#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ANXA9	8416	hgsc.bcm.edu	37	1	150960818	150960818	+	Splice_Site	SNP	G	G	A			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr1:150960818G>A	ENST00000368947.4	+	12	1328		c.e12+1			NM_003568.2	NP_003559.2	O76027	ANXA9_HUMAN	annexin A9						single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	acetylcholine receptor activity (GO:0015464)|calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylserine binding (GO:0001786)|phospholipid binding (GO:0005543)|protein homodimerization activity (GO:0042803)			endometrium(1)|large_intestine(1)|lung(4)|skin(2)	8	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			AGCCCTCCAGGTGAGAGGGGC	0.493																																					.		Atlas-SNP	.											.	ANXA9	28	.	0			c.852+1G>A						.						104.0	96.0	99.0					1																	150960818		2203	4300	6503	SO:0001630	splice_region_variant	8416	exon12			CTCCAGGTGAGAG	AJ009985	CCDS975.2	1q21.2	2008-02-05			ENSG00000143412	ENSG00000143412		"""Annexins"""	547	protein-coding gene	gene with protein product		603319		ANX31		9742942, 9931420	Standard	NM_003568		Approved		uc001ewa.2	O76027	OTTHUMG00000035063	ENST00000368947.4:c.852+1G>A	chr1.hg19:g.150960818G>A		80.0	0.0		119.0	43.0	NM_003568	Q5SZF1|Q6FI55|Q9BS00|Q9HBJ6	Splice_Site	SNP	ENST00000368947.4	hg19	CCDS975.2	.	.	.	.	.	.	.	.	.	.	G	22.6	4.316799	0.81469	.	.	ENSG00000143412	ENST00000368947	.	.	.	5.29	5.29	0.74685	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4183	0.83750	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ANXA9	149227442	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.088000	0.64486	2.493000	0.84123	0.655000	0.94253	.	.	.		0.493	ANXA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084895.2	NM_003568	Intron
KCNN3	3782	hgsc.bcm.edu	37	1	154842252	154842253	+	Missense_Mutation	DNP	AG	AG	CT			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	A|G	A|G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr1:154842252_154842253AG>CT	ENST00000271915.4	-	1	503_504	c.188_189CT>AG	c.(187-189)cCT>cAG	p.P63Q	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	63	Gln-rich.|Pro-rich.				potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	gaagctgcggaggctgaggctg	0.698																																					p.P63P|p.P63H		Atlas-SNP	.											.	KCNN3	141	.	0			c.T189G|c.C188A						.																																			SO:0001583	missense	3782	exon1			CTGCGGAGGCTGA|TGCGGAGGCTGAG	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.188_189delinsCT	chr1.hg19:g.154842252_154842253delinsCT	ENSP00000271915:p.Pro63Gln	65.0|66.0	0.0		93.0	9.0|10.0	NM_001204087	B1ANX0|O43517|Q86VF9|Q8WXG7	Silent|Missense_Mutation	SNP	ENST00000271915.4	hg19	CCDS30880.1																																																																																			.	.		0.698	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249	
TNR	7143	hgsc.bcm.edu	37	1	175335172	175335172	+	Missense_Mutation	SNP	G	G	C			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr1:175335172G>C	ENST00000367674.2	-	11	2864	c.2156C>G	c.(2155-2157)aCc>aGc	p.T719S	TNR_ENST00000263525.2_Missense_Mutation_p.T719S			Q92752	TENR_HUMAN	tenascin R	719	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					TGGGGTAAAGGTAATTCGGTA	0.547																																					p.T719S		Atlas-SNP	.											.	TNR	399	.	0			c.C2156G						.						159.0	148.0	152.0					1																	175335172		2203	4300	6503	SO:0001583	missense	7143	exon11			GTAAAGGTAATTC	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.2156C>G	chr1.hg19:g.175335172G>C	ENSP00000356646:p.Thr719Ser	131.0	0.0		172.0	91.0	NM_003285	C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	ENST00000367674.2	hg19	CCDS1318.1	.	.	.	.	.	.	.	.	.	.	G	13.72	2.321118	0.41096	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.58060	0.36;0.36	5.92	3.95	0.45737	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.052752	0.85682	D	0.000000	T	0.39517	0.1081	N	0.20357	0.565	0.45791	D	0.998675	B	0.28512	0.214	B	0.36289	0.221	T	0.15983	-1.0418	10	0.32370	T	0.25	.	9.9484	0.41623	0.0747:0.0:0.7886:0.1367	.	719	Q92752	TENR_HUMAN	S	719	ENSP00000356646:T719S;ENSP00000263525:T719S	ENSP00000263525:T719S	T	-	2	0	TNR	173601795	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	6.055000	0.71103	0.734000	0.32515	0.555000	0.69702	ACC	.	.		0.547	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285	
BRINP2	57795	hgsc.bcm.edu	37	1	177226365	177226365	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr1:177226365G>A	ENST00000361539.4	+	4	826	c.514G>A	c.(514-516)Gag>Aag	p.E172K	BRINP2_ENST00000478325.1_3'UTR	NM_021165.2	NP_066988.1	Q9C0B6	BRNP2_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 2	172	MACPF.				cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	extracellular region (GO:0005576)											AAGAAAGACAGAGACAACAGG	0.537																																					p.E172K		Atlas-SNP	.											.	FAM5B	191	.	0			c.G514A						.						83.0	80.0	81.0					1																	177226365		2203	4300	6503	SO:0001583	missense	57795	exon4			AAGACAGAGACAA		CCDS1320.1	1q24	2013-08-06	2013-08-06	2013-07-31	ENSG00000198797	ENSG00000198797			13746	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member B"""	FAM5B		15193423	Standard	NM_021165		Approved	DBCCR1L2	uc001glf.3	Q9C0B6	OTTHUMG00000034953	ENST00000361539.4:c.514G>A	chr1.hg19:g.177226365G>A	ENSP00000354481:p.Glu172Lys	251.0	0.0		282.0	80.0	NM_021165	O95560|Q6ZWC1|Q7LCZ9|Q8N360	Missense_Mutation	SNP	ENST00000361539.4	hg19	CCDS1320.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.135863	0.77662	.	.	ENSG00000198797	ENST00000361539	T	0.15256	2.44	5.05	5.05	0.67936	Membrane attack complex component/perforin (MACPF) domain (1);	0.000000	0.85682	D	0.000000	T	0.38401	0.1039	M	0.64997	1.995	0.80722	D	1	D;D	0.59767	0.981;0.986	P;P	0.61800	0.848;0.894	T	0.15665	-1.0429	10	0.72032	D	0.01	-22.3638	18.3758	0.90435	0.0:0.0:1.0:0.0	.	67;172	Q9C0B6-2;Q9C0B6	.;FAM5B_HUMAN	K	172	ENSP00000354481:E172K	ENSP00000354481:E172K	E	+	1	0	FAM5B	175492988	1.000000	0.71417	0.808000	0.32385	0.094000	0.18550	7.070000	0.76763	2.496000	0.84212	0.655000	0.94253	GAG	.	.		0.537	BRINP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084599.1	NM_021165	
INTS7	25896	hgsc.bcm.edu	37	1	212190324	212190324	+	Missense_Mutation	SNP	T	T	C			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr1:212190324T>C	ENST00000366994.3	-	4	517	c.413A>G	c.(412-414)aAt>aGt	p.N138S	INTS7_ENST00000469606.1_5'UTR|INTS7_ENST00000366993.3_Missense_Mutation_p.N138S|INTS7_ENST00000440600.2_Missense_Mutation_p.N89S|INTS7_ENST00000366992.3_Missense_Mutation_p.N138S	NM_001199811.1|NM_001199812.1|NM_015434.3	NP_001186740.1|NP_001186741.1|NP_056249.1	Q9NVH2	INT7_HUMAN	integrator complex subunit 7	138					cellular response to ionizing radiation (GO:0071479)|DNA damage checkpoint (GO:0000077)|snRNA processing (GO:0016180)	chromosome (GO:0005694)|integrator complex (GO:0032039)				NS(1)|breast(1)|kidney(1)|large_intestine(8)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20				OV - Ovarian serous cystadenocarcinoma(81;0.00584)|all cancers(67;0.0318)|Epithelial(68;0.0852)		ATGATGAGCATTCTTCCTCTC	0.393																																					p.N138S		Atlas-SNP	.											.	INTS7	68	.	0			c.A413G						.						177.0	177.0	177.0					1																	212190324		2203	4300	6503	SO:0001583	missense	25896	exon4			TGAGCATTCTTCC	AK022509	CCDS1501.1, CCDS55684.1, CCDS55683.1, CCDS55685.1	1q32.3	2008-02-05	2006-03-15	2006-03-15	ENSG00000143493	ENSG00000143493			24484	protein-coding gene	gene with protein product		611350	"""chromosome 1 open reading frame 73"""	C1orf73		16239144	Standard	NM_015434		Approved	DKFZP434B168, INT7	uc001hiw.2	Q9NVH2	OTTHUMG00000037119	ENST00000366994.3:c.413A>G	chr1.hg19:g.212190324T>C	ENSP00000355961:p.Asn138Ser	183.0	0.0		223.0	76.0	NM_015434	B4DLZ6|B7WNP6|B7WPB6|Q8N4K7|Q8WUH5|Q9H9V3|Q9NVU5|Q9UFC6|Q9UFM3	Missense_Mutation	SNP	ENST00000366994.3	hg19	CCDS1501.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.428315	0.83667	.	.	ENSG00000143493	ENST00000366994;ENST00000366993;ENST00000366992;ENST00000440600	T;T;T;T	0.26223	1.75;1.75;1.75;1.75	5.88	5.88	0.94601	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.45895	0.1365	L	0.55834	1.745	0.80722	D	1	D;D;D;D	0.67145	0.996;0.996;0.996;0.994	D;D;D;D	0.73380	0.98;0.98;0.98;0.934	T	0.18713	-1.0328	10	0.30078	T	0.28	-32.3397	16.2879	0.82732	0.0:0.0:0.0:1.0	.	89;138;138;138	B4DLZ6;Q9NVH2-3;Q9NVH2-2;Q9NVH2	.;.;.;INT7_HUMAN	S	138;138;138;89	ENSP00000355961:N138S;ENSP00000355960:N138S;ENSP00000355959:N138S;ENSP00000388908:N89S	ENSP00000355959:N138S	N	-	2	0	INTS7	210256947	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.622000	0.83099	2.242000	0.73789	0.533000	0.62120	AAT	.	.		0.393	INTS7-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090142.1	NM_015434	
DISC1	27185	hgsc.bcm.edu	37	1	231931028	231931028	+	Nonsense_Mutation	SNP	G	G	T			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr1:231931028G>T	ENST00000602281.1	+	7	1728	c.1675G>T	c.(1675-1677)Gaa>Taa	p.E559*	TSNAX-DISC1_ENST00000602962.1_3'UTR|DISC1_ENST00000535983.1_Nonsense_Mutation_p.E559*|DISC1_ENST00000537876.1_Intron|DISC1_ENST00000602873.1_Intron|DISC1_ENST00000366633.3_Nonsense_Mutation_p.E559*|DISC1_ENST00000539444.1_Nonsense_Mutation_p.E559*|DISC1_ENST00000439617.2_Nonsense_Mutation_p.E559*|DISC1_ENST00000366636.4_Nonsense_Mutation_p.E559*|DISC1_ENST00000366637.3_5'UTR	NM_001164542.1|NM_001164544.1	NP_001158014.1|NP_001158016.1	Q9NRI5	DISC1_HUMAN	disrupted in schizophrenia 1	559	Interaction with TRAF3IP1.|Necessary and sufficient for interaction with PCNT and localization at the centrosome.|Required for localization to punctate cytoplasmic foci.				canonical Wnt signaling pathway (GO:0060070)|cell proliferation in forebrain (GO:0021846)|cellular protein localization (GO:0034613)|cerebral cortex radially oriented cell migration (GO:0021799)|microtubule cytoskeleton organization (GO:0000226)|mitochondrial calcium ion homeostasis (GO:0051560)|neuron migration (GO:0001764)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neuron projection development (GO:0010975)|regulation of synapse maturation (GO:0090128)|TOR signaling (GO:0031929)	cell junction (GO:0030054)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|postsynaptic membrane (GO:0045211)				breast(1)|cervix(1)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	15		all_cancers(173;0.0208)|Prostate(94;0.0975)				GTCACTTAAAGAAATCACTAC	0.353																																					p.E591X		Atlas-SNP	.											DISC1_ENST00000366638,caecum,carcinoma,0,6	DISC1	207	.	0			c.G1771T						.						80.0	81.0	81.0					1																	231931028		2203	4300	6503	SO:0001587	stop_gained	27185	exon8			CTTAAAGAAATCA	AF222980	CCDS31055.1, CCDS31056.1, CCDS53482.1, CCDS53483.1, CCDS53484.1, CCDS59205.1, CCDS59206.1, CCDS59207.1	1q42.1	2008-02-05			ENSG00000162946	ENSG00000162946			2888	protein-coding gene	gene with protein product		605210				10814723	Standard	NM_001164550		Approved		uc010pxh.2	Q9NRI5	OTTHUMG00000037835	ENST00000602281.1:c.1675G>T	chr1.hg19:g.231931028G>T	ENSP00000473425:p.Glu559*	71.0	0.0		85.0	5.0	NM_001164537	A6NLH2|C4P091|C4P095|C4P0A1|C4P0A3|C4P0B3|C4P0B6|C4P0C1|C9J6D0|O75045|Q5VT44|Q5VT45|Q8IXJ0|Q8IXJ1|Q9BX19|Q9NRI3|Q9NRI4	Nonsense_Mutation	SNP	ENST00000602281.1	hg19	CCDS59205.1	.	.	.	.	.	.	.	.	.	.	G	38	6.665954	0.97747	.	.	ENSG00000162946	ENST00000439617;ENST00000366637;ENST00000366636;ENST00000366638;ENST00000532576;ENST00000535983;ENST00000366633;ENST00000539444	.	.	.	4.72	2.84	0.33178	.	0.058100	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-14.0953	9.2333	0.37450	0.1675:0.0:0.8325:0.0	.	.	.	.	X	559;559;559;591;437;559;559;559	.	ENSP00000355593:E559X	E	+	1	0	DISC1	229997651	1.000000	0.71417	0.626000	0.29213	0.986000	0.74619	5.159000	0.64923	0.688000	0.31529	0.557000	0.71058	GAA	.	.		0.353	DISC1-019	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000467451.1	NM_018662	
OR2L3	391192	hgsc.bcm.edu	37	1	248224001	248224001	+	Missense_Mutation	SNP	A	A	T			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr1:248224001A>T	ENST00000359959.3	+	1	18	c.18A>T	c.(16-18)caA>caT	p.Q6H	OR2L13_ENST00000366478.2_Intron	NM_001004687.1	NP_001004687.1	Q8NG85	OR2L3_HUMAN	olfactory receptor, family 2, subfamily L, member 3	6						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|large_intestine(7)|lung(28)|prostate(1)|skin(1)|urinary_tract(1)	41	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			ATTACAATCAAACATCAACTG	0.393																																					p.Q6H		Atlas-SNP	.											.	OR2L3	97	.	0			c.A18T						.						181.0	180.0	180.0					1																	248224001		2203	4300	6503	SO:0001583	missense	391192	exon1			CAATCAAACATCA	AB065950	CCDS31104.1	1q44	2012-08-09			ENSG00000198128	ENSG00000198128		"""GPCR / Class A : Olfactory receptors"""	15009	protein-coding gene	gene with protein product							Standard	NM_001004687		Approved		uc001idx.1	Q8NG85	OTTHUMG00000040195	ENST00000359959.3:c.18A>T	chr1.hg19:g.248224001A>T	ENSP00000353044:p.Gln6His	160.0	0.0		180.0	80.0	NM_001004687	B9EH44	Missense_Mutation	SNP	ENST00000359959.3	hg19	CCDS31104.1	.	.	.	.	.	.	.	.	.	.	.	8.919	0.960659	0.18583	.	.	ENSG00000198128	ENST00000359959	T	0.00572	6.49	2.05	0.915	0.19366	.	.	.	.	.	T	0.00412	0.0013	N	0.16903	0.455	0.25872	N	0.983693	B	0.13594	0.008	B	0.18263	0.021	T	0.40251	-0.9573	9	0.25106	T	0.35	.	4.71	0.12868	0.6785:0.0:0.3215:0.0	.	6	Q8NG85	OR2L3_HUMAN	H	6	ENSP00000353044:Q6H	ENSP00000353044:Q6H	Q	+	3	2	OR2L3	246290624	0.095000	0.21747	0.051000	0.19133	0.366000	0.29705	0.389000	0.20751	0.928000	0.37168	0.379000	0.24179	CAA	.	.		0.393	OR2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096852.1	NM_001004687	
MYT1L	23040	hgsc.bcm.edu	37	2	1926072	1926072	+	Missense_Mutation	SNP	G	G	T			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr2:1926072G>T	ENST00000399161.2	-	10	2216	c.1469C>A	c.(1468-1470)cCa>cAa	p.P490Q	MYT1L_ENST00000428368.2_Missense_Mutation_p.P490Q	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	490					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.P490K(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		ACCATAGTATGGCTTTTTGAC	0.448																																					p.P490Q		Atlas-SNP	.											.,1	MYT1L	241	.	1	Substitution - Missense(1)	lung(1)	c.C1469A						.						117.0	110.0	112.0					2																	1926072		1919	4131	6050	SO:0001583	missense	23040	exon10			TAGTATGGCTTTT	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.1469C>A	chr2.hg19:g.1926072G>T	ENSP00000382114:p.Pro490Gln	100.0	0.0		122.0	26.0	NM_015025	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	ENST00000399161.2	hg19		.	.	.	.	.	.	.	.	.	.	G	23.1	4.376907	0.82682	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000428368	T;T	0.43294	0.95;0.95	5.91	5.91	0.95273	.	0.165892	0.53938	D	0.000046	T	0.49490	0.1560	N	0.24115	0.695	0.80722	D	1	D;P	0.63880	0.993;0.846	P;B	0.60541	0.876;0.358	T	0.32052	-0.9921	10	0.29301	T	0.29	-14.9637	20.2936	0.98544	0.0:0.0:1.0:0.0	.	490;490	Q9UL68;Q9UL68-4	MYT1L_HUMAN;.	Q	490;438;490	ENSP00000382114:P490Q;ENSP00000396103:P490Q	ENSP00000295067:P438Q	P	-	2	0	MYT1L	1905079	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.787000	0.99055	2.801000	0.96364	0.655000	0.94253	CCA	.	.		0.448	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	NM_015025	
NR4A2	4929	hgsc.bcm.edu	37	2	157186301	157186301	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr2:157186301G>A	ENST00000339562.4	-	3	760	c.398C>T	c.(397-399)cCg>cTg	p.P133L	NR4A2_ENST00000429376.1_Missense_Mutation_p.P70L|NR4A2_ENST00000409108.2_Missense_Mutation_p.P133L|NR4A2_ENST00000409572.1_Missense_Mutation_p.P133L|NR4A2_ENST00000539077.1_Missense_Mutation_p.P144L|NR4A2_ENST00000426264.1_Missense_Mutation_p.P70L	NM_006186.3	NP_006177.1	P43354	NR4A2_HUMAN	nuclear receptor subfamily 4, group A, member 2	133	Gln-rich.|Pro-rich.				adult locomotory behavior (GO:0008344)|cellular response to extracellular stimulus (GO:0031668)|cellular response to oxidative stress (GO:0034599)|central nervous system projection neuron axonogenesis (GO:0021952)|death (GO:0016265)|dopamine biosynthetic process (GO:0042416)|dopaminergic neuron differentiation (GO:0071542)|gene expression (GO:0010467)|general adaptation syndrome (GO:0051866)|habenula development (GO:0021986)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of neuron apoptotic process (GO:0043524)|neuron maturation (GO:0042551)|neuron migration (GO:0001764)|positive regulation of catalytic activity (GO:0043085)|post-embryonic development (GO:0009791)|regulation of dopamine metabolic process (GO:0042053)|regulation of respiratory gaseous exchange (GO:0043576)|response to amphetamine (GO:0001975)|response to hypoxia (GO:0001666)|response to inorganic substance (GO:0010035)|response to insecticide (GO:0017085)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(15)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	40						CTGGAAGCCCGGGGTGGTGGG	0.637																																					p.P133L		Atlas-SNP	.											.	NR4A2	82	.	0			c.C398T						.						57.0	69.0	65.0					2																	157186301		2203	4300	6503	SO:0001583	missense	4929	exon3			AAGCCCGGGGTGG	X75918	CCDS2201.1	2q22-q23	2013-01-16			ENSG00000153234	ENSG00000153234		"""Nuclear hormone receptors"""	7981	protein-coding gene	gene with protein product		601828		NURR1		7706727	Standard	NM_006186		Approved	TINUR, NOT, RNR1, HZF-3	uc002tyz.4	P43354	OTTHUMG00000131950	ENST00000339562.4:c.398C>T	chr2.hg19:g.157186301G>A	ENSP00000344479:p.Pro133Leu	70.0	0.0		66.0	9.0	NM_006186	Q16311|Q53RZ2|Q6NXU0	Missense_Mutation	SNP	ENST00000339562.4	hg19	CCDS2201.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.354232	0.82243	.	.	ENSG00000153234	ENST00000339562;ENST00000426264;ENST00000409572;ENST00000539077;ENST00000409108;ENST00000429376;ENST00000424077;ENST00000421709	D;D;D;D;D;D;D;D	0.95069	-3.07;-3.36;-3.07;-3.09;-3.38;-3.6;-1.87;-2.64	5.95	5.95	0.96441	.	0.483808	0.24678	N	0.036500	D	0.96259	0.8780	L	0.57536	1.79	0.80722	D	1	D	0.71674	0.998	P	0.59288	0.855	D	0.96147	0.9105	10	0.87932	D	0	.	20.3854	0.98941	0.0:0.0:1.0:0.0	.	133	P43354	NR4A2_HUMAN	L	133;70;133;144;133;70;133;70	ENSP00000344479:P133L;ENSP00000389986:P70L;ENSP00000386747:P133L;ENSP00000444925:P144L;ENSP00000386993:P133L;ENSP00000410952:P70L;ENSP00000406808:P133L;ENSP00000388120:P70L	ENSP00000344479:P133L	P	-	2	0	NR4A2	156894547	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	9.869000	0.99810	2.825000	0.97269	0.655000	0.94253	CCG	.	.		0.637	NR4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254909.2		
STAT1	6772	hgsc.bcm.edu	37	2	191841668	191841668	+	Missense_Mutation	SNP	C	C	G			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr2:191841668C>G	ENST00000361099.3	-	22	2344	c.1957G>C	c.(1957-1959)Gtc>Ctc	p.V653L	STAT1_ENST00000392322.3_Missense_Mutation_p.V653L|STAT1_ENST00000540176.1_3'UTR|STAT1_ENST00000409465.1_Missense_Mutation_p.V653L|STAT1_ENST00000392323.2_Missense_Mutation_p.V655L	NM_007315.3	NP_009330.1	P42224	STAT1_HUMAN	signal transducer and activator of transcription 1, 91kDa	653	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				apoptotic process (GO:0006915)|blood circulation (GO:0008015)|cellular response to insulin stimulus (GO:0032869)|cellular response to interferon-beta (GO:0035458)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of macrophage fusion (GO:0034240)|negative regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003340)|negative regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|renal tubule development (GO:0061326)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to exogenous dsRNA (GO:0043330)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|transcription from RNA polymerase II promoter (GO:0006366)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|tumor necrosis factor receptor binding (GO:0005164)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			OV - Ovarian serous cystadenocarcinoma(117;0.00434)|Epithelial(96;0.0555)|all cancers(119;0.141)			GCAGCCATGACTTTGTAATTG	0.418																																					p.V653L		Atlas-SNP	.											.	STAT1	93	.	0			c.G1957C						.						118.0	110.0	113.0					2																	191841668		2203	4300	6503	SO:0001583	missense	6772	exon22			CCATGACTTTGTA		CCDS2309.1, CCDS42793.1	2q32.2-q32.3	2014-09-17	2002-08-29		ENSG00000115415	ENSG00000115415		"""SH2 domain containing"""	11362	protein-coding gene	gene with protein product	"""transcription factor ISGF-3 components p91/p84"""	600555	"""signal transducer and activator of transcription 1, 91kD"""			7885841	Standard	NM_139266		Approved	STAT91, ISGF-3	uc002usj.2	P42224	OTTHUMG00000132699	ENST00000361099.3:c.1957G>C	chr2.hg19:g.191841668C>G	ENSP00000354394:p.Val653Leu	131.0	0.0		106.0	59.0	NM_007315	A8K989|B2RCA0|D2KFR8|D3DPI7|Q53S88|Q53XW4|Q68D00|Q9UDL5	Missense_Mutation	SNP	ENST00000361099.3	hg19	CCDS2309.1	.	.	.	.	.	.	.	.	.	.	C	13.27	2.186456	0.38609	.	.	ENSG00000115415	ENST00000361099;ENST00000409465;ENST00000392322;ENST00000392323	D;D;D;D	0.96427	-4.01;-4.01;-4.01;-4.01	5.53	5.53	0.82687	SH2 motif (3);	0.051635	0.85682	D	0.000000	D	0.92731	0.7689	N	0.25245	0.725	0.80722	D	1	B;B	0.26318	0.146;0.023	B;B	0.25140	0.058;0.05	D	0.88936	0.3376	10	0.25106	T	0.35	-31.2802	19.6556	0.95837	0.0:1.0:0.0:0.0	.	653;653	P42224-2;P42224	.;STAT1_HUMAN	L	653;653;653;655	ENSP00000354394:V653L;ENSP00000386244:V653L;ENSP00000376136:V653L;ENSP00000376137:V655L	ENSP00000354394:V653L	V	-	1	0	STAT1	191549913	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.798000	0.55522	2.882000	0.98803	0.655000	0.94253	GTC	.	.		0.418	STAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255997.3	NM_007315	
CATIP	375307	hgsc.bcm.edu	37	2	219225307	219225307	+	Silent	SNP	C	C	T			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr2:219225307C>T	ENST00000289388.3	+	5	416	c.387C>T	c.(385-387)ctC>ctT	p.L129L	C2orf62_ENST00000481940.1_3'UTR|AC021016.8_ENST00000411433.1_RNA	NM_198559.1	NP_940961.1	Q7Z7H3	CATIP_HUMAN		129					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(4)|kidney(2)|large_intestine(4)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	16		Renal(207;0.0915)		Epithelial(149;8.08e-07)|all cancers(144;0.000146)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TCCTCATCCTCCCCATGGAAC	0.552																																					p.L129L		Atlas-SNP	.											.	C2orf62	28	.	0			c.C387T						.						97.0	82.0	87.0					2																	219225307		2203	4300	6503	SO:0001819	synonymous_variant	375307	exon5			CATCCTCCCCATG																												ENST00000289388.3:c.387C>T	chr2.hg19:g.219225307C>T		41.0	0.0		39.0	10.0	NM_198559		Silent	SNP	ENST00000289388.3	hg19	CCDS2414.1																																																																																			.	.		0.552	C2orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256771.1		
NDUFA10	4705	hgsc.bcm.edu	37	2	240946749	240946749	+	Missense_Mutation	SNP	G	G	T			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr2:240946749G>T	ENST00000252711.2	-	7	888	c.788C>A	c.(787-789)gCt>gAt	p.A263D	NDUFA10_ENST00000404554.1_Missense_Mutation_p.A263D|NDUFA10_ENST00000307300.4_Missense_Mutation_p.A293D	NM_004544.3	NP_004535.1	O95299	NDUAA_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa	263					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	ATP binding (GO:0005524)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|nucleoside kinase activity (GO:0019206)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)	16		all_epithelial(40;4.26e-15)|Breast(86;4.4e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0396)|Lung NSC(271;0.128)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(121;7.82e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.5e-13)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;2.39e-05)|Lung(119;0.00519)|LUSC - Lung squamous cell carcinoma(224;0.0202)		TGAATCTTGAGCTTCCCTTGC	0.313																																					p.A263D		Atlas-SNP	.											.	NDUFA10	40	.	0			c.C788A						.						110.0	106.0	107.0					2																	240946749		2202	4298	6500	SO:0001583	missense	4705	exon7			TCTTGAGCTTCCC	AF087661	CCDS2531.1	2q37.3	2011-07-04	2002-08-29		ENSG00000130414	ENSG00000130414		"""Mitochondrial respiratory chain complex / Complex I"""	7684	protein-coding gene	gene with protein product	"""complex I 42kDa subunit"""	603835	"""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10 (42kD)"""			9878551	Standard	NM_004544		Approved	CI-42k	uc002vyn.3	O95299	OTTHUMG00000133350	ENST00000252711.2:c.788C>A	chr2.hg19:g.240946749G>T	ENSP00000252711:p.Ala263Asp	76.0	0.0		61.0	6.0	NM_004544	Q8WXC9	Missense_Mutation	SNP	ENST00000252711.2	hg19	CCDS2531.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	6.632|6.632|6.632	0.485114|0.485114|0.485114	0.12641|0.12641|0.12641	.|.|.	.|.|.	ENSG00000130414|ENSG00000130414|ENSG00000130414	ENST00000419408;ENST00000252711;ENST00000404554;ENST00000422018;ENST00000448880;ENST00000307300|ENST00000443626|ENST00000444548	D;D;D|D|.	0.94537|0.94758|.	-3.45;-3.45;-3.45|-3.51|.	4.34|4.34|4.34	2.51|2.51|2.51	0.30379|0.30379|0.30379	.|.|.	0.220526|.|.	0.46442|.|.	D|.|.	0.000297|.|.	T|T|T	0.44932|0.44932|0.44932	0.1317|0.1317|0.1317	M|M|M	0.65320|0.65320|0.65320	2|2|2	0.19775|0.19775|0.19775	N|N|N	0.999957|0.999957|0.999957	D;D|.|.	0.58268|.|.	0.982;0.979|.|.	P;P|.|.	0.61533|.|.	0.843;0.89|.|.	T|T|T	0.31971|0.31971|0.31971	-0.9924|-0.9924|-0.9924	10|7|5	0.34782|0.33940|.	T|T|.	0.22|0.23|.	-5.7217|-5.7217|-5.7217	7.0912|7.0912|7.0912	0.25285|0.25285|0.25285	0.2165:0.0:0.7835:0.0|0.2165:0.0:0.7835:0.0|0.2165:0.0:0.7835:0.0	.|.|.	293;263|.|.	Q8WXC9;O95299|.|.	.;NDUAA_HUMAN|.|.	D|I|R	28;263;263;263;26;293|196|33	ENSP00000252711:A263D;ENSP00000385697:A263D;ENSP00000302321:A293D|ENSP00000411527:L196I|.	ENSP00000252711:A263D|ENSP00000411527:L196I|.	A|L|S	-|-|-	2|1|3	0|0|2	NDUFA10|NDUFA10|NDUFA10	240595422|240595422|240595422	0.445000|0.445000|0.445000	0.25657|0.25657|0.25657	0.007000|0.007000|0.007000	0.13788|0.13788|0.13788	0.000000|0.000000|0.000000	0.00434|0.00434|0.00434	3.327000|3.327000|3.327000	0.52045|0.52045|0.52045	0.405000|0.405000|0.405000	0.25532|0.25532|0.25532	-0.291000|-0.291000|-0.291000	0.09656|0.09656|0.09656	GCT|CTC|AGC	.	.		0.313	NDUFA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257180.2	NM_004544	
NKTR	4820	hgsc.bcm.edu	37	3	42672063	42672063	+	Missense_Mutation	SNP	G	G	C			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr3:42672063G>C	ENST00000232978.8	+	7	588	c.400G>C	c.(400-402)Gat>Cat	p.D134H	RP4-613B23.1_ENST00000445452.1_RNA|RP4-613B23.1_ENST00000434363.1_RNA|RP4-613B23.1_ENST00000438017.1_RNA	NM_005385.3	NP_005376.2	P30414	NKTR_HUMAN	natural killer cell triggering receptor	134	PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				protein folding (GO:0006457)	membrane (GO:0016020)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	41				KIRC - Kidney renal clear cell carcinoma(284;0.24)		TCCACACCTGGATGGGTAAGA	0.453																																					p.D134H		Atlas-SNP	.											.	NKTR	116	.	0			c.G400C						.						160.0	138.0	145.0					3																	42672063		2203	4300	6503	SO:0001583	missense	4820	exon7			CACCTGGATGGGT		CCDS2702.1	3p22.1	2014-01-20	2014-01-20		ENSG00000114857	ENSG00000114857			7833	protein-coding gene	gene with protein product	"""NK-tumor recognition protein"", ""natural-killer cells cyclophilin-related protein"", ""NK-TR protein"""	161565	"""natural killer-tumor recognition sequence"""			8314596, 8144875	Standard	XM_005265173		Approved	p104	uc003clo.3	P30414	OTTHUMG00000133037	ENST00000232978.8:c.400G>C	chr3.hg19:g.42672063G>C	ENSP00000232978:p.Asp134His	141.0	0.0		89.0	12.0	NM_005385		Missense_Mutation	SNP	ENST00000232978.8	hg19	CCDS2702.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.673695	0.88445	.	.	ENSG00000114857	ENST00000232978	T	0.42900	0.96	5.37	5.37	0.77165	Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (4);Cyclophilin-like (1);	0.048956	0.85682	D	0.000000	T	0.76378	0.3979	H	0.95780	3.72	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.84100	0.0395	10	0.87932	D	0	-16.2521	19.0902	0.93224	0.0:0.0:1.0:0.0	.	14;134	Q59EC3;P30414	.;NKTR_HUMAN	H	134	ENSP00000232978:D134H	ENSP00000232978:D134H	D	+	1	0	NKTR	42647067	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	8.914000	0.92735	2.519000	0.84933	0.455000	0.32223	GAT	.	.		0.453	NKTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256642.2	NM_005385	
APEH	327	hgsc.bcm.edu	37	3	49720485	49720485	+	Silent	SNP	C	C	T			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr3:49720485C>T	ENST00000296456.5	+	21	2399	c.1999C>T	c.(1999-2001)Ctg>Ttg	p.L667L	APEH_ENST00000438011.1_Silent_p.L672L|AC099668.5_ENST00000563780.1_RNA	NM_001640.3	NP_001631.3	P13798	ACPH_HUMAN	acylaminoacyl-peptide hydrolase	667					beta-amyloid metabolic process (GO:0050435)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)	omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase activity (GO:0004252)			endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|stomach(2)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GAAGACACCACTGTTACTGAT	0.597																																					p.L667L		Atlas-SNP	.											.	APEH	45	.	0			c.C1999T						.						88.0	73.0	78.0					3																	49720485		2203	4300	6503	SO:0001819	synonymous_variant	327	exon21			ACACCACTGTTAC	D38441	CCDS2801.1	3p21	2013-05-29	2013-05-29		ENSG00000164062	ENSG00000164062	3.4.19.1		586	protein-coding gene	gene with protein product	"""acylaminoacyl-peptidase"""	102645	"""N-acylaminoacyl-peptide hydrolase"""	D3F15S2, DNF15S2, D3S48E		2392324	Standard	NM_001640		Approved		uc003cxf.3	P13798	OTTHUMG00000156882	ENST00000296456.5:c.1999C>T	chr3.hg19:g.49720485C>T		96.0	0.0		58.0	26.0	NM_001640	Q9BQ33|Q9P0Y2	Silent	SNP	ENST00000296456.5	hg19	CCDS2801.1																																																																																			.	.		0.597	APEH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346415.2		
P2RY1	5028	hgsc.bcm.edu	37	3	152554423	152554423	+	Missense_Mutation	SNP	G	G	C			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr3:152554423G>C	ENST00000305097.3	+	1	1688	c.852G>C	c.(850-852)ttG>ttC	p.L284F	RP11-38P22.2_ENST00000460407.1_lincRNA	NM_002563.3	NP_002554.1	P47900	P2RY1_HUMAN	purinergic receptor P2Y, G-protein coupled, 1	284					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|aging (GO:0007568)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cell surface receptor signaling pathway (GO:0007166)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of binding (GO:0051100)|negative regulation of norepinephrine secretion (GO:0010700)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of hormone secretion (GO:0046887)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|positive regulation of ion transport (GO:0043270)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein localization to plasma membrane (GO:0072659)|regulation of receptor activity (GO:0010469)|regulation of vasodilation (GO:0042312)|relaxation of muscle (GO:0090075)|response to growth factor (GO:0070848)|response to mechanical stimulus (GO:0009612)|sensory perception of pain (GO:0019233)|signal transduction involved in regulation of gene expression (GO:0023019)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ADP binding (GO:0043531)|ADP-activated nucleotide receptor activity (GO:0045032)|ATP binding (GO:0005524)|ATP-activated nucleotide receptor activity (GO:0045031)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|receptor activity (GO:0004872)|scaffold protein binding (GO:0097110)			breast(1)|endometrium(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)	23			LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)			CGATGAACTTGAGGGCCCGGC	0.443																																					p.L284F		Atlas-SNP	.											.	P2RY1	49	.	0			c.G852C						.						109.0	111.0	111.0					3																	152554423		2203	4300	6503	SO:0001583	missense	5028	exon1			GAACTTGAGGGCC	U42029	CCDS3169.1	3q25.2	2012-08-08			ENSG00000169860	ENSG00000169860		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8539	protein-coding gene	gene with protein product		601167				8579591	Standard	NM_002563		Approved	P2Y1	uc003ezq.3	P47900	OTTHUMG00000159694	ENST00000305097.3:c.852G>C	chr3.hg19:g.152554423G>C	ENSP00000304767:p.Leu284Phe	117.0	0.0		88.0	42.0	NM_002563		Missense_Mutation	SNP	ENST00000305097.3	hg19	CCDS3169.1	.	.	.	.	.	.	.	.	.	.	G	17.77	3.472105	0.63737	.	.	ENSG00000169860	ENST00000305097	T	0.38077	1.16	5.58	5.58	0.84498	GPCR, rhodopsin-like superfamily (1);	0.069347	0.64402	D	0.000019	T	0.38348	0.1037	L	0.49571	1.57	0.53005	D	0.999968	P	0.44946	0.846	P	0.47528	0.549	T	0.07404	-1.0774	10	0.32370	T	0.25	.	10.1406	0.42734	0.1519:0.0:0.8481:0.0	.	284	P47900	P2RY1_HUMAN	F	284	ENSP00000304767:L284F	ENSP00000304767:L284F	L	+	3	2	P2RY1	154037113	1.000000	0.71417	0.871000	0.34182	0.987000	0.75469	3.434000	0.52841	2.618000	0.88619	0.563000	0.77884	TTG	.	.		0.443	P2RY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356943.1	NM_002563	
UGT2B4	7363	hgsc.bcm.edu	37	4	70359471	70359471	+	Silent	SNP	G	G	C			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr4:70359471G>C	ENST00000305107.6	-	2	856	c.810C>G	c.(808-810)ctC>ctG	p.L270L	UGT2B4_ENST00000381096.3_Silent_p.L134L|UGT2B4_ENST00000506580.1_5'UTR|UGT2B4_ENST00000512583.1_Silent_p.L270L	NM_021139.2	NP_066962.2	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B4	270					cellular glucuronidation (GO:0052695)|estrogen catabolic process (GO:0006711)|metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(29)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	47					Canagliflozin(DB08907)|Codeine(DB00318)|Dapagliflozin(DB06292)|Flurbiprofen(DB00712)|Ibuprofen(DB01050)|Morphine(DB00295)	CATTTGGTAAGAGTGGGTGAG	0.433																																					p.L270L		Atlas-SNP	.											.	UGT2B4	105	.	0			c.C810G						.						120.0	127.0	125.0					4																	70359471		2195	4299	6494	SO:0001819	synonymous_variant	7363	exon2			TGGTAAGAGTGGG	BC026264	CCDS43234.1, CCDS75137.1	4q13	2008-02-05	2005-07-20			ENSG00000156096		"""UDP glucuronosyltransferases"""	12553	protein-coding gene	gene with protein product		600067	"""UDP glycosyltransferase 2 family, polypeptide B4"""			3109396, 7835904	Standard	NM_021139		Approved	UGT2B11	uc003hek.4	P06133		ENST00000305107.6:c.810C>G	chr4.hg19:g.70359471G>C		87.0	0.0		111.0	60.0	NM_021139	A6NCP7|B4DT75|G5E9X8|O60731|O60867|O75614|P36538|Q1HBF9|Q6QQX7	Silent	SNP	ENST00000305107.6	hg19	CCDS43234.1																																																																																			.	.		0.433	UGT2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365526.1	NM_021139	
SYNPO2	171024	hgsc.bcm.edu	37	4	119951206	119951206	+	Missense_Mutation	SNP	G	G	C			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr4:119951206G>C	ENST00000429713.2	+	4	1458	c.1276G>C	c.(1276-1278)Gaa>Caa	p.E426Q	SYNPO2_ENST00000448416.2_Intron|SYNPO2_ENST00000434046.2_Missense_Mutation_p.E426Q|SYNPO2_ENST00000307142.4_Missense_Mutation_p.E426Q	NM_001128933.1	NP_001122405.1	Q9UMS6	SYNP2_HUMAN	synaptopodin 2	426	Poly-Glu.					actin cytoskeleton (GO:0015629)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|Z disc (GO:0030018)	14-3-3 protein binding (GO:0071889)|muscle alpha-actinin binding (GO:0051371)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(18)|ovary(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						CGAGGAGGAAGAAGGTGACAA	0.507																																					p.E426Q		Atlas-SNP	.											.	SYNPO2	353	.	0			c.G1276C						.						183.0	172.0	176.0					4																	119951206		2203	4300	6503	SO:0001583	missense	171024	exon4			GAGGAAGAAGGTG	AJ010482	CCDS34054.1, CCDS47128.1, CCDS47129.1, CCDS75185.1, CCDS75186.1	4q26	2008-08-29			ENSG00000172403	ENSG00000172403			17732	protein-coding gene	gene with protein product						11673475, 17828378	Standard	NM_133477		Approved	MYOPODIN	uc010inb.3	Q9UMS6	OTTHUMG00000161165	ENST00000429713.2:c.1276G>C	chr4.hg19:g.119951206G>C	ENSP00000395143:p.Glu426Gln	138.0	0.0		125.0	93.0	NM_001128934	B2RWP6|B2Y8J9|Q9UK89|S5XAM4	Missense_Mutation	SNP	ENST00000429713.2	hg19	CCDS47129.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.6|20.6	4.018909|4.018909	0.75275|0.75275	.|.	.|.	ENSG00000172403|ENSG00000172403	ENST00000307142;ENST00000429713;ENST00000434046|ENST00000504178	T;T;T|.	0.10960|.	2.82;2.85;2.84|.	5.69|5.69	5.69|5.69	0.88448|0.88448	.|.	0.396576|.	0.23738|.	N|.	0.045058|.	T|T	0.74520|0.74520	0.3727|0.3727	M|M	0.64404|0.64404	1.975|1.975	0.80722|0.80722	D|D	1|1	B;P;P;B|.	0.43477|.	0.437;0.741;0.808;0.437|.	B;P;B;B|.	0.44394|.	0.203;0.448;0.261;0.143|.	T|T	0.71563|0.71563	-0.4555|-0.4555	10|5	0.51188|.	T|.	0.08|.	-3.0698|-3.0698	19.8006|19.8006	0.96506|0.96506	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	426;426;426;426|.	B9EG60;Q9UMS6-2;E9PEM2;Q9UMS6|.	.;.;.;SYNP2_HUMAN|.	Q|T	426|377	ENSP00000306015:E426Q;ENSP00000395143:E426Q;ENSP00000390965:E426Q|.	ENSP00000306015:E426Q|.	E|R	+|+	1|2	0|0	SYNPO2|SYNPO2	120170654|120170654	0.956000|0.956000	0.32656|0.32656	0.483000|0.483000	0.27378|0.27378	0.043000|0.043000	0.13939|0.13939	5.671000|5.671000	0.68095|0.68095	2.683000|2.683000	0.91414|0.91414	0.563000|0.563000	0.77884|0.77884	GAA|AGA	.	.		0.507	SYNPO2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364020.1		
UCP1	7350	hgsc.bcm.edu	37	4	141489132	141489132	+	Splice_Site	SNP	C	C	T			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr4:141489132C>T	ENST00000262999.3	-	2	202		c.e2-1			NM_021833.4	NP_068605.1	P25874	UCP1_HUMAN	uncoupling protein 1 (mitochondrial, proton carrier)						brown fat cell differentiation (GO:0050873)|cellular metabolic process (GO:0044237)|mitochondrial transport (GO:0006839)|proton transport (GO:0015992)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	oxidative phosphorylation uncoupler activity (GO:0017077)			NS(1)|breast(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(1)|stomach(1)	16	all_hematologic(180;0.162)					CACCTTGGACCTGGAAATAAG	0.453																																					.		Atlas-SNP	.											.	UCP1	33	.	0			c.127-1G>A						.						69.0	69.0	69.0					4																	141489132		2203	4300	6503	SO:0001630	splice_region_variant	7350	exon3			TTGGACCTGGAAA	X51955	CCDS3753.1	4q28-q31	2013-05-22			ENSG00000109424	ENSG00000109424		"""Solute carriers"""	12517	protein-coding gene	gene with protein product		113730		UCP		2380264	Standard	NM_021833		Approved	SLC25A7	uc011chj.2	P25874	OTTHUMG00000133415	ENST00000262999.3:c.127-1G>A	chr4.hg19:g.141489132C>T		50.0	0.0		43.0	32.0	NM_021833	Q13218|Q4KMZ3|Q68G66	Splice_Site	SNP	ENST00000262999.3	hg19	CCDS3753.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.972372	0.74246	.	.	ENSG00000109424	ENST00000262999	.	.	.	5.51	5.51	0.81932	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.9102	0.86139	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	UCP1	141708582	1.000000	0.71417	0.997000	0.53966	0.747000	0.42532	7.090000	0.76916	2.597000	0.87782	0.655000	0.94253	.	.	.		0.453	UCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257273.1		Intron
DNAH5	1767	hgsc.bcm.edu	37	5	13788992	13788992	+	Missense_Mutation	SNP	T	T	C			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr5:13788992T>C	ENST00000265104.4	-	51	8584	c.8480A>G	c.(8479-8481)aAa>aGa	p.K2827R		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2827					cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TATAACACGTTTACACTCATG	0.388									Kartagener syndrome																												p.K2827R		Atlas-SNP	.											.	DNAH5	868	.	0			c.A8480G						.						115.0	107.0	110.0					5																	13788992		2203	4300	6503	SO:0001583	missense	1767	exon51	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	ACACGTTTACACT	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.8480A>G	chr5.hg19:g.13788992T>C	ENSP00000265104:p.Lys2827Arg	141.0	0.0		183.0	116.0	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	hg19	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	T	12.68	2.009432	0.35415	.	.	ENSG00000039139	ENST00000265104	T	0.39997	1.05	6.06	6.06	0.98353	.	0.093306	0.64402	D	0.000001	T	0.39172	0.1068	L	0.52126	1.63	0.58432	D	0.999996	B	0.06786	0.001	B	0.08055	0.003	T	0.18808	-1.0325	10	0.18710	T	0.47	.	16.6093	0.84858	0.0:0.0:0.0:1.0	.	2827	Q8TE73	DYH5_HUMAN	R	2827	ENSP00000265104:K2827R	ENSP00000265104:K2827R	K	-	2	0	DNAH5	13841992	1.000000	0.71417	1.000000	0.80357	0.611000	0.37282	5.069000	0.64370	2.324000	0.78689	0.533000	0.62120	AAA	.	.		0.388	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
ZSWIM6	57688	hgsc.bcm.edu	37	5	60831392	60831392	+	Missense_Mutation	SNP	C	C	G	rs557637276		TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr5:60831392C>G	ENST00000252744.5	+	10	2327	c.2327C>G	c.(2326-2328)tCt>tGt	p.S776C		NM_020928.1	NP_065979.1	Q9HCJ5	ZSWM6_HUMAN	zinc finger, SWIM-type containing 6	776					neuron projection morphogenesis (GO:0048812)|regulation of neuron migration (GO:2001222)		zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)	8						CTCTTCACCTCTCTCCTACCT	0.498													C|||	1	0.000199681	0.0	0.0	5008	,	,		19630	0.001		0.0	False		,,,				2504	0.0				p.S776C		Atlas-SNP	.											.	ZSWIM6	51	.	0			c.C2327G						.						250.0	198.0	214.0					5																	60831392		692	1591	2283	SO:0001583	missense	57688	exon10			TCACCTCTCTCCT	BC039438	CCDS47215.1	5q12.1	2011-03-17			ENSG00000130449	ENSG00000130449		"""Zinc fingers, SWIM-type"""	29316	protein-coding gene	gene with protein product		615951				10997877, 16427614	Standard	NM_020928		Approved	KIAA1577	uc003jsr.3	Q9HCJ5	OTTHUMG00000162388	ENST00000252744.5:c.2327C>G	chr5.hg19:g.60831392C>G	ENSP00000252744:p.Ser776Cys	90.0	0.0		85.0	34.0	NM_020928		Missense_Mutation	SNP	ENST00000252744.5	hg19	CCDS47215.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.715601	0.89112	.	.	ENSG00000130449	ENST00000252744	T	0.49139	0.79	5.16	5.16	0.70880	.	0.118551	0.64402	D	0.000015	T	0.62417	0.2426	L	0.48642	1.525	0.58432	D	0.999996	D	0.67145	0.996	D	0.63703	0.917	T	0.63972	-0.6516	10	0.87932	D	0	-8.4869	19.2125	0.93763	0.0:1.0:0.0:0.0	.	776	Q9HCJ5	ZSWM6_HUMAN	C	776	ENSP00000252744:S776C	ENSP00000252744:S776C	S	+	2	0	ZSWIM6	60867149	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.787000	0.62432	2.840000	0.97914	0.655000	0.94253	TCT	.	.		0.498	ZSWIM6-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368710.1	NM_020928	
TSLP	85480	hgsc.bcm.edu	37	5	110409224	110409224	+	Nonsense_Mutation	SNP	G	G	T			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr5:110409224G>T	ENST00000344895.3	+	3	431	c.232G>T	c.(232-234)Gaa>Taa	p.E78*	TSLP_ENST00000379706.4_5'UTR|TSLP_ENST00000420978.2_Nonsense_Mutation_p.E78*	NM_033035.4	NP_149024.1	Q969D9	TSLP_HUMAN	thymic stromal lymphopoietin	78						extracellular space (GO:0005615)				breast(1)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|stomach(1)	11		all_cancers(142;2.72e-05)|all_epithelial(76;4.39e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0417)|Ovarian(225;0.0443)|Colorectal(57;0.0464)|all_lung(232;0.0507)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.24e-08)|Epithelial(69;1.54e-07)|all cancers(49;1.73e-05)|COAD - Colon adenocarcinoma(37;0.109)		TTGCCTTACTGAAATCCAGAG	0.512																																					p.E78X		Atlas-SNP	.											.	TSLP	22	.	0			c.G232T						.						151.0	158.0	156.0					5																	110409224		2202	4300	6502	SO:0001587	stop_gained	85480	exon3			CTTACTGAAATCC	BC040592	CCDS4101.1	5q22.1	2007-08-24			ENSG00000145777	ENSG00000145777			30743	protein-coding gene	gene with protein product		607003				11418668, 11480573	Standard	NM_033035		Approved		uc003kpb.2	Q969D9	OTTHUMG00000128791	ENST00000344895.3:c.232G>T	chr5.hg19:g.110409224G>T	ENSP00000339804:p.Glu78*	311.0	0.0		251.0	42.0	NM_033035	Q8IW99	Nonsense_Mutation	SNP	ENST00000344895.3	hg19	CCDS4101.1	.	.	.	.	.	.	.	.	.	.	G	47	13.427668	0.99741	.	.	ENSG00000145777	ENST00000420978;ENST00000344895	.	.	.	4.93	-3.95	0.04118	.	1.790240	0.03195	N	0.173956	.	.	.	.	.	.	0.19775	N	0.999957	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.873	0.951	0.01376	0.1982:0.1532:0.3464:0.3022	.	.	.	.	X	78	.	ENSP00000339804:E78X	E	+	1	0	TSLP	110437123	0.000000	0.05858	0.000000	0.03702	0.043000	0.13939	-0.090000	0.11163	-0.403000	0.07622	0.655000	0.94253	GAA	.	.		0.512	TSLP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250717.1	NM_033035	
FBN2	2201	hgsc.bcm.edu	37	5	127680141	127680141	+	Silent	SNP	G	G	T	rs142809999		TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr5:127680141G>T	ENST00000508053.1	-	31	4253	c.3279C>A	c.(3277-3279)atC>atA	p.I1093I	FBN2_ENST00000262464.4_Silent_p.I1093I|FBN2_ENST00000508989.1_Silent_p.I1060I			P35556	FBN2_HUMAN	fibrillin 2	1093	EGF-like 15; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.		I -> T (in DA9). {ECO:0000269|PubMed:11754102, ECO:0000269|PubMed:9714438}.		anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		TGAAGCTTCCGATTGTATTTC	0.423																																					p.I1093I		Atlas-SNP	.											.	FBN2	858	.	0			c.C3279A						.						137.0	131.0	133.0					5																	127680141		2203	4300	6503	SO:0001819	synonymous_variant	2201	exon25			GCTTCCGATTGTA	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.3279C>A	chr5.hg19:g.127680141G>T		122.0	0.0		74.0	17.0	NM_001999	B4DU01|Q59ES6	Silent	SNP	ENST00000508053.1	hg19	CCDS34222.1																																																																																			.	G|1.000;A|0.000		0.423	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
RIPK1	8737	hgsc.bcm.edu	37	6	3106166	3106166	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr6:3106166C>T	ENST00000259808.4	+	9	1755	c.1457C>T	c.(1456-1458)cCc>cTc	p.P486L	RIPK1_ENST00000479389.1_3'UTR|RIPK1_ENST00000380409.2_Missense_Mutation_p.P486L|RIPK1_ENST00000541791.1_Missense_Mutation_p.P440L			Q13546	RIPK1_HUMAN	receptor (TNFRSF)-interacting serine-threonine kinase 1	486	Interaction with SQSTM1.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|amyloid fibril formation (GO:1990000)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular protein catabolic process (GO:0044257)|cellular response to growth factor stimulus (GO:0071363)|cellular response to tumor necrosis factor (GO:0071356)|extrinsic apoptotic signaling pathway (GO:0097191)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic process (GO:0070266)|necroptotic signaling pathway (GO:0097527)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|peptidyl-serine autophosphorylation (GO:0036289)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of necroptotic process (GO:0060545)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon production (GO:0032481)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of ATP:ADP antiporter activity (GO:0070926)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to tumor necrosis factor (GO:0034612)|ripoptosome assembly (GO:0097343)|ripoptosome assembly involved in necroptotic process (GO:1901026)|T cell apoptotic process (GO:0070231)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)|ripoptosome (GO:0097342)	ATP binding (GO:0005524)|death domain binding (GO:0070513)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|protein complex binding (GO:0032403)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	23	Ovarian(93;0.0386)	all_hematologic(90;0.0895)				ACAGCAGGTCCCAGAGTTTGG	0.473																																					p.P486L		Atlas-SNP	.											.	RIPK1	56	.	0			c.C1457T						.						97.0	76.0	83.0					6																	3106166		2203	4300	6503	SO:0001583	missense	8737	exon8			CAGGTCCCAGAGT	U25994	CCDS4482.1	6p25.2	2008-02-05			ENSG00000137275	ENSG00000137275			10019	protein-coding gene	gene with protein product		603453				7538908, 8612133	Standard	XM_005249458		Approved	RIP	uc003mux.3	Q13546	OTTHUMG00000014134	ENST00000259808.4:c.1457C>T	chr6.hg19:g.3106166C>T	ENSP00000259808:p.Pro486Leu	204.0	0.0		254.0	109.0	NM_003804	A0AV89|B2RAG1|B4E3F9|Q13180|Q59H33	Missense_Mutation	SNP	ENST00000259808.4	hg19	CCDS4482.1	.	.	.	.	.	.	.	.	.	.	C	12.32	1.902407	0.33628	.	.	ENSG00000137275	ENST00000259808;ENST00000541791;ENST00000380409;ENST00000453483	T;T;T	0.75704	-0.96;-0.45;-0.96	5.55	3.71	0.42584	.	0.726894	0.13977	N	0.349794	T	0.46776	0.1410	L	0.50333	1.59	0.09310	N	1	P;P	0.37276	0.589;0.544	B;B	0.30855	0.121;0.107	T	0.31081	-0.9956	10	0.42905	T	0.14	0.4965	8.4232	0.32714	0.1513:0.7674:0.0:0.0813	.	440;486	Q13546-2;Q13546	.;RIPK1_HUMAN	L	486;440;486;88	ENSP00000259808:P486L;ENSP00000442294:P440L;ENSP00000369773:P486L	ENSP00000259808:P486L	P	+	2	0	RIPK1	3051165	0.000000	0.05858	0.002000	0.10522	0.159000	0.22180	0.675000	0.25232	1.307000	0.44944	0.655000	0.94253	CCC	.	.		0.473	RIPK1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039659.2	NM_003804	
LGSN	51557	hgsc.bcm.edu	37	6	64004842	64004842	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr6:64004842C>T	ENST00000370657.4	-	2	172	c.139G>A	c.(139-141)Gaa>Aaa	p.E47K	LGSN_ENST00000370658.5_Missense_Mutation_p.E47K			Q5TDP6	LGSN_HUMAN	lengsin, lens protein with glutamine synthetase domain	47					glutamine biosynthetic process (GO:0006542)	plasma membrane (GO:0005886)	glutamate-ammonia ligase activity (GO:0004356)			NS(1)|endometrium(2)|large_intestine(5)|lung(16)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						ATATCCGTTTCTCCCACTTCA	0.388																																					p.E47K		Atlas-SNP	.											.	LGSN	82	.	0			c.G139A						.						255.0	227.0	237.0					6																	64004842		2203	4300	6503	SO:0001583	missense	51557	exon2			CCGTTTCTCCCAC	AF242388	CCDS4964.1, CCDS55027.1	6q12	2013-09-19	2008-09-19	2008-09-19	ENSG00000146166	ENSG00000146166			21016	protein-coding gene	gene with protein product		611470	"""glutamate-ammonia ligase (glutamine synthetase) domain containing 1"""	GLULD1		12107412	Standard	NM_016571		Approved	LGS	uc003peh.3	Q5TDP6	OTTHUMG00000014946	ENST00000370657.4:c.139G>A	chr6.hg19:g.64004842C>T	ENSP00000359691:p.Glu47Lys	128.0	0.0		129.0	49.0	NM_016571	A1L421|Q0PVN9|Q0PVP0|Q9NYJ0	Missense_Mutation	SNP	ENST00000370657.4	hg19	CCDS4964.1	.	.	.	.	.	.	.	.	.	.	C	14.29	2.492673	0.44352	.	.	ENSG00000146166	ENST00000370658;ENST00000370657	T;T	0.31510	1.49;1.56	4.71	3.83	0.44106	.	0.373619	0.29900	N	0.010917	T	0.34716	0.0907	M	0.61703	1.905	0.34360	D	0.690862	P;P;D	0.63880	0.873;0.939;0.993	P;P;D	0.72625	0.543;0.584;0.978	T	0.18085	-1.0348	10	0.42905	T	0.14	-18.9088	6.6755	0.23092	0.0:0.8171:0.0:0.1829	.	47;47;47	Q5TDP6-3;Q5TDP6-2;Q5TDP6	.;.;LGSN_HUMAN	K	47	ENSP00000359692:E47K;ENSP00000359691:E47K	ENSP00000359691:E47K	E	-	1	0	LGSN	64062801	0.855000	0.29742	0.893000	0.35052	0.225000	0.24961	1.226000	0.32563	2.325000	0.78763	0.591000	0.81541	GAA	.	.		0.388	LGSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041076.2	NM_016571	
MYO6	4646	hgsc.bcm.edu	37	6	76527267	76527267	+	Start_Codon_SNP	SNP	G	G	A			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr6:76527267G>A	ENST00000369977.3	+	2	142	c.3G>A	c.(1-3)atG>atA	p.M1I	MYO6_ENST00000369981.3_Start_Codon_SNP_p.M1I|MYO6_ENST00000369975.1_Start_Codon_SNP_p.M1I|MYO6_ENST00000369985.4_Start_Codon_SNP_p.M1I	NM_004999.3	NP_004990.3	Q9UM54	MYO6_HUMAN	myosin VI	1					actin filament-based movement (GO:0030048)|auditory receptor cell differentiation (GO:0042491)|cellular response to electrical stimulus (GO:0071257)|dendrite development (GO:0016358)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|endocytosis (GO:0006897)|glutamate secretion (GO:0014047)|inner ear morphogenesis (GO:0042472)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein targeting (GO:0006605)|regulation of secretion (GO:0051046)|regulation of synaptic plasticity (GO:0048167)|response to drug (GO:0042493)|sensory perception of sound (GO:0007605)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell cortex (GO:0005938)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microvillus (GO:0005902)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|unconventional myosin complex (GO:0016461)|vesicle membrane (GO:0012506)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|minus-end directed microfilament motor activity (GO:0060001)|motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(16)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	58		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		CTTCAAAAATGGAGGATGGAA	0.433																																					p.M1I		Atlas-SNP	.											.	MYO6	124	.	0			c.G3A						.						73.0	69.0	70.0					6																	76527267		2203	4300	6503	SO:0001582	initiator_codon_variant	4646	exon2			AAAAATGGAGGAT	U90236, AB002387	CCDS34487.1, CCDS75481.1	6q14.1	2014-09-17	2004-05-19		ENSG00000196586	ENSG00000196586		"""Myosins / Myosin superfamily : Class VI"""	7605	protein-coding gene	gene with protein product		600970	"""deafness, autosomal recessive 37"""	DFNA22, DFNB37		9259267, 11468689	Standard	XM_005248719		Approved	KIAA0389	uc003pih.1	Q9UM54	OTTHUMG00000015061	ENST00000369977.3:c.3G>A	chr6.hg19:g.76527267G>A	ENSP00000358994:p.Met1Ile	94.0	0.0		97.0	47.0	NM_004999	A6H8V4|E1P540|Q5TEM5|Q5TEM6|Q5TEM7|Q9BZZ7|Q9UEG2	Missense_Mutation	SNP	ENST00000369977.3	hg19	CCDS34487.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.980050	0.92982	.	.	ENSG00000196586	ENST00000428345;ENST00000369981;ENST00000369985;ENST00000369977;ENST00000369975	D;D;D;D	0.88586	-2.37;-2.4;-2.39;-2.39	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	D	0.90359	0.6983	.	.	.	0.80722	D	1	P;P	0.50528	0.936;0.656	P;P	0.51777	0.596;0.679	D	0.89421	0.3710	9	0.46703	T	0.11	.	19.6379	0.95744	0.0:0.0:1.0:0.0	.	1;1	Q9UM54-2;Q9UM54-1	.;.	I	1	ENSP00000358998:M1I;ENSP00000359002:M1I;ENSP00000358994:M1I;ENSP00000358992:M1I	ENSP00000358992:M1I	M	+	3	0	MYO6	76583987	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	9.304000	0.96190	2.812000	0.96745	0.555000	0.69702	ATG	.	.		0.433	MYO6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041279.2	NM_004999	Missense_Mutation
GPR63	81491	hgsc.bcm.edu	37	6	97246394	97246394	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr6:97246394C>T	ENST00000229955.3	-	2	1559	c.1214G>A	c.(1213-1215)cGt>cAt	p.R405H	GPR63_ENST00000417980.1_Missense_Mutation_p.R405H|RP3-417O22.3_ENST00000442184.1_RNA	NM_001143957.2|NM_030784.3	NP_001137429.1|NP_110411.1	Q9BZJ6	GPR63_HUMAN	G protein-coupled receptor 63	405						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			kidney(1)|large_intestine(5)|lung(13)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(76;6.89e-05)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.0618)|Colorectal(196;0.0721)		BRCA - Breast invasive adenocarcinoma(108;0.0912)		AGCACTAGGACGTATCCGTCG	0.463																																					p.R405H		Atlas-SNP	.											.	GPR63	60	.	0			c.G1214A						.						145.0	119.0	128.0					6																	97246394		2203	4300	6503	SO:0001583	missense	81491	exon2			CTAGGACGTATCC	AF317654	CCDS5036.1	6q16.1-q16.3	2012-08-21			ENSG00000112218	ENSG00000112218		"""GPCR / Class A : Orphans"""	13302	protein-coding gene	gene with protein product		606915					Standard	NM_030784		Approved	PSP24(beta), PSP24B	uc003pou.3	Q9BZJ6	OTTHUMG00000015245	ENST00000229955.3:c.1214G>A	chr6.hg19:g.97246394C>T	ENSP00000229955:p.Arg405His	159.0	0.0		163.0	69.0	NM_030784	Q9UJH3	Missense_Mutation	SNP	ENST00000229955.3	hg19	CCDS5036.1	.	.	.	.	.	.	.	.	.	.	C	14.77	2.633995	0.47049	.	.	ENSG00000112218	ENST00000536583;ENST00000417980;ENST00000229955;ENST00000369268	T;T;T	0.61510	0.1;0.1;0.1	5.35	5.35	0.76521	.	0.071658	0.64402	D	0.000016	T	0.36138	0.0956	L	0.42245	1.32	0.58432	D	0.999999	D	0.53151	0.958	B	0.36845	0.234	T	0.25916	-1.0118	10	0.27082	T	0.32	-9.8128	19.4213	0.94723	0.0:1.0:0.0:0.0	.	405	Q9BZJ6	GPR63_HUMAN	H	429;405;405;405	ENSP00000393170:R405H;ENSP00000229955:R405H;ENSP00000358273:R405H	ENSP00000229955:R405H	R	-	2	0	GPR63	97353115	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	4.502000	0.60400	2.675000	0.91044	0.650000	0.86243	CGT	.	.		0.463	GPR63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041566.2		
GRIK2	2898	hgsc.bcm.edu	37	6	102134211	102134211	+	Missense_Mutation	SNP	C	C	A			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr6:102134211C>A	ENST00000421544.1	+	6	1424	c.934C>A	c.(934-936)Ctg>Atg	p.L312M	GRIK2_ENST00000318991.6_Missense_Mutation_p.L312M|GRIK2_ENST00000413795.1_Missense_Mutation_p.L312M|GRIK2_ENST00000369134.4_Missense_Mutation_p.L263M|GRIK2_ENST00000358361.3_Missense_Mutation_p.L312M|GRIK2_ENST00000369138.1_Missense_Mutation_p.L312M|GRIK2_ENST00000369137.3_Missense_Mutation_p.L312M	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	312					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	TTCAGGTTTGCTGGATGGATT	0.383																																					p.L312M		Atlas-SNP	.											.	GRIK2	487	.	0			c.C934A						.						90.0	91.0	91.0					6																	102134211		2203	4300	6503	SO:0001583	missense	2898	exon6			GGTTTGCTGGATG		CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	ENST00000421544.1:c.934C>A	chr6.hg19:g.102134211C>A	ENSP00000397026:p.Leu312Met	124.0	0.0		117.0	15.0	NM_021956	A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Missense_Mutation	SNP	ENST00000421544.1	hg19	CCDS5048.1	.	.	.	.	.	.	.	.	.	.	C	15.68	2.905806	0.52333	.	.	ENSG00000164418	ENST00000421544;ENST00000413795;ENST00000369138;ENST00000358361;ENST00000369137;ENST00000318991;ENST00000403289;ENST00000369134;ENST00000540076	D;D;D;T;D;D;D	0.83755	-1.76;-1.76;-1.76;2.0;-1.76;-1.76;-1.76	5.84	5.84	0.93424	Extracellular ligand-binding receptor (1);	0.000000	0.64402	D	0.000003	T	0.74612	0.3739	L	0.45352	1.415	0.44261	D	0.997119	B;B;B	0.21753	0.049;0.06;0.049	B;B;B	0.27380	0.047;0.079;0.047	T	0.69899	-0.5020	10	0.45353	T	0.12	.	20.1551	0.98106	0.0:1.0:0.0:0.0	.	312;312;312	Q13002-5;Q13002;Q13002-2	.;GRIK2_HUMAN;.	M	312;312;312;312;312;312;312;263;274	ENSP00000397026:L312M;ENSP00000405596:L312M;ENSP00000358134:L312M;ENSP00000351128:L312M;ENSP00000358133:L312M;ENSP00000313276:L312M;ENSP00000358130:L263M	ENSP00000313276:L312M	L	+	1	2	GRIK2	102240904	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.762000	0.55250	2.760000	0.94817	0.655000	0.94253	CTG	.	.		0.383	GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043718.1		
ARID1B	57492	hgsc.bcm.edu	37	6	157522371	157522371	+	Missense_Mutation	SNP	A	A	G			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr6:157522371A>G	ENST00000350026.5	+	17	4605	c.4604A>G	c.(4603-4605)aAt>aGt	p.N1535S	ARID1B_ENST00000346085.5_Missense_Mutation_p.N1548S|ARID1B_ENST00000275248.4_Missense_Mutation_p.N1530S|ARID1B_ENST00000367148.1_Missense_Mutation_p.N1588S	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	1535	Pro-rich.				chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		TCACTGCCAAATCACATCTCC	0.602																																					p.N1548S		Atlas-SNP	.											.	ARID1B	320	.	0			c.A4643G						.						135.0	131.0	133.0					6																	157522371		2203	4296	6499	SO:0001583	missense	57492	exon18			TGCCAAATCACAT	AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.4604A>G	chr6.hg19:g.157522371A>G	ENSP00000055163:p.Asn1535Ser	45.0	0.0		50.0	20.0	NM_020732	Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Missense_Mutation	SNP	ENST00000350026.5	hg19	CCDS5251.2	.	.	.	.	.	.	.	.	.	.	A	17.12	3.309092	0.60414	.	.	ENSG00000049618	ENST00000346085;ENST00000350026;ENST00000367148;ENST00000275248;ENST00000414678	T;T;T;T;T	0.02395	4.67;4.65;4.67;4.66;4.31	4.94	4.94	0.65067	.	0.000000	0.85682	D	0.000000	T	0.07638	0.0192	L	0.61218	1.895	0.58432	D	0.999998	D;D;D	0.71674	0.997;0.998;0.998	D;D;D	0.80764	0.985;0.994;0.994	T	0.07290	-1.0780	10	0.56958	D	0.05	.	14.9157	0.70795	1.0:0.0:0.0:0.0	.	1535;1548;1530	Q8NFD5;Q8NFD5-2;G3XAA0	ARI1B_HUMAN;.;.	S	1548;1535;1588;1530;1057	ENSP00000344546:N1548S;ENSP00000055163:N1535S;ENSP00000356116:N1588S;ENSP00000275248:N1530S;ENSP00000412835:N1057S	ENSP00000275248:N1530S	N	+	2	0	ARID1B	157564063	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.798000	0.91888	1.992000	0.58205	0.533000	0.62120	AAT	.	.		0.602	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000372723.1	NM_020732	
GPC2	221914	hgsc.bcm.edu	37	7	99769820	99769820	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr7:99769820C>T	ENST00000292377.2	-	6	1080	c.913G>A	c.(913-915)Gat>Aat	p.D305N	GPC2_ENST00000471050.1_5'UTR	NM_152742.1	NP_689955.1	Q8N158	GPC2_HUMAN	glypican 2	305					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|neuron differentiation (GO:0030182)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|smoothened signaling pathway (GO:0007224)	anchored component of membrane (GO:0031225)|endoplasmic reticulum (GO:0005783)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|pancreas(1)|skin(3)	18	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TGGAGCTTATCAGCCAGGATC	0.517																																					p.D305N		Atlas-SNP	.											.	GPC2	49	.	0			c.G913A						.						54.0	50.0	51.0					7																	99769820		2203	4300	6503	SO:0001583	missense	221914	exon6			GCTTATCAGCCAG	BX375153	CCDS5689.1	7q22.1	2007-02-16	2007-02-15		ENSG00000213420	ENSG00000213420		"""Proteoglycans / Cell Surface : Glypicans"""	4450	protein-coding gene	gene with protein product	"""glypican proteoglycan 2, cerebroglycan proteoglycan"""		"""glypican 2 (cerebroglycan)"""			8294498	Standard	NM_152742		Approved	cerebroglycan, FLJ38962, DKFZp547M109	uc003utv.3	Q8N158	OTTHUMG00000154894	ENST00000292377.2:c.913G>A	chr7.hg19:g.99769820C>T	ENSP00000292377:p.Asp305Asn	50.0	0.0		51.0	5.0	NM_152742	A4D2A7	Missense_Mutation	SNP	ENST00000292377.2	hg19	CCDS5689.1	.	.	.	.	.	.	.	.	.	.	C	19.30	3.801609	0.70682	.	.	ENSG00000213420	ENST00000292377	T	0.50813	0.73	5.1	4.22	0.49857	.	0.434050	0.25789	N	0.028290	T	0.37732	0.1014	L	0.49778	1.585	0.32594	N	0.526853	P	0.43231	0.801	B	0.37780	0.258	T	0.47381	-0.9122	10	0.16896	T	0.51	-18.9488	11.2782	0.49178	0.0:0.9096:0.0:0.0904	.	305	Q8N158	GPC2_HUMAN	N	305	ENSP00000292377:D305N	ENSP00000292377:D305N	D	-	1	0	GPC2	99607756	1.000000	0.71417	0.743000	0.31040	0.797000	0.45037	4.760000	0.62235	1.138000	0.42230	-0.350000	0.07774	GAT	.	.		0.517	GPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337556.1	NM_152742	
ATP6V0A4	50617	hgsc.bcm.edu	37	7	138394421	138394421	+	Missense_Mutation	SNP	G	G	C			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr7:138394421G>C	ENST00000310018.2	-	21	2659	c.2377C>G	c.(2377-2379)Ctt>Gtt	p.L793V	ATP6V0A4_ENST00000393054.1_Missense_Mutation_p.L793V|ATP6V0A4_ENST00000353492.4_Missense_Mutation_p.L793V	NM_020632.2|NM_130840.2	NP_065683.2|NP_570855.2	Q9HBG4	VPP4_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a4	793					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|excretion (GO:0007588)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|ossification (GO:0001503)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|regulation of pH (GO:0006885)|sensory perception of sound (GO:0007605)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	ATPase binding (GO:0051117)|hydrogen ion transmembrane transporter activity (GO:0015078)			NS(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(15)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36						ATGATCAGAAGGATGGCTACT	0.537																																					p.L793V		Atlas-SNP	.											.	ATP6V0A4	93	.	0			c.C2377G						.						178.0	174.0	175.0					7																	138394421		2203	4300	6503	SO:0001583	missense	50617	exon20			TCAGAAGGATGGC	AF245517	CCDS5849.1	7q34	2011-06-09	2006-01-20	2002-05-10	ENSG00000105929	ENSG00000105929		"""ATPases / V-type"""	866	protein-coding gene	gene with protein product		605239	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) non-catalytic accessory protein 1B"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 4"", ""ATPase, H+ transporting, lysosomal V0 subunit A4"""	ATP6N1B, ATP6N2, RTA1C		10577919, 10973252	Standard	XM_005250393		Approved	RDRTA2, VPP2, RTADR, a4, Vph1, Stv1	uc003vuf.3	Q9HBG4	OTTHUMG00000157122	ENST00000310018.2:c.2377C>G	chr7.hg19:g.138394421G>C	ENSP00000308122:p.Leu793Val	209.0	0.0		155.0	72.0	NM_130841	A4D1R4|A8KA80|Q32M47	Missense_Mutation	SNP	ENST00000310018.2	hg19	CCDS5849.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.158834	0.78226	.	.	ENSG00000105929	ENST00000310018;ENST00000393054;ENST00000353492	D;D;D	0.88741	-2.42;-2.42;-2.42	5.71	3.89	0.44902	.	0.000000	0.64402	D	0.000012	D	0.95987	0.8693	H	0.97291	3.975	0.58432	D	0.999996	D	0.89917	1.0	D	0.91635	0.999	D	0.95299	0.8402	10	0.87932	D	0	-24.0661	9.7684	0.40574	0.2128:0.0:0.7872:0.0	.	793	Q9HBG4	VPP4_HUMAN	V	793	ENSP00000308122:L793V;ENSP00000376774:L793V;ENSP00000253856:L793V	ENSP00000308122:L793V	L	-	1	0	ATP6V0A4	138044961	1.000000	0.71417	0.970000	0.41538	0.992000	0.81027	3.436000	0.52856	0.740000	0.32651	0.655000	0.94253	CTT	.	.		0.537	ATP6V0A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347514.1	NM_020632	
OR9A2	135924	hgsc.bcm.edu	37	7	142723964	142723964	+	Missense_Mutation	SNP	A	A	G			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr7:142723964A>G	ENST00000350513.2	-	1	318	c.256T>C	c.(256-258)Ttc>Ctc	p.F86L		NM_001001658.1	NP_001001658.1	Q8NGT5	OR9A2_HUMAN	olfactory receptor, family 9, subfamily A, member 2	86						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(3)|endometrium(4)|large_intestine(1)|lung(14)|skin(3)	25	Melanoma(164;0.059)					CATCCCAGGAAGAGCAATCCC	0.493																																					p.F86L		Atlas-SNP	.											.	OR9A2	52	.	0			c.T256C						.						101.0	95.0	97.0					7																	142723964		2203	4300	6503	SO:0001583	missense	135924	exon1			CCAGGAAGAGCAA		CCDS34767.1	7q34	2014-07-10			ENSG00000179468	ENSG00000179468		"""GPCR / Class A : Olfactory receptors"""	15093	protein-coding gene	gene with protein product							Standard	NM_001001658		Approved		uc003wcc.1	Q8NGT5	OTTHUMG00000158386	ENST00000350513.2:c.256T>C	chr7.hg19:g.142723964A>G	ENSP00000316518:p.Phe86Leu	160.0	0.0		101.0	24.0	NM_001001658	B9EH51|Q6IF71|Q8NGD9	Missense_Mutation	SNP	ENST00000350513.2	hg19	CCDS34767.1	.	.	.	.	.	.	.	.	.	.	A	0.904	-0.721380	0.03182	.	.	ENSG00000179468	ENST00000350513	T	0.01388	4.95	4.62	3.45	0.39498	GPCR, rhodopsin-like superfamily (1);	3.169520	0.01368	N	0.012462	T	0.01730	0.0055	N	0.24115	0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44862	-0.9300	10	0.33940	T	0.23	-8.7938	7.4943	0.27479	0.6535:0.0:0.0:0.3465	.	86	Q8NGT5	OR9A2_HUMAN	L	86	ENSP00000316518:F86L	ENSP00000316518:F86L	F	-	1	0	OR9A2	142434086	0.004000	0.15560	0.615000	0.29064	0.199000	0.23934	0.952000	0.29149	0.877000	0.35895	0.459000	0.35465	TTC	.	.		0.493	OR9A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350862.1		
XPO7	23039	hgsc.bcm.edu	37	8	21827677	21827677	+	Silent	SNP	T	T	C			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr8:21827677T>C	ENST00000252512.9	+	4	382	c.282T>C	c.(280-282)ctT>ctC	p.L94L	XPO7_ENST00000434536.1_Silent_p.L94L|XPO7_ENST00000433566.4_Silent_p.L95L|XPO7_ENST00000518017.1_3'UTR	NM_015024.4	NP_055839.3	Q9UIA9	XPO7_HUMAN	exportin 7	94	Importin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00115}.				mRNA transport (GO:0051028)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	nuclear export signal receptor activity (GO:0005049)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				Colorectal(74;0.0187)|COAD - Colon adenocarcinoma(73;0.0724)		TCAACTACCTTGCCACTCGGC	0.408																																					p.L94L		Atlas-SNP	.											.	XPO7	79	.	0			c.T282C						.						198.0	192.0	194.0					8																	21827677		1865	4105	5970	SO:0001819	synonymous_variant	23039	exon4			CTACCTTGCCACT	AF064729	CCDS47818.1	8p21	2011-04-13	2003-03-11	2003-03-14	ENSG00000130227	ENSG00000130227		"""Exportins"""	14108	protein-coding gene	gene with protein product		606140	"""RAN binding protein 16"""	RANBP16		11024021, 9872452	Standard	NM_015024		Approved	KIAA0745	uc003xaa.4	Q9UIA9	OTTHUMG00000163789	ENST00000252512.9:c.282T>C	chr8.hg19:g.21827677T>C		86.0	0.0		52.0	12.0	NM_015024	O94846|Q6PJK9|Q8NEK7	Silent	SNP	ENST00000252512.9	hg19	CCDS47818.1	.	.	.	.	.	.	.	.	.	.	T	10.51	1.369361	0.24771	.	.	ENSG00000130227	ENST00000521303	T	0.76186	-1.0	5.55	4.32	0.51571	.	0.068550	0.64402	D	0.000011	T	0.78104	0.4231	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.79790	-0.1655	7	0.87932	D	0	-12.214	7.401	0.26965	0.1269:0.0:0.2475:0.6256	.	.	.	.	S	99	ENSP00000429290:L99S	ENSP00000429290:L99S	L	+	2	0	XPO7	21883623	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.272000	0.43373	2.239000	0.73571	0.482000	0.46254	TTG	.	.		0.408	XPO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375494.1	NM_015024	
KCNU1	157855	hgsc.bcm.edu	37	8	36675256	36675256	+	Missense_Mutation	SNP	A	A	G			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr8:36675256A>G	ENST00000399881.3	+	10	1121	c.1084A>G	c.(1084-1086)Act>Gct	p.T362A		NM_001031836.2	NP_001027006.2	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	362	RCK N-terminal.				multicellular organism reproduction (GO:0032504)|potassium ion transmembrane transport (GO:0071805)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	large conductance calcium-activated potassium channel activity (GO:0060072)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(31)|ovary(1)|urinary_tract(1)	57				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		AGAGATCAACACTGAAATTGT	0.388																																					p.T362A		Atlas-SNP	.											.	KCNU1	359	.	0			c.A1084G						.						150.0	137.0	141.0					8																	36675256		1876	4096	5972	SO:0001583	missense	157855	exon10			ATCAACACTGAAA	BC028701	CCDS55220.1	8p11.2	2012-07-05				ENSG00000215262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18867	protein-coding gene	gene with protein product		615215				16382103	Standard	NM_001031836		Approved	KCa5.1, Slo3, KCNMC1, Kcnma3	uc010lvw.3	A8MYU2		ENST00000399881.3:c.1084A>G	chr8.hg19:g.36675256A>G	ENSP00000382770:p.Thr362Ala	115.0	0.0		59.0	25.0	NM_001031836		Missense_Mutation	SNP	ENST00000399881.3	hg19	CCDS55220.1	.	.	.	.	.	.	.	.	.	.	A	9.583	1.124099	0.20959	.	.	ENSG00000215262	ENST00000399881	T	0.31247	1.5	5.31	2.72	0.32119	.	0.460878	0.15185	U	0.275862	T	0.22166	0.0534	L	0.47716	1.5	0.27653	N	0.947325	P	0.39282	0.666	B	0.31869	0.137	T	0.16660	-1.0395	10	0.87932	D	0	-2.0603	6.6891	0.23161	0.6897:0.1584:0.0:0.1519	.	362	A8MYU2	KCNU1_HUMAN	A	362	ENSP00000382770:T362A	ENSP00000382770:T362A	T	+	1	0	KCNU1	36794414	0.996000	0.38824	0.010000	0.14722	0.154000	0.21943	3.854000	0.55949	0.931000	0.37242	0.533000	0.62120	ACT	.	.		0.388	KCNU1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376631.1	NM_001031836	
CRISPLD1	83690	hgsc.bcm.edu	37	8	75929298	75929298	+	Missense_Mutation	SNP	G	G	T			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr8:75929298G>T	ENST00000262207.4	+	9	1414	c.946G>T	c.(946-948)Ggc>Tgc	p.G316C	CRISPLD1_ENST00000517786.1_Missense_Mutation_p.G130C|CRISPLD1_ENST00000523524.1_Missense_Mutation_p.G128C	NM_031461.5	NP_113649.1	Q9H336	CRLD1_HUMAN	cysteine-rich secretory protein LCCL domain containing 1	316	LCCL 1. {ECO:0000255|PROSITE- ProRule:PRU00123}.				face morphogenesis (GO:0060325)	extracellular vesicular exosome (GO:0070062)				biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)			ATGTCCTGCTGGCTGTTTGGA	0.274																																					p.G316C		Atlas-SNP	.											CRISPLD1,NS,carcinoma,0,1	CRISPLD1	94	.	0			c.G946T						.						88.0	92.0	91.0					8																	75929298		2203	4297	6500	SO:0001583	missense	83690	exon9			CCTGCTGGCTGTT	AL834301	CCDS6219.1, CCDS69497.1, CCDS75754.1	8q21.13	2005-09-23	2005-02-16	2005-02-16	ENSG00000121005	ENSG00000121005			18206	protein-coding gene	gene with protein product			"""LCCL domain containing cysteine-rich secretory protein 1"""	LCRISP1			Standard	NM_031461		Approved	Cocoacrisp, DKFZp762F133	uc003yan.3	Q9H336	OTTHUMG00000164529	ENST00000262207.4:c.946G>T	chr8.hg19:g.75929298G>T	ENSP00000262207:p.Gly316Cys	214.0	0.0		158.0	23.0	NM_031461	B2RA60|B7Z929	Missense_Mutation	SNP	ENST00000262207.4	hg19	CCDS6219.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.497223	0.85069	.	.	ENSG00000121005	ENST00000262207;ENST00000523524;ENST00000517786	D;D;D	0.90197	-2.63;-2.63;-2.63	5.12	5.12	0.69794	LCCL (5);	0.000000	0.85682	D	0.000000	D	0.96852	0.8972	H	0.94306	3.52	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97512	1.0067	10	0.87932	D	0	.	19.116	0.93340	0.0:0.0:1.0:0.0	.	130;316	B7Z929;Q9H336	.;CRLD1_HUMAN	C	316;128;130	ENSP00000262207:G316C;ENSP00000430105:G128C;ENSP00000429746:G130C	ENSP00000262207:G316C	G	+	1	0	CRISPLD1	76091853	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.237000	0.78164	2.821000	0.97095	0.650000	0.86243	GGC	.	.		0.274	CRISPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379117.1	NM_031461	
RUNX1T1	862	hgsc.bcm.edu	37	8	93023242	93023242	+	Silent	SNP	G	G	T			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr8:93023242G>T	ENST00000523629.1	-	5	1000	c.546C>A	c.(544-546)atC>atA	p.I182I	RUNX1T1_ENST00000520724.1_Silent_p.I145I|RUNX1T1_ENST00000521553.1_Silent_p.I145I|RUNX1T1_ENST00000518844.1_Silent_p.I155I|RUNX1T1_ENST00000360348.2_Silent_p.I145I|RUNX1T1_ENST00000436581.2_Silent_p.I193I|RUNX1T1_ENST00000422361.2_Silent_p.I145I|RUNX1T1_ENST00000396218.1_Silent_p.I155I|RUNX1T1_ENST00000265814.3_Silent_p.I182I	NM_001198626.1|NM_001198630.1|NM_001198633.1|NM_175634.2	NP_001185555.1|NP_001185559.1|NP_001185562.1|NP_783552.1	Q06455	MTG8_HUMAN	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)	182	TAFH. {ECO:0000255|PROSITE- ProRule:PRU00440}.				fat cell differentiation (GO:0045444)|generation of precursor metabolites and energy (GO:0006091)|regulation of DNA binding (GO:0051101)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(54)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	86			BRCA - Breast invasive adenocarcinoma(11;0.0141)			TCAAAAATGGGATGACAAAAG	0.358																																					p.I241I		Atlas-SNP	.											.	RUNX1T1	516	.	0			c.C723A						.						142.0	136.0	138.0					8																	93023242		2203	4300	6503	SO:0001819	synonymous_variant	862	exon5			AAATGGGATGACA	D43638	CCDS6256.1, CCDS6257.1, CCDS47891.1, CCDS56544.1, CCDS75766.1, CCDS75767.1	8q22	2007-01-29	2005-01-20	2005-01-22	ENSG00000079102	ENSG00000079102		"""Zinc fingers, MYND-type"""	1535	protein-coding gene	gene with protein product		133435	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related"""	AML1T1, CBFA2T1		1391946, 9790752	Standard	NM_004349		Approved	CDR, ETO, MTG8, ZMYND2	uc011lgi.2	Q06455	OTTHUMG00000164066	ENST00000523629.1:c.546C>A	chr8.hg19:g.93023242G>T		102.0	0.0		76.0	35.0	NM_001198679	B7Z4P4|E7EPN4|O14784|Q06456|Q14873|Q16239|Q16346|Q16347|Q6IBL1|Q6NXH1|Q7Z4J5|Q92479|Q9BRZ0	Silent	SNP	ENST00000523629.1	hg19	CCDS6256.1																																																																																			.	.		0.358	RUNX1T1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377045.3	NM_004349, NM_175635	
TRAPPC9	83696	hgsc.bcm.edu	37	8	141294100	141294100	+	Missense_Mutation	SNP	C	C	T	rs147687394		TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr8:141294100C>T	ENST00000438773.2	-	14	2135	c.2002G>A	c.(2002-2004)Ggt>Agt	p.G668S	TRAPPC9_ENST00000389327.3_Missense_Mutation_p.G659S|TRAPPC9_ENST00000389328.4_Missense_Mutation_p.G766S	NM_001160372.1	NP_001153844.1	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9	668					cell differentiation (GO:0030154)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)				breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	47						CTGAACACACCGAAGACCGTG	0.522																																					p.G766S		Atlas-SNP	.											.	TRAPPC9	114	.	0			c.G2296A						.	C	SER/GLY,SER/GLY	0,4406		0,0,2203	126.0	115.0	119.0		2002,2296	4.8	0.2	8	dbSNP_134	119	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	TRAPPC9	NM_001160372.1,NM_031466.5	56,56	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	668/1149,766/1247	141294100	1,13005	2203	4300	6503	SO:0001583	missense	83696	exon14			ACACACCGAAGAC	BC006206	CCDS34946.1, CCDS55278.1	8q24.3	2010-10-22			ENSG00000167632	ENSG00000167632		"""Trafficking protein particle complex"""	30832	protein-coding gene	gene with protein product	"""TRAPP 120 kDa subunit"", ""tularik gene 1"""	611966				11572484	Standard	NM_031466		Approved	IKBKBBP, NIBP, KIAA1882, T1, TRS120, MRT13	uc003yvh.2	Q96Q05	OTTHUMG00000164187	ENST00000438773.2:c.2002G>A	chr8.hg19:g.141294100C>T	ENSP00000405060:p.Gly668Ser	102.0	0.0		73.0	10.0	NM_031466	Q4VTT3|Q658K7|Q6P149|Q6ZQT3|Q7L5C4|Q86Y21|Q96SL2|Q9BQA2	Missense_Mutation	SNP	ENST00000438773.2	hg19	CCDS55278.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.82|18.82	3.704744|3.704744	0.68615|0.68615	0.0|0.0	1.16E-4|1.16E-4	ENSG00000167632|ENSG00000167632	ENST00000389328;ENST00000389327;ENST00000438773|ENST00000520857	.|.	.|.	.|.	5.64|5.64	4.77|4.77	0.60923|0.60923	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.68137|0.68137	0.2968|0.2968	L|L	0.56199|0.56199	1.76|1.76	0.58432|0.58432	D|D	0.999999|0.999999	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.97110|.	1.0;1.0;1.0;1.0|.	T|T	0.66536|0.66536	-0.5899|-0.5899	9|5	0.42905|.	T|.	0.14|.	.|.	14.6364|14.6364	0.68692|0.68692	0.0:0.9302:0.0:0.0698|0.0:0.9302:0.0:0.0698	.|.	766;668;659;766|.	A6NIF0;Q96Q05;Q96Q05-3;Q96Q05-2|.	.;TPPC9_HUMAN;.;.|.	S|Q	766;659;668|511	.|.	ENSP00000373978:G659S|.	G|R	-|-	1|2	0|0	TRAPPC9|TRAPPC9	141363282|141363282	1.000000|1.000000	0.71417|0.71417	0.156000|0.156000	0.22583|0.22583	0.107000|0.107000	0.19398|0.19398	6.960000|6.960000	0.76036|0.76036	1.390000|1.390000	0.46547|0.46547	0.655000|0.655000	0.94253|0.94253	GGT|CGG	.	C|1.000;T|0.000		0.522	TRAPPC9-002	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377749.1	NM_031466	
TOPORS	10210	hgsc.bcm.edu	37	9	32550784	32550784	+	Silent	SNP	C	C	T			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr9:32550784C>T	ENST00000360538.2	-	2	302	c.186G>A	c.(184-186)ccG>ccA	p.P62P	TOPORS-AS1_ENST00000450093.1_RNA|TOPORS_ENST00000379858.1_Intron|TOPORS-AS1_ENST00000540066.1_RNA|TOPORS-AS1_ENST00000453396.1_RNA|TOPORS-AS1_ENST00000458036.1_RNA|TOPORS-AS1_ENST00000425533.1_RNA	NM_005802.4	NP_005793.2	Q9NS56	TOPRS_HUMAN	topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase	62	E3 ubiquitin-protein ligase activity.|Required for DNA-binding.				cellular response to DNA damage stimulus (GO:0006974)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of apoptotic process (GO:0043066)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein localization to nucleus (GO:0034504)|protein monoubiquitination (GO:0006513)|protein sumoylation (GO:0016925)|regulation of cell proliferation (GO:0042127)|retina layer formation (GO:0010842)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|gamma-tubulin complex (GO:0000930)|midbody (GO:0030496)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|PML body (GO:0016605)|spindle pole (GO:0000922)|ubiquitin ligase complex (GO:0000151)	antigen binding (GO:0003823)|DNA binding (GO:0003677)|DNA topoisomerase binding (GO:0044547)|SUMO ligase activity (GO:0019789)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.0018)		CGGAGGATGCCGGCGCAGGCC	0.716																																					p.P62P		Atlas-SNP	.											.	TOPORS	127	.	0			c.G186A						.						22.0	27.0	25.0					9																	32550784		2188	4264	6452	SO:0001819	synonymous_variant	10210	exon2			GGATGCCGGCGCA	AF098300	CCDS6527.1, CCDS56566.1	9p21	2013-01-09	2010-09-17		ENSG00000197579	ENSG00000197579		"""RING-type (C3HC4) zinc fingers"""	21653	protein-coding gene	gene with protein product		609507	"""retinitis pigmentosa 31 (autosomal dominant)"", ""topoisomerase I binding, arginine/serine-rich"""	RP31		10352183, 12083797, 17924349	Standard	NM_005802		Approved	TP53BPL, LUN	uc003zrb.3	Q9NS56	OTTHUMG00000019743	ENST00000360538.2:c.186G>A	chr9.hg19:g.32550784C>T		195.0	0.0		245.0	95.0	NM_005802	O43273|Q6P987|Q9NS55|Q9UNR9	Silent	SNP	ENST00000360538.2	hg19	CCDS6527.1																																																																																			.	.		0.716	TOPORS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052007.1	NM_005802	
FAM69B	138311	hgsc.bcm.edu	37	9	139617859	139617859	+	Missense_Mutation	SNP	A	A	G			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr9:139617859A>G	ENST00000371692.4	+	5	1025	c.929A>G	c.(928-930)gAc>gGc	p.D310G	FAM69B_ENST00000371691.1_Missense_Mutation_p.D223G|SNHG7_ENST00000362567.2_RNA|SNHG7_ENST00000414282.1_RNA|SNHG7_ENST00000416970.1_RNA|SNHG7_ENST00000436596.1_RNA|SNHG7_ENST00000447221.1_RNA	NM_152421.3	NP_689634.2	Q5VUD6	FA69B_HUMAN	family with sequence similarity 69, member B	310						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				NS(1)|endometrium(3)|large_intestine(2)|lung(1)|prostate(1)	8	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;1.03e-05)|Epithelial(140;0.00013)		GCCACCTACGACTTCAAGATG	0.647																																					p.D310G		Atlas-SNP	.											.	FAM69B	22	.	0			c.A929G						.						39.0	39.0	39.0					9																	139617859		2203	4300	6503	SO:0001583	missense	138311	exon5			CCTACGACTTCAA		CCDS7004.1	9q34.3	2012-08-03			ENSG00000165716	ENSG00000165716			28290	protein-coding gene	gene with protein product		614543				21334309	Standard	NM_152421		Approved	MGC20262, C9orf136	uc004cik.3	Q5VUD6	OTTHUMG00000020940	ENST00000371692.4:c.929A>G	chr9.hg19:g.139617859A>G	ENSP00000360757:p.Asp310Gly	131.0	0.0		91.0	22.0	NM_152421	Q5VUD7|Q8N5N0|Q8WYU5	Missense_Mutation	SNP	ENST00000371692.4	hg19	CCDS7004.1	.	.	.	.	.	.	.	.	.	.	A	28.5	4.926912	0.92319	.	.	ENSG00000165716	ENST00000371692;ENST00000371691	T;T	0.47177	0.86;0.85	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.67411	0.2890	M	0.75615	2.305	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.67511	-0.5652	10	0.36615	T	0.2	-53.2084	14.3785	0.66895	1.0:0.0:0.0:0.0	.	310	Q5VUD6	FA69B_HUMAN	G	310;223	ENSP00000360757:D310G;ENSP00000360756:D223G	ENSP00000360756:D223G	D	+	2	0	FAM69B	138737680	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.480000	0.73604	1.992000	0.58205	0.459000	0.35465	GAC	.	.		0.647	FAM69B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055102.1	NM_152421	
RASSF4	83937	hgsc.bcm.edu	37	10	45478109	45478109	+	Silent	SNP	T	T	A			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr10:45478109T>A	ENST00000340258.5	+	4	392	c.279T>A	c.(277-279)ccT>ccA	p.P93P	RASSF4_ENST00000374417.2_Silent_p.P93P|RASSF4_ENST00000334940.6_Silent_p.P75P|RASSF4_ENST00000472561.1_3'UTR	NM_032023.3	NP_114412.2	Q8WYP3	RIN2_HUMAN	Ras association (RalGDS/AF-6) domain family member 4	629					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			NS(1)|endometrium(2)|large_intestine(6)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16						CTAGCTGCCCTCTGTGAGTAC	0.662																																					p.P93P		Atlas-SNP	.											.	RASSF4	33	.	0			c.T279A						.						65.0	61.0	63.0					10																	45478109		2203	4300	6503	SO:0001819	synonymous_variant	83937	exon4			CTGCCCTCTGTGA	BC032593	CCDS7208.1	10q11.1	2008-02-22	2008-02-22		ENSG00000107551	ENSG00000107551			20793	protein-coding gene	gene with protein product		610559					Standard	NM_032023		Approved	AD037, MGC44914	uc001jbo.3	Q9H2L5	OTTHUMG00000018060	ENST00000340258.5:c.279T>A	chr10.hg19:g.45478109T>A		99.0	0.0		81.0	31.0	NM_032023	Q00425|Q5TFT8|Q9BQL3|Q9H071	Silent	SNP	ENST00000340258.5	hg19	CCDS7208.1																																																																																			.	.		0.662	RASSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047745.2	NM_032023	
ANK3	288	hgsc.bcm.edu	37	10	61833020	61833020	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr10:61833020G>A	ENST00000280772.2	-	37	7810	c.7619C>T	c.(7618-7620)aCa>aTa	p.T2540I	ANK3_ENST00000373827.2_Intron|ANK3_ENST00000355288.2_Intron|ANK3_ENST00000503366.1_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	2540					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						GTGCAACACTGTCACTTTATC	0.383																																					p.T2540I		Atlas-SNP	.											.	ANK3	703	.	0			c.C7619T						.						151.0	145.0	147.0					10																	61833020		2203	4300	6503	SO:0001583	missense	288	exon37			AACACTGTCACTT	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.7619C>T	chr10.hg19:g.61833020G>A	ENSP00000280772:p.Thr2540Ile	127.0	0.0		111.0	46.0	NM_020987	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	ENST00000280772.2	hg19	CCDS7258.1	.	.	.	.	.	.	.	.	.	.	G	11.99	1.803204	0.31869	.	.	ENSG00000151150	ENST00000280772	T	0.70282	-0.47	5.47	5.47	0.80525	.	0.000000	0.43416	D	0.000573	T	0.74275	0.3695	L	0.58101	1.795	0.80722	D	1	D	0.53619	0.961	P	0.47206	0.541	T	0.76737	-0.2849	10	0.54805	T	0.06	.	19.3349	0.94312	0.0:0.0:1.0:0.0	.	2540	Q12955	ANK3_HUMAN	I	2540	ENSP00000280772:T2540I	ENSP00000280772:T2540I	T	-	2	0	ANK3	61503026	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.852000	0.86927	2.564000	0.86499	0.462000	0.41574	ACA	.	.		0.383	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
TET1	80312	hgsc.bcm.edu	37	10	70450720	70450720	+	Missense_Mutation	SNP	A	A	G			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr10:70450720A>G	ENST00000373644.4	+	12	5769	c.5560A>G	c.(5560-5562)Act>Gct	p.T1854A		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	1854					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						GTCCCCGAAGACTGCTTCAGC	0.512																																					p.T1854A		Atlas-SNP	.											TET1_ENST00000373644,NS,carcinoma,0,1	TET1	255	.	0			c.A5560G						.						83.0	79.0	80.0					10																	70450720		2203	4300	6503	SO:0001583	missense	80312	exon12			CCGAAGACTGCTT	AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.5560A>G	chr10.hg19:g.70450720A>G	ENSP00000362748:p.Thr1854Ala	88.0	1.0		82.0	31.0	NM_030625	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Missense_Mutation	SNP	ENST00000373644.4	hg19	CCDS7281.1	.	.	.	.	.	.	.	.	.	.	A	4.708	0.131658	0.08981	.	.	ENSG00000138336	ENST00000373644	T	0.06142	3.34	5.48	0.382	0.16234	Methylcytosine dioxygenase TET, double-stranded beta helix fold domain (1);	17.798000	0.00166	N	0.000003	T	0.05135	0.0137	L	0.32530	0.975	0.09310	N	1	B	0.14805	0.011	B	0.10450	0.005	T	0.38457	-0.9660	10	0.19590	T	0.45	.	0.3069	0.00282	0.2961:0.2297:0.2566:0.2175	.	1854	Q8NFU7	TET1_HUMAN	A	1854	ENSP00000362748:T1854A	ENSP00000362748:T1854A	T	+	1	0	TET1	70120726	0.000000	0.05858	0.001000	0.08648	0.205000	0.24178	-0.170000	0.09897	0.393000	0.25203	0.533000	0.62120	ACT	.	.		0.512	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048354.1	NM_030625	
TCERG1L	256536	hgsc.bcm.edu	37	10	133058601	133058601	+	Silent	SNP	C	C	T			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr10:133058601C>T	ENST00000368642.4	-	4	862	c.777G>A	c.(775-777)ccG>ccA	p.P259P		NM_174937.3	NP_777597.2	Q5VWI1	TCRGL_HUMAN	transcription elongation regulator 1-like	259										cervix(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	31		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)		TGGAGGGGGACGGGCCCCGGA	0.687																																					p.P259P		Atlas-SNP	.											TCERG1L,caecum,carcinoma,0,1	TCERG1L	91	.	0			c.G777A						.						21.0	25.0	24.0					10																	133058601		2203	4299	6502	SO:0001819	synonymous_variant	256536	exon4			GGGGGACGGGCCC	AK096269	CCDS7662.2	10q26.3	2006-04-12			ENSG00000176769	ENSG00000176769			23533	protein-coding gene	gene with protein product							Standard	NM_174937		Approved	FLJ38950	uc001lkp.3	Q5VWI1	OTTHUMG00000019276	ENST00000368642.4:c.777G>A	chr10.hg19:g.133058601C>T		29.0	0.0		37.0	13.0	NM_174937	Q5VWI2|Q86XM8	Silent	SNP	ENST00000368642.4	hg19	CCDS7662.2																																																																																			.	.		0.687	TCERG1L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091619.2	NM_174937	
KNDC1	85442	hgsc.bcm.edu	37	10	134999499	134999499	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr10:134999499G>A	ENST00000304613.3	+	6	668	c.647G>A	c.(646-648)cGg>cAg	p.R216Q	KNDC1_ENST00000368572.2_Missense_Mutation_p.R216Q|KNDC1_ENST00000368571.2_Missense_Mutation_p.R151Q			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	216	KIND 1. {ECO:0000255|PROSITE- ProRule:PRU00709}.				cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		AGCAGCTGGCGGGAGAGACCT	0.716																																					p.R216Q		Atlas-SNP	.											.	KNDC1	155	.	0			c.G647A						.						8.0	10.0	9.0					10																	134999499		2141	4216	6357	SO:0001583	missense	85442	exon6			GCTGGCGGGAGAG	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.647G>A	chr10.hg19:g.134999499G>A	ENSP00000304437:p.Arg216Gln	37.0	0.0		67.0	15.0	NM_152643	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Missense_Mutation	SNP	ENST00000304613.3	hg19	CCDS7674.1	.	.	.	.	.	.	.	.	.	.	G	17.25	3.341647	0.61073	.	.	ENSG00000171798	ENST00000304613;ENST00000368572;ENST00000368571	T;T;T	0.20069	2.61;2.61;2.1	4.05	1.06	0.20224	KIND (2);	0.464800	0.20582	U	0.089515	T	0.18173	0.0436	L	0.51422	1.61	0.09310	N	1	D;P	0.57899	0.981;0.804	B;B	0.43103	0.408;0.085	T	0.12400	-1.0549	10	0.66056	D	0.02	.	6.8841	0.24189	0.3198:0.0:0.6802:0.0	.	151;216	Q76NI1-2;Q76NI1	.;VKIND_HUMAN	Q	216;216;151	ENSP00000304437:R216Q;ENSP00000357561:R216Q;ENSP00000357560:R151Q	ENSP00000304437:R216Q	R	+	2	0	KNDC1	134849489	0.838000	0.29461	0.003000	0.11579	0.016000	0.09150	0.295000	0.19065	0.111000	0.17947	0.538000	0.68166	CGG	.	.		0.716	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	NM_152643	
VENTX	27287	hgsc.bcm.edu	37	10	135053718	135053718	+	Missense_Mutation	SNP	C	C	G			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr10:135053718C>G	ENST00000325980.9	+	3	1196	c.685C>G	c.(685-687)Ccc>Gcc	p.P229A		NM_014468.3	NP_055283.1	O95231	VENTX_HUMAN	VENT homeobox	229					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			NS(1)|endometrium(1)|large_intestine(1)|lung(9)|soft_tissue(1)|upper_aerodigestive_tract(1)	14		all_cancers(35;4.15e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;7.8e-06)|Epithelial(32;9.31e-06)|all cancers(32;1.19e-05)		GGCGTCCCACCCCCCTACCCC	0.692																																					p.P229A		Atlas-SNP	.											.	VENTX	24	.	0			c.C685G						.						10.0	12.0	11.0					10																	135053718		2165	4240	6405	SO:0001583	missense	27287	exon3			TCCCACCCCCCTA	AF068006	CCDS7675.1	10q26.3	2011-06-20	2011-06-01	2005-09-27	ENSG00000151650	ENSG00000151650		"""Homeoboxes / ANTP class : NKL subclass"""	13639	protein-coding gene	gene with protein product		607158	"""VENT-like homeobox 2"", ""VENT homeobox homolog (Xenopus laevis)"""	VENTX2		10790436	Standard	NM_014468		Approved	HPX42B	uc010quy.1	O95231	OTTHUMG00000019307	ENST00000325980.9:c.685C>G	chr10.hg19:g.135053718C>G	ENSP00000357556:p.Pro229Ala	37.0	0.0		40.0	18.0	NM_014468	Q32MZ3	Missense_Mutation	SNP	ENST00000325980.9	hg19	CCDS7675.1	.	.	.	.	.	.	.	.	.	.	C	4.490	0.090850	0.08632	.	.	ENSG00000151650	ENST00000325980	D	0.91521	-2.86	2.12	0.0629	0.14346	.	0.876510	0.09573	U	0.783967	T	0.76004	0.3927	N	0.14661	0.345	0.09310	N	1	B	0.21225	0.053	B	0.17722	0.019	T	0.61148	-0.7121	10	0.07482	T	0.82	.	2.8706	0.05616	0.0:0.4989:0.3017:0.1994	.	229	O95231	VENTX_HUMAN	A	229	ENSP00000357556:P229A	ENSP00000357556:P229A	P	+	1	0	VENTX	134903708	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.720000	0.25896	0.013000	0.14918	-0.556000	0.04195	CCC	.	.		0.692	VENTX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051116.4	NM_014468	
PIK3C2A	5286	hgsc.bcm.edu	37	11	17153463	17153463	+	Splice_Site	SNP	A	A	G			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr11:17153463A>G	ENST00000265970.7	-	11	2230	c.2231T>C	c.(2230-2232)cTa>cCa	p.L744P	PIK3C2A_ENST00000531428.1_Intron|PIK3C2A_ENST00000540361.1_Splice_Site_p.L364P	NM_002645.2	NP_002636.2	O00443	P3C2A_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha	744	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00041, ECO:0000255|PROSITE- ProRule:PRU00880}.				clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|exocytosis (GO:0006887)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|small molecule metabolic process (GO:0044281)|vascular smooth muscle contraction (GO:0014829)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol binding (GO:0035091)			central_nervous_system(4)|endometrium(5)|kidney(5)|large_intestine(7)|lung(24)|ovary(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	58						TTTCACTTACAGTTCATCCCA	0.313																																					p.L744P		Atlas-SNP	.											.	PIK3C2A	148	.	0			c.T2231C						.						105.0	116.0	112.0					11																	17153463		2200	4288	6488	SO:0001630	splice_region_variant	5286	exon11			ACTTACAGTTCAT	Y13367	CCDS7824.1	11p15.5-p14	2012-07-13	2012-07-13			ENSG00000011405	2.7.1.154		8971	protein-coding gene	gene with protein product		603601	"""phosphoinositide-3-kinase, class 2, alpha polypeptide"""			9337861	Standard	NM_002645		Approved	PI3K-C2alpha	uc001mmq.4	O00443		ENST00000265970.7:c.2231+1T>C	chr11.hg19:g.17153463A>G		174.0	0.0		215.0	41.0	NM_002645	B0LPH2|B4E2G4|Q14CQ9	Missense_Mutation	SNP	ENST00000265970.7	hg19	CCDS7824.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.091985	0.76756	.	.	ENSG00000011405	ENST00000265970;ENST00000540361	T;T	0.78003	-1.14;-1.14	5.81	5.81	0.92471	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);Phosphoinositide 3-kinase, C2 (2);	0.000000	0.85682	D	0.000000	D	0.85864	0.5796	L	0.57536	1.79	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85282	0.1062	9	.	.	.	-8.7055	16.1652	0.81750	1.0:0.0:0.0:0.0	.	744	O00443	P3C2A_HUMAN	P	744;364	ENSP00000265970:L744P;ENSP00000438687:L364P	.	L	-	2	0	PIK3C2A	17110039	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	8.962000	0.93254	2.230000	0.72887	0.528000	0.53228	CTA	.	.		0.313	PIK3C2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387553.1	NM_002645	Missense_Mutation
NAV2	89797	hgsc.bcm.edu	37	11	20057523	20057523	+	Silent	SNP	C	C	A	rs199691877		TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr11:20057523C>A	ENST00000396087.3	+	13	2955	c.2856C>A	c.(2854-2856)tcC>tcA	p.S952S	NAV2_ENST00000533917.1_Silent_p.S15S|NAV2_ENST00000396085.1_Silent_p.S929S|NAV2_ENST00000540292.1_Silent_p.S883S|NAV2_ENST00000349880.4_Silent_p.S929S|NAV2_ENST00000360655.4_Silent_p.S865S|NAV2_ENST00000527559.2_Silent_p.S881S|NAV2_ENST00000311043.8_Silent_p.S15S	NM_001244963.1	NP_001231892.1	Q8IVL1	NAV2_HUMAN	neuron navigator 2	952					glossopharyngeal nerve development (GO:0021563)|locomotory behavior (GO:0007626)|optic nerve development (GO:0021554)|regulation of systemic arterial blood pressure by baroreceptor feedback (GO:0003025)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|vagus nerve development (GO:0021564)	interstitial matrix (GO:0005614)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|heparin binding (GO:0008201)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(26)|lung(38)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	116						ACAGCAGCTCCGTCAGCAGCG	0.547																																					p.S952S		Atlas-SNP	.											.	NAV2	255	.	0			c.C2856A						.						212.0	133.0	160.0					11																	20057523		2203	4300	6503	SO:0001819	synonymous_variant	89797	exon13			CAGCTCCGTCAGC	AB037840	CCDS7850.1, CCDS7851.2, CCDS44552.1, CCDS53612.1, CCDS58126.1	11p15.1	2008-07-18			ENSG00000166833	ENSG00000166833	3.6.1.1		15997	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 2"", ""retinoic acid inducible gene in neuroblastoma 1"", ""helicase, APC down-regulated 1"""	607026				12079279, 12062803	Standard	NM_145117		Approved	FLJ10633, FLJ11030, HELAD1, KIAA1419, POMFIL2, RAINB1, FLJ23707	uc010rdm.2	Q8IVL1	OTTHUMG00000151837	ENST00000396087.3:c.2856C>A	chr11.hg19:g.20057523C>A		113.0	0.0		97.0	36.0	NM_001244963	A6NEC1|Q8IVK3|Q8IVK4|Q8IVK5|Q8IVK6|Q8IVK7|Q8IVK8|Q8NHC9|Q8NHD0|Q8TDE9|Q8TDF0|Q8TEB3|Q96B30|Q9NUZ6|Q9NVM7|Q9P2C8	Silent	SNP	ENST00000396087.3	hg19	CCDS58126.1																																																																																			.	C|1.000;T|0.000		0.547	NAV2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324112.1	NM_145117	
PIWIL4	143689	hgsc.bcm.edu	37	11	94354053	94354053	+	Missense_Mutation	SNP	T	T	G			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr11:94354053T>G	ENST00000299001.6	+	20	2665	c.2454T>G	c.(2452-2454)agT>agG	p.S818R	PIWIL4_ENST00000537419.1_Missense_Mutation_p.S169R|RP11-867G2.8_ENST00000537874.1_RNA|RP11-867G2.8_ENST00000536540.1_RNA	NM_152431.2	NP_689644.2	Q7Z3Z4	PIWL4_HUMAN	piwi-like RNA-mediated gene silencing 4	818	Piwi. {ECO:0000255|PROSITE- ProRule:PRU00150}.				cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|P granule (GO:0043186)|piP-body (GO:0071547)	piRNA binding (GO:0034584)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|urinary_tract(2)	30		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				GCATAGTCAGTGTCCCAGCAC	0.393																																					p.S818R		Atlas-SNP	.											.	PIWIL4	70	.	0			c.T2454G						.						66.0	60.0	62.0					11																	94354053		2201	4298	6499	SO:0001583	missense	143689	exon20			AGTCAGTGTCCCA	AB079366	CCDS31656.1	11q12	2013-02-15	2013-02-15			ENSG00000134627		"""Argonaute/PIWI family"""	18444	protein-coding gene	gene with protein product		610315	"""piwi-like 4 (Drosophila)"""			12906857	Standard	NM_152431		Approved	FLJ36156, HIWI2, Miwi2	uc001pfa.3	Q7Z3Z4		ENST00000299001.6:c.2454T>G	chr11.hg19:g.94354053T>G	ENSP00000299001:p.Ser818Arg	90.0	0.0		76.0	17.0	NM_152431	B4DEG5|Q68CZ4|Q8N8G9|Q8N9V8|Q8NEH2	Missense_Mutation	SNP	ENST00000299001.6	hg19	CCDS31656.1	.	.	.	.	.	.	.	.	.	.	T	3.613	-0.079140	0.07141	.	.	ENSG00000134627	ENST00000299001;ENST00000537419	T;T	0.33438	1.41;1.41	5.41	-4.71	0.03279	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	0.358550	0.26525	N	0.023890	T	0.05960	0.0155	N	0.02412	-0.56	0.29576	N	0.849507	B	0.06786	0.001	B	0.06405	0.002	T	0.30149	-0.9988	10	0.02654	T	1	-9.3505	1.0149	0.01505	0.2406:0.3289:0.2224:0.2081	.	818	Q7Z3Z4	PIWL4_HUMAN	R	818;169	ENSP00000299001:S818R;ENSP00000439710:S169R	ENSP00000299001:S818R	S	+	3	2	PIWIL4	93993701	0.829000	0.29322	0.399000	0.26333	0.955000	0.61496	-0.094000	0.11094	-0.480000	0.06803	0.454000	0.30748	AGT	.	.		0.393	PIWIL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396388.1	NM_152431	
GRIA4	2893	hgsc.bcm.edu	37	11	105795190	105795190	+	Silent	SNP	T	T	A			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr11:105795190T>A	ENST00000530497.1	+	11	1542	c.1542T>A	c.(1540-1542)tcT>tcA	p.S514S	GRIA4_ENST00000393127.2_Silent_p.S514S|GRIA4_ENST00000282499.5_Silent_p.S514S|GRIA4_ENST00000525187.1_Silent_p.S514S			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4	514					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		TTGACTTTTCTAAGCCCTTCA	0.413																																					p.S514S		Atlas-SNP	.											.	GRIA4	380	.	0			c.T1542A						.						139.0	137.0	137.0					11																	105795190		2202	4299	6501	SO:0001819	synonymous_variant	2893	exon12			CTTTTCTAAGCCC	U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.1542T>A	chr11.hg19:g.105795190T>A		104.0	0.0		100.0	20.0	NM_001077243	Q86XE8	Silent	SNP	ENST00000530497.1	hg19	CCDS8333.1																																																																																			.	.		0.413	GRIA4-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388593.1		
PCSK7	9159	hgsc.bcm.edu	37	11	117096683	117096683	+	Missense_Mutation	SNP	T	T	C			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr11:117096683T>C	ENST00000320934.3	-	6	1454	c.824A>G	c.(823-825)aAc>aGc	p.N275S	PCSK7_ENST00000540028.1_5'Flank	NM_004716.2	NP_004707.2	Q16549	PCSK7_HUMAN	proprotein convertase subtilisin/kexin type 7	275	Peptidase S8.				peptide hormone processing (GO:0016486)|protein processing (GO:0016485)	integral component of Golgi membrane (GO:0030173)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(3)|large_intestine(2)|lung(8)|ovary(1)|skin(1)	16	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.72e-06)|Epithelial(105;6.71e-05)|all cancers(92;0.000537)		ATAGTGCTTGTTGAACGCCAC	0.542			T	IGH@	MLCLS						OREG0021371	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.N275S		Atlas-SNP	.		Dom	yes		11	11q23.3	9159	proprotein convertase subtilisin/kexin type 7		L	.	PCSK7	59	.	0			c.A824G						.						149.0	108.0	122.0					11																	117096683		2201	4296	6497	SO:0001583	missense	9159	exon6			TGCTTGTTGAACG	U40623	CCDS8382.1	11q23-q24	2008-02-01			ENSG00000160613	ENSG00000160613			8748	protein-coding gene	gene with protein product		604872				8615762, 9820811	Standard	XM_006718938		Approved	PC7, PC8, LPC, SPC7	uc001pqr.3	Q16549	OTTHUMG00000165640	ENST00000320934.3:c.824A>G	chr11.hg19:g.117096683T>C	ENSP00000325917:p.Asn275Ser	54.0	0.0	1478	42.0	22.0	NM_004716	B0YJ60|Q3C1X1|Q53GM4|Q96FK8|Q9UL57	Missense_Mutation	SNP	ENST00000320934.3	hg19	CCDS8382.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.099839	0.76983	.	.	ENSG00000160613	ENST00000320934;ENST00000543900;ENST00000525027	T;D	0.87887	-1.37;-2.31	5.83	5.83	0.93111	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.000000	0.85682	D	0.000000	D	0.83608	0.5291	N	0.12663	0.25	0.80722	D	1	D	0.54397	0.966	P	0.57502	0.822	T	0.80616	-0.1303	10	0.10902	T	0.67	-39.2626	15.3821	0.74664	0.0:0.0:0.0:1.0	.	275	Q16549	PCSK7_HUMAN	S	275	ENSP00000325917:N275S;ENSP00000431181:N275S	ENSP00000325917:N275S	N	-	2	0	PCSK7	116601893	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.235000	0.73313	0.533000	0.62120	AAC	.	.		0.542	PCSK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385529.2	NM_004716	
CBL	867	hgsc.bcm.edu	37	11	119103248	119103248	+	Missense_Mutation	SNP	C	C	T	rs147438359		TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr11:119103248C>T	ENST00000264033.4	+	2	662	c.286C>T	c.(286-288)Cgt>Tgt	p.R96C		NM_005188.3	NP_005179.2	P22681	CBL_HUMAN	Cbl proto-oncogene, E3 ubiquitin protein ligase	96	4H.|Cbl-PTB. {ECO:0000255|PROSITE- ProRule:PRU00839}.|Sufficient for interaction with EPHB1.				cell surface receptor signaling pathway (GO:0007166)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|flotillin complex (GO:0016600)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ephrin receptor binding (GO:0046875)|ligase activity (GO:0016874)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SH3 domain binding (GO:0017124)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R96S(1)		breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(194)|kidney(3)|large_intestine(9)|lung(30)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	251		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.92e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.000784)		CCAGCATCTCCGTACTATCTT	0.428			"""T, Mis S, O"""	MLL	"""AML, JMML, MDS"""				Noonan syndrome;CBL gene-associated Juvenile Myelomonocytic Leukemia and Developmental Anomalies																												p.R96C		Atlas-SNP	.		"""Dom, Rec"""	yes		11	11q23.3	867	Cas-Br-M (murine) ecotropic retroviral transforming		L	.	CBL	408	.	1	Substitution - Missense(1)	lung(1)	c.C286T						.	C	CYS/ARG	0,4398		0,0,2199	96.0	92.0	93.0		286	5.9	1.0	11	dbSNP_134	93	1,8589	1.2+/-3.3	0,1,4294	no	missense	CBL	NM_005188.2	180	0,1,6493	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	96/907	119103248	1,12987	2199	4295	6494	SO:0001583	missense	867	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CBL-associated JMML	CATCTCCGTACTA	X57110	CCDS8418.1	11q23.3	2014-09-17	2012-02-23		ENSG00000110395	ENSG00000110395		"""RING-type (C3HC4) zinc fingers"""	1541	protein-coding gene	gene with protein product	"""oncogene CBL2"""	165360	"""Cas-Br-M (murine) ecotropic retroviral transforming sequence"""	CBL2		2013228	Standard	NM_005188		Approved	RNF55, c-Cbl	uc001pwe.4	P22681	OTTHUMG00000166170	ENST00000264033.4:c.286C>T	chr11.hg19:g.119103248C>T	ENSP00000264033:p.Arg96Cys	81.0	0.0		63.0	19.0	NM_005188	A3KMP8	Missense_Mutation	SNP	ENST00000264033.4	hg19	CCDS8418.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.154905	0.78114	0.0	1.16E-4	ENSG00000110395	ENST00000264033	T	0.79141	-1.24	5.91	5.91	0.95273	Adaptor protein Cbl, N-terminal helical (3);Adaptor protein Cbl, PTB domain (1);	0.094469	0.85682	D	0.000000	D	0.89238	0.6658	M	0.81497	2.545	0.80722	D	1	D	0.89917	1.0	D	0.74348	0.983	D	0.89541	0.3792	10	0.87932	D	0	-14.7254	20.2959	0.98551	0.0:1.0:0.0:0.0	.	96	P22681	CBL_HUMAN	C	96	ENSP00000264033:R96C	ENSP00000264033:R96C	R	+	1	0	CBL	118608458	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.893000	0.69798	2.793000	0.96121	0.655000	0.94253	CGT	.	C|1.000;T|0.000		0.428	CBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388219.4	NM_005188	
Unknown	0	hgsc.bcm.edu	37	11	124095563	124095563	+	IGR	SNP	T	T	G			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr11:124095563T>G								OR10D3 (38611 upstream) : OR8G1 (24859 downstream)																							GGTGGGCAACTTGAGCATGAT	0.502																																					p.L56V		Atlas-SNP	.											.	.	.	.	0			c.T166G						.						167.0	166.0	166.0					11																	124095563		2139	4282	6421	SO:0001628	intergenic_variant	26492	exon1			GGCAACTTGAGCA																													chr11.hg19:g.124095563T>G		96.0	0.0		85.0	15.0	NM_001007249		Missense_Mutation	SNP		hg19																																																																																				.	.	0	0.502								
CLEC6A	93978	hgsc.bcm.edu	37	12	8612254	8612254	+	Silent	SNP	T	T	C	rs142509792	byFrequency	TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr12:8612254T>C	ENST00000382073.3	+	3	369	c.183T>C	c.(181-183)caT>caC	p.H61H		NM_001007033.1	NP_001007034.1	Q6EIG7	CLC6A_HUMAN	C-type lectin domain family 6, member A	61					defense response to fungus (GO:0050832)|innate immune response (GO:0045087)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|large_intestine(2)|lung(7)	10	Lung SC(5;0.184)					ACTCATATCATTCAAGTCTCA	0.378																																					p.H61H		Atlas-SNP	.											.	CLEC6A	19	.	0			c.T183C						.						164.0	158.0	160.0					12																	8612254		2203	4300	6503	SO:0001819	synonymous_variant	93978	exon3			ATATCATTCAAGT	AY321309	CCDS31739.1	12p13	2005-09-21	2005-02-09	2005-02-11	ENSG00000205846	ENSG00000205846		"""C-type lectin domain containing"""	14556	protein-coding gene	gene with protein product		613579	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 10"""	CLECSF10			Standard	NM_001007033		Approved	dectin-2	uc001qum.1	Q6EIG7	OTTHUMG00000168672	ENST00000382073.3:c.183T>C	chr12.hg19:g.8612254T>C		81.0	0.0		101.0	37.0	NM_001007033	A2RUK3	Silent	SNP	ENST00000382073.3	hg19	CCDS31739.1																																																																																			.	T|0.999;A|0.001		0.378	CLEC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400562.1	NM_001007033	
CLEC4D	338339	hgsc.bcm.edu	37	12	8672896	8672896	+	Missense_Mutation	SNP	G	G	T			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr12:8672896G>T	ENST00000299665.2	+	5	652	c.459G>T	c.(457-459)caG>caT	p.Q153H		NM_080387.4	NP_525126.2	Q8WXI8	CLC4D_HUMAN	C-type lectin domain family 4, member D	153	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				innate immune response (GO:0045087)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			large_intestine(4)|lung(6)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	14	Lung SC(5;0.184)					CCAAAGGTCAGTGGCGTTGGG	0.398																																					p.Q153H		Atlas-SNP	.											.	CLEC4D	46	.	0			c.G459T						.						99.0	101.0	100.0					12																	8672896		2203	4300	6503	SO:0001583	missense	338339	exon5			AGGTCAGTGGCGT	AF411850	CCDS8593.1	12p13.31	2005-09-21	2005-02-09	2005-02-11		ENSG00000166527		"""C-type lectin domain containing"""	14554	protein-coding gene	gene with protein product		609964	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 8"""	CLECSF8			Standard	NM_080387		Approved	Mpcl	uc001qun.3	Q8WXI8		ENST00000299665.2:c.459G>T	chr12.hg19:g.8672896G>T	ENSP00000299665:p.Gln153His	111.0	0.0		102.0	14.0	NM_080387	Q8N5J5	Missense_Mutation	SNP	ENST00000299665.2	hg19	CCDS8593.1	.	.	.	.	.	.	.	.	.	.	G	14.22	2.471819	0.43942	.	.	ENSG00000166527	ENST00000299665	T	0.19669	2.13	4.67	0.623	0.17654	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	.	.	.	.	T	0.32315	0.0825	L	0.54965	1.715	0.32729	N	0.509203	D	0.76494	0.999	D	0.69824	0.966	T	0.39396	-0.9616	8	.	.	.	.	4.1055	0.10035	0.246:0.0:0.5879:0.1661	.	153	Q8WXI8	CLC4D_HUMAN	H	153	ENSP00000299665:Q153H	.	Q	+	3	2	CLEC4D	8564163	0.975000	0.34042	0.959000	0.39883	0.694000	0.40290	0.328000	0.19681	-0.005000	0.14395	-0.195000	0.12781	CAG	.	.		0.398	CLEC4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400565.1	NM_080387	
ADAMTS20	80070	hgsc.bcm.edu	37	12	43846137	43846137	+	Silent	SNP	A	A	T			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr12:43846137A>T	ENST00000389420.3	-	14	2018	c.2019T>A	c.(2017-2019)gtT>gtA	p.V673V	ADAMTS20_ENST00000553158.1_Silent_p.V673V	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	673	Cys-rich.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		TACCATCTTCAACCATATCCT	0.353																																					p.V673V		Atlas-SNP	.											.	ADAMTS20	635	.	0			c.T2019A						.						90.0	85.0	87.0					12																	43846137		2203	4300	6503	SO:0001819	synonymous_variant	80070	exon14			ATCTTCAACCATA	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.2019T>A	chr12.hg19:g.43846137A>T		85.0	0.0		75.0	14.0	NM_025003	A6NNC9|J3QT00	Silent	SNP	ENST00000389420.3	hg19	CCDS31778.2																																																																																			.	.		0.353	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1	NM_025003	
HOXC11	3227	hgsc.bcm.edu	37	12	54367576	54367576	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr12:54367576C>T	ENST00000546378.1	+	1	667	c.551C>T	c.(550-552)cCc>cTc	p.P184L	HOTAIR_ENST00000424518.1_RNA|HOTAIR_ENST00000455246.1_RNA|HOXC11_ENST00000243082.4_Missense_Mutation_p.P184L			O43248	HXC11_HUMAN	homeobox C11	184					anterior/posterior pattern specification (GO:0009952)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal joint morphogenesis (GO:0060272)|endoderm development (GO:0007492)|metanephros development (GO:0001656)|organ induction (GO:0001759)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			large_intestine(1)|ovary(1)	2						CCCGAGGCACCCCCGGCCTCG	0.721			T	NUP98	AML																																p.P184L		Atlas-SNP	.		Dom	yes		12	12q13.3	3227	homeo box C11		L	.	HOXC11	32	.	0			c.C551T						.						7.0	10.0	9.0					12																	54367576		2088	4003	6091	SO:0001583	missense	3227	exon1			AGGCACCCCCGGC		CCDS8867.1	12q13.13	2011-06-20	2005-12-22		ENSG00000123388	ENSG00000123388		"""Homeoboxes / ANTP class : HOXL subclass"""	5123	protein-coding gene	gene with protein product		605559	"""homeo box C11"""	HOX3H		1973146, 1358459	Standard	NM_014212		Approved		uc001sem.3	O43248	OTTHUMG00000160011	ENST00000546378.1:c.551C>T	chr12.hg19:g.54367576C>T	ENSP00000446680:p.Pro184Leu	70.0	0.0		74.0	13.0	NM_014212	A8K7D1|Q96DH2	Missense_Mutation	SNP	ENST00000546378.1	hg19	CCDS8867.1	.	.	.	.	.	.	.	.	.	.	C	11.33	1.607536	0.28623	.	.	ENSG00000123388	ENST00000546378;ENST00000243082	D;T	0.91686	-2.89;1.92	4.21	4.21	0.49690	.	0.300114	0.36200	N	0.002732	D	0.83248	0.5213	N	0.08118	0	0.47123	D	0.999327	B	0.19935	0.04	B	0.22152	0.038	T	0.81274	-0.1007	10	0.72032	D	0.01	.	12.3754	0.55277	0.0:0.8284:0.1716:0.0	.	184	O43248	HXC11_HUMAN	L	184	ENSP00000446680:P184L;ENSP00000243082:P184L	ENSP00000243082:P184L	P	+	2	0	HOXC11	52653843	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	3.005000	0.49521	2.338000	0.79540	0.555000	0.69702	CCC	.	.		0.721	HOXC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358869.2		
SLC6A15	55117	hgsc.bcm.edu	37	12	85279232	85279232	+	Missense_Mutation	SNP	T	T	C			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr12:85279232T>C	ENST00000266682.5	-	4	1097	c.556A>G	c.(556-558)Aaa>Gaa	p.K186E	SLC6A15_ENST00000552192.1_Missense_Mutation_p.K79E|SLC6A15_ENST00000450363.3_Missense_Mutation_p.K186E|SLC6A15_ENST00000551388.1_Intron	NM_182767.5	NP_877499.1	Q9H2J7	S6A15_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 15	186					amino acid transport (GO:0006865)|ion transport (GO:0006811)|leucine transport (GO:0015820)|neurotransmitter transport (GO:0006836)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter transporter activity (GO:0005326)|neurotransmitter:sodium symporter activity (GO:0005328)|proline:sodium symporter activity (GO:0005298)			kidney(1)|large_intestine(18)|lung(15)|ovary(1)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	44						GAAGCATTTTTCACCAAAGGA	0.358																																					p.K186E		Atlas-SNP	.											.	SLC6A15	159	.	0			c.A556G						.						79.0	79.0	79.0					12																	85279232		2203	4300	6503	SO:0001583	missense	55117	exon4			CATTTTTCACCAA	AF265577	CCDS9026.1, CCDS9027.1, CCDS53816.1	12q21.31	2013-07-15	2008-09-02		ENSG00000072041	ENSG00000072041		"""Solute carriers"""	13621	protein-coding gene	gene with protein product	"""homolog of rat orphan transporter v7-3"", ""sodium/chloride dependent neurotransmitter transporter Homo sapiens orphan neurotransmitter transporter NTT7"""	607971	"""solute carrier family 6 (neurotransmitter transporter), member 15"""			10471414, 11112352, 16185194	Standard	NM_182767		Approved	hv7-3, NTT73, FLJ10316, V7-3, SBAT1	uc001szv.4	Q9H2J7	OTTHUMG00000169742	ENST00000266682.5:c.556A>G	chr12.hg19:g.85279232T>C	ENSP00000266682:p.Lys186Glu	234.0	0.0		214.0	86.0	NM_018057	A8K592|B7Z2P7|E7ESJ5|Q9H9F5	Missense_Mutation	SNP	ENST00000266682.5	hg19	CCDS9026.1	.	.	.	.	.	.	.	.	.	.	T	14.99	2.700914	0.48307	.	.	ENSG00000072041	ENST00000266682;ENST00000552192;ENST00000450363	T;T;T	0.74106	-0.81;-0.81;-0.81	5.02	5.02	0.67125	.	0.340418	0.28865	N	0.013897	T	0.70605	0.3243	L	0.36672	1.1	0.58432	D	0.999994	B;P	0.41188	0.051;0.741	B;P	0.45712	0.063;0.491	T	0.68424	-0.5412	10	0.27785	T	0.31	.	15.0856	0.72148	0.0:0.0:0.0:1.0	.	186;186	Q9H9F5;Q9H2J7	.;S6A15_HUMAN	E	186;79;186	ENSP00000266682:K186E;ENSP00000450145:K79E;ENSP00000390706:K186E	ENSP00000266682:K186E	K	-	1	0	SLC6A15	83803363	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.649000	0.83500	2.036000	0.60181	0.477000	0.44152	AAA	.	.		0.358	SLC6A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405678.1	NM_018057, NM_182767	
TBX3	6926	hgsc.bcm.edu	37	12	115109981	115109981	+	Missense_Mutation	SNP	T	T	A			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr12:115109981T>A	ENST00000257566.3	-	8	2286	c.1897A>T	c.(1897-1899)Acc>Tcc	p.T633S	TBX3_ENST00000349155.2_Missense_Mutation_p.T613S	NM_016569.3	NP_057653.3	O15119	TBX3_HUMAN	T-box 3	633	Transcription repression.				anterior/posterior axis specification, embryo (GO:0008595)|atrioventricular bundle cell differentiation (GO:0003167)|blood vessel development (GO:0001568)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cardiac muscle cell fate commitment (GO:0060923)|cell aging (GO:0007569)|cellular senescence (GO:0090398)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|female genitalia development (GO:0030540)|follicle-stimulating hormone secretion (GO:0046884)|forelimb morphogenesis (GO:0035136)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|limbic system development (GO:0021761)|luteinizing hormone secretion (GO:0032275)|male genitalia development (GO:0030539)|mammary gland development (GO:0030879)|mammary placode formation (GO:0060596)|mesoderm morphogenesis (GO:0048332)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ morphogenesis (GO:0009887)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sinoatrial node cell development (GO:0060931)|skeletal system development (GO:0001501)|specification of organ position (GO:0010159)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum morphogenesis (GO:0060412)	nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(1)|kidney(1)|large_intestine(6)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0574)		GGGCGCATGGTGTTCAGATTG	0.706																																					p.T633S		Atlas-SNP	.											.	TBX3	106	.	0			c.A1897T						.						10.0	9.0	9.0					12																	115109981		2162	4243	6405	SO:0001583	missense	6926	exon8			GCATGGTGTTCAG	BC025258	CCDS9175.1, CCDS9176.1	12q24.21	2013-09-05	2008-07-31		ENSG00000135111	ENSG00000135111		"""T-boxes"""	11602	protein-coding gene	gene with protein product		601621	"""ulnar mammary syndrome"""	UMS		8988164	Standard	NM_005996		Approved	TBX3-ISO, XHL	uc001tvt.1	O15119	OTTHUMG00000169586	ENST00000257566.3:c.1897A>T	chr12.hg19:g.115109981T>A	ENSP00000257566:p.Thr633Ser	49.0	0.0		46.0	26.0	NM_016569	Q8TB20|Q9UKF8	Missense_Mutation	SNP	ENST00000257566.3	hg19	CCDS9176.1	.	.	.	.	.	.	.	.	.	.	T	2.019	-0.425280	0.04701	.	.	ENSG00000135111	ENST00000349155;ENST00000257566;ENST00000361100	D;D	0.83591	-1.74;-1.7	3.08	1.86	0.25419	.	3.810000	0.00397	N	0.000046	T	0.56659	0.2000	N	0.01352	-0.895	0.20563	N	0.999882	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.62756	-0.6787	10	0.02654	T	1	.	5.2988	0.15766	0.2551:0.0:0.0:0.7449	.	613;633	O15119-2;O15119	.;TBX3_HUMAN	S	613;633;507	ENSP00000257567:T613S;ENSP00000257566:T633S	ENSP00000257566:T633S	T	-	1	0	TBX3	113594364	0.995000	0.38212	0.940000	0.37924	0.998000	0.95712	0.445000	0.21677	0.530000	0.28619	0.533000	0.62120	ACC	.	.		0.706	TBX3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404947.2	NM_016569, NM_005996	
MICU2	221154	hgsc.bcm.edu	37	13	22077105	22077105	+	Missense_Mutation	SNP	A	A	G			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr13:22077105A>G	ENST00000382374.4	-	9	958	c.893T>C	c.(892-894)aTt>aCt	p.I298T	MICU2_ENST00000479790.1_5'UTR	NM_152726.2	NP_689939.1	Q8IYU8	MICU2_HUMAN	mitochondrial calcium uptake 2	298	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				mitochondrial calcium ion transport (GO:0006851)|negative regulation of mitochondrial calcium ion concentration (GO:0051562)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)	calcium channel complex (GO:0034704)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|uniplex complex (GO:1990246)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)										TTTCCAATAAATATCTTTATT	0.318																																					p.I298T		Atlas-SNP	.											.	EFHA1	33	.	0			c.T893C						.						52.0	55.0	54.0					13																	22077105		2203	4294	6497	SO:0001583	missense	221154	exon9			CAATAAATATCTT	AK091907	CCDS9297.1	13q12.11	2013-03-13	2013-03-13	2013-03-13	ENSG00000165487	ENSG00000165487		"""EF-hand domain containing"""	31830	protein-coding gene	gene with protein product		610632	"""EF hand domain family A1"", ""EF-hand domain family, member A1"""	EFHA1		23409044	Standard	NM_152726		Approved		uc001uof.3	Q8IYU8	OTTHUMG00000067414	ENST00000382374.4:c.893T>C	chr13.hg19:g.22077105A>G	ENSP00000371811:p.Ile298Thr	84.0	0.0		62.0	40.0	NM_152726	Q8N0T6|Q8NAX8	Missense_Mutation	SNP	ENST00000382374.4	hg19	CCDS9297.1	.	.	.	.	.	.	.	.	.	.	A	8.365	0.834027	0.16820	.	.	ENSG00000165487	ENST00000382374	T	0.59772	0.24	5.88	5.88	0.94601	.	0.422460	0.28198	N	0.016227	T	0.47097	0.1427	L	0.47716	1.5	0.39831	D	0.972978	B	0.31125	0.309	B	0.19666	0.026	T	0.47636	-0.9102	10	0.09084	T	0.74	-25.923	16.2744	0.82636	1.0:0.0:0.0:0.0	.	298	Q8IYU8	EFHA1_HUMAN	T	298	ENSP00000371811:I298T	ENSP00000371811:I298T	I	-	2	0	EFHA1	20975105	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	3.166000	0.50785	2.237000	0.73441	0.482000	0.46254	ATT	.	.		0.318	MICU2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000144355.1	NM_152726	
NBEA	26960	hgsc.bcm.edu	37	13	36202217	36202217	+	Splice_Site	SNP	G	G	T			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr13:36202217G>T	ENST00000400445.3	+	49	7983		c.e49-1		NBEA_ENST00000310336.4_Splice_Site|NBEA_ENST00000379922.3_Splice_Site|NBEA_ENST00000540320.1_Splice_Site|NBEA_ENST00000379939.2_Splice_Site|NBEA_ENST00000537702.1_Splice_Site	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin						protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		ACTCATTTCAGGCCCTAGAAA	0.353																																					.		Atlas-SNP	.											.	NBEA	340	.	0			c.7450-1G>T						.						78.0	71.0	73.0					13																	36202217		1871	4114	5985	SO:0001630	splice_region_variant	26960	exon49			ATTTCAGGCCCTA	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.7450-1G>T	chr13.hg19:g.36202217G>T		113.0	0.0		57.0	18.0	NM_015678	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Splice_Site	SNP	ENST00000400445.3	hg19	CCDS45026.1	.	.	.	.	.	.	.	.	.	.	G	16.66	3.185898	0.57909	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336;ENST00000422518;ENST00000402346;ENST00000543274;ENST00000537702;ENST00000379922	.	.	.	5.6	5.6	0.85130	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.6287	0.95691	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NBEA	35100217	1.000000	0.71417	1.000000	0.80357	0.476000	0.33039	9.722000	0.98770	2.652000	0.90054	0.563000	0.77884	.	.	.		0.353	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	Intron
GPC6	10082	hgsc.bcm.edu	37	13	94680117	94680117	+	Silent	SNP	T	T	C			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr13:94680117T>C	ENST00000377047.4	+	4	1461	c.846T>C	c.(844-846)gcT>gcC	p.A282A	RNA5SP35_ENST00000391257.1_RNA	NM_005708.3	NP_005699.1	Q9Y625	GPC6_HUMAN	glypican 6	282					carbohydrate metabolic process (GO:0005975)|cell migration (GO:0016477)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	38	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)				CAAATCAGGCTGACCTCGACA	0.502																																					p.A282A		Atlas-SNP	.											.	GPC6	102	.	0			c.T846C						.						137.0	124.0	129.0					13																	94680117		2203	4300	6503	SO:0001819	synonymous_variant	10082	exon4			TCAGGCTGACCTC	AF111178	CCDS9469.1	13q32	2008-02-05			ENSG00000183098	ENSG00000183098		"""Proteoglycans / Cell Surface : Glypicans"""	4454	protein-coding gene	gene with protein product	"""glypican proteoglycan 6"""	604404				10329016	Standard	NM_005708		Approved		uc001vlt.3	Q9Y625	OTTHUMG00000017205	ENST00000377047.4:c.846T>C	chr13.hg19:g.94680117T>C		85.0	0.0		178.0	12.0	NM_005708	A8K279|Q96SG5|Q96SG8|Q9H1P4	Silent	SNP	ENST00000377047.4	hg19	CCDS9469.1																																																																																			.	.		0.502	GPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045460.4	NM_005708	
TPP2	7174	hgsc.bcm.edu	37	13	103328668	103328668	+	Missense_Mutation	SNP	A	A	T			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr13:103328668A>T	ENST00000376065.4	+	28	3599	c.3563A>T	c.(3562-3564)cAt>cTt	p.H1188L	TPP2_ENST00000376052.3_Missense_Mutation_p.H1201L|TPP2_ENST00000466153.1_3'UTR	NM_003291.2	NP_003282.2	P29144	TPP2_HUMAN	tripeptidyl peptidase II	1188					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|tripeptidyl-peptidase activity (GO:0008240)			breast(2)|endometrium(5)|kidney(2)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	52	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GCATATAAACATGCATTAGTA	0.264																																					p.H1188L		Atlas-SNP	.											.	TPP2	124	.	0			c.A3563T						.						53.0	51.0	52.0					13																	103328668		2197	4290	6487	SO:0001583	missense	7174	exon28			ATAAACATGCATT	M55169	CCDS9502.1	13q32-q33	2008-02-05			ENSG00000134900	ENSG00000134900	3.4.14.10		12016	protein-coding gene	gene with protein product		190470				1670990	Standard	NM_003291		Approved		uc001vpi.4	P29144	OTTHUMG00000017305	ENST00000376065.4:c.3563A>T	chr13.hg19:g.103328668A>T	ENSP00000365233:p.His1188Leu	312.0	0.0		673.0	451.0	NM_003291	Q5VZU8	Missense_Mutation	SNP	ENST00000376065.4	hg19	CCDS9502.1	.	.	.	.	.	.	.	.	.	.	A	24.9	4.577770	0.86645	.	.	ENSG00000134900	ENST00000376065;ENST00000376052	.	.	.	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.74245	0.3691	L	0.46157	1.445	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.75311	-0.3362	9	0.54805	T	0.06	.	16.146	0.81569	1.0:0.0:0.0:0.0	.	1188	P29144	TPP2_HUMAN	L	1188;1201	.	ENSP00000365220:H1201L	H	+	2	0	TPP2	102126669	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	8.572000	0.90756	2.216000	0.71823	0.460000	0.39030	CAT	.	.		0.264	TPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045683.2		
MCF2L	23263	hgsc.bcm.edu	37	13	113750685	113750685	+	Splice_Site	SNP	G	G	A			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr13:113750685G>A	ENST00000375608.3	+	29	3224	c.3166G>A	c.(3166-3168)Gtt>Att	p.V1056I	MCF2L_ENST00000397030.1_Splice_Site_p.V1059I|MCF2L_ENST00000535094.2_Splice_Site_p.V1026I|MCF2L_ENST00000375604.2_Splice_Site_p.V1083I|MCF2L_ENST00000434480.2_Splice_Site_p.V1032I|MCF2L_ENST00000442652.2_Splice_Site_p.V1056I|MCF2L_ENST00000421756.1_Splice_Site_p.V1030I|MCF2L_ENST00000423482.2_Splice_Site_p.V1024I|MCF2L_ENST00000375601.3_Splice_Site_p.V1030I			O15068	MCF2L_HUMAN	MCF.2 cell line derived transforming sequence-like	1056	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular space (GO:0005615)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			kidney(1)|large_intestine(5)|ovary(1)|stomach(1)	8	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0368)|all_epithelial(44;0.0396)|Lung NSC(25;0.129)|Breast(118;0.188)				CTCCCACCAGGTTCCAGGTAA	0.716																																					p.V1026I		Atlas-SNP	.											.	MCF2L	182	.	0			c.G3076A						.						19.0	24.0	23.0					13																	113750685		1551	3557	5108	SO:0001630	splice_region_variant	23263	exon28			CACCAGGTTCCAG	AB002360	CCDS9527.2, CCDS45070.1, CCDS9527.3, CCDS45070.2	13q34	2013-01-10			ENSG00000126217	ENSG00000126217		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14576	protein-coding gene	gene with protein product		609499				9205841	Standard	NM_001112732		Approved	KIAA0362, DBS, OST, ARHGEF14	uc010tjr.2	O15068	OTTHUMG00000017377	ENST00000375608.3:c.3166-1G>A	chr13.hg19:g.113750685G>A		107.0	0.0		190.0	18.0	NM_001112732	A2A2X1|A2A2X2|A2A3G6|A2A3G8|B4DHD6|B4DIL6|E9PDN8|Q5JU56|Q5VXT1|Q6ZWD4|Q765G8|Q765G9|Q8N679	Missense_Mutation	SNP	ENST00000375608.3	hg19		.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	15.87|15.87|15.87	2.959717|2.959717|2.959717	0.53400|0.53400|0.53400	.|.|.	.|.|.	ENSG00000126217|ENSG00000126217|ENSG00000126217	ENST00000397017;ENST00000453297|ENST00000375608;ENST00000442652;ENST00000375604;ENST00000397030;ENST00000535094;ENST00000421756;ENST00000375601;ENST00000434480;ENST00000423482;ENST00000440749|ENST00000413354;ENST00000261963;ENST00000420013	.|T;T;T;T;T;T;T;T;T|.	.|0.37915|.	.|1.24;1.24;1.17;1.29;1.19;1.29;1.18;1.24;1.19|.	5.01|5.01|5.01	5.01|5.01|5.01	0.66863|0.66863|0.66863	.|Src homology-3 domain (1);|.	.|0.403683|.	.|0.26812|.	.|N|.	.|0.022378|.	T|T|.	0.55816|0.55816|.	0.1944|0.1944|.	M|M|M	0.75264|0.75264|0.75264	2.295|2.295|2.295	0.28288|0.28288|0.28288	N|N|N	0.923699|0.923699|0.923699	.|B;B;B;B|.	.|0.31705|.	.|0.336;0.336;0.336;0.227|.	.|B;B;B;B|.	.|0.38225|.	.|0.205;0.138;0.268;0.065|.	T|T|.	0.56195|0.56195|.	-0.8019|-0.8019|.	5|10|.	.|0.31617|.	.|T|.	.|0.26|.	.|.|.	7.3465|7.3465|7.3465	0.26666|0.26666|0.26666	0.1886:0.0:0.8114:0.0|0.1886:0.0:0.8114:0.0|0.1886:0.0:0.8114:0.0	.|.|.	.|1024;1026;1083;1056|.	.|E9PDN8;O15068-9;G5E9A1;O15068|.	.|.;.;.;MCF2L_HUMAN|.	D|I|X	711;236|1056;1056;1083;1059;1026;1030;1030;1032;1024;867|308;196;97	.|ENSP00000364758:V1056I;ENSP00000401422:V1056I;ENSP00000364754:V1083I;ENSP00000380225:V1059I;ENSP00000440374:V1026I;ENSP00000397285:V1030I;ENSP00000364751:V1030I;ENSP00000407722:V1032I;ENSP00000405639:V1024I|.	.|ENSP00000364751:V1030I|.	G|V|W	+|+|+	2|1|3	0|0|0	MCF2L|MCF2L|MCF2L	112798686|112798686|112798686	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.552000|0.552000|0.552000	0.28243|0.28243|0.28243	0.045000|0.045000|0.045000	0.14185|0.14185|0.14185	1.564000|1.564000|1.564000	0.36375|0.36375|0.36375	2.330000|2.330000|2.330000	0.79161|0.79161|0.79161	0.563000|0.563000|0.563000	0.77884|0.77884|0.77884	GGT|GTT|TGG	.	.		0.716	MCF2L-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045849.4		Missense_Mutation
MYH7	4625	hgsc.bcm.edu	37	14	23894029	23894029	+	Missense_Mutation	SNP	C	C	G			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr14:23894029C>G	ENST00000355349.3	-	22	2790	c.2628G>C	c.(2626-2628)aaG>aaC	p.K876N		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	876					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		GGGACACCATCTTCTCCTCCA	0.587																																					p.K876N		Atlas-SNP	.											.	MYH7	349	.	0			c.G2628C						.						89.0	76.0	80.0					14																	23894029		2203	4300	6503	SO:0001583	missense	4625	exon22			CACCATCTTCTCC	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.2628G>C	chr14.hg19:g.23894029C>G	ENSP00000347507:p.Lys876Asn	73.0	0.0		79.0	19.0	NM_000257	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	ENST00000355349.3	hg19	CCDS9601.1	.	.	.	.	.	.	.	.	.	.	C	19.10	3.762397	0.69763	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.94576	-3.46	4.73	4.73	0.59995	.	.	.	.	.	D	0.97362	0.9137	M	0.89414	3.03	0.58432	D	0.999991	D	0.76494	0.999	D	0.87578	0.998	D	0.97504	1.0062	9	0.62326	D	0.03	.	13.6731	0.62438	0.0:0.9226:0.0:0.0774	.	876	P12883	MYH7_HUMAN	N	876	ENSP00000347507:K876N	ENSP00000347507:K876N	K	-	3	2	MYH7	22963869	0.999000	0.42202	1.000000	0.80357	0.986000	0.74619	0.609000	0.24238	2.612000	0.88384	0.655000	0.94253	AAG	.	.		0.587	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257	
SH3GL3	6457	hgsc.bcm.edu	37	15	84241337	84241337	+	Missense_Mutation	SNP	G	G	C			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr15:84241337G>C	ENST00000427482.2	+	5	658	c.352G>C	c.(352-354)Ggt>Cgt	p.G118R	SH3GL3_ENST00000535412.1_Missense_Mutation_p.G118R|SH3GL3_ENST00000324537.5_Missense_Mutation_p.G126R|SH3GL3_ENST00000434347.1_Missense_Mutation_p.G126R	NM_003027.3	NP_003018.3	Q99963	SH3G3_HUMAN	SH3-domain GRB2-like 3	118	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				central nervous system development (GO:0007417)|endocytosis (GO:0006897)|signal transduction (GO:0007165)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)			central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	30						GATAGAAGTTGGTGAATCCAT	0.328																																					p.G118R		Atlas-SNP	.											.	SH3GL3	91	.	0			c.G352C						.						116.0	104.0	108.0					15																	84241337		2203	4300	6503	SO:0001583	missense	6457	exon5			GAAGTTGGTGAAT	AF036271	CCDS10325.2, CCDS73772.1	15q24	2006-11-24			ENSG00000140600	ENSG00000140600			10832	protein-coding gene	gene with protein product		603362				9169142	Standard	NR_026799		Approved	SH3D2C, SH3P13, CNSA3, EEN-B2, HsT19371	uc002bjw.3	Q99963	OTTHUMG00000147361	ENST00000427482.2:c.352G>C	chr15.hg19:g.84241337G>C	ENSP00000391372:p.Gly118Arg	74.0	0.0		77.0	24.0	NM_003027	O43553|O43554	Missense_Mutation	SNP	ENST00000427482.2	hg19	CCDS10325.2	.	.	.	.	.	.	.	.	.	.	G	35	5.542607	0.96474	.	.	ENSG00000140600	ENST00000427482;ENST00000535412;ENST00000324537;ENST00000434347	T;T;T;T	0.49720	0.77;0.77;0.77;0.77	5.13	5.13	0.70059	BAR (3);	0.051959	0.85682	D	0.000000	T	0.75309	0.3832	M	0.90595	3.13	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.997	T	0.81172	-0.1054	10	0.87932	D	0	-9.1028	17.9227	0.88972	0.0:0.0:1.0:0.0	.	118;118;126	Q8IVP1;Q99963;Q99963-3	.;SH3G3_HUMAN;.	R	118;118;126;126	ENSP00000391372:G118R;ENSP00000439239:G118R;ENSP00000320092:G126R;ENSP00000397871:G126R	ENSP00000320092:G126R	G	+	1	0	SH3GL3	82032341	1.000000	0.71417	0.755000	0.31263	0.991000	0.79684	7.374000	0.79633	2.550000	0.86006	0.585000	0.79938	GGT	.	.		0.328	SH3GL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347797.1	NM_003027	
CACNA1H	8912	hgsc.bcm.edu	37	16	1260417	1260417	+	Missense_Mutation	SNP	A	A	G			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr16:1260417A>G	ENST00000348261.5	+	19	4141	c.3893A>G	c.(3892-3894)cAc>cGc	p.H1298R	CACNA1H_ENST00000565831.1_Missense_Mutation_p.H1298R|CACNA1H_ENST00000358590.4_Missense_Mutation_p.H1298R	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	1298					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	ATGTTTGATCACGTGGTCCTC	0.632																																					p.H1298R		Atlas-SNP	.											.	CACNA1H	317	.	0			c.A3893G						.						39.0	39.0	39.0					16																	1260417		2169	4250	6419	SO:0001583	missense	8912	exon19			TTGATCACGTGGT	AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.3893A>G	chr16.hg19:g.1260417A>G	ENSP00000334198:p.His1298Arg	90.0	0.0		54.0	23.0	NM_021098	B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Missense_Mutation	SNP	ENST00000348261.5	hg19	CCDS45375.1	.	.	.	.	.	.	.	.	.	.	A	16.67	3.186414	0.57909	.	.	ENSG00000196557	ENST00000348261;ENST00000358590	D;D	0.97232	-4.3;-4.3	3.77	3.77	0.43336	.	0.000000	0.85682	D	0.000000	D	0.97216	0.9090	L	0.60455	1.87	0.42043	D	0.991084	P;P;P;B;D	0.62365	0.932;0.653;0.677;0.338;0.991	P;B;B;B;P	0.61397	0.888;0.414;0.097;0.132;0.874	D	0.97145	0.9827	10	0.54805	T	0.06	.	12.0946	0.53747	1.0:0.0:0.0:0.0	.	39;39;39;1298;1298	A2SX38;A2SX35;A2SX37;O95180-2;O95180	.;.;.;.;CAC1H_HUMAN	R	1298	ENSP00000334198:H1298R;ENSP00000351401:H1298R	ENSP00000334198:H1298R	H	+	2	0	CACNA1H	1200418	1.000000	0.71417	0.998000	0.56505	0.952000	0.60782	7.101000	0.76997	1.704000	0.51252	0.443000	0.29094	CAC	.	.		0.632	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000421601.1	NM_001005407	
MLST8	64223	hgsc.bcm.edu	37	16	2257035	2257035	+	Splice_Site	SNP	G	G	C			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr16:2257035G>C	ENST00000569417.1	+	5	698		c.e5-1		MLST8_ENST00000561651.1_Splice_Site|MLST8_ENST00000382450.4_Splice_Site|AC009065.3_ENST00000517149.1_RNA|MLST8_ENST00000301725.7_Splice_Site|MLST8_ENST00000397124.1_Splice_Site|MLST8_ENST00000565250.1_Splice_Site|MLST8_ENST00000301724.10_Splice_Site|MLST8_ENST00000564088.1_Splice_Site	NM_022372.4	NP_071767.3	Q9BVC4	LST8_HUMAN	MTOR associated protein, LST8 homolog (S. cerevisiae)						epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of TOR signaling (GO:0032008)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of Rac GTPase activity (GO:0032314)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|cytosol (GO:0005829)				large_intestine(3)|lung(2)|skin(1)	6						CCGGCCCGCAGGTCCCGGAAC	0.662																																					.		Atlas-SNP	.											.	MLST8	60	.	0			c.345-1G>C						.						43.0	48.0	46.0					16																	2257035		1948	4130	6078	SO:0001630	splice_region_variant	64223	exon5			CCCGCAGGTCCCG		CCDS10462.2, CCDS58409.1	16p13.3	2013-01-09			ENSG00000167965	ENSG00000167965		"""WD repeat domain containing"""	24825	protein-coding gene	gene with protein product	"""G protein beta subunit like"""	612190				12477932	Standard	NM_022372		Approved	Lst8, Pop3, GBL, GbetaL	uc002cpc.3	Q9BVC4	OTTHUMG00000128827	ENST00000569417.1:c.345-1G>C	chr16.hg19:g.2257035G>C		189.0	0.0		152.0	34.0	NM_022372	B3KMM4|B4DY00|D3DU88|Q5M800|Q86Y18|Q8WUI5|Q9HA66|Q9UJV6	Splice_Site	SNP	ENST00000569417.1	hg19	CCDS10462.2	.	.	.	.	.	.	.	.	.	.	G	17.34	3.365872	0.61513	.	.	ENSG00000167965	ENST00000382450;ENST00000301724;ENST00000397124;ENST00000301725	.	.	.	4.81	4.81	0.61882	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4217	0.83760	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MLST8	2197036	1.000000	0.71417	0.994000	0.49952	0.577000	0.36160	9.774000	0.98992	2.205000	0.71048	0.462000	0.41574	.	.	.		0.662	MLST8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250763.2	NM_022372	Intron
CES3	23491	hgsc.bcm.edu	37	16	67006828	67006828	+	Missense_Mutation	SNP	C	C	A			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr16:67006828C>A	ENST00000303334.4	+	13	1663	c.1592C>A	c.(1591-1593)cCa>cAa	p.P531Q	CES3_ENST00000543856.1_Missense_Mutation_p.P170Q|CES3_ENST00000394037.1_Missense_Mutation_p.P528Q	NM_024922.5	NP_079198.2	Q6UWW8	EST3_HUMAN	carboxylesterase 3	531						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	carboxylic ester hydrolase activity (GO:0052689)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|ovary(3)|skin(1)	24		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0488)|Epithelial(162;0.127)		GAGATCAACCCAGTGCCACGG	0.567																																					p.P531Q		Atlas-SNP	.											.	CES3	56	.	0			c.C1592A						.						92.0	93.0	93.0					16																	67006828		2200	4300	6500	SO:0001583	missense	23491	exon13			TCAACCCAGTGCC	AK025389	CCDS10826.1, CCDS54022.1, CCDS54023.1	16q22.1	2014-05-13	2008-07-25		ENSG00000172828	ENSG00000172828		"""Carboxylesterases"""	1865	protein-coding gene	gene with protein product	"""esterase 31"", ""brain carboxylesterase BR3"""	605279	"""carboxylesterase 3 (brain)"""			10518925, 14581373, 15100172, 20931200	Standard	NM_001185176		Approved	FLJ21736, ES31	uc002eqt.3	Q6UWW8	OTTHUMG00000137525	ENST00000303334.4:c.1592C>A	chr16.hg19:g.67006828C>A	ENSP00000304782:p.Pro531Gln	109.0	0.0		83.0	38.0	NM_024922	B2Z3W9|F5H242|Q7Z6J1|Q9H6X7	Missense_Mutation	SNP	ENST00000303334.4	hg19	CCDS10826.1	.	.	.	.	.	.	.	.	.	.	C	15.27	2.783561	0.49891	.	.	ENSG00000172828	ENST00000303334;ENST00000394037;ENST00000543856	T;T;T	0.66099	-0.19;-0.19;-0.19	5.03	1.58	0.23477	Carboxylesterase, type B (1);	1.045480	0.07705	N	0.941121	T	0.50394	0.1613	N	0.17838	0.53	0.09310	N	1	P;B	0.47106	0.89;0.014	P;B	0.45712	0.491;0.063	T	0.41556	-0.9502	10	0.62326	D	0.03	.	6.7176	0.23312	0.0:0.2981:0.0:0.7019	.	170;531	F5H242;Q6UWW8	.;EST3_HUMAN	Q	531;528;170	ENSP00000304782:P531Q;ENSP00000377602:P528Q;ENSP00000445559:P170Q	ENSP00000304782:P531Q	P	+	2	0	CES3	65564329	0.000000	0.05858	0.013000	0.15412	0.017000	0.09413	-0.831000	0.04405	0.275000	0.22094	-0.516000	0.04426	CCA	.	.		0.567	CES3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268848.1	NM_024922	
ATP6V0D1	9114	hgsc.bcm.edu	37	16	67472440	67472440	+	Silent	SNP	A	A	T			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr16:67472440A>T	ENST00000290949.3	-	8	1197	c.1047T>A	c.(1045-1047)ccT>ccA	p.P349P	ATP6V0D1_ENST00000602876.1_Silent_p.P272P|ATP6V0D1_ENST00000567694.1_5'Flank|ATP6V0D1_ENST00000540149.1_Silent_p.P390P	NM_004691.4	NP_004682.2	P61421	VA0D1_HUMAN	ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1	349					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP hydrolysis coupled proton transport (GO:0015991)|brain development (GO:0007420)|cellular iron ion homeostasis (GO:0006879)|cellular protein metabolic process (GO:0044267)|cilium assembly (GO:0042384)|endoplasmic reticulum unfolded protein response (GO:0030968)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|axon terminus (GO:0043679)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|phagocytic vesicle membrane (GO:0030670)|proton-transporting V-type ATPase, V0 domain (GO:0033179)|synaptic vesicle (GO:0008021)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	hydrogen-exporting ATPase activity, phosphorylative mechanism (GO:0008553)			large_intestine(3)|lung(3)|urinary_tract(2)	8		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0439)|Epithelial(162;0.101)		GCTAGAAGATAGGGATGTAGT	0.542																																					p.P349P		Atlas-SNP	.											.	ATP6V0D1	25	.	0			c.T1047A						.						90.0	80.0	83.0					16																	67472440		2198	4300	6498	SO:0001819	synonymous_variant	9114	exon8			GAAGATAGGGATG	X71490	CCDS10838.1	16q22	2010-04-21	2006-01-20	2002-05-10	ENSG00000159720	ENSG00000159720		"""ATPases / V-type"""	13724	protein-coding gene	gene with protein product		607028	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), member D"", ""ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 1"", ""ATPase, H+ transporting, lysosomal 38kDa, V0 subunit D1"""	ATP6D		8250920	Standard	NM_004691		Approved	ATP6DV, VATX, VPATPD, P39, Vma6	uc002ete.1	P61421	OTTHUMG00000137515	ENST00000290949.3:c.1047T>A	chr16.hg19:g.67472440A>T		132.0	0.0		98.0	26.0	NM_004691	P12953|Q02547	Silent	SNP	ENST00000290949.3	hg19	CCDS10838.1																																																																																			.	.		0.542	ATP6V0D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268835.1	NM_004691	
DPEP2	64174	hgsc.bcm.edu	37	16	68026979	68026979	+	Missense_Mutation	SNP	A	A	T			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr16:68026979A>T	ENST00000572888.1	-	1	787	c.137T>A	c.(136-138)cTg>cAg	p.L46Q	DPEP2_ENST00000393847.1_Missense_Mutation_p.L46Q|DPEP2_ENST00000412757.2_Missense_Mutation_p.L46Q			Q9H4A9	DPEP2_HUMAN	dipeptidase 2	46					arachidonic acid metabolic process (GO:0019369)|leukotriene metabolic process (GO:0006691)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	dipeptidase activity (GO:0016805)|dipeptidyl-peptidase activity (GO:0008239)|metal ion binding (GO:0046872)|metalloexopeptidase activity (GO:0008235)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(10)|skin(2)|upper_aerodigestive_tract(1)	17		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0489)|all cancers(182;0.239)		GGGGGCGCCCAGCGTGGTGAG	0.692																																					p.L46Q		Atlas-SNP	.											.	DPEP2	43	.	0			c.T137A						.						16.0	18.0	18.0					16																	68026979		2181	4287	6468	SO:0001583	missense	64174	exon2			GCGCCCAGCGTGG	AJ295149	CCDS10857.1	16q22.1	2011-07-22			ENSG00000167261	ENSG00000167261	3.4.13.19		23028	protein-coding gene	gene with protein product		609925					Standard	NM_022355		Approved		uc002eve.4	Q9H4A9	OTTHUMG00000137542	ENST00000572888.1:c.137T>A	chr16.hg19:g.68026979A>T	ENSP00000458977:p.Leu46Gln	65.0	0.0		59.0	22.0	NM_022355	B2RCF8|Q6UX92|Q8TC95	Missense_Mutation	SNP	ENST00000572888.1	hg19	CCDS10857.1	.	.	.	.	.	.	.	.	.	.	A	8.991	0.977816	0.18812	.	.	ENSG00000167261	ENST00000393847;ENST00000412757;ENST00000268795	T;T	0.18502	2.21;2.21	3.29	-6.58	0.01836	.	1.769450	0.03395	N	0.202482	T	0.09774	0.0240	L	0.34521	1.04	0.09310	N	0.999999	B;B	0.29432	0.048;0.244	B;B	0.21546	0.01;0.035	T	0.13495	-1.0507	10	0.34782	T	0.22	0.0754	2.5432	0.04730	0.5502:0.1335:0.1819:0.1344	.	46;46	B4DNP7;Q9H4A9	.;DPEP2_HUMAN	Q	46	ENSP00000377430:L46Q;ENSP00000412549:L46Q	ENSP00000268795:L46Q	L	-	2	0	DPEP2	66584480	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.447000	0.06828	-1.645000	0.01515	-0.451000	0.05528	CTG	.	.		0.692	DPEP2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437026.1	NM_022355	
VAC14	55697	hgsc.bcm.edu	37	16	70820268	70820268	+	Splice_Site	SNP	C	C	A			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr16:70820268C>A	ENST00000261776.5	-	2	365	c.105G>T	c.(103-105)aaG>aaT	p.K35N		NM_018052.3	NP_060522.3	Q08AM6	VAC14_HUMAN	Vac14 homolog (S. cerevisiae)	35					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of lipid kinase activity (GO:0043550)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|PAS complex (GO:0070772)	receptor activity (GO:0004872)			breast(2)|endometrium(2)|kidney(10)|large_intestine(1)|lung(10)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	33		Ovarian(137;0.0699)				CCCGGACCAGCCTGGAGAGAG	0.602																																					p.K35N		Atlas-SNP	.											.	VAC14	65	.	0			c.G105T						.						66.0	66.0	66.0					16																	70820268		2198	4300	6498	SO:0001630	splice_region_variant	55697	exon2			GACCAGCCTGGAG	AK056433	CCDS10896.1	16q22.1	2010-03-23	2005-02-09		ENSG00000103043	ENSG00000103043			25507	protein-coding gene	gene with protein product		604632	"""Tax1 (human T-cell leukemia virus type I) binding protein 2"""	TAX1BP2		15542851, 12719380	Standard	NM_018052		Approved	FLJ10305, ArPIKfyve	uc002ezm.3	Q08AM6	OTTHUMG00000137583	ENST00000261776.5:c.105-1G>T	chr16.hg19:g.70820268C>A		66.0	0.0		58.0	31.0	NM_018052	B3KPJ5|B3KSM8|Q13174|Q6IA12|Q7L4Y1|Q9BW96|Q9H6V6	Missense_Mutation	SNP	ENST00000261776.5	hg19	CCDS10896.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.531711	0.85706	.	.	ENSG00000103043	ENST00000261776	T	0.68025	-0.3	5.49	5.49	0.81192	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.80287	0.4595	M	0.70595	2.14	0.80722	D	1	D	0.58620	0.983	P	0.61275	0.886	T	0.80464	-0.1371	10	0.51188	T	0.08	.	19.3733	0.94498	0.0:1.0:0.0:0.0	.	35	Q08AM6	VAC14_HUMAN	N	35	ENSP00000261776:K35N	ENSP00000261776:K35N	K	-	3	2	VAC14	69377769	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	5.338000	0.65947	2.579000	0.87056	0.650000	0.86243	AAG	.	.		0.602	VAC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268973.3	NM_018052	Missense_Mutation
PLCG2	5336	hgsc.bcm.edu	37	16	81922840	81922840	+	Missense_Mutation	SNP	A	A	T	rs372494175		TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr16:81922840A>T	ENST00000359376.3	+	10	1043	c.829A>T	c.(829-831)Atg>Ttg	p.M277L		NM_002661.3	NP_002652.2	P16885	PLCG2_HUMAN	phospholipase C, gamma 2 (phosphatidylinositol-specific)	277					B cell differentiation (GO:0030183)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid catabolic process (GO:0009395)|platelet activation (GO:0030168)|release of sequestered calcium ion into cytosol (GO:0051209)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(18)|lung(21)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	58						TGATGACACCATGCGTGAAAC	0.468																																					p.M277L		Atlas-SNP	.											.	PLCG2	276	.	0			c.A829T						.						190.0	182.0	185.0					16																	81922840		2037	4194	6231	SO:0001583	missense	5336	exon10			GACACCATGCGTG		CCDS42204.1	16q24.1	2014-09-17				ENSG00000197943	3.1.4.11	"""SH2 domain containing"""	9066	protein-coding gene	gene with protein product		600220				7835906	Standard	XR_248240		Approved		uc002fgt.3	P16885		ENST00000359376.3:c.829A>T	chr16.hg19:g.81922840A>T	ENSP00000352336:p.Met277Leu	105.0	0.0		107.0	23.0	NM_002661	D3DUL3|Q3ZTS2|Q59H45|Q969T5	Missense_Mutation	SNP	ENST00000359376.3	hg19	CCDS42204.1	.	.	.	.	.	.	.	.	.	.	A	9.795	1.179074	0.21787	.	.	ENSG00000197943	ENST00000359376	T	0.27256	1.68	5.09	3.98	0.46160	Phospholipase C, phosphoinositol-specific, EF-hand-like (1);	0.035665	0.85682	N	0.000000	T	0.25717	0.0626	N	0.15975	0.35	0.52501	D	0.999953	B;D	0.58268	0.009;0.982	B;P	0.59288	0.03;0.855	T	0.02512	-1.1148	10	0.18710	T	0.47	.	12.0579	0.53546	0.8557:0.1443:0.0:0.0	.	144;277	B4E3H3;P16885	.;PLCG2_HUMAN	L	277	ENSP00000352336:M277L	ENSP00000352336:M277L	M	+	1	0	PLCG2	80480341	1.000000	0.71417	0.731000	0.30826	0.521000	0.34408	4.616000	0.61197	0.867000	0.35654	0.460000	0.39030	ATG	.	.		0.468	PLCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432429.1		
TP53	7157	hgsc.bcm.edu	37	17	7578205	7578205	+	Missense_Mutation	SNP	C	C	A	rs587782177		TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr17:7578205C>A	ENST00000269305.4	-	6	833	c.644G>T	c.(643-645)aGt>aTt	p.S215I	TP53_ENST00000420246.2_Missense_Mutation_p.S215I|TP53_ENST00000445888.2_Missense_Mutation_p.S215I|TP53_ENST00000359597.4_Missense_Mutation_p.S215I|TP53_ENST00000455263.2_Missense_Mutation_p.S215I|TP53_ENST00000413465.2_Missense_Mutation_p.S215I|TP53_ENST00000574684.1_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	215	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		S -> C (in sporadic cancers; somatic mutation).|S -> G (in sporadic cancers; somatic mutation).|S -> I (in sporadic cancers; somatic mutation).|S -> K (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|S -> N (in sporadic cancers; somatic mutation).|S -> R (in sporadic cancers; somatic mutation).|S -> T (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.S215I(18)|p.S215N(9)|p.0?(8)|p.?(5)|p.S215T(3)|p.S215fs*32(3)|p.H214fs*5(2)|p.S122N(1)|p.S215fs*27(1)|p.S215del(1)|p.S215fs*29(1)|p.D208_V216delDRNTFRHSV(1)|p.S83I(1)|p.S83N(1)|p.T211_S215delTFRHS(1)|p.D208fs*1(1)|p.S215fs*31(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.S122I(1)|p.D207_V216del10(1)|p.S215_V218>M(1)|p.R209fs*6(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CACCACCACACTATGTCGAAA	0.537		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.S215I	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000545858,NS,lymphoid_neoplasm,+1,1	TP53	33396	.	64	Substitution - Missense(34)|Deletion - Frameshift(10)|Whole gene deletion(8)|Unknown(5)|Deletion - In frame(4)|Complex - deletion inframe(2)|Complex - frameshift(1)	biliary_tract(10)|oesophagus(10)|lung(9)|large_intestine(6)|ovary(6)|bone(5)|upper_aerodigestive_tract(4)|haematopoietic_and_lymphoid_tissue(4)|central_nervous_system(3)|liver(2)|breast(2)|stomach(1)|kidney(1)|skin(1)	c.G644T						.						125.0	112.0	116.0					17																	7578205		2203	4300	6503	SO:0001583	missense	7157	exon6	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	ACCACACTATGTC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.644G>T	chr17.hg19:g.7578205C>A	ENSP00000269305:p.Ser215Ile	144.0	0.0		121.0	57.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.898786	0.91962	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99856	-7.21;-7.21;-7.21;-7.21;-7.21;-7.21;-7.21;-7.21	5.28	5.28	0.74379	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99878	0.9942	M	0.90705	3.14	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;0.999;1.0;1.0;1.0;1.0	D	0.96464	0.9343	10	0.87932	D	0	-18.3023	16.7921	0.85592	0.0:1.0:0.0:0.0	.	176;215;215;122;215;215;215	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	I	215;215;215;215;215;215;204;122;83;122;83	ENSP00000410739:S215I;ENSP00000352610:S215I;ENSP00000269305:S215I;ENSP00000398846:S215I;ENSP00000391127:S215I;ENSP00000391478:S215I;ENSP00000425104:S83I;ENSP00000423862:S122I	ENSP00000269305:S215I	S	-	2	0	TP53	7518930	1.000000	0.71417	0.567000	0.28434	0.964000	0.63967	6.042000	0.70996	2.634000	0.89283	0.563000	0.77884	AGT	.	.		0.537	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
MYH8	4626	hgsc.bcm.edu	37	17	10307686	10307686	+	Silent	SNP	G	G	T			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr17:10307686G>T	ENST00000403437.2	-	22	2743	c.2649C>A	c.(2647-2649)ctC>ctA	p.L883L	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	883					ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						TCTCTTTTAAGAGAGTGACCA	0.408									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																												p.L883L		Atlas-SNP	.											.	MYH8	346	.	0			c.C2649A						.						135.0	122.0	126.0					17																	10307686		2203	4300	6503	SO:0001819	synonymous_variant	4626	exon22	Familial Cancer Database	Carney Complex Variant	TTTTAAGAGAGTG		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.2649C>A	chr17.hg19:g.10307686G>T		133.0	0.0		93.0	29.0	NM_002472	Q14910	Silent	SNP	ENST00000403437.2	hg19	CCDS11153.1																																																																																			.	.		0.408	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252724.2	NM_002472	
RAI1	10743	hgsc.bcm.edu	37	17	17696772	17696772	+	Silent	SNP	C	C	T			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr17:17696772C>T	ENST00000353383.1	+	3	979	c.510C>T	c.(508-510)tcC>tcT	p.S170S	RAI1_ENST00000261641.6_Silent_p.S170S	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	170	Gln-rich.				circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		GGACTCACTCCCTGCACGTCC	0.622																																					p.S170S		Atlas-SNP	.											.	RAI1	121	.	0			c.C510T						.						63.0	62.0	62.0					17																	17696772		2203	4300	6503	SO:0001819	synonymous_variant	10743	exon3			TCACTCCCTGCAC	AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.510C>T	chr17.hg19:g.17696772C>T		149.0	0.0		81.0	14.0	NM_030665	Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	Silent	SNP	ENST00000353383.1	hg19	CCDS11188.1																																																																																			.	.		0.622	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131775.1	NM_030665	
EFCAB3	146779	hgsc.bcm.edu	37	17	60493662	60493662	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr17:60493662G>A	ENST00000305286.3	+	10	1367	c.1289G>A	c.(1288-1290)cGg>cAg	p.R430Q	EFCAB3_ENST00000450662.2_Missense_Mutation_p.R482Q	NM_173503.3	NP_775774.1	Q8N7B9	EFCB3_HUMAN	EF-hand calcium binding domain 3	430							calcium ion binding (GO:0005509)			cervix(1)|endometrium(2)|large_intestine(5)|lung(6)|skin(3)	17			BRCA - Breast invasive adenocarcinoma(2;2.27e-11)			AAAAGAAAACGGAAAGGTTTA	0.333																																					p.R482Q		Atlas-SNP	.											.	EFCAB3	71	.	0			c.G1445A						.						74.0	81.0	79.0					17																	60493662		2202	4298	6500	SO:0001583	missense	146779	exon12			GAAAACGGAAAGG	AK098684	CCDS11632.1, CCDS45751.1	17q23.3	2013-01-10			ENSG00000172421	ENSG00000172421		"""EF-hand domain containing"""	26379	protein-coding gene	gene with protein product						12477932	Standard	NM_173503		Approved	FLJ25818	uc010wpc.2	Q8N7B9	OTTHUMG00000179175	ENST00000305286.3:c.1289G>A	chr17.hg19:g.60493662G>A	ENSP00000302649:p.Arg430Gln	75.0	0.0		50.0	15.0	NM_001144933	J3KQM8	Missense_Mutation	SNP	ENST00000305286.3	hg19	CCDS11632.1	.	.	.	.	.	.	.	.	.	.	G	6.933	0.541929	0.13250	.	.	ENSG00000172421	ENST00000450662;ENST00000305286	T;T	0.62498	0.02;0.08	5.04	4.08	0.47627	.	0.403035	0.21131	N	0.079658	T	0.48554	0.1506	L	0.40543	1.245	0.32193	N	0.578761	B	0.11235	0.004	B	0.09377	0.004	T	0.50857	-0.8778	10	0.17369	T	0.5	.	9.5007	0.39015	0.0961:0.0:0.9039:0.0	.	430	Q8N7B9	EFCB3_HUMAN	Q	482;430	ENSP00000403932:R482Q;ENSP00000302649:R430Q	ENSP00000302649:R430Q	R	+	2	0	EFCAB3	57847394	0.999000	0.42202	0.998000	0.56505	0.144000	0.21451	1.528000	0.35985	1.360000	0.45960	-0.263000	0.10527	CGG	.	.		0.333	EFCAB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379114.1	NM_173503	
TMEM200C	645369	hgsc.bcm.edu	37	18	5890394	5890394	+	Missense_Mutation	SNP	G	G	C			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr18:5890394G>C	ENST00000581347.2	-	3	2314	c.1669C>G	c.(1669-1671)Caa>Gaa	p.Q557E	RP11-945C19.4_ENST00000582939.1_RNA|TMEM200C_ENST00000383490.2_Missense_Mutation_p.Q557E|RP11-945C19.4_ENST00000580845.1_RNA|RP11-945C19.4_ENST00000577694.1_RNA			A6NKL6	T200C_HUMAN	transmembrane protein 200C	557						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|endometrium(1)|large_intestine(4)|lung(5)|stomach(1)	12						TCTCGCGTTTGACCAGCTACT	0.677																																					p.Q557E		Atlas-SNP	.											.	TMEM200C	30	.	0			c.C1669G						.						24.0	28.0	27.0					18																	5890394		1924	4109	6033	SO:0001583	missense	645369	exon1			GCGTTTGACCAGC		CCDS45825.1	18p11.31	2009-09-08			ENSG00000206432	ENSG00000206432			37208	protein-coding gene	gene with protein product						15722956	Standard	NM_001080209		Approved	TTMA	uc002kmx.1	A6NKL6		ENST00000581347.2:c.1669C>G	chr18.hg19:g.5890394G>C	ENSP00000463375:p.Gln557Glu	50.0	0.0		49.0	8.0	NM_001080209		Missense_Mutation	SNP	ENST00000581347.2	hg19	CCDS45825.1	.	.	.	.	.	.	.	.	.	.	G	11.29	1.593891	0.28445	.	.	ENSG00000206432	ENST00000383490	.	.	.	4.62	-9.25	0.00666	.	.	.	.	.	T	0.11793	0.0287	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.16158	-1.0412	8	0.11794	T	0.64	.	4.5462	0.12081	0.0835:0.0988:0.3352:0.4825	.	557	A6NKL6	T200C_HUMAN	E	557	.	ENSP00000372982:Q557E	Q	-	1	0	TMEM200C	5880394	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.798000	0.01747	-2.610000	0.00446	-0.305000	0.09177	CAA	.	.		0.677	TMEM200C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441917.4	NM_001080209	
GNAL	2774	hgsc.bcm.edu	37	18	11753928	11753928	+	Missense_Mutation	SNP	A	A	G			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr18:11753928A>G	ENST00000423027.3	+	4	698	c.377A>G	c.(376-378)gAc>gGc	p.D126G	GNAL_ENST00000590972.1_3'UTR|GNAL_ENST00000535121.1_Missense_Mutation_p.D126G|GNAL_ENST00000334049.6_Missense_Mutation_p.D203G|GNAL_ENST00000269162.5_Missense_Mutation_p.D126G			P38405	GNAL_HUMAN	guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type	126					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|response to amphetamine (GO:0001975)|response to caffeine (GO:0031000)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|liver(1)|lung(4)|ovary(1)	12						CCTATCACTGACTTTGAATAT	0.358																																					p.D203G		Atlas-SNP	.											.	GNAL	59	.	0			c.A608G						.						81.0	82.0	82.0					18																	11753928		2203	4300	6503	SO:0001583	missense	2774	exon4			TCACTGACTTTGA	AF493893	CCDS11851.1, CCDS11852.1, CCDS58614.1	18p11.22-p11.21	2003-12-17			ENSG00000141404	ENSG00000141404			4388	protein-coding gene	gene with protein product		139312				1302014	Standard	NM_182978		Approved		uc002kqc.3	P38405	OTTHUMG00000131660	ENST00000423027.3:c.377A>G	chr18.hg19:g.11753928A>G	ENSP00000408489:p.Asp126Gly	184.0	0.0		207.0	91.0	NM_182978	B7ZA26|Q86XU3	Missense_Mutation	SNP	ENST00000423027.3	hg19	CCDS11852.1	.	.	.	.	.	.	.	.	.	.	A	18.15	3.558818	0.65538	.	.	ENSG00000141404	ENST00000540217;ENST00000334049;ENST00000535121;ENST00000269162;ENST00000423027	T;T;T;T	0.44881	0.91;0.91;0.91;0.91	5.58	5.58	0.84498	G protein alpha subunit, helical insertion (2);	0.082890	0.85682	D	0.000000	T	0.54870	0.1885	M	0.76727	2.345	0.80722	D	1	P;B	0.35433	0.501;0.32	P;B	0.45071	0.468;0.247	T	0.56123	-0.8031	10	0.45353	T	0.12	.	15.7482	0.77962	1.0:0.0:0.0:0.0	.	126;203	P38405;Q86XU3	GNAL_HUMAN;.	G	65;203;126;126;126	ENSP00000334051:D203G;ENSP00000439023:D126G;ENSP00000269162:D126G;ENSP00000408489:D126G	ENSP00000269162:D126G	D	+	2	0	GNAL	11743928	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.957000	0.93082	2.125000	0.65367	0.459000	0.35465	GAC	.	.		0.358	GNAL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254561.2	NM_182978, NM_002071	
NEDD4L	23327	hgsc.bcm.edu	37	18	56033299	56033299	+	Silent	SNP	A	A	G			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr18:56033299A>G	ENST00000400345.3	+	21	2185	c.1902A>G	c.(1900-1902)agA>agG	p.R634R	NEDD4L_ENST00000589054.1_Intron|NEDD4L_ENST00000357895.5_Silent_p.R626R|NEDD4L_ENST00000456173.2_Silent_p.R493R|NEDD4L_ENST00000256832.7_Silent_p.R494R|NEDD4L_ENST00000435432.2_Silent_p.R493R|NEDD4L_ENST00000456986.1_Silent_p.R513R|NEDD4L_ENST00000382850.4_Silent_p.R614R|NEDD4L_ENST00000256830.9_Silent_p.R530R|NEDD4L_ENST00000586263.1_Silent_p.R606R|NEDD4L_ENST00000356462.6_Silent_p.R570R|NEDD4L_ENST00000431212.2_Silent_p.R513R	NM_001144967.2	NP_001138439.1	Q96PU5	NED4L_HUMAN	neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase	634					cellular sodium ion homeostasis (GO:0006883)|excretion (GO:0007588)|gene expression (GO:0010467)|ion transmembrane transport (GO:0034220)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of protein localization to cell surface (GO:2000009)|negative regulation of sodium ion transmembrane transport (GO:1902306)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cation channel activity (GO:2001259)|positive regulation of caveolin-mediated endocytosis (GO:2001288)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of sodium ion transport (GO:0010765)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane depolarization (GO:0003254)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of protein catabolic process (GO:0042176)|regulation of tight junction assembly (GO:2000810)|response to metal ion (GO:0010038)|response to salt stress (GO:0009651)|sodium ion transport (GO:0006814)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|ventricular cardiac muscle cell action potential (GO:0086005)|viral life cycle (GO:0019058)|viral process (GO:0016032)|water homeostasis (GO:0030104)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ion channel binding (GO:0044325)|ligase activity (GO:0016874)|potassium channel inhibitor activity (GO:0019870)|potassium channel regulator activity (GO:0015459)|sodium channel inhibitor activity (GO:0019871)|sodium channel regulator activity (GO:0017080)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(11)|ovary(1)|prostate(4)	37						CCTATCGGAGAATTATGTCCG	0.388																																					p.R634R		Atlas-SNP	.											.	NEDD4L	126	.	0			c.A1902G						.						113.0	106.0	108.0					18																	56033299		1846	4090	5936	SO:0001819	synonymous_variant	23327	exon21			TCGGAGAATTATG	AF210730	CCDS45872.1, CCDS45873.1, CCDS45874.1, CCDS45875.1, CCDS45876.1, CCDS58632.1, CCDS59323.1	18q21.31	2014-08-12	2012-02-23		ENSG00000049759				7728	protein-coding gene	gene with protein product		606384	"""neural precursor cell expressed, developmentally down-regulated 4-like"""			10594025, 11244092, 18322022	Standard	NM_001144965		Approved	KIAA0439, RSP5, NEDD4-2	uc002lgy.3	Q96PU5	OTTHUMG00000179875	ENST00000400345.3:c.1902A>G	chr18.hg19:g.56033299A>G		67.0	0.0		68.0	26.0	NM_001144967	O43165|Q3LSM7|Q7Z5F1|Q7Z5F2|Q7Z5N3|Q8N5A7|Q8WUU9|Q9BW58|Q9H2W4|Q9NT88	Silent	SNP	ENST00000400345.3	hg19	CCDS45872.1																																																																																			.	.		0.388	NEDD4L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000448749.1		
ELANE	1991	hgsc.bcm.edu	37	19	855638	855638	+	Silent	SNP	C	C	T	rs146878885	byFrequency	TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr19:855638C>T	ENST00000590230.1	+	5	582	c.441C>T	c.(439-441)aaC>aaT	p.N147N	ELANE_ENST00000263621.1_Silent_p.N147N			P08246	ELNE_HUMAN	elastase, neutrophil expressed	147	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				acute inflammatory response to antigenic stimulus (GO:0002438)|cellular calcium ion homeostasis (GO:0006874)|collagen catabolic process (GO:0030574)|defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|negative regulation of chemokine biosynthetic process (GO:0045079)|negative regulation of chemotaxis (GO:0050922)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-8 biosynthetic process (GO:0045415)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neutrophil mediated killing of fungus (GO:0070947)|phagocytosis (GO:0006909)|positive regulation of immune response (GO:0050778)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein catabolic process (GO:0030163)|proteolysis (GO:0006508)|response to lipopolysaccharide (GO:0032496)|response to UV (GO:0009411)|response to yeast (GO:0001878)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|secretory granule (GO:0030141)|transcriptional repressor complex (GO:0017053)	cytokine binding (GO:0019955)|endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|peptidase activity (GO:0008233)|protease binding (GO:0002020)|RNA polymerase II transcription corepressor activity (GO:0001106)|serine-type endopeptidase activity (GO:0004252)			breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(1)|lung(4)|pancreas(1)	13					Alpha-1-proteinase inhibitor(DB00058)|Filgrastim(DB00099)|Pegfilgrastim(DB00019)	GCCTGGGCAACGGGGTGCAGT	0.687													C|||	5	0.000998403	0.003	0.0	5008	,	,		15709	0.001		0.0	False		,,,				2504	0.0				p.N147N		Atlas-SNP	.											.	ELANE	27	.	0			c.C441T						.	C		1,4405	2.1+/-5.4	0,1,2202	51.0	48.0	49.0		441	-8.6	0.0	19	dbSNP_134	49	1,8593	1.2+/-3.3	0,1,4296	no	coding-synonymous	ELANE	NM_001972.2		0,2,6498	TT,TC,CC		0.0116,0.0227,0.0154		147/268	855638	2,12998	2203	4297	6500	SO:0001819	synonymous_variant	1991	exon4			GGGCAACGGGGTG		CCDS12045.1	19p13.3	2014-09-17	2009-05-05	2009-05-05	ENSG00000197561	ENSG00000197561	3.4.21.37		3309	protein-coding gene	gene with protein product	"""neutrophil elastase"", ""leukocyte elastase"", ""medullasin"""	130130	"""elastase 2, neutrophil"""	ELA2		2902087	Standard	XM_005259517		Approved	NE, HNE, HLE	uc002lqb.3	P08246		ENST00000590230.1:c.441C>T	chr19.hg19:g.855638C>T		25.0	0.0		31.0	5.0	NM_001972	P09649|Q6B0D9|Q6LDP5	Silent	SNP	ENST00000590230.1	hg19	CCDS12045.1																																																																																			.	C|1.000;T|0.000		0.687	ELANE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457890.2	NM_001972	
OR2Z1	284383	hgsc.bcm.edu	37	19	8842153	8842153	+	Missense_Mutation	SNP	G	G	A	rs200115143		TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr19:8842153G>A	ENST00000324060.2	+	1	838	c.763G>A	c.(763-765)Gcc>Acc	p.A255T		NM_001004699.1	NP_001004699.1	Q8NG97	OR2Z1_HUMAN	olfactory receptor, family 2, subfamily Z, member 1	255						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A255T(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						TTATGGTGCCGCCGTGTTCAT	0.562																																					p.A255T		Atlas-SNP	.											OR2Z1,NS,carcinoma,0,2	OR2Z1	53	.	1	Substitution - Missense(1)	stomach(1)	c.G763A						.						162.0	129.0	140.0					19																	8842153		2203	4300	6503	SO:0001583	missense	284383	exon1			GGTGCCGCCGTGT	AC008753	CCDS32895.1	19p13.2	2013-09-20	2002-11-13		ENSG00000181733	ENSG00000181733		"""GPCR / Class A : Olfactory receptors"""	15391	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily Z, member 2"""	OR2Z2			Standard	NM_001004699		Approved		uc010xkg.2	Q8NG97	OTTHUMG00000182195	ENST00000324060.2:c.763G>A	chr19.hg19:g.8842153G>A	ENSP00000316284:p.Ala255Thr	103.0	0.0		89.0	4.0	NM_001004699	B9EH50|Q6IFK0|Q96R25	Missense_Mutation	SNP	ENST00000324060.2	hg19	CCDS32895.1	.	.	.	.	.	.	.	.	.	.	G	12.62	1.992148	0.35131	.	.	ENSG00000181733	ENST00000324060	T	0.00169	8.63	4.67	2.42	0.29668	GPCR, rhodopsin-like superfamily (1);	1.410570	0.04115	N	0.315375	T	0.00300	0.0009	L	0.52206	1.635	0.09310	N	1	D	0.61080	0.989	P	0.54210	0.745	T	0.54636	-0.8264	10	0.59425	D	0.04	.	4.0346	0.09724	0.196:0.2092:0.5948:0.0	.	255	Q8NG97	OR2Z1_HUMAN	T	255	ENSP00000316284:A255T	ENSP00000316284:A255T	A	+	1	0	OR2Z1	8703153	0.000000	0.05858	0.240000	0.24138	0.048000	0.14542	0.336000	0.19823	2.356000	0.79943	0.543000	0.68304	GCC	.	G|0.999;A|0.001		0.562	OR2Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459954.1		
MUC16	94025	hgsc.bcm.edu	37	19	8996440	8996440	+	Missense_Mutation	SNP	G	G	C			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr19:8996440G>C	ENST00000397910.4	-	61	41335	c.41132C>G	c.(41131-41133)cCt>cGt	p.P13711R	MUC16_ENST00000380951.5_Missense_Mutation_p.P352R	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13713	SEA 11. {ECO:0000255|PROSITE- ProRule:PRU00188}.			Missing (in Ref. 3; AAK74120). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TTTGGGGTCAGGGTGGTGGGT	0.557																																					p.P13711R		Atlas-SNP	.											.	MUC16	4315	.	0			c.C41132G						.						81.0	76.0	78.0					19																	8996440		1936	4142	6078	SO:0001583	missense	94025	exon61			GGGTCAGGGTGGT	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.41132C>G	chr19.hg19:g.8996440G>C	ENSP00000381008:p.Pro13711Arg	120.0	0.0		90.0	12.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	6.929|6.929	0.541051|0.541051	0.13250|0.13250	.|.	.|.	ENSG00000181143|ENSG00000181143	ENST00000542240|ENST00000397910;ENST00000380951	.|T;T	.|0.43294	.|0.95;0.95	3.36|3.36	-1.75|-1.75	0.08031|0.08031	.|SEA (1);	.|0.518513	.|0.14520	.|U	.|0.314548	T|T	0.26666|0.26666	0.0652|0.0652	N|N	0.01874|0.01874	-0.695|-0.695	.|.	.|.	.|.	.|P;D	.|0.71674	.|0.624;0.998	.|B;D	.|0.78314	.|0.329;0.991	T|T	0.30736|0.30736	-0.9968|-0.9968	4|9	.|0.32370	.|T	.|0.25	-0.2631|-0.2631	2.7492|2.7492	0.05275|0.05275	0.3706:0.0:0.4239:0.2056|0.3706:0.0:0.4239:0.2056	.|.	.|21356;13711	.|Q8WXI7;B5ME49	.|MUC16_HUMAN;.	V|R	551|13711;352	.|ENSP00000381008:P13711R;ENSP00000370338:P352R	.|ENSP00000370338:P352R	L|P	-|-	1|2	2|0	MUC16|MUC16	8857440|8857440	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.009000|0.009000	0.06853|0.06853	0.101000|0.101000	0.15251|0.15251	-0.009000|-0.009000	0.14296|0.14296	-0.397000|-0.397000	0.06425|0.06425	CTG|CCT	.	.		0.557	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
COLGALT1	79709	hgsc.bcm.edu	37	19	17692114	17692114	+	Nonsense_Mutation	SNP	G	G	A			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr19:17692114G>A	ENST00000252599.4	+	12	1850	c.1730G>A	c.(1729-1731)tGg>tAg	p.W577*		NM_024656.2	NP_078932.2	Q8NBJ5	GT251_HUMAN	collagen beta(1-O)galactosyltransferase 1	577					extracellular matrix organization (GO:0030198)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)	procollagen galactosyltransferase activity (GO:0050211)										TCAGTCGTATGGAACAATGAG	0.592																																					p.W577X		Atlas-SNP	.											.	.	.	.	0			c.G1730A						.						173.0	137.0	149.0					19																	17692114		2203	4300	6503	SO:0001587	stop_gained	79709	exon12			TCGTATGGAACAA	AK075541	CCDS12363.1	19p13.11	2013-02-27	2013-02-27	2013-02-27	ENSG00000130309	ENSG00000130309			26182	protein-coding gene	gene with protein product			"""glycosyltransferase 25 domain containing 1"""	GLT25D1		19075007	Standard	NM_024656		Approved	FLJ22329	uc002nhc.1	Q8NBJ5		ENST00000252599.4:c.1730G>A	chr19.hg19:g.17692114G>A	ENSP00000252599:p.Trp577*	169.0	0.0		155.0	27.0	NM_024656	Q8NC64	Nonsense_Mutation	SNP	ENST00000252599.4	hg19	CCDS12363.1	.	.	.	.	.	.	.	.	.	.	G	28.5	4.926788	0.92319	.	.	ENSG00000130309	ENST00000252599	.	.	.	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	-7.8185	15.6857	0.77409	0.0:0.0:1.0:0.0	.	.	.	.	X	577	.	ENSP00000252599:W577X	W	+	2	0	GLT25D1	17553114	1.000000	0.71417	1.000000	0.80357	0.236000	0.25371	9.507000	0.97996	2.298000	0.77334	0.313000	0.20887	TGG	.	.		0.592	COLGALT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464216.1	NM_024656	
ZNF98	148198	hgsc.bcm.edu	37	19	22575687	22575687	+	Missense_Mutation	SNP	C	C	A	rs140301665	byFrequency	TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr19:22575687C>A	ENST00000357774.5	-	4	471	c.350G>T	c.(349-351)cGt>cTt	p.R117L		NM_001098626.1	NP_001092096.1	A6NK75	ZNF98_HUMAN	zinc finger protein 98	117					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				TAAATTTTCACGTCCACATTT	0.343																																					p.R117L		Atlas-SNP	.											.	ZNF98	230	.	0			c.G350T						.						66.0	55.0	58.0					19																	22575687		1969	4170	6139	SO:0001583	missense	148198	exon4			TTTTCACGTCCAC		CCDS46031.1	19p12	2014-02-14	2010-04-20	2008-06-12	ENSG00000197360	ENSG00000197360		"""Zinc fingers, C2H2-type"", ""-"""	13174	protein-coding gene	gene with protein product	"""zinc finger protein 739"""	603980					Standard	NM_001098626		Approved	ZNF739, F7175	uc002nqt.2	A6NK75	OTTHUMG00000182940	ENST00000357774.5:c.350G>T	chr19.hg19:g.22575687C>A	ENSP00000350418:p.Arg117Leu	235.0	0.0		244.0	86.0	NM_001098626		Missense_Mutation	SNP	ENST00000357774.5	hg19	CCDS46031.1	.	.	.	.	.	.	.	.	.	.	.	0.316	-0.964637	0.02249	.	.	ENSG00000197360	ENST00000357774	T	0.06294	3.32	0.916	-1.83	0.07833	.	.	.	.	.	T	0.01353	0.0044	N	0.00254	-1.765	0.09310	N	1	B	0.11235	0.004	B	0.09377	0.004	T	0.44757	-0.9307	9	0.33141	T	0.24	.	3.7588	0.08596	0.0:0.2691:0.0:0.7309	.	117	A6NK75	ZNF98_HUMAN	L	117	ENSP00000350418:R117L	ENSP00000350418:R117L	R	-	2	0	ZNF98	22367527	0.000000	0.05858	0.033000	0.17914	0.033000	0.12548	-0.805000	0.04530	-0.779000	0.04560	-0.786000	0.03341	CGT	.	C|0.998;T|0.002		0.343	ZNF98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464398.1	NM_001098626	
NOVA2	4858	hgsc.bcm.edu	37	19	46457193	46457193	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr19:46457193G>A	ENST00000263257.5	-	3	435	c.241C>T	c.(241-243)Cgg>Tgg	p.R81W		NM_002516.2	NP_002507.1	Q9UNW9	NOVA2_HUMAN	neuro-oncological ventral antigen 2	81	KH 1. {ECO:0000255|PROSITE- ProRule:PRU00117}.				regulation of RNA metabolic process (GO:0051252)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(3)|large_intestine(5)|lung(13)	21		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.00245)|GBM - Glioblastoma multiforme(486;0.0782)|Epithelial(262;0.179)		AGGCATACCCGCTCTGTGGTT	0.537																																					p.R81W		Atlas-SNP	.											NOVA2,NS,carcinoma,0,1	NOVA2	38	.	0			c.C241T						.						166.0	140.0	149.0					19																	46457193		2203	4300	6503	SO:0001583	missense	4858	exon3			ATACCCGCTCTGT	U70477	CCDS12679.1	19q13.3	2008-07-17				ENSG00000104967			7887	protein-coding gene	gene with protein product	"""neuro-oncological ventral antigen 3"""	601991		NOVA3		9344654, 10368286	Standard	NM_002516		Approved	ANOVA	uc002pdv.2	Q9UNW9		ENST00000263257.5:c.241C>T	chr19.hg19:g.46457193G>A	ENSP00000263257:p.Arg81Trp	100.0	0.0		77.0	23.0	NM_002516	O43267|Q9UEA1	Missense_Mutation	SNP	ENST00000263257.5	hg19	CCDS12679.1	.	.	.	.	.	.	.	.	.	.	G	14.24	2.476224	0.44044	.	.	ENSG00000104967	ENST00000263257	T	0.36340	1.26	5.17	1.67	0.24075	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.000000	0.85682	D	0.000000	T	0.71204	0.3312	H	0.99104	4.43	0.58432	D	0.999994	D	0.89917	1.0	D	0.87578	0.998	T	0.74680	-0.3584	10	0.87932	D	0	-11.7429	7.5401	0.27733	0.0845:0.0:0.6127:0.3027	.	81	Q9UNW9	NOVA2_HUMAN	W	81	ENSP00000263257:R81W	ENSP00000263257:R81W	R	-	1	2	NOVA2	51149033	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.067000	0.57527	0.763000	0.33175	0.591000	0.81541	CGG	.	.		0.537	NOVA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437210.2	NM_002516	
DBP	1628	hgsc.bcm.edu	37	19	49136708	49136708	+	Missense_Mutation	SNP	T	T	C			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr19:49136708T>C	ENST00000222122.5	-	3	1198	c.755A>G	c.(754-756)gAg>gGg	p.E252G	DBP_ENST00000599385.1_Missense_Mutation_p.E50G|DBP_ENST00000593500.1_Missense_Mutation_p.E50G|DBP_ENST00000601104.1_Missense_Mutation_p.E252G	NM_001352.3	NP_001343.2	Q10586	DBP_HUMAN	D site of albumin promoter (albumin D-box) binding protein	252					liver development (GO:0001889)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|rhythmic process (GO:0048511)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	5		all_lung(116;0.000125)|Lung NSC(112;0.000202)|all_epithelial(76;0.000283)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;9.98e-05)|all cancers(93;0.000112)|GBM - Glioblastoma multiforme(486;0.00615)|Epithelial(262;0.0155)		CACCTTCTGCTCCTCCGGCAC	0.557																																					p.E252G		Atlas-SNP	.											.	DBP	16	.	0			c.A755G						.						230.0	236.0	234.0					19																	49136708		2203	4300	6503	SO:0001583	missense	1628	exon3			TTCTGCTCCTCCG	U06936	CCDS12728.1	19q13.33	2013-09-20			ENSG00000105516	ENSG00000105516			2697	protein-coding gene	gene with protein product		124097				1535333, 7835883	Standard	XR_243907		Approved	DABP	uc002pjx.4	Q10586	OTTHUMG00000183319	ENST00000222122.5:c.755A>G	chr19.hg19:g.49136708T>C	ENSP00000222122:p.Glu252Gly	75.0	0.0		69.0	18.0	NM_001352	A2I2P4	Missense_Mutation	SNP	ENST00000222122.5	hg19	CCDS12728.1	.	.	.	.	.	.	.	.	.	.	T	16.19	3.052345	0.55218	.	.	ENSG00000105516	ENST00000222122	T	0.45668	0.89	4.9	4.9	0.64082	.	0.202954	0.39687	U	0.001289	T	0.40932	0.1137	L	0.55990	1.75	0.80722	D	1	B	0.20671	0.047	B	0.25506	0.061	T	0.36720	-0.9736	10	0.59425	D	0.04	-16.2153	12.7938	0.57549	0.0:0.0:0.0:1.0	.	252	Q10586	DBP_HUMAN	G	252	ENSP00000222122:E252G	ENSP00000222122:E252G	E	-	2	0	DBP	53828520	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.244000	0.72391	1.977000	0.57605	0.533000	0.62120	GAG	.	.		0.557	DBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466167.1	NM_001352	
SIGLEC12	89858	hgsc.bcm.edu	37	19	52001422	52001422	+	Missense_Mutation	SNP	T	T	C			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr19:52001422T>C	ENST00000291707.3	-	5	1310	c.1255A>G	c.(1255-1257)Acc>Gcc	p.T419A	SIGLEC12_ENST00000598614.1_Missense_Mutation_p.T301A	NM_053003.2	NP_443729.1	Q96PQ1	SIG12_HUMAN	sialic acid binding Ig-like lectin 12 (gene/pseudogene)	419	Ig-like C2-type 2.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(2)|biliary_tract(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(1)|lung(23)|ovary(4)|prostate(2)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)	61		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.0102)		GGGCTCAGGGTCAGGCTCCCC	0.627																																					p.T419A		Atlas-SNP	.											.	SIGLEC12	243	.	0			c.A1255G						.						49.0	47.0	48.0					19																	52001422		2203	4300	6503	SO:0001583	missense	89858	exon5			TCAGGGTCAGGCT	AF282256	CCDS12833.1, CCDS59416.1	19q13.41	2013-01-29	2011-06-29	2004-10-20	ENSG00000254521	ENSG00000254521		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15482	protein-coding gene	gene with protein product		606094	"""SIGLEC-like 1"", ""sialic acid binding Ig-like lectin 12"""	SIGLECL1		11409877, 11328818, 21555517	Standard	NM_053003		Approved	SLG, S2V, Siglec-XII, Siglec-12, Siglec-L1	uc002pwx.1	Q96PQ1	OTTHUMG00000165524	ENST00000291707.3:c.1255A>G	chr19.hg19:g.52001422T>C	ENSP00000291707:p.Thr419Ala	63.0	0.0		36.0	19.0	NM_053003	Q8IYH7	Missense_Mutation	SNP	ENST00000291707.3	hg19	CCDS12833.1	.	.	.	.	.	.	.	.	.	.	.	2.382	-0.341845	0.05243	.	.	ENSG00000254521	ENST00000291707	T	0.11495	2.77	1.39	1.39	0.22231	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.665043	0.12424	U	0.470130	T	0.08537	0.0212	L	0.41356	1.27	0.09310	N	1	B;B	0.33379	0.41;0.285	B;B	0.37091	0.241;0.155	T	0.35649	-0.9780	10	0.16896	T	0.51	.	4.9309	0.13917	0.0:0.0:0.0:1.0	.	419;301	Q96PQ1;Q96PQ1-2	SIG12_HUMAN;.	A	419	ENSP00000291707:T419A	ENSP00000291707:T419A	T	-	1	0	SIGLEC12	56693234	0.000000	0.05858	0.041000	0.18516	0.130000	0.20726	-1.037000	0.03557	0.889000	0.36185	0.324000	0.21423	ACC	.	.		0.627	SIGLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384641.2	NM_053003	
ZNF175	7728	hgsc.bcm.edu	37	19	52091277	52091277	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr19:52091277G>A	ENST00000262259.2	+	5	2051	c.1693G>A	c.(1693-1695)Ggg>Agg	p.G565R	ZNF175_ENST00000436511.2_Intron	NM_007147.2	NP_009078.1	Q9Y473	ZN175_HUMAN	zinc finger protein 175	565					defense response to virus (GO:0051607)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000426)|OV - Ovarian serous cystadenocarcinoma(262;0.0257)		CAGTGAATGTGGGAAAGCCTT	0.468																																					p.G565R		Atlas-SNP	.											.	ZNF175	65	.	0			c.G1693A						.						80.0	77.0	78.0					19																	52091277		2203	4300	6503	SO:0001583	missense	7728	exon5			GAATGTGGGAAAG	D50419	CCDS12837.1	19q13.4	2013-01-08			ENSG00000105497	ENSG00000105497		"""Zinc fingers, C2H2-type"", ""-"""	12964	protein-coding gene	gene with protein product		601139				8838321	Standard	NM_007147		Approved	OTK18	uc002pxb.3	Q9Y473	OTTHUMG00000167771	ENST00000262259.2:c.1693G>A	chr19.hg19:g.52091277G>A	ENSP00000262259:p.Gly565Arg	82.0	0.0		63.0	6.0	NM_007147	A8K9H2	Missense_Mutation	SNP	ENST00000262259.2	hg19	CCDS12837.1	.	.	.	.	.	.	.	.	.	.	G	19.68	3.872811	0.72180	.	.	ENSG00000105497	ENST00000262259	T	0.21361	2.01	2.37	2.37	0.29283	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.39708	0.1088	M	0.64170	1.965	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.30909	-0.9962	9	0.62326	D	0.03	.	10.8646	0.46847	0.0:0.0:1.0:0.0	.	565	Q9Y473	ZN175_HUMAN	R	565	ENSP00000262259:G565R	ENSP00000262259:G565R	G	+	1	0	ZNF175	56783089	1.000000	0.71417	0.986000	0.45419	0.977000	0.68977	3.547000	0.53663	1.650000	0.50662	0.655000	0.94253	GGG	.	.		0.468	ZNF175-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396205.1	NM_007147	
TARM1	441864	hgsc.bcm.edu	37	19	54577312	54577312	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr19:54577312C>T	ENST00000432826.1	-	4	542	c.518G>A	c.(517-519)aGt>aAt	p.S173N	TARM1_ENST00000446034.2_Missense_Mutation_p.S181N	NM_001135686.1	NP_001129158.2	B6A8C7	TARM1_HUMAN	T cell-interacting, activating receptor on myeloid cells 1	173	Ig-like C2-type 2.					integral component of membrane (GO:0016021)				endometrium(1)|stomach(2)	3						CCCCGCTGGACTCTGCAGCTG	0.557																																					p.S173N		Atlas-SNP	.											.	TARM1	10	.	0			c.G518A						.						136.0	134.0	135.0					19																	54577312		692	1591	2283	SO:0001583	missense	441864	exon4			GCTGGACTCTGCA		CCDS46173.1	19q13.42	2013-01-29			ENSG00000248385	ENSG00000248385		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	37250	protein-coding gene	gene with protein product							Standard	XM_005258952		Approved		uc010yei.1	B6A8C7		ENST00000432826.1:c.518G>A	chr19.hg19:g.54577312C>T	ENSP00000439454:p.Ser173Asn	114.0	0.0		134.0	9.0	NM_001135686	B4DWY4	Missense_Mutation	SNP	ENST00000432826.1	hg19	CCDS46173.1	.	.	.	.	.	.	.	.	.	.	C	6.655	0.489344	0.12641	.	.	ENSG00000248385	ENST00000432826;ENST00000446034	T;T	0.14266	2.52;2.52	4.01	-2.6	0.06190	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.11324	0.0276	L	0.49126	1.545	0.09310	N	1	B	0.27117	0.168	B	0.26614	0.071	T	0.37820	-0.9689	9	0.20046	T	0.44	.	9.3093	0.37893	0.0:0.3099:0.5963:0.0939	.	173	B6A8C7	TARM1_HUMAN	N	173;181	ENSP00000439454:S173N;ENSP00000441055:S181N	ENSP00000439454:S173N	S	-	2	0	TARM1	59269124	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.950000	0.01530	-0.433000	0.07286	0.609000	0.83330	AGT	.	.		0.557	TARM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465679.1	NM_001135686	
PAK7	57144	hgsc.bcm.edu	37	20	9520141	9520141	+	Missense_Mutation	SNP	C	C	A	rs560752200		TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr20:9520141C>A	ENST00000378429.3	-	11	2674	c.2128G>T	c.(2128-2130)Gtc>Ttc	p.V710F	PAK7_ENST00000378423.1_Missense_Mutation_p.V710F|PAK7_ENST00000353224.5_Missense_Mutation_p.V710F	NM_020341.3	NP_065074.1	Q9P286	PAK7_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 7	710					apoptotic process (GO:0006915)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|learning (GO:0007612)|locomotory behavior (GO:0007626)|memory (GO:0007613)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(44)|ovary(2)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)	81			COAD - Colon adenocarcinoma(9;0.194)			ATGAGGGGGACGATGCAAGAC	0.493																																					p.V710F		Atlas-SNP	.											.	PAK7	194	.	0			c.G2128T						.						237.0	218.0	225.0					20																	9520141		2203	4300	6503	SO:0001583	missense	57144	exon10			GGGGGACGATGCA	AB033090	CCDS13107.1	20p12	2008-06-17	2008-06-17		ENSG00000101349	ENSG00000101349			15916	protein-coding gene	gene with protein product		608038	"""p21(CDKN1A)-activated kinase 7"""			11756552, 10574462	Standard	NM_020341		Approved	KIAA1264, PAK5	uc002wnk.2	Q9P286	OTTHUMG00000031857	ENST00000378429.3:c.2128G>T	chr20.hg19:g.9520141C>A	ENSP00000367686:p.Val710Phe	112.0	0.0		116.0	57.0	NM_177990	A8K5T6|D3DW14|Q5W115|Q9BX09|Q9ULF6	Missense_Mutation	SNP	ENST00000378429.3	hg19	CCDS13107.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.636534	0.87760	.	.	ENSG00000101349	ENST00000378429;ENST00000353224;ENST00000378423;ENST00000439520	T;T;T	0.75050	-0.9;-0.9;-0.9	5.48	5.48	0.80851	.	0.054780	0.64402	D	0.000001	T	0.76821	0.4041	L	0.57536	1.79	0.80722	D	1	P;P	0.52061	0.95;0.95	P;P	0.51079	0.658;0.658	T	0.76266	-0.3022	9	.	.	.	.	12.6695	0.56860	0.0:0.9245:0.0:0.0755	.	710;710	B0AZM9;Q9P286	.;PAK7_HUMAN	F	710;710;710;571	ENSP00000367686:V710F;ENSP00000322957:V710F;ENSP00000367679:V710F	.	V	-	1	0	PAK7	9468141	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	6.091000	0.71406	2.597000	0.87782	0.655000	0.94253	GTC	.	.		0.493	PAK7-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077962.1		
BPIFB4	149954	hgsc.bcm.edu	37	20	31672750	31672750	+	Missense_Mutation	SNP	G	G	T			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr20:31672750G>T	ENST00000375483.3	+	4	730	c.730G>T	c.(730-732)Ggc>Tgc	p.G244C		NM_182519.2	NP_872325.2	P59827	BPIB4_HUMAN	BPI fold containing family B, member 4	244						cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)	p.G205C(1)									GCTCCTGCCCGGCGTGGGTGT	0.667																																					p.G244C		Atlas-SNP	.											C20orf186,NS,carcinoma,0,1	.	.	.	1	Substitution - Missense(1)	lung(1)	c.G730T						.						54.0	43.0	46.0					20																	31672750		2203	4300	6503	SO:0001583	missense	149954	exon4			CTGCCCGGCGTGG	AF549190	CCDS13213.2	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186191	ENSG00000186191		"""BPI fold containing"""	16179	protein-coding gene	gene with protein product		615718	"""chromosome 20 open reading frame 186"""	C20orf186		11971875, 21787333	Standard	NM_182519		Approved	dJ726C3.5, LPLUNC4	uc010zue.2	P59827	OTTHUMG00000032235	ENST00000375483.3:c.730G>T	chr20.hg19:g.31672750G>T	ENSP00000364632:p.Gly244Cys	20.0	0.0		16.0	5.0	NM_182519	Q5TDX6	Missense_Mutation	SNP	ENST00000375483.3	hg19	CCDS13213.2	.	.	.	.	.	.	.	.	.	.	G	17.80	3.478373	0.63849	.	.	ENSG00000186191	ENST00000375483	T	0.06142	3.34	3.39	3.39	0.38822	.	0.196114	0.34507	N	0.003914	T	0.20820	0.0501	M	0.71206	2.165	0.46678	D	0.999158	D	0.89917	1.0	D	0.97110	1.0	T	0.00521	-1.1691	10	0.87932	D	0	-17.045	10.14	0.42730	0.0:0.0:1.0:0.0	.	244	P59827	BPIB4_HUMAN	C	244	ENSP00000364632:G244C	ENSP00000364632:G244C	G	+	1	0	BPIFB4	31136411	0.998000	0.40836	0.994000	0.49952	0.910000	0.53928	4.873000	0.63057	1.749000	0.51849	0.484000	0.47621	GGC	.	.		0.667	BPIFB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078655.5	NM_182519	
PLCG1	5335	hgsc.bcm.edu	37	20	39802162	39802162	+	Missense_Mutation	SNP	A	A	G			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr20:39802162A>G	ENST00000373271.1	+	28	3787	c.3382A>G	c.(3382-3384)Aca>Gca	p.T1128A	PLCG1_ENST00000608689.1_3'UTR|PLCG1_ENST00000244007.3_Missense_Mutation_p.T1128A|PLCG1_ENST00000373272.2_Missense_Mutation_p.T1128A	NM_182811.1	NP_877963.1	P19174	PLCG1_HUMAN	phospholipase C, gamma 1	1128	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|cell migration (GO:0016477)|cellular response to epidermal growth factor stimulus (GO:0071364)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phospholipid catabolic process (GO:0009395)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cell projection (GO:0042995)|cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|protein kinase binding (GO:0019901)|receptor signaling protein activity (GO:0005057)			breast(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(16)|skin(6)|urinary_tract(2)	46		Myeloproliferative disorder(115;0.00878)				CAAGCAGAAGACAGAGTTTGT	0.572											OREG0025953	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T1128A		Atlas-SNP	.											.	PLCG1	111	.	0			c.A3382G						.						127.0	104.0	112.0					20																	39802162		2203	4300	6503	SO:0001583	missense	5335	exon28			CAGAAGACAGAGT	M34667	CCDS13313.1, CCDS13314.1	20q12-q13.1	2013-02-14	2004-01-29		ENSG00000124181	ENSG00000124181	3.1.4.11	"""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"", ""SH2 domain containing"""	9065	protein-coding gene	gene with protein product		172420	"""phospholipase C, gamma 1 (formerly subtype 148)"""	PLC1		2167438, 3254788	Standard	NM_182811		Approved	PLC148, PLC-II, PLCgamma1, NCKAP3	uc002xjo.1	P19174	OTTHUMG00000033082	ENST00000373271.1:c.3382A>G	chr20.hg19:g.39802162A>G	ENSP00000362368:p.Thr1128Ala	49.0	0.0	888	45.0	4.0	NM_182811	B7ZLY7|B9EGH4|E1P5W4|Q2V575	Missense_Mutation	SNP	ENST00000373271.1	hg19	CCDS13314.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.133710	0.77662	.	.	ENSG00000124181	ENST00000244007;ENST00000373271;ENST00000373272	T;T;T	0.48522	0.81;0.81;0.81	5.2	5.2	0.72013	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.78735	0.4330	H	0.97077	3.935	0.80722	D	1	D;D;D	0.76494	0.998;0.998;0.999	D;D;D	0.74674	0.973;0.974;0.984	D	0.86422	0.1755	10	0.87932	D	0	.	15.0623	0.71964	1.0:0.0:0.0:0.0	.	1128;1128;1128	P19174-2;P19174;A2A284	.;PLCG1_HUMAN;.	A	1128	ENSP00000244007:T1128A;ENSP00000362368:T1128A;ENSP00000362369:T1128A	ENSP00000244007:T1128A	T	+	1	0	PLCG1	39235576	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.339000	0.96797	1.967000	0.57214	0.374000	0.22700	ACA	.	.		0.572	PLCG1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080514.3	NM_182811	
POTEH	23784	hgsc.bcm.edu	37	22	16287459	16287459	+	Missense_Mutation	SNP	A	A	T			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr22:16287459A>T	ENST00000343518.6	-	1	478	c.427T>A	c.(427-429)Ttc>Atc	p.F143I		NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H	143										NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						CAGCAGGGGAAGCAGTGGCAG	0.607																																					p.F143I		Atlas-SNP	.											.	POTEH	114	.	0			c.T427A						.						101.0	114.0	109.0					22																	16287459		2010	3844	5854	SO:0001583	missense	23784	exon1			AGGGGAAGCAGTG	AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.427T>A	chr22.hg19:g.16287459A>T	ENSP00000340610:p.Phe143Ile	743.0	0.0		607.0	108.0	NM_001136213	A2CEK4|A6NCI1|A9Z1W0	Missense_Mutation	SNP	ENST00000343518.6	hg19	CCDS46658.1	.	.	.	.	.	.	.	.	.	.	.	8.190	0.795719	0.16327	.	.	ENSG00000198062	ENST00000359587;ENST00000343518;ENST00000355872	T	0.25250	1.81	.	.	.	.	.	.	.	.	T	0.22360	0.0539	L	0.53249	1.67	0.09310	N	1	B	0.34181	0.44	B	0.33750	0.169	T	0.18147	-1.0346	7	0.54805	T	0.06	.	.	.	.	.	143	Q6S545	POTEH_HUMAN	I	106;143;143	ENSP00000340610:F143I	ENSP00000340610:F143I	F	-	1	0	POTEH	14667459	0.000000	0.05858	0.003000	0.11579	0.137000	0.21094	-0.060000	0.11712	0.355000	0.24131	0.000000	0.15137	TTC	.	.		0.607	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276918.4	NM_001136213	
SF3A1	10291	hgsc.bcm.edu	37	22	30733037	30733037	+	Missense_Mutation	SNP	T	T	A			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr22:30733037T>A	ENST00000215793.8	-	13	2238	c.2084A>T	c.(2083-2085)gAg>gTg	p.E695V	SF3A1_ENST00000439242.1_Missense_Mutation_p.E630V	NM_005877.4	NP_005868.1	Q15459	SF3A1_HUMAN	splicing factor 3a, subunit 1, 120kDa	695					gene expression (GO:0010467)|mRNA 3'-splice site recognition (GO:0000389)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U2-type spliceosomal complex (GO:0005684)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|urinary_tract(1)	29						CAGGAACTCCTCCTCTGGCAT	0.557																																					p.E695V		Atlas-SNP	.											.	SF3A1	61	.	0			c.A2084T						.						112.0	102.0	106.0					22																	30733037		2203	4300	6503	SO:0001583	missense	10291	exon13			AACTCCTCCTCTG	X85237	CCDS13875.1	22q12.2	2014-09-17	2002-08-29		ENSG00000099995	ENSG00000099995			10765	protein-coding gene	gene with protein product		605595	"""splicing factor 3a, subunit 1, 120kD"""			7489498	Standard	NM_005877		Approved	SF3a120, SAP114, PRPF21, Prp21	uc003ahl.3	Q15459	OTTHUMG00000151005	ENST00000215793.8:c.2084A>T	chr22.hg19:g.30733037T>A	ENSP00000215793:p.Glu695Val	109.0	0.0		106.0	41.0	NM_005877	E9PAW1	Missense_Mutation	SNP	ENST00000215793.8	hg19	CCDS13875.1	.	.	.	.	.	.	.	.	.	.	T	19.65	3.867266	0.72065	.	.	ENSG00000099995	ENST00000439242;ENST00000215793;ENST00000536049	T;T	0.39787	1.06;1.06	5.17	5.17	0.71159	.	0.050977	0.85682	D	0.000000	T	0.60932	0.2307	M	0.73217	2.22	0.80722	D	1	D	0.53312	0.959	P	0.62089	0.898	T	0.62053	-0.6935	10	0.45353	T	0.12	-19.4209	15.1839	0.72982	0.0:0.0:0.0:1.0	.	695	Q15459	SF3A1_HUMAN	V	630;695;592	ENSP00000390336:E630V;ENSP00000215793:E695V	ENSP00000215793:E695V	E	-	2	0	SF3A1	29063037	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.479000	0.81095	2.170000	0.68504	0.533000	0.62120	GAG	.	.		0.557	SF3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320916.2	NM_005877	
DNAJB7	150353	hgsc.bcm.edu	37	22	41257117	41257117	+	Missense_Mutation	SNP	T	T	G			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr22:41257117T>G	ENST00000307221.4	-	1	1013	c.882A>C	c.(880-882)aaA>aaC	p.K294N	XPNPEP3_ENST00000482652.1_Intron|XPNPEP3_ENST00000357137.4_Intron|XPNPEP3_ENST00000414396.1_Intron|XPNPEP3_ENST00000544094.1_5'Flank|XPNPEP3_ENST00000541156.1_Intron	NM_145174.1	NP_660157.1	Q7Z6W7	DNJB7_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 7	294	Poly-Lys.						chaperone binding (GO:0051087)			breast(2)|endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	10						TACGCTTCTTTTTTTTCCTCT	0.383																																					p.K294N		Atlas-SNP	.											.	DNAJB7	29	.	0			c.A882C						.						105.0	100.0	101.0					22																	41257117		2203	4300	6503	SO:0001583	missense	150353	exon1			CTTCTTTTTTTTC	AF085232	CCDS14008.1	22q13.2	2011-09-02			ENSG00000172404	ENSG00000172404		"""Heat shock proteins / DNAJ (HSP40)"""	24986	protein-coding gene	gene with protein product		611336				12477932	Standard	NM_145174		Approved	HSC3	uc003azj.3	Q7Z6W7	OTTHUMG00000151202	ENST00000307221.4:c.882A>C	chr22.hg19:g.41257117T>G	ENSP00000307197:p.Lys294Asn	149.0	0.0		159.0	62.0	NM_145174	Q2M220|Q5H904|Q8WYJ7	Missense_Mutation	SNP	ENST00000307221.4	hg19	CCDS14008.1	.	.	.	.	.	.	.	.	.	.	T	11.59	1.683980	0.29872	.	.	ENSG00000172404	ENST00000307221	T	0.69926	-0.44	4.58	-1.07	0.09968	.	0.634564	0.13633	N	0.373555	T	0.77928	0.4204	M	0.78049	2.395	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.75255	-0.3382	10	0.59425	D	0.04	.	8.7574	0.34654	0.0:0.516:0.0:0.484	.	294	Q7Z6W7	DNJB7_HUMAN	N	294	ENSP00000307197:K294N	ENSP00000307197:K294N	K	-	3	2	DNAJB7	39587063	0.998000	0.40836	0.985000	0.45067	0.013000	0.08279	0.311000	0.19380	-0.267000	0.09325	-0.326000	0.08463	AAA	.	.		0.383	DNAJB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321765.1	NM_145174	
MOSPD2	158747	hgsc.bcm.edu	37	X	14915353	14915353	+	Missense_Mutation	SNP	A	A	G			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chrX:14915353A>G	ENST00000380492.3	+	5	558	c.470A>G	c.(469-471)aAt>aGt	p.N157S	MOSPD2_ENST00000482354.1_Missense_Mutation_p.N157S|MOSPD2_ENST00000495110.1_3'UTR	NM_001177475.1|NM_152581.3	NP_001170946.1|NP_689794.1	Q8NHP6	MSPD2_HUMAN	motile sperm domain containing 2	157	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.					integral component of membrane (GO:0016021)|membrane (GO:0016020)	structural molecule activity (GO:0005198)			breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20	Hepatocellular(33;0.183)					ACTGGAATAAATAGCATTGTA	0.388																																					p.N157S		Atlas-SNP	.											.	MOSPD2	46	.	0			c.A470G						.						150.0	145.0	146.0					X																	14915353		2203	4300	6503	SO:0001583	missense	158747	exon5			GAATAAATAGCAT	AL834345	CCDS14162.1	Xp22.31	2006-03-16			ENSG00000130150	ENSG00000130150			28381	protein-coding gene	gene with protein product						15533722	Standard	NM_152581		Approved	MGC26706	uc004cwi.3	Q8NHP6	OTTHUMG00000021170	ENST00000380492.3:c.470A>G	chrX.hg19:g.14915353A>G	ENSP00000369860:p.Asn157Ser	94.0	0.0		93.0	82.0	NM_152581	Q8N3H2|Q8NA83	Missense_Mutation	SNP	ENST00000380492.3	hg19	CCDS14162.1	.	.	.	.	.	.	.	.	.	.	A	3.749	-0.052072	0.07362	.	.	ENSG00000130150	ENST00000380492	T	0.73897	-0.79	5.23	2.6	0.31112	Cellular retinaldehyde-binding/triple function, C-terminal (5);	0.119539	0.85682	N	0.000000	T	0.24198	0.0586	N	0.00045	-2.445	0.36913	D	0.891003	B	0.14012	0.009	B	0.17098	0.017	T	0.44283	-0.9338	10	0.02654	T	1	-17.9392	5.4354	0.16478	0.4155:0.0:0.5845:0.0	.	157	Q8NHP6	MSPD2_HUMAN	S	157	ENSP00000369860:N157S	ENSP00000369860:N157S	N	+	2	0	MOSPD2	14825274	1.000000	0.71417	0.988000	0.46212	0.951000	0.60555	6.085000	0.71343	0.714000	0.32081	0.430000	0.28490	AAT	.	.		0.388	MOSPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055837.1	NM_152581	
SSX5	6758	hgsc.bcm.edu	37	X	48054255	48054255	+	Missense_Mutation	SNP	T	T	A			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chrX:48054255T>A	ENST00000376923.1	-	2	104	c.105A>T	c.(103-105)aaA>aaT	p.K35N	SSX5_ENST00000311798.1_Missense_Mutation_p.K76N|SSX5_ENST00000347757.1_Missense_Mutation_p.K35N			O60225	SSX5_HUMAN	synovial sarcoma, X breakpoint 5	35	KRAB-related. {ECO:0000255|PROSITE- ProRule:PRU00120}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			endometrium(3)|kidney(1)|large_intestine(6)|lung(7)|skin(1)	18						TTTCCCACTCTTTCTCAGAGA	0.403																																					p.K76N		Atlas-SNP	.											.	SSX5	41	.	0			c.A228T						.						125.0	108.0	114.0					X																	48054255		2203	4299	6502	SO:0001583	missense	6758	exon4			CCACTCTTTCTCA	BC016640	CCDS14288.1, CCDS14289.1	Xp11.23	2008-02-05			ENSG00000165583	ENSG00000165583			11339	protein-coding gene	gene with protein product		300327					Standard	NM_021015		Approved		uc004diz.1	O60225	OTTHUMG00000021471	ENST00000376923.1:c.105A>T	chrX.hg19:g.48054255T>A	ENSP00000366122:p.Lys35Asn	178.0	0.0		145.0	105.0	NM_021015	Q5JQ59|Q5JQ60|Q96AW3	Missense_Mutation	SNP	ENST00000376923.1	hg19	CCDS14289.1	.	.	.	.	.	.	.	.	.	.	N	5.887	0.347704	0.11126	.	.	ENSG00000165583	ENST00000311798;ENST00000376923;ENST00000347757	T;T;T	0.00840	5.63;5.63;5.63	1.51	-1.69	0.08186	Krueppel-associated box (2);Krueppel-associated box-related (1);	1.119480	0.06749	N	0.779719	T	0.01661	0.0053	M	0.77313	2.365	0.09310	N	1	B;B	0.15473	0.007;0.013	B;B	0.23419	0.016;0.046	T	0.47262	-0.9131	10	0.72032	D	0.01	.	2.2119	0.03950	0.0:0.2324:0.3169:0.4506	.	35;76	O60225;O60225-2	SSX5_HUMAN;.	N	76;35;35	ENSP00000312415:K76N;ENSP00000366122:K35N;ENSP00000290558:K35N	ENSP00000312415:K76N	K	-	3	2	SSX5	47939199	0.000000	0.05858	0.002000	0.10522	0.024000	0.10985	-0.673000	0.05239	-0.508000	0.06540	0.143000	0.16000	AAA	.	.		0.403	SSX5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000056466.1	NM_021015	
KIAA1217	56243	hgsc.bcm.edu	37	10	24832181	24832187	+	Frame_Shift_Del	DEL	TCAAGCG	TCAAGCG	-	rs373416621		TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	TCAAGCG	TCAAGCG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr10:24832181_24832187delTCAAGCG	ENST00000376454.3	+	19	4012_4018	c.3982_3988delTCAAGCG	c.(3982-3990)tcaagcgtgfs	p.SSV1328fs	KIAA1217_ENST00000458595.1_Intron|KIAA1217_ENST00000307544.6_Intron|KIAA1217_ENST00000376452.3_Intron|KIAA1217_ENST00000396446.1_Intron|KIAA1217_ENST00000396445.1_Intron|KIAA1217_ENST00000376451.2_Frame_Shift_Del_p.SSV1011fs|KIAA1217_ENST00000376462.1_Intron	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	1328					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)		p.S1328T(1)		breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						ACTAACAGAATCAAGCGTGCATGATTT	0.43																																					p.1327_1329del		Atlas-Indel,Pindel	.											.	KIAA1217	235	.	1	Substitution - Missense(1)	endometrium(1)	c.3981_3987del						.																																			SO:0001589	frameshift_variant	56243	exon19			.	BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.3982_3988delTCAAGCG	chr10.hg19:g.24832181_24832187delTCAAGCG	ENSP00000365637:p.Ser1328fs	118.0	0.0		117.0	32.0	NM_019590	A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Frame_Shift_Del	DEL	ENST00000376454.3	hg19	CCDS31165.1																																																																																			.	.		0.430	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047223.2	NM_019590	
NFAT5	10725	hgsc.bcm.edu	37	16	69726159	69726159	+	Frame_Shift_Del	DEL	G	G	-			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr16:69726159delG	ENST00000354436.2	+	12	2695	c.2377delG	c.(2377-2379)ggafs	p.G793fs	NFAT5_ENST00000432919.1_Frame_Shift_Del_p.G811fs|NFAT5_ENST00000566899.1_Frame_Shift_Del_p.G717fs|NFAT5_ENST00000567239.1_Frame_Shift_Del_p.G810fs|NFAT5_ENST00000393742.2_Frame_Shift_Del_p.G717fs|NFAT5_ENST00000349945.1_Frame_Shift_Del_p.G717fs	NM_006599.3	NP_006590.1	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5, tonicity-responsive	793					cytokine production (GO:0001816)|excretion (GO:0007588)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of calcineurin-NFAT signaling cascade (GO:0070884)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						TGGCAGCAGTGGAAGTGTTGA	0.428																																					p.S810fs		Atlas-Indel,Pindel	.											.	NFAT5	184	.	0			c.2430delT						.						89.0	86.0	87.0					16																	69726159		2198	4300	6498	SO:0001589	frameshift_variant	10725	exon13			.	AF134870	CCDS10881.1, CCDS10882.1, CCDS45519.1	16q22.1	2009-11-24			ENSG00000102908	ENSG00000102908		"""Nuclear factor of activated T-cells"""	7774	protein-coding gene	gene with protein product		604708				10377394	Standard	NM_173214		Approved	TONEBP, KIAA0827, NFATL1, OREBP, NFATZ, NF-AT5	uc002exl.2	O94916	OTTHUMG00000137572	ENST00000354436.2:c.2377delG	chr16.hg19:g.69726159delG	ENSP00000346420:p.Gly793fs	65.0	0.0		68.0	17.0	NM_138713	A2RRB4|A6H8V5|E9PHR7|O95693|Q7LA65|Q969Q8|Q96QH3|Q9UN18	Frame_Shift_Del	DEL	ENST00000354436.2	hg19	CCDS10881.1																																																																																			.	.		0.428	NFAT5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268952.2	NM_138714	
C11orf49	79096	hgsc.bcm.edu	37	11	47182742	47182743	+	Splice_Site	INS	-	-	T	rs34737621|rs78089169|rs200603540		TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr11:47182742_47182743insT	ENST00000278460.7	+	8	880		c.e8+1		C11orf49_ENST00000543718.1_Splice_Site|C11orf49_ENST00000378618.2_Splice_Site|C11orf49_ENST00000395460.2_Frame_Shift_Ins_p.*275fs|C11orf49_ENST00000536126.1_Splice_Site|C11orf49_ENST00000378615.3_Splice_Site	NM_001003677.1|NM_024113.3	NP_001003677.1|NP_077018.1	Q9H6J7	CK049_HUMAN	chromosome 11 open reading frame 49							nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|skin(1)	11						TGGAACGGCTGTAAGTGTCAAG	0.569											OREG0020950	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L274fs		Atlas-Indel,Pindel	.											.	C11orf49	41	.	0			c.822_823insT						.		,,,	0,4264		0,0,2132					,,,	5.5	1.0		dbSNP_126	79	1,8253		0,1,4126	no	splice-5,splice-5,splice-5,frameshift	C11orf49	NM_024113.3,NM_001003678.1,NM_001003677.1,NM_001003676.1	,,,	0,1,6258	A1A1,A1R,RR		0.0121,0.0,0.0080	,,,	,,,		1,12517				SO:0001630	splice_region_variant	79096	exon8			.	AL136575	CCDS7925.1, CCDS31479.1, CCDS31480.1, CCDS41641.1	11p11.2	2006-02-02			ENSG00000149179	ENSG00000149179			28720	protein-coding gene	gene with protein product							Standard	NM_001003677		Approved	FLJ22210, MGC4707	uc001ndr.4	Q9H6J7	OTTHUMG00000166725	ENST00000278460.7:c.821+1->T	chr11.hg19:g.47182743_47182743dupT		101.0	0.0	944	79.0	17.0	NM_001003676	D3DQQ8|E9PAX7|Q7L077|Q96CS8|Q9BQH4|Q9BUW5	Frame_Shift_Ins	INS	ENST00000278460.7	hg19	CCDS7925.1																																																																																			.	.		0.569	C11orf49-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391218.1	NM_024113	Intron
CWC22	57703	hgsc.bcm.edu	37	2	180853328	180853332	+	Frame_Shift_Del	DEL	TGATA	TGATA	-			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	TGATA	TGATA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr2:180853328_180853332delTGATA	ENST00000410053.3	-	3	366_370	c.67_71delTATCA	c.(67-72)tatcagfs	p.YQ23fs	CWC22_ENST00000295749.6_Frame_Shift_Del_p.YQ23fs	NM_020943.2	NP_065994.1	Q9HCG8	CWC22_HUMAN	CWC22 spliceosome-associated protein	23	Arg-rich.				mRNA splicing, via spliceosome (GO:0000398)|regulation of mRNA splicing, via spliceosome (GO:0048024)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	RNA binding (GO:0003723)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(8)|liver(1)|lung(8)|stomach(1)	30						GGAGTTCCTCTGATATGAATTAAGG	0.307																																					p.23_24del		Atlas-Indel,Pindel	.											.	CWC22	62	.	0			c.68_72del						.																																			SO:0001589	frameshift_variant	57703	exon3			.		CCDS46465.1	2q31.3	2014-07-03	2014-07-03		ENSG00000163510	ENSG00000163510			29322	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein b"""	615186	"""CWC22 spliceosome-associated protein homolog (S. cerevisiae)"""			9136012, 23236153	Standard	NM_020943		Approved	KIAA1604, EIF4GL, fSAPb, NCM	uc010frh.1	Q9HCG8	OTTHUMG00000154244	ENST00000410053.3:c.67_71delTATCA	chr2.hg19:g.180853328_180853332delTGATA	ENSP00000387006:p.Tyr23fs	183.0	0.0		162.0	14.0	NM_020943	Q05DC2|Q4G135|Q52LF0|Q6PEX2|Q7Z6I0|Q9H5L3|Q9H6Q6	Frame_Shift_Del	DEL	ENST00000410053.3	hg19	CCDS46465.1																																																																																			.	.		0.307	CWC22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334537.1	NM_020943	
B3GNTL1	146712	hgsc.bcm.edu	37	17	80915065	80915065	+	Frame_Shift_Del	DEL	C	C	-			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr17:80915065delC	ENST00000320865.3	-	10	935	c.922delG	c.(922-924)gacfs	p.D308fs	B3GNTL1_ENST00000576599.1_Frame_Shift_Del_p.D197fs	NM_001009905.1	NP_001009905.1	Q67FW5	B3GNL_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1	308							transferase activity, transferring glycosyl groups (GO:0016757)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	8	Breast(20;0.000443)|all_neural(118;0.0779)	all_cancers(8;0.0396)|all_epithelial(8;0.0556)	BRCA - Breast invasive adenocarcinoma(99;0.0517)|OV - Ovarian serous cystadenocarcinoma(97;0.0868)			ACCTGAGAGTCCTCGTGGCAA	0.622																																					p.D308fs		Atlas-Indel,Pindel	.											.	B3GNTL1	40	.	0			c.923delA						.						169.0	155.0	160.0					17																	80915065		2203	4300	6503	SO:0001589	frameshift_variant	146712	exon10			.	AY634364	CCDS32778.1	17q25.3	2013-02-22	2004-01-13	2004-01-14	ENSG00000175711	ENSG00000175711		"""Glycosyltransferase family 2 domain containing"""	21727	protein-coding gene	gene with protein product		615337					Standard	NM_001009905		Approved	B3GNT8	uc002kgg.1	Q67FW5	OTTHUMG00000177788	ENST00000320865.3:c.922delG	chr17.hg19:g.80915065delC	ENSP00000319979:p.Asp308fs	153.0	0.0		116.0	24.0	NM_001009905	Q6GV30|Q8WUT3	Frame_Shift_Del	DEL	ENST00000320865.3	hg19	CCDS32778.1																																																																																			.	.		0.622	B3GNTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438949.1	NM_001009905	
ZNF488	118738	hgsc.bcm.edu	37	10	48371553	48371554	+	Stop_Codon_Del	DEL	TA	TA	-			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	TA	TA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr10:48371553_48371554delTA	ENST00000395702.2	+	0	1248_1249				ZNF488_ENST00000494156.1_3'UTR|ZNF488_ENST00000586537.1_Stop_Codon_Del			Q96MN9	ZN488_HUMAN	zinc finger protein 488						negative regulation of transcription, DNA-templated (GO:0045892)|oligodendrocyte development (GO:0014003)|positive regulation of oligodendrocyte differentiation (GO:0048714)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(7)|ovary(2)	14						TTCTCACAGCTAGCAGGTGACC	0.634																																					p.340_341del		Atlas-Indel,Pindel	.											.	ZNF488	38	.	0			c.1020_1021del						.																																			SO:0001567	stop_retained_variant	118738	exon2			.	AK056666	CCDS73120.1	10q11.22	2014-04-10			ENSG00000165388	ENSG00000265763		"""Zinc fingers, C2H2-type"""	23535	protein-coding gene	gene with protein product							Standard	NM_153034		Approved	FLJ32104	uc001jex.3	Q96MN9	OTTHUMG00000188322	Exception_encountered	chr10.hg19:g.48371553_48371554delTA		38.0	0.0		48.0	15.0	NM_153034	Q05CE0	Frame_Shift_Del	DEL	ENST00000395702.2	hg19	CCDS7217.1																																																																																			.	.		0.634	ZNF488-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000314632.1	NM_153034	
FAM72A	729533	hgsc.bcm.edu	37	1	206145524	206145525	+	Frame_Shift_Ins	INS	-	-	TC			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr1:206145524_206145525insTC	ENST00000367128.3	+	3	1149_1150	c.301_302insTC	c.(301-303)ttcfs	p.F101fs	FAM72A_ENST00000470041.1_3'UTR|FAM72A_ENST00000341209.5_Frame_Shift_Ins_p.F61fs|FAM72A_ENST00000367129.2_Frame_Shift_Ins_p.F101fs			Q5TYM5	FA72A_HUMAN	family with sequence similarity 72, member A	101						mitochondrion (GO:0005739)				endometrium(2)	2						CAACGGACACTTCTGGATGTTT	0.376																																					p.F101fs		Atlas-INDEL	.											.	FAM72A	9	.	0			c.301_302insTC						.																																			SO:0001589	frameshift_variant	729533	exon3			.	CR407567	CCDS73016.1	1q32.1	2008-03-26			ENSG00000196550	ENSG00000196550			24044	protein-coding gene	gene with protein product		614710				12477932	Standard	NM_001123168		Approved	MGC57827, RP11-312O7.1	uc001hdr.4	Q5TYM5	OTTHUMG00000042552	ENST00000367128.3:c.302_303dupTC	chr1.hg19:g.206145525_206145526dupTC	ENSP00000356096:p.Phe101fs	481.0	0.0		596.0	92.0	NM_001123168	B2RV15|Q5TYM4	Frame_Shift_Ins	INS	ENST00000367128.3	hg19	CCDS41458.1																																																																																			.	.		0.376	FAM72A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100825.1		
KANSL1	284058	hgsc.bcm.edu	37	17	44110522	44110526	+	Frame_Shift_Del	DEL	GCAGG	GCAGG	-			TCGA-UB-A7MF-01A-11D-A33K-10	TCGA-UB-A7MF-10A-01D-A33K-10	GCAGG	GCAGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	681bd4c8-baed-4557-911b-588c343ee8cd	ebf05fa8-848e-4a45-85ad-42311dac4923	g.chr17:44110522_44110526delGCAGG	ENST00000262419.6	-	13	3227_3231	c.2757_2761delCCTGC	c.(2755-2763)gccctgcatfs	p.LH920fs	KANSL1_ENST00000574590.1_Frame_Shift_Del_p.LH920fs|KANSL1_ENST00000572904.1_Frame_Shift_Del_p.LH920fs|KANSL1_ENST00000432791.1_Frame_Shift_Del_p.LH920fs|RP11-669E14.6_ENST00000570454.1_RNA|KANSL1_ENST00000393476.3_Frame_Shift_Del_p.LH214fs|KANSL1_ENST00000575318.1_Frame_Shift_Del_p.LH856fs	NM_001193466.1	NP_001180395	Q7Z3B3	KANL1_HUMAN	KAT8 regulatory NSL complex subunit 1	920	Sufficient for interaction with KAT8.				chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											CATTTGGCATGCAGGGCGGCGAAGG	0.61																																					p.920_921del		Atlas-Indel,Pindel	.											.	.	.	.	0			c.2758_2762del						.																																			SO:0001589	frameshift_variant	284058	exon13			.	BX538006	CCDS11503.1, CCDS11503.2, CCDS74084.1	17q21.31	2012-02-20	2012-02-20	2012-02-20	ENSG00000120071	ENSG00000120071			24565	protein-coding gene	gene with protein product	"""centromere protein 36"""	612452	"""KIAA1267"""	KIAA1267		10574462	Standard	NM_015443		Approved	DKFZP727C091, MSL1v1, CENP-36, NSL1	uc002ikd.3	Q7Z3B3		ENST00000262419.6:c.2757_2761delCCTGC	chr17.hg19:g.44110522_44110526delGCAGG	ENSP00000262419:p.Leu920fs	82.0	0.0		65.0	14.0	NM_001193466	A8K5E4|Q6AW85|Q8IYH1|Q9BRH0|Q9NTE7|Q9UFT0|Q9ULF3	Frame_Shift_Del	DEL	ENST00000262419.6	hg19	CCDS11503.1																																																																																			.	.		0.610	KANSL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440274.1	NM_015443	
