.0	87.0	90.0					6																	160454117		2203	4300	6503	SO:0001819	synonymous_variant	3482	exon9			GCAGGAAGATACC	J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.1189A>C	chr6.hg19:g.160454117A>C		48.0	0.0		27.0	16.0	NM_000876	Q7Z7G9|Q96PT5	Silent	SNP	ENST00000356956.1	hg19	CCDS5273.1																																																																																			.	.		0.438	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042931.1	NM_000876	
OSBPL3	26031	hgsc.bcm.edu	37	7	24904971	24904971	+	Missense_Mutation	SNP	T	T	G			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr7:24904971T>G	ENST00000313367.2	-	7	1114	c.663A>C	c.(661-663)aaA>aaC	p.K221N	OSBPL3_ENST00000353930.1_Missense_Mutation_p.K221N|OSBPL3_ENST00000396431.1_Missense_Mutation_p.K221N|OSBPL3_ENST00000396429.1_Missense_Mutation_p.K221N|OSBPL3_ENST00000431825.2_Missense_Mutation_p.K221N|OSBPL3_ENST00000409069.1_Missense_Mutation_p.K221N|OSBPL3_ENST00000352860.1_Missense_Mutation_p.K221N	NM_015550.2	NP_056365.1	Q9H4L5	OSBL3_HUMAN	oxysterol binding protein-like 3	221					lipid transport (GO:0006869)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	cholesterol binding (GO:0015485)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(19)|prostate(1)|skin(3)|urinary_tract(1)	43						CTTTGGAGCATTTTTCCATGT	0.393																																					p.K221N		Atlas-SNP	.											.	OSBPL3	100	.	0			c.A663C						.						262.0	242.0	249.0					7																	24904971		2203	4300	6503	SO:0001583	missense	26031	exon7			GGAGCATTTTTCC	AB014604	CCDS5390.1, CCDS5391.1, CCDS5392.1, CCDS47564.1	7p15.3	2013-01-10			ENSG00000070882	ENSG00000070882		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16370	protein-coding gene	gene with protein product		606732		OSBP3		9734811	Standard	XM_005249698		Approved	ORP-3, ORP3, KIAA0704	uc003sxf.3	Q9H4L5	OTTHUMG00000023277	ENST00000313367.2:c.663A>C	chr7.hg19:g.24904971T>G	ENSP00000315410:p.Lys221Asn	118.0	0.0		106.0	21.0	NM_145321	A4D167|A4D168|A4D169|A4D170|A4D171|A4D172|B8ZZ79|B8ZZP0|O14591|O43357|O43358|Q8N702|Q8N703|Q8N704|Q8NFH0|Q8NFH1|Q8NI12|Q8NI13|Q9BZF4|Q9UED6	Missense_Mutation	SNP	ENST00000313367.2	hg19	CCDS5390.1	.	.	.	.	.	.	.	.	.	.	T	18.75	3.689770	0.68271	.	.	ENSG00000070882	ENST00000313367;ENST00000352860;ENST00000353930;ENST00000431825;ENST00000396431;ENST00000396429;ENST00000409069	T;T;T;T;T;T;T	0.48522	2.15;0.84;0.81;2.16;0.84;0.81;2.16	5.75	1.99	0.26369	.	0.097834	0.64402	D	0.000001	T	0.49813	0.1579	M	0.71581	2.175	0.42308	D	0.992203	P;P;B;P	0.43909	0.821;0.682;0.38;0.726	P;P;B;B	0.47299	0.543;0.462;0.343;0.342	T	0.40365	-0.9567	10	0.27082	T	0.32	-7.1484	9.6826	0.40078	0.0:0.1999:0.0:0.8001	.	221;221;221;221	Q9H4L5-4;Q9H4L5-2;Q9H4L5-3;Q9H4L5	.;.;.;OSBL3_HUMAN	N	221	ENSP00000315410:K221N;ENSP00000315331:K221N;ENSP00000315277:K221N;ENSP00000389779:K221N;ENSP00000379708:K221N;ENSP00000379706:K221N;ENSP00000386953:K221N	ENSP00000315410:K221N	K	-	3	2	OSBPL3	24871496	0.997000	0.39634	1.000000	0.80357	0.997000	0.91878	0.345000	0.19979	0.093000	0.17368	0.533000	0.62120	AAA	.	.		0.393	OSBPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214085.2		
STEAP4	79689	hgsc.bcm.edu	37	7	87910335	87910335	+	Silent	SNP	A	A	G			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr7:87910335A>G	ENST00000380079.4	-	4	1145	c.1044T>C	c.(1042-1044)taT>taC	p.Y348Y	STEAP4_ENST00000301959.5_Silent_p.Y172Y|AC003991.3_ENST00000434733.1_RNA|AC003991.3_ENST00000595121.1_RNA|AC003991.3_ENST00000600908.1_RNA|AC003991.3_ENST00000447758.1_RNA	NM_001205315.1|NM_024636.3	NP_001192244.1|NP_078912.2	Q687X5	STEA4_HUMAN	STEAP family member 4	348	Ferric oxidoreductase.				copper ion import (GO:0015677)|fat cell differentiation (GO:0045444)|ferric iron import into cell (GO:0097461)|iron ion homeostasis (GO:0055072)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cupric reductase activity (GO:0008823)|ferric-chelate reductase (NADPH) activity (GO:0052851)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(3)	15	Esophageal squamous(14;0.00802)					CCAAAGCCACATATGAATCAC	0.388																																					p.Y348Y		Atlas-SNP	.											.	STEAP4	54	.	0			c.T1044C						.						91.0	89.0	89.0					7																	87910335		1881	4112	5993	SO:0001819	synonymous_variant	79689	exon5			AGCCACATATGAA	AK026806	CCDS43611.1, CCDS56494.1	7q21.13	2014-01-28	2005-06-15	2005-06-15	ENSG00000127954	ENSG00000127954			21923	protein-coding gene	gene with protein product		611098	"""tumor necrosis factor, alpha-induced protein 9"""	TNFAIP9		11443137, 15897894	Standard	NM_024636		Approved	FLJ23153, TIARP, STAMP2	uc003ujs.3	Q687X5	OTTHUMG00000153853	ENST00000380079.4:c.1044T>C	chr7.hg19:g.87910335A>G		97.0	0.0		112.0	30.0	NM_001205315	Q658Q9|Q687X4|Q8WWB0|Q9H5R1	Silent	SNP	ENST00000380079.4	hg19	CCDS43611.1																																																																																			.	.		0.388	STEAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332712.4	NM_024636	
KMT2C	58508	hgsc.bcm.edu	37	7	151878921	151878922	+	Missense_Mutation	DNP	AG	AG	TA	rs369706450		TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	A|G	A|G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr7:151878921_151878922AG>TA	ENST00000262189.6	-	36	6241_6242	c.6023_6024CT>TA	c.(6022-6024)aCT>aTA	p.T2008I	KMT2C_ENST00000355193.2_Missense_Mutation_p.T2008I	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	2008	Pro-rich.		T -> A (in dbSNP:rs6951159).		histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										GAGATGGTTTAGTAAAGTGATC	0.47																																					p.T2008T|p.T2008I		Atlas-SNP	.											.	MLL3	1564	.	0			c.T6024A|c.C6023T						.																																			SO:0001583	missense	58508	exon36			TGGTTTAGTAAAG|GGTTTAGTAAAGT	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.6023_6024delinsTA	chr7.hg19:g.151878921_151878922delinsTA	ENSP00000262189:p.Thr2008Ile	75.0|76.0	0.0		92.0|90.0	35.0	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Silent|Missense_Mutation	SNP	ENST00000262189.6	hg19	CCDS5931.1																																																																																			.	.		0.470	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
ZBTB10	65986	hgsc.bcm.edu	37	8	81412438	81412438	+	Missense_Mutation	SNP	A	A	G			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr8:81412438A>G	ENST00000430430.1	+	3	2461	c.1682A>G	c.(1681-1683)aAt>aGt	p.N561S	ZBTB10_ENST00000455036.3_Missense_Mutation_p.N561S|ZBTB10_ENST00000426744.2_Missense_Mutation_p.N561S|ZBTB10_ENST00000379091.4_Missense_Mutation_p.N269S	NM_001277145.1	NP_001264074.1	Q96DT7	ZBT10_HUMAN	zinc finger and BTB domain containing 10	561					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(4)	20	all_cancers(3;1.68e-09)|all_epithelial(4;5.13e-11)|Lung NSC(7;1.75e-07)|all_lung(9;7.38e-07)|Breast(3;2.96e-06)		BRCA - Breast invasive adenocarcinoma(6;0.000434)|Epithelial(68;0.00486)|all cancers(69;0.0296)			TTTATTTGGAATAATATGGGC	0.353																																					p.N561S		Atlas-SNP	.											.	ZBTB10	51	.	0			c.A1682G						.						35.0	34.0	34.0					8																	81412438		1815	4070	5885	SO:0001583	missense	65986	exon2			TTTGGAATAATAT	AK022814	CCDS47880.1, CCDS64920.1	8q13-q21.1	2013-01-09			ENSG00000205189	ENSG00000205189		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	30953	protein-coding gene	gene with protein product						12477932	Standard	NM_001105539		Approved	RINZF, FLJ12752	uc003ybx.5	Q96DT7	OTTHUMG00000155016	ENST00000430430.1:c.1682A>G	chr8.hg19:g.81412438A>G	ENSP00000387462:p.Asn561Ser	110.0	0.0		121.0	55.0	NM_023929	A4FVD0|Q86W96|Q8IXI9|Q96MH9	Missense_Mutation	SNP	ENST00000430430.1	hg19	CCDS47880.1	.	.	.	.	.	.	.	.	.	.	A	19.06	3.754300	0.69648	.	.	ENSG00000205189	ENST00000379091;ENST00000430430;ENST00000455036;ENST00000426744;ENST00000519370	T;T;T;T	0.15372	2.53;2.46;2.46;2.43	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.29716	0.0742	L	0.29908	0.895	0.47037	D	0.999299	D;D;D;D	0.76494	0.985;0.997;0.998;0.999	P;D;D;D	0.85130	0.834;0.97;0.994;0.997	T	0.02966	-1.1088	10	0.24483	T	0.36	.	15.9836	0.80130	1.0:0.0:0.0:0.0	.	417;561;561;269	A8E4L4;Q96DT7;Q96DT7-2;Q96DT7-4	.;ZBT10_HUMAN;.;.	S	269;561;561;561;389	ENSP00000368384:N269S;ENSP00000387462:N561S;ENSP00000412036:N561S;ENSP00000416134:N561S	ENSP00000368384:N269S	N	+	2	0	ZBTB10	81574993	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.366000	0.90111	2.185000	0.69588	0.528000	0.53228	AAT	.	.		0.353	ZBTB10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338055.2	NM_023929	
LRRC6	23639	hgsc.bcm.edu	37	8	133634904	133634904	+	Silent	SNP	C	C	T			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr8:133634904C>T	ENST00000519595.1	-	7	965	c.867G>A	c.(865-867)agG>agA	p.R289R	LRRC6_ENST00000520446.1_5'Flank|LRRC6_ENST00000250173.1_Silent_p.R289R|LRRC6_ENST00000518642.1_Silent_p.R289R			Q86X45	TILB_HUMAN	leucine rich repeat containing 6	289					cilium movement (GO:0003341)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|inner dynein arm assembly (GO:0036159)|male gonad development (GO:0008584)|motile cilium assembly (GO:0044458)|outer dynein arm assembly (GO:0036158)|reproductive system development (GO:0061458)|sperm motility (GO:0030317)	cilium (GO:0005929)|cytoplasm (GO:0005737)				breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|prostate(1)|urinary_tract(2)	34	Ovarian(258;0.00352)|Esophageal squamous(12;0.00507)|all_neural(3;0.0052)|Medulloblastoma(3;0.0922)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			TGATCAAAGTCCTGGGTGGTT	0.403																																					p.R289R		Atlas-SNP	.											.	LRRC6	58	.	0			c.G867A						.						303.0	287.0	293.0					8																	133634904		2203	4300	6503	SO:0001819	synonymous_variant	23639	exon7			CAAAGTCCTGGGT	U60666	CCDS6365.1	8q24	2013-02-22			ENSG00000129295	ENSG00000129295			16725	protein-coding gene	gene with protein product	"""leucine rich testes protein"""	614930				10775177, 23122586	Standard	NM_012472		Approved	TSLRP, LRTP, CILD19	uc003ytk.4	Q86X45	OTTHUMG00000164646	ENST00000519595.1:c.867G>A	chr8.hg19:g.133634904C>T		162.0	0.0		236.0	61.0	NM_012472	Q13648|Q4G183	Silent	SNP	ENST00000519595.1	hg19		.	.	.	.	.	.	.	.	.	.	C	5.057	0.196109	0.09599	.	.	ENSG00000129295	ENST00000519085	.	.	.	5.54	2.74	0.32292	.	.	.	.	.	T	0.31389	0.0795	.	.	.	0.25614	N	0.986468	.	.	.	.	.	.	T	0.21965	-1.0230	4	.	.	.	-18.665	5.3498	0.16030	0.0:0.6092:0.1472:0.2435	.	.	.	.	N	11	.	.	D	-	1	0	LRRC6	133704086	1.000000	0.71417	0.485000	0.27403	0.645000	0.38454	1.946000	0.40283	0.283000	0.22279	0.637000	0.83480	GAC	.	.		0.403	LRRC6-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379578.1	NM_012472	
PTK2	5747	hgsc.bcm.edu	37	8	141756887	141756887	+	Missense_Mutation	SNP	A	A	G			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr8:141756887A>G	ENST00000522684.1	-	18	1719	c.1490T>C	c.(1489-1491)aTa>aCa	p.I497T	PTK2_ENST00000517887.1_Missense_Mutation_p.I541T|PTK2_ENST00000519419.1_Missense_Mutation_p.I541T|PTK2_ENST00000520151.1_Intron|PTK2_ENST00000538769.1_Missense_Mutation_p.I165T|PTK2_ENST00000395218.2_Missense_Mutation_p.I497T|PTK2_ENST00000521059.1_Missense_Mutation_p.I497T|PTK2_ENST00000519465.1_Missense_Mutation_p.I125T|PTK2_ENST00000535192.1_Missense_Mutation_p.I497T|PTK2_ENST00000340930.3_Missense_Mutation_p.I497T	NM_153831.3	NP_722560.1	Q05397	FAK1_HUMAN	protein tyrosine kinase 2	497	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell motility (GO:0048870)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|central nervous system neuron axonogenesis (GO:0021955)|embryo development (GO:0009790)|endothelial cell migration (GO:0043542)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|establishment of nucleus localization (GO:0040023)|extracellular matrix organization (GO:0030198)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|growth hormone receptor signaling pathway (GO:0060396)|heart morphogenesis (GO:0003007)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of organ growth (GO:0046621)|negative regulation of synapse assembly (GO:0051964)|netrin-activated signaling pathway (GO:0038007)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|placenta development (GO:0001890)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|regulation of endothelial cell migration (GO:0010594)|regulation of focal adhesion assembly (GO:0051893)|regulation of osteoblast differentiation (GO:0045667)|regulation of Rho GTPase activity (GO:0032319)|signal complex assembly (GO:0007172)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)	apical plasma membrane (GO:0016324)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|stress fiber (GO:0001725)	actin binding (GO:0003779)|ATP binding (GO:0005524)|JUN kinase binding (GO:0008432)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(6)|lung(23)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	48	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			CTCCATGATTATCCAGACAGG	0.398																																					p.I519T		Atlas-SNP	.											.	PTK2	311	.	0			c.T1556C						.						124.0	103.0	110.0					8																	141756887		2203	4300	6503	SO:0001583	missense	5747	exon18			ATGATTATCCAGA	L13616	CCDS6381.1, CCDS56557.1	8q24.3	2013-02-18	2013-02-18		ENSG00000169398	ENSG00000169398	2.7.10.1	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9611	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 71"""	600758	"""PTK2 protein tyrosine kinase 2"""			8422239	Standard	NM_153831		Approved	FAK, FADK, FAK1, PPP1R71	uc003yvt.3	Q05397	OTTHUMG00000067438	ENST00000522684.1:c.1490T>C	chr8.hg19:g.141756887A>G	ENSP00000429911:p.Ile497Thr	64.0	0.0		84.0	9.0	NM_005607	B4E2N6|F5H4S4|Q14291|Q9UD85	Missense_Mutation	SNP	ENST00000522684.1	hg19	CCDS6381.1	.	.	.	.	.	.	.	.	.	.	A	25.1	4.604267	0.87157	.	.	ENSG00000169398	ENST00000522684;ENST00000535192;ENST00000519465;ENST00000517887;ENST00000521059;ENST00000395214;ENST00000395218;ENST00000354438;ENST00000395221;ENST00000523539;ENST00000340930;ENST00000538769;ENST00000519419;ENST00000521986;ENST00000342207;ENST00000519024	D;D;D;D;D;D;D;D;D;D;D;D	0.85861	-2.04;-2.04;-2.04;-2.04;-2.04;-2.04;-2.04;-2.04;-2.04;-2.04;-2.04;-2.04	5.63	5.63	0.86233	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.087685	0.85682	D	0.000000	D	0.92958	0.7759	M	0.84948	2.725	0.80722	D	1	D;P;D;D;D;D;P;B;P;P	0.89917	0.994;0.492;0.96;0.993;1.0;0.993;0.931;0.274;0.898;0.866	D;P;P;D;D;D;D;P;D;P	0.81914	0.942;0.851;0.885;0.919;0.995;0.912;0.922;0.557;0.949;0.837	D	0.93978	0.7255	10	0.87932	D	0	.	16.1825	0.81920	1.0:0.0:0.0:0.0	.	497;192;417;497;519;497;449;345;165;125	B4E2N6;B4DH13;Q59GN8;Q05397;Q658W2;Q8IYN9;Q59GM6;Q05397-2;Q8N9D7;E9PEI4	.;.;.;FAK1_HUMAN;.;.;.;.;.;.	T	497;497;125;541;497;449;497;418;192;169;497;165;541;195;343;132	ENSP00000429911:I497T;ENSP00000438009:I497T;ENSP00000429170:I125T;ENSP00000429082:I541T;ENSP00000429474:I497T;ENSP00000378644:I497T;ENSP00000428492:I169T;ENSP00000341189:I497T;ENSP00000445742:I165T;ENSP00000429129:I541T;ENSP00000430603:I195T;ENSP00000428232:I132T	ENSP00000341189:I497T	I	-	2	0	PTK2	141826069	1.000000	0.71417	0.994000	0.49952	0.993000	0.82548	8.950000	0.93019	2.281000	0.76405	0.524000	0.50904	ATA	.	.		0.398	PTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378054.5	NM_005607	
MELK	9833	hgsc.bcm.edu	37	9	36630339	36630339	+	Missense_Mutation	SNP	T	T	G			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr9:36630339T>G	ENST00000298048.2	+	9	894	c.710T>G	c.(709-711)aTt>aGt	p.I237S	MELK_ENST00000536329.1_Missense_Mutation_p.I166S|MELK_ENST00000541717.1_Missense_Mutation_p.I237S|MELK_ENST00000543751.1_Missense_Mutation_p.I205S|MELK_ENST00000536860.1_Missense_Mutation_p.I189S|MELK_ENST00000487398.1_3'UTR|MELK_ENST00000536987.1_Missense_Mutation_p.I106S|MELK_ENST00000545008.1_Missense_Mutation_p.I166S|MELK_ENST00000538311.1_Missense_Mutation_p.I43S	NM_014791.3	NP_055606.1	Q14680	MELK_HUMAN	maternal embryonic leucine zipper kinase	237	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|hemopoiesis (GO:0030097)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|neural precursor cell proliferation (GO:0061351)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)	cell cortex (GO:0005938)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)	29		Acute lymphoblastic leukemia(2;1.09e-08)|all_hematologic(2;8.15e-06)	STAD - Stomach adenocarcinoma(86;0.228)			CCCAGTAGCATTCTGCTTCTT	0.348																																					p.I237S	Ovarian(82;980 1317 7225 14391 18624)	Atlas-SNP	.											.	MELK	74	.	0			c.T710G						.						195.0	205.0	202.0					9																	36630339		2203	4300	6503	SO:0001583	missense	9833	exon9			GTAGCATTCTGCT	D79997	CCDS6606.1, CCDS59123.1, CCDS59124.1, CCDS59125.1, CCDS59126.1, CCDS59127.1, CCDS59128.1	9p13.1	2008-02-05			ENSG00000165304	ENSG00000165304			16870	protein-coding gene	gene with protein product		607025				8724849, 9136115	Standard	NM_001256689		Approved	KIAA0175	uc003zzn.4	Q14680	OTTHUMG00000019906	ENST00000298048.2:c.710T>G	chr9.hg19:g.36630339T>G	ENSP00000298048:p.Ile237Ser	59.0	0.0		61.0	20.0	NM_014791	A6P3A7|A6P3A8|B1AMQ6|B7Z1E6|B7Z5M5|B7Z6Q7|B7Z6R8|B7Z6Y0|B7Z7Q1|D3DRP8|F5H0Y0|F5H2R4|F5H689|Q7L3C3	Missense_Mutation	SNP	ENST00000298048.2	hg19	CCDS6606.1	.	.	.	.	.	.	.	.	.	.	T	13.09	2.132096	0.37630	.	.	ENSG00000165304	ENST00000298048;ENST00000538311;ENST00000536987;ENST00000545008;ENST00000536860;ENST00000536329;ENST00000541717;ENST00000543751	T;T;T;T;T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14;-0.14;-0.14;-0.14;-0.14	5.41	3.08	0.35506	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.423208	0.29451	N	0.012116	T	0.52677	0.1749	N	0.20766	0.605	0.21290	N	0.99973	B;B;B;B;B;P;B	0.35307	0.343;0.321;0.053;0.053;0.149;0.494;0.066	P;B;B;B;B;B;B	0.46389	0.515;0.138;0.062;0.06;0.174;0.297;0.155	T	0.46803	-0.9165	10	0.48119	T	0.1	-1.4603	7.2153	0.25957	0.0:0.2437:0.0:0.7563	.	157;166;189;237;166;205;237	B7Z1G6;F5H2R4;F5H0Y0;F5H689;A6P3A8;A6P3A7;Q14680	.;.;.;.;.;.;MELK_HUMAN	S	237;43;106;166;189;166;237;205	ENSP00000298048:I237S;ENSP00000438226:I43S;ENSP00000439184:I106S;ENSP00000445452:I166S;ENSP00000439792:I189S;ENSP00000443550:I166S;ENSP00000437804:I237S;ENSP00000441596:I205S	ENSP00000298048:I237S	I	+	2	0	MELK	36620339	0.003000	0.15002	0.543000	0.28128	0.987000	0.75469	0.554000	0.23407	0.881000	0.35993	0.533000	0.62120	ATT	.	.		0.348	MELK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052428.3	NM_014791	
SYK	6850	hgsc.bcm.edu	37	9	93650155	93650155	+	Missense_Mutation	SNP	G	G	T			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr9:93650155G>T	ENST00000375754.4	+	12	1854	c.1706G>T	c.(1705-1707)gGg>gTg	p.G569V	SYK_ENST00000375747.1_Missense_Mutation_p.G546V|SYK_ENST00000375746.1_Missense_Mutation_p.G569V|SYK_ENST00000375751.4_Missense_Mutation_p.G546V	NM_003177.5	NP_003168.2	P43405	KSYK_HUMAN	spleen tyrosine kinase	569	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|B cell receptor signaling pathway (GO:0050853)|beta selection (GO:0043366)|blood coagulation (GO:0007596)|blood vessel morphogenesis (GO:0048514)|cell proliferation (GO:0008283)|cellular response to molecule of fungal origin (GO:0071226)|defense response to bacterium (GO:0042742)|enzyme linked receptor protein signaling pathway (GO:0007167)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte activation involved in immune response (GO:0002366)|leukocyte cell-cell adhesion (GO:0007159)|leukotriene biosynthetic process (GO:0019370)|lymph vessel development (GO:0001945)|macrophage activation involved in immune response (GO:0002281)|neutrophil activation involved in immune response (GO:0002283)|neutrophil chemotaxis (GO:0030593)|organ morphogenesis (GO:0009887)|platelet activation (GO:0030168)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of bone resorption (GO:0045780)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of granulocyte macrophage colony-stimulating factor biosynthetic process (GO:0045425)|positive regulation of interleukin-3 biosynthetic process (GO:0045401)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of arachidonic acid secretion (GO:0090237)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of neutrophil degranulation (GO:0043313)|regulation of phagocytosis (GO:0050764)|regulation of platelet activation (GO:0010543)|regulation of platelet aggregation (GO:0090330)|regulation of superoxide anion generation (GO:0032928)|serotonin secretion by platelet (GO:0002554)|viral process (GO:0016032)	B cell receptor complex (GO:0019815)|cytosol (GO:0005829)|early phagosome (GO:0032009)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	ATP binding (GO:0005524)|integrin binding (GO:0005178)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)	p.G546V(1)|p.G569V(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|prostate(3)|skin(2)|stomach(2)	26						TTCTCCTATGGGCAGAAGCCA	0.468			T	"""ETV6, ITK"""	"""MDS, peripheral T-cell lymphoma"""																																p.G569V		Atlas-SNP	.		Dom	yes		9	9q22	6850	spleen tyrosine kinase		L	SYK_ENST00000375754,NS,carcinoma,0,2	SYK	132	.	2	Substitution - Missense(2)	lung(2)	c.G1706T						.						119.0	115.0	117.0					9																	93650155		2203	4300	6503	SO:0001583	missense	6850	exon12			CCTATGGGCAGAA	L28824	CCDS6688.1, CCDS47992.1	9q22	2013-02-14			ENSG00000165025	ENSG00000165025		"""SH2 domain containing"""	11491	protein-coding gene	gene with protein product		600085				8082894, 1423621	Standard	XM_005252147		Approved		uc004aqz.3	P43405	OTTHUMG00000020200	ENST00000375754.4:c.1706G>T	chr9.hg19:g.93650155G>T	ENSP00000364907:p.Gly569Val	118.0	0.0		107.0	8.0	NM_003177		Missense_Mutation	SNP	ENST00000375754.4	hg19	CCDS6688.1	.	.	.	.	.	.	.	.	.	.	G	16.83	3.231238	0.58777	.	.	ENSG00000165025	ENST00000375754;ENST00000375751;ENST00000375747;ENST00000375746	T;T;T;T	0.72394	-0.65;-0.65;-0.65;-0.65	4.77	4.77	0.60923	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.90937	0.7151	H	0.98754	4.32	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94746	0.7923	10	0.87932	D	0	.	17.9801	0.89138	0.0:0.0:1.0:0.0	.	546;569	P43405-2;P43405	.;KSYK_HUMAN	V	569;546;546;569	ENSP00000364907:G569V;ENSP00000364904:G546V;ENSP00000364899:G546V;ENSP00000364898:G569V	ENSP00000364898:G569V	G	+	2	0	SYK	92689976	1.000000	0.71417	0.981000	0.43875	0.182000	0.23217	9.037000	0.93765	2.459000	0.83118	0.455000	0.32223	GGG	.	.		0.468	SYK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053018.1		
NCBP1	4686	hgsc.bcm.edu	37	9	100425320	100425320	+	Missense_Mutation	SNP	C	C	G	rs200307901		TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr9:100425320C>G	ENST00000375147.3	+	18	2044	c.1788C>G	c.(1786-1788)aaC>aaG	p.N596K		NM_002486.4	NP_002477.1	Q09161	NCBP1_HUMAN	nuclear cap binding protein subunit 1, 80kDa	596					7-methylguanosine mRNA capping (GO:0006370)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|mRNA cis splicing, via spliceosome (GO:0045292)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of viral transcription (GO:0050434)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|spliceosomal snRNP assembly (GO:0000387)|termination of RNA polymerase II transcription (GO:0006369)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|mRNA cap binding complex (GO:0005845)|nuclear cap binding complex (GO:0005846)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA cap binding (GO:0000339)			NS(1)|central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(4)	19		Acute lymphoblastic leukemia(62;0.158)				TCTGGAGGAACCATCCACAGG	0.343																																					p.N596K	Ovarian(36;879 898 2893 44212 50307)	Atlas-SNP	.											.	NCBP1	64	.	0			c.C1788G						.						96.0	101.0	99.0					9																	100425320		2203	4299	6502	SO:0001583	missense	4686	exon18			GAGGAACCATCCA	BC001450	CCDS6728.1	9q34.1	2010-01-26	2002-08-29		ENSG00000136937	ENSG00000136937			7658	protein-coding gene	gene with protein product		600469	"""nuclear cap binding protein subunit 1, 80kD"""	NCBP		7937105, 8812508	Standard	NM_002486		Approved	CBP80, Sto1	uc004axq.3	Q09161	OTTHUMG00000020332	ENST00000375147.3:c.1788C>G	chr9.hg19:g.100425320C>G	ENSP00000364289:p.Asn596Lys	89.0	0.0		65.0	14.0	NM_002486	B2R718|Q59G76|Q5T1V0|Q5T7X2	Missense_Mutation	SNP	ENST00000375147.3	hg19	CCDS6728.1	.	.	.	.	.	.	.	.	.	.	C	13.73	2.323188	0.41096	.	.	ENSG00000136937	ENST00000375147	.	.	.	5.55	3.31	0.37934	MIF4G-like, type 2 (1);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.000000	0.85682	D	0.000000	T	0.52108	0.1714	L	0.61218	1.895	0.80722	D	1	B	0.30526	0.283	B	0.38156	0.266	T	0.38436	-0.9661	9	0.12430	T	0.62	-22.1877	7.546	0.27768	0.0:0.6654:0.0:0.3346	.	596	Q09161	NCBP1_HUMAN	K	596	.	ENSP00000364289:N596K	N	+	3	2	NCBP1	99465141	0.985000	0.35326	1.000000	0.80357	0.998000	0.95712	0.163000	0.16520	1.465000	0.48006	0.655000	0.94253	AAC	.	C|1.000;A|0.000		0.343	NCBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053337.1	NM_002486	
LAMC3	10319	hgsc.bcm.edu	37	9	133914252	133914252	+	Splice_Site	SNP	C	C	T			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr9:133914252C>T	ENST00000361069.4	+	5	1111	c.978C>T	c.(976-978)ccC>ccT	p.P326P	LAMC3_ENST00000480883.1_3'UTR	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	326	Laminin EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00460}.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		TGCCCATAGCCTGCAACTGCA	0.612																																					p.P326P		Atlas-SNP	.											.	LAMC3	167	.	0			c.C978T						.						76.0	80.0	79.0					9																	133914252		2203	4296	6499	SO:0001630	splice_region_variant	10319	exon5			CATAGCCTGCAAC	AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.977-1C>T	chr9.hg19:g.133914252C>T		24.0	0.0		25.0	11.0	NM_006059	B1APX9|B1APY0|Q59H72	Silent	SNP	ENST00000361069.4	hg19	CCDS6938.1																																																																																			.	.		0.612	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054717.3	NM_006059	Silent
OLFM1	10439	hgsc.bcm.edu	37	9	138011380	138011380	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr9:138011380C>T	ENST00000371793.3	+	6	1065	c.814C>T	c.(814-816)Cgc>Tgc	p.R272C	OLFM1_ENST00000371796.3_Missense_Mutation_p.R245C|OLFM1_ENST00000252854.4_Missense_Mutation_p.R254C	NM_001282611.1	NP_001269540.1	Q99784	NOE1_HUMAN	olfactomedin 1	272	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of neuron migration (GO:2001223)|nervous system development (GO:0007399)|protein oligomerization (GO:0051259)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|synapse (GO:0045202)	beta-amyloid binding (GO:0001540)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(2)	21		Myeloproliferative disorder(178;0.0333)		Epithelial(140;5.49e-08)|OV - Ovarian serous cystadenocarcinoma(145;9.68e-08)|all cancers(34;1.88e-07)		TCACAACAACCGCTTCGTACG	0.572																																					p.R254C		Atlas-SNP	.											.	OLFM1	57	.	0			c.C760T						.						121.0	108.0	113.0					9																	138011380		2203	4300	6503	SO:0001583	missense	10439	exon6			AACAACCGCTTCG	AF035301	CCDS6986.1, CCDS6987.1, CCDS65183.1, CCDS65184.1	9q34.3	2014-01-20			ENSG00000130558	ENSG00000130558			17187	protein-coding gene	gene with protein product	"""pancortin"""	605366				9039501	Standard	NM_006334		Approved	NOE1, OlfA, AMY, NOELIN	uc004cfl.4	Q99784	OTTHUMG00000020897	ENST00000371793.3:c.814C>T	chr9.hg19:g.138011380C>T	ENSP00000360858:p.Arg272Cys	71.0	0.0		42.0	11.0	NM_014279	Q53XZ8|Q6IMJ4|Q6IMJ5|Q8N8R0|Q969S7|Q99452	Missense_Mutation	SNP	ENST00000371793.3	hg19		.	.	.	.	.	.	.	.	.	.	C	25.7	4.665111	0.88251	.	.	ENSG00000130558	ENST00000252854;ENST00000371796;ENST00000371793;ENST00000539877	D;D;D;D	0.88664	-2.41;-2.41;-2.41;-2.13	5.07	5.07	0.68467	Olfactomedin-like (3);	0.000000	0.85682	D	0.000000	D	0.95411	0.8510	M	0.89214	3.015	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76071	0.98;0.987	D	0.96221	0.9160	10	0.87932	D	0	.	18.4324	0.90630	0.0:1.0:0.0:0.0	.	272;254	Q99784;Q6IMJ8	NOE1_HUMAN;.	C	254;245;272;169	ENSP00000252854:R254C;ENSP00000360861:R245C;ENSP00000360858:R272C;ENSP00000443806:R169C	ENSP00000252854:R254C	R	+	1	0	OLFM1	137151201	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.590000	0.82653	2.357000	0.79964	0.561000	0.74099	CGC	.	.		0.572	OLFM1-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000054974.1	NM_014279	
UBAC1	10422	hgsc.bcm.edu	37	9	138837090	138837090	+	Silent	SNP	C	C	A			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr9:138837090C>A	ENST00000371756.3	-	7	877	c.660G>T	c.(658-660)tcG>tcT	p.S220S	UBAC1_ENST00000465873.1_5'UTR	NM_016172.2	NP_057256.2	Q9BSL1	UBAC1_HUMAN	UBA domain containing 1	220	UBA 1. {ECO:0000255|PROSITE- ProRule:PRU00212}.				protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)				NS(1)|biliary_tract(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(2)|lung(6)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	25		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.1e-06)|Epithelial(140;7.79e-06)		CCTGAGGCACCGACATGCTGC	0.592																																					p.S220S	NSCLC(78;973 1398 27381 29552 42415)	Atlas-SNP	.											.	UBAC1	40	.	0			c.G660T						.						53.0	46.0	49.0					9																	138837090		2203	4300	6503	SO:0001819	synonymous_variant	10422	exon7			AGGCACCGACATG	AF176796	CCDS35177.1	9q34.3	2008-02-05	2007-04-20	2007-04-20	ENSG00000130560	ENSG00000130560			30221	protein-coding gene	gene with protein product		608129	"""ubiquitin associated domain containing 1"""	UBADC1		10857748, 8619474	Standard	NM_016172		Approved	GBDR1	uc004cgt.3	Q9BSL1	OTTHUMG00000020920	ENST00000371756.3:c.660G>T	chr9.hg19:g.138837090C>A		31.0	0.0		39.0	17.0	NM_016172	O75500|Q9UMW7	Silent	SNP	ENST00000371756.3	hg19	CCDS35177.1																																																																																			.	.		0.592	UBAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055034.1	NM_016172	
CCAR1	55749	hgsc.bcm.edu	37	10	70507323	70507323	+	Splice_Site	SNP	G	G	A			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr10:70507323G>A	ENST00000265872.6	+	8	945	c.826G>A	c.(826-828)Gct>Act	p.A276T	CCAR1_ENST00000543719.1_Splice_Site_p.A261T|CCAR1_ENST00000535016.1_Splice_Site_p.A261T	NM_001282959.1|NM_001282960.1|NM_018237.2	NP_001269888.1|NP_001269889.1|NP_060707.2	Q8IX12	CCAR1_HUMAN	cell division cycle and apoptosis regulator 1	276					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(7)|skin(3)	56						TCAGCAAAAAGGTATCTTTGC	0.393																																					p.A276T		Atlas-SNP	.											.	CCAR1	118	.	0			c.G826A						.						104.0	103.0	103.0					10																	70507323		2203	4300	6503	SO:0001630	splice_region_variant	55749	exon8			CAAAAAGGTATCT	AY249140	CCDS7282.1, CCDS60547.1	10q22.1	2004-02-19			ENSG00000060339	ENSG00000060339			24236	protein-coding gene	gene with protein product		612569				12816952	Standard	NM_018237		Approved	FLJ10590, CARP-1, CARP1	uc001joo.3	Q8IX12	OTTHUMG00000018361	ENST00000265872.6:c.826+1G>A	chr10.hg19:g.70507323G>A		60.0	0.0		44.0	7.0	NM_018237	A0JLT7|A1L4P7|A8K9D4|B4DNP8|B4DRK8|Q32NE3|Q5EBM3|Q5VUP6|Q6PIZ0|Q6X935|Q9H8N4|Q9NVA7|Q9NVQ0|Q9NWM6	Missense_Mutation	SNP	ENST00000265872.6	hg19	CCDS7282.1	.	.	.	.	.	.	.	.	.	.	G	18.96	3.732951	0.69189	.	.	ENSG00000060339	ENST00000265872;ENST00000535016;ENST00000543719;ENST00000539539;ENST00000543225;ENST00000536012	T;T;T;T;T;T	0.29655	1.56;1.85;1.85;1.87;1.89;1.9	5.06	5.06	0.68205	.	0.183837	0.48286	D	0.000182	T	0.19046	0.0457	N	0.08118	0	0.45676	D	0.99859	B;B;B	0.25609	0.02;0.034;0.13	B;B;B	0.26969	0.003;0.011;0.075	T	0.07888	-1.0749	10	0.19590	T	0.45	-12.2394	18.781	0.91932	0.0:0.0:1.0:0.0	.	261;276;250	Q8IX12-2;Q8IX12;F5H2E6	.;CCAR1_HUMAN;.	T	276;261;261;261;250;81	ENSP00000265872:A276T;ENSP00000441820:A261T;ENSP00000445254:A261T;ENSP00000439252:A261T;ENSP00000438610:A250T;ENSP00000439642:A81T	ENSP00000265872:A276T	A	+	1	0	CCAR1	70177329	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.160000	0.77495	2.526000	0.85167	0.655000	0.94253	GCT	.	.		0.393	CCAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048356.2	NM_018237	Missense_Mutation
DUSP13	51207	hgsc.bcm.edu	37	10	76865548	76865548	+	Missense_Mutation	SNP	C	C	T	rs200574063	byFrequency	TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr10:76865548C>T	ENST00000372702.3	-	3	509	c.446G>A	c.(445-447)cGg>cAg	p.R149Q	DUSP13_ENST00000491677.2_5'UTR|DUSP13_ENST00000607131.1_Intron|DUSP13_ENST00000372700.3_Intron|DUSP13_ENST00000607009.1_Intron			Q9UII6	DS13B_HUMAN	dual specificity phosphatase 13	158	Tyrosine-protein phosphatase.				meiotic nuclear division (GO:0007126)|protein dephosphorylation (GO:0006470)|spermatogenesis (GO:0007283)		protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			large_intestine(3)|lung(3)|prostate(1)|urinary_tract(1)	8	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					CAGGGACAGCCGCTGGTGCAG	0.647													C|||	5	0.000998403	0.0038	0.0	5008	,	,		17110	0.0		0.0	False		,,,				2504	0.0				p.R149Q	NSCLC(174;1655 2059 12324 40663 42963)	Atlas-SNP	.											.	DUSP13	82	.	0			c.G446A						.	C	GLN/ARG,,	12,4280		0,12,2134	13.0	18.0	17.0		446,,	-0.6	1.0	10		17	0,8374		0,0,4187	yes	missense,intron,intron	DUSP13	NM_001007271.1,NM_001007272.1,NM_001007273.1	43,,	0,12,6321	TT,TC,CC		0.0,0.2796,0.0947	,,	149/189,,	76865548	12,12654	2146	4187	6333	SO:0001583	missense	51207	exon3			GACAGCCGCTGGT	AB027004	CCDS7346.1, CCDS31224.1, CCDS53542.1	10q23.1	2013-10-25			ENSG00000079393	ENSG00000079393		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	19681	protein-coding gene	gene with protein product		613191				10585869	Standard	XM_005269883		Approved	BEDP, TMDP, FLJ32450, DUSP13A, DUSP13B	uc001jwu.3	Q6B8I1	OTTHUMG00000018516	ENST00000372702.3:c.446G>A	chr10.hg19:g.76865548C>T	ENSP00000361787:p.Arg149Gln	50.0	0.0		52.0	25.0	NM_001007271	A8K776|A8K782|B3KPY1|B3KXT0|B4DUK0|Q5JSC6|Q6IAR0|Q96GC2	Missense_Mutation	SNP	ENST00000372702.3	hg19	CCDS53542.1	.	.	.	.	.	.	.	.	.	.	C	11.44	1.640526	0.29157	0.002796	0.0	ENSG00000079393	ENST00000372702	T	0.60171	0.21	4.81	-0.652	0.11450	Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	.	.	.	.	T	0.37919	0.1021	N	0.20574	0.59	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.21621	-1.0240	9	0.27785	T	0.31	.	9.3275	0.38001	0.0:0.3962:0.0:0.6038	.	149	Q6B8I1	MDSP_HUMAN	Q	149	ENSP00000361787:R149Q	ENSP00000361787:R149Q	R	-	2	0	DUSP13	76535554	0.000000	0.05858	0.996000	0.52242	0.468000	0.32798	-0.170000	0.09897	0.027000	0.15297	-0.672000	0.03802	CGG	.	.		0.647	DUSP13-012	KNOWN	NMD_exception|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000401503.3		
SLC1A2	6506	hgsc.bcm.edu	37	11	35308464	35308464	+	Missense_Mutation	SNP	C	C	G			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr11:35308464C>G	ENST00000278379.3	-	8	1408	c.1126G>C	c.(1126-1128)Gaa>Caa	p.E376Q	SLC1A2_ENST00000606205.1_Missense_Mutation_p.E376Q|SLC1A2_ENST00000395750.1_Missense_Mutation_p.E367Q|RP1-68D18.3_ENST00000532760.1_RNA|SLC1A2_ENST00000479543.1_5'Flank|SLC1A2_ENST00000395753.1_Missense_Mutation_p.E367Q	NM_004171.3	NP_004162.2	P43004	EAA2_HUMAN	solute carrier family 1 (glial high affinity glutamate transporter), member 2	376					adult behavior (GO:0030534)|cellular response to extracellular stimulus (GO:0031668)|D-aspartate import (GO:0070779)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|multicellular organism growth (GO:0035264)|multicellular organismal aging (GO:0010259)|positive regulation of glucose import (GO:0046326)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to wounding (GO:0009611)|synaptic transmission (GO:0007268)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)|visual behavior (GO:0007632)	axolemma (GO:0030673)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glutamate:sodium symporter activity (GO:0015501)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(1)|urinary_tract(1)	24	all_lung(20;0.211)|all_epithelial(35;0.234)	all_hematologic(20;0.109)	STAD - Stomach adenocarcinoma(6;0.00731)			AGATTTTCTTCCAGGCAACGA	0.463																																					p.E376Q	NSCLC(100;1273 1575 12993 16869 47409)|Ovarian(164;45 1946 8965 30452 48454)	Atlas-SNP	.											.	SLC1A2	54	.	0			c.G1126C						.						155.0	149.0	151.0					11																	35308464		2202	4298	6500	SO:0001583	missense	6506	exon8			TTTCTTCCAGGCA	AB209444	CCDS31459.1, CCDS55756.1	11p13-p12	2013-05-22			ENSG00000110436	ENSG00000110436		"""Solute carriers"""	10940	protein-coding gene	gene with protein product		600300				1448170	Standard	NM_004171		Approved	GLT-1, EAAT2	uc001mwd.3	P43004	OTTHUMG00000044391	ENST00000278379.3:c.1126G>C	chr11.hg19:g.35308464C>G	ENSP00000278379:p.Glu376Gln	61.0	0.0		60.0	24.0	NM_004171	B4DQE9|Q14417|Q541G6|U3KQQ4	Missense_Mutation	SNP	ENST00000278379.3	hg19	CCDS31459.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.1|28.1	4.889942|4.889942	0.91889|0.91889	.|.	.|.	ENSG00000110436|ENSG00000110436	ENST00000278379;ENST00000395750;ENST00000395753|ENST00000531628	T;T;T|.	0.61980|.	0.06;0.06;0.06|.	5.62|5.62	4.71|4.71	0.59529|0.59529	.|.	0.086454|.	0.85682|.	D|.	0.000000|.	T|T	0.72669|0.72669	0.3489|0.3489	M|M	0.70842|0.70842	2.15|2.15	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.995;0.999|.	T|T	0.73269|0.73269	-0.4036|-0.4036	10|5	0.72032|.	D|.	0.01|.	-18.6683|-18.6683	14.8568|14.8568	0.70344|0.70344	0.0:0.9308:0.0:0.0692|0.0:0.9308:0.0:0.0692	.|.	376;376|.	B4DQE9;P43004|.	.;EAA2_HUMAN|.	Q|C	376;367;367|93	ENSP00000278379:E376Q;ENSP00000379099:E367Q;ENSP00000379102:E367Q|.	ENSP00000278379:E376Q|.	E|W	-|-	1|3	0|0	SLC1A2|SLC1A2	35265040|35265040	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	7.776000|7.776000	0.85560|0.85560	1.517000|1.517000	0.48917|0.48917	0.561000|0.561000	0.74099|0.74099	GAA|TGG	.	.		0.463	SLC1A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000258181.1	NM_004171	
OR5D18	219438	hgsc.bcm.edu	37	11	55587559	55587559	+	Missense_Mutation	SNP	T	T	A			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr11:55587559T>A	ENST00000333976.4	+	1	474	c.454T>A	c.(454-456)Tgg>Agg	p.W152R		NM_001001952.1	NP_001001952.1	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D, member 18	152						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(3)|large_intestine(6)|lung(33)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		all_epithelial(135;0.208)				ATCCTATGCCTGGGGAGTCTC	0.478																																					p.W152R		Atlas-SNP	.											.	OR5D18	121	.	0			c.T454A						.						189.0	178.0	182.0					11																	55587559		2200	4296	6496	SO:0001583	missense	219438	exon1			TATGCCTGGGGAG	AB065781	CCDS31510.1	11q11	2012-08-09			ENSG00000186119	ENSG00000186119		"""GPCR / Class A : Olfactory receptors"""	15285	protein-coding gene	gene with protein product							Standard	NM_001001952		Approved		uc010rin.2	Q8NGL1	OTTHUMG00000166811	ENST00000333976.4:c.454T>A	chr11.hg19:g.55587559T>A	ENSP00000335025:p.Trp152Arg	206.0	0.0		177.0	58.0	NM_001001952	Q6IF67|Q6IFD3|Q96RB3	Missense_Mutation	SNP	ENST00000333976.4	hg19	CCDS31510.1	.	.	.	.	.	.	.	.	.	.	.	8.973	0.973516	0.18736	.	.	ENSG00000186119	ENST00000333976	T	0.36520	1.25	4.85	0.776	0.18532	GPCR, rhodopsin-like superfamily (1);	0.000000	0.36628	N	0.002487	T	0.50531	0.1621	M	0.75447	2.3	0.09310	N	0.999994	D	0.71674	0.998	D	0.73708	0.981	T	0.35992	-0.9766	10	0.27785	T	0.31	-7.4768	7.165	0.25685	0.0:0.0835:0.371:0.5456	.	152	Q8NGL1	OR5DI_HUMAN	R	152	ENSP00000335025:W152R	ENSP00000335025:W152R	W	+	1	0	OR5D18	55344135	0.000000	0.05858	0.022000	0.16811	0.010000	0.07245	-0.220000	0.09215	0.298000	0.22638	0.462000	0.41574	TGG	.	.		0.478	OR5D18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391515.1	NM_001001952	
GAL	51083	hgsc.bcm.edu	37	11	68455540	68455540	+	Silent	SNP	G	G	A			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr11:68455540G>A	ENST00000265643.3	+	4	453	c.195G>A	c.(193-195)gaG>gaA	p.E65E		NM_015973.3	NP_057057.2	P22466	GALA_HUMAN	galanin/GMAP prepropeptide	65					cAMP-mediated signaling (GO:0019933)|feeding behavior (GO:0007631)|inflammatory response (GO:0006954)|insulin secretion (GO:0030073)|negative regulation of lymphocyte proliferation (GO:0050672)|negative regulation of root hair elongation (GO:1902891)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catagen (GO:0051795)|positive regulation of cortisol secretion (GO:0051464)|positive regulation of large conductance calcium-activated potassium channel activity (GO:1902608)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein kinase A signaling (GO:0010737)|regulation of glucocorticoid metabolic process (GO:0031943)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to insulin (GO:0032868)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|neuronal cell body (GO:0043025)|secretory granule (GO:0030141)	neuropeptide hormone activity (GO:0005184)|type 1 galanin receptor binding (GO:0031764)|type 2 galanin receptor binding (GO:0031765)|type 3 galanin receptor binding (GO:0031766)			lung(4)	4	Esophageal squamous(3;7.33e-10)	Melanoma(852;0.0749)	LUAD - Lung adenocarcinoma(13;0.0514)	Kidney(183;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(183;3.23e-08)|Lung(977;0.000152)|LUSC - Lung squamous cell carcinoma(976;0.00154)		GCAAGCGGGAGCTGCGGCCCG	0.602																																					p.E65E		Atlas-SNP	.											.	GAL	11	.	0			c.G195A						.						87.0	78.0	81.0					11																	68455540		2200	4294	6494	SO:0001819	synonymous_variant	51083	exon4			GCGGGAGCTGCGG	L11144	CCDS8183.1	11q13.2	2013-02-26	2012-10-23		ENSG00000069482	ENSG00000069482		"""Endogenous ligands"""	4114	protein-coding gene	gene with protein product	"""galanin-message-associated peptide"", ""galanin/GMAP prepropeptide"""	137035	"""galanin"", ""galanin prepropeptide"""	GALN		7508413	Standard	XM_006718580		Approved	GMAP, GAL-GMAP, GLNN	uc001oob.3	P22466	OTTHUMG00000167890	ENST00000265643.3:c.195G>A	chr11.hg19:g.68455540G>A		62.0	0.0		67.0	24.0	NM_015973	Q14413	Silent	SNP	ENST00000265643.3	hg19	CCDS8183.1																																																																																			.	.		0.602	GAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396843.2	NM_001479	
GPR84	53831	hgsc.bcm.edu	37	12	54757494	54757494	+	Missense_Mutation	SNP	G	G	T			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr12:54757494G>T	ENST00000551809.1	-	1	777	c.142C>A	c.(142-144)Cag>Aag	p.Q48K	GPR84_ENST00000267015.3_Missense_Mutation_p.Q48K|RP11-753H16.5_ENST00000552785.1_RNA|RP11-753H16.3_ENST00000550474.1_RNA			Q9NQS5	GPR84_HUMAN	G protein-coupled receptor 84	48						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(2)|kidney(2)|large_intestine(6)|lung(5)|skin(1)|urinary_tract(1)	18						AGCTTGGGCTGGATGGCCAAG	0.582																																					p.Q48K		Atlas-SNP	.											.	GPR84	38	.	0			c.C142A						.						187.0	156.0	167.0					12																	54757494		2203	4300	6503	SO:0001583	missense	53831	exon2			TGGGCTGGATGGC	AF237762	CCDS8878.1	12q13.13	2012-08-20						"""GPCR / Class A : Fatty acid receptors"""	4535	protein-coding gene	gene with protein product		606383				11273702	Standard	NM_020370		Approved	EX33	uc001sfu.3	Q9NQS5		ENST00000551809.1:c.142C>A	chr12.hg19:g.54757494G>T	ENSP00000450310:p.Gln48Lys	55.0	0.0		50.0	14.0	NM_020370	B6V9G7	Missense_Mutation	SNP	ENST00000551809.1	hg19	CCDS8878.1	.	.	.	.	.	.	.	.	.	.	G	9.510	1.105459	0.20632	.	.	ENSG00000139572	ENST00000267015;ENST00000551809	T;T	0.71461	-0.57;-0.57	4.81	3.84	0.44239	GPCR, rhodopsin-like superfamily (1);	0.370724	0.19734	N	0.107286	T	0.59376	0.2189	L	0.40543	1.245	0.31811	N	0.627181	B	0.20164	0.042	B	0.22753	0.041	T	0.58685	-0.7593	10	0.25106	T	0.35	-3.7216	10.9202	0.47161	0.0:0.3044:0.6955:0.0	.	48	Q9NQS5	GPR84_HUMAN	K	48	ENSP00000267015:Q48K;ENSP00000450310:Q48K	ENSP00000267015:Q48K	Q	-	1	0	GPR84	53043761	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	4.497000	0.60367	2.602000	0.87976	0.555000	0.69702	CAG	.	.		0.582	GPR84-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406156.1		
MON2	23041	hgsc.bcm.edu	37	12	62979151	62979151	+	Missense_Mutation	SNP	A	A	T			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr12:62979151A>T	ENST00000393632.2	+	33	5168	c.4777A>T	c.(4777-4779)Aat>Tat	p.N1593Y	MON2_ENST00000280379.6_Missense_Mutation_p.N1594Y|MON2_ENST00000552738.1_Missense_Mutation_p.N1564Y|MON2_ENST00000393630.3_Missense_Mutation_p.N1594Y|MON2_ENST00000551397.1_5'Flank|MON2_ENST00000393629.2_Missense_Mutation_p.N1587Y|MON2_ENST00000546600.1_Missense_Mutation_p.N1593Y	NM_015026.2	NP_055841.2	Q7Z3U7	MON2_HUMAN	MON2 homolog (S. cerevisiae)	1593					actin cytoskeleton organization (GO:0030036)|Golgi to endosome transport (GO:0006895)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(15)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	57			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		TTCCTTCAGTAATAAAGTCAC	0.353																																					p.N1593Y		Atlas-SNP	.											.	MON2	160	.	0			c.A4777T						.						91.0	86.0	88.0					12																	62979151		2203	4300	6503	SO:0001583	missense	23041	exon33			TTCAGTAATAAAG		CCDS31849.1, CCDS61175.1, CCDS61177.1, CCDS61178.1	12q14.1	2014-08-12	2006-04-04		ENSG00000061987	ENSG00000061987			29177	protein-coding gene	gene with protein product			"""MON2 homolog (yeast)"""			16301316, 24285343	Standard	NM_015026		Approved	KIAA1040	uc001sre.3	Q7Z3U7	OTTHUMG00000169992	ENST00000393632.2:c.4777A>T	chr12.hg19:g.62979151A>T	ENSP00000377252:p.Asn1593Tyr	162.0	0.0		148.0	47.0	NM_015026	A5D8U7|A7E2Y0|B9EGP5|F8VWA6|F8W1Z6|Q86TA2|Q8N3I5|Q8NAI0|Q8NHE2|Q9UPW1	Missense_Mutation	SNP	ENST00000393632.2	hg19	CCDS31849.1	.	.	.	.	.	.	.	.	.	.	A	23.2	4.384753	0.82792	.	.	ENSG00000061987	ENST00000393632;ENST00000393630;ENST00000280379;ENST00000546600;ENST00000552738;ENST00000393629	T;T;T;T;T;T	0.58210	0.36;0.36;0.36;0.36;0.35;0.36	5.31	5.31	0.75309	.	0.092243	0.64402	D	0.000001	T	0.64472	0.2601	L	0.42245	1.32	0.80722	D	1	D;D;D;D;D	0.76494	0.997;0.996;0.994;0.999;0.998	P;D;P;D;D	0.72075	0.854;0.93;0.846;0.976;0.93	T	0.62595	-0.6821	9	.	.	.	-17.5848	15.5557	0.76189	1.0:0.0:0.0:0.0	.	1587;1564;1593;462;1593	B9EGP5;F8VWA6;F8W1Z6;Q7Z3U7-3;Q7Z3U7-4	.;.;.;.;.	Y	1593;1594;1594;1593;1564;1587	ENSP00000377252:N1593Y;ENSP00000377250:N1594Y;ENSP00000280379:N1594Y;ENSP00000447407:N1593Y;ENSP00000449215:N1564Y;ENSP00000377249:N1587Y	.	N	+	1	0	MON2	61265418	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.481000	0.81124	2.123000	0.65237	0.460000	0.39030	AAT	.	.		0.353	MON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406767.3	NM_015026	
EEA1	8411	hgsc.bcm.edu	37	12	93236314	93236314	+	Missense_Mutation	SNP	T	T	A			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr12:93236314T>A	ENST00000322349.8	-	10	1106	c.842A>T	c.(841-843)cAg>cTg	p.Q281L		NM_003566.3	NP_003557	Q15075	EEA1_HUMAN	early endosome antigen 1	281					early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|synaptic vesicle to endosome fusion (GO:0016189)|vesicle fusion (GO:0006906)	axonal spine (GO:0044308)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|membrane (GO:0016020)|recycling endosome (GO:0055037)|serine-pyruvate aminotransferase complex (GO:0005969)	1-phosphatidylinositol binding (GO:0005545)|calmodulin binding (GO:0005516)|GTP-dependent protein binding (GO:0030742)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(11)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	36						AGCAACTTCCTGGGGGCCTTT	0.308																																					p.Q281L		Atlas-SNP	.											.	EEA1	104	.	0			c.A842T						.						39.0	40.0	40.0					12																	93236314		2203	4299	6502	SO:0001583	missense	8411	exon10			ACTTCCTGGGGGC	L40157	CCDS31874.1	12q22	2007-02-23	2007-02-23			ENSG00000102189		"""Zinc fingers, FYVE domain containing"""	3185	protein-coding gene	gene with protein product		605070	"""early endosome antigen 1, 162kD"""			7768953, 9697774	Standard	NM_003566		Approved	ZFYVE2	uc001tck.3	Q15075	OTTHUMG00000170110	ENST00000322349.8:c.842A>T	chr12.hg19:g.93236314T>A	ENSP00000317955:p.Gln281Leu	230.0	0.0		345.0	99.0	NM_003566	Q14221	Missense_Mutation	SNP	ENST00000322349.8	hg19	CCDS31874.1	.	.	.	.	.	.	.	.	.	.	T	25.1	4.599645	0.87055	.	.	ENSG00000102189	ENST00000322349;ENST00000540777	D	0.83419	-1.72	5.51	5.51	0.81932	.	0.000000	0.48767	D	0.000169	D	0.86024	0.5834	L	0.34521	1.04	0.80722	D	1	D	0.60160	0.987	D	0.67725	0.953	D	0.86690	0.1922	10	0.49607	T	0.09	.	15.6229	0.76820	0.0:0.0:0.0:1.0	.	281	Q15075	EEA1_HUMAN	L	281;280	ENSP00000317955:Q281L	ENSP00000317955:Q281L	Q	-	2	0	EEA1	91760445	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.560000	0.73950	2.094000	0.63399	0.460000	0.39030	CAG	.	.		0.308	EEA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407304.1	NM_003566	
DAO	1610	hgsc.bcm.edu	37	12	109283278	109283278	+	Missense_Mutation	SNP	C	C	T	rs201583577		TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr12:109283278C>T	ENST00000228476.3	+	4	547	c.343C>T	c.(343-345)Cgg>Tgg	p.R115W	DAO_ENST00000551281.1_Intron	NM_001917.4	NP_001908.3	P14920	OXDA_HUMAN	D-amino-acid oxidase	115					cellular nitrogen compound metabolic process (GO:0034641)|D-alanine catabolic process (GO:0055130)|D-serine catabolic process (GO:0036088)|D-serine metabolic process (GO:0070178)|dopamine biosynthetic process (GO:0042416)|glyoxylate metabolic process (GO:0046487)|leucine metabolic process (GO:0006551)|proline catabolic process (GO:0006562)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	cofactor binding (GO:0048037)|D-amino-acid oxidase activity (GO:0003884)|FAD binding (GO:0071949)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|prostate(2)|skin(1)	26					Flavin adenine dinucleotide(DB03147)	TCTGGGATTTCGGAAGCTGAC	0.532																																					p.R115W		Atlas-SNP	.											.	DAO	58	.	0			c.C343T						.	C	TRP/ARG	0,4406		0,0,2203	88.0	81.0	83.0		343	5.2	1.0	12		83	1,8599	1.2+/-3.3	0,1,4299	yes	missense	DAO	NM_001917.4	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	115/348	109283278	1,13005	2203	4300	6503	SO:0001583	missense	1610	exon4			GGATTTCGGAAGC	D11370	CCDS9122.1	12q24.11	2013-09-20			ENSG00000110887	ENSG00000110887	1.4.3.3		2671	protein-coding gene	gene with protein product		124050				1356107, 8182053	Standard	NM_001917		Approved	DAMOX	uc001tnr.4	P14920	OTTHUMG00000169360	ENST00000228476.3:c.343C>T	chr12.hg19:g.109283278C>T	ENSP00000228476:p.Arg115Trp	48.0	0.0		49.0	9.0	NM_001917	B2R7I5|Q16758|Q8N6R2	Missense_Mutation	SNP	ENST00000228476.3	hg19	CCDS9122.1	.	.	.	.	.	.	.	.	.	.	C	17.49	3.402537	0.62288	0.0	1.16E-4	ENSG00000110887	ENST00000228476;ENST00000547166	D;D	0.83163	-1.69;-1.69	6.06	5.17	0.71159	FAD dependent oxidoreductase (1);	0.049288	0.85682	D	0.000000	D	0.93736	0.7998	H	0.95917	3.74	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95339	0.8436	10	0.87932	D	0	-14.6652	13.984	0.64321	0.2751:0.7249:0.0:0.0	.	115	P14920	OXDA_HUMAN	W	115	ENSP00000228476:R115W;ENSP00000447104:R115W	ENSP00000228476:R115W	R	+	1	2	DAO	107807407	1.000000	0.71417	1.000000	0.80357	0.531000	0.34715	2.461000	0.45040	1.562000	0.49601	0.655000	0.94253	CGG	.	.		0.532	DAO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403682.1		
SUPT20H	55578	hgsc.bcm.edu	37	13	37605935	37605935	+	Missense_Mutation	SNP	T	T	C			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr13:37605935T>C	ENST00000350612.6	-	11	1025	c.805A>G	c.(805-807)Aaa>Gaa	p.K269E	SUPT20H_ENST00000475892.1_Missense_Mutation_p.K269E|SUPT20H_ENST00000542180.1_Missense_Mutation_p.K257E|SUPT20H_ENST00000464744.1_Missense_Mutation_p.K270E|AL138706.1_ENST00000408173.1_RNA|SUPT20H_ENST00000356185.3_Missense_Mutation_p.K270E|SUPT20H_ENST00000360252.4_Missense_Mutation_p.K270E	NM_001014286.2	NP_001014308.2	Q8NEM7	SP20H_HUMAN	suppressor of Ty 20 homolog (S. cerevisiae)	269					autophagy (GO:0006914)|chromatin organization (GO:0006325)|gastrulation (GO:0007369)	SAGA complex (GO:0000124)|SAGA-type complex (GO:0070461)	transcription cofactor activity (GO:0003712)										TCCTTTCTTTTTTGTAAGAAA	0.373																																					p.K270E		Atlas-SNP	.											.	.	.	.	0			c.A808G						.						61.0	67.0	65.0					13																	37605935		2203	4300	6503	SO:0001583	missense	55578	exon11			TTCTTTTTTGTAA	AF093250	CCDS9362.1, CCDS31959.1, CCDS61311.1	13q13	2012-11-29	2012-11-29	2012-11-29	ENSG00000102710	ENSG00000102710			20596	protein-coding gene	gene with protein product	"""p38 interacting protein"", ""transcription factor (p38 interacting protein)"""	613417	"""chromosome 13 open reading frame 19"", ""family with sequence similarity 48, member A"""	C13orf19, FAM48A		12070015 , 16685401	Standard	NM_001278480		Approved	SPT20, bA421P11.4, P38IP	uc001uwg.3	Q8NEM7	OTTHUMG00000016747	ENST00000350612.6:c.805A>G	chr13.hg19:g.37605935T>C	ENSP00000218894:p.Lys269Glu	179.0	0.0		218.0	63.0	NM_017569	E7ER46|Q71RF3|Q9Y6A6	Missense_Mutation	SNP	ENST00000350612.6	hg19	CCDS31959.1	.	.	.	.	.	.	.	.	.	.	T	16.15	3.040872	0.55003	.	.	ENSG00000102710	ENST00000360252;ENST00000475892;ENST00000350612;ENST00000356185;ENST00000536874;ENST00000464744;ENST00000542180	T;T;T;T;T;T	0.55052	0.56;0.54;1.14;0.56;0.56;0.75	5.94	5.94	0.96194	.	0.101865	0.64402	D	0.000002	T	0.54334	0.1852	L	0.50333	1.59	0.49483	D	0.999799	B;P;P;B;B;B	0.36753	0.212;0.568;0.568;0.235;0.199;0.126	B;B;B;B;B;B	0.40636	0.086;0.175;0.311;0.18;0.335;0.137	T	0.57969	-0.7719	10	0.72032	D	0.01	-10.7368	16.4075	0.83691	0.0:0.0:0.0:1.0	.	257;269;269;270;270;269	B4E2D5;B3KNI1;E7ER46;A8K8L1;Q8NEM7-2;Q8NEM7	.;.;.;.;.;FA48A_HUMAN	E	270;269;269;270;269;270;257	ENSP00000353388:K270E;ENSP00000417510:K269E;ENSP00000218894:K269E;ENSP00000348512:K270E;ENSP00000419754:K270E;ENSP00000439000:K257E	ENSP00000218894:K269E	K	-	1	0	FAM48A	36503935	1.000000	0.71417	0.990000	0.47175	0.349000	0.29174	5.850000	0.69473	2.275000	0.75901	0.528000	0.53228	AAA	.	.		0.373	SUPT20H-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354766.1	NM_017569	
DOCK9	23348	hgsc.bcm.edu	37	13	99533811	99533811	+	Splice_Site	SNP	C	C	T			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr13:99533811C>T	ENST00000376460.1	-	25	2826		c.e25+1		DOCK9_ENST00000339416.2_Splice_Site|DOCK9_ENST00000448493.2_Splice_Site|DOCK9_ENST00000442173.1_Splice_Site	NM_001130048.1|NM_015296.2	NP_001123520.1|NP_056111.1	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9						blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(18)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					GTTTTACATACCTTAACATAT	0.423																																					.		Atlas-SNP	.											.	DOCK9	311	.	0			c.2748+1G>A						.						96.0	90.0	92.0					13																	99533811		1945	4133	6078	SO:0001630	splice_region_variant	23348	exon26			TACATACCTTAAC	AF527605	CCDS45062.1	13q32.3	2013-01-10			ENSG00000088387	ENSG00000088387		"""Pleckstrin homology (PH) domain containing"""	14132	protein-coding gene	gene with protein product	"""zizimin1"""	607325				12172552, 12432077	Standard	NM_015296		Approved	KIAA1058, ZIZ1	uc001vnt.2	Q9BZ29	OTTHUMG00000017260	ENST00000376460.1:c.2745+1G>A	chr13.hg19:g.99533811C>T		53.0	0.0		52.0	15.0	NM_015296	B3KX25|E9PFM9|Q5JUD4|Q5JUD6|Q5T2Q1|Q5TAN8|Q9BZ25|Q9BZ26|Q9BZ27|Q9BZ28|Q9UPU4	Splice_Site	SNP	ENST00000376460.1	hg19	CCDS45062.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.886544	0.91814	.	.	ENSG00000088387	ENST00000376460;ENST00000357329;ENST00000376455;ENST00000400235;ENST00000428223;ENST00000339416;ENST00000448493;ENST00000442173	.	.	.	5.46	5.46	0.80206	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.6793	0.95956	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DOCK9	98331812	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.427000	0.80284	2.713000	0.92767	0.655000	0.94253	.	.	.		0.423	DOCK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045566.1	NM_015296	Intron
ANKRD10	55608	hgsc.bcm.edu	37	13	111532383	111532383	+	Silent	SNP	G	G	C			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr13:111532383G>C	ENST00000267339.2	-	6	998	c.864C>G	c.(862-864)tcC>tcG	p.S288S	ANKRD10_ENST00000375758.5_3'UTR	NM_017664.2	NP_060134.2	Q9NXR5	ANR10_HUMAN	ankyrin repeat domain 10	288										central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(3)	9	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		all cancers(43;0.0882)|BRCA - Breast invasive adenocarcinoma(86;0.188)|Lung(89;0.208)			GCGGGGTCGTGGAGGGGAAGT	0.473																																					p.S288S		Atlas-SNP	.											.	ANKRD10	24	.	0			c.C864G						.						72.0	74.0	73.0					13																	111532383		2203	4300	6503	SO:0001819	synonymous_variant	55608	exon6			GGTCGTGGAGGGG	AK000100	CCDS9520.1, CCDS66580.1	13q33.3	2013-01-10			ENSG00000088448	ENSG00000088448		"""Ankyrin repeat domain containing"""	20265	protein-coding gene	gene with protein product							Standard	NM_017664		Approved	FLJ20093	uc001vrn.3	Q9NXR5	OTTHUMG00000017349	ENST00000267339.2:c.864C>G	chr13.hg19:g.111532383G>C		82.0	0.0		64.0	22.0	NM_017664	Q5VW12|Q9BV12	Silent	SNP	ENST00000267339.2	hg19	CCDS9520.1																																																																																			.	.		0.473	ANKRD10-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045783.1		
PSMB5	5693	hgsc.bcm.edu	37	14	23495455	23495455	+	Missense_Mutation	SNP	T	T	C	rs60224002		TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr14:23495455T>C	ENST00000361611.6	-	3	898	c.635A>G	c.(634-636)tAt>tGt	p.Y212C	PSMB5_ENST00000425762.2_Missense_Mutation_p.Y109C|PSMB5_ENST00000460922.2_3'UTR|PSMB5_ENST00000493471.2_3'UTR	NM_002797.3	NP_002788.1	P28074	PSB5_HUMAN	proteasome (prosome, macropain) subunit, beta type, 5	212					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to oxidative stress (GO:0006979)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)	threonine-type endopeptidase activity (GO:0004298)			kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)	7	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.0121)	Bortezomib(DB00188)|Carfilzomib(DB08889)	GGCCAGATCATAGGCCTGCTC	0.567																																					p.Y212C		Atlas-SNP	.											.	PSMB5	31	.	0			c.A635G						.						160.0	139.0	147.0					14																	23495455		2203	4300	6503	SO:0001583	missense	5693	exon3			AGATCATAGGCCT	D29011	CCDS9584.1, CCDS45083.1, CCDS45084.1	14q11.2	2008-08-29			ENSG00000100804	ENSG00000100804		"""Proteasome (prosome, macropain) subunits"""	9542	protein-coding gene	gene with protein product		600306				8066462, 8811196	Standard	NM_001130725		Approved	X, MB1	uc001wii.3	P28074	OTTHUMG00000028713	ENST00000361611.6:c.635A>G	chr14.hg19:g.23495455T>C	ENSP00000355325:p.Tyr212Cys	79.0	0.0		60.0	14.0	NM_002797	B2R4N9|B4DUM9|D3DS43|E9PAV2|Q16242|Q6PEW2|Q7Z3B5|Q86T01|Q9TNN9	Missense_Mutation	SNP	ENST00000361611.6	hg19	CCDS9584.1	.	.	.	.	.	.	.	.	.	.	T	10.96	1.499269	0.26861	.	.	ENSG00000100804	ENST00000361611;ENST00000425762	T;T	0.22134	1.97;1.97	5.25	5.25	0.73442	.	0.180201	0.50627	D	0.000106	T	0.20536	0.0494	L	0.41492	1.28	0.34311	D	0.685429	B	0.18968	0.032	B	0.25405	0.06	T	0.16719	-1.0393	10	0.37606	T	0.19	-2.4825	14.1432	0.65334	0.0:0.0:0.0:1.0	rs60224002	212	P28074	PSB5_HUMAN	C	212;109	ENSP00000355325:Y212C;ENSP00000395206:Y109C	ENSP00000355325:Y212C	Y	-	2	0	PSMB5	22565295	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.206000	0.42779	1.988000	0.58038	0.392000	0.25879	TAT	.	T|0.998;C|0.002		0.567	PSMB5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071695.4	NM_002797	
CHURC1	91612	hgsc.bcm.edu	37	14	65398907	65398907	+	Missense_Mutation	SNP	A	A	G			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr14:65398907A>G	ENST00000549115.1	+	4	433	c.379A>G	c.(379-381)Att>Gtt	p.I127V	FNTB_ENST00000447296.2_Intron|CHURC1_ENST00000359118.2_Missense_Mutation_p.I101V|CHURC1_ENST00000552002.2_Missense_Mutation_p.I100V|CHURC1-FNTB_ENST00000549987.1_Intron|FNTB_ENST00000542227.1_Intron|CHURC1_ENST00000548752.2_Missense_Mutation_p.Y103C|CHURC1_ENST00000607599.1_Missense_Mutation_p.I128V			Q8WUH1	CHUR_HUMAN	churchill domain containing 1	127					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)		zinc ion binding (GO:0008270)			breast(1)|pancreas(1)	2				all cancers(60;0.00119)|OV - Ovarian serous cystadenocarcinoma(108;0.0056)|BRCA - Breast invasive adenocarcinoma(234;0.00976)		TACTATCAGTATTCTCCCTGA	0.398																																					p.I128V		Atlas-SNP	.											.	CHURC1	6	.	0			c.A382G						.						144.0	131.0	135.0					14																	65398907		2203	4300	6503	SO:0001583	missense	91612	exon4			ATCAGTATTCTCC	AF060510	CCDS32101.1, CCDS32101.2, CCDS55921.1, CCDS55922.1	14q23.3	2011-09-28	2004-05-05	2004-05-07	ENSG00000258289	ENSG00000258289			20099	protein-coding gene	gene with protein product		608577		C14orf52			Standard	NM_145165		Approved	My015, FLJ33064		Q8WUH1	OTTHUMG00000170218	ENST00000549115.1:c.379A>G	chr14.hg19:g.65398907A>G	ENSP00000448050:p.Ile127Val	101.0	0.0		115.0	35.0	NM_145165	B3KQ81|G3V1X3|G3V214|Q9H3K7	Missense_Mutation	SNP	ENST00000549115.1	hg19	CCDS55921.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.889|9.889	1.203766|1.203766	0.22121|0.22121	.|.	.|.	ENSG00000258289|ENSG00000258289	ENST00000552002;ENST00000549115;ENST00000359118|ENST00000548752	.|.	.|.	.|.	6.11|6.11	3.75|3.75	0.43078|0.43078	.|.	0.190860|.	0.45867|.	D|.	0.000336|.	T|T	0.15565|0.15565	0.0375|0.0375	N|N	0.01576|0.01576	-0.805|-0.805	0.80722|0.80722	D|D	1|1	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.04013|.	0.0;0.001|.	T|T	0.04522|0.04522	-1.0945|-1.0945	9|5	0.09084|.	T|.	0.74|.	.|.	2.377|2.377	0.04345|0.04345	0.6102:0.0:0.1534:0.2364|0.6102:0.0:0.1534:0.2364	.|.	100;128|.	Q8WUH1;G3V214|.	CHUR_HUMAN;.|.	V|C	128;127;101|103	.|.	ENSP00000352026:I101V|.	I|Y	+|+	1|2	0|0	CHURC1|CHURC1	64468660|64468660	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	4.446000|4.446000	0.60014|0.60014	1.108000|1.108000	0.41662|0.41662	0.533000|0.533000	0.62120|0.62120	ATT|TAT	.	.		0.398	CHURC1-002	KNOWN	NAGNAG_splice_site|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000408062.1	NM_145165	
NPAP1	23742	hgsc.bcm.edu	37	15	24923800	24923800	+	Missense_Mutation	SNP	C	C	A			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr15:24923800C>A	ENST00000329468.2	+	1	3260	c.2786C>A	c.(2785-2787)aCa>aAa	p.T929K		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	929			T -> P (in dbSNP:rs34413216).		cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											ATAGGCTTAACATCTCCTTCA	0.483																																					p.T929K		Atlas-SNP	.											.	.	.	.	0			c.C2786A						.						88.0	91.0	90.0					15																	24923800		2203	4300	6503	SO:0001583	missense	23742	exon1			GCTTAACATCTCC	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.2786C>A	chr15.hg19:g.24923800C>A	ENSP00000333735:p.Thr929Lys	33.0	0.0		35.0	8.0	NM_018958		Missense_Mutation	SNP	ENST00000329468.2	hg19	CCDS10015.1	.	.	.	.	.	.	.	.	.	.	.	5.606	0.296622	0.10622	.	.	ENSG00000185823	ENST00000329468	T	0.09911	2.93	2.04	1.07	0.20283	.	1.446920	0.04526	N	0.385475	T	0.09335	0.0230	N	0.24115	0.695	0.09310	N	1	B	0.24920	0.114	B	0.32022	0.139	T	0.42481	-0.9449	10	0.28530	T	0.3	.	6.4327	0.21807	0.0:0.6495:0.3505:0.0	.	929	Q9NZP6	CO002_HUMAN	K	929	ENSP00000333735:T929K	ENSP00000333735:T929K	T	+	2	0	C15orf2	22474893	0.001000	0.12720	0.000000	0.03702	0.010000	0.07245	1.363000	0.34159	0.388000	0.25054	0.313000	0.20887	ACA	.	.		0.483	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958	
SPTBN5	51332	hgsc.bcm.edu	37	15	42178394	42178394	+	Silent	SNP	G	G	A			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr15:42178394G>A	ENST00000320955.6	-	7	1286	c.1059C>T	c.(1057-1059)acC>acT	p.T353T		NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	353					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		GCTTCTCCTGGGTGCGGAAGA	0.647																																					p.T318T		Atlas-SNP	.											.	SPTBN5	171	.	0			c.C954T						.						24.0	27.0	26.0					15																	42178394		2009	4192	6201	SO:0001819	synonymous_variant	51332	exon7			CTCCTGGGTGCGG	AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.1059C>T	chr15.hg19:g.42178394G>A		60.0	0.0		69.0	19.0	NM_016642		Silent	SNP	ENST00000320955.6	hg19																																																																																				.	.		0.647	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000420237.1	NM_016642	
PLA2G4E	123745	hgsc.bcm.edu	37	15	42280320	42280320	+	Silent	SNP	C	C	A			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr15:42280320C>A	ENST00000399518.3	-	16	2244	c.1758G>T	c.(1756-1758)ctG>ctT	p.L586L	PLA2G4E_ENST00000413860.2_Silent_p.L557L|CTD-2382E5.1_ENST00000499478.2_RNA	NM_001206670.1	NP_001193599.1	Q3MJ16	PA24E_HUMAN	phospholipase A2, group IVE	574	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phospholipase A2 activity (GO:0004623)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|stomach(1)	16		all_cancers(109;8.09e-13)|all_epithelial(112;2.03e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.0273)		OV - Ovarian serous cystadenocarcinoma(18;7.61e-18)|GBM - Glioblastoma multiforme(94;3.07e-06)		TCCAGGCATCCAGCAGGTTCA	0.607																																					p.L586L		Atlas-SNP	.											.	PLA2G4E	60	.	0			c.G1758T						.						42.0	50.0	48.0					15																	42280320		2116	4252	6368	SO:0001819	synonymous_variant	123745	exon16			GGCATCCAGCAGG		CCDS55962.1	15q15.1	2008-09-19			ENSG00000188089	ENSG00000188089	3.1.1.4		24791	protein-coding gene	gene with protein product						15866882	Standard	NM_001206670		Approved	FLJ45651	uc021sjp.1	Q3MJ16	OTTHUMG00000130371	ENST00000399518.3:c.1758G>T	chr15.hg19:g.42280320C>A		41.0	0.0		32.0	14.0	NM_001206670	Q6ZSC0	Silent	SNP	ENST00000399518.3	hg19	CCDS55962.1																																																																																			.	.		0.607	PLA2G4E-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252738.2	NM_198442	
SEMA6D	80031	hgsc.bcm.edu	37	15	48060868	48060868	+	Missense_Mutation	SNP	C	C	A			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr15:48060868C>A	ENST00000316364.5	+	18	2295	c.1856C>A	c.(1855-1857)aCa>aAa	p.T619K	SEMA6D_ENST00000389433.2_Missense_Mutation_p.T600K|SEMA6D_ENST00000354744.4_Intron|SEMA6D_ENST00000358066.4_Intron|SEMA6D_ENST00000558014.1_Intron|SEMA6D_ENST00000389432.2_Intron|SEMA6D_ENST00000536845.2_Missense_Mutation_p.T619K|SEMA6D_ENST00000558816.1_Intron|SEMA6D_ENST00000355997.3_Intron|SEMA6D_ENST00000537942.1_Intron|SEMA6D_ENST00000389428.3_Intron	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	619					axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		CCTAAACTGACAAGCTCTCGG	0.443																																					p.T619K		Atlas-SNP	.											.	SEMA6D	322	.	0			c.C1856A						.						115.0	108.0	111.0					15																	48060868		2198	4297	6495	SO:0001583	missense	80031	exon18			AACTGACAAGCTC	AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.1856C>A	chr15.hg19:g.48060868C>A	ENSP00000324857:p.Thr619Lys	62.0	0.0		61.0	15.0	NM_153618	A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Missense_Mutation	SNP	ENST00000316364.5	hg19	CCDS32225.1	.	.	.	.	.	.	.	.	.	.	C	12.24	1.879792	0.33162	.	.	ENSG00000137872	ENST00000536845;ENST00000316364;ENST00000389433	T;T;T	0.16073	2.38;2.38;2.37	5.49	5.49	0.81192	.	0.000000	0.64402	D	0.000017	T	0.09555	0.0235	N	0.08118	0	0.80722	D	1	B	0.24186	0.099	B	0.19946	0.027	T	0.12016	-1.0564	10	0.05959	T	0.93	.	19.7433	0.96241	0.0:1.0:0.0:0.0	.	619	Q8NFY4	SEM6D_HUMAN	K	619;619;600	ENSP00000446152:T619K;ENSP00000324857:T619K;ENSP00000374084:T600K	ENSP00000324857:T619K	T	+	2	0	SEMA6D	45848160	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.590000	0.53979	2.733000	0.93635	0.655000	0.94253	ACA	.	.		0.443	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416868.1	NM_024966	
BNC1	646	hgsc.bcm.edu	37	15	83932654	83932654	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr15:83932654C>T	ENST00000345382.2	-	4	1434	c.1349G>A	c.(1348-1350)tGt>tAt	p.C450Y	BNC1_ENST00000569704.1_Missense_Mutation_p.C443Y|RP11-382A20.4_ENST00000565495.1_RNA	NM_001717.3	NP_001708.3	Q01954	BNC1_HUMAN	basonuclin 1	450					chromosome organization (GO:0051276)|epidermis development (GO:0008544)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	56						AGGAGGCCTACAGTCTGGGGA	0.522																																					p.C450Y		Atlas-SNP	.											.	BNC1	149	.	0			c.G1349A						.						111.0	102.0	105.0					15																	83932654		2203	4300	6503	SO:0001583	missense	646	exon4			GGCCTACAGTCTG	L03427	CCDS10324.1, CCDS73771.1	15q25.1	2013-05-20	2004-04-30	2004-05-04	ENSG00000169594	ENSG00000169594		"""Zinc fingers, C2H2-type"""	1081	protein-coding gene	gene with protein product		601930	"""basonuclin"""	BNC		1332044	Standard	NM_001717		Approved	HsT19447	uc002bjt.1	Q01954	OTTHUMG00000147362	ENST00000345382.2:c.1349G>A	chr15.hg19:g.83932654C>T	ENSP00000307041:p.Cys450Tyr	120.0	0.0		103.0	28.0	NM_001717	Q15840	Missense_Mutation	SNP	ENST00000345382.2	hg19	CCDS10324.1	.	.	.	.	.	.	.	.	.	.	C	0.018	-1.467134	0.01053	.	.	ENSG00000169594	ENST00000345382;ENST00000541809	T	0.42900	0.96	4.98	3.12	0.35913	.	0.136514	0.64402	N	0.000004	T	0.32585	0.0834	L	0.60455	1.87	0.28465	N	0.915674	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.33292	-0.9874	10	0.06494	T	0.89	-6.0256	9.874	0.41191	0.0:0.7786:0.0:0.2214	.	443;450	F5GY04;Q01954	.;BNC1_HUMAN	Y	450;443	ENSP00000307041:C450Y	ENSP00000307041:C450Y	C	-	2	0	BNC1	81723658	0.640000	0.27243	0.854000	0.33618	0.259000	0.26198	0.856000	0.27818	0.701000	0.31803	-0.137000	0.14449	TGT	.	.		0.522	BNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304006.1	NM_001717	
PDE8A	5151	hgsc.bcm.edu	37	15	85664189	85664189	+	Silent	SNP	G	G	A			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr15:85664189G>A	ENST00000310298.4	+	19	2148	c.1896G>A	c.(1894-1896)ttG>ttA	p.L632L	PDE8A_ENST00000394553.1_Silent_p.L632L|PDE8A_ENST00000557957.1_Silent_p.L560L|PDE8A_ENST00000339708.5_Silent_p.L586L			O60658	PDE8A_HUMAN	phosphodiesterase 8A	632	Catalytic. {ECO:0000250}.				cAMP catabolic process (GO:0006198)|cyclic nucleotide metabolic process (GO:0009187)|phosphorelay signal transduction system (GO:0000160)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	25	Colorectal(223;0.227)		BRCA - Breast invasive adenocarcinoma(143;0.0608)		Caffeine(DB00201)|Ketotifen(DB00920)	ATGCGGCCTTGGCCTTCCAGC	0.463																																					p.L632L		Atlas-SNP	.											.	PDE8A	50	.	0			c.G1896A						.						93.0	79.0	84.0					15																	85664189		2203	4299	6502	SO:0001819	synonymous_variant	5151	exon18			GGCCTTGGCCTTC	AF056490	CCDS10336.1, CCDS10337.1, CCDS58397.1	15q25.3	2008-05-14			ENSG00000073417	ENSG00000073417	3.1.4.17	"""Phosphodiesterases"""	8793	protein-coding gene	gene with protein product		602972				9618252	Standard	NM_001243137		Approved	HsT19550	uc002blh.3	O60658	OTTHUMG00000148670	ENST00000310298.4:c.1896G>A	chr15.hg19:g.85664189G>A		60.0	0.0		68.0	28.0	NM_002605	B3KXE6|H0YMZ7|Q6P9H3|Q969I1|Q96PC9|Q96PD0|Q96PD1|Q96T71|Q9UMB7|Q9UMC3	Silent	SNP	ENST00000310298.4	hg19	CCDS10336.1																																																																																			.	.		0.463	PDE8A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000309018.1	NM_002605	
C16orf13	84326	hgsc.bcm.edu	37	16	684899	684899	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr16:684899G>A	ENST00000301686.8	-	4	489	c.478C>T	c.(478-480)Ctc>Ttc	p.L160F	C16orf13_ENST00000397664.4_Intron|C16orf13_ENST00000397665.2_Intron|C16orf13_ENST00000338401.4_Intron|C16orf13_ENST00000397666.2_Intron	NM_032366.3	NP_115742.3	Q96S19	CP013_HUMAN	chromosome 16 open reading frame 13	160										large_intestine(1)	1		Hepatocellular(780;0.00335)				CTGCATCTGAGCATCAGGTCA	0.627																																					p.L160F		Atlas-SNP	.											.	C16orf13	11	.	0			c.C478T						.						30.0	35.0	33.0					16																	684899		2162	4259	6421	SO:0001583	missense	84326	exon4			ATCTGAGCATCAG		CCDS32352.1, CCDS42090.1, CCDS42091.1, CCDS45367.1, CCDS45368.1, CCDS73798.1	16p13.3	2012-10-09			ENSG00000130731	ENSG00000130731			14141	protein-coding gene	gene with protein product							Standard	NM_001040160		Approved	MGC13114	uc002chw.1	Q96S19	OTTHUMG00000047855	ENST00000301686.8:c.478C>T	chr16.hg19:g.684899G>A	ENSP00000445926:p.Leu160Phe	23.0	0.0		21.0	9.0	NM_032366	A8MTR1|A8MWJ8|A8MZA1|B4DG95|B4DIJ3|D6REA6|F6TF62|F6VM53|Q96IW1|Q96MD6	Missense_Mutation	SNP	ENST00000301686.8	hg19	CCDS45368.1	.	.	.	.	.	.	.	.	.	.	G	16.27	3.077205	0.55753	.	.	ENSG00000130731	ENST00000301686	T	0.65178	-0.14	4.6	4.6	0.57074	.	0.084173	0.49916	D	0.000125	D	0.84042	0.5385	M	0.94101	3.495	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88648	0.3180	10	0.87932	D	0	.	16.1476	0.81580	0.0:0.0:1.0:0.0	.	160	Q96S19	CP013_HUMAN	F	160	ENSP00000445926:L160F	ENSP00000445926:L160F	L	-	1	0	Z84479.1	624900	0.994000	0.37717	0.915000	0.36163	0.618000	0.37518	3.832000	0.55783	2.379000	0.81126	0.561000	0.74099	CTC	.	.		0.627	C16orf13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109081.2	NM_001040160	
WDR90	197335	hgsc.bcm.edu	37	16	709346	709346	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr16:709346G>A	ENST00000293879.4	+	26	3154	c.3154G>A	c.(3154-3156)Gtc>Atc	p.V1052I	WDR90_ENST00000549091.1_Missense_Mutation_p.V1052I			Q96KV7	WDR90_HUMAN	WD repeat domain 90	1052										endometrium(4)|kidney(3)|large_intestine(2)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	37		Hepatocellular(780;0.0218)				ACGGCTGGGCGTCTGTGCCAG	0.711																																					p.V1052I		Atlas-SNP	.											.	WDR90	107	.	0			c.G3154A						.						14.0	20.0	18.0					16																	709346		2094	4201	6295	SO:0001583	missense	197335	exon26			CTGGGCGTCTGTG	AB067511	CCDS42092.1	16p13.3	2013-01-09			ENSG00000161996	ENSG00000161996		"""WD repeat domain containing"""	26960	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 17"", ""chromosome 16 open reading frame 15"", ""chromosome 16 open reading frame 16"", ""chromosome 16 open reading frame 19"", ""chromosome 16 open reading frame 18"""	C16orf17, C16orf15, C16orf16, C16orf19, C16orf18		11572484, 11157797	Standard	XM_005255160		Approved	FLJ36483, KIAA1924	uc002cii.1	Q96KV7	OTTHUMG00000048040	ENST00000293879.4:c.3154G>A	chr16.hg19:g.709346G>A	ENSP00000293879:p.Val1052Ile	92.0	0.0		50.0	13.0	NM_145294	Q0VA87|Q0VA88|Q6P048|Q6ZMS1|Q6ZTH1|Q8N202|Q8N221|Q8NBB8|Q96PW4|Q96S18	Missense_Mutation	SNP	ENST00000293879.4	hg19	CCDS42092.1	.	.	.	.	.	.	.	.	.	.	G	2.289	-0.362831	0.05103	.	.	ENSG00000161996	ENST00000549091;ENST00000293879	T;T	0.26660	1.76;1.72	4.38	-8.76	0.00830	.	3.312490	0.01911	N	0.039832	T	0.09379	0.0231	N	0.03154	-0.405	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.17806	-1.0357	10	0.13470	T	0.59	.	8.2669	0.31819	0.1956:0.3681:0.4362:0.0	.	1052;1052	F8VUX9;Q96KV7	.;WDR90_HUMAN	I	1052	ENSP00000448122:V1052I;ENSP00000293879:V1052I	ENSP00000293879:V1052I	V	+	1	0	WDR90	649347	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.053000	0.01400	-2.553000	0.00478	-1.434000	0.01081	GTC	.	.		0.711	WDR90-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404335.1	NM_145294	
TPSD1	23430	hgsc.bcm.edu	37	16	1306673	1306673	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr16:1306673C>T	ENST00000211076.3	+	2	387	c.239C>T	c.(238-240)gCg>gTg	p.A80V	TPSD1_ENST00000397534.2_Missense_Mutation_p.A73V|RP11-616M22.5_ENST00000566997.1_RNA	NM_012217.2	NP_036349.1	Q9BZJ3	TRYD_HUMAN	tryptase delta 1	80	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)	20		Hepatocellular(780;0.00369)				CTAACCGCGGCGCACTGCGTG	0.701																																					p.A80V		Atlas-SNP	.											TPSD1,NS,carcinoma,0,1	TPSD1	47	.	0			c.C239T						.						42.0	51.0	48.0					16																	1306673		2199	4298	6497	SO:0001583	missense	23430	exon2			CCGCGGCGCACTG	AF206664	CCDS10432.1	16p13.3	2008-07-29			ENSG00000095917	ENSG00000095917	3.4.21.59		14118	protein-coding gene	gene with protein product	"""mMCP-7-like II"", ""mMCP-7-like I"", ""MMCP-7-LIKE-2"""	609272				9920877	Standard	NM_012217		Approved		uc002clb.1	Q9BZJ3	OTTHUMG00000128511	ENST00000211076.3:c.239C>T	chr16.hg19:g.1306673C>T	ENSP00000211076:p.Ala80Val	65.0	0.0		67.0	22.0	NM_012217	O95824|Q8TDI6|Q96L36|Q96RZ5|Q9H2Y6|Q9UQI8	Missense_Mutation	SNP	ENST00000211076.3	hg19	CCDS10432.1	.	.	.	.	.	.	.	.	.	.	-	15.31	2.795139	0.50208	.	.	ENSG00000095917	ENST00000397534;ENST00000211076	D;D	0.89746	-2.56;-2.56	3.0	1.98	0.26296	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.143335	0.32175	N	0.006466	D	0.92244	0.7540	H	0.95917	3.74	0.38830	D	0.95582	P;P	0.50617	0.937;0.937	B;P	0.45577	0.352;0.486	D	0.92167	0.5740	10	0.72032	D	0.01	.	9.5188	0.39122	0.0:0.7372:0.2628:0.0	.	73;80	C9JJL5;Q9BZJ3	.;TRYD_HUMAN	V	73;80	ENSP00000380668:A73V;ENSP00000211076:A80V	ENSP00000211076:A80V	A	+	2	0	TPSD1	1246674	0.996000	0.38824	0.004000	0.12327	0.012000	0.07955	3.480000	0.53172	0.510000	0.28216	0.185000	0.17295	GCG	.	.		0.701	TPSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250320.2		
EME2	197342	hgsc.bcm.edu	37	16	1826218	1826218	+	Silent	SNP	C	C	T			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr16:1826218C>T	ENST00000568449.1	+	8	1140	c.1119C>T	c.(1117-1119)ctC>ctT	p.L373L	EME2_ENST00000307394.7_Silent_p.L438L	NM_001257370.1	NP_001244299.1	A4GXA9	EME2_HUMAN	essential meiotic structure-specific endonuclease subunit 2	373					DNA recombination (GO:0006310)|DNA repair (GO:0006281)	nucleus (GO:0005634)	DNA binding (GO:0003677)|endonuclease activity (GO:0004519)			central_nervous_system(1)|kidney(2)|lung(5)|pancreas(1)	9						ACCCTGATCTCCTGCTGGACC	0.687								Direct reversal of damage;Homologous recombination																													p.L373L		Atlas-SNP	.											.	EME2	40	.	0			c.C1119T						.						72.0	62.0	65.0					16																	1826218		2174	4258	6432	SO:0001819	synonymous_variant	197342	exon8			TGATCTCCTGCTG	AK074080	CCDS58404.1	16p13.3	2013-07-03	2013-07-03			ENSG00000197774			27289	protein-coding gene	gene with protein product	"""SLX2 structure-specific endonuclease subunit homolog B (S. cerevisiae)"""	610886	"""essential meiotic endonuclease 1 homolog 2 (S. pombe)"""			12721304	Standard	NM_001257370		Approved	FLJ00151, SLX2B	uc010brw.1	A4GXA9		ENST00000568449.1:c.1119C>T	chr16.hg19:g.1826218C>T		35.0	0.0		39.0	14.0	NM_001257370	Q8TEP2|Q96RY3	Silent	SNP	ENST00000568449.1	hg19	CCDS58404.1																																																																																			.	.		0.687	EME2-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000433185.2	NM_001010865	
TIGD7	91151	hgsc.bcm.edu	37	16	3350103	3350103	+	Missense_Mutation	SNP	A	A	T			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr16:3350103A>T	ENST00000396862.1	-	2	2340	c.512T>A	c.(511-513)cTa>cAa	p.L171Q	TIGD7_ENST00000574598.1_5'Flank|TIGD7_ENST00000268674.2_Missense_Mutation_p.L171Q	NM_033208.3	NP_149985.2	Q6NT04	TIGD7_HUMAN	tigger transposable element derived 7	171	DDE.					nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12						tagctgAGCTAGACACAGTTT	0.418																																					p.L171Q		Atlas-SNP	.											.	TIGD7	41	.	0			c.T512A						.						161.0	157.0	159.0					16																	3350103		2197	4300	6497	SO:0001583	missense	91151	exon2			TGAGCTAGACACA	AF251050	CCDS10500.1	16p13.11	2008-02-05			ENSG00000140993	ENSG00000140993			18331	protein-coding gene	gene with protein product		612969					Standard	NM_033208		Approved	Sancho	uc002cus.3	Q6NT04	OTTHUMG00000129325	ENST00000396862.1:c.512T>A	chr16.hg19:g.3350103A>T	ENSP00000380071:p.Leu171Gln	136.0	0.0		157.0	54.0	NM_033208	Q9BXZ0	Missense_Mutation	SNP	ENST00000396862.1	hg19	CCDS10500.1	.	.	.	.	.	.	.	.	.	.	A	12.24	1.878217	0.33162	.	.	ENSG00000140993	ENST00000426381;ENST00000396862;ENST00000268674	T;T	0.33438	1.41;1.41	5.22	5.22	0.72569	.	0.293724	0.17915	U	0.157710	T	0.44498	0.1296	L	0.50333	1.59	0.29096	N	0.881769	D	0.56287	0.975	P	0.62298	0.9	T	0.32613	-0.9900	10	0.30854	T	0.27	.	11.4827	0.50335	1.0:0.0:0.0:0.0	.	171	Q6NT04	TIGD7_HUMAN	Q	171	ENSP00000380071:L171Q;ENSP00000268674:L171Q	ENSP00000268674:L171Q	L	-	2	0	TIGD7	3290104	0.945000	0.32115	0.758000	0.31321	0.918000	0.54935	2.781000	0.47750	1.977000	0.57605	0.533000	0.62120	CTA	.	.		0.418	TIGD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251465.1	NM_033208	
NLRC3	197358	hgsc.bcm.edu	37	16	3613898	3613898	+	RNA	SNP	G	G	T			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr16:3613898G>T	ENST00000301749.7	-	0	1445				NLRC3_ENST00000324659.8_RNA|NLRC3_ENST00000359128.5_RNA|NLRC3_ENST00000448023.2_RNA|NLRC3_ENST00000419350.2_RNA|NLRC3_ENST00000603507.1_RNA	NM_178844.2	NP_849172.2	Q7RTR2	NLRC3_HUMAN	NLR family, CARD domain containing 3						I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of protein ubiquitination (GO:0031396)|response to lipopolysaccharide (GO:0032496)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(16)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CTGGGGCCCCGTCCTGCTGCG	0.667																																					p.T347K		Atlas-SNP	.											.	NLRC3	103	.	0			c.C1040A						.						30.0	34.0	33.0					16																	3613898		1994	4146	6140			197358	exon5			GGCCCCGTCCTGC	BK001112	CCDS73817.1	16p13.3	2014-03-25			ENSG00000167984	ENSG00000167984		"""Nucleotide-binding domain and leucine rich repeat containing"""	29889	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 3"", ""NOD-like receptor C3"""	615648				15705585, 12766759	Standard	NM_178844		Approved	CLR16.2, FLJ00348, NOD3	uc010btn.3	Q7RTR2	OTTHUMG00000177561		chr16.hg19:g.3613898G>T		13.0	0.0		17.0	7.0	NM_178844	Q5EY36|Q8NF48|Q8NI01|Q8NI02|Q8TEL3	Missense_Mutation	SNP	ENST00000301749.7	hg19		.	.	.	.	.	.	.	.	.	.	G	0.006	-2.070469	0.00379	.	.	ENSG00000167984	ENST00000419350;ENST00000301749;ENST00000359128;ENST00000448023;ENST00000324659	D;D;D;D	0.83755	-1.76;-1.76;-1.76;-1.76	5.15	-10.3	0.00346	.	1.039180	0.07631	N	0.928641	T	0.49881	0.1583	.	.	.	0.09310	N	1	B	0.13594	0.008	B	0.12156	0.007	T	0.49293	-0.8955	9	0.05833	T	0.94	.	1.3184	0.02112	0.44:0.1678:0.1654:0.2268	.	394	C9JLH9	.	K	347;347;347;394;329	ENSP00000301749:T347K;ENSP00000352039:T347K;ENSP00000414415:T394K;ENSP00000323897:T329K	ENSP00000301749:T347K	T	-	2	0	NLRC3	3553899	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.069000	0.01381	-2.458000	0.00538	-0.119000	0.15052	ACG	.	.		0.667	NLRC3-201	KNOWN	basic|appris_principal	protein_coding	polymorphic_pseudogene		NM_178844	
RBFOX1	54715	hgsc.bcm.edu	37	16	7760685	7760685	+	Missense_Mutation	SNP	G	G	T	rs369122393		TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr16:7760685G>T	ENST00000550418.1	+	16	2120	c.1132G>T	c.(1132-1134)Gtt>Ttt	p.V378F	RBFOX1_ENST00000547372.1_3'UTR|RBFOX1_ENST00000547338.1_Missense_Mutation_p.V378F|RBFOX1_ENST00000552089.1_3'UTR|RBFOX1_ENST00000340209.4_Missense_Mutation_p.V383F|RBFOX1_ENST00000355637.4_3'UTR|RBFOX1_ENST00000311745.5_Missense_Mutation_p.V399F|RBFOX1_ENST00000436368.2_Intron|RBFOX1_ENST00000553186.1_Missense_Mutation_p.V351F	NM_018723.3	NP_061193.2	Q9NWB1	RFOX1_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 1	378					mRNA processing (GO:0006397)|neuromuscular process controlling balance (GO:0050885)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	nucleotide binding (GO:0000166)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|lung(17)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)	55						TGTGGGTCTCGTTCTTTCTTC	0.413																																					p.V399F	Ovarian(157;934 2567 15163 39509)	Atlas-SNP	.											.	RBFOX1	341	.	0			c.G1195T						.						226.0	198.0	208.0					16																	7760685		2197	4300	6497	SO:0001583	missense	54715	exon13			GGTCTCGTTCTTT	AF107203	CCDS10531.1, CCDS10532.1, CCDS45405.1, CCDS55983.1, CCDS55984.1	16p13.3	2013-02-12			ENSG00000078328	ENSG00000078328		"""RNA binding motif (RRM) containing"""	18222	protein-coding gene	gene with protein product	"""ataxin 2-binding protein 1"", ""hexaribonucleotide binding protein 1"""	605104				10814712, 16260614	Standard	NM_018723		Approved	A2BP1, FOX-1, HRNBP1	uc002cyy.2	Q9NWB1	OTTHUMG00000129551	ENST00000550418.1:c.1132G>T	chr16.hg19:g.7760685G>T	ENSP00000450031:p.Val378Phe	116.0	0.0		112.0	27.0	NM_145891	Q7Z7I7|Q8TAE3|Q8TAF2|Q8WYB2|Q9NS20	Missense_Mutation	SNP	ENST00000550418.1	hg19	CCDS55983.1	.	.	.	.	.	.	.	.	.	.	G	14.93	2.681620	0.47991	.	.	ENSG00000078328	ENST00000550418;ENST00000553186;ENST00000547338;ENST00000311745;ENST00000352951;ENST00000340209	T;T;T;T;T	0.33216	1.42;1.69;1.42;1.74;1.43	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.34483	0.0899	N	0.08118	0	0.80722	D	1	D;D;P;P	0.76494	0.999;0.999;0.454;0.553	D;D;B;B	0.68943	0.961;0.961;0.176;0.121	T	0.16012	-1.0417	10	0.10636	T	0.68	-9.0665	20.3923	0.98948	0.0:0.0:1.0:0.0	.	372;399;351;378	F8WAC5;Q9NWB1-2;Q9NWB1-3;Q9NWB1	.;.;.;RFOX1_HUMAN	F	378;351;378;399;372;383	ENSP00000450031:V378F;ENSP00000447753:V351F;ENSP00000447717:V378F;ENSP00000309117:V399F;ENSP00000344196:V383F	ENSP00000309117:V399F	V	+	1	0	RBFOX1	7700686	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.850000	0.92190	2.831000	0.97527	0.609000	0.83330	GTT	.	.		0.413	RBFOX1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409492.2	NM_145891	
ZNF267	10308	hgsc.bcm.edu	37	16	31927163	31927163	+	Missense_Mutation	SNP	T	T	G			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr16:31927163T>G	ENST00000300870.10	+	4	1802	c.1593T>G	c.(1591-1593)tgT>tgG	p.C531W		NM_001265588.1|NM_003414.5	NP_001252517.1|NP_003405	Q14586	ZN267_HUMAN	zinc finger protein 267	531					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(5)|kidney(1)|large_intestine(14)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	41						CTTTTACTTGTTTCTCAAATC	0.353																																					p.C531W		Atlas-SNP	.											.	ZNF267	94	.	0			c.T1593G						.						38.0	42.0	41.0					16																	31927163		2196	4298	6494	SO:0001583	missense	10308	exon4			TACTTGTTTCTCA	X78925	CCDS32440.1	16p11.2	2013-01-08			ENSG00000185947	ENSG00000185947		"""Zinc fingers, C2H2-type"", ""-"""	13060	protein-coding gene	gene with protein product		604752				7865130	Standard	NM_003414		Approved	HZF2	uc002ecs.5	Q14586		ENST00000300870.10:c.1593T>G	chr16.hg19:g.31927163T>G	ENSP00000300870:p.Cys531Trp	52.0	0.0		56.0	14.0	NM_003414	A0JNZ9|Q8NE41|Q9NRJ0	Missense_Mutation	SNP	ENST00000300870.10	hg19	CCDS32440.1	.	.	.	.	.	.	.	.	.	.	.	4.640	0.118900	0.08881	.	.	ENSG00000185947	ENST00000300870	T	0.26518	1.73	0.458	0.458	0.16670	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.15435	0.0372	N	0.25144	0.715	0.09310	N	1	P	0.47106	0.89	B	0.41894	0.369	T	0.15321	-1.0441	8	0.33141	T	0.24	.	.	.	.	.	531	Q14586	ZN267_HUMAN	W	531	ENSP00000300870:C531W	ENSP00000300870:C531W	C	+	3	2	ZNF267	31834664	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	-4.545000	0.00218	0.407000	0.25591	0.397000	0.26171	TGT	.	.		0.353	ZNF267-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432446.2	NM_003414	
GPR97	222487	hgsc.bcm.edu	37	16	57717987	57717987	+	Missense_Mutation	SNP	G	G	T			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr16:57717987G>T	ENST00000333493.4	+	9	1186	c.1025G>T	c.(1024-1026)gGg>gTg	p.G342V	RP11-405F3.4_ENST00000563062.1_RNA|GPR97_ENST00000450388.3_Missense_Mutation_p.G222V|GPR97_ENST00000327655.6_Missense_Mutation_p.G132V	NM_170776.4	NP_740746.4	Q86Y34	GPR97_HUMAN	G protein-coupled receptor 97	342					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						TGGGCCCGGGGGGCTGTCTTC	0.602																																					p.G342V		Atlas-SNP	.											.	GPR97	74	.	0			c.G1025T						.						99.0	97.0	98.0					16																	57717987		2198	4300	6498	SO:0001583	missense	222487	exon9			CCCGGGGGGCTGT	AY140959	CCDS10786.1	16q13	2014-08-08			ENSG00000182885	ENSG00000182885		"""-"", ""GPCR / Class B : Orphans"""	13728	protein-coding gene	gene with protein product						12435584, 222487	Standard	NM_170776		Approved	Pb99, PGR26	uc002emh.3	Q86Y34	OTTHUMG00000133458	ENST00000333493.4:c.1025G>T	chr16.hg19:g.57717987G>T	ENSP00000332900:p.Gly342Val	57.0	0.0		66.0	19.0	NM_170776	Q6ZMF4|Q86SL9|Q8IZF1	Missense_Mutation	SNP	ENST00000333493.4	hg19	CCDS10786.1	.	.	.	.	.	.	.	.	.	.	G	15.54	2.864908	0.51482	.	.	ENSG00000182885	ENST00000333493;ENST00000327655;ENST00000450388	T;T;T	0.38887	1.11;1.11;1.11	4.99	4.03	0.46877	GPCR, family 2-like (1);	0.102172	0.43110	D	0.000611	T	0.61702	0.2368	M	0.73962	2.25	0.29777	N	0.834341	D	0.69078	0.997	D	0.67103	0.949	T	0.64433	-0.6409	10	0.87932	D	0	.	12.8778	0.57999	0.0:0.3919:0.6081:0.0	.	342	Q86Y34	GPR97_HUMAN	V	342;132;222	ENSP00000332900:G342V;ENSP00000331199:G132V;ENSP00000404803:G222V	ENSP00000331199:G132V	G	+	2	0	GPR97	56275488	0.408000	0.25360	0.015000	0.15790	0.010000	0.07245	0.757000	0.26433	1.074000	0.40909	0.591000	0.81541	GGG	.	.		0.602	GPR97-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257333.2	NM_170776	
FANCA	2175	hgsc.bcm.edu	37	16	89813065	89813065	+	Missense_Mutation	SNP	T	T	A			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr16:89813065T>A	ENST00000389301.3	-	35	3470	c.3440A>T	c.(3439-3441)gAc>gTc	p.D1147V	FANCA_ENST00000568369.1_Missense_Mutation_p.D1147V	NM_000135.2	NP_000126.2	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A	1147					DNA repair (GO:0006281)|female gonad development (GO:0008585)|male gonad development (GO:0008584)|male meiosis (GO:0007140)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(5)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|urinary_tract(3)	47		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		CAGGGAGGGGTCTCTGCTCCG	0.552			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.D1147V		Atlas-SNP	.	yes	Rec		Fanconi anaemia A	16	16q24.3	2175	"""Fanconi anemia, complementation group A"""		L	.	FANCA	99	.	0			c.A3440T						.						71.0	70.0	70.0					16																	89813065		2198	4300	6498	SO:0001583	missense	2175	exon35	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	GAGGGGTCTCTGC	Z83067	CCDS32515.1, CCDS42221.1, CCDS67099.1	16q24.3	2014-09-17			ENSG00000187741	ENSG00000187741		"""Fanconi anemia, complementation groups"""	3582	protein-coding gene	gene with protein product		607139		FACA, FANCH		7581462, 9382107	Standard	NM_001286167		Approved	FAA, FA-H, FAH	uc002fou.1	O15360		ENST00000389301.3:c.3440A>T	chr16.hg19:g.89813065T>A	ENSP00000373952:p.Asp1147Val	39.0	0.0		31.0	7.0	NM_000135	A5D923|B4DRI7|H3BSR5|O75266|Q6PL10|Q92497|Q96H18|Q9UEA5|Q9UEL8|Q9UEL9|Q9UPK3|Q9Y6M2	Missense_Mutation	SNP	ENST00000389301.3	hg19	CCDS32515.1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.284325	0.80803	.	.	ENSG00000187741	ENST00000389301;ENST00000305699	D	0.85013	-1.93	5.39	5.39	0.77823	.	0.296333	0.28706	N	0.014413	D	0.90851	0.7126	M	0.67953	2.075	0.80722	D	1	D;D;D	0.76494	0.999;0.993;0.993	D;P;P	0.68765	0.96;0.844;0.844	D	0.91836	0.5479	10	0.87932	D	0	-16.6636	14.5788	0.68271	0.0:0.0:0.0:1.0	.	124;1147;1147	B7Z6Y4;B4DRI7;O15360	.;.;FANCA_HUMAN	V	1147;124	ENSP00000373952:D1147V	ENSP00000306281:D124V	D	-	2	0	FANCA	88340566	0.696000	0.27757	0.533000	0.28001	0.006000	0.05464	2.413000	0.44618	2.045000	0.60652	0.459000	0.35465	GAC	.	.		0.552	FANCA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000421927.1		
DVL2	1856	hgsc.bcm.edu	37	17	7137468	7137468	+	Silent	SNP	G	G	A			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr17:7137468G>A	ENST00000005340.5	-	1	396	c.114C>T	c.(112-114)atC>atT	p.I38I	DVL2_ENST00000575458.1_Silent_p.I38I|PHF23_ENST00000570753.1_5'Flank	NM_004422.2	NP_004413.1	O14641	DVL2_HUMAN	dishevelled segment polarity protein 2	38	DIX. {ECO:0000255|PROSITE- ProRule:PRU00069}.				canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration in hindbrain (GO:0021535)|cellular protein localization (GO:0034613)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|convergent extension involved in neural plate elongation (GO:0022007)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|hippo signaling (GO:0035329)|neural tube closure (GO:0001843)|non-canonical Wnt signaling pathway (GO:0035567)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|segment specification (GO:0007379)|transcription from RNA polymerase II promoter (GO:0006366)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|clathrin-coated endocytic vesicle (GO:0045334)|clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|identical protein binding (GO:0042802)			breast(2)|endometrium(3)|kidney(1)|large_intestine(11)|lung(7)|skin(1)	25						CGCCGAGGGTGATGCGCTCGG	0.597																																					p.I38I		Atlas-SNP	.											.	DVL2	49	.	0			c.C114T						.						104.0	112.0	110.0					17																	7137468		2203	4300	6503	SO:0001819	synonymous_variant	1856	exon1			GAGGGTGATGCGC	BC014844	CCDS11091.1	17p13.1	2013-05-22	2013-05-22		ENSG00000004975	ENSG00000004975		"""Dishevelled homologs"""	3086	protein-coding gene	gene with protein product		602151	"""dishevelled 2 (homologous to Drosophila dsh)"", ""dishevelled, dsh homolog 2 (Drosophila)"""			8662242	Standard	NM_004422		Approved		uc002gez.1	O14641	OTTHUMG00000102155	ENST00000005340.5:c.114C>T	chr17.hg19:g.7137468G>A		78.0	0.0		38.0	12.0	NM_004422	D3DTN3|Q53XM0	Silent	SNP	ENST00000005340.5	hg19	CCDS11091.1																																																																																			.	.		0.597	DVL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219999.2	NM_004422	
TP53	7157	hgsc.bcm.edu	37	17	7579591	7579591	+	Splice_Site	SNP	C	C	T			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr17:7579591C>T	ENST00000269305.4	-	4	286		c.e4-1		TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(8)|p.0?(8)|p.L35fs*10(3)|p.S33fs*10(1)|p.P13fs*18(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCAAGGGGGACTGTAGATGGG	0.592		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											.	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000413465,NS,carcinoma,0,31	TP53	33396	.	21	Unknown(11)|Whole gene deletion(8)|Insertion - Frameshift(1)|Deletion - Frameshift(1)	bone(4)|large_intestine(3)|central_nervous_system(3)|lung(3)|pancreas(3)|upper_aerodigestive_tract(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)	c.97-1G>A	GRCh37	CS971912	TP53	S		.						141.0	137.0	138.0					17																	7579591		2203	4300	6503	SO:0001630	splice_region_variant	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	GGGGGACTGTAGA	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.97-1G>A	chr17.hg19:g.7579591C>T		30.0	0.0		30.0	9.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	6.702	0.498192	0.12762	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000508793;ENST00000503591	.	.	.	2.49	2.49	0.30216	.	.	.	.	.	.	.	.	.	.	.	0.40380	D	0.979434	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.6143	0.33822	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7520316	0.879000	0.30193	0.021000	0.16686	0.027000	0.11550	1.937000	0.40193	1.730000	0.51580	0.561000	0.74099	.	.	.		0.592	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Intron
UNC45B	146862	hgsc.bcm.edu	37	17	33495177	33495177	+	Missense_Mutation	SNP	C	C	G			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr17:33495177C>G	ENST00000268876.5	+	10	1346	c.1249C>G	c.(1249-1251)Ctg>Gtg	p.L417V	UNC45B_ENST00000378449.1_Missense_Mutation_p.L417V|RP11-799D4.3_ENST00000585646.1_RNA|UNC45B_ENST00000433649.1_Missense_Mutation_p.L417V|UNC45B_ENST00000394570.2_Missense_Mutation_p.L417V|UNC45B_ENST00000591048.1_Missense_Mutation_p.L417V	NM_173167.2	NP_775259.1	Q8IWX7	UN45B_HUMAN	unc-45 homolog B (C. elegans)	417					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(10)|lung(24)|ovary(3)|prostate(2)|skin(1)|stomach(1)|urinary_tract(3)	59		Ovarian(249;0.17)				CAACCAGCTGCTGGGACTGAA	0.592																																					p.L417V		Atlas-SNP	.											.	UNC45B	133	.	0			c.C1249G						.						110.0	86.0	94.0					17																	33495177		2203	4300	6503	SO:0001583	missense	146862	exon10			CAGCTGCTGGGAC	AW755253	CCDS11292.1, CCDS45648.1	17q12	2008-02-05	2005-11-17	2005-11-17	ENSG00000141161	ENSG00000141161			14304	protein-coding gene	gene with protein product		611220	"""cardiomyopathy associated 4"""	CMYA4		12356907	Standard	NM_001267052		Approved	UNC45	uc002hja.3	Q8IWX7	OTTHUMG00000132931	ENST00000268876.5:c.1249C>G	chr17.hg19:g.33495177C>G	ENSP00000268876:p.Leu417Val	86.0	0.0		82.0	29.0	NM_001267052	Q495Q8|Q495Q9	Missense_Mutation	SNP	ENST00000268876.5	hg19	CCDS11292.1	.	.	.	.	.	.	.	.	.	.	C	13.88	2.369898	0.42003	.	.	ENSG00000141161	ENST00000394570;ENST00000268876;ENST00000433649;ENST00000378449	T;T;T;T	0.46819	0.86;0.86;0.86;0.86	5.02	5.02	0.67125	Armadillo-like helical (1);Armadillo-type fold (1);	0.135277	0.50627	D	0.000107	T	0.45538	0.1347	L	0.35341	1.055	0.24841	N	0.992463	P;B;B	0.40083	0.702;0.278;0.208	P;B;B	0.45449	0.481;0.199;0.39	T	0.32771	-0.9894	10	0.23891	T	0.37	-15.1686	17.8675	0.88800	0.0:1.0:0.0:0.0	.	417;417;417	Q8IWX7-2;Q8IWX7-3;Q8IWX7	.;.;UN45B_HUMAN	V	417	ENSP00000378071:L417V;ENSP00000268876:L417V;ENSP00000412840:L417V;ENSP00000367710:L417V	ENSP00000268876:L417V	L	+	1	2	UNC45B	30519290	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.339000	0.52135	2.767000	0.95098	0.655000	0.94253	CTG	.	.		0.592	UNC45B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256458.2	NM_173167	
KLHL11	55175	hgsc.bcm.edu	37	17	40010438	40010438	+	Missense_Mutation	SNP	T	T	C			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr17:40010438T>C	ENST00000319121.3	-	2	1741	c.1681A>G	c.(1681-1683)Aca>Gca	p.T561A	RP11-156E6.1_ENST00000560400.1_RNA	NM_018143.1	NP_060613.1	Q9NVR0	KLH11_HUMAN	kelch-like family member 11	561										NS(2)|breast(2)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	17		Breast(137;0.00156)				CATGATGCTGTCTGATAAAAG	0.408																																					p.T561A		Atlas-SNP	.											.	KLHL11	44	.	0			c.A1681G						.						100.0	103.0	102.0					17																	40010438		2203	4300	6503	SO:0001583	missense	55175	exon2			ATGCTGTCTGATA		CCDS11411.1	17q21	2013-01-30	2013-01-30		ENSG00000178502	ENSG00000178502		"""Kelch-like"", ""BTB/POZ domain containing"""	19008	protein-coding gene	gene with protein product			"""kelch-like 11 (Drosophila)"""				Standard	NM_018143		Approved	FLJ10572	uc002hyf.1	Q9NVR0	OTTHUMG00000133506	ENST00000319121.3:c.1681A>G	chr17.hg19:g.40010438T>C	ENSP00000314608:p.Thr561Ala	67.0	0.0		55.0	16.0	NM_018143		Missense_Mutation	SNP	ENST00000319121.3	hg19	CCDS11411.1	.	.	.	.	.	.	.	.	.	.	T	17.70	3.454141	0.63290	.	.	ENSG00000178502	ENST00000319121;ENST00000540254	T	0.65549	-0.16	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.51924	0.1703	L	0.32530	0.975	0.80722	D	1	P	0.38565	0.637	B	0.37047	0.24	T	0.52102	-0.8620	10	0.32370	T	0.25	0.1393	15.4567	0.75321	0.0:0.0:0.0:1.0	.	561	Q9NVR0	KLH11_HUMAN	A	561;424	ENSP00000314608:T561A	ENSP00000314608:T561A	T	-	1	0	KLHL11	37263964	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	7.559000	0.82265	2.106000	0.64143	0.477000	0.44152	ACA	.	.		0.408	KLHL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257464.2	NM_018143	
TMUB2	79089	hgsc.bcm.edu	37	17	42266396	42266396	+	Silent	SNP	C	C	T			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr17:42266396C>T	ENST00000587989.1	+	3	195	c.42C>T	c.(40-42)gaC>gaT	p.D14D	TMUB2_ENST00000589856.1_5'UTR|ASB16-AS1_ENST00000591166.1_RNA|TMUB2_ENST00000590235.1_5'UTR|TMUB2_ENST00000587172.1_5'UTR|TMUB2_ENST00000592825.1_5'UTR|TMUB2_ENST00000589184.1_5'UTR|ASB16-AS1_ENST00000585457.1_RNA|TMUB2_ENST00000589785.1_5'UTR|TMUB2_ENST00000538716.2_Silent_p.D14D|TMUB2_ENST00000446571.3_5'UTR|TMUB2_ENST00000319511.6_5'UTR|ASB16-AS1_ENST00000592897.1_RNA|TMUB2_ENST00000357984.3_5'UTR|ASB16-AS1_ENST00000588785.1_RNA			Q71RG4	TMUB2_HUMAN	transmembrane and ubiquitin-like domain containing 2	14						integral component of membrane (GO:0016021)				endometrium(2)|kidney(2)|large_intestine(1)|lung(3)	8		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.113)		GCAGCGTGGACCCTGCCAGCA	0.557																																					p.D14D		Atlas-SNP	.											.	TMUB2	29	.	0			c.C42T						.						66.0	58.0	61.0					17																	42266396		2203	4300	6503	SO:0001819	synonymous_variant	79089	exon3			CGTGGACCCTGCC		CCDS11479.1, CCDS54134.1	17q21	2006-06-27				ENSG00000168591			28459	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_177441		Approved	MGC3123	uc002ifo.3	Q71RG4		ENST00000587989.1:c.42C>T	chr17.hg19:g.42266396C>T		60.0	0.0		79.0	20.0	NM_001076674	B3KU81|Q8NDI2|Q9BPZ5|Q9HAG3	Silent	SNP	ENST00000587989.1	hg19	CCDS54134.1																																																																																			.	.		0.557	TMUB2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457711.1	NM_177441	
TTLL6	284076	hgsc.bcm.edu	37	17	46878909	46878909	+	Missense_Mutation	SNP	A	A	T			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr17:46878909A>T	ENST00000393382.3	-	4	599	c.458T>A	c.(457-459)gTg>gAg	p.V153E		NM_001130918.1	NP_001124390.1			tubulin tyrosine ligase-like family, member 6											endometrium(1)|large_intestine(5)|lung(9)|prostate(1)|skin(2)	18						CATTTCCATCACCCGCTCCAG	0.522																																					p.V153E		Atlas-SNP	.											.	TTLL6	113	.	0			c.T458A						.						154.0	123.0	133.0					17																	46878909		692	1591	2283	SO:0001583	missense	284076	exon4			TCCATCACCCGCT	AK093127	CCDS11537.2, CCDS45724.1	17q21.32	2013-02-14			ENSG00000170703	ENSG00000170703		"""Tubulin tyrosine ligase-like family"""	26664	protein-coding gene	gene with protein product		610849				15890843	Standard	NM_173623		Approved	FLJ35808	uc021tzm.1	Q8N841	OTTHUMG00000156978	ENST00000393382.3:c.458T>A	chr17.hg19:g.46878909A>T	ENSP00000377043:p.Val153Glu	96.0	0.0		68.0	29.0	NM_001130918		Missense_Mutation	SNP	ENST00000393382.3	hg19	CCDS45724.1	.	.	.	.	.	.	.	.	.	.	A	25.4	4.638671	0.87760	.	.	ENSG00000170703	ENST00000440941;ENST00000393382	.	.	.	4.39	4.39	0.52855	.	0.000000	0.46758	U	0.000276	T	0.80297	0.4597	M	0.87547	2.89	0.51012	D	0.999901	D	0.76494	0.999	D	0.75484	0.986	D	0.83736	0.0201	9	0.66056	D	0.02	.	12.7456	0.57280	1.0:0.0:0.0:0.0	.	105	Q8N841	TTLL6_HUMAN	E	153;105	.	ENSP00000377043:V105E	V	-	2	0	TTLL6	44233908	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.736000	0.91554	1.834000	0.53371	0.477000	0.44152	GTG	.	.		0.522	TTLL6-003	KNOWN	downstream_ATG|non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346939.3	NM_173623	
UBE2Z	65264	hgsc.bcm.edu	37	17	46988176	46988176	+	Silent	SNP	C	C	T			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr17:46988176C>T	ENST00000360943.5	+	2	459	c.324C>T	c.(322-324)atC>atT	p.I108I	RP11-463M16.4_ENST00000508743.1_RNA	NM_023079.4	NP_075567.2	Q9H832	UBE2Z_HUMAN	ubiquitin-conjugating enzyme E2Z	108					apoptotic process (GO:0006915)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)										ACAGGGATATCATGTCCATTT	0.488																																					p.I108I		Atlas-SNP	.											.	.	.	.	0			c.C324T						.						148.0	145.0	146.0					17																	46988176		2203	4300	6503	SO:0001819	synonymous_variant	65264	exon2			GGATATCATGTCC	BC015890	CCDS11540.2	17q21.32	2010-01-14	2007-07-18		ENSG00000159202	ENSG00000159202		"""Ubiquitin-conjugating enzymes E2"""	25847	protein-coding gene	gene with protein product	"""UBA6-specific enzyme E2"""	611362				17597759	Standard	NM_023079		Approved	FLJ13855, USE1	uc002ioi.3	Q9H832	OTTHUMG00000150521	ENST00000360943.5:c.324C>T	chr17.hg19:g.46988176C>T		67.0	0.0		78.0	20.0	NM_023079	A6N8M6|A6NC60|Q7L354|Q8TCM4|Q9H893	Silent	SNP	ENST00000360943.5	hg19	CCDS11540.2																																																																																			.	.		0.488	UBE2Z-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318724.2	NM_023079	
TTYH2	94015	hgsc.bcm.edu	37	17	72233606	72233606	+	Missense_Mutation	SNP	G	G	T			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr17:72233606G>T	ENST00000269346.4	+	4	662	c.588G>T	c.(586-588)atG>atT	p.M196I	TTYH2_ENST00000529107.1_Missense_Mutation_p.M175I	NM_032646.5	NP_116035.5	Q9BSA4	TTYH2_HUMAN	tweety family member 2	196						chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(14)|ovary(3)|pancreas(1)|stomach(3)|upper_aerodigestive_tract(1)	36						AGGTCACCATGGAGCTGACCA	0.602																																					p.M196I		Atlas-SNP	.											.	TTYH2	63	.	0			c.G588T						.						73.0	67.0	69.0					17																	72233606		2203	4300	6503	SO:0001583	missense	94015	exon4			CACCATGGAGCTG		CCDS32717.1, CCDS45770.1	17q25.1	2013-09-02	2013-09-02		ENSG00000141540	ENSG00000141540			13877	protein-coding gene	gene with protein product		608855	"""tweety (Drosophila) homolog 2"", ""tweety homolog 2 (Drosophila)"""			11597145	Standard	XM_005257824		Approved	C17orf29	uc002jkc.3	Q9BSA4	OTTHUMG00000166018	ENST00000269346.4:c.588G>T	chr17.hg19:g.72233606G>T	ENSP00000269346:p.Met196Ile	41.0	0.0		36.0	12.0	NM_032646	B3KX97|Q3B7H8|Q3B7R9|Q6AWB4|Q8NBB7|Q96PK1	Missense_Mutation	SNP	ENST00000269346.4	hg19	CCDS32717.1	.	.	.	.	.	.	.	.	.	.	G	3.862	-0.029754	0.07589	.	.	ENSG00000141540	ENST00000269346;ENST00000529107	T;T	0.09538	2.97;2.97	5.52	-11.0	0.00169	.	1.194220	0.05715	N	0.596697	T	0.05777	0.0151	N	0.16368	0.405	0.09310	N	1	B;B	0.17268	0.016;0.021	B;B	0.21151	0.033;0.027	T	0.35943	-0.9768	10	0.37606	T	0.19	4.6593	9.4911	0.38960	0.1344:0.3812:0.4265:0.0579	.	175;196	B4DKD1;Q9BSA4	.;TTYH2_HUMAN	I	196;175	ENSP00000269346:M196I;ENSP00000433089:M175I	ENSP00000269346:M196I	M	+	3	0	TTYH2	69745201	0.000000	0.05858	0.000000	0.03702	0.133000	0.20885	-2.116000	0.01327	-4.242000	0.00062	-0.302000	0.09304	ATG	.	.		0.602	TTYH2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387459.1		
ITGB4	3691	hgsc.bcm.edu	37	17	73727379	73727379	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr17:73727379G>A	ENST00000200181.3	+	10	1332	c.1145G>A	c.(1144-1146)cGg>cAg	p.R382Q	ITGB4_ENST00000339591.3_Missense_Mutation_p.R382Q|ITGB4_ENST00000579662.1_Missense_Mutation_p.R382Q|ITGB4_ENST00000450894.3_Missense_Mutation_p.R382Q|ITGB4_ENST00000449880.2_Missense_Mutation_p.R382Q|ITGB4_ENST00000584558.1_3'UTR	NM_000213.3	NP_000204.3	P16144	ITB4_HUMAN	integrin, beta 4	382					amelogenesis (GO:0097186)|autophagy (GO:0006914)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell motility (GO:0048870)|cell-matrix adhesion (GO:0007160)|digestive tract development (GO:0048565)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|mesodermal cell differentiation (GO:0048333)|nail development (GO:0035878)|renal system development (GO:0072001)|response to wounding (GO:0009611)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|hemidesmosome (GO:0030056)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor binding (GO:0001664)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(1)|lung(25)|skin(1)|urinary_tract(1)	43	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			CGAGGCCTTCGGACAGAGGTC	0.642																																					p.R382Q		Atlas-SNP	.											ITGB4,colon,carcinoma,0,1	ITGB4	165	.	0			c.G1145A						.						62.0	58.0	59.0					17																	73727379		2203	4300	6503	SO:0001583	missense	3691	exon10			GCCTTCGGACAGA		CCDS11727.1, CCDS32736.1, CCDS58599.1	17q25.1	2013-09-19			ENSG00000132470	ENSG00000132470		"""CD molecules"", ""Integrins"", ""Fibronectin type III domain containing"""	6158	protein-coding gene	gene with protein product		147557				2070796	Standard	XM_005257309		Approved	CD104	uc002jpg.3	P16144	OTTHUMG00000179814	ENST00000200181.3:c.1145G>A	chr17.hg19:g.73727379G>A	ENSP00000200181:p.Arg382Gln	37.0	0.0		37.0	14.0	NM_001005731	A0AVL6|O14690|O14691|O15339|O15340|O15341|Q0VF97|Q9UIQ4	Missense_Mutation	SNP	ENST00000200181.3	hg19	CCDS11727.1	.	.	.	.	.	.	.	.	.	.	G	13.47	2.246796	0.39697	.	.	ENSG00000132470	ENST00000450894;ENST00000200181;ENST00000339591;ENST00000449880	D;D;D	0.92249	-3.0;-3.0;-3.0	4.97	1.92	0.25849	Integrin beta subunit, N-terminal (2);	0.368522	0.25526	N	0.030061	D	0.84880	0.5570	L	0.28344	0.845	0.25903	N	0.983322	B;B;P;P	0.50943	0.066;0.055;0.484;0.94	B;B;B;B	0.43950	0.027;0.02;0.184;0.437	T	0.77869	-0.2427	10	0.54805	T	0.06	.	5.8834	0.18868	0.5183:0.0:0.4817:0.0	.	382;382;382;382	P16144-5;P16144-3;A0AVL6;P16144	.;.;.;ITB4_HUMAN	Q	298;382;382;382	ENSP00000200181:R382Q;ENSP00000344079:R382Q;ENSP00000400217:R382Q	ENSP00000200181:R382Q	R	+	2	0	ITGB4	71238974	1.000000	0.71417	0.996000	0.52242	0.817000	0.46193	2.241000	0.43097	0.513000	0.28278	0.455000	0.32223	CGG	.	.		0.642	ITGB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000448334.1		
QRICH2	84074	hgsc.bcm.edu	37	17	74290071	74290071	+	Missense_Mutation	SNP	T	T	A			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr17:74290071T>A	ENST00000262765.5	-	4	418	c.239A>T	c.(238-240)cAc>cTc	p.H80L		NM_032134.1	NP_115510.1	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	80										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(2)|stomach(4)	62						GAACCCTCCGTGCTTAGAAAA	0.448																																					p.H80L		Atlas-SNP	.											.	QRICH2	143	.	0			c.A239T						.						85.0	93.0	90.0					17																	74290071		2203	4300	6503	SO:0001583	missense	84074	exon4			CCTCCGTGCTTAG	AK058102	CCDS32741.1	17q25.1	2009-03-19			ENSG00000129646	ENSG00000129646			25326	protein-coding gene	gene with protein product							Standard	NM_032134		Approved	DKFZP434P0316	uc002jrd.1	Q9H0J4	OTTHUMG00000167578	ENST00000262765.5:c.239A>T	chr17.hg19:g.74290071T>A	ENSP00000262765:p.His80Leu	42.0	0.0		29.0	12.0	NM_032134	A2RRE1|Q96LM3	Missense_Mutation	SNP	ENST00000262765.5	hg19	CCDS32741.1	.	.	.	.	.	.	.	.	.	.	t	4.333	0.061163	0.08339	.	.	ENSG00000129646	ENST00000262765;ENST00000301613	T	0.08458	3.09	3.74	-6.9	0.01655	.	.	.	.	.	T	0.05593	0.0147	N	0.22421	0.69	0.09310	N	1	B;B	0.30281	0.275;0.144	B;B	0.28232	0.087;0.025	T	0.29336	-1.0015	9	0.66056	D	0.02	0.0271	12.4132	0.55480	0.0:0.3246:0.0:0.6754	.	80;80	B5MD94;Q9H0J4	.;QRIC2_HUMAN	L	80	ENSP00000262765:H80L	ENSP00000262765:H80L	H	-	2	0	QRICH2	71801666	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-5.378000	0.00127	-1.610000	0.01583	-1.987000	0.00451	CAC	.	.		0.448	QRICH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395140.1	NM_032134	
DNAH17	8632	hgsc.bcm.edu	37	17	76433836	76433836	+	Missense_Mutation	SNP	G	G	T			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr17:76433836G>T	ENST00000585328.1	-	74	12029	c.11905C>A	c.(11905-11907)Ccc>Acc	p.P3969T	DNAH17_ENST00000586052.1_5'UTR|DNAH17_ENST00000389840.5_Missense_Mutation_p.P3968T	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	3968	AAA 6. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			TGGGTCTCGGGGCTGGGGGCA	0.642																																					p.P3974T		Atlas-SNP	.											.	DNAH17	347	.	0			c.C11920A						.						55.0	52.0	53.0					17																	76433836		2203	4299	6502	SO:0001583	missense	8632	exon74			TCTCGGGGCTGGG	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.11905C>A	chr17.hg19:g.76433836G>T	ENSP00000465516:p.Pro3969Thr	42.0	0.0		47.0	16.0	NM_173628	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	ENST00000585328.1	hg19		.	.	.	.	.	.	.	.	.	.	G	17.16	3.319484	0.60524	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.24151	1.87	5.22	4.23	0.50019	.	0.972289	0.08438	N	0.945875	T	0.59046	0.2165	M	0.92555	3.32	0.44316	D	0.997193	P	0.37015	0.578	P	0.51550	0.673	T	0.57394	-0.7819	10	0.66056	D	0.02	.	15.41	0.74911	0.0:0.1446:0.8554:0.0	.	3969	E7EUM8	.	T	3969;3968	ENSP00000374490:P3968T	ENSP00000300671:P3969T	P	-	1	0	DNAH17	73945431	1.000000	0.71417	1.000000	0.80357	0.400000	0.30750	6.490000	0.73645	1.154000	0.42482	0.561000	0.74099	CCC	.	.		0.642	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000318962.2	NM_173628	
ANKRD30B	374860	hgsc.bcm.edu	37	18	14764069	14764069	+	Missense_Mutation	SNP	C	C	A			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr18:14764069C>A	ENST00000358984.4	+	7	1385	c.1205C>A	c.(1204-1206)tCt>tAt	p.S402Y	ANKRD30B_ENST00000579292.1_Intron|ANKRD30B_ENST00000447268.2_Missense_Mutation_p.S402Y	NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	402										breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						AAAGAAACATCTACAAAAGCA	0.373																																					p.S402Y		Atlas-SNP	.											.	ANKRD30B	237	.	0			c.C1205A						.						15.0	12.0	13.0					18																	14764069		691	1589	2280	SO:0001583	missense	374860	exon7			AAACATCTACAAA	BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.1205C>A	chr18.hg19:g.14764069C>A	ENSP00000351875:p.Ser402Tyr	43.0	0.0		35.0	13.0	NM_001145029	B4DGP1|F8WAG3|Q4G175	Missense_Mutation	SNP	ENST00000358984.4	hg19	CCDS54182.1	.	.	.	.	.	.	.	.	.	.	N	9.117	1.007960	0.19199	.	.	ENSG00000180777	ENST00000358984;ENST00000447268	T;T	0.41758	0.99;1.0	0.64	0.64	0.17752	.	.	.	.	.	T	0.42017	0.1184	L	0.47716	1.5	0.09310	N	1	D	0.58268	0.982	P	0.50231	0.635	T	0.28332	-1.0047	8	0.72032	D	0.01	.	.	.	.	.	402	F8WAG3	.	Y	402	ENSP00000351875:S402Y;ENSP00000399031:S402Y	ENSP00000351875:S402Y	S	+	2	0	ANKRD30B	14754069	0.000000	0.05858	0.004000	0.12327	0.055000	0.15305	-1.014000	0.03641	0.609000	0.30018	0.313000	0.20887	TCT	.	.		0.373	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443557.1	NM_001145029	
CHST9	83539	hgsc.bcm.edu	37	18	24496571	24496571	+	Silent	SNP	G	G	A			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr18:24496571G>A	ENST00000284224.8	-	6	1261	c.984C>T	c.(982-984)gtC>gtT	p.V328V	AQP4-AS1_ENST00000582605.1_RNA|AQP4-AS1_ENST00000568797.1_RNA|CHST9_ENST00000581714.1_Silent_p.V328V|AQP4-AS1_ENST00000578701.1_RNA|CHST9_ENST00000580774.1_3'UTR|AQP4-AS1_ENST00000579964.1_RNA	NM_031422.5	NP_113610.2	Q7L1S5	CHST9_HUMAN	carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9	328					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|hormone biosynthetic process (GO:0042446)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|skin(3)	28	all_lung(6;0.0145)|Ovarian(20;0.124)					CTTTGAACTTGACTCCAGATC	0.413																																					p.V328V		Atlas-SNP	.											CHST9_ENST00000284224,NS,carcinoma,0,2	CHST9	114	.	0			c.C984T						.						143.0	138.0	139.0					18																	24496571		1907	4111	6018	SO:0001819	synonymous_variant	83539	exon6			GAACTTGACTCCA	AF239821	CCDS42422.1, CCDS58618.1	18q11.2	2011-04-28			ENSG00000154080	ENSG00000154080		"""Sulfotransferases, membrane-bound"""	19898	protein-coding gene	gene with protein product		610191				11139592, 11445554	Standard	NM_031422		Approved	GALNAC4ST-2, GALNAC-4-ST2	uc002kwe.4	Q7L1S5		ENST00000284224.8:c.984C>T	chr18.hg19:g.24496571G>A		146.0	0.0		105.0	23.0	NM_031422	Q6UX69|Q9BXH3|Q9BXH4|Q9BZW9	Silent	SNP	ENST00000284224.8	hg19	CCDS42422.1																																																																																			.	.		0.413	CHST9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446549.1	NM_031422	
TCEB3B	51224	hgsc.bcm.edu	37	18	44560133	44560133	+	Silent	SNP	A	A	T			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr18:44560133A>T	ENST00000332567.4	-	1	1855	c.1503T>A	c.(1501-1503)gcT>gcA	p.A501A	KATNAL2_ENST00000356157.7_Intron|KATNAL2_ENST00000245121.5_Intron|KATNAL2_ENST00000592005.1_Intron	NM_016427.2	NP_057511.2	Q8IYF1	ELOA2_HUMAN	transcription elongation factor B polypeptide 3B (elongin A2)	501	Activation domain. {ECO:0000250}.				regulation of DNA-templated transcription, elongation (GO:0032784)|transcription from RNA polymerase II promoter (GO:0006366)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|lung(24)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						CAGGGAAAGCAGCTTCCTCCC	0.607																																					p.A501A		Atlas-SNP	.											.	TCEB3B	141	.	0			c.T1503A						.						70.0	79.0	76.0					18																	44560133		2203	4300	6503	SO:0001819	synonymous_variant	51224	exon1			GAAAGCAGCTTCC	BC036022	CCDS11932.1	18q21.1	2009-08-04			ENSG00000206181	ENSG00000206181			30771	protein-coding gene	gene with protein product	"""transcription elongation factor (SIII) elongin A2"", ""elongin A2"""	609522				7660129, 8244996	Standard	NM_016427		Approved	HsT832, TCEB3L	uc002lcr.1	Q8IYF1	OTTHUMG00000132649	ENST00000332567.4:c.1503T>A	chr18.hg19:g.44560133A>T		52.0	0.0		60.0	14.0	NM_016427	Q9P2V9	Silent	SNP	ENST00000332567.4	hg19	CCDS11932.1																																																																																			.	.		0.607	TCEB3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255900.1	NM_016427	
CFAP53	220136	hgsc.bcm.edu	37	18	47788414	47788414	+	Missense_Mutation	SNP	C	C	A			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr18:47788414C>A	ENST00000398545.4	-	2	362	c.245G>T	c.(244-246)aGa>aTa	p.R82I		NM_145020.3	NP_659457.2														endometrium(1)|kidney(4)|large_intestine(6)|lung(6)|ovary(1)|pancreas(1)|skin(1)	20				STAD - Stomach adenocarcinoma(97;2.66e-05)|Colorectal(21;7.57e-05)|Lung(128;0.00932)|READ - Rectum adenocarcinoma(32;0.164)		ATCCTTGATTCTTGCTCGCAC	0.423																																					p.R82I		Atlas-SNP	.											.	CCDC11	59	.	0			c.G245T						.						173.0	158.0	163.0					18																	47788414		1917	4136	6053	SO:0001583	missense	220136	exon2			TTGATTCTTGCTC																												ENST00000398545.4:c.245G>T	chr18.hg19:g.47788414C>A	ENSP00000381553:p.Arg82Ile	148.0	0.0		122.0	45.0	NM_145020		Missense_Mutation	SNP	ENST00000398545.4	hg19	CCDS11940.2	.	.	.	.	.	.	.	.	.	.	C	17.77	3.471679	0.63737	.	.	ENSG00000172361	ENST00000398545	T	0.43688	0.94	5.12	4.24	0.50183	.	0.357634	0.18120	U	0.151099	T	0.57315	0.2045	M	0.65498	2.005	0.46167	D	0.998902	D	0.76494	0.999	D	0.66716	0.946	T	0.57376	-0.7822	10	0.66056	D	0.02	-9.6961	8.8334	0.35098	0.0:0.9014:0.0:0.0986	.	82	Q96M91	CCD11_HUMAN	I	82	ENSP00000381553:R82I	ENSP00000381553:R82I	R	-	2	0	CCDC11	46042412	0.998000	0.40836	0.997000	0.53966	0.552000	0.35366	1.497000	0.35649	2.817000	0.96982	0.563000	0.77884	AGA	.	.		0.423	CCDC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255922.3		
C2CD4C	126567	hgsc.bcm.edu	37	19	408161	408161	+	Silent	SNP	G	G	A			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr19:408161G>A	ENST00000332235.6	-	2	374	c.201C>T	c.(199-201)gcC>gcT	p.A67A		NM_001136263.1	NP_001129735.1	Q8TF44	C2C4C_HUMAN	C2 calcium-dependent domain containing 4C	67										large_intestine(1)|pancreas(1)	2						GGCCCAGCGCGGCCTGTCCCT	0.711																																					p.A67A		Atlas-SNP	.											.	C2CD4C	13	.	0			c.C201T						.						14.0	18.0	17.0					19																	408161		691	1587	2278	SO:0001819	synonymous_variant	126567	exon2			CAGCGCGGCCTGT	AB075837	CCDS45890.1	19p13.3	2009-09-28	2009-09-28	2009-09-28		ENSG00000183186			29417	protein-coding gene	gene with protein product	"""nuclear localized factor 3"""	610336	"""KIAA1957"", ""family with sequence similarity 148, member C"""	KIAA1957, FAM148C		11853319	Standard	NM_001136263		Approved	NLF3	uc002loo.3	Q8TF44		ENST00000332235.6:c.201C>T	chr19.hg19:g.408161G>A		62.0	0.0		61.0	19.0	NM_001136263	Q8N3H7	Silent	SNP	ENST00000332235.6	hg19	CCDS45890.1																																																																																			.	.		0.711	C2CD4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451789.2	XM_065166	
ECSIT	51295	hgsc.bcm.edu	37	19	11624014	11624014	+	Missense_Mutation	SNP	G	G	A	rs373672064		TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr19:11624014G>A	ENST00000270517.7	-	4	730	c.595C>T	c.(595-597)Cgc>Tgc	p.R199C	ECSIT_ENST00000591352.1_Intron|ECSIT_ENST00000592312.1_Missense_Mutation_p.R83C|ECSIT_ENST00000591104.1_Missense_Mutation_p.R199C|ECSIT_ENST00000252440.7_Missense_Mutation_p.R199C|ECSIT_ENST00000417981.2_Intron|RN7SL833P_ENST00000498758.2_RNA|ECSIT_ENST00000588998.1_Intron	NM_016581.4	NP_057665.2	Q9BQ95	ECSIT_HUMAN	ECSIT signalling integrator	199					BMP signaling pathway (GO:0030509)|innate immune response (GO:0045087)|mesoderm formation (GO:0001707)|oxidation-reduction process (GO:0055114)|regulation of oxidoreductase activity (GO:0051341)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	oxidoreductase activity, acting on NAD(P)H (GO:0016651)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			kidney(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	11						AGCTTCAGGCGCACCAACTTG	0.592																																					p.R199C		Atlas-SNP	.											.	ECSIT	32	.	0			c.C595T						.		CYS/ARG,CYS/ARG,	0,4406		0,0,2203	132.0	95.0	108.0		595,595,	4.9	0.9	19		108	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,intron	ECSIT	NM_001142464.2,NM_016581.4,NM_001142465.2	180,180,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,	199/297,199/432,	11624014	1,13005	2203	4300	6503	SO:0001583	missense	51295	exon4			TCAGGCGCACCAA	BC005119	CCDS12262.1, CCDS45979.1, CCDS45980.1, CCDS59353.1	19p13.2	2013-05-24	2013-05-24			ENSG00000130159		"""Mitochondrial respiratory chain complex assembly factors"""	29548	protein-coding gene	gene with protein product	"""signaling intermediate in Toll pathway evolutionarily conserved ortholog (mouse)"""	608388	"""ECSIT homolog (Drosophila)"""			10465784, 22982022	Standard	NM_001142464		Approved	SITPEC	uc002msb.3	Q9BQ95		ENST00000270517.7:c.595C>T	chr19.hg19:g.11624014G>A	ENSP00000270517:p.Arg199Cys	35.0	0.0		48.0	16.0	NM_001142464	E9PAN9|K7EMM0|Q96HQ7|Q9NYI1	Missense_Mutation	SNP	ENST00000270517.7	hg19	CCDS12262.1	.	.	.	.	.	.	.	.	.	.	g	15.87	2.959959	0.53400	0.0	1.16E-4	ENSG00000130159	ENST00000270517;ENST00000252440	D;D	0.88046	-2.33;-2.33	4.94	4.94	0.65067	.	0.000000	0.85682	D	0.000000	D	0.93693	0.7985	M	0.87180	2.865	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94393	0.7616	10	0.87932	D	0	-28.7658	13.0287	0.58829	0.0:0.0:0.8382:0.1618	.	199;199	Q9BQ95-2;Q9BQ95	.;ECSIT_HUMAN	C	199	ENSP00000270517:R199C;ENSP00000252440:R199C	ENSP00000252440:R199C	R	-	1	0	ECSIT	11485014	1.000000	0.71417	0.933000	0.37362	0.008000	0.06430	6.854000	0.75440	2.453000	0.82957	0.639000	0.83563	CGC	.	.		0.592	ECSIT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442603.2	NM_016581	
ZNF28	7576	hgsc.bcm.edu	37	19	53304474	53304474	+	Silent	SNP	T	T	A	rs372999948		TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr19:53304474T>A	ENST00000457749.2	-	4	743	c.624A>T	c.(622-624)gtA>gtT	p.V208V	ZNF28_ENST00000360272.4_Silent_p.V155V|ZNF28_ENST00000438150.2_Silent_p.V155V|ZNF28_ENST00000414252.2_Silent_p.V155V	NM_006969.3	NP_008900.3	P17035	ZNF28_HUMAN	zinc finger protein 28	208					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|liver(1)|lung(10)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(134;0.0386)|Lung(386;0.145)		CTCTCATGTGTACATTCCGTT	0.338																																					p.V208V		Atlas-SNP	.											.	ZNF28	191	.	0			c.A624T						.						129.0	136.0	134.0					19																	53304474		2203	4300	6503	SO:0001819	synonymous_variant	7576	exon4			CATGTGTACATTC	X52355	CCDS33093.1, CCDS33093.2	19q13.41	2013-01-08	2006-05-10		ENSG00000198538	ENSG00000198538		"""Zinc fingers, C2H2-type"", ""-"""	13073	protein-coding gene	gene with protein product			"""zinc finger protein 28 (KOX 24)"""				Standard	NR_036599		Approved	KOX24, DKFZp781D0275	uc002qad.3	P17035	OTTHUMG00000154564	ENST00000457749.2:c.624A>T	chr19.hg19:g.53304474T>A		64.0	0.0		66.0	22.0	NM_006969	A8KAK9|B4E3G0|B9EIK7|Q5H9V1|Q5HYM9|Q6ZML9|Q6ZN56	Silent	SNP	ENST00000457749.2	hg19	CCDS33093.2																																																																																			.	.		0.338	ZNF28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336038.2	NM_006969	
ZNF415	55786	hgsc.bcm.edu	37	19	53612425	53612425	+	Silent	SNP	C	C	T			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr19:53612425C>T	ENST00000500065.4	-	4	1206	c.873G>A	c.(871-873)cgG>cgA	p.R291R	ZNF415_ENST00000455735.2_Silent_p.R339R|ZNF415_ENST00000440291.1_Silent_p.R278R|ZNF415_ENST00000597748.1_3'UTR|ZNF415_ENST00000243643.4_Silent_p.R291R|ZNF415_ENST00000448501.1_Silent_p.R339R|ZNF415_ENST00000421033.1_Silent_p.R303R|ZNF415_ENST00000597503.1_3'UTR|ZNF415_ENST00000594011.1_3'UTR|ZNF415_ENST00000595193.1_3'UTR|ZNF415_ENST00000601493.1_Silent_p.R61R	NM_001136038.2	NP_001129510.2	Q09FC8	ZN415_HUMAN	zinc finger protein 415	339					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(3)|large_intestine(8)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31				GBM - Glioblastoma multiforme(134;0.0191)		TGTGAACTCTCCGATGTAGTG	0.423																																					p.R291R		Atlas-SNP	.											.	ZNF415	68	.	0			c.G873A						.						101.0	89.0	93.0					19																	53612425		2203	4300	6503	SO:0001819	synonymous_variant	55786	exon4			AACTCTCCGATGT	AK002053	CCDS12860.1, CCDS54313.1	19q13.42	2014-03-18			ENSG00000170954	ENSG00000170954		"""Zinc fingers, C2H2-type"", ""-"""	20636	protein-coding gene	gene with protein product						14702039	Standard	NM_001136038		Approved		uc002qaw.3	Q09FC8	OTTHUMG00000182865	ENST00000500065.4:c.873G>A	chr19.hg19:g.53612425C>T		58.0	0.0		65.0	19.0	NM_018355	F5H287|Q09FC7|Q09FC9|Q09FD0|Q6NSZ2|Q6P3S0|Q9NUR2	Silent	SNP	ENST00000500065.4	hg19	CCDS54313.1																																																																																			.	.		0.423	ZNF415-025	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464043.1	NM_018355	
POLR3F	10621	hgsc.bcm.edu	37	20	18464200	18464200	+	Nonstop_Mutation	SNP	T	T	C			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr20:18464200T>C	ENST00000377603.4	+	9	1329	c.949T>C	c.(949-951)Taa>Caa	p.*317Q	POLR3F_ENST00000462997.1_3'UTR	NM_006466.2	NP_006457.2	Q9H1D9	RPC6_HUMAN	polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa	0					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			breast(2)	2						GCTCGAATTTTAATAGAGAGC	0.323																																					p.X317Q	GBM(69;898 1468 19907 52011)	Atlas-SNP	.											.	POLR3F	14	.	0			c.T949C						.						30.0	32.0	31.0					20																	18464200		2203	4298	6501	SO:0001578	stop_lost	10621	exon9			GAATTTTAATAGA	U93869	CCDS13135.1	20p11.23	2013-01-21	2002-08-29		ENSG00000132664	ENSG00000132664		"""RNA polymerase subunits"""	15763	protein-coding gene	gene with protein product	"""RNA polymerase III C39 subunit"""		"""polymerase (RNA) III (DNA directed) polypeptide F (39 kDa)"""			9171375	Standard	NM_006466		Approved	RPC39, RPC6	uc002wqv.3	Q9H1D9	OTTHUMG00000031971	ENST00000377603.4:c.949T>C	chr20.hg19:g.18464200T>C	ENSP00000366828:p.*317Glnext*1	36.0	0.0		36.0	8.0	NM_006466	A8K4C7|O15319	Missense_Mutation	SNP	ENST00000377603.4	hg19	CCDS13135.1	.	.	.	.	.	.	.	.	.	.	T	16.92	3.256406	0.59321	.	.	ENSG00000132664	ENST00000377603	.	.	.	5.57	5.57	0.84162	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.99999	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.74	0.77887	0.0:0.0:0.0:1.0	.	.	.	.	Q	317	.	.	X	+	1	0	POLR3F	18412200	1.000000	0.71417	0.994000	0.49952	0.339000	0.28857	7.668000	0.83897	2.133000	0.65898	0.533000	0.62120	TAA	.	.		0.323	POLR3F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078170.2	NM_006466	
ZNF335	63925	hgsc.bcm.edu	37	20	44592256	44592256	+	Missense_Mutation	SNP	C	C	A			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr20:44592256C>A	ENST00000322927.2	-	9	1489	c.1389G>T	c.(1387-1389)agG>agT	p.R463S	ZNF335_ENST00000426788.1_Missense_Mutation_p.R308S	NM_022095.3	NP_071378.1	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	463					brain development (GO:0007420)|brain morphogenesis (GO:0048854)|cerebral cortex neuron differentiation (GO:0021895)|histone H3-K4 trimethylation (GO:0080182)|in utero embryonic development (GO:0001701)|neuron projection morphogenesis (GO:0048812)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of neurogenesis (GO:0050769)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(13)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	51		Myeloproliferative disorder(115;0.0122)				ACAGGAAGGGCCTCAAAAGTG	0.572																																					p.R463S		Atlas-SNP	.											.	ZNF335	115	.	0			c.G1389T						.						237.0	219.0	225.0					20																	44592256		2203	4300	6503	SO:0001583	missense	63925	exon9			GAAGGGCCTCAAA	AK026157	CCDS13389.1	20q13.12	2011-09-12			ENSG00000198026	ENSG00000198026		"""Zinc fingers, C2H2-type"""	15807	protein-coding gene	gene with protein product	"""NRC-interacting factor 1"""	610827				12215545, 19131338	Standard	NM_022095		Approved	bA465L10.2, NIF-1	uc002xqw.3	Q9H4Z2	OTTHUMG00000032637	ENST00000322927.2:c.1389G>T	chr20.hg19:g.44592256C>A	ENSP00000325326:p.Arg463Ser	78.0	0.0		58.0	18.0	NM_022095	B4DLG7|Q548D0|Q9H684	Missense_Mutation	SNP	ENST00000322927.2	hg19	CCDS13389.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.937453	0.73557	.	.	ENSG00000198026	ENST00000322927;ENST00000243961;ENST00000426788	T;T	0.30182	1.54;1.54	5.16	0.878	0.19150	.	0.104089	0.64402	D	0.000005	T	0.38665	0.1049	L	0.34521	1.04	0.58432	D	0.999993	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.991	T	0.15378	-1.0439	10	0.87932	D	0	-32.8936	8.7232	0.34454	0.0:0.596:0.0:0.404	.	308;463	Q9H4Z2-2;Q9H4Z2	.;ZN335_HUMAN	S	463;240;308	ENSP00000325326:R463S;ENSP00000397098:R308S	ENSP00000243961:R240S	R	-	3	2	ZNF335	44025663	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	0.847000	0.27696	0.349000	0.23975	0.655000	0.94253	AGG	.	.		0.572	ZNF335-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079553.1	NM_022095	
PRAME	23532	hgsc.bcm.edu	37	22	22892516	22892516	+	Silent	SNP	G	G	A			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr22:22892516G>A	ENST00000398741.1	-	5	891	c.585C>T	c.(583-585)ctC>ctT	p.L195L	PRAME_ENST00000539862.1_Silent_p.L179L|PRAME_ENST00000402697.1_Silent_p.L195L|PRAME_ENST00000543184.1_Silent_p.L195L|PRAME_ENST00000398743.2_Silent_p.L195L|PRAME_ENST00000424204.2_Silent_p.L179L|PRAME_ENST00000485532.1_5'Flank|PRAME_ENST00000405655.3_Silent_p.L195L	NM_206955.1	NP_996838.1	P78395	PRAME_HUMAN	preferentially expressed antigen in melanoma	195					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	retinoic acid receptor binding (GO:0042974)			autonomic_ganglia(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	36	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)|all_lung(157;4.03e-05)		READ - Rectum adenocarcinoma(21;0.0649)		CTTTCTCAATGAGGTAGGAGA	0.453																																					p.L195L	Melanoma(73;1707 1838 15168 27201)	Atlas-SNP	.											.	PRAME	78	.	0			c.C585T						.						154.0	146.0	149.0					22																	22892516		2203	4300	6503	SO:0001819	synonymous_variant	23532	exon5			CTCAATGAGGTAG	U65011	CCDS13801.1	22q11.22	2013-01-17			ENSG00000185686	ENSG00000185686		"""-"""	9336	protein-coding gene	gene with protein product	"""cancer/testis antigen 130"""	606021		MAPE		9047241, 10591208	Standard	XM_006725402		Approved	CT130	uc002zwj.3	P78395	OTTHUMG00000151172	ENST00000398741.1:c.585C>T	chr22.hg19:g.22892516G>A		57.0	0.0		70.0	18.0	NM_206954	B2R6Y7|O43481|Q8IXN8	Silent	SNP	ENST00000398741.1	hg19	CCDS13801.1																																																																																			.	.		0.453	PRAME-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321644.1	NM_206953	
ACOT9	23597	hgsc.bcm.edu	37	X	23731290	23731290	+	Silent	SNP	T	T	C			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chrX:23731290T>C	ENST00000336430.7	-	8	728	c.597A>G	c.(595-597)gcA>gcG	p.A199A	ACOT9_ENST00000379295.1_Silent_p.A139A|ACOT9_ENST00000492081.1_Intron|ACOT9_ENST00000379303.5_Silent_p.A208A	NM_001033583.2	NP_001028755.2	Q9Y305	ACOT9_HUMAN	acyl-CoA thioesterase 9	199					acyl-CoA metabolic process (GO:0006637)	mitochondrion (GO:0005739)	acetyl-CoA hydrolase activity (GO:0003986)|carboxylic ester hydrolase activity (GO:0052689)			breast(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(4)|pancreas(1)|skin(1)	15						TTACAAATGTTGCATCCAAAA	0.328																																					p.A208A		Atlas-SNP	.											.	ACOT9	33	.	0			c.A624G						.						85.0	72.0	76.0					X																	23731290		2203	4300	6503	SO:0001819	synonymous_variant	23597	exon9			AAATGTTGCATCC	AF132950	CCDS35216.1, CCDS43924.1	Xp22.11	2008-02-05			ENSG00000123130	ENSG00000123130		"""Acyl CoA thioesterases"""	17152	protein-coding gene	gene with protein product		300862				10383425, 10810093, 16103133, 16940157	Standard	XM_005274471		Approved	CGI-16, MT-ACT48, ACATE2	uc004dao.3	Q9Y305	OTTHUMG00000021257	ENST00000336430.7:c.597A>G	chrX.hg19:g.23731290T>C		145.0	0.0		189.0	131.0	NM_001037171	B3KNC9|B7ZM94	Silent	SNP	ENST00000336430.7	hg19	CCDS35216.1																																																																																			.	.		0.328	ACOT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056065.1	NM_012332	
AMER1	139285	hgsc.bcm.edu	37	X	63410478	63410478	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chrX:63410478C>T	ENST00000330258.3	-	2	2961	c.2689G>A	c.(2689-2691)Gac>Aac	p.D897N	AMER1_ENST00000403336.1_Intron|AMER1_ENST00000374869.3_Intron	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	897					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)									TCTGCAGTGTCGAGAGAGCGG	0.602																																					p.D897N		Atlas-SNP	.											.	.	.	.	67	Whole gene deletion(67)	kidney(65)|ovary(1)|large_intestine(1)	c.G2689A						.						41.0	40.0	41.0					X																	63410478		2069	4192	6261	SO:0001583	missense	139285	exon2			CAGTGTCGAGAGA	AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.2689G>A	chrX.hg19:g.63410478C>T	ENSP00000329117:p.Asp897Asn	64.0	0.0		72.0	44.0	NM_152424	A2IB86|Q8N885	Missense_Mutation	SNP	ENST00000330258.3	hg19	CCDS14377.2	.	.	.	.	.	.	.	.	.	.	C	21.0	4.082665	0.76528	.	.	ENSG00000184675	ENST00000330258	T	0.71222	-0.55	4.79	4.79	0.61399	.	.	.	.	.	T	0.71074	0.3297	N	0.19112	0.55	0.80722	D	1	D	0.76494	0.999	P	0.62813	0.907	T	0.70146	-0.4952	8	.	.	.	-12.3048	15.8198	0.78631	0.0:1.0:0.0:0.0	.	897	Q5JTC6	F123B_HUMAN	N	897	ENSP00000329117:D897N	.	D	-	1	0	FAM123B	63327203	1.000000	0.71417	0.997000	0.53966	0.972000	0.66771	6.856000	0.75450	2.385000	0.81259	0.529000	0.55759	GAC	.	.		0.602	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316584.1	NM_152424	
AFF2	2334	hgsc.bcm.edu	37	X	148037267	148037267	+	Missense_Mutation	SNP	A	A	T			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chrX:148037267A>T	ENST00000370460.2	+	11	2171	c.1692A>T	c.(1690-1692)caA>caT	p.Q564H	AFF2_ENST00000370457.5_Missense_Mutation_p.Q531H|AFF2_ENST00000342251.3_Missense_Mutation_p.Q531H|AFF2_ENST00000286437.5_Missense_Mutation_p.Q205H	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	564					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)			breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					CAATCATCCAACCAATGGAAG	0.458																																					p.Q564H		Atlas-SNP	.											.	AFF2	679	.	0			c.A1692T						.						191.0	200.0	197.0					X																	148037267		2203	4300	6503	SO:0001583	missense	2334	exon11			CATCCAACCAATG	U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.1692A>T	chrX.hg19:g.148037267A>T	ENSP00000359489:p.Gln564His	58.0	0.0		71.0	37.0	NM_002025	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	ENST00000370460.2	hg19	CCDS14684.1	.	.	.	.	.	.	.	.	.	.	A	16.23	3.065278	0.55432	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000286437	T;T;T;T	0.64618	-0.11;-0.11;-0.11;-0.11	5.56	-5.73	0.02398	.	0.270973	0.36893	N	0.002352	T	0.63105	0.2483	L	0.41236	1.265	0.25746	N	0.985106	D;D;D;D;D;D	0.71674	0.998;0.998;0.998;0.998;0.998;0.998	D;P;P;P;P;D	0.66196	0.942;0.904;0.904;0.904;0.904;0.942	T	0.64076	-0.6492	10	0.45353	T	0.12	.	13.3874	0.60803	0.195:0.088:0.717:0.0	.	205;529;531;525;554;564	B4DXD5;P51816-6;P51816-3;P51816-2;P51816-5;P51816	.;.;.;.;.;AFF2_HUMAN	H	564;531;531;205	ENSP00000359489:Q564H;ENSP00000359486:Q531H;ENSP00000345459:Q531H;ENSP00000286437:Q205H	ENSP00000286437:Q205H	Q	+	3	2	AFF2	147844967	0.129000	0.22400	0.262000	0.24481	0.952000	0.60782	-0.537000	0.06128	-1.286000	0.02384	-0.335000	0.08231	CAA	.	.		0.458	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025	
PASD1	139135	hgsc.bcm.edu	37	X	150842573	150842573	+	Missense_Mutation	SNP	C	C	G			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chrX:150842573C>G	ENST00000370357.4	+	15	2335	c.2090C>G	c.(2089-2091)tCt>tGt	p.S697C		NM_173493.2	NP_775764.2	Q8IV76	PASD1_HUMAN	PAS domain containing 1	697						nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(3)|liver(1)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48	Acute lymphoblastic leukemia(192;6.56e-05)					CAAGAGTTGTCTGATTCACTC	0.527																																					p.S697C		Atlas-SNP	.											.	PASD1	286	.	0			c.C2090G						.						124.0	115.0	118.0					X																	150842573		2203	4300	6503	SO:0001583	missense	139135	exon15			AGTTGTCTGATTC	AY270020	CCDS35431.1	Xq28	2009-08-06			ENSG00000166049	ENSG00000166049			20686	protein-coding gene	gene with protein product	"""cancer/testis antigen 63"""					15122589, 15162151	Standard	NM_173493		Approved	CT63	uc004fev.4	Q8IV76	OTTHUMG00000024169	ENST00000370357.4:c.2090C>G	chrX.hg19:g.150842573C>G	ENSP00000359382:p.Ser697Cys	69.0	0.0		47.0	29.0	NM_173493	Q3MNE0|Q69HD7|Q8N7X9	Missense_Mutation	SNP	ENST00000370357.4	hg19	CCDS35431.1	.	.	.	.	.	.	.	.	.	.	C	11.21	1.572103	0.28092	.	.	ENSG00000166049	ENST00000370357	T	0.34275	1.37	3.25	0.239	0.15484	.	.	.	.	.	T	0.23846	0.0577	N	0.14661	0.345	0.09310	N	1	P	0.52463	0.953	P	0.47705	0.555	T	0.11299	-1.0593	9	0.51188	T	0.08	-8.0E-4	5.0809	0.14656	0.4461:0.3644:0.1895:0.0	.	697	Q8IV76	PASD1_HUMAN	C	697	ENSP00000359382:S697C	ENSP00000359382:S697C	S	+	2	0	PASD1	150593229	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.403000	0.07214	-0.063000	0.13065	-0.237000	0.12165	TCT	.	.		0.527	PASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060879.2	NM_173493	
SREBF1	6720	hgsc.bcm.edu	37	17	17721042	17721042	+	Frame_Shift_Del	DEL	C	C	-			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr17:17721042delC	ENST00000261646.5	-	7	1556	c.1372delG	c.(1372-1374)gagfs	p.E458fs	SREBF1_ENST00000355815.4_Frame_Shift_Del_p.E488fs|SREBF1_ENST00000395757.1_Frame_Shift_Del_p.E204fs|SREBF1_ENST00000583732.1_5'Flank|SREBF1_ENST00000338854.5_Frame_Shift_Del_p.E458fs|SREBF1_ENST00000435530.2_Frame_Shift_Del_p.E458fs	NM_004176.4	NP_004167.3	P36956	SRBP1_HUMAN	sterol regulatory element binding transcription factor 1	458	Gly/Pro/Ser-rich.|Interaction with LMNA. {ECO:0000250}.				aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|cellular response to starvation (GO:0009267)|cholesterol metabolic process (GO:0008203)|circadian rhythm (GO:0007623)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|negative regulation of insulin secretion (GO:0046676)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of fatty acid metabolic process (GO:0019217)|regulation of heart rate by chemical signal (GO:0003062)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|response to food (GO:0032094)|response to glucagon (GO:0033762)|response to glucose (GO:0009749)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|sterol response element binding (GO:0032810)			cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	14						CTGTCAGGCTCCGAGTCACTG	0.657																																					p.E488fs		Atlas-INDEL	.											.	SREBF1	47	.	0			c.1463delA						.						46.0	36.0	39.0					17																	17721042		2203	4297	6500	SO:0001589	frameshift_variant	6720	exon8			.	BC057388	CCDS11189.1, CCDS32583.1	17p11.2	2013-05-21			ENSG00000072310	ENSG00000072310		"""Basic helix-loop-helix proteins"""	11289	protein-coding gene	gene with protein product		184756				8402897, 7759101	Standard	NM_001005291		Approved	SREBP1, bHLHd1, SREBP-1c	uc002grt.2	P36956	OTTHUMG00000059313	ENST00000261646.5:c.1372delG	chr17.hg19:g.17721042delC	ENSP00000261646:p.Glu458fs	52.0	0.0		28.0	12.0	NM_001005291	B0I4X3|B0I4X4|D3DXC4|Q16062|Q59F52|Q6P4R7|Q6PFW7|Q6PJ36|Q8TAK9	Frame_Shift_Del	DEL	ENST00000261646.5	hg19	CCDS11189.1																																																																																			.	.		0.657	SREBF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131771.1	NM_004176	
C3	718	hgsc.bcm.edu	37	19	6681964	6681966	+	In_Frame_Del	DEL	GAT	GAT	-			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	GAT	GAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr19:6681964_6681966delGAT	ENST00000245907.6	-	35	4428_4430	c.4336_4338delATC	c.(4336-4338)atcdel	p.I1446del	C3_ENST00000599668.1_5'Flank	NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	1446	Properdin-binding.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	TGTCCAGGTAGATGATGAGGGTG	0.522																																					p.1446_1447del		Atlas-Indel,Pindel	.											C3,NS,carcinoma,0,1	C3	192	.	0			c.4337_4339del						.																																			SO:0001651	inframe_deletion	718	exon35			.	J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.4336_4338delATC	chr19.hg19:g.6681967_6681969delGAT	ENSP00000245907:p.Ile1446del	66.0	0.0		50.0	15.0	NM_000064	A7E236	In_Frame_Del	DEL	ENST00000245907.6	hg19	CCDS32883.1																																																																																			.	.		0.522	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317636.2	NM_000064	
HCFC2	29915	hgsc.bcm.edu	37	12	104474603	104474604	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	AA	AA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr12:104474603_104474604delAA	ENST00000229330.4	+	5	866_867	c.762_763delAA	c.(760-765)ggaaacfs	p.N255fs		NM_013320.2	NP_037452.1	Q9Y5Z7	HCFC2_HUMAN	host cell factor C2	255					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|lung(14)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	35						GTGTTATAGGAAACAAGTATGG	0.322																																					p.254_254del	Esophageal Squamous(184;1814 2036 4771 6974 15702)	Atlas-Indel,Pindel	.											.	HCFC2	94	.	0			c.761_762del						.																																			SO:0001589	frameshift_variant	29915	exon5			.	AF117210	CCDS9097.1	12q23.3	2011-03-30			ENSG00000111727	ENSG00000111727			24972	protein-coding gene	gene with protein product		607926				10196288	Standard	NM_013320		Approved	HCF-2	uc001tkj.4	Q9Y5Z7	OTTHUMG00000170175	ENST00000229330.4:c.762_763delAA	chr12.hg19:g.104474603_104474604delAA	ENSP00000229330:p.Asn255fs	99.0	0.0		94.0	33.0	NM_013320	B2R8Q5|C0H5X3	Frame_Shift_Del	DEL	ENST00000229330.4	hg19	CCDS9097.1																																																																																			.	.		0.322	HCFC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407780.1	NM_013320	
ZFC3H1	196441	hgsc.bcm.edu	37	12	72030765	72030766	+	Frame_Shift_Ins	INS	-	-	ATTA			TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr12:72030765_72030766insATTA	ENST00000378743.3	-	8	2157_2158	c.1799_1800insTAAT	c.(1798-1800)ccafs	p.-600fs	SNORA17_ENST00000391159.1_RNA	NM_144982.4	NP_659419.3	O60293	ZC3H1_HUMAN	zinc finger, C3H1-type containing						RNA processing (GO:0006396)	extracellular space (GO:0005615)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(31)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						GAGGTGGTAATGGTGGTAGAGG	0.441																																					p.P600fs		Atlas-Indel,Pindel	.											.	ZFC3H1	172	.	0			c.1800_1801insTAAT						.																																			SO:0001589	frameshift_variant	196441	exon8			.	AB011118	CCDS41813.1	12q21.1	2013-01-25	2008-10-01	2008-10-01		ENSG00000133858		"""Zinc finger, C3H1-type containing"""	28328	protein-coding gene	gene with protein product			"""proline/serine-rich coiled-coil 2"", ""coiled-coil domain containing 131"""	PSRC2, CCDC131		9628581	Standard	NM_144982		Approved	MGC23401, KIAA0546	uc001swo.2	O60293	OTTHUMG00000169545	ENST00000378743.3:c.1799_1800insTAAT	chr12.hg19:g.72030765_72030766insATTA	ENSP00000368017:p.Pro600fs	91.0	0.0		141.0	23.0	NM_144982	Q6GMU1|Q6P2S9|Q6ZV36|Q96BE7	Frame_Shift_Ins	INS	ENST00000378743.3	hg19	CCDS41813.1																																																																																			.	.		0.441	ZFC3H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404751.1	NM_144982	
SLC44A3	126969	hgsc.bcm.edu	37	1	95357851	95357859	+	In_Frame_Del	DEL	TTTCACTGT	TTTCACTGT	-	rs200876036		TCGA-UB-A7MD-01A-12D-A34Z-10	TCGA-UB-A7MD-10A-01D-A34Z-10	TTTCACTGT	TTTCACTGT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d48970c7-b709-4f1b-99d3-3a4d1654738b	d3214cb5-374d-4e2f-b712-07dfcb82966a	g.chr1:95357851_95357859delTTTCACTGT	ENST00000271227.6	+	14	1737_1745	c.1635_1643delTTTCACTGT	c.(1633-1644)tgtttcactgtt>tgt	p.FTV546del	SLC44A3_ENST00000446120.2_In_Frame_Del_p.FTV510del|SLC44A3_ENST00000529450.1_In_Frame_Del_p.FTV513del|SLC44A3_ENST00000467909.1_In_Frame_Del_p.FTV498del|SLC44A3_ENST00000527077.1_In_Frame_Del_p.FTV478del|SLC44A3_ENST00000532427.1_In_Frame_Del_p.FTV466del	NM_001114106.2|NM_001258340.1|NM_001258341.1	NP_001107578.1|NP_001245269.1|NP_001245270.1	Q8N4M1	CTL3_HUMAN	solute carrier family 44, member 3	546					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(6)|prostate(2)|stomach(1)|urinary_tract(1)	23		all_lung(203;0.000712)|Lung NSC(277;0.00316)		all cancers(265;0.039)|Epithelial(280;0.124)	Choline(DB00122)	TAGTGGTGTGTTTCACTGTTTTTGGAGGA	0.388																																					p.545_548del		Atlas-Indel,Pindel	.											.	SLC44A3	109	.	0			c.1634_1642del						.																																			SO:0001651	inframe_deletion	126969	exon14			.	BC033858	CCDS751.1, CCDS44176.1, CCDS58011.1, CCDS58012.1, CCDS58013.1, CCDS72827.1	1p22.1	2013-05-22	2005-09-06		ENSG00000143036	ENSG00000143036		"""Solute carriers"""	28689	protein-coding gene	gene with protein product			"""solute carrier family, member 3"""			15715662, 12975309	Standard	NM_001114106		Approved	MGC45474, CTL3	uc001dqv.5	Q8N4M1	OTTHUMG00000010700	ENST00000271227.6:c.1635_1643delTTTCACTGT	chr1.hg19:g.95357851_95357859delTTTCACTGT	ENSP00000271227:p.Phe546_Val548del	327.0	0.0		231.0	49.0	NM_001114106	B4DVY4|B4E1M4|B7ZA08|E9PJH2|E9PJY8|Q6UWT1|Q7Z6C5|Q9BWY7	In_Frame_Del	DEL	ENST00000271227.6	hg19	CCDS44176.1																																																																																			.	.		0.388	SLC44A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029544.3	NM_152369	
