#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CD1A	909	hgsc.bcm.edu	37	1	158225111	158225111	+	Missense_Mutation	SNP	G	G	A	rs139349958		TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr1:158225111G>A	ENST00000289429.5	+	2	829	c.296G>A	c.(295-297)cGt>cAt	p.R99H		NM_001763.2	NP_001754.2	P06126	CD1A_HUMAN	CD1a molecule	99					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)				NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(14)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	32	all_hematologic(112;0.0378)				Antithymocyte globulin(DB00098)	GAGGGAATTCGTAGATACGCC	0.468																																					p.R99H		Atlas-SNP	.											.	CD1A	88	.	0			c.G296A						.	G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	86.0	83.0	84.0		296	0.1	0.0	1	dbSNP_134	84	0,8600		0,0,4300	no	missense	CD1A	NM_001763.2	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	99/328	158225111	1,13005	2203	4300	6503	SO:0001583	missense	909	exon2			GAATTCGTAGATA	M28825	CCDS1174.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158477	ENSG00000158477		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1634	protein-coding gene	gene with protein product		188370	"""CD1A antigen, a polypeptide"", ""CD1a antigen"""	CD1		2447586, 2784820	Standard	NM_001763		Approved		uc001frt.3	P06126	OTTHUMG00000017512	ENST00000289429.5:c.296G>A	chr1.hg19:g.158225111G>A	ENSP00000289429:p.Arg99His	98.0	0.0		131.0	35.0	NM_001763	D3DVD7|Q13962|Q5TDJ8|Q9UMM4|Q9Y5M5	Missense_Mutation	SNP	ENST00000289429.5	hg19	CCDS1174.1	.	.	.	.	.	.	.	.	.	.	G	6.021	0.372180	0.11409	2.27E-4	0.0	ENSG00000158477	ENST00000289429	T	0.06687	3.27	4.07	0.103	0.14526	MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	1.769060	0.03408	N	0.204308	T	0.00906	0.0030	N	0.02721	-0.515	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.44742	-0.9308	10	0.25106	T	0.35	0.0237	3.4602	0.07529	0.5867:0.0:0.1039:0.3094	.	99	P06126	CD1A_HUMAN	H	99	ENSP00000289429:R99H	ENSP00000289429:R99H	R	+	2	0	CD1A	156491735	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.021000	0.13489	-0.083000	0.12618	-0.397000	0.06425	CGT	.	G|1.000;A|0.000		0.468	CD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046349.2	NM_001763	
C1orf35	79169	hgsc.bcm.edu	37	1	228289844	228289844	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr1:228289844C>T	ENST00000272139.4	-	6	704	c.470G>A	c.(469-471)gGg>gAg	p.G157E	C1orf35_ENST00000472617.1_5'UTR	NM_024319.2	NP_077295.1	Q9BU76	MMTA2_HUMAN	chromosome 1 open reading frame 35	157							poly(A) RNA binding (GO:0044822)			large_intestine(1)|lung(1)|skin(1)	3		Prostate(94;0.0488)				GGTCCCGGGCCCGCCGCTCTC	0.746																																					p.G157E		Atlas-SNP	.											.	C1orf35	17	.	0			c.G470A						.						5.0	10.0	8.0					1																	228289844		1927	4019	5946	SO:0001583	missense	79169	exon6			CCGGGCCCGCCGC	AY137773	CCDS1566.1	1q42.13	2012-06-25			ENSG00000143793	ENSG00000143793			19032	protein-coding gene	gene with protein product	"""multiple myeloma tumor-associated protein 2"""					12545221	Standard	NM_024319		Approved	MGC4174, MMTAG2	uc001hrx.3	Q9BU76	OTTHUMG00000037793	ENST00000272139.4:c.470G>A	chr1.hg19:g.228289844C>T	ENSP00000272139:p.Gly157Glu	50.0	0.0		72.0	14.0	NM_024319	Q6P5Y0|Q6ZTZ6|Q6ZWA6|Q8IZH3	Missense_Mutation	SNP	ENST00000272139.4	hg19	CCDS1566.1	.	.	.	.	.	.	.	.	.	.	C	9.361	1.067920	0.20067	.	.	ENSG00000143793	ENST00000272139	.	.	.	4.13	2.03	0.26663	.	0.785067	0.11877	N	0.520881	T	0.26991	0.0661	L	0.40543	1.245	0.09310	N	1	B	0.33694	0.421	B	0.27500	0.08	T	0.12682	-1.0538	9	0.02654	T	1	-19.3943	11.6334	0.51189	0.0:0.6618:0.3382:0.0	.	157	Q9BU76	MMTA2_HUMAN	E	157	.	ENSP00000272139:G157E	G	-	2	0	C1orf35	226356467	0.000000	0.05858	0.001000	0.08648	0.711000	0.40976	0.575000	0.23729	1.057000	0.40506	0.491000	0.48974	GGG	.	.		0.746	C1orf35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092245.1	NM_024319	
NLRP3	114548	hgsc.bcm.edu	37	1	247607349	247607349	+	Silent	SNP	G	G	A	rs201764635		TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr1:247607349G>A	ENST00000336119.3	+	7	3491	c.2745G>A	c.(2743-2745)acG>acA	p.T915T	NLRP3_ENST00000366497.2_Silent_p.T858T|NLRP3_ENST00000391828.3_Silent_p.T915T|NLRP3_ENST00000391827.2_Silent_p.T858T|NLRP3_ENST00000366496.2_Silent_p.T858T|NLRP3_ENST00000348069.2_Silent_p.T801T	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	915					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)			NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			AGAATCTCACGCACCTTTACC	0.512																																					p.T915T		Atlas-SNP	.											.	NLRP3	286	.	0			c.G2745A						.						197.0	157.0	171.0					1																	247607349		2203	4300	6503	SO:0001819	synonymous_variant	114548	exon7			TCTCACGCACCTT	AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.2745G>A	chr1.hg19:g.247607349G>A		102.0	0.0		147.0	33.0	NM_004895	B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Silent	SNP	ENST00000336119.3	hg19	CCDS1632.1																																																																																			.	.		0.512	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097740.1	NM_004895	
MYT1L	23040	hgsc.bcm.edu	37	2	1926738	1926738	+	Missense_Mutation	SNP	A	A	G			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr2:1926738A>G	ENST00000399161.2	-	10	1550	c.803T>C	c.(802-804)tTa>tCa	p.L268S	MYT1L_ENST00000428368.2_Missense_Mutation_p.L268S	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	268					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		TCCTTGGGCTAATAGTTTAAG	0.413																																					p.L268S		Atlas-SNP	.											.	MYT1L	241	.	0			c.T803C						.						189.0	183.0	185.0					2																	1926738		1958	4150	6108	SO:0001583	missense	23040	exon10			TGGGCTAATAGTT	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.803T>C	chr2.hg19:g.1926738A>G	ENSP00000382114:p.Leu268Ser	124.0	0.0		124.0	25.0	NM_015025	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	ENST00000399161.2	hg19		.	.	.	.	.	.	.	.	.	.	A	13.39	2.221583	0.39300	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000428368	T;T	0.59772	0.24;0.24	6.07	6.07	0.98685	.	0.082418	0.49305	D	0.000150	T	0.64757	0.2627	L	0.34521	1.04	0.33530	D	0.593518	D;D	0.89917	0.981;1.0	P;D	0.91635	0.69;0.999	T	0.64002	-0.6509	10	0.10636	T	0.68	-12.8367	16.6288	0.85011	1.0:0.0:0.0:0.0	.	268;268	Q9UL68;Q9UL68-4	MYT1L_HUMAN;.	S	268;216;268	ENSP00000382114:L268S;ENSP00000396103:L268S	ENSP00000295067:L216S	L	-	2	0	MYT1L	1905745	1.000000	0.71417	0.003000	0.11579	0.024000	0.10985	9.248000	0.95456	2.326000	0.78906	0.533000	0.62120	TTA	.	.		0.413	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	NM_015025	
ASXL2	55252	hgsc.bcm.edu	37	2	25966699	25966699	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr2:25966699G>A	ENST00000435504.4	-	13	2800	c.2507C>T	c.(2506-2508)aCa>aTa	p.T836I	ASXL2_ENST00000404843.1_Missense_Mutation_p.T576I|ASXL2_ENST00000336112.4_Missense_Mutation_p.T808I|ASXL2_ENST00000272341.4_Missense_Mutation_p.T576I			Q76L83	ASXL2_HUMAN	additional sex combs like transcriptional regulator 2	836					adult heart development (GO:0007512)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone H3-K27 trimethylation (GO:1902466)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(3)	33	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGCAGGACCTGTTGGAGAAGG	0.507																																					p.T836I		Atlas-SNP	.											.	ASXL2	217	.	0			c.C2507T						.						178.0	177.0	177.0					2																	25966699		2038	4180	6218	SO:0001583	missense	55252	exon12			GGACCTGTTGGAG			2p24.1	2014-06-17	2014-06-17		ENSG00000143970	ENSG00000143970			23805	protein-coding gene	gene with protein product		612991	"""additional sex combs like 2 (Drosophila)"""			12888926	Standard	NM_018263		Approved	ASXH2, FLJ10898, KIAA1685	uc002rgs.2	Q76L83	OTTHUMG00000152176	ENST00000435504.4:c.2507C>T	chr2.hg19:g.25966699G>A	ENSP00000391447:p.Thr836Ile	88.0	0.0		83.0	37.0	NM_018263	Q53TC9|Q5H9U4|Q76L81|Q86XM1|Q9C0H8|Q9NV67	Missense_Mutation	SNP	ENST00000435504.4	hg19		.	.	.	.	.	.	.	.	.	.	G	12.16	1.853462	0.32791	.	.	ENSG00000143970	ENST00000435504;ENST00000336112;ENST00000404843;ENST00000272341	T;T;T;T	0.22539	1.95;1.95;2.26;2.26	5.57	1.7	0.24286	.	1.494570	0.03580	N	0.230053	T	0.19604	0.0471	L	0.43152	1.355	0.09310	N	1	P;B	0.40398	0.716;0.201	B;B	0.36666	0.23;0.075	T	0.22591	-1.0212	10	0.54805	T	0.06	5.8076	6.2669	0.20932	0.142:0.0:0.5956:0.2624	.	576;836	Q76L83-2;Q76L83	.;ASXL2_HUMAN	I	836;808;576;576	ENSP00000391447:T836I;ENSP00000337250:T808I;ENSP00000383920:T576I;ENSP00000272341:T576I	ENSP00000272341:T576I	T	-	2	0	ASXL2	25820203	0.013000	0.17824	0.004000	0.12327	0.978000	0.69477	1.392000	0.34486	0.033000	0.15463	-0.253000	0.11424	ACA	.	.		0.507	ASXL2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000325593.3	NM_018263	
FOSL2	2355	hgsc.bcm.edu	37	2	28635208	28635208	+	Missense_Mutation	SNP	T	T	C			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr2:28635208T>C	ENST00000264716.4	+	4	1737	c.874T>C	c.(874-876)Tca>Cca	p.S292P	FOSL2_ENST00000379619.1_Missense_Mutation_p.S284P|FOSL2_ENST00000545753.1_Missense_Mutation_p.S253P	NM_005253.3	NP_005244.1	P15408	FOSL2_HUMAN	FOS-like antigen 2	292					cell death (GO:0008219)|cellular response to hormone stimulus (GO:0032870)|female pregnancy (GO:0007565)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to mechanical stimulus (GO:0009612)|response to morphine (GO:0043278)|response to progesterone (GO:0032570)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(1)|large_intestine(3)|lung(1)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	14	Acute lymphoblastic leukemia(172;0.155)					GGAGCAGGAGTCACCCGCATC	0.622																																					p.S292P		Atlas-SNP	.											.	FOSL2	39	.	0			c.T874C						.						78.0	63.0	68.0					2																	28635208		2203	4300	6503	SO:0001583	missense	2355	exon4			CAGGAGTCACCCG		CCDS1766.1	2p23.3	2013-01-10			ENSG00000075426	ENSG00000075426		"""basic leucine zipper proteins"""	3798	protein-coding gene	gene with protein product		601575					Standard	NM_005253		Approved	FRA2, FLJ23306	uc002rma.3	P15408	OTTHUMG00000097832	ENST00000264716.4:c.874T>C	chr2.hg19:g.28635208T>C	ENSP00000264716:p.Ser292Pro	50.0	0.0		42.0	12.0	NM_005253	B2RD58|B3KP27|B4DYV4|Q6FG46	Missense_Mutation	SNP	ENST00000264716.4	hg19	CCDS1766.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.003503	0.74932	.	.	ENSG00000075426	ENST00000379619;ENST00000264716;ENST00000545753	T;T;T	0.78481	-1.18;-0.17;-1.16	5.71	5.71	0.89125	.	0.574568	0.18921	N	0.127495	T	0.81470	0.4829	L	0.49350	1.555	0.54753	D	0.999988	D	0.65815	0.995	P	0.53185	0.72	T	0.83150	-0.0104	10	0.72032	D	0.01	-14.0961	15.9725	0.80031	0.0:0.0:0.0:1.0	.	292	P15408	FOSL2_HUMAN	P	284;292;253	ENSP00000368939:S284P;ENSP00000264716:S292P;ENSP00000439303:S253P	ENSP00000264716:S292P	S	+	1	0	FOSL2	28488712	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	2.605000	0.46283	2.174000	0.68829	0.533000	0.62120	TCA	.	.		0.622	FOSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215116.2	NM_005253	
IL1RL2	8808	hgsc.bcm.edu	37	2	102808479	102808479	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr2:102808479G>A	ENST00000264257.2	+	4	514	c.388G>A	c.(388-390)Gat>Aat	p.D130N	IL1RL2_ENST00000481806.1_Intron|IL1RL2_ENST00000539491.1_Missense_Mutation_p.D130N|IL1RL2_ENST00000441515.2_Intron	NM_003854.2	NP_003845.2	Q9HB29	ILRL2_HUMAN	interleukin 1 receptor-like 2	130	Ig-like C2-type 2.				cellular defense response (GO:0006968)|cytokine-mediated signaling pathway (GO:0019221)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of T cell differentiation (GO:0045582)|regulation of inflammatory response (GO:0050727)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type I, activating receptor activity (GO:0004909)			breast(1)|cervix(1)|endometrium(5)|large_intestine(6)|liver(2)|lung(8)|ovary(2)|prostate(1)	26						AAATTTATCAGATGAGTACAA	0.368																																					p.D130N		Atlas-SNP	.											.	IL1RL2	118	.	0			c.G388A						.						106.0	103.0	104.0					2																	102808479		2203	4300	6503	SO:0001583	missense	8808	exon4			TTATCAGATGAGT	U49065	CCDS2056.1	2q12	2013-01-14			ENSG00000115598	ENSG00000115598		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5999	protein-coding gene	gene with protein product		604512				8898719, 10191101, 11466363	Standard	NM_003854		Approved	IL1R-rp2, IL1RRP2	uc002tbs.3	Q9HB29	OTTHUMG00000130776	ENST00000264257.2:c.388G>A	chr2.hg19:g.102808479G>A	ENSP00000264257:p.Asp130Asn	351.0	0.0		318.0	59.0	NM_003854	A4FU63|Q13525|Q45H74|Q53TU8|Q587I8	Missense_Mutation	SNP	ENST00000264257.2	hg19	CCDS2056.1	.	.	.	.	.	.	.	.	.	.	G	13.68	2.308224	0.40895	.	.	ENSG00000115598	ENST00000264257;ENST00000421464;ENST00000539491	T;T;T	0.12361	2.69;2.69;2.69	4.87	-1.8	0.07907	Immunoglobulin-like (1);	1.386070	0.04654	N	0.407677	T	0.09686	0.0238	L	0.41079	1.255	0.09310	N	1	B	0.17268	0.021	B	0.21360	0.034	T	0.35943	-0.9768	10	0.23891	T	0.37	.	0.2421	0.00193	0.2704:0.1474:0.281:0.3012	.	130	Q9HB29	ILRL2_HUMAN	N	130	ENSP00000264257:D130N;ENSP00000387611:D130N;ENSP00000442184:D130N	ENSP00000264257:D130N	D	+	1	0	IL1RL2	102174911	0.000000	0.05858	0.001000	0.08648	0.728000	0.41692	-0.256000	0.08757	-0.144000	0.11314	0.655000	0.94253	GAT	.	.		0.368	IL1RL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253290.1	NM_003854	
MAP3K2	10746	hgsc.bcm.edu	37	2	128084382	128084382	+	Missense_Mutation	SNP	T	T	C			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr2:128084382T>C	ENST00000409947.1	-	8	760	c.478A>G	c.(478-480)Aga>Gga	p.R160G	MAP3K2_ENST00000344908.5_Missense_Mutation_p.R160G			Q9Y2U5	M3K2_HUMAN	mitogen-activated protein kinase kinase kinase 2	160					activation of JUN kinase activity (GO:0007257)|activation of MAPK activity (GO:0000187)|cellular response to mechanical stimulus (GO:0071260)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|large_intestine(1)|lung(3)|ovary(2)	7	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0706)	Bosutinib(DB06616)	CTTCTATCTCTACTAGTAGGA	0.358																																					p.R160G		Atlas-SNP	.											.	MAP3K2	78	.	0			c.A478G						.						79.0	79.0	79.0					2																	128084382		1808	4076	5884	SO:0001583	missense	10746	exon7			TATCTCTACTAGT	AF111105	CCDS46404.1	2q21.1	2011-06-09			ENSG00000169967	ENSG00000169967		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6854	protein-coding gene	gene with protein product	"""MAP/ERK kinase kinase 2"""	609487		MEKK2		8621389, 10085062	Standard	NM_006609		Approved	MEKK2B	uc002toj.2	Q9Y2U5	OTTHUMG00000153397	ENST00000409947.1:c.478A>G	chr2.hg19:g.128084382T>C	ENSP00000387246:p.Arg160Gly	67.0	0.0		83.0	25.0	NM_006609	B9EG87|Q53QL9|Q53S75|Q59GZ6|Q8NC32|Q9NYK3	Missense_Mutation	SNP	ENST00000409947.1	hg19	CCDS46404.1	.	.	.	.	.	.	.	.	.	.	T	12.92	2.083803	0.36758	.	.	ENSG00000169967	ENST00000409947;ENST00000344908	T;T	0.67171	-0.25;-0.25	5.73	5.73	0.89815	.	0.046997	0.85682	D	0.000000	T	0.45397	0.1340	N	0.08118	0	0.45914	D	0.998756	B	0.23128	0.08	B	0.23275	0.045	T	0.42275	-0.9461	10	0.22109	T	0.4	.	12.2793	0.54755	0.0:0.0:0.1809:0.8191	.	160	Q9Y2U5	M3K2_HUMAN	G	160	ENSP00000387246:R160G;ENSP00000343463:R160G	ENSP00000343463:R160G	R	-	1	2	MAP3K2	127800852	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	5.646000	0.67916	2.187000	0.69744	0.402000	0.26972	AGA	.	.		0.358	MAP3K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331014.1	NM_006609	
ZRANB3	84083	hgsc.bcm.edu	37	2	136026637	136026637	+	Silent	SNP	T	T	C			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr2:136026637T>C	ENST00000264159.6	-	11	1397	c.1281A>G	c.(1279-1281)gcA>gcG	p.A427A	ZRANB3_ENST00000401392.1_Silent_p.A427A|ZRANB3_ENST00000536680.1_Silent_p.A427A	NM_032143.2	NP_115519.2	Q5FWF4	ZRAB3_HUMAN	zinc finger, RAN-binding domain containing 3	427	DNA annealing helicase activity.|Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|DNA rewinding (GO:0036292)|DNA strand renaturation (GO:0000733)|negative regulation of DNA recombination (GO:0045910)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to UV (GO:0009411)	nuclear replication fork (GO:0043596)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|endodeoxyribonuclease activity (GO:0004520)|helicase activity (GO:0004386)|K63-linked polyubiquitin binding (GO:0070530)|zinc ion binding (GO:0008270)			NS(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|upper_aerodigestive_tract(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.135)		CTCGGTCTTCTGCTTGTTTTA	0.403																																					p.A427A		Atlas-SNP	.											.	ZRANB3	109	.	0			c.A1281G						.						144.0	136.0	139.0					2																	136026637		1841	4092	5933	SO:0001819	synonymous_variant	84083	exon11			GTCTTCTGCTTGT	AL136824	CCDS46419.1, CCDS67963.1, CCDS74580.1	2q21.3	2013-05-13			ENSG00000121988	ENSG00000121988		"""Zinc fingers, RAN-binding domain containing"""	25249	protein-coding gene	gene with protein product						11230166	Standard	XM_005263809		Approved	DKFZP434B1727	uc002tum.3	Q5FWF4	OTTHUMG00000150475	ENST00000264159.6:c.1281A>G	chr2.hg19:g.136026637T>C		70.0	0.0		82.0	40.0	NM_032143	B3KYA1|B4E375|B5MDI3|D3DP76|E9PBP0|Q53SM1|Q6P2C4|Q8N1P4|Q9H0E8	Silent	SNP	ENST00000264159.6	hg19	CCDS46419.1																																																																																			.	.		0.403	ZRANB3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318254.1	NM_032143	
WDR12	55759	hgsc.bcm.edu	37	2	203765765	203765765	+	Missense_Mutation	SNP	T	T	C			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr2:203765765T>C	ENST00000261015.4	-	3	963	c.214A>G	c.(214-216)Atg>Gtg	p.M72V	WDR12_ENST00000477723.1_5'UTR	NM_018256.3	NP_060726.3			WD repeat domain 12											endometrium(3)|large_intestine(1)|liver(1)|lung(6)|prostate(1)|skin(1)	13						ATGTTCTCCATTTCCATGTGT	0.368																																					p.M72V		Atlas-SNP	.											.	WDR12	35	.	0			c.A214G						.						120.0	98.0	105.0					2																	203765765		2203	4300	6503	SO:0001583	missense	55759	exon3			TCTCCATTTCCAT	AF242546	CCDS2356.1	2q33.1	2013-01-09			ENSG00000138442	ENSG00000138442		"""WD repeat domain containing"""	14098	protein-coding gene	gene with protein product						16043514, 17353269	Standard	NM_018256		Approved	YTM1, FLJ10881	uc002uzl.3	Q9GZL7	OTTHUMG00000132855	ENST00000261015.4:c.214A>G	chr2.hg19:g.203765765T>C	ENSP00000261015:p.Met72Val	74.0	0.0		67.0	13.0	NM_018256		Missense_Mutation	SNP	ENST00000261015.4	hg19	CCDS2356.1	.	.	.	.	.	.	.	.	.	.	T	8.634	0.894445	0.17613	.	.	ENSG00000138442	ENST00000261015	T	0.54866	0.55	5.83	1.84	0.25277	WD40 repeat-like-containing domain (1);	0.437153	0.25101	N	0.033138	T	0.29783	0.0744	N	0.22421	0.69	0.23809	N	0.996785	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.10894	-1.0610	10	0.30078	T	0.28	-0.6813	1.9179	0.03301	0.1492:0.3162:0.2896:0.245	.	72;72	Q53T99;Q9GZL7	.;WDR12_HUMAN	V	72	ENSP00000261015:M72V	ENSP00000261015:M72V	M	-	1	0	WDR12	203474010	0.963000	0.33076	0.998000	0.56505	0.933000	0.57130	0.250000	0.18235	0.047000	0.15862	-0.223000	0.12442	ATG	.	.		0.368	WDR12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256329.4	NM_018256	
IDH1	3417	hgsc.bcm.edu	37	2	209104688	209104688	+	Missense_Mutation	SNP	C	C	G			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr2:209104688C>G	ENST00000415913.1	-	8	1271	c.890G>C	c.(889-891)tGt>tCt	p.C297S	IDH1_ENST00000345146.2_Missense_Mutation_p.C297S|IDH1_ENST00000446179.1_Missense_Mutation_p.C297S	NM_001282387.1	NP_001269316.1	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	297					2-oxoglutarate metabolic process (GO:0006103)|cellular lipid metabolic process (GO:0044255)|female gonad development (GO:0008585)|glutathione metabolic process (GO:0006749)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|NADPH regeneration (GO:0006740)|response to oxidative stress (GO:0006979)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|biliary_tract(24)|bone(237)|central_nervous_system(3764)|endometrium(3)|haematopoietic_and_lymphoid_tissue(794)|kidney(2)|large_intestine(7)|lung(7)|prostate(6)|skin(5)|soft_tissue(12)|thyroid(22)|urinary_tract(1)	4887				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		GCCATCTGGACAAACCAGCAC	0.542			Mis		gliobastoma																																p.C297S	Pancreas(158;264 1958 3300 35450 36047)	Atlas-SNP	.		Dom	yes		2	2q33.3	3417	"""isocitrate dehydrogenase 1 (NADP+), soluble"""		O	.	IDH1	6310	.	0			c.G890C						.						137.0	106.0	117.0					2																	209104688		2203	4300	6503	SO:0001583	missense	3417	exon8			TCTGGACAAACCA		CCDS2381.1	2q34	2014-09-17			ENSG00000138413	ENSG00000138413	1.1.1.42		5382	protein-coding gene	gene with protein product		147700					Standard	NM_005896		Approved		uc002vcu.3	O75874	OTTHUMG00000132943	ENST00000415913.1:c.890G>C	chr2.hg19:g.209104688C>G	ENSP00000390265:p.Cys297Ser	80.0	0.0		50.0	18.0	NM_005896	Q567U4|Q6FHQ6|Q7Z3V0|Q93090|Q9NTJ9|Q9UKW8	Missense_Mutation	SNP	ENST00000415913.1	hg19	CCDS2381.1	.	.	.	.	.	.	.	.	.	.	C	19.27	3.795048	0.70452	.	.	ENSG00000138413	ENST00000345146;ENST00000446179;ENST00000415913	T;T;T	0.74737	-0.87;-0.87;-0.87	6.08	6.08	0.98989	Isopropylmalate dehydrogenase-like domain (2);	0.039026	0.85682	N	0.000000	T	0.81522	0.4840	L	0.31926	0.97	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.78800	-0.2062	10	0.38643	T	0.18	-8.9644	20.2672	0.98462	0.0:1.0:0.0:0.0	.	297	O75874	IDHC_HUMAN	S	297	ENSP00000260985:C297S;ENSP00000410513:C297S;ENSP00000390265:C297S	ENSP00000260985:C297S	C	-	2	0	IDH1	208812933	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.794000	0.85869	2.894000	0.99253	0.591000	0.81541	TGT	.	.		0.542	IDH1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336672.1		
ERBB4	2066	hgsc.bcm.edu	37	2	212251640	212251640	+	Missense_Mutation	SNP	C	C	A			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr2:212251640C>A	ENST00000342788.4	-	27	3729	c.3419G>T	c.(3418-3420)aGc>aTc	p.S1140I	ERBB4_ENST00000402597.1_Missense_Mutation_p.S1130I|ERBB4_ENST00000436443.1_Missense_Mutation_p.S1124I	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	1140					cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	TCCTCGTGGGCTCCGTTCTGG	0.532										TSP Lung(8;0.080)																											p.S1140I		Atlas-SNP	.											.	ERBB4	480	.	0			c.G3419T						.						157.0	143.0	148.0					2																	212251640		2203	4300	6503	SO:0001583	missense	2066	exon27			CGTGGGCTCCGTT	L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.3419G>T	chr2.hg19:g.212251640C>A	ENSP00000342235:p.Ser1140Ile	136.0	0.0		121.0	24.0	NM_005235	B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	ENST00000342788.4	hg19	CCDS2394.1	.	.	.	.	.	.	.	.	.	.	C	13.38	2.219040	0.39201	.	.	ENSG00000178568	ENST00000342788;ENST00000436443;ENST00000402597	T;T;T	0.76186	-0.97;-1.0;-0.97	5.6	1.55	0.23275	.	0.705369	0.15165	N	0.276955	T	0.51176	0.1659	N	0.14661	0.345	0.21878	N	0.999492	B;B;B;B	0.15473	0.012;0.013;0.012;0.002	B;B;B;B	0.17098	0.004;0.017;0.004;0.002	T	0.40059	-0.9583	10	0.51188	T	0.08	.	1.7125	0.02895	0.1384:0.4338:0.1208:0.307	.	1114;1130;1124;1140	Q15303-4;Q15303-2;Q15303-3;Q15303	.;.;.;ERBB4_HUMAN	I	1140;1124;1130	ENSP00000342235:S1140I;ENSP00000403204:S1124I;ENSP00000385565:S1130I	ENSP00000342235:S1140I	S	-	2	0	ERBB4	211959885	0.301000	0.24444	1.000000	0.80357	0.996000	0.88848	0.957000	0.29215	0.306000	0.22856	0.462000	0.41574	AGC	.	.		0.532	ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1	NM_001042599	
XRCC5	7520	hgsc.bcm.edu	37	2	216977745	216977745	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr2:216977745G>A	ENST00000392133.3	+	4	489	c.28G>A	c.(28-30)Gtt>Att	p.V10I	XRCC5_ENST00000392132.2_Missense_Mutation_p.V10I			P13010	XRCC5_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)	10					brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular hyperosmotic salinity response (GO:0071475)|cellular response to fatty acid (GO:0071398)|cellular response to X-ray (GO:0071481)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|hematopoietic stem cell differentiation (GO:0060218)|innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neurogenesis (GO:0050769)|positive regulation of type I interferon production (GO:0032481)|response to drug (GO:0042493)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|Ku70:Ku80 complex (GO:0043564)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nuclear chromosome, telomeric region (GO:0000784)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|telomeric DNA binding (GO:0042162)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			endometrium(1)|kidney(3)|large_intestine(8)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		Renal(323;0.0328)		Epithelial(149;9.78e-06)|all cancers(144;0.000632)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.0117)		CCAGGCAGCTGTTGTGCTGTG	0.398								Non-homologous end-joining																													p.V10I		Atlas-SNP	.											.	XRCC5	64	.	0			c.G28A						.						161.0	155.0	157.0					2																	216977745		2203	4300	6503	SO:0001583	missense	7520	exon2			GCAGCTGTTGTGC	AF039597	CCDS2402.1	2q35	2008-07-31	2008-07-31		ENSG00000079246	ENSG00000079246			12833	protein-coding gene	gene with protein product	"""Ku autoantigen, 80kDa"""	194364	"""X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining; Ku autoantigen, 80kD)"""			9636207, 9214634	Standard	NM_021141		Approved	KU80, KARP-1, Ku86, KUB2	uc002vfy.3	P13010	OTTHUMG00000133059	ENST00000392133.3:c.28G>A	chr2.hg19:g.216977745G>A	ENSP00000375978:p.Val10Ile	97.0	0.0		89.0	19.0	NM_021141	A8K3X5|Q0Z7V0|Q4VBQ5|Q53HH7|Q7M4N0|Q9UCQ0|Q9UCQ1	Missense_Mutation	SNP	ENST00000392133.3	hg19	CCDS2402.1	.	.	.	.	.	.	.	.	.	.	G	9.363	1.068448	0.20067	.	.	ENSG00000079246	ENST00000392133;ENST00000392132	T;T	0.30182	1.54;1.54	5.12	4.24	0.50183	Ku70/Ku80, N-terminal alpha/beta (1);von Willebrand factor, type A (1);	0.167952	0.41500	D	0.000877	T	0.21962	0.0529	L	0.38838	1.175	0.36287	D	0.856165	B	0.17667	0.023	B	0.15870	0.014	T	0.14980	-1.0453	10	0.22109	T	0.4	.	9.2892	0.37775	0.1802:0.0:0.8198:0.0	.	10	P13010	XRCC5_HUMAN	I	10	ENSP00000375978:V10I;ENSP00000375977:V10I	ENSP00000375977:V10I	V	+	1	0	XRCC5	216685990	0.859000	0.29813	1.000000	0.80357	0.463000	0.32649	0.768000	0.26590	1.387000	0.46486	0.655000	0.94253	GTT	.	.		0.398	XRCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256675.3	NM_021141	
IGFBP5	3488	hgsc.bcm.edu	37	2	217559447	217559447	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr2:217559447C>T	ENST00000233813.4	-	1	801	c.52G>A	c.(52-54)Gcc>Acc	p.A18T	AC007563.5_ENST00000447289.1_RNA	NM_000599.3	NP_000590.1	P24593	IBP5_HUMAN	insulin-like growth factor binding protein 5	18					cellular protein metabolic process (GO:0044267)|cellular response to cAMP (GO:0071320)|cellular response to organic cyclic compound (GO:0071407)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|hair follicle morphogenesis (GO:0031069)|intracellular signal transduction (GO:0035556)|mammary gland involution (GO:0060056)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of translation (GO:0017148)|osteoblast differentiation (GO:0001649)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell growth (GO:0001558)|regulation of glucose metabolic process (GO:0010906)|signal transduction (GO:0007165)|skeletal muscle tissue growth (GO:0048630)|striated muscle cell differentiation (GO:0051146)|type B pancreatic cell proliferation (GO:0044342)	extracellular region (GO:0005576)|insulin-like growth factor binding protein complex (GO:0016942)	insulin-like growth factor I binding (GO:0031994)			endometrium(1)|large_intestine(3)|lung(1)	5		Renal(323;0.0822)		Epithelial(149;2.1e-06)|all cancers(144;0.000165)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGGCTCTGGGCCGGCCCCGCA	0.687																																					p.A18T		Atlas-SNP	.											.	IGFBP5	13	.	0			c.G52A						.						4.0	6.0	5.0					2																	217559447		1887	3937	5824	SO:0001583	missense	3488	exon1			TCTGGGCCGGCCC		CCDS2405.1	2q35	2014-09-16			ENSG00000115461	ENSG00000115461			5474	protein-coding gene	gene with protein product		146734				7511611	Standard	NM_000599		Approved		uc002vgj.4	P24593	OTTHUMG00000133058	ENST00000233813.4:c.52G>A	chr2.hg19:g.217559447C>T	ENSP00000233813:p.Ala18Thr	93.0	0.0		83.0	27.0	NM_000599	Q5U0A3	Missense_Mutation	SNP	ENST00000233813.4	hg19	CCDS2405.1	.	.	.	.	.	.	.	.	.	.	C	13.96	2.393844	0.42410	.	.	ENSG00000115461	ENST00000233813;ENST00000449583	T;T	0.29397	1.57;2.09	4.32	2.27	0.28462	.	0.277575	0.35013	N	0.003513	T	0.14098	0.0341	N	0.16368	0.405	0.26804	N	0.969136	B	0.02656	0.0	B	0.01281	0.0	T	0.11767	-1.0574	10	0.19590	T	0.45	-23.989	4.9375	0.13948	0.3288:0.5621:0.0:0.1091	.	18	P24593	IBP5_HUMAN	T	18	ENSP00000233813:A18T;ENSP00000413474:A18T	ENSP00000233813:A18T	A	-	1	0	IGFBP5	217267692	0.986000	0.35501	0.981000	0.43875	0.950000	0.60333	1.234000	0.32660	1.938000	0.56188	0.455000	0.32223	GCC	.	.		0.687	IGFBP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256674.2	NM_000599	
SLC4A3	6508	hgsc.bcm.edu	37	2	220502908	220502908	+	Missense_Mutation	SNP	T	T	A			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr2:220502908T>A	ENST00000358055.3	+	18	3301	c.2789T>A	c.(2788-2790)tTt>tAt	p.F930Y	SLC4A3_ENST00000273063.6_Missense_Mutation_p.F957Y|SLC4A3_ENST00000373762.3_Missense_Mutation_p.F957Y|SLC4A3_ENST00000373760.2_Missense_Mutation_p.F930Y|SLC4A3_ENST00000317151.3_Missense_Mutation_p.F930Y			P48751	B3A3_HUMAN	solute carrier family 4 (anion exchanger), member 3	930	Membrane (anion exchange).				bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	51		Renal(207;0.0183)		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		ATCGGGGACTTTGGCATCCCC	0.597																																					p.F957Y		Atlas-SNP	.											.	SLC4A3	144	.	0			c.T2870A						.						83.0	56.0	66.0					2																	220502908		2203	4300	6503	SO:0001583	missense	6508	exon18			GGGACTTTGGCAT		CCDS2445.1, CCDS2446.1	2q35	2013-07-19	2013-07-19		ENSG00000114923	ENSG00000114923		"""Solute carriers"""	11029	protein-coding gene	gene with protein product	"""Anion exchanger 3, neuronal"""	106195	"""solute carrier family 4, anion exchanger, member 3"""			8001971	Standard	NM_005070		Approved	AE3, SLC2C	uc002vmo.4	P48751	OTTHUMG00000059238	ENST00000358055.3:c.2789T>A	chr2.hg19:g.220502908T>A	ENSP00000350756:p.Phe930Tyr	68.0	0.0		36.0	7.0	NM_201574	A6H8L2|A8K1Q9|B7ZVX6|B9EGD1|Q6YIQ9	Missense_Mutation	SNP	ENST00000358055.3	hg19	CCDS2445.1	.	.	.	.	.	.	.	.	.	.	T	33	5.272296	0.95429	.	.	ENSG00000114923	ENST00000358055;ENST00000373760;ENST00000273063;ENST00000373762;ENST00000356251;ENST00000317151	D;D;D;D;D	0.85629	-2.01;-2.01;-2.01;-2.01;-2.01	4.84	4.84	0.62591	Bicarbonate transporter, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.91945	0.7449	M	0.77486	2.375	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.93041	0.6457	10	0.87932	D	0	.	14.928	0.70893	0.0:0.0:0.0:1.0	.	634;930;957	P48751-2;P48751;P48751-3	.;B3A3_HUMAN;.	Y	930;930;957;957;190;930	ENSP00000350756:F930Y;ENSP00000362865:F930Y;ENSP00000273063:F957Y;ENSP00000362867:F957Y;ENSP00000314006:F930Y	ENSP00000273063:F957Y	F	+	2	0	SLC4A3	220211152	1.000000	0.71417	0.878000	0.34440	0.987000	0.75469	7.752000	0.85141	2.168000	0.68352	0.529000	0.55759	TTT	.	.		0.597	SLC4A3-009	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316472.1	NM_005070	
ADCY5	111	hgsc.bcm.edu	37	3	123166784	123166784	+	Silent	SNP	C	C	T			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr3:123166784C>T	ENST00000462833.1	-	1	1821	c.609G>A	c.(607-609)ctG>ctA	p.L203L		NM_183357.2	NP_899200.1	O95622	ADCY5_HUMAN	adenylate cyclase 5	203					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(22)|ovary(5)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(114;0.0342)		CGCCCAGGGACAGCAccgcgc	0.726																																					p.L203L		Atlas-SNP	.											.	ADCY5	169	.	0			c.G609A						.						7.0	8.0	8.0					3																	123166784		2143	4202	6345	SO:0001819	synonymous_variant	111	exon1			CAGGGACAGCACC	U65473	CCDS3022.1, CCDS56274.1	3q21.1	2013-02-04			ENSG00000173175	ENSG00000173175	4.6.1.1	"""Adenylate cyclases"""	236	protein-coding gene	gene with protein product		600293				10481931	Standard	NM_183357		Approved	AC5	uc003egh.2	O95622	OTTHUMG00000159517	ENST00000462833.1:c.609G>A	chr3.hg19:g.123166784C>T		43.0	0.0		43.0	13.0	NM_183357	B7Z8A6|Q7RTV7|Q8NFM3	Silent	SNP	ENST00000462833.1	hg19	CCDS3022.1																																																																																			.	.		0.726	ADCY5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355889.4	XM_171048	
TRIM42	287015	hgsc.bcm.edu	37	3	140406640	140406640	+	Silent	SNP	G	G	A			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr3:140406640G>A	ENST00000286349.3	+	3	1307	c.1116G>A	c.(1114-1116)aaG>aaA	p.K372K		NM_152616.4	NP_689829.3	Q8IWZ5	TRI42_HUMAN	tripartite motif containing 42	372						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(11)|lung(33)|ovary(2)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						AGGAGGCAAAGCGAAAAGAGA	0.393																																					p.K372K		Atlas-SNP	.											.	TRIM42	143	.	0			c.G1116A						.						62.0	62.0	62.0					3																	140406640		2203	4300	6503	SO:0001819	synonymous_variant	287015	exon3			GGCAAAGCGAAAA	AF521868	CCDS3113.1	3q23	2014-02-17	2011-01-25		ENSG00000155890	ENSG00000155890		"""Tripartite motif containing / Tripartite motif containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	19014	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 40"""		"""tripartite motif-containing 42"""				Standard	NM_152616		Approved	FLJ40097, PPP1R40	uc003eto.2	Q8IWZ5	OTTHUMG00000160170	ENST00000286349.3:c.1116G>A	chr3.hg19:g.140406640G>A		200.0	0.0		137.0	47.0	NM_152616	A1L4B4|Q8N832|Q8NDL3	Silent	SNP	ENST00000286349.3	hg19	CCDS3113.1																																																																																			.	.		0.393	TRIM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359531.2	NM_152616	
MECOM	2122	hgsc.bcm.edu	37	3	168840444	168840444	+	Missense_Mutation	SNP	T	T	A			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr3:168840444T>A	ENST00000464456.1	-	5	1538	c.338A>T	c.(337-339)aAc>aTc	p.N113I	MECOM_ENST00000392736.3_Missense_Mutation_p.N113I|MECOM_ENST00000264674.3_Missense_Mutation_p.N177I|MECOM_ENST00000472280.1_Missense_Mutation_p.N113I|MECOM_ENST00000468789.1_Missense_Mutation_p.N113I|MECOM_ENST00000494292.1_Missense_Mutation_p.N301I|MECOM_ENST00000433243.2_Missense_Mutation_p.N113I|MECOM_ENST00000460814.1_Missense_Mutation_p.N113I	NM_001164000.1	NP_001157472.1	Q13465	MDS1_HUMAN	MDS1 and EVI1 complex locus	0					regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	85						GGACTTCCAGTTAAATGCCTT	0.403																																					p.N301I		Atlas-SNP	.											.	MECOM	216	.	0			c.A902T						.						238.0	199.0	212.0					3																	168840444		2203	4300	6503	SO:0001583	missense	2122	exon6			TTCCAGTTAAATG	S82592, AF164154	CCDS3205.1, CCDS54669.1, CCDS54670.1	3q26.2	2013-01-08	2009-08-07	2009-08-07	ENSG00000085276	ENSG00000085276		"""Zinc fingers, C2H2-type"""	3498	protein-coding gene	gene with protein product		165215	"""myelodysplasia syndrome 1"", ""ecotropic viral integration site 1"""	MDS1, EVI1		2115646, 8171026, 8643684	Standard	NM_001105077		Approved	MDS1-EVI1, PRDM3	uc011bpj.1	Q03112	OTTHUMG00000158596	ENST00000464456.1:c.338A>T	chr3.hg19:g.168840444T>A	ENSP00000419770:p.Asn113Ile	130.0	0.0		95.0	32.0	NM_004991	Q13466|Q6FH90	Missense_Mutation	SNP	ENST00000464456.1	hg19	CCDS54669.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.125075	0.77436	.	.	ENSG00000085276	ENST00000264674;ENST00000392736;ENST00000464456;ENST00000472280;ENST00000494292;ENST00000468789;ENST00000460814;ENST00000433243;ENST00000492586;ENST00000484519	T;T;T;T;T;T;T;T;T;T	0.27557	2.49;2.5;2.5;2.49;2.5;2.5;2.5;2.49;2.5;1.66	5.68	4.51	0.55191	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.266003	0.32372	N	0.006197	T	0.37128	0.0992	N	0.13140	0.3	0.54753	D	0.999989	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.999;0.999;0.999	T	0.31251	-0.9950	10	0.62326	D	0.03	-16.2494	12.1338	0.53959	0.1285:0.0:0.0:0.8715	.	301;113;301;177;113	Q03112-3;Q03112-6;E7EQ57;Q03112-4;Q03112	.;.;.;.;EVI1_HUMAN	I	177;113;113;113;301;113;113;113;88;113	ENSP00000264674:N177I;ENSP00000376493:N113I;ENSP00000419770:N113I;ENSP00000420048:N113I;ENSP00000417899:N301I;ENSP00000419995:N113I;ENSP00000420466:N113I;ENSP00000394302:N113I;ENSP00000417506:N88I;ENSP00000417299:N113I	ENSP00000264674:N177I	N	-	2	0	MECOM	170323138	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.698000	0.84413	0.965000	0.38133	0.533000	0.62120	AAC	.	.		0.403	MECOM-020	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000351519.1	NM_005241, NM_004991	
KIT	3815	hgsc.bcm.edu	37	4	55595596	55595596	+	Missense_Mutation	SNP	G	G	T			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr4:55595596G>T	ENST00000288135.5	+	14	2183	c.2086G>T	c.(2086-2088)Gat>Tat	p.D696Y		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	696	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	AAAGCAGGAAGATCATGCAGA	0.368		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																												p.D696Y		Atlas-SNP	.	yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	.	KIT	7396	.	0			c.G2086T						.						109.0	113.0	111.0					4																	55595596		2203	4300	6503	SO:0001583	missense	3815	exon14	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	CAGGAAGATCATG	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.2086G>T	chr4.hg19:g.55595596G>T	ENSP00000288135:p.Asp696Tyr	74.0	0.0		66.0	16.0	NM_000222	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	ENST00000288135.5	hg19	CCDS3496.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.970424	0.74246	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	D;D	0.88975	-2.45;-2.45	5.93	5.93	0.95920	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.380730	0.25178	N	0.032559	D	0.93354	0.7881	L	0.50333	1.59	0.58432	D	0.999993	D;D;D	0.89917	0.992;0.999;1.0	P;D;D	0.78314	0.843;0.977;0.991	D	0.93259	0.6641	10	0.87932	D	0	.	20.3363	0.98740	0.0:0.0:1.0:0.0	.	203;692;696	D5MAV8;P10721-2;P10721	.;.;KIT_HUMAN	Y	696;692	ENSP00000288135:D696Y;ENSP00000390987:D692Y	ENSP00000288135:D696Y	D	+	1	0	KIT	55290353	1.000000	0.71417	0.998000	0.56505	0.737000	0.42083	8.844000	0.92147	2.814000	0.96858	0.563000	0.77884	GAT	.	.		0.368	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250618.1		
C4orf26	152816	hgsc.bcm.edu	37	4	76489344	76489344	+	Missense_Mutation	SNP	C	C	A			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr4:76489344C>A	ENST00000311623.4	+	2	123	c.88C>A	c.(88-90)Cct>Act	p.P30T	C4orf26_ENST00000435974.2_Silent_p.R44R	NM_001257072.1|NM_178497.3	NP_001244001.1|NP_848592.2	Q17RF5	CD026_HUMAN	chromosome 4 open reading frame 26	30			P -> L (in dbSNP:rs2306175). {ECO:0000269|PubMed:14702039}.			extracellular region (GO:0005576)				kidney(1)|large_intestine(4)|stomach(1)	6			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			GGTATTTACGCCTCCTGGAGA	0.537																																					p.P30T		Atlas-SNP	.											.	C4orf26	24	.	0			c.C88A						.						69.0	72.0	71.0					4																	76489344		2203	4300	6503	SO:0001583	missense	152816	exon2			TTTACGCCTCCTG	AK074237	CCDS3569.1, CCDS56334.1, CCDS75142.1	4q21.1	2012-10-31			ENSG00000174792	ENSG00000174792			26300	protein-coding gene	gene with protein product		614829				22901946	Standard	NM_001206981		Approved	FLJ23657	uc011cbo.2	Q17RF5	OTTHUMG00000130104	ENST00000311623.4:c.88C>A	chr4.hg19:g.76489344C>A	ENSP00000311307:p.Pro30Thr	87.0	0.0		79.0	12.0	NM_001257072	B4DTI3|E7ETQ0|Q8TEC3	Missense_Mutation	SNP	ENST00000311623.4	hg19	CCDS3569.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.967942	0.74131	.	.	ENSG00000174792	ENST00000311623	T	0.64803	-0.12	4.6	4.6	0.57074	.	0.145749	0.32120	N	0.006545	T	0.65407	0.2688	L	0.29908	0.895	0.80722	D	1	D	0.61080	0.989	P	0.61658	0.892	T	0.67507	-0.5653	10	0.59425	D	0.04	.	13.1663	0.59573	0.0:1.0:0.0:0.0	.	30	Q17RF5	CD026_HUMAN	T	30	ENSP00000311307:P30T	ENSP00000311307:P30T	P	+	1	0	C4orf26	76708368	0.188000	0.23250	0.294000	0.24946	0.207000	0.24258	3.303000	0.51858	2.569000	0.86673	0.551000	0.68910	CCT	.	.		0.537	C4orf26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252410.1	NM_178497	
THAP9	79725	hgsc.bcm.edu	37	4	83827764	83827764	+	Silent	SNP	A	A	T			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr4:83827764A>T	ENST00000302236.5	+	3	615	c.564A>T	c.(562-564)ctA>ctT	p.L188L		NM_024672.4	NP_078948.3	Q9H5L6	THAP9_HUMAN	THAP domain containing 9	188					DNA integration (GO:0015074)|DNA recombination (GO:0006310)|transposition, DNA-mediated (GO:0006313)		metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transferase activity (GO:0016740)|transposase activity (GO:0004803)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(13)|lung(5)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(3)	33		Hepatocellular(203;0.114)				AGTGTCTGCTACGAGCTCAAT	0.358																																					p.L188L		Atlas-SNP	.											.	THAP9	65	.	0			c.A564T						.						54.0	56.0	55.0					4																	83827764		2203	4300	6503	SO:0001819	synonymous_variant	79725	exon3			TCTGCTACGAGCT	AK091412	CCDS3598.1	4q21.3	2013-01-25			ENSG00000168152	ENSG00000168152		"""THAP (C2CH-type zinc finger) domain containing"""	23192	protein-coding gene	gene with protein product		612537				12575992	Standard	NM_024672		Approved	FLJ34093	uc003hnt.2	Q9H5L6	OTTHUMG00000130291	ENST00000302236.5:c.564A>T	chr4.hg19:g.83827764A>T		191.0	0.0		236.0	52.0	NM_024672	B3KRE2|Q59AC9	Silent	SNP	ENST00000302236.5	hg19	CCDS3598.1																																																																																			.	.		0.358	THAP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252633.1	NM_024672	
DAB2	1601	hgsc.bcm.edu	37	5	39383019	39383019	+	Missense_Mutation	SNP	C	C	A			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr5:39383019C>A	ENST00000320816.6	-	10	1509	c.1042G>T	c.(1042-1044)Gac>Tac	p.D348Y	DAB2_ENST00000545653.1_Missense_Mutation_p.D327Y|DAB2_ENST00000512525.1_5'Flank|DAB2_ENST00000339788.6_Intron|DAB2_ENST00000509337.1_Missense_Mutation_p.D327Y	NM_001343.3	NP_001334.2	P98082	DAB2_HUMAN	Dab, mitogen-responsive phosphoprotein, homolog 2 (Drosophila)	348	Required for localization to clathrin- coated pits. {ECO:0000250}.				activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cell morphogenesis involved in differentiation (GO:0000904)|cell proliferation (GO:0008283)|cellular response to transforming growth factor beta stimulus (GO:0071560)|clathrin coat assembly (GO:0048268)|endoderm development (GO:0007492)|excretion (GO:0007588)|in utero embryonic development (GO:0001701)|leading edge cell differentiation (GO:0035026)|membrane organization (GO:0061024)|myeloid cell differentiation (GO:0030099)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of protein binding (GO:0032091)|negative regulation of protein localization to plasma membrane (GO:1903077)|negative regulation of transcription, DNA-templated (GO:0045892)|pinocytosis (GO:0006907)|positive regulation of cell migration (GO:0030335)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of endocytosis (GO:0045807)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of receptor recycling (GO:0001921)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|clathrin coat of coated pit (GO:0030132)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	cargo receptor activity (GO:0038024)|clathrin adaptor activity (GO:0035615)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein C-terminus binding (GO:0008022)|SMAD binding (GO:0046332)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(5)|large_intestine(9)|lung(19)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	47	all_lung(31;0.000197)		Epithelial(62;0.137)			GAGATCTGGTCAAATTGCTGA	0.498																																					p.D348Y		Atlas-SNP	.											.	DAB2	124	.	0			c.G1042T						.						83.0	86.0	85.0					5																	39383019		2203	4300	6503	SO:0001583	missense	1601	exon10			TCTGGTCAAATTG	U53446	CCDS34149.1, CCDS58946.1	5p13.1	2013-10-03	2013-03-08		ENSG00000153071	ENSG00000153071			2662	protein-coding gene	gene with protein product		601236	"""disabled (Drosophila) homolog 2 (mitogen-responsive phosphoprotein)"", ""disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)"""			8660969, 9620555	Standard	NM_001343		Approved	DOC-2	uc003jlx.3	P98082	OTTHUMG00000162043	ENST00000320816.6:c.1042G>T	chr5.hg19:g.39383019C>A	ENSP00000313391:p.Asp348Tyr	53.0	0.0		41.0	9.0	NM_001343	A6NES5|Q13598|Q9BTY0|Q9UK04	Missense_Mutation	SNP	ENST00000320816.6	hg19	CCDS34149.1	.	.	.	.	.	.	.	.	.	.	C	18.00	3.525989	0.64860	.	.	ENSG00000153071	ENST00000320816;ENST00000545653;ENST00000509337	T;T;T	0.41758	1.0;0.99;0.99	5.73	5.73	0.89815	.	0.102151	0.64402	D	0.000003	T	0.64951	0.2645	M	0.62723	1.935	0.46901	D	0.999242	D;D	0.89917	1.0;1.0	D;D	0.75484	0.968;0.986	T	0.64947	-0.6287	10	0.87932	D	0	-15.0468	20.2602	0.98440	0.0:1.0:0.0:0.0	.	348;327	P98082;P98082-3	DAB2_HUMAN;.	Y	348;327;327	ENSP00000313391:D348Y;ENSP00000439919:D327Y;ENSP00000426245:D327Y	ENSP00000313391:D348Y	D	-	1	0	DAB2	39418776	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.577000	0.67444	2.861000	0.98227	0.655000	0.94253	GAC	.	.		0.498	DAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367014.1	NM_001343	
RASA1	5921	hgsc.bcm.edu	37	5	86629119	86629119	+	Silent	SNP	A	A	G			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr5:86629119A>G	ENST00000274376.6	+	4	1428	c.864A>G	c.(862-864)ctA>ctG	p.L288L	RASA1_ENST00000506290.1_Silent_p.L122L|RASA1_ENST00000456692.2_Silent_p.L111L|RASA1_ENST00000512763.1_Silent_p.L121L	NM_002890.2	NP_002881.1	P20936	RASA1_HUMAN	RAS p21 protein activator (GTPase activating protein) 1	288	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				blood vessel morphogenesis (GO:0048514)|embryo development (GO:0009790)|intracellular signal transduction (GO:0035556)|mitotic cytokinesis (GO:0000281)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|regulation of RNA metabolic process (GO:0051252)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|ruffle (GO:0001726)	glycoprotein binding (GO:0001948)|GTPase binding (GO:0051020)|potassium channel inhibitor activity (GO:0019870)|Ras GTPase activator activity (GO:0005099)|receptor binding (GO:0005102)			NS(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(12)|lung(13)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	48		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		GAGCTATTCTACCTTACACAA	0.308																																					p.L288L		Atlas-SNP	.											.	RASA1	213	.	0			c.A864G						.						71.0	76.0	75.0					5																	86629119		2203	4300	6503	SO:0001819	synonymous_variant	5921	exon4			TATTCTACCTTAC		CCDS34200.1, CCDS47243.1	5q13	2013-02-14			ENSG00000145715	ENSG00000145715		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	9871	protein-coding gene	gene with protein product	"""capillary malformation-arteriovenous malformation"""	139150		RASA		15917201	Standard	NM_022650		Approved	GAP, CM-AVM, p120GAP, p120RASGAP	uc003kiw.3	P20936	OTTHUMG00000162605	ENST00000274376.6:c.864A>G	chr5.hg19:g.86629119A>G		358.0	0.0		296.0	95.0	NM_002890	B2R6W3|Q9UDI1	Silent	SNP	ENST00000274376.6	hg19	CCDS34200.1																																																																																			.	.		0.308	RASA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369729.1	NM_002890	
BRD8	10902	hgsc.bcm.edu	37	5	137475827	137475827	+	Missense_Mutation	SNP	T	T	C			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr5:137475827T>C	ENST00000254900.5	-	27	4015	c.3644A>G	c.(3643-3645)aAa>aGa	p.K1215R	NME5_ENST00000265191.2_5'Flank	NM_139199.1	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8	1215					cell surface receptor signaling pathway (GO:0007166)|chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|intracellular receptor signaling pathway (GO:0030522)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid hormone receptor activity (GO:0004887)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(3)|urinary_tract(1)	35			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			ACTTGAGCCTTTTCTTTTGTC	0.373																																					p.K1215R		Atlas-SNP	.											.	BRD8	192	.	0			c.A3644G						.						155.0	150.0	152.0					5																	137475827		2203	4300	6503	SO:0001583	missense	10902	exon27			GAGCCTTTTCTTT	AF016270	CCDS4198.1, CCDS34241.1, CCDS54907.1	5q31	2008-02-05			ENSG00000112983	ENSG00000112983			19874	protein-coding gene	gene with protein product		602848				8611617, 9368056	Standard	NM_001164326		Approved	SMAP, p120	uc003lcf.1	Q9H0E9	OTTHUMG00000129204	ENST00000254900.5:c.3644A>G	chr5.hg19:g.137475827T>C	ENSP00000254900:p.Lys1215Arg	110.0	0.0		105.0	13.0	NM_139199	O43178|Q15355|Q58AB0|Q59GN0|Q969M9	Missense_Mutation	SNP	ENST00000254900.5	hg19	CCDS4198.1	.	.	.	.	.	.	.	.	.	.	T	0.012	-1.657231	0.00779	.	.	ENSG00000112983	ENST00000254900	T	0.22336	1.96	5.54	3.55	0.40652	.	0.251040	0.28544	N	0.014965	T	0.06508	0.0167	N	0.02916	-0.46	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.27773	-1.0064	10	0.02654	T	1	-0.8037	6.7984	0.23738	0.0:0.7567:0.0:0.2433	.	1215	Q9H0E9	BRD8_HUMAN	R	1215	ENSP00000254900:K1215R	ENSP00000254900:K1215R	K	-	2	0	BRD8	137503726	1.000000	0.71417	0.998000	0.56505	0.023000	0.10783	1.326000	0.33735	0.544000	0.28883	-0.408000	0.06270	AAA	.	.		0.373	BRD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251282.3	NM_006696	
OR5V1	81696	hgsc.bcm.edu	37	6	29323776	29323776	+	Missense_Mutation	SNP	A	A	C			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr6:29323776A>C	ENST00000377154.1	-	4	496	c.197T>G	c.(196-198)tTg>tGg	p.L66W	OR5V1_ENST00000543825.1_Missense_Mutation_p.L66W			Q9UGF6	OR5V1_HUMAN	olfactory receptor, family 5, subfamily V, member 1	66						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(3)|large_intestine(3)|liver(1)|lung(8)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						AATAAAGGCCAAGTTCCCTAG	0.413																																					p.L66W	Ovarian(32;43 883 21137 32120 42650)	Atlas-SNP	.											.	OR5V1	63	.	0			c.T197G						.						146.0	142.0	143.0					6																	29323776		2203	4300	6503	SO:0001583	missense	81696	exon1			AAGGCCAAGTTCC		CCDS4657.1	6p22.1	2013-09-23				ENSG00000243729		"""GPCR / Class A : Olfactory receptors"""	13972	protein-coding gene	gene with protein product							Standard	NM_030876		Approved	hs6M1-21	uc011dlo.2	Q9UGF6		ENST00000377154.1:c.197T>G	chr6.hg19:g.29323776A>C	ENSP00000366359:p.Leu66Trp	107.0	0.0		150.0	34.0	NM_030876	A2BDZ0|B0S860|Q5SQI9|Q6NTB5|Q8IVL3	Missense_Mutation	SNP	ENST00000377154.1	hg19	CCDS4657.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.114220	0.77210	.	.	ENSG00000243729	ENST00000377154;ENST00000377151;ENST00000543825	T;T	0.00590	6.36;6.36	4.36	4.36	0.52297	GPCR, rhodopsin-like superfamily (1);	0.000000	0.25352	N	0.031290	T	0.03095	0.0091	H	0.98542	4.26	0.29097	N	0.881741	D	0.89917	1.0	D	0.91635	0.999	T	0.16808	-1.0390	10	0.87932	D	0	-22.889	13.6517	0.62314	1.0:0.0:0.0:0.0	.	66	Q9UGF6	OR5V1_HUMAN	W	66	ENSP00000366359:L66W;ENSP00000443309:L66W	ENSP00000366356:L66W	L	-	2	0	OR5V1	29431755	0.676000	0.27567	0.840000	0.33206	0.991000	0.79684	6.204000	0.72143	1.956000	0.56807	0.438000	0.28831	TTG	.	.		0.413	OR5V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076398.3		
TRERF1	55809	hgsc.bcm.edu	37	6	42204142	42204142	+	Missense_Mutation	SNP	T	T	A			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr6:42204142T>A	ENST00000372922.4	-	16	3429	c.2867A>T	c.(2866-2868)gAa>gTa	p.E956V	TRERF1_ENST00000372917.4_Missense_Mutation_p.E873V|TRERF1_ENST00000340840.2_Missense_Mutation_p.E873V|TRERF1_ENST00000541110.1_Missense_Mutation_p.E976V|TRERF1_ENST00000354325.2_Missense_Mutation_p.E873V	NM_033502.2	NP_277037.1	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1	956	Glu-rich.|Interacts with CREBBP.				cholesterol catabolic process (GO:0006707)|homeostatic process (GO:0042592)|multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hormone biosynthetic process (GO:0046885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|steroid biosynthetic process (GO:0006694)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(2)|endometrium(7)|kidney(1)|large_intestine(12)|lung(13)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(2)	45	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			TTCTTCTTCTTCACTTGTCTA	0.473																																					p.E956V		Atlas-SNP	.											.	TRERF1	124	.	0			c.A2867T						.						53.0	51.0	52.0					6																	42204142		2162	4242	6404	SO:0001583	missense	55809	exon16			TCTTCTTCACTTG	AF297872	CCDS4867.1, CCDS75455.1	6p21.1-p12.1	2012-09-25			ENSG00000124496	ENSG00000124496			18273	protein-coding gene	gene with protein product		610322	"""breast cancer anti-estrogen resistance 2"""	BCAR2		11349124	Standard	XM_005249223		Approved	TReP-132, HSA277276, RAPA, dJ139D8.5	uc003osd.2	Q96PN7	OTTHUMG00000014698	ENST00000372922.4:c.2867A>T	chr6.hg19:g.42204142T>A	ENSP00000362013:p.Glu956Val	44.0	0.0		63.0	16.0	NM_033502	Q05GC6|Q7Z6T2|Q7Z6T3|Q9NQ72|Q9NQ73|Q9NUN9	Missense_Mutation	SNP	ENST00000372922.4	hg19	CCDS4867.1	.	.	.	.	.	.	.	.	.	.	T	17.45	3.391959	0.62066	.	.	ENSG00000124496	ENST00000541110;ENST00000372917;ENST00000372922;ENST00000340840;ENST00000354325	T;T;T;T;T	0.29397	1.57;1.57;1.57;1.57;1.57	5.61	4.46	0.54185	.	0.123452	0.39909	N	0.001235	T	0.09512	0.0234	N	0.19112	0.55	0.33433	D	0.58142	P;P;P;P;P	0.48640	0.763;0.651;0.651;0.763;0.913	B;B;B;B;P	0.45753	0.387;0.216;0.216;0.387;0.492	T	0.09885	-1.0654	10	0.33141	T	0.24	-16.0837	3.8988	0.09150	0.0:0.1468:0.2034:0.6498	.	873;976;956;712;712	Q96PN7-4;Q05GC8;Q96PN7;Q96PN7-2;Q96PN7-3	.;.;TREF1_HUMAN;.;.	V	976;873;956;873;873	ENSP00000439689:E976V;ENSP00000362008:E873V;ENSP00000362013:E956V;ENSP00000339438:E873V;ENSP00000346285:E873V	ENSP00000339438:E873V	E	-	2	0	TRERF1	42312120	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.589000	0.36644	2.131000	0.65755	0.533000	0.62120	GAA	.	.		0.473	TRERF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040551.2	NM_033502	
MDN1	23195	hgsc.bcm.edu	37	6	90390402	90390402	+	Silent	SNP	C	C	T			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr6:90390402C>T	ENST00000369393.3	-	74	12286	c.12171G>A	c.(12169-12171)ttG>ttA	p.L4057L	MDN1_ENST00000428876.1_Silent_p.L4057L			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	4057					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TGAGCTTTGGCAAGCGACGCA	0.577																																					p.L4057L		Atlas-SNP	.											.	MDN1	478	.	0			c.G12171A						.						79.0	70.0	73.0					6																	90390402		2203	4300	6503	SO:0001819	synonymous_variant	23195	exon74			CTTTGGCAAGCGA	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.12171G>A	chr6.hg19:g.90390402C>T		76.0	0.0		55.0	23.0	NM_014611	O15019|Q5T794	Silent	SNP	ENST00000369393.3	hg19	CCDS5024.1																																																																																			.	.		0.577	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2		
REV3L	5980	hgsc.bcm.edu	37	6	111694493	111694493	+	Missense_Mutation	SNP	G	G	T			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr6:111694493G>T	ENST00000358835.3	-	14	5519	c.5065C>A	c.(5065-5067)Caa>Aaa	p.Q1689K	REV3L_ENST00000368805.1_Missense_Mutation_p.Q1689K|REV3L_ENST00000368802.3_Missense_Mutation_p.Q1689K|REV3L_ENST00000435970.1_Missense_Mutation_p.Q1611K			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	1689					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		TCTATAGCTTGTCCTGGAAAA	0.393								DNA polymerases (catalytic subunits)																													p.Q1689K		Atlas-SNP	.											.	REV3L	386	.	0			c.C5065A						.						61.0	61.0	61.0					6																	111694493		2203	4299	6502	SO:0001583	missense	5980	exon13			TAGCTTGTCCTGG	AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.5065C>A	chr6.hg19:g.111694493G>T	ENSP00000351697:p.Gln1689Lys	90.0	0.0		77.0	38.0	NM_002912	O43214|Q5TC33	Missense_Mutation	SNP	ENST00000358835.3	hg19	CCDS5091.2	.	.	.	.	.	.	.	.	.	.	G	15.98	2.991219	0.54041	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970	T;T;T;T	0.01647	4.8;4.8;4.8;4.71	5.84	5.84	0.93424	Ribonuclease H-like (1);	0.153798	0.44483	D	0.000442	T	0.03178	0.0093	L	0.56769	1.78	0.45541	D	0.998492	D	0.67145	0.996	P	0.57620	0.824	T	0.65981	-0.6036	10	0.17369	T	0.5	.	18.3357	0.90287	0.0:0.0:1.0:0.0	.	1689	O60673	DPOLZ_HUMAN	K	1689;1689;1689;1611	ENSP00000357792:Q1689K;ENSP00000357795:Q1689K;ENSP00000351697:Q1689K;ENSP00000402003:Q1611K	ENSP00000351697:Q1689K	Q	-	1	0	REV3L	111801186	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.413000	0.90235	2.760000	0.94817	0.655000	0.94253	CAA	.	.		0.393	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043695.1	NM_002912	
DLL1	28514	hgsc.bcm.edu	37	6	170592454	170592454	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr6:170592454G>A	ENST00000366756.3	-	9	2246	c.1913C>T	c.(1912-1914)gCg>gTg	p.A638V		NM_005618.3	NP_005609.3	O00548	DLL1_HUMAN	delta-like 1 (Drosophila)	638					cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|cell-cell signaling (GO:0007267)|compartment pattern specification (GO:0007386)|determination of left/right symmetry (GO:0007368)|heart looping (GO:0001947)|hemopoiesis (GO:0030097)|inner ear development (GO:0048839)|left/right axis specification (GO:0070986)|loop of Henle development (GO:0072070)|negative regulation of auditory receptor cell differentiation (GO:0045608)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of myeloid cell differentiation (GO:0045638)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal tubule development (GO:0072014)|regulation of cell adhesion (GO:0030155)|somite specification (GO:0001757)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|Notch binding (GO:0005112)			NS(2)|breast(1)|endometrium(1)|large_intestine(7)|lung(17)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	33		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;6.71e-23)|BRCA - Breast invasive adenocarcinoma(81;4.81e-06)|GBM - Glioblastoma multiforme(31;0.0584)		ATAGTCCACCGCTGGGTAGCG	0.622																																					p.A638V		Atlas-SNP	.											.	DLL1	72	.	0			c.C1913T						.						180.0	150.0	160.0					6																	170592454		2203	4300	6503	SO:0001583	missense	28514	exon9			TCCACCGCTGGGT	AF003522	CCDS5313.1	6q13-q22.33	2008-07-28	2001-12-03		ENSG00000198719	ENSG00000198719			2908	protein-coding gene	gene with protein product		606582	"""delta (Drosophila)-like 1"""				Standard	NM_005618		Approved		uc003qxm.3	O00548	OTTHUMG00000016078	ENST00000366756.3:c.1913C>T	chr6.hg19:g.170592454G>A	ENSP00000355718:p.Ala638Val	45.0	0.0		21.0	11.0	NM_005618	B2RAK7|B5M0B3|Q9NU41|Q9UJV2	Missense_Mutation	SNP	ENST00000366756.3	hg19	CCDS5313.1	.	.	.	.	.	.	.	.	.	.	G	2.363	-0.346115	0.05208	.	.	ENSG00000198719	ENST00000366756	D	0.85861	-2.04	5.53	4.65	0.58169	.	0.792684	0.12374	N	0.474489	T	0.71048	0.3294	L	0.51422	1.61	0.09310	N	1	B	0.29341	0.242	B	0.21708	0.036	T	0.63193	-0.6692	10	0.31617	T	0.26	.	16.4331	0.83860	0.0:0.1446:0.8554:0.0	.	638	O00548	DLL1_HUMAN	V	638	ENSP00000355718:A638V	ENSP00000355718:A638V	A	-	2	0	DLL1	170434379	0.004000	0.15560	0.004000	0.12327	0.027000	0.11550	1.497000	0.35649	1.441000	0.47550	0.655000	0.94253	GCG	.	.		0.622	DLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043254.1		
SPAM1	6677	hgsc.bcm.edu	37	7	123599859	123599859	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr7:123599859G>A	ENST00000439500.1	+	6	1979	c.1366G>A	c.(1366-1368)Gat>Aat	p.D456N	SPAM1_ENST00000223028.7_Missense_Mutation_p.D456N|SPAM1_ENST00000340011.5_Missense_Mutation_p.D456N|SPAM1_ENST00000402183.2_Missense_Mutation_p.D456N|SPAM1_ENST00000460182.1_Missense_Mutation_p.D456N	NM_001174045.1|NM_001174046.1	NP_001167516.1|NP_001167517.1	P38567	HYALP_HUMAN	sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)	456					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	hyalurononglucosaminidase activity (GO:0004415)			breast(1)|cervix(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(23)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						TGATGCTGTTGATGTGTGTAT	0.393																																					p.D456N		Atlas-SNP	.											.	SPAM1	195	.	0			c.G1366A						.						168.0	156.0	160.0					7																	123599859		2203	4300	6503	SO:0001583	missense	6677	exon5			GCTGTTGATGTGT	L13781	CCDS5790.1, CCDS5791.1	7q31	2008-05-02			ENSG00000106304	ENSG00000106304			11217	protein-coding gene	gene with protein product		600930				8282124, 8575780	Standard	NM_153189		Approved	HYAL5, PH-20, SPAG15	uc003vle.3	P38567	OTTHUMG00000157284	ENST00000439500.1:c.1366G>A	chr7.hg19:g.123599859G>A	ENSP00000402123:p.Asp456Asn	81.0	0.0		111.0	25.0	NM_153189	Q8TC30	Missense_Mutation	SNP	ENST00000439500.1	hg19	CCDS5791.1	.	.	.	.	.	.	.	.	.	.	G	2.814	-0.246425	0.05867	.	.	ENSG00000106304	ENST00000402183;ENST00000460182;ENST00000340011;ENST00000439500;ENST00000223028	T;T;T;T;T	0.13778	2.57;2.57;2.56;2.57;2.57	5.8	-7.08	0.01558	.	1.576540	0.03004	N	0.148595	T	0.02230	0.0069	N	0.00483	-1.445	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.35748	-0.9776	10	0.02654	T	1	-14.9812	1.107	0.01696	0.2907:0.3059:0.2275:0.1759	.	456;456	Q8TC30;P38567	.;HYALP_HUMAN	N	456	ENSP00000386028:D456N;ENSP00000417934:D456N;ENSP00000345849:D456N;ENSP00000402123:D456N;ENSP00000223028:D456N	ENSP00000223028:D456N	D	+	1	0	SPAM1	123387095	0.008000	0.16893	0.000000	0.03702	0.005000	0.04900	0.078000	0.14761	-0.883000	0.03982	-0.355000	0.07637	GAT	.	.		0.393	SPAM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000348309.1		
FLNC	2318	hgsc.bcm.edu	37	7	128478085	128478085	+	Silent	SNP	C	C	A			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr7:128478085C>A	ENST00000325888.8	+	6	1275	c.1014C>A	c.(1012-1014)gtC>gtA	p.V338V	FLNC_ENST00000346177.6_Silent_p.V338V	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	338					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						CCTATGCTGTCTCCTATGTGC	0.552																																					p.V338V		Atlas-SNP	.											.	FLNC	339	.	0			c.C1014A						.						146.0	155.0	152.0					7																	128478085		2105	4224	6329	SO:0001819	synonymous_variant	2318	exon6			TGCTGTCTCCTAT	AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.1014C>A	chr7.hg19:g.128478085C>A		71.0	0.0		82.0	22.0	NM_001127487	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Silent	SNP	ENST00000325888.8	hg19	CCDS43644.1																																																																																			.	.		0.552	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3		
CPQ	10404	hgsc.bcm.edu	37	8	97978226	97978226	+	Missense_Mutation	SNP	G	G	T	rs373415893		TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr8:97978226G>T	ENST00000220763.5	+	5	1123	c.913G>T	c.(913-915)Ggt>Tgt	p.G305C		NM_016134.2	NP_057218.1	Q9Y646	CBPQ_HUMAN	carboxypeptidase Q	305					peptide catabolic process (GO:0043171)|proteolysis (GO:0006508)|thyroid hormone generation (GO:0006590)|tissue regeneration (GO:0042246)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)	carboxypeptidase activity (GO:0004180)|metal ion binding (GO:0046872)|metallodipeptidase activity (GO:0070573)|protein homodimerization activity (GO:0042803)										GGATGATGGCGGTGGAGCCTT	0.378																																					p.G305C		Atlas-SNP	.											.	.	.	.	0			c.G913T						.						98.0	97.0	98.0					8																	97978226		2203	4300	6503	SO:0001583	missense	10404	exon5			GATGGCGGTGGAG	AF107834	CCDS6273.1	8q22.2	2012-02-17			ENSG00000104324	ENSG00000104324			16910	protein-coding gene	gene with protein product	"""lysosomal dipeptidase"", ""Ser-Met dipeptidase"", ""plasma glutamate carboxypeptidase"""					10206990	Standard	NM_016134		Approved	LDP, PGCP	uc003yhw.3	Q9Y646	OTTHUMG00000164690	ENST00000220763.5:c.913G>T	chr8.hg19:g.97978226G>T	ENSP00000220763:p.Gly305Cys	80.0	0.0		117.0	6.0	NM_016134	B2RD88|Q8NBZ1|Q9UNM8|Q9Y5X6	Missense_Mutation	SNP	ENST00000220763.5	hg19	CCDS6273.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.203969	0.79127	.	.	ENSG00000104324	ENST00000220763	T	0.49139	0.79	5.94	4.14	0.48551	Peptidase M28 (1);	0.191964	0.46442	D	0.000298	T	0.66416	0.2787	M	0.83953	2.67	0.48135	D	0.999599	D;P	0.58268	0.982;0.944	D;P	0.64410	0.925;0.893	T	0.69789	-0.5050	10	0.54805	T	0.06	-2.2955	10.4502	0.44518	0.1514:0.0:0.8486:0.0	.	305;305	B5MDX4;Q9Y646	.;PGCP_HUMAN	C	305	ENSP00000220763:G305C	ENSP00000220763:G305C	G	+	1	0	AC010859.1	98047402	1.000000	0.71417	0.951000	0.38953	0.990000	0.78478	5.541000	0.67212	1.524000	0.49035	0.561000	0.74099	GGT	.	.		0.378	CPQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379757.2	NM_016134	
NIPAL2	79815	hgsc.bcm.edu	37	8	99264768	99264768	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr8:99264768C>T	ENST00000341166.3	-	3	554	c.299G>A	c.(298-300)gGa>gAa	p.G100E	NIPAL2_ENST00000430223.2_Missense_Mutation_p.G100E|NIPAL2_ENST00000520545.1_5'Flank	NM_024759.1	NP_079035.1	Q9H841	NPAL2_HUMAN	NIPA-like domain containing 2	100						integral component of membrane (GO:0016021)	magnesium ion transmembrane transporter activity (GO:0015095)			cervix(3)|kidney(1)|large_intestine(2)|lung(5)|stomach(1)	12						CCCCGTCTCTCCCACGGCCAT	0.502																																					p.G100E		Atlas-SNP	.											.	NIPAL2	23	.	0			c.G299A						.						111.0	89.0	96.0					8																	99264768		2203	4300	6503	SO:0001583	missense	79815	exon3			GTCTCTCCCACGG	AK024017	CCDS6278.1	8q22.2	2009-03-24		2009-03-24	ENSG00000104361	ENSG00000104361			25854	protein-coding gene	gene with protein product				NPAL2		14702039	Standard	NM_024759		Approved	FLJ13955	uc003yil.1	Q9H841	OTTHUMG00000164668	ENST00000341166.3:c.299G>A	chr8.hg19:g.99264768C>T	ENSP00000339256:p.Gly100Glu	153.0	0.0		187.0	29.0	NM_024759	A2RTY8	Missense_Mutation	SNP	ENST00000341166.3	hg19	CCDS6278.1	.	.	.	.	.	.	.	.	.	.	C	28.3	4.906415	0.92107	.	.	ENSG00000104361	ENST00000430223;ENST00000341166	D;D	0.96587	-4.06;-4.06	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	D	0.98585	0.9527	M	0.92833	3.35	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99331	1.0909	10	0.87932	D	0	-13.2313	17.3107	0.87208	0.0:1.0:0.0:0.0	.	100;100	A2RTY8;Q9H841	.;NPAL2_HUMAN	E	100	ENSP00000407087:G100E;ENSP00000339256:G100E	ENSP00000339256:G100E	G	-	2	0	NIPAL2	99333944	1.000000	0.71417	0.962000	0.40283	0.817000	0.46193	7.208000	0.77907	2.830000	0.97506	0.585000	0.79938	GGA	.	.		0.502	NIPAL2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000379677.1	NM_024759	
COL22A1	169044	hgsc.bcm.edu	37	8	139890313	139890314	+	Missense_Mutation	DNP	CC	CC	AA	rs375895986		TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr8:139890313_139890314CC>AA	ENST00000303045.6	-	3	783_784	c.337_338GG>TT	c.(337-339)GGc>TTc	p.G113F	COL22A1_ENST00000435777.1_Missense_Mutation_p.G113F	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	113	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GTTGGTGTTGCCCCCGTGGTAG	0.713										HNSCC(7;0.00092)																											p.G113V|p.G113C		Atlas-SNP	.											.	COL22A1	390	.	0			c.G338T|c.G337T						.																																			SO:0001583	missense	169044	exon3			GTGTTGCCCCCGT|TGTTGCCCCCGTG	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.337_338delinsAA	chr8.hg19:g.139890313_139890314delinsAA	ENSP00000303153:p.Gly113Phe	78.0|79.0	0.0		110.0	25.0	NM_152888	B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	ENST00000303045.6	hg19	CCDS6376.1																																																																																			.	.		0.713	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257	
GPAA1	8733	hgsc.bcm.edu	37	8	145140996	145140996	+	Missense_Mutation	SNP	C	C	A			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr8:145140996C>A	ENST00000355091.4	+	12	1955	c.1834C>A	c.(1834-1836)Ctg>Atg	p.L612M	GPAA1_ENST00000361036.6_Missense_Mutation_p.L552M	NM_003801.3	NP_003792.1	O43292	GPAA1_HUMAN	glycosylphosphatidylinositol anchor attachment 1	612					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein complex assembly (GO:0006461)|protein retention in ER lumen (GO:0006621)	endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|membrane (GO:0016020)	tubulin binding (GO:0015631)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|upper_aerodigestive_tract(2)	19	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.02e-40)|all cancers(56;2.11e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCCCTGCTGGCTGCTTTTCTG	0.612																																					p.L612M		Atlas-SNP	.											.	GPAA1	40	.	0			c.C1834A						.						60.0	64.0	63.0					8																	145140996		1992	4161	6153	SO:0001583	missense	8733	exon12			TGCTGGCTGCTTT	AB006969	CCDS43776.1	8q24.3	2012-12-10	2012-12-10		ENSG00000197858	ENSG00000197858			4446	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	603048	"""anchor attachment protein 1 (Gaa1p, yeast) homolog"", ""GPAA1P anchor attachment protein 1 homolog (yeast)"", ""glycosylphosphatidylinositol anchor attachment protein 1 homolog (yeast)"""			9828142	Standard	NM_003801		Approved	GAA1, hGAA1	uc003zax.3	O43292	OTTHUMG00000165438	ENST00000355091.4:c.1834C>A	chr8.hg19:g.145140996C>A	ENSP00000347206:p.Leu612Met	41.0	0.0		36.0	5.0	NM_003801	Q9NSS0|Q9UQ31	Missense_Mutation	SNP	ENST00000355091.4	hg19	CCDS43776.1	.	.	.	.	.	.	.	.	.	.	C	19.69	3.875526	0.72180	.	.	ENSG00000197858	ENST00000355091;ENST00000361036	.	.	.	5.13	4.25	0.50352	.	0.000000	0.64402	D	0.000003	T	0.69655	0.3135	L	0.58810	1.83	0.58432	D	0.999992	D	0.89917	1.0	D	0.91635	0.999	T	0.68996	-0.5262	9	0.44086	T	0.13	-15.6631	11.7676	0.51939	0.0:0.9116:0.0:0.0883	.	612	O43292	GPAA1_HUMAN	M	612;552	.	ENSP00000347206:L612M	L	+	1	2	GPAA1	145212984	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.439000	0.66556	2.404000	0.81709	0.655000	0.94253	CTG	.	.		0.612	GPAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384070.1	NM_003801	
ALDH1B1	219	hgsc.bcm.edu	37	9	38396813	38396813	+	Silent	SNP	C	C	T			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr9:38396813C>T	ENST00000377698.3	+	2	1221	c.1068C>T	c.(1066-1068)acC>acT	p.T356T		NM_000692.4	NP_000683.3	P30837	AL1B1_HUMAN	aldehyde dehydrogenase 1 family, member B1	356					carbohydrate metabolic process (GO:0005975)|ethanol catabolic process (GO:0006068)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	aldehyde dehydrogenase (NAD) activity (GO:0004029)			NS(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(1)|stomach(2)|urinary_tract(2)	32				GBM - Glioblastoma multiforme(29;0.043)|Lung(182;0.115)		AGCTGGACACCCAGCAGGGGC	0.562																																					p.T356T		Atlas-SNP	.											.	ALDH1B1	50	.	0			c.C1068T						.						53.0	57.0	55.0					9																	38396813		2203	4300	6503	SO:0001819	synonymous_variant	219	exon2			GGACACCCAGCAG	M63967	CCDS6615.1	9p13	2008-02-05			ENSG00000137124	ENSG00000137124	1.2.1.3	"""Aldehyde dehydrogenases"""	407	protein-coding gene	gene with protein product		100670		ALDH5		2061311	Standard	NM_000692		Approved	ALDHX	uc004aay.3	P30837	OTTHUMG00000019938	ENST00000377698.3:c.1068C>T	chr9.hg19:g.38396813C>T		184.0	0.0		148.0	26.0	NM_000692	B2R8F0|Q8WX76|Q9BV45	Silent	SNP	ENST00000377698.3	hg19	CCDS6615.1																																																																																			.	.		0.562	ALDH1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052492.1		
TNFSF15	9966	hgsc.bcm.edu	37	9	117552930	117552930	+	Missense_Mutation	SNP	G	G	C			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr9:117552930G>C	ENST00000374045.4	-	4	671	c.558C>G	c.(556-558)gaC>gaG	p.D186E	AL390240.1_ENST00000408807.1_RNA|TNFSF15_ENST00000374044.1_Missense_Mutation_p.D109E	NM_001204344.1|NM_005118.3	NP_001191273.1|NP_005109.2	O95150	TNF15_HUMAN	tumor necrosis factor (ligand) superfamily, member 15	186					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|cytokine metabolic process (GO:0042107)|immune response (GO:0006955)|positive regulation of cytokine secretion (GO:0050715)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|skin(1)	11						CAGGGTAGCTGTCTGTTACCT	0.537																																					p.D186E		Atlas-SNP	.											.	TNFSF15	23	.	0			c.C558G						.						228.0	177.0	195.0					9																	117552930		2203	4300	6503	SO:0001583	missense	9966	exon4			GTAGCTGTCTGTT	AF039390	CCDS6809.1	9q32	2008-07-21			ENSG00000181634	ENSG00000181634		"""Tumor necrosis factor (ligand) superfamily"""	11931	protein-coding gene	gene with protein product	"""vascular endothelial cell growth inhibitor"", ""TNF superfamily ligand TL1A"", ""TNF ligand-related molecule 1"", ""vascular endothelial growth inhibitor-192A"""	604052				9434163	Standard	NM_005118		Approved	TL1, VEGI, TL1A, VEGI192A, MGC129934, MGC129935	uc004bjh.3	O95150	OTTHUMG00000021011	ENST00000374045.4:c.558C>G	chr9.hg19:g.117552930G>C	ENSP00000363157:p.Asp186Glu	160.0	0.0		120.0	33.0	NM_005118	Q3SX69|Q5VJK8|Q5VWH1|Q8NFE9	Missense_Mutation	SNP	ENST00000374045.4	hg19	CCDS6809.1	.	.	.	.	.	.	.	.	.	.	G	14.44	2.535869	0.45176	.	.	ENSG00000181634	ENST00000374045;ENST00000374044	D;D	0.94457	-3.43;-3.43	6.03	0.978	0.19740	Tumour necrosis factor (3);Tumour necrosis factor-like (2);	0.428447	0.26262	N	0.025387	D	0.87819	0.6273	L	0.41710	1.295	0.34345	D	0.689213	B;B	0.13145	0.007;0.002	B;B	0.12156	0.007;0.004	T	0.77054	-0.2730	10	0.09338	T	0.73	-21.6492	7.2563	0.26179	0.1865:0.2267:0.5867:0.0	.	186;127	O95150;O95150-2	TNF15_HUMAN;.	E	186;109	ENSP00000363157:D186E;ENSP00000363156:D109E	ENSP00000363156:D109E	D	-	3	2	TNFSF15	116592751	0.998000	0.40836	0.955000	0.39395	0.905000	0.53344	1.078000	0.30754	-0.075000	0.12798	-0.140000	0.14226	GAC	.	.		0.537	TNFSF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055424.2	NM_005118	
SPTAN1	6709	hgsc.bcm.edu	37	9	131353846	131353846	+	Nonsense_Mutation	SNP	G	G	T			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr9:131353846G>T	ENST00000372731.4	+	22	3207	c.3097G>T	c.(3097-3099)Gag>Tag	p.E1033*	SPTAN1_ENST00000358161.5_Nonsense_Mutation_p.E1033*|SPTAN1_ENST00000372739.3_Nonsense_Mutation_p.E1033*	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	1033					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						AGCCTCCCGGGAGAATCTCCT	0.562																																					p.E1033X	NSCLC(120;833 1744 2558 35612 37579)	Atlas-SNP	.											.	SPTAN1	266	.	0			c.G3097T						.						83.0	86.0	85.0					9																	131353846		2203	4300	6503	SO:0001587	stop_gained	6709	exon22			TCCCGGGAGAATC	M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.3097G>T	chr9.hg19:g.131353846G>T	ENSP00000361816:p.Glu1033*	108.0	0.0		81.0	13.0	NM_003127	Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Nonsense_Mutation	SNP	ENST00000372731.4	hg19	CCDS6905.1	.	.	.	.	.	.	.	.	.	.	G	43	10.271077	0.99372	.	.	ENSG00000197694	ENST00000358161;ENST00000372731;ENST00000372739;ENST00000372719	.	.	.	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	.	19.0596	0.93081	0.0:0.0:1.0:0.0	.	.	.	.	X	1033	.	ENSP00000350882:E1033X	E	+	1	0	SPTAN1	130393667	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.238000	0.95380	2.750000	0.94351	0.585000	0.79938	GAG	.	.		0.562	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054472.1	NM_003127	
KIAA1217	56243	hgsc.bcm.edu	37	10	24508698	24508698	+	Missense_Mutation	SNP	C	C	G			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr10:24508698C>G	ENST00000376454.3	+	2	244	c.214C>G	c.(214-216)Ccc>Gcc	p.P72A	KIAA1217_ENST00000376452.3_Missense_Mutation_p.P72A|KIAA1217_ENST00000458595.1_Missense_Mutation_p.P72A|KIAA1217_ENST00000376462.1_5'UTR	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	72					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)				breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						CCTAGGGGGGCCCCGAAGTTC	0.512																																					p.P72A		Atlas-SNP	.											.	KIAA1217	235	.	0			c.C214G						.																																			SO:0001583	missense	56243	exon2			GGGGGGCCCCGAA	BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.214C>G	chr10.hg19:g.24508698C>G	ENSP00000365637:p.Pro72Ala	186.0	0.0		153.0	38.0	NM_019590	A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Missense_Mutation	SNP	ENST00000376454.3	hg19	CCDS31165.1	.	.	.	.	.	.	.	.	.	.	C	0.013	-1.607175	0.00842	.	.	ENSG00000120549	ENST00000376456;ENST00000458595;ENST00000376454;ENST00000376452	T;T;T;T	0.42900	0.96;0.96;0.96;0.96	5.77	2.87	0.33458	.	0.212895	0.29884	N	0.010944	T	0.21881	0.0527	N	0.08118	0	0.35714	D	0.816594	B;B;B;B	0.16166	0.016;0.009;0.001;0.016	B;B;B;B	0.16722	0.016;0.011;0.01;0.016	T	0.29027	-1.0025	10	0.02654	T	1	.	17.1008	0.86649	0.0:0.628:0.372:0.0	.	72;72;72;72	Q5T5P2-7;A6NLF3;Q5T5P2;Q5T5P2-2	.;.;SKT_HUMAN;.	A	72	ENSP00000365639:P72A;ENSP00000392625:P72A;ENSP00000365637:P72A;ENSP00000365635:P72A	ENSP00000365635:P72A	P	+	1	0	KIAA1217	24548704	1.000000	0.71417	0.995000	0.50966	0.236000	0.25371	2.556000	0.45862	0.346000	0.23899	-0.913000	0.02753	CCC	.	.		0.512	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047223.2	NM_019590	
ARMC4	55130	hgsc.bcm.edu	37	10	28224053	28224053	+	Missense_Mutation	SNP	C	C	A			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr10:28224053C>A	ENST00000305242.5	-	16	2473	c.2381G>T	c.(2380-2382)cGg>cTg	p.R794L	ARMC4_ENST00000537576.1_Missense_Mutation_p.R486L|ARMC4_ENST00000545014.1_Missense_Mutation_p.R319L	NM_018076.2	NP_060546.2	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	794					cell projection organization (GO:0030030)|cilium movement (GO:0003341)|left/right axis specification (GO:0070986)|outer dynein arm assembly (GO:0036158)|ventricular system development (GO:0021591)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(17)|liver(1)|lung(17)|ovary(5)|prostate(3)|skin(8)|stomach(2)|urinary_tract(3)	75						ACCACATTTCCGGACAATGAC	0.458																																					p.R794L		Atlas-SNP	.											.	ARMC4	177	.	0			c.G2381T						.						179.0	170.0	173.0					10																	28224053		2203	4300	6503	SO:0001583	missense	55130	exon16			CATTTCCGGACAA	AL136859	CCDS7157.1	10p12.1-p11.23	2014-02-03			ENSG00000169126	ENSG00000169126		"""Armadillo repeat containing"""	25583	protein-coding gene	gene with protein product		615408				11230166	Standard	XM_005252485		Approved	FLJ10817, FLJ10376, DKFZP434P1735, CILD23	uc001itz.3	Q5T2S8	OTTHUMG00000017867	ENST00000305242.5:c.2381G>T	chr10.hg19:g.28224053C>A	ENSP00000306410:p.Arg794Leu	171.0	0.0		155.0	43.0	NM_018076	A8K906|B7Z7I1|Q9H0C0	Missense_Mutation	SNP	ENST00000305242.5	hg19	CCDS7157.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.902699	0.92035	.	.	ENSG00000169126	ENST00000537576;ENST00000305242;ENST00000545014	T;T;T	0.61510	0.1;0.1;0.1	5.78	5.78	0.91487	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.76877	0.4049	M	0.79693	2.465	0.80722	D	1	B;D	0.60160	0.378;0.987	B;D	0.65323	0.35;0.934	T	0.73895	-0.3838	10	0.32370	T	0.25	-23.4861	20.0079	0.97439	0.0:1.0:0.0:0.0	.	319;794	B7Z7I1;Q5T2S8	.;ARMC4_HUMAN	L	486;794;319	ENSP00000443208:R486L;ENSP00000306410:R794L;ENSP00000441076:R319L	ENSP00000306410:R794L	R	-	2	0	ARMC4	28264059	1.000000	0.71417	0.995000	0.50966	0.994000	0.84299	7.762000	0.85270	2.722000	0.93159	0.655000	0.94253	CGG	.	.		0.458	ARMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047339.1	NM_018076	
ARHGAP22	58504	hgsc.bcm.edu	37	10	49654442	49654442	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr10:49654442G>A	ENST00000249601.4	-	10	2385	c.2089C>T	c.(2089-2091)Cca>Tca	p.P697S	ARHGAP22_ENST00000477708.2_Missense_Mutation_p.P530S|ARHGAP22_ENST00000374170.1_Missense_Mutation_p.P538S|ARHGAP22_ENST00000417912.2_Missense_Mutation_p.P713S|ARHGAP22_ENST00000374172.1_Missense_Mutation_p.P588S|ARHGAP22_ENST00000417247.2_Missense_Mutation_p.P607S|ARHGAP22_ENST00000435790.2_Missense_Mutation_p.P703S	NM_001256024.1|NM_021226.3	NP_001242953.1|NP_067049.2	Q7Z5H3	RHG22_HUMAN	Rho GTPase activating protein 22	697					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)	p.P697T(1)		endometrium(3)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						TTTTACTTTGGGGCCCTGGCA	0.542																																					p.P713S		Atlas-SNP	.											ARHGAP22,NS,carcinoma,0,1	ARHGAP22	94	.	1	Substitution - Missense(1)	prostate(1)	c.C2137T						.						108.0	99.0	102.0					10																	49654442		2203	4300	6503	SO:0001583	missense	58504	exon10			ACTTTGGGGCCCT	AY324801	CCDS7227.1, CCDS58079.1, CCDS58080.1, CCDS58081.1	10q11.23	2013-01-10			ENSG00000128805	ENSG00000128805		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	30320	protein-coding gene	gene with protein product		610585				8619474	Standard	NM_021226		Approved	RhoGAP2	uc010qgm.3	Q7Z5H3	OTTHUMG00000018176	ENST00000249601.4:c.2089C>T	chr10.hg19:g.49654442G>A	ENSP00000249601:p.Pro697Ser	106.0	0.0		105.0	33.0	NM_001256024	A0AVP7|A5YM75|B4DED8|B9EGA0|C9JDM2|O00152|Q6ZSB0	Missense_Mutation	SNP	ENST00000249601.4	hg19	CCDS7227.1	.	.	.	.	.	.	.	.	.	.	G	16.14	3.038571	0.55003	.	.	ENSG00000128805	ENST00000249601;ENST00000374172;ENST00000374170;ENST00000477708;ENST00000417247;ENST00000435790;ENST00000417912	T;T;T;T;T;T;T	0.47528	2.13;1.88;0.84;1.05;1.75;2.07;2.2	4.16	4.16	0.48862	.	0.614826	0.14995	N	0.286489	T	0.52757	0.1754	M	0.65975	2.015	0.09310	N	1	P;B;B;B;B;P	0.52316	0.952;0.1;0.161;0.1;0.161;0.908	P;B;B;B;B;B	0.49140	0.601;0.033;0.116;0.033;0.116;0.436	T	0.49679	-0.8914	10	0.66056	D	0.02	.	9.493	0.38971	0.1046:0.0:0.8954:0.0	.	703;697;713;697;607;530	B4DED8;A6NDI7;Q7Z5H3-2;Q7Z5H3;Q7Z5H3-3;D6R9V6	.;.;.;RHG22_HUMAN;.;.	S	697;588;538;530;607;703;713	ENSP00000249601:P697S;ENSP00000363287:P588S;ENSP00000363285:P538S;ENSP00000422868:P530S;ENSP00000410054:P607S;ENSP00000416701:P703S;ENSP00000412461:P713S	ENSP00000249601:P697S	P	-	1	0	ARHGAP22	49324448	0.003000	0.15002	0.003000	0.11579	0.386000	0.30323	0.419000	0.21247	1.869000	0.54173	0.491000	0.48974	CCA	.	.		0.542	ARHGAP22-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000358767.1	NM_021226	
LZTS2	84445	hgsc.bcm.edu	37	10	102770293	102770293	+	IGR	SNP	T	T	G	rs200896335|rs71013480	byFrequency	TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr10:102770293T>G	ENST00000370220.1	+	0	5741									leucine zipper, putative tumor suppressor 2											breast(1)|large_intestine(6)|lung(7)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22				Epithelial(162;7.3e-09)|all cancers(201;3.72e-07)		TGACCCCGgctgctgcggctg	0.697																																					p.S785R	Esophageal Squamous(8;38 437 13604 19902 37640)	Atlas-SNP	.											.	PDZD7	101	.	0			c.A2353C						.																																			SO:0001628	intergenic_variant	79955	exon15			CCCGGCTGCTGCG	AB058716	CCDS7507.1	10q24	2004-03-18			ENSG00000107816	ENSG00000107816			29381	protein-coding gene	gene with protein product		610454				11347906, 11709705	Standard	NM_032429		Approved	KIAA1813, LAPSER1	uc001ksj.3	Q9BRK4	OTTHUMG00000018914		chr10.hg19:g.102770293T>G		385.0	0.0		397.0	44.0	NM_001195263		Missense_Mutation	SNP	ENST00000370220.1	hg19	CCDS7507.1	.	.	.	.	.	.	.	.	.	.	T	2.648	-0.282573	0.05642	.	.	ENSG00000186862	ENST00000393462	.	.	.	3.99	2.83	0.33086	.	.	.	.	.	T	0.29716	0.0742	N	0.24115	0.695	0.28374	N	0.919888	.	.	.	.	.	.	T	0.21793	-1.0235	6	0.20046	T	0.44	.	9.5348	0.39216	0.0:0.0:0.1777:0.8222	.	.	.	.	R	785	.	ENSP00000377106:S785R	S	-	1	0	PDZD7	102760283	0.123000	0.22298	0.736000	0.30914	0.083000	0.17756	0.220000	0.17660	0.649000	0.30751	-0.680000	0.03767	AGC	.	.		0.697	LZTS2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049872.1	XM_046743	
NLRP6	171389	hgsc.bcm.edu	37	11	280376	280376	+	Silent	SNP	G	G	A			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr11:280376G>A	ENST00000312165.5	+	4	642	c.642G>A	c.(640-642)aaG>aaA	p.K214K	NLRP6_ENST00000534750.1_Silent_p.K214K	NM_138329.1	NP_612202.2	P59044	NALP6_HUMAN	NLR family, pyrin domain containing 6	214	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|regulation of inflammatory response (GO:0050727)|response to bacterium (GO:0009617)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|vasopressin receptor activity (GO:0005000)			breast(1)|skin(1)|upper_aerodigestive_tract(2)	4		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.28e-28)|Epithelial(43;2.47e-27)|OV - Ovarian serous cystadenocarcinoma(40;4.66e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.0485)|LUSC - Lung squamous cell carcinoma(625;0.122)		CGGCCAAAAAGATCCTGTACG	0.697																																					p.K214K		Atlas-SNP	.											.	NLRP6	4	.	0			c.G642A						.						21.0	21.0	21.0					11																	280376		2171	4260	6431	SO:0001819	synonymous_variant	171389	exon4			CAAAAAGATCCTG	AF479748	CCDS7693.1, CCDS60680.1	11p15	2006-12-08	2006-12-08	2006-12-08	ENSG00000174885	ENSG00000174885		"""Nucleotide-binding domain and leucine rich repeat containing"""	22944	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 6"""	609650	"""NACHT, leucine rich repeat and PYD containing 6"""	NALP6		12563287, 12019269	Standard	NM_138329		Approved	PYPAF5, PAN3, CLR11.4	uc010qvs.3	P59044	OTTHUMG00000119070	ENST00000312165.5:c.642G>A	chr11.hg19:g.280376G>A		31.0	0.0		34.0	13.0	NM_138329	A8K9F3|E9PJZ8	Silent	SNP	ENST00000312165.5	hg19	CCDS7693.1																																																																																			.	.		0.697	NLRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239283.1	NM_138329	
KRTAP5-5	439915	hgsc.bcm.edu	37	11	1651253	1651253	+	Silent	SNP	C	C	G			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr11:1651253C>G	ENST00000399676.2	+	1	221	c.183C>G	c.(181-183)ggC>ggG	p.G61G		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	61						keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		gtggctccggctgCTGTGTGC	0.682																																					p.G61G		Atlas-SNP	.											.	KRTAP5-5	86	.	0			c.C183G						.						59.0	72.0	67.0					11																	1651253		2199	4293	6492	SO:0001819	synonymous_variant	439915	exon1			CTCCGGCTGCTGT	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.183C>G	chr11.hg19:g.1651253C>G		144.0	0.0		161.0	23.0	NM_001001480	A8MWN2	Silent	SNP	ENST00000399676.2	hg19	CCDS41592.1																																																																																			.	.		0.682	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127919.1		
RRM1	6240	hgsc.bcm.edu	37	11	4127292	4127292	+	Missense_Mutation	SNP	A	A	G			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr11:4127292A>G	ENST00000300738.5	+	3	329	c.125A>G	c.(124-126)aAa>aGa	p.K42R	RRM1_ENST00000423050.2_Intron	NM_001033.3	NP_001024.1	P23921	RIR1_HUMAN	ribonucleotide reductase M1	42	ATP-cone. {ECO:0000255|PROSITE- ProRule:PRU00492}.				cell proliferation in forebrain (GO:0021846)|deoxyribonucleotide biosynthetic process (GO:0009263)|DNA replication (GO:0006260)|male gonad development (GO:0008584)|mitotic cell cycle (GO:0000278)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein heterotetramerization (GO:0051290)|pyrimidine nucleobase metabolic process (GO:0006206)|response to ionizing radiation (GO:0010212)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ribonucleoside-diphosphate reductase activity, thioredoxin disulfide as acceptor (GO:0004748)			breast(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(7)|skin(2)	14		Medulloblastoma(188;0.0025)|Breast(177;0.00502)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0848)|LUSC - Lung squamous cell carcinoma(625;0.205)	Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Hydroxyurea(DB01005)	ATCACCATGAAAGTAATCCAA	0.408																																					p.K42R	NSCLC(45;1345 1376 6258 22925)|Ovarian(34;894 1053 6175 12768)	Atlas-SNP	.											.	RRM1	31	.	0			c.A125G						.						88.0	80.0	83.0					11																	4127292		2201	4298	6499	SO:0001583	missense	6240	exon3			CCATGAAAGTAAT	X59543	CCDS7750.1	11p15.5	2009-07-10	2008-03-11		ENSG00000167325	ENSG00000167325	1.17.14.1		10451	protein-coding gene	gene with protein product		180410	"""ribonucleotide reductase M1 polypeptide"""			7557993	Standard	NM_001033		Approved		uc001lyw.4	P23921	OTTHUMG00000133361	ENST00000300738.5:c.125A>G	chr11.hg19:g.4127292A>G	ENSP00000300738:p.Lys42Arg	82.0	0.0		104.0	19.0	NM_001033	Q9UNN2	Missense_Mutation	SNP	ENST00000300738.5	hg19	CCDS7750.1	.	.	.	.	.	.	.	.	.	.	A	16.14	3.037836	0.54896	.	.	ENSG00000167325	ENST00000300738;ENST00000536894	T	0.33216	1.42	5.77	5.77	0.91146	Ribonucleotide reductase R1 subunit, N-terminal (1);ATP-cone (2);	0.000000	0.85682	D	0.000000	T	0.28797	0.0714	L	0.42008	1.315	0.80722	D	1	B	0.12630	0.006	B	0.17098	0.017	T	0.03619	-1.1019	10	0.29301	T	0.29	-17.3309	15.2176	0.73281	1.0:0.0:0.0:0.0	.	42	P23921	RIR1_HUMAN	R	42;36	ENSP00000300738:K42R	ENSP00000300738:K42R	K	+	2	0	RRM1	4083868	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.836000	0.92105	2.326000	0.78906	0.533000	0.62120	AAA	.	.		0.408	RRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257197.1	NM_001033	
CHRM4	1132	hgsc.bcm.edu	37	11	46407264	46407264	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr11:46407264G>A	ENST00000433765.2	-	1	843	c.844C>T	c.(844-846)Ccg>Tcg	p.P282S		NM_000741.2	NP_000732.2	P08173	ACM4_HUMAN	cholinergic receptor, muscarinic 4	282					adenylate cyclase-inhibiting G-protein coupled acetylcholine receptor signaling pathway (GO:0007197)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|regulation of locomotion (GO:0040012)|signal transduction (GO:0007165)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)			breast(1)|endometrium(7)|kidney(1)|large_intestine(1)|lung(6)|prostate(3)|skin(1)	20				GBM - Glioblastoma multiforme(35;0.0254)|Lung(87;0.14)	Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Atropine(DB00572)|Brompheniramine(DB00835)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cryptenamine(DB00785)|Darifenacin(DB00496)|Desipramine(DB01151)|Doxepin(DB01142)|Fesoterodine(DB06702)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Isopropamide(DB01625)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paroxetine(DB00715)|Pethidine(DB00454)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Tolterodine(DB01036)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	CGCGGTGGCGGTGGCAGCGCT	0.672																																					p.P282S	Esophageal Squamous(171;1020 1936 4566 30205 42542)	Atlas-SNP	.											.	CHRM4	47	.	0			c.C844T						.						18.0	23.0	21.0					11																	46407264		2031	4155	6186	SO:0001583	missense	1132	exon1			GTGGCGGTGGCAG	M16405	CCDS44581.1	11p12-p11.2	2012-08-08			ENSG00000180720	ENSG00000180720		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1953	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 4"""	118495				1577490	Standard	NM_000741		Approved		uc001nct.1	P08173	OTTHUMG00000154371	ENST00000433765.2:c.844C>T	chr11.hg19:g.46407264G>A	ENSP00000409378:p.Pro282Ser	59.0	0.0		41.0	15.0	NM_000741	B2RPP4|Q0VD60|Q4VBK7	Missense_Mutation	SNP	ENST00000433765.2	hg19	CCDS44581.1	.	.	.	.	.	.	.	.	.	.	g	0	-2.732138	0.00089	.	.	ENSG00000180720	ENST00000433765	T	0.57752	0.38	3.24	3.24	0.37175	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.26304	0.0642	N	0.02802	-0.49	0.09310	N	1	B	0.06786	0.001	B	0.15052	0.012	T	0.10154	-1.0642	9	0.17369	T	0.5	-7.3883	10.2254	0.43222	0.0:0.0:1.0:0.0	.	282	P08173	ACM4_HUMAN	S	282	ENSP00000409378:P282S	ENSP00000409378:P282S	P	-	1	0	CHRM4	46363840	0.992000	0.36948	0.678000	0.29963	0.011000	0.07611	3.454000	0.52986	2.117000	0.64856	0.457000	0.33378	CCG	.	.		0.672	CHRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334985.1	NM_000741	
CATSPER1	117144	hgsc.bcm.edu	37	11	65787820	65787820	+	Silent	SNP	G	G	A			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr11:65787820G>A	ENST00000312106.5	-	8	2169	c.2032C>T	c.(2032-2034)Ctg>Ttg	p.L678L		NM_053054.3	NP_444282.3	Q8NEC5	CTSR1_HUMAN	cation channel, sperm associated 1	678					calcium ion import (GO:0070509)|cell differentiation (GO:0030154)|fusion of sperm to egg plasma membrane (GO:0007342)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|regulation of calcium ion transport (GO:0051924)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|endometrium(9)|kidney(3)|large_intestine(6)|liver(3)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44						CCTTTGAACAGCGCCGTCTGG	0.637																																					p.L678L		Atlas-SNP	.											.	CATSPER1	101	.	0			c.C2032T						.						121.0	116.0	118.0					11																	65787820		2201	4296	6497	SO:0001819	synonymous_variant	117144	exon8			TGAACAGCGCCGT	AF407333	CCDS8127.1	11q12.1	2011-07-05			ENSG00000175294	ENSG00000175294		"""Voltage-gated ion channels / Cation channels, sperm associated"""	17116	protein-coding gene	gene with protein product		606389				11675491, 11595941, 16382101	Standard	NM_053054		Approved	CATSPER	uc001ogt.3	Q8NEC5	OTTHUMG00000166668	ENST00000312106.5:c.2032C>T	chr11.hg19:g.65787820G>A		77.0	0.0		71.0	15.0	NM_053054	Q96P76	Silent	SNP	ENST00000312106.5	hg19	CCDS8127.1																																																																																			.	.		0.637	CATSPER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391055.1	NM_053054	
RNF121	55298	hgsc.bcm.edu	37	11	71640151	71640151	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr11:71640151G>A	ENST00000361756.3	+	1	405	c.44G>A	c.(43-45)gGg>gAg	p.G15E	RP11-849H4.2_ENST00000531488.1_5'Flank|RP11-849H4.2_ENST00000529844.1_5'Flank|RP11-849H4.2_ENST00000528511.2_5'Flank|RNF121_ENST00000530137.1_5'UTR|RP11-849H4.2_ENST00000529513.1_5'Flank|RNF121_ENST00000545854.1_5'UTR|RNF121_ENST00000490867.1_3'UTR|RNF121_ENST00000533380.1_5'UTR|RNF121_ENST00000393713.3_5'UTR	NM_018320.4	NP_060790.2	Q9H920	RN121_HUMAN	ring finger protein 121	15						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(1)|lung(6)|urinary_tract(1)	13						GGTGCTGCTGGGGAACGGGAG	0.652																																					p.G15E		Atlas-SNP	.											.	RNF121	19	.	0			c.G44A						.						104.0	67.0	80.0					11																	71640151		2112	4128	6240	SO:0001583	missense	55298	exon1			CTGCTGGGGAACG	AK001961	CCDS8203.1, CCDS73343.1	11q13.3	2008-02-05			ENSG00000137522	ENSG00000137522		"""RING-type (C3HC4) zinc fingers"""	21070	protein-coding gene	gene with protein product							Standard	NM_018320		Approved	FLJ11099	uc001ora.3	Q9H920	OTTHUMG00000157023	ENST00000361756.3:c.44G>A	chr11.hg19:g.71640151G>A	ENSP00000354571:p.Gly15Glu	80.0	0.0		99.0	13.0	NM_018320	B3KSW8|Q6IA57|Q6P449|Q96DB4	Missense_Mutation	SNP	ENST00000361756.3	hg19	CCDS8203.1	.	.	.	.	.	.	.	.	.	.	G	11.90	1.775954	0.31411	.	.	ENSG00000137522	ENST00000361756	T	0.15952	2.38	5.22	0.927	0.19437	.	0.385818	0.28700	N	0.014428	T	0.04543	0.0124	N	0.04508	-0.205	0.80722	D	1	P	0.37233	0.588	B	0.21708	0.036	T	0.48151	-0.9060	10	0.12430	T	0.62	.	7.6028	0.28085	0.0:0.3537:0.3892:0.2572	.	15	Q9H920	RN121_HUMAN	E	15	ENSP00000354571:G15E	ENSP00000354571:G15E	G	+	2	0	RNF121	71317799	1.000000	0.71417	0.995000	0.50966	0.995000	0.86356	0.633000	0.24598	0.088000	0.17205	0.563000	0.77884	GGG	.	.		0.652	RNF121-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347132.1	NM_018320	
GRIA4	2893	hgsc.bcm.edu	37	11	105795410	105795410	+	Nonsense_Mutation	SNP	C	C	T			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr11:105795410C>T	ENST00000530497.1	+	11	1762	c.1762C>T	c.(1762-1764)Cag>Tag	p.Q588*	GRIA4_ENST00000282499.5_Nonsense_Mutation_p.Q588*|GRIA4_ENST00000525187.1_Nonsense_Mutation_p.Q588*|GRIA4_ENST00000393127.2_Nonsense_Mutation_p.Q588*			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4	588					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		ACCCAGCGACCAGCCTCCCAA	0.473																																					p.Q588X		Atlas-SNP	.											.	GRIA4	380	.	0			c.C1762T						.						119.0	98.0	105.0					11																	105795410		2202	4299	6501	SO:0001587	stop_gained	2893	exon12			AGCGACCAGCCTC	U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.1762C>T	chr11.hg19:g.105795410C>T	ENSP00000435775:p.Gln588*	215.0	0.0		174.0	30.0	NM_001077243	Q86XE8	Nonsense_Mutation	SNP	ENST00000530497.1	hg19	CCDS8333.1	.	.	.	.	.	.	.	.	.	.	C	42	9.547899	0.99201	.	.	ENSG00000152578	ENST00000282499;ENST00000393127;ENST00000530497;ENST00000525187	.	.	.	6.05	6.05	0.98169	.	0.000000	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	.	20.6013	0.99457	0.0:1.0:0.0:0.0	.	.	.	.	X	588	.	ENSP00000282499:Q588X	Q	+	1	0	GRIA4	105300620	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.948000	0.56660	2.878000	0.98634	0.650000	0.86243	CAG	.	.		0.473	GRIA4-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388593.1		
ALG9	79796	hgsc.bcm.edu	37	11	111706981	111706981	+	Silent	SNP	A	A	T			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr11:111706981A>T	ENST00000531154.1	-	13	1468	c.996T>A	c.(994-996)ggT>ggA	p.G332G	ALG9_ENST00000524880.1_3'UTR|ALG9_ENST00000527228.1_5'UTR|ALG9_ENST00000398006.2_Silent_p.G325G	NM_024740.2	NP_079016.2	Q9H6U8	ALG9_HUMAN	ALG9, alpha-1,2-mannosyltransferase	496					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	dol-P-Man:Man(6)GlcNAc(2)-PP-Dol alpha-1,2-mannosyltransferase activity (GO:0052926)|dol-P-Man:Man(8)GlcNAc(2)-PP-Dol alpha-1,2-mannosyltransferase activity (GO:0052918)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;6.81e-07)|BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|all cancers(92;1.3e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0587)		TTGGTAACTGACCTCTGAACT	0.428																																					p.G503G		Atlas-SNP	.											.	ALG9	77	.	0			c.T1509A						.						82.0	79.0	80.0					11																	111706981		1864	4086	5950	SO:0001819	synonymous_variant	79796	exon14			TAACTGACCTCTG		CCDS41714.1, CCDS53709.1, CCDS73379.1, CCDS73380.1	11q23	2013-02-26	2013-02-26	2004-08-26	ENSG00000086848	ENSG00000086848	2.4.1.259, 2.4.1.261	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	15672	protein-coding gene	gene with protein product	"""dolichyl-P-Man:Man(6)GlcNAc(2)-PP-dolichol alpha-1,2-mannosyltransferase"", ""dolichyl-P-Man:Man(8)GlcNAc(2)-PP-dolichol alpha-1,2-mannosyltransferase"", ""dol-P-Man dependent alpha-1,2-mannosyltransferase"""	606941	"""disrupted in bipolar affective disorder 1"", ""asparagine-linked glycosylation 9 homolog (yeast, alpha 1,2 mannosyltransferase)"", ""asparagine-linked glycosylation 9, alpha- 1,2-mannosyltransferase homolog (S. cerevisiae, alpha- 1,2-mannosyltransferase)"", ""asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae)"""	DIBD1		12030331, 15148656	Standard	NM_024740		Approved		uc021qql.1	Q9H6U8	OTTHUMG00000166819	ENST00000531154.1:c.996T>A	chr11.hg19:g.111706981A>T		101.0	0.0		62.0	21.0	NM_024740	Q6ZMD5|Q7Z4R4|Q96GS7|Q96PB9|Q9H068	Silent	SNP	ENST00000531154.1	hg19	CCDS41714.1	.	.	.	.	.	.	.	.	.	.	A	10.38	1.334845	0.24253	.	.	ENSG00000086848	ENST00000532425	.	.	.	5.2	-0.692	0.11301	.	.	.	.	.	T	0.43986	0.1272	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.26292	-1.0107	4	.	.	.	-13.6198	4.2235	0.10570	0.2664:0.0:0.4957:0.2379	.	.	.	.	D	81	.	.	V	-	2	0	ALG9	111212191	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	0.702000	0.25631	0.003000	0.14656	-0.376000	0.06991	GTC	.	.		0.428	ALG9-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000391485.1	NM_024740	
USP5	8078	hgsc.bcm.edu	37	12	6972521	6972521	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr12:6972521C>T	ENST00000229268.8	+	15	1986	c.1934C>T	c.(1933-1935)cCt>cTt	p.P645L	USP5_ENST00000389231.5_Intron|USP5_ENST00000541969.1_3'UTR	NM_001098536.1	NP_001092006.1	P45974	UBP5_HUMAN	ubiquitin specific peptidase 5 (isopeptidase T)	645	USP.				positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)	lysosome (GO:0005764)	cysteine-type endopeptidase activity (GO:0004197)|omega peptidase activity (GO:0008242)|ubiquitin thiolesterase activity (GO:0004221)|zinc ion binding (GO:0008270)			breast(6)|endometrium(4)|kidney(2)|large_intestine(6)|lung(14)|skin(2)|urinary_tract(2)	36						TTCTGCTCCCCTCACTTCTCC	0.582																																					p.P645L		Atlas-SNP	.											.	USP5	124	.	0			c.C1934T						.						141.0	148.0	145.0					12																	6972521		2203	4300	6503	SO:0001583	missense	8078	exon15			GCTCCCCTCACTT	U35116	CCDS31733.1, CCDS41743.1	12p13	2007-03-02	2005-08-08		ENSG00000111667	ENSG00000111667		"""Ubiquitin-specific peptidases"""	12628	protein-coding gene	gene with protein product		601447	"""ubiquitin specific protease 5 (isopeptidase T)"""			12838346, 8723724	Standard	NM_003481		Approved	IsoT	uc001qri.4	P45974	OTTHUMG00000169233	ENST00000229268.8:c.1934C>T	chr12.hg19:g.6972521C>T	ENSP00000229268:p.Pro645Leu	111.0	0.0		77.0	40.0	NM_001098536	D3DUS7|D3DUS8|Q96J22	Missense_Mutation	SNP	ENST00000229268.8	hg19	CCDS41743.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.938615	0.73557	.	.	ENSG00000111667	ENST00000229268	T	0.22336	1.96	4.96	4.96	0.65561	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.07683	0.0193	N	0.00926	-1.1	0.80722	D	1	P	0.41345	0.746	B	0.38225	0.268	T	0.37174	-0.9717	10	0.08179	T	0.78	-2.5474	18.756	0.91833	0.0:1.0:0.0:0.0	.	645	P45974	UBP5_HUMAN	L	645	ENSP00000229268:P645L	ENSP00000229268:P645L	P	+	2	0	USP5	6842782	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.147000	0.64851	2.735000	0.93741	0.561000	0.74099	CCT	.	.		0.582	USP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402982.1		
ARID2	196528	hgsc.bcm.edu	37	12	46246680	46246680	+	Splice_Site	SNP	G	G	T			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr12:46246680G>T	ENST00000334344.6	+	15	4945		c.e15+1		ARID2_ENST00000422737.1_Splice_Site|ARID2_ENST00000457135.1_Splice_Site|ARID2_ENST00000479608.1_Splice_Site|ARID2_ENST00000444670.1_Splice_Site	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)						chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		GGTCCCGCAGGTAAGTTATTC	0.383			"""N, S, F"""		hepatocellular carcinoma																																.		Atlas-SNP	.		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	.	ARID2	311	.	0			c.4773+1G>T						.						29.0	23.0	25.0					12																	46246680		2200	4295	6495	SO:0001630	splice_region_variant	196528	exon15			CCGCAGGTAAGTT		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.4773+1G>T	chr12.hg19:g.46246680G>T		53.0	0.0		37.0	18.0	NM_152641	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Splice_Site	SNP	ENST00000334344.6	hg19	CCDS31783.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.481141	0.84747	.	.	ENSG00000189079	ENST00000334344;ENST00000549153;ENST00000338636;ENST00000422737;ENST00000444670;ENST00000457135	.	.	.	6.02	6.02	0.97574	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.5407	0.99260	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ARID2	44532947	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	8.115000	0.89572	2.865000	0.98341	0.655000	0.94253	.	.	.		0.383	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875	Intron
LMBR1L	55716	hgsc.bcm.edu	37	12	49498238	49498238	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr12:49498238G>A	ENST00000267102.8	-	5	770	c.428C>T	c.(427-429)tCc>tTc	p.S143F	LMBR1L_ENST00000553204.1_Intron|LMBR1L_ENST00000547382.1_Missense_Mutation_p.S143F|LMBR1L_ENST00000395141.4_Missense_Mutation_p.S138F	NM_018113.2	NP_060583.2	Q6UX01	LMBRL_HUMAN	limb development membrane protein 1-like	143					endocytosis (GO:0006897)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						TACCTTTCTGGAGCCAGCAAA	0.458																																					p.S143F		Atlas-SNP	.											LMBR1L_ENST00000267102,bladder,carcinoma,0,2	LMBR1L	61	.	0			c.C428T						.						131.0	134.0	133.0					12																	49498238		2203	4300	6503	SO:0001583	missense	55716	exon5			TTTCTGGAGCCAG	AB033000	CCDS8780.2, CCDS73466.1	12q13.12	2013-08-05	2013-08-05		ENSG00000139636	ENSG00000139636			18268	protein-coding gene	gene with protein product		610007	"""limb region 1 homolog (mouse)-like"""			10574461, 11287427	Standard	XM_005269022		Approved	FLJ10494, KIAA1174	uc001rth.4	Q6UX01	OTTHUMG00000150511	ENST00000267102.8:c.428C>T	chr12.hg19:g.49498238G>A	ENSP00000267102:p.Ser143Phe	118.0	0.0		103.0	18.0	NM_018113	Q969J4|Q96BY8|Q96HN8|Q9NT09|Q9NVE1|Q9NVU9|Q9ULP6	Missense_Mutation	SNP	ENST00000267102.8	hg19	CCDS8780.2	.	.	.	.	.	.	.	.	.	.	G	24.6	4.546393	0.86022	.	.	ENSG00000139636	ENST00000267102;ENST00000547382;ENST00000395141	T;T;T	0.34667	1.35;1.35;1.35	6.07	6.07	0.98685	LMBR1-like membrane protein (1);	0.000000	0.85682	D	0.000000	T	0.56529	0.1991	L	0.61387	1.9	0.80722	D	1	D;D;D;D	0.89917	0.997;0.997;0.999;1.0	D;D;D;D	0.87578	0.991;0.994;0.998;0.998	T	0.42548	-0.9445	10	0.09590	T	0.72	.	19.4154	0.94694	0.0:0.0:1.0:0.0	.	141;143;143;138	Q6UX01-2;Q6UX01-3;Q6UX01;Q6UX01-4	.;.;LMBRL_HUMAN;.	F	143;143;138	ENSP00000267102:S143F;ENSP00000447329:S143F;ENSP00000378573:S138F	ENSP00000267102:S143F	S	-	2	0	LMBR1L	47784505	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.824000	0.99380	2.884000	0.98904	0.655000	0.94253	TCC	.	.		0.458	LMBR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318696.1	NM_018113	
LGR5	8549	hgsc.bcm.edu	37	12	71977548	71977548	+	Silent	SNP	T	T	G			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr12:71977548T>G	ENST00000266674.5	+	18	2069	c.1758T>G	c.(1756-1758)ccT>ccG	p.P586P	RP11-186F10.2_ENST00000546601.1_RNA|LGR5_ENST00000540815.2_Silent_p.P562P|LGR5_ENST00000536515.1_Silent_p.P514P			O75473	LGR5_HUMAN	leucine-rich repeat containing G protein-coupled receptor 5	586					G-protein coupled receptor signaling pathway (GO:0007186)|inner ear development (GO:0048839)|positive regulation of canonical Wnt signaling pathway (GO:0090263)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)		NUP107/LGR5(2)	endometrium(2)|kidney(3)|large_intestine(2)|lung(24)|ovary(1)|pancreas(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	48						TCAGATCCCCTCTGTACATTT	0.498																																					p.P586P		Atlas-SNP	.											.	LGR5	103	.	0			c.T1758G						.						180.0	156.0	164.0					12																	71977548		2203	4300	6503	SO:0001819	synonymous_variant	8549	exon18			ATCCCCTCTGTAC	AF062006	CCDS9000.1, CCDS61194.1, CCDS61195.1	12q22-q23	2012-08-21	2011-01-25	2004-11-12				"""GPCR / Class A : Orphans"""	4504	protein-coding gene	gene with protein product		606667	"""G protein-coupled receptor 49"", ""leucine-rich repeat-containing G protein-coupled receptor 5"""	GPR67, GPR49		9642114	Standard	NM_003667		Approved	HG38, FEX	uc001swl.4	O75473	OTTHUMG00000169543	ENST00000266674.5:c.1758T>G	chr12.hg19:g.71977548T>G		144.0	0.0		122.0	41.0	NM_003667	D8MCT0|Q4VAM0|Q4VAM2|Q9UP75	Silent	SNP	ENST00000266674.5	hg19	CCDS9000.1																																																																																			.	.		0.498	LGR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404744.1	NM_003667	
HECTD4	283450	hgsc.bcm.edu	37	12	112673514	112673514	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr12:112673514C>T	ENST00000430131.2	-	35	5398	c.4253G>A	c.(4252-4254)cGc>cAc	p.R1418H	HECTD4_ENST00000550722.1_Missense_Mutation_p.R1694H|HECTD4_ENST00000377560.5_Missense_Mutation_p.R1668H			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	1418					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										TGGAGACGGGCGTTGGTCAAG	0.557																																					p.R1706H		Atlas-SNP	.											.	.	.	.	0			c.G5117A						.						39.0	41.0	40.0					12																	112673514		2019	4178	6197	SO:0001583	missense	283450	exon36			GACGGGCGTTGGT	AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.4253G>A	chr12.hg19:g.112673514C>T	ENSP00000404379:p.Arg1418His	99.0	0.0		94.0	12.0	NM_001109662	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	ENST00000430131.2	hg19		.	.	.	.	.	.	.	.	.	.	C	36	5.928818	0.97116	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722	T;T;T	0.51817	0.69;0.7;0.69	6.03	6.03	0.97812	.	.	.	.	.	T	0.54447	0.1859	N	0.12182	0.205	0.80722	D	1	D	0.71674	0.998	D	0.72075	0.976	T	0.59742	-0.7397	9	0.54805	T	0.06	.	20.5666	0.99351	0.0:1.0:0.0:0.0	.	1418	Q9Y4D8	K0614_HUMAN	H	1668;1418;1694	ENSP00000366783:R1668H;ENSP00000404379:R1418H;ENSP00000449784:R1694H	ENSP00000366783:R1668H	R	-	2	0	C12orf51	111157897	1.000000	0.71417	0.997000	0.53966	0.987000	0.75469	7.400000	0.79949	2.854000	0.98071	0.655000	0.94253	CGC	.	.		0.557	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813	
PROSER1	80209	hgsc.bcm.edu	37	13	39587872	39587872	+	Missense_Mutation	SNP	T	T	C			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr13:39587872T>C	ENST00000352251.3	-	11	2350	c.1517A>G	c.(1516-1518)cAg>cGg	p.Q506R	PROSER1_ENST00000350125.3_Missense_Mutation_p.Q484R|PROSER1_ENST00000484434.3_Intron	NM_025138.4	NP_079414.3	Q86XN7	PRSR1_HUMAN	proline and serine rich 1	506	Ser-rich.																GTCAGAGTTCTGAAGAGTAAG	0.493																																					p.Q506R		Atlas-SNP	.											.	.	.	.	0			c.A1517G						.						79.0	77.0	78.0					13																	39587872		2203	4300	6503	SO:0001583	missense	80209	exon11			GAGTTCTGAAGAG	AK022723	CCDS9368.2	13q13.2	2011-08-09	2011-08-09	2011-08-09	ENSG00000120685	ENSG00000120685			20291	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 23"""	C13orf23			Standard	NM_025138		Approved	bA50D16.2, FLJ12661	uc001uwy.4	Q86XN7	OTTHUMG00000016764	ENST00000352251.3:c.1517A>G	chr13.hg19:g.39587872T>C	ENSP00000332034:p.Gln506Arg	111.0	0.0		61.0	16.0	NM_025138	A6NJ97|Q6P2S2|Q7Z3X5|Q8N3D2|Q8N3P1|Q9H9M1	Missense_Mutation	SNP	ENST00000352251.3	hg19	CCDS9368.2	.	.	.	.	.	.	.	.	.	.	T	10.09	1.254041	0.22965	.	.	ENSG00000120685	ENST00000352251;ENST00000350125	T;T	0.32023	1.47;1.47	5.37	-3.55	0.04639	.	.	.	.	.	T	0.14356	0.0347	N	0.20986	0.625	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.08055	0.001;0.003	T	0.27054	-1.0085	8	.	.	.	4.993	2.6752	0.05079	0.114:0.1423:0.3893:0.3544	.	484;506	A6NJ97;Q86XN7	.;PRSR1_HUMAN	R	506;484	ENSP00000332034:Q506R;ENSP00000339123:Q484R	.	Q	-	2	0	PROSER1	38485872	0.802000	0.28943	0.000000	0.03702	0.402000	0.30811	1.137000	0.31479	-0.946000	0.03677	0.459000	0.35465	CAG	.	.		0.493	PROSER1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044607.5	NM_025138	
DCT	1638	hgsc.bcm.edu	37	13	95112447	95112447	+	Silent	SNP	C	C	T			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr13:95112447C>T	ENST00000377028.5	-	6	1490	c.1077G>A	c.(1075-1077)ggG>ggA	p.G359G	DCT_ENST00000446125.1_Silent_p.G359G|DCT_ENST00000490854.1_5'Flank	NM_001922.3	NP_001913.2	P40126	TYRP2_HUMAN	dopachrome tautomerase	359					cell development (GO:0048468)|developmental pigmentation (GO:0048066)|epidermis development (GO:0008544)|melanin biosynthetic process from tyrosine (GO:0006583)|positive regulation of neuroblast proliferation (GO:0002052)|ventricular zone neuroblast division (GO:0021847)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)	copper ion binding (GO:0005507)|dopachrome isomerase activity (GO:0004167)|oxidoreductase activity (GO:0016491)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	50	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;3.71e-42)|all_epithelial(2;3.76e-31)|all_lung(2;5.16e-14)|Lung NSC(4;1.33e-13)|Breast(118;0.0013)|Hepatocellular(115;0.00886)|Renal(2;0.00988)		COAD - Colon adenocarcinoma(199;7.07e-05)|GBM - Glioblastoma multiforme(99;0.000472)		AATCCAGAGTCCCATCTGCTT	0.413																																					p.G359G		Atlas-SNP	.											.	DCT	186	.	0			c.G1077A						.						85.0	80.0	82.0					13																	95112447		2203	4300	6503	SO:0001819	synonymous_variant	1638	exon6			CAGAGTCCCATCT	D17547	CCDS9470.1, CCDS45060.1	13q32	2012-09-28	2012-09-28		ENSG00000080166	ENSG00000080166	5.3.3.12		2709	protein-coding gene	gene with protein product	"""dopachrome delta-isomerase"""	191275	"""tyrosine-related protein 2"""	TYRP2		8306979	Standard	NM_001922		Approved		uc010afh.3	P40126	OTTHUMG00000017206	ENST00000377028.5:c.1077G>A	chr13.hg19:g.95112447C>T		228.0	0.0		272.0	41.0	NM_001129889	Q09GT4	Silent	SNP	ENST00000377028.5	hg19	CCDS9470.1																																																																																			.	.		0.413	DCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045461.3		
MCF2L	23263	hgsc.bcm.edu	37	13	113741578	113741578	+	Silent	SNP	G	G	A			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr13:113741578G>A	ENST00000375608.3	+	23	2551	c.2493G>A	c.(2491-2493)ctG>ctA	p.L831L	MCF2L_ENST00000375604.2_Silent_p.L858L|MCF2L_ENST00000442652.2_Silent_p.L831L|MCF2L_ENST00000535094.2_Silent_p.L801L|MCF2L_ENST00000423482.2_Silent_p.L799L|MCF2L_ENST00000434480.2_Silent_p.L807L|MCF2L_ENST00000375601.3_Silent_p.L805L|MCF2L_ENST00000375597.4_Silent_p.L799L|MCF2L_ENST00000421756.1_Silent_p.L805L|MCF2L_ENST00000397030.1_Silent_p.L834L			O15068	MCF2L_HUMAN	MCF.2 cell line derived transforming sequence-like	831	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular space (GO:0005615)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			kidney(1)|large_intestine(5)|ovary(1)|stomach(1)	8	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0368)|all_epithelial(44;0.0396)|Lung NSC(25;0.129)|Breast(118;0.188)				GCAAGCTGCTGATGCAGGGCT	0.637																																					p.L801L		Atlas-SNP	.											.	MCF2L	182	.	0			c.G2403A						.						61.0	55.0	57.0					13																	113741578		2203	4299	6502	SO:0001819	synonymous_variant	23263	exon22			GCTGCTGATGCAG	AB002360	CCDS9527.2, CCDS45070.1, CCDS9527.3, CCDS45070.2	13q34	2013-01-10			ENSG00000126217	ENSG00000126217		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14576	protein-coding gene	gene with protein product		609499				9205841	Standard	NM_001112732		Approved	KIAA0362, DBS, OST, ARHGEF14	uc010tjr.2	O15068	OTTHUMG00000017377	ENST00000375608.3:c.2493G>A	chr13.hg19:g.113741578G>A		124.0	0.0		113.0	13.0	NM_001112732	A2A2X1|A2A2X2|A2A3G6|A2A3G8|B4DHD6|B4DIL6|E9PDN8|Q5JU56|Q5VXT1|Q6ZWD4|Q765G8|Q765G9|Q8N679	Silent	SNP	ENST00000375608.3	hg19		.	.	.	.	.	.	.	.	.	.	G	7.902	0.734581	0.15574	.	.	ENSG00000126217	ENST00000397017	.	.	.	4.34	-0.343	0.12632	.	.	.	.	.	T	0.50769	0.1635	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38735	-0.9647	4	.	.	.	.	5.6299	0.17504	0.2053:0.6068:0.1879:0.0	.	.	.	.	N	462	.	.	D	+	1	0	MCF2L	112789579	1.000000	0.71417	0.999000	0.59377	0.773000	0.43773	1.088000	0.30877	0.044000	0.15775	-0.300000	0.09419	GAT	.	.		0.637	MCF2L-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045849.4		
TECPR2	9895	hgsc.bcm.edu	37	14	102881064	102881064	+	Missense_Mutation	SNP	A	A	G			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr14:102881064A>G	ENST00000359520.7	+	5	798	c.572A>G	c.(571-573)cAa>cGa	p.Q191R	TECPR2_ENST00000561228.1_3'UTR|TECPR2_ENST00000558678.1_Missense_Mutation_p.Q191R	NM_014844.3	NP_055659.2	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2	191					autophagy (GO:0006914)|cell death (GO:0008219)					breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(21)|ovary(2)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	50						TCTACTCTGCAAAGAAGTCTG	0.463																																					p.Q191R		Atlas-SNP	.											.	TECPR2	114	.	0			c.A572G						.						150.0	141.0	144.0					14																	102881064		2203	4300	6503	SO:0001583	missense	9895	exon5			CTCTGCAAAGAAG	AB019441	CCDS32162.1, CCDS58337.1	14q32.33	2009-02-27	2009-02-27	2009-02-27		ENSG00000196663			19957	protein-coding gene	gene with protein product		615000	"""KIAA0329"""	KIAA0329		9205841	Standard	NM_014844		Approved		uc001ylw.2	O15040		ENST00000359520.7:c.572A>G	chr14.hg19:g.102881064A>G	ENSP00000352510:p.Gln191Arg	105.0	0.0		116.0	38.0	NM_001172631	A5PKY3|A6NFY9|A7E2X3|H0YMM9|Q9UEG6	Missense_Mutation	SNP	ENST00000359520.7	hg19	CCDS32162.1	.	.	.	.	.	.	.	.	.	.	A	14.38	2.518822	0.44763	.	.	ENSG00000196663	ENST00000359520;ENST00000380088	T	0.01295	5.04	4.89	4.89	0.63831	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.057659	0.64402	D	0.000001	T	0.03390	0.0098	M	0.70595	2.14	0.42066	D	0.991188	B;P;P	0.48503	0.278;0.483;0.911	B;B;B	0.43680	0.057;0.065;0.427	T	0.50398	-0.8833	10	0.52906	T	0.07	.	14.5137	0.67804	1.0:0.0:0.0:0.0	.	191;191;191	B4DK51;A5PKY3;O15040	.;.;TCPR2_HUMAN	R	191	ENSP00000352510:Q191R	ENSP00000352510:Q191R	Q	+	2	0	TECPR2	101950817	1.000000	0.71417	0.030000	0.17652	0.596000	0.36781	8.847000	0.92166	1.825000	0.53177	0.459000	0.35465	CAA	.	.		0.463	TECPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415056.2	NM_014844	
TMEM62	80021	hgsc.bcm.edu	37	15	43473452	43473452	+	Silent	SNP	A	A	G			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr15:43473452A>G	ENST00000260403.2	+	13	1839	c.1560A>G	c.(1558-1560)ggA>ggG	p.G520G	TMEM62_ENST00000569369.1_3'UTR|RP11-473C18.3_ENST00000565685.1_RNA|EPB42_ENST00000563128.1_Intron	NM_024956.3	NP_079232.3	Q0P6H9	TMM62_HUMAN	transmembrane protein 62	520						integral component of membrane (GO:0016021)				breast(1)|cervix(1)|endometrium(3)|large_intestine(3)|lung(4)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	18		all_cancers(109;1.16e-10)|all_epithelial(112;2.01e-09)|Lung NSC(122;8.91e-07)|all_lung(180;8.8e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;4.23e-07)		TTGTTAATGGACATTTCCTAC	0.358																																					p.G520G		Atlas-SNP	.											.	TMEM62	47	.	0			c.A1560G						.						193.0	189.0	190.0					15																	43473452		2203	4299	6502	SO:0001819	synonymous_variant	80021	exon13			TAATGGACATTTC	BC009981	CCDS32210.1	15q15.2	2014-09-11			ENSG00000137842	ENSG00000137842			26269	protein-coding gene	gene with protein product							Standard	NM_024956		Approved	FLJ23375	uc001zqr.3	Q0P6H9	OTTHUMG00000176485	ENST00000260403.2:c.1560A>G	chr15.hg19:g.43473452A>G		72.0	0.0		59.0	7.0	NM_024956	Q6I9Y5|Q9H5J6	Silent	SNP	ENST00000260403.2	hg19	CCDS32210.1																																																																																			.	.		0.358	TMEM62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432227.1	NM_024956	
MNS1	55329	hgsc.bcm.edu	37	15	56736725	56736725	+	Silent	SNP	T	T	C			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr15:56736725T>C	ENST00000260453.3	-	5	767	c.603A>G	c.(601-603)aaA>aaG	p.K201K	TEX9_ENST00000352903.2_Intron|TEX9_ENST00000537232.1_Intron	NM_018365.2	NP_060835.1	Q8NEH6	MNS1_HUMAN	meiosis-specific nuclear structural 1	201	Glu-rich.				cilium organization (GO:0044782)|left/right axis specification (GO:0070986)|meiotic nuclear division (GO:0007126)	axoneme (GO:0005930)|intermediate filament (GO:0005882)|nuclear envelope (GO:0005635)|sperm flagellum (GO:0036126)	identical protein binding (GO:0042802)	p.?(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(4)|ovary(2)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	20				all cancers(107;0.0196)|GBM - Glioblastoma multiforme(80;0.101)		CTTCCTGCTTTTTTTTTTCTT	0.343																																					p.K201K		Atlas-SNP	.											.	MNS1	39	.	1	Unknown(1)	skin(1)	c.A603G						.						154.0	148.0	150.0					15																	56736725		2192	4292	6484	SO:0001819	synonymous_variant	55329	exon5			CTGCTTTTTTTTT	AK002084	CCDS10158.1	15q21.3	2013-01-16			ENSG00000138587	ENSG00000138587			29636	protein-coding gene	gene with protein product	"""spermatogenesis associated 40"""	610766				7625268, 8032679	Standard	NM_018365		Approved	FLJ11222, SPATA40	uc002adr.2	Q8NEH6	OTTHUMG00000132034	ENST00000260453.3:c.603A>G	chr15.hg19:g.56736725T>C		52.0	0.0		46.0	6.0	NM_018365	Q8IYT6|Q9NUP4	Silent	SNP	ENST00000260453.3	hg19	CCDS10158.1																																																																																			.	.		0.343	MNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255047.2	NM_018365	
DPP8	54878	hgsc.bcm.edu	37	15	65799617	65799617	+	Silent	SNP	T	T	C	rs377607090		TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr15:65799617T>C	ENST00000341861.5	-	3	1964	c.384A>G	c.(382-384)ttA>ttG	p.L128L	DPP8_ENST00000339244.5_Silent_p.L128L|DPP8_ENST00000358939.4_Silent_p.L112L|DPP8_ENST00000321118.7_Silent_p.L128L|DPP8_ENST00000559233.1_Silent_p.L128L|DPP8_ENST00000321147.6_Silent_p.L128L|DPP8_ENST00000300141.6_Silent_p.L112L	NM_197960.2	NP_932064.1	Q6V1X1	DPP8_HUMAN	dipeptidyl-peptidase 8	128					immune response (GO:0006955)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(2)|endometrium(3)|large_intestine(11)|lung(11)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						AAGAGAGCATTAAGACTGCTG	0.338																																					p.L128L		Atlas-SNP	.											.	DPP8	78	.	0			c.A384G						.						107.0	106.0	107.0					15																	65799617		2201	4299	6500	SO:0001819	synonymous_variant	54878	exon4			GAGCATTAAGACT	AF221634	CCDS10207.1, CCDS10208.1, CCDS10209.1, CCDS10210.1	15q22	2008-07-18	2006-01-12		ENSG00000074603	ENSG00000074603			16490	protein-coding gene	gene with protein product	"""dipeptidyl peptidase VIII"", ""dipeptidyl peptidase IV-related protein-1"", ""prolyl dipeptidase DPP8"""	606819	"""dipeptidylpeptidase 8"""			11012666	Standard	XM_005254500		Approved	DP8, DPRP1, MSTP141, FLJ14920, FLJ20283, MGC26191	uc002aox.3	Q6V1X1	OTTHUMG00000133150	ENST00000341861.5:c.384A>G	chr15.hg19:g.65799617T>C		76.0	0.0		89.0	12.0	NM_197960	Q7Z4C8|Q7Z4D3|Q7Z4E1|Q8IWG7|Q8NEM5|Q96JX1|Q9HBM2|Q9HBM3|Q9HBM4|Q9HBM5|Q9NXF4	Silent	SNP	ENST00000341861.5	hg19	CCDS10207.1																																																																																			.	.		0.338	DPP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256847.1	NM_017743	
SMG1	23049	hgsc.bcm.edu	37	16	18937327	18937327	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr16:18937327C>T	ENST00000446231.2	-	1	449	c.37G>A	c.(37-39)Ggc>Agc	p.G13S	CTD-2288F12.1_ENST00000565782.1_RNA|SMG1_ENST00000567737.1_5'UTR|SMG1_ENST00000389467.3_Missense_Mutation_p.G13S			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	13	Interaction with SMG8 and SMG9.				DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						ccgccgccgccgctgcTCAGC	0.736																																					p.G13S		Atlas-SNP	.											.	SMG1	401	.	0			c.G37A						.						2.0	3.0	3.0					16																	18937327		1046	2801	3847	SO:0001583	missense	23049	exon1			CGCCGCCGCTGCT	AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.37G>A	chr16.hg19:g.18937327C>T	ENSP00000402515:p.Gly13Ser	88.0	0.0		86.0	5.0	NM_015092	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	ENST00000446231.2	hg19	CCDS45430.1	.	.	.	.	.	.	.	.	.	.	c	16.19	3.051895	0.55218	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	T;T	0.01240	5.12;5.12	4.27	3.31	0.37934	.	0.832224	0.10596	N	0.656220	T	0.00998	0.0033	N	0.14661	0.345	0.31512	N	0.663496	B	0.22346	0.068	B	0.08055	0.003	T	0.29912	-0.9996	10	0.12766	T	0.61	.	6.0417	0.19738	0.0:0.7231:0.0:0.2769	.	13	Q96Q15	SMG1_HUMAN	S	13	ENSP00000402515:G13S;ENSP00000374118:G13S	ENSP00000374118:G13S	G	-	1	0	SMG1	18844828	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.149000	0.42244	0.999000	0.39023	0.455000	0.32223	GGC	.	.		0.736	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391817.1	NM_015092	
PYDC1	260434	hgsc.bcm.edu	37	16	31226434	31226434	+	IGR	SNP	C	C	T	rs553041719		TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr16:31226434C>T	ENST00000302964.3	-	0	813				TRIM72_ENST00000322122.3_Silent_p.A125A|PYDC1_ENST00000568383.1_5'Flank	NM_152901.2	NP_690865.1	Q8WXC3	PYDC1_HUMAN	PYD (pyrin domain) containing 1						innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of interleukin-1 beta secretion (GO:0050718)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(2)|lung(1)	5						CCGCCGAGGCCCACGCACGCC	0.697													C|||	1	0.000199681	0.0	0.0014	5008	,	,		13533	0.0		0.0	False		,,,				2504	0.0				p.A125A		Atlas-SNP	.											.	TRIM72	32	.	0			c.C375T						.						9.0	9.0	9.0					16																	31226434		1796	3450	5246	SO:0001628	intergenic_variant	493829	exon2			CGAGGCCCACGCA		CCDS10710.1	16p11.2	2008-02-05	2005-12-02		ENSG00000169900	ENSG00000169900			30261	protein-coding gene	gene with protein product		615700	"""pyrin domain containing 1"""			11786556, 16905547	Standard	NM_152901		Approved	ASC2, POP1	uc002ebo.3	Q8WXC3	OTTHUMG00000132407		chr16.hg19:g.31226434C>T		20.0	0.0		25.0	8.0	NM_001008274	B2R8L4|Q8NFP8	Silent	SNP	ENST00000302964.3	hg19	CCDS10710.1																																																																																			.	.		0.697	PYDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255543.2	NM_152901	
GSE1	23199	hgsc.bcm.edu	37	16	85690011	85690011	+	Missense_Mutation	SNP	G	G	A	rs374600357		TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr16:85690011G>A	ENST00000253458.7	+	7	1228	c.1052G>A	c.(1051-1053)cGt>cAt	p.R351H	GSE1_ENST00000405402.2_Missense_Mutation_p.R247H|RN7SL381P_ENST00000577658.1_RNA|GSE1_ENST00000393243.1_Missense_Mutation_p.R278H	NM_014615.2	NP_055430.1	Q14687	GSE1_HUMAN	Gse1 coiled-coil protein	351																	gagcgtgagcgtgaggctgac	0.667																																					p.R351H		Atlas-SNP	.											.	.	.	.	0			c.G1052A						.	-	HIS/ARG,HIS/ARG	0,4276		0,0,2138	12.0	13.0	13.0		740,1052	4.6	1.0	16		13	4,8348		0,4,4172	no	missense,missense	KIAA0182	NM_001134473.1,NM_014615.2	29,29	0,4,6310	AA,AG,GG		0.0479,0.0,0.0317	probably-damaging,probably-damaging	247/1114,351/1218	85690011	4,12624	2138	4176	6314	SO:0001583	missense	23199	exon7			GTGAGCGTGAGGC	D80004	CCDS10952.1, CCDS45539.1, CCDS62007.1	16q24.1	2012-12-07	2012-12-07	2012-10-02	ENSG00000131149	ENSG00000131149			28979	protein-coding gene	gene with protein product	"""genetic suppressor element 1"""		"""KIAA0182"", ""Gse1 coiled-coil protein homolog (mouse)"""	KIAA0182		8724849, 8786132	Standard	NM_014615		Approved		uc002fix.4	Q14687	OTTHUMG00000137650	ENST00000253458.7:c.1052G>A	chr16.hg19:g.85690011G>A	ENSP00000253458:p.Arg351His	196.0	0.0		143.0	27.0	NM_014615	D3DUM4|Q8IY61|Q96GA4|Q9BW09	Missense_Mutation	SNP	ENST00000253458.7	hg19	CCDS10952.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	18.37|18.37	3.610108|3.610108	0.66558|0.66558	0.0|0.0	4.79E-4|4.79E-4	ENSG00000131149|ENSG00000131149	ENST00000405402;ENST00000253458;ENST00000393243|ENST00000412692	D;T;D|.	0.81579|.	-1.51;-0.04;-1.51|.	4.6|4.6	4.6|4.6	0.57074|0.57074	.|.	0.279493|.	0.35262|.	N|.	0.003324|.	T|T	0.69895|0.69895	0.3162|0.3162	L|L	0.60067|0.60067	1.865|1.865	0.48087|0.48087	D|D	0.999583|0.999583	D;D|.	0.89917|.	1.0;0.999|.	D;P|.	0.74023|.	0.982;0.902|.	T|T	0.69213|0.69213	-0.5204|-0.5204	10|5	0.52906|.	T|.	0.07|.	-17.7057|-17.7057	15.5565|15.5565	0.76200|0.76200	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	278;351|.	Q14687-3;Q14687|.	.;GSE1_HUMAN|.	H|M	247;351;278|158	ENSP00000384839:R247H;ENSP00000253458:R351H;ENSP00000376934:R278H|.	ENSP00000253458:R351H|.	R|V	+|+	2|1	0|0	KIAA0182|KIAA0182	84247512|84247512	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.778000|0.778000	0.44026|0.44026	8.163000|8.163000	0.89659|0.89659	2.271000|2.271000	0.75665|0.75665	0.556000|0.556000	0.70494|0.70494	CGT|GTG	.	.		0.667	GSE1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325527.1	NM_014615	
SCARF1	8578	hgsc.bcm.edu	37	17	1543920	1543920	+	Missense_Mutation	SNP	T	T	C			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr17:1543920T>C	ENST00000263071.4	-	5	881	c.832A>G	c.(832-834)Aca>Gca	p.T278A	SCARF1_ENST00000574545.1_5'UTR|SCARF1_ENST00000571272.1_Missense_Mutation_p.T278A|SCARF1_ENST00000348987.3_Missense_Mutation_p.T278A	NM_003693.2|NM_145350.1	NP_003684.2|NP_663325.1	Q14162	SREC_HUMAN	scavenger receptor class F, member 1	278					cell adhesion (GO:0007155)|cholesterol catabolic process (GO:0006707)|dendrite development (GO:0016358)|neuron remodeling (GO:0016322)|positive regulation of axon regeneration (GO:0048680)|positive regulation of neuron projection development (GO:0010976)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	endocytic vesicle membrane (GO:0030666)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	low-density lipoprotein particle binding (GO:0030169)|scavenger receptor activity (GO:0005044)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(3)|kidney(2)|lung(9)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		CAGCTGCCTGTGTCTGGAGAG	0.657																																					p.T278A		Atlas-SNP	.											.	SCARF1	46	.	0			c.A832G						.						31.0	26.0	28.0					17																	1543920		2201	4300	6501	SO:0001583	missense	8578	exon5			TGCCTGTGTCTGG	D63483	CCDS11007.1, CCDS45564.1	17p13.3	2008-07-18			ENSG00000074660	ENSG00000074660			16820	protein-coding gene	gene with protein product	"""scavenger receptor expressed by endothelial cells"", ""acetyl LDL receptor"""	607873				9395444, 8590280	Standard	NM_003693		Approved	SREC, KIAA0149	uc002fsz.2	Q14162	OTTHUMG00000090555	ENST00000263071.4:c.832A>G	chr17.hg19:g.1543920T>C	ENSP00000263071:p.Thr278Ala	204.0	0.0		131.0	57.0	NM_145350	A8MQ05|O43701|Q8NHD2|Q8NHD3|Q8NHD4|Q8NHD5	Missense_Mutation	SNP	ENST00000263071.4	hg19	CCDS11007.1	.	.	.	.	.	.	.	.	.	.	T	14.03	2.412905	0.42817	.	.	ENSG00000074660	ENST00000263071;ENST00000348987;ENST00000434376	T;T;T	0.32988	1.43;1.43;1.43	5.24	5.24	0.73138	Growth factor, receptor (1);	0.000000	0.47852	D	0.000201	T	0.46464	0.1394	M	0.75884	2.315	0.43467	D	0.995672	D;P;P	0.53745	0.962;0.86;0.938	P;B;P	0.61003	0.578;0.4;0.882	T	0.49466	-0.8937	10	0.48119	T	0.1	-10.1822	5.176	0.15135	0.0:0.2118:0.0:0.7882	.	278;278;278	Q14162-2;Q14162;Q14162-3	.;SREC_HUMAN;.	A	278	ENSP00000263071:T278A;ENSP00000323964:T278A;ENSP00000411167:T278A	ENSP00000263071:T278A	T	-	1	0	SCARF1	1490670	1.000000	0.71417	1.000000	0.80357	0.497000	0.33675	4.539000	0.60657	2.199000	0.70637	0.533000	0.62120	ACA	.	.		0.657	SCARF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207081.4	NM_003693	
KRTAP4-1	85285	hgsc.bcm.edu	37	17	39340971	39340971	+	Missense_Mutation	SNP	G	G	T	rs375189286	byFrequency	TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr17:39340971G>T	ENST00000398472.1	-	1	623	c.136C>A	c.(136-138)Cgc>Agc	p.R46S				Q9BYQ7	KRA41_HUMAN	keratin associated protein 4-1	46	18 X 5 AA repeats of C-C-[GRQC]-[SPT]- [VSTL].					keratin filament (GO:0045095)				kidney(1)|large_intestine(1)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	5		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			CAGGATGGGCGGCAGCAGCTG	0.647																																					p.R46S		Atlas-SNP	.											.	KRTAP4-1	58	.	0			c.C136A						.						28.0	32.0	31.0					17																	39340971		2174	4287	6461	SO:0001583	missense	85285	exon1			ATGGGCGGCAGCA	AC006070		17q21.2	2013-06-25			ENSG00000198443	ENSG00000198443		"""Keratin associated proteins"""	18907	protein-coding gene	gene with protein product			"""keratin associated protein 4-10"""	KRTAP4-10		11279113	Standard	NM_033060		Approved	KAP4.1, KAP4.10	uc002hwe.4	Q9BYQ7	OTTHUMG00000132081	ENST00000398472.1:c.136C>A	chr17.hg19:g.39340971G>T	ENSP00000381489:p.Arg46Ser	114.0	0.0		124.0	38.0	NM_033060	A8MWS7|Q3SYF2	Missense_Mutation	SNP	ENST00000398472.1	hg19		.	.	.	.	.	.	.	.	.	.	G	11.91	1.781048	0.31502	.	.	ENSG00000244537;ENSG00000198443;ENSG00000198443	ENST00000458321;ENST00000398472;ENST00000334190	T	0.01455	4.87	4.81	3.8	0.43715	.	.	.	.	.	T	0.04137	0.0115	.	.	.	0.24121	N	0.995808	P	0.39665	0.682	P	0.47981	0.563	T	0.36089	-0.9762	8	0.39692	T	0.17	.	12.5323	0.56122	0.0:0.1696:0.8304:0.0	.	46	Q9BYQ7	KRA41_HUMAN	S	42;46;46	ENSP00000381489:R46S	ENSP00000335483:R46S	R	-	1	0	KRTAP4-2;KRTAP4-1	36594497	0.000000	0.05858	0.052000	0.19188	0.006000	0.05464	-0.517000	0.06275	0.927000	0.37143	0.655000	0.94253	CGC	.	.		0.647	KRTAP4-1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000255108.1	NM_033060	
ACLY	47	hgsc.bcm.edu	37	17	40030078	40030078	+	Silent	SNP	G	G	A			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr17:40030078G>A	ENST00000352035.2	-	23	2758	c.2628C>T	c.(2626-2628)ctC>ctT	p.L876L	ACLY_ENST00000537919.1_Silent_p.L605L|ACLY_ENST00000393896.2_Silent_p.L866L|ACLY_ENST00000590151.1_Silent_p.L876L|ACLY_ENST00000353196.1_Silent_p.L866L	NM_001096.2	NP_001087.2	P53396	ACLY_HUMAN	ATP citrate lyase	876					ATP catabolic process (GO:0006200)|cellular carbohydrate metabolic process (GO:0044262)|cellular lipid metabolic process (GO:0044255)|citrate metabolic process (GO:0006101)|coenzyme A metabolic process (GO:0015936)|energy reserve metabolic process (GO:0006112)|lipid biosynthetic process (GO:0008610)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	citrate lyase complex (GO:0009346)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP citrate synthase activity (GO:0003878)|cofactor binding (GO:0048037)|metal ion binding (GO:0046872)|succinate-CoA ligase (ADP-forming) activity (GO:0004775)		NTN1/ACLY(2)	breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(4)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	28		Breast(137;0.000143)				TCTGGAACCAGAGGAGGCCGA	0.577																																					p.L876L	Colon(64;807 1396 15971 30971)	Atlas-SNP	.											.	ACLY	85	.	0			c.C2628T						.						68.0	72.0	71.0					17																	40030078		2203	4300	6503	SO:0001819	synonymous_variant	47	exon23			GAACCAGAGGAGG	X64330	CCDS11412.1, CCDS11413.1	17q21.2	2010-04-27			ENSG00000131473	ENSG00000131473	2.3.3.8		115	protein-coding gene	gene with protein product	"""ATP citrate synthase"""	108728				1371749, 8088842	Standard	NM_001096		Approved	ATPCL, CLATP, ACL	uc002hyg.3	P53396	OTTHUMG00000133507	ENST00000352035.2:c.2628C>T	chr17.hg19:g.40030078G>A		44.0	0.0		51.0	9.0	NM_001096	B4DIM0|B4E3P0|Q13037|Q9BRL0	Silent	SNP	ENST00000352035.2	hg19	CCDS11412.1																																																																																			.	.		0.577	ACLY-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257465.1	NM_001096	
KAT7	11143	hgsc.bcm.edu	37	17	47875714	47875714	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr17:47875714C>T	ENST00000259021.4	+	4	654	c.374C>T	c.(373-375)cCg>cTg	p.P125L	KAT7_ENST00000509773.1_Intron|KAT7_ENST00000510819.1_Intron|KAT7_ENST00000454930.2_Intron|KAT7_ENST00000424009.2_Missense_Mutation_p.P125L|KAT7_ENST00000503935.2_5'UTR|KAT7_ENST00000435742.2_5'UTR	NM_007067.4	NP_008998.1	O95251	KAT7_HUMAN	K(lysine) acetyltransferase 7	125					chromatin organization (GO:0006325)|DNA replication (GO:0006260)|histone H3 acetylation (GO:0043966)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										GATGAGTCACCGCCTCGAACT	0.418																																					p.P125L		Atlas-SNP	.											.	.	.	.	0			c.C374T						.						82.0	73.0	76.0					17																	47875714		2203	4300	6503	SO:0001583	missense	11143	exon4			AGTCACCGCCTCG	AF074606	CCDS11554.1, CCDS56035.1, CCDS56036.1, CCDS56037.1, CCDS56038.1	17q21.32	2013-01-10	2011-07-21	2011-07-21	ENSG00000136504	ENSG00000136504	2.3.1.48	"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	17016	protein-coding gene	gene with protein product	"""histone acetyltransferase binding to ORC1"""	609880	"""MYST histone acetyltransferase 2"""	MYST2		10438470, 10930412	Standard	NM_001199155		Approved	HBOA, HBO1, ZC2HC7	uc002ipm.3	O95251	OTTHUMG00000161770	ENST00000259021.4:c.374C>T	chr17.hg19:g.47875714C>T	ENSP00000259021:p.Pro125Leu	80.0	0.0		111.0	5.0	NM_007067	B3KN74|B4DF85|B4DFB4|B4DFE0|B4DGY4|E7ER15|G5E9K7	Missense_Mutation	SNP	ENST00000259021.4	hg19	CCDS11554.1	.	.	.	.	.	.	.	.	.	.	C	36	5.681181	0.96774	.	.	ENSG00000136504	ENST00000259021;ENST00000424009	.	.	.	6.14	6.14	0.99180	.	0.000000	0.85682	D	0.000000	T	0.77177	0.4092	L	0.53249	1.67	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.72443	-0.4292	9	0.39692	T	0.17	-13.3576	20.4548	0.99139	0.0:1.0:0.0:0.0	.	125;125	O95251;G5E9K7	KAT7_HUMAN;.	L	125	.	ENSP00000259021:P125L	P	+	2	0	KAT7	45230713	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.796000	0.85898	2.937000	0.99478	0.650000	0.86243	CCG	.	.		0.418	KAT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366032.1	NM_007067	
C17orf64	124773	hgsc.bcm.edu	37	17	58506757	58506757	+	Missense_Mutation	SNP	C	C	A			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr17:58506757C>A	ENST00000269127.4	+	5	548	c.464C>A	c.(463-465)tCc>tAc	p.S155Y		NM_181707.2	NP_859058.2	Q86WR6	CQ064_HUMAN	chromosome 17 open reading frame 64	155								p.S45Y(1)		breast(2)|large_intestine(1)|lung(3)	6	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;5.81e-13)|all cancers(12;2.17e-11)|Colorectal(3;0.01)			CCGGAGAGGTCCTTGCTGGCC	0.602																																					p.S155Y		Atlas-SNP	.											C17orf64,NS,carcinoma,0,1	C17orf64	19	.	1	Substitution - Missense(1)	lung(1)	c.C464A						.						39.0	40.0	40.0					17																	58506757		2203	4300	6503	SO:0001583	missense	124773	exon5			AGAGGTCCTTGCT	BC048806	CCDS32698.2	17q23.2	2005-12-16			ENSG00000141371	ENSG00000141371			26990	protein-coding gene	gene with protein product						12477932	Standard	NM_181707		Approved		uc002iyq.3	Q86WR6	OTTHUMG00000157171	ENST00000269127.4:c.464C>A	chr17.hg19:g.58506757C>A	ENSP00000269127:p.Ser155Tyr	139.0	1.0		171.0	53.0	NM_181707	Q8IY87	Missense_Mutation	SNP	ENST00000269127.4	hg19	CCDS32698.2	.	.	.	.	.	.	.	.	.	.	C	11.67	1.709148	0.30322	.	.	ENSG00000141371	ENST00000269127	.	.	.	4.3	1.07	0.20283	.	0.717069	0.12126	N	0.497239	T	0.39989	0.1099	M	0.65975	2.015	0.09310	N	1	P	0.34462	0.454	B	0.37833	0.259	T	0.41520	-0.9504	9	0.87932	D	0	-5.0308	4.6136	0.12415	0.0:0.6097:0.1825:0.2078	.	155	Q86WR6	CQ064_HUMAN	Y	155	.	ENSP00000269127:S155Y	S	+	2	0	C17orf64	55861539	0.000000	0.05858	0.006000	0.13384	0.004000	0.04260	0.335000	0.19806	0.436000	0.26393	0.561000	0.74099	TCC	.	.		0.602	C17orf64-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000347743.1	NM_181707	
GAA	2548	hgsc.bcm.edu	37	17	78092487	78092487	+	Silent	SNP	T	T	C			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr17:78092487T>C	ENST00000302262.3	+	19	2901	c.2682T>C	c.(2680-2682)agT>agC	p.S894S	GAA_ENST00000390015.3_Silent_p.S894S	NM_000152.3	NP_000143.2	P10253	LYAG_HUMAN	glucosidase, alpha; acid	894					cardiac muscle contraction (GO:0060048)|diaphragm contraction (GO:0002086)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|heart morphogenesis (GO:0003007)|locomotory behavior (GO:0007626)|lysosome organization (GO:0007040)|maltose metabolic process (GO:0000023)|muscle cell cellular homeostasis (GO:0046716)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|regulation of the force of heart contraction (GO:0002026)|sucrose metabolic process (GO:0005985)|tissue development (GO:0009888)|vacuolar sequestering (GO:0043181)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|maltose alpha-glucosidase activity (GO:0032450)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(6)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	21	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)		Acarbose(DB00284)|Miglitol(DB00491)	GTGTGACCAGTGAGGGAGCTG	0.607																																					p.S894S		Atlas-SNP	.											.	GAA	66	.	0			c.T2682C						.						155.0	144.0	147.0					17																	78092487		2203	4300	6503	SO:0001819	synonymous_variant	2548	exon20			GACCAGTGAGGGA		CCDS32760.1	17q25.2-q25.3	2014-09-17	2008-08-01				3.2.1.20		4065	protein-coding gene	gene with protein product	"""Pompe disease"", ""glycogen storage disease type II"""	606800					Standard	NM_000152		Approved		uc002jxq.3	P10253		ENST00000302262.3:c.2682T>C	chr17.hg19:g.78092487T>C		60.0	0.0		56.0	11.0	NM_001079803	Q09GN4|Q14351|Q16302|Q8IWE7	Silent	SNP	ENST00000302262.3	hg19	CCDS32760.1																																																																																			.	.		0.607	GAA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437441.1		
FBXO15	201456	hgsc.bcm.edu	37	18	71791775	71791775	+	Missense_Mutation	SNP	T	T	C			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr18:71791775T>C	ENST00000419743.2	-	7	1023	c.944A>G	c.(943-945)aAt>aGt	p.N315S	FBXO15_ENST00000269500.5_Missense_Mutation_p.N239S	NM_001142958.1	NP_001136430.1	Q8NCQ5	FBX15_HUMAN	F-box protein 15	315						SCF ubiquitin ligase complex (GO:0019005)				autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)	27		Esophageal squamous(42;0.103)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.143)		AAAATGAAGATTTGCCATAAC	0.333																																					p.N315S		Atlas-SNP	.											.	FBXO15	97	.	0			c.A944G						.						165.0	160.0	162.0					18																	71791775		2203	4300	6503	SO:0001583	missense	201456	exon7			TGAAGATTTGCCA	AK094215	CCDS45884.1	18q22.3	2006-03-09	2004-06-15		ENSG00000141665	ENSG00000141665		"""F-boxes /  ""other"""""	13617	protein-coding gene	gene with protein product		609093	"""F-box only protein 15"""			12665572	Standard	NM_152676		Approved	MGC39671, FBX15	uc002llf.2	Q8NCQ5	OTTHUMG00000132842	ENST00000419743.2:c.944A>G	chr18.hg19:g.71791775T>C	ENSP00000393154:p.Asn315Ser	157.0	0.0		116.0	48.0	NM_001142958	B3KST3	Missense_Mutation	SNP	ENST00000419743.2	hg19	CCDS45884.1	.	.	.	.	.	.	.	.	.	.	T	11.13	1.546799	0.27652	.	.	ENSG00000141665	ENST00000269500;ENST00000419743	T;T	0.47177	0.88;0.85	5.31	2.88	0.33553	.	0.256263	0.43747	N	0.000525	T	0.29389	0.0732	L	0.44542	1.39	0.28125	N	0.930441	P;P	0.38020	0.473;0.615	B;B	0.29267	0.056;0.1	T	0.14227	-1.0480	10	0.20519	T	0.43	-17.1188	5.7565	0.18176	0.0:0.0865:0.3281:0.5854	.	315;239	B3KST3;Q8NCQ5	.;FBX15_HUMAN	S	239;315	ENSP00000269500:N239S;ENSP00000393154:N315S	ENSP00000269500:N239S	N	-	2	0	FBXO15	69942755	0.995000	0.38212	0.999000	0.59377	0.993000	0.82548	0.447000	0.21710	0.320000	0.23234	0.460000	0.39030	AAT	.	.		0.333	FBXO15-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000444223.1	NM_152676	
RDH8	50700	hgsc.bcm.edu	37	19	10129559	10129559	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr19:10129559G>A	ENST00000171214.1	+	3	664	c.415G>A	c.(415-417)Gtg>Atg	p.V139M	RDH8_ENST00000591589.1_Missense_Mutation_p.V159M	NM_015725.2	NP_056540.2	Q9NYR8	RDH8_HUMAN	retinol dehydrogenase 8 (all-trans)	139					estrogen biosynthetic process (GO:0006703)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|steroid biosynthetic process (GO:0006694)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	estradiol 17-beta-dehydrogenase activity (GO:0004303)|NADP-retinol dehydrogenase activity (GO:0052650)|retinol dehydrogenase activity (GO:0004745)			endometrium(3)|large_intestine(3)|lung(10)|ovary(3)|pancreas(1)|prostate(1)	21			Epithelial(33;4.24e-05)		Vitamin A(DB00162)	CCACATCGTGGTGATCAGCAG	0.577																																					p.V159M		Atlas-SNP	.											.	RDH8	51	.	0			c.G475A						.						77.0	75.0	75.0					19																	10129559		2203	4300	6503	SO:0001583	missense	50700	exon3			ATCGTGGTGATCA	AF229845	CCDS12223.1, CCDS12223.2	19p13.2	2011-09-14				ENSG00000080511	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	14423	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 28C, member 2"""	608575				10753906, 19027726	Standard	NM_015725		Approved	PRRDH, SDR28C2	uc002mmr.4	Q9NYR8		ENST00000171214.1:c.415G>A	chr19.hg19:g.10129559G>A	ENSP00000171214:p.Val139Met	93.0	0.0		88.0	34.0	NM_015725	Q9H838	Missense_Mutation	SNP	ENST00000171214.1	hg19		.	.	.	.	.	.	.	.	.	.	G	23.4	4.414753	0.83449	.	.	ENSG00000080511	ENST00000171214	D	0.93307	-3.2	5.34	5.34	0.76211	NAD(P)-binding domain (1);	0.062472	0.64402	D	0.000006	D	0.93423	0.7902	N	0.17082	0.46	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	D	0.94101	0.7362	10	0.49607	T	0.09	.	16.5222	0.84320	0.0:0.0:1.0:0.0	.	139	Q9NYR8	RDH8_HUMAN	M	139	ENSP00000171214:V139M	ENSP00000171214:V139M	V	+	1	0	RDH8	9990559	1.000000	0.71417	1.000000	0.80357	0.732000	0.41865	7.596000	0.82721	2.492000	0.84095	0.491000	0.48974	GTG	.	.		0.577	RDH8-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			
SMARCA4	6597	hgsc.bcm.edu	37	19	11138584	11138584	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr19:11138584G>A	ENST00000429416.3	+	25	3621	c.3340G>A	c.(3340-3342)Gat>Aat	p.D1114N	SMARCA4_ENST00000450717.3_Missense_Mutation_p.D1114N|SMARCA4_ENST00000358026.2_Missense_Mutation_p.D1114N|SMARCA4_ENST00000541122.2_Missense_Mutation_p.D1114N|SMARCA4_ENST00000444061.3_Missense_Mutation_p.D1114N|SMARCA4_ENST00000590574.1_Missense_Mutation_p.D1114N|SMARCA4_ENST00000589677.1_Missense_Mutation_p.D1114N|SMARCA4_ENST00000413806.3_Missense_Mutation_p.D1114N|SMARCA4_ENST00000344626.4_Missense_Mutation_p.D1114N	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	1114	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(2)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				CATCATGGAAGATTACTTTGC	0.458			"""F, N, Mis"""		NSCLC																																p.D1114N		Atlas-SNP	.		Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	.	SMARCA4	502	.	2	Unknown(2)	lung(2)	c.G3340A						.						180.0	175.0	177.0					19																	11138584		2203	4300	6503	SO:0001583	missense	6597	exon24			ATGGAAGATTACT	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.3340G>A	chr19.hg19:g.11138584G>A	ENSP00000395654:p.Asp1114Asn	115.0	0.0		131.0	24.0	NM_003072	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	hg19	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	G	35	5.426567	0.96131	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	T;T;T;T;T;T;T	0.75938	-0.98;-0.98;-0.98;-0.98;-0.98;-0.98;-0.98	5.04	5.04	0.67666	Helicase, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.87297	0.6142	M	0.83312	2.635	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;0.999;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	1.0;0.999;0.999;1.0;1.0;0.994;1.0;1.0	D	0.89009	0.3427	10	0.87932	D	0	-31.0813	17.3259	0.87246	0.0:0.0:1.0:0.0	.	1114;1114;1114;1114;1114;334;1114;1114	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;B4E0F1;A7E2E1;P51532	.;.;.;.;.;.;.;SMCA4_HUMAN	N	1114;1114;1178;1114;1114;1114;1114;1114	ENSP00000395654:D1114N;ENSP00000350720:D1114N;ENSP00000343896:D1114N;ENSP00000445036:D1114N;ENSP00000392837:D1114N;ENSP00000397783:D1114N;ENSP00000414727:D1114N	ENSP00000343896:D1114N	D	+	1	0	SMARCA4	10999584	1.000000	0.71417	0.983000	0.44433	0.990000	0.78478	9.293000	0.96082	2.617000	0.88574	0.655000	0.94253	GAT	.	.		0.458	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072	
ZNF701	55762	hgsc.bcm.edu	37	19	53086589	53086589	+	Missense_Mutation	SNP	C	C	A			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr19:53086589C>A	ENST00000540331.1	+	5	1700	c.1475C>A	c.(1474-1476)gCa>gAa	p.A492E	ZNF701_ENST00000301093.2_Missense_Mutation_p.A492E|ZNF701_ENST00000391785.3_Missense_Mutation_p.A426E|CTD-3099C6.7_ENST00000599222.1_RNA	NM_001172655.1	NP_001166126.1	Q9NV72	ZN701_HUMAN	zinc finger protein 701	492					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|kidney(1)|large_intestine(2)|lung(6)	14				OV - Ovarian serous cystadenocarcinoma(262;0.0105)|GBM - Glioblastoma multiforme(134;0.0402)		TCAAACCTTGCATGTCATCGT	0.353																																					p.A492E	NSCLC(89;451 1475 9611 20673 52284)	Atlas-SNP	.											.	ZNF701	44	.	0			c.C1475A						.						50.0	42.0	44.0					19																	53086589		2203	4298	6501	SO:0001583	missense	55762	exon5			ACCTTGCATGTCA	AK001753	CCDS33092.1, CCDS54311.1	19q13.41	2013-01-08				ENSG00000167562		"""Zinc fingers, C2H2-type"", ""-"""	25597	protein-coding gene	gene with protein product							Standard	NM_018260		Approved	FLJ10891	uc021uyw.1	Q9NV72		ENST00000540331.1:c.1475C>A	chr19.hg19:g.53086589C>A	ENSP00000444339:p.Ala492Glu	245.0	0.0		188.0	8.0	NM_001172655	A2RRM8|B9EGF2|F5GZM6|Q66K42	Missense_Mutation	SNP	ENST00000540331.1	hg19	CCDS54311.1	.	.	.	.	.	.	.	.	.	.	c	0.275	-0.990405	0.02162	.	.	ENSG00000167562	ENST00000391785;ENST00000301093;ENST00000540331	T;T;T	0.17054	2.3;2.3;2.3	1.98	-3.96	0.04106	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06280	0.0162	N	0.11313	0.125	0.09310	N	1	B;B	0.11235	0.003;0.004	B;B	0.20577	0.03;0.004	T	0.26985	-1.0087	9	0.22706	T	0.39	.	0.4102	0.00440	0.2682:0.2962:0.1329:0.3027	.	492;426	F5GZM6;Q9NV72	.;ZN701_HUMAN	E	426;492;492	ENSP00000375662:A426E;ENSP00000301093:A492E;ENSP00000444339:A492E	ENSP00000301093:A492E	A	+	2	0	ZNF701	57778401	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-10.911000	0.00005	-3.031000	0.00266	-2.043000	0.00416	GCA	.	.		0.353	ZNF701-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463467.1	NM_018260	
ZNF701	55762	hgsc.bcm.edu	37	19	53086622	53086622	+	Missense_Mutation	SNP	C	C	G	rs142390931		TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr19:53086622C>G	ENST00000540331.1	+	5	1733	c.1508C>G	c.(1507-1509)cCt>cGt	p.P503R	ZNF701_ENST00000301093.2_Missense_Mutation_p.P503R|ZNF701_ENST00000391785.3_Missense_Mutation_p.P437R|CTD-3099C6.7_ENST00000599222.1_RNA	NM_001172655.1	NP_001166126.1	Q9NV72	ZN701_HUMAN	zinc finger protein 701	503					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|kidney(1)|large_intestine(2)|lung(6)	14				OV - Ovarian serous cystadenocarcinoma(262;0.0105)|GBM - Glioblastoma multiforme(134;0.0402)		GGAGAGAAACCTTACAAGTGT	0.348																																					p.P503R	NSCLC(89;451 1475 9611 20673 52284)	Atlas-SNP	.											.	ZNF701	44	.	0			c.C1508G						.						44.0	40.0	41.0					19																	53086622		2200	4292	6492	SO:0001583	missense	55762	exon5			AGAAACCTTACAA	AK001753	CCDS33092.1, CCDS54311.1	19q13.41	2013-01-08				ENSG00000167562		"""Zinc fingers, C2H2-type"", ""-"""	25597	protein-coding gene	gene with protein product							Standard	NM_018260		Approved	FLJ10891	uc021uyw.1	Q9NV72		ENST00000540331.1:c.1508C>G	chr19.hg19:g.53086622C>G	ENSP00000444339:p.Pro503Arg	274.0	0.0		227.0	11.0	NM_001172655	A2RRM8|B9EGF2|F5GZM6|Q66K42	Missense_Mutation	SNP	ENST00000540331.1	hg19	CCDS54311.1	.	.	.	.	.	.	.	.	.	.	C	13.24	2.178537	0.38511	.	.	ENSG00000167562	ENST00000391785;ENST00000301093;ENST00000540331	T;T;T	0.27890	1.64;1.64;1.64	1.98	0.858	0.19030	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.48589	0.1508	M	0.68728	2.09	0.23524	N	0.997498	D;D	0.89917	1.0;1.0	D;D	0.91635	0.983;0.999	T	0.27606	-1.0069	9	0.87932	D	0	.	7.4095	0.27009	0.0:0.8493:0.0:0.1507	.	503;437	F5GZM6;Q9NV72	.;ZN701_HUMAN	R	437;503;503	ENSP00000375662:P437R;ENSP00000301093:P503R;ENSP00000444339:P503R	ENSP00000301093:P503R	P	+	2	0	ZNF701	57778434	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	0.201000	0.17276	0.156000	0.19299	0.462000	0.41574	CCT	.	C|1.000;T|0.000		0.348	ZNF701-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463467.1	NM_018260	
ZNF701	55762	hgsc.bcm.edu	37	19	53086658	53086659	+	Missense_Mutation	DNP	GA	GA	AC			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	G|A	G|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr19:53086658_53086659GA>AC	ENST00000540331.1	+	5	1769_1770	c.1544_1545GA>AC	c.(1543-1545)cGA>cAC	p.R515H	ZNF701_ENST00000301093.2_Missense_Mutation_p.R515H|ZNF701_ENST00000391785.3_Missense_Mutation_p.R449H|CTD-3099C6.7_ENST00000599222.1_RNA	NM_001172655.1	NP_001166126.1	Q9NV72	ZN701_HUMAN	zinc finger protein 701	515					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|kidney(1)|large_intestine(2)|lung(6)	14				OV - Ovarian serous cystadenocarcinoma(262;0.0105)|GBM - Glioblastoma multiforme(134;0.0402)		GTTTTTAATCGAAAATCAAACC	0.361																																					p.R515Q|p.R515R	NSCLC(89;451 1475 9611 20673 52284)	Atlas-SNP	.											ZNF701,NS,carcinoma,0,1|.	ZNF701	44	.	0			c.G1544A|c.A1545C						.																																			SO:0001583	missense	55762	exon5			TTAATCGAAAATC|TAATCGAAAATCA	AK001753	CCDS33092.1, CCDS54311.1	19q13.41	2013-01-08				ENSG00000167562		"""Zinc fingers, C2H2-type"", ""-"""	25597	protein-coding gene	gene with protein product							Standard	NM_018260		Approved	FLJ10891	uc021uyw.1	Q9NV72		Exception_encountered	chr19.hg19:g.53086658_53086659delinsAC	ENSP00000444339:p.Arg515His	315.0|314.0	0.0		242.0	28.0	NM_001172655	A2RRM8|B9EGF2|F5GZM6|Q66K42	Missense_Mutation|Silent	SNP	ENST00000540331.1	hg19	CCDS54311.1																																																																																			.	.		0.361	ZNF701-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463467.1	NM_018260	
HSPBP1	23640	hgsc.bcm.edu	37	19	55790902	55790902	+	Silent	SNP	C	C	G			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr19:55790902C>G	ENST00000255631.5	-	3	385	c.75G>C	c.(73-75)ggG>ggC	p.G25G	HSPBP1_ENST00000376343.3_Silent_p.G25G|HSPBP1_ENST00000433386.2_Silent_p.G25G|HSPBP1_ENST00000587922.1_Silent_p.G25G|BRSK1_ENST00000590333.1_5'Flank	NM_001130106.1|NM_012267.4	NP_001123578.1|NP_036399.3	Q9NZL4	HPBP1_HUMAN	HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1	25	Gly-rich.		Missing. {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:9830037, ECO:0000269|Ref.3, ECO:0000269|Ref.6}.		negative regulation of catalytic activity (GO:0043086)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein folding (GO:0006457)		enzyme inhibitor activity (GO:0004857)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)|urinary_tract(1)	8			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		CGCCGCCGCCCCCTGAAGAGC	0.692																																					p.G25G		Atlas-SNP	.											.	HSPBP1	24	.	0			c.G75C						.						7.0	10.0	9.0					19																	55790902		1738	3706	5444	SO:0001819	synonymous_variant	23640	exon2			GCCGCCCCCTGAA		CCDS33111.1	19q13.42	2008-12-16			ENSG00000133265	ENSG00000133265			24989	protein-coding gene	gene with protein product	"""hsp70 interacting protein"", ""Hsp70 binding protein 1"""	612939				10786638, 9830037	Standard	NM_001130106		Approved	HspBP1, FES1	uc002qkd.3	Q9NZL4		ENST00000255631.5:c.75G>C	chr19.hg19:g.55790902C>G		64.0	0.0		75.0	5.0	NM_012267	B3KQP0|B4DG11|O95351|Q6ZNU5	Silent	SNP	ENST00000255631.5	hg19	CCDS33111.1																																																																																			.	.		0.692	HSPBP1-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452670.1	NM_012267	
MATN4	8785	hgsc.bcm.edu	37	20	43934157	43934157	+	Missense_Mutation	SNP	C	C	G			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr20:43934157C>G	ENST00000372754.1	-	1	74	c.66G>C	c.(64-66)caG>caC	p.Q22H	MATN4_ENST00000342716.4_Missense_Mutation_p.Q22H|RBPJL_ENST00000343694.3_5'Flank|MATN4_ENST00000372751.4_Missense_Mutation_p.Q22H|MATN4_ENST00000360607.6_Missense_Mutation_p.Q22H|MATN4_ENST00000353917.5_Missense_Mutation_p.Q22H|MATN4_ENST00000372756.1_Missense_Mutation_p.Q22H|MATN4_ENST00000537548.1_Missense_Mutation_p.Q22H|RBPJL_ENST00000372743.1_5'Flank|RBPJL_ENST00000372741.3_5'Flank			O95460	MATN4_HUMAN	matrilin 4	22					extracellular matrix organization (GO:0030198)|response to axon injury (GO:0048678)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	27		Myeloproliferative disorder(115;0.0122)				CACCTGTCAACTGGAGCTGGG	0.637																																					p.Q22H		Atlas-SNP	.											.	MATN4	57	.	0			c.G66C						.						31.0	23.0	26.0					20																	43934157		2183	4246	6429	SO:0001583	missense	8785	exon2			TGTCAACTGGAGC	AJ007581	CCDS13348.1, CCDS46607.1	20q13.1-q13.2	2008-07-07			ENSG00000124159	ENSG00000124159			6910	protein-coding gene	gene with protein product		603897				9827539, 9027493	Standard	NM_003833		Approved		uc002xnn.2	O95460	OTTHUMG00000033043	ENST00000372754.1:c.66G>C	chr20.hg19:g.43934157C>G	ENSP00000361840:p.Gln22His	35.0	0.0		48.0	16.0	NM_030592	A6NH94|A6NKN5|Q5QPU2|Q5QPU3|Q5QPU4|Q8N2M5|Q8N2M7|Q9H1F8|Q9H1F9	Missense_Mutation	SNP	ENST00000372754.1	hg19		.	.	.	.	.	.	.	.	.	.	C	11.28	1.593129	0.28357	.	.	ENSG00000124159	ENST00000372753;ENST00000372754;ENST00000372756;ENST00000353917;ENST00000360607;ENST00000342716;ENST00000537548;ENST00000255132;ENST00000372751	T;T;T;T;T;T;T;T	0.78003	-1.04;-1.14;-1.14;-1.14;-1.14;-1.14;-1.14;-1.04	3.89	3.89	0.44902	.	0.191348	0.25587	N	0.029654	D	0.85353	0.5677	M	0.70275	2.135	0.09310	N	1	P;D;D	0.71674	0.952;0.998;0.972	B;D;P	0.72982	0.395;0.979;0.599	T	0.76242	-0.3031	10	0.72032	D	0.01	.	11.6801	0.51453	0.0:1.0:0.0:0.0	.	22;22;22	A6NNA4;O95460-4;O95460-2	.;.;.	H	22	ENSP00000361839:Q22H;ENSP00000361840:Q22H;ENSP00000361842:Q22H;ENSP00000243983:Q22H;ENSP00000353819:Q22H;ENSP00000343164:Q22H;ENSP00000440328:Q22H;ENSP00000361837:Q22H	ENSP00000255132:Q22H	Q	-	3	2	MATN4	43367571	0.729000	0.28090	0.033000	0.17914	0.027000	0.11550	0.946000	0.29069	2.479000	0.83701	0.557000	0.71058	CAG	.	.		0.637	MATN4-002	KNOWN	non_canonical_conserved|non_canonical_U12|not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000080335.1		
DSCAM	1826	hgsc.bcm.edu	37	21	41725589	41725589	+	Missense_Mutation	SNP	C	C	A			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr21:41725589C>A	ENST00000400454.1	-	5	1214	c.737G>T	c.(736-738)tGc>tTc	p.C246F		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	246	Ig-like C2-type 3.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				GAGCGCTTTGCAAGGCAGCTC	0.572																																					p.C246F	Melanoma(134;970 1778 1785 21664 32388)	Atlas-SNP	.											.	DSCAM	347	.	0			c.G737T						.						32.0	32.0	32.0					21																	41725589		1924	4135	6059	SO:0001583	missense	1826	exon5			GCTTTGCAAGGCA	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.737G>T	chr21.hg19:g.41725589C>A	ENSP00000383303:p.Cys246Phe	51.0	0.0		52.0	9.0	NM_001271534	O60468	Missense_Mutation	SNP	ENST00000400454.1	hg19	CCDS42929.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.529045	0.85706	.	.	ENSG00000171587	ENST00000400454	T	0.65178	-0.14	5.31	5.31	0.75309	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.86285	0.5896	H	0.96547	3.84	0.80722	D	1	D	0.65815	0.995	D	0.72982	0.979	D	0.90431	0.4424	10	0.87932	D	0	.	19.3181	0.94224	0.0:1.0:0.0:0.0	.	246	O60469	DSCAM_HUMAN	F	246	ENSP00000383303:C246F	ENSP00000383303:C246F	C	-	2	0	DSCAM	40647459	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.354000	0.79424	2.629000	0.89072	0.650000	0.86243	TGC	.	.		0.572	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389	
GNAZ	2781	hgsc.bcm.edu	37	22	23438485	23438485	+	Silent	SNP	C	C	T	rs375941406		TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr22:23438485C>T	ENST00000248996.4	+	2	1269	c.603C>T	c.(601-603)gaC>gaT	p.D201D	RTDR1_ENST00000216036.4_Intron	NM_002073.2	NP_002064.1	P19086	GNAZ_HUMAN	guanine nucleotide binding protein (G protein), alpha z polypeptide	201					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled serotonin receptor binding (GO:0031821)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|receptor signaling protein activity (GO:0005057)|signal transducer activity (GO:0004871)	p.D201D(1)		endometrium(3)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(5)|urinary_tract(1)	19	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.166)		AGATGGTGGACGTGGGGGGGC	0.572													C|||	1	0.000199681	0.0	0.0	5008	,	,		19093	0.0		0.001	False		,,,				2504	0.0				p.D201D		Atlas-SNP	.											GNAZ,NS,carcinoma,0,1	GNAZ	45	.	1	Substitution - coding silent(1)	lung(1)	c.C603T						.	C	,	0,4406		0,0,2203	131.0	137.0	135.0		603,	-8.9	0.4	22		135	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,intron	GNAZ,RTDR1	NM_002073.2,NM_014433.2	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	201/356,	23438485	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	2781	exon2			GGTGGACGTGGGG		CCDS13804.1	22q11.1-q11.2	2008-06-10			ENSG00000128266	ENSG00000128266			4395	protein-coding gene	gene with protein product		139160				2115889	Standard	NM_002073		Approved		uc002zwu.1	P19086	OTTHUMG00000150611	ENST00000248996.4:c.603C>T	chr22.hg19:g.23438485C>T		44.0	0.0		36.0	14.0	NM_002073	B2R6C1|Q4QRJ6	Silent	SNP	ENST00000248996.4	hg19	CCDS13804.1																																																																																			.	.		0.572	GNAZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319073.1	NM_002073	
GATSL3	652968	hgsc.bcm.edu	37	22	30683518	30683518	+	Silent	SNP	A	A	C			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr22:30683518A>C	ENST00000407689.3	-	3	345	c.216T>G	c.(214-216)gcT>gcG	p.A72A	RP1-130H16.18_ENST00000447976.1_3'UTR|GATSL3_ENST00000404953.3_Silent_p.A72A|GATSL3_ENST00000459785.1_5'Flank	NM_001037666.2	NP_001032755.1	Q8WTX7	GATL3_HUMAN	GATS protein-like 3	72										breast(1)|endometrium(1)|lung(1)	3						ATGTGGCCTCAGCTACTTGCA	0.632											OREG0026457	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A72A		Atlas-SNP	.											.	GATSL3	14	.	0			c.T216G						.						24.0	27.0	26.0					22																	30683518		2185	4267	6452	SO:0001819	synonymous_variant	652968	exon3			GGCCTCAGCTACT		CCDS43001.1	22q12	2010-06-23			ENSG00000239282	ENSG00000239282			34423	protein-coding gene	gene with protein product							Standard	NM_001037666		Approved			Q8WTX7	OTTHUMG00000150929	ENST00000407689.3:c.216T>G	chr22.hg19:g.30683518A>C		49.0	0.0	819	42.0	17.0	NM_001037666	O76052|Q96ND9|Q9UIE8	Silent	SNP	ENST00000407689.3	hg19	CCDS43001.1																																																																																			.	.		0.632	GATSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320581.2	NM_001037666	
SHROOM4	57477	hgsc.bcm.edu	37	X	50350752	50350752	+	Silent	SNP	T	T	C	rs534812379		TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chrX:50350752T>C	ENST00000289292.7	-	6	3673	c.3390A>G	c.(3388-3390)caA>caG	p.Q1130Q	SHROOM4_ENST00000460112.3_Silent_p.Q1014Q|SHROOM4_ENST00000376020.2_Silent_p.Q1130Q			Q9ULL8	SHRM4_HUMAN	shroom family member 4	1130	Gln-rich.			KQQ -> QQQQKQQE (in Ref. 1; BAA86516 and 3; AAI51241). {ECO:0000305}.	actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					cctcctcctgttgcttctgct	0.582																																					p.Q1130Q		Atlas-SNP	.											.	SHROOM4	171	.	0			c.A3390G						.						15.0	15.0	15.0					X																	50350752		2198	4291	6489	SO:0001819	synonymous_variant	57477	exon6			CTCCTGTTGCTTC	AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.3390A>G	chrX.hg19:g.50350752T>C		39.0	0.0		24.0	5.0	NM_020717	A7E2X9|D6RFW0|Q96LA0	Silent	SNP	ENST00000289292.7	hg19	CCDS35277.1																																																																																			.	.		0.582	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056564.4	NM_020717	
MAGEC3	139081	hgsc.bcm.edu	37	X	140969562	140969562	+	Nonsense_Mutation	SNP	G	G	T			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chrX:140969562G>T	ENST00000298296.1	+	4	889	c.889G>T	c.(889-891)Gaa>Taa	p.E297*	MAGEC3_ENST00000536088.1_Intron|MAGEC3_ENST00000448920.1_Intron|MAGEC3_ENST00000443323.2_Intron	NM_138702.1	NP_619647.1	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3	297	MAGE 1. {ECO:0000255|PROSITE- ProRule:PRU00127}.									NS(2)|breast(3)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|liver(1)|lung(32)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(2)	69	Acute lymphoblastic leukemia(192;6.56e-05)					GGTCATCTGGGAAGTGCTGAA	0.512																																					p.E297X		Atlas-SNP	.											.	MAGEC3	228	.	0			c.G889T						.						126.0	122.0	124.0					X																	140969562		2203	4300	6503	SO:0001587	stop_gained	139081	exon4			ATCTGGGAAGTGC	AF490508	CCDS14676.1, CCDS14677.1	Xq27.2	2009-03-25			ENSG00000165509	ENSG00000165509			23798	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 2"""	300469				10861452	Standard	NM_138702		Approved	HCA2, MAGE-C3, CT7.2	uc011mwp.2	Q8TD91	OTTHUMG00000022570	ENST00000298296.1:c.889G>T	chrX.hg19:g.140969562G>T	ENSP00000298296:p.Glu297*	66.0	0.0		58.0	27.0	NM_138702	Q3SYA7|Q5JZ43|Q9BZ80	Nonsense_Mutation	SNP	ENST00000298296.1	hg19	CCDS14676.1	.	.	.	.	.	.	.	.	.	.	G	15.41	2.826192	0.50739	.	.	ENSG00000165509	ENST00000298296	.	.	.	2.26	0.324	0.15898	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	.	2.2627	0.04071	0.1932:0.0:0.5038:0.303	.	.	.	.	X	297	.	ENSP00000298296:E297X	E	+	1	0	MAGEC3	140797228	0.584000	0.26766	0.001000	0.08648	0.008000	0.06430	1.367000	0.34204	-0.019000	0.14055	0.525000	0.51046	GAA	.	.		0.512	MAGEC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058606.1	NM_138702	
RBL2	5934	hgsc.bcm.edu	37	16	53499478	53499479	+	Frame_Shift_Ins	INS	-	-	A			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr16:53499478_53499479insA	ENST00000262133.6	+	13	1964_1965	c.1827_1828insA	c.(1828-1830)agafs	p.R610fs	RBL2_ENST00000544545.1_Frame_Shift_Ins_p.R394fs|RBL2_ENST00000379935.4_3'UTR	NM_005611.3	NP_005602.3	Q08999	RBL2_HUMAN	retinoblastoma-like 2	610	Domain A.|Pocket; binds E1A.				chromatin modification (GO:0016568)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						GGGAAAAAATTAGAGACAATGA	0.332																																					p.I609fs		Atlas-INDEL	.											.	RBL2	115	.	0			c.1827_1828insA						.																																			SO:0001589	frameshift_variant	5934	exon13			.	X74594	CCDS10748.1	16q12.2	2014-03-11	2014-03-11		ENSG00000103479	ENSG00000103479			9894	protein-coding gene	gene with protein product		180203				8361765, 8643454	Standard	NM_005611		Approved	Rb2, p130	uc002ehi.4	Q08999	OTTHUMG00000133198	ENST00000262133.6:c.1828dupA	chr16.hg19:g.53499479_53499479dupA	ENSP00000262133:p.Arg610fs	189.0	0.0		178.0	96.0	NM_005611	B7Z913|Q15073|Q16084|Q8NE70|Q92812	Frame_Shift_Ins	INS	ENST00000262133.6	hg19	CCDS10748.1																																																																																			.	.		0.332	RBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256908.3	NM_005611	
MYRF	745	hgsc.bcm.edu	37	11	61533636	61533637	+	Frame_Shift_Ins	INS	-	-	C			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr11:61533636_61533637insC	ENST00000278836.5	+	3	437_438	c.341_342insC	c.(340-345)ttcccgfs	p.FP114fs	MYRF_ENST00000265460.5_Frame_Shift_Ins_p.FP105fs|TMEM258_ENST00000535042.1_5'Flank	NM_001127392.1	NP_001120864.1	Q9Y2G1	MRF_HUMAN	myelin regulatory factor	114	Pro-rich.				central nervous system myelin maintenance (GO:0032286)|central nervous system myelination (GO:0022010)|oligodendrocyte development (GO:0014003)|oligodendrocyte differentiation (GO:0048709)|positive regulation of myelination (GO:0031643)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)										CCCAAGCCCTTCCCGGGGGGCA	0.703																																					p.F114fs		Atlas-INDEL	.											.	.	.	.	0			c.341_342insC						.																																			SO:0001589	frameshift_variant	745	exon3			.		CCDS31579.1, CCDS44622.1	11q12-q13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000124920	ENSG00000124920			1181	protein-coding gene	gene with protein product	"""myelin gene regulatory factor"""	608329	"""chromosome 11 open reading frame 9"""	C11orf9		10828591, 12384578	Standard	NM_001127392		Approved	Ndt80, pqn-47, MRF	uc001nsc.1	Q9Y2G1	OTTHUMG00000168161	ENST00000278836.5:c.344dupC	chr11.hg19:g.61533639_61533639dupC	ENSP00000278836:p.Phe114fs	75.0	0.0		66.0	10.0	NM_001127392	O43582|Q9P1Q6	Frame_Shift_Ins	INS	ENST00000278836.5	hg19	CCDS44622.1																																																																																			.	.		0.703	MYRF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398519.2	NM_013279	
DNM2	1785	hgsc.bcm.edu	37	19	10940881	10940882	+	Frame_Shift_Ins	INS	-	-	C			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr19:10940881_10940882insC	ENST00000355667.6	+	20	2450_2451	c.2370_2371insC	c.(2371-2373)cccfs	p.P791fs	DNM2_ENST00000389253.4_Frame_Shift_Ins_p.P791fs|DNM2_ENST00000359692.6_Frame_Shift_Ins_p.P787fs|DNM2_ENST00000585892.1_Frame_Shift_Ins_p.P791fs|DNM2_ENST00000314646.5_Frame_Shift_Ins_p.P791fs|DNM2_ENST00000408974.4_Frame_Shift_Ins_p.P787fs	NM_001005360.2|NM_001190716.1	NP_001005360.1|NP_001177645.1	P50570	DYN2_HUMAN	dynamin 2	791	Pro-rich.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|endocytosis (GO:0006897)|G2/M transition of mitotic cell cycle (GO:0000086)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|nitric oxide metabolic process (GO:0046209)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic vesicle transport (GO:0048489)|transferrin transport (GO:0033572)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	enzyme binding (GO:0019899)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|microtubule binding (GO:0008017)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	42			Epithelial(33;4.17e-05)|all cancers(31;8.48e-05)			CCACTCCAGGGCCCCCCCTGAT	0.693			"""F, N, Splice, Mis, O"""		ETP ALL																																p.G790fs		Atlas-INDEL	.		Rec	yes		19	19p13.2	1785	dynamin 2		L	.,4	DNM2	175	.	0			c.2370_2371insC						.																																			SO:0001589	frameshift_variant	1785	exon20			.		CCDS32907.1, CCDS32908.1, CCDS45968.1, CCDS45969.1, CCDS59351.1	19p	2014-09-17						"""Pleckstrin homology (PH) domain containing"""	2974	protein-coding gene	gene with protein product	"""dynamin II"", ""cytoskeletal protein"""	602378				7590285, 9143510	Standard	NM_001190716		Approved	DYNII, DYN2, CMTDIB, CMTDI1, DI-CMTB	uc002mps.2	P50570		ENST00000355667.6:c.2377dupC	chr19.hg19:g.10940888_10940888dupC	ENSP00000347890:p.Pro791fs	92.0	0.0		80.0	25.0	NM_001005361	A8K1B6|E7EV30|E9PEQ4|K7ESI9|Q5I0Y0|Q7Z5S3|Q9UPH4	Frame_Shift_Ins	INS	ENST00000355667.6	hg19	CCDS45968.1																																																																																			.	.		0.693	DNM2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452592.1	NM_004945	
MBL2	4153	hgsc.bcm.edu	37	10	54528080	54528115	+	In_Frame_Del	DEL	ATCAGTGATGCCCAGGAAGGCTTCCTCCTTGATGAG	ATCAGTGATGCCCAGGAAGGCTTCCTCCTTGATGAG	-	rs139637221|rs267602523		TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	ATCAGTGATGCCCAGGAAGGCTTCCTCCTTGATGAG	ATCAGTGATGCCCAGGAAGGCTTCCTCCTTGATGAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr10:54528080_54528115delATCAGTGATGCCCAGGAAGGCTTCCTCCTTGATGAG	ENST00000373968.3	-	4	593_628	c.529_564delCTCATCAAGGAGGAAGCCTTCCTGGGCATCACTGAT	c.(529-564)ctcatcaaggaggaagccttcctgggcatcactgatdel	p.LIKEEAFLGITD177del		NM_000242.2	NP_000233.1	P11226	MBL2_HUMAN	mannose-binding lectin (protein C) 2, soluble	177	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				acute-phase response (GO:0006953)|complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|complement activation, lectin pathway (GO:0001867)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response (GO:0045087)|killing by host of symbiont cells (GO:0051873)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of viral process (GO:0048525)|opsonization (GO:0008228)|positive regulation of phagocytosis (GO:0050766)|response to oxidative stress (GO:0006979)	cell surface (GO:0009986)|collagen trimer (GO:0005581)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium-dependent protein binding (GO:0048306)|mannose binding (GO:0005537)|receptor binding (GO:0005102)	p.E180E(1)		breast(1)|endometrium(2)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21						CTGTCTTCTCATCAGTGATGCCCAGGAAGGCTTCCTCCTTGATGAGATTCTGAATG	0.479																																					p.177_189del		Atlas-INDEL	.											.	MBL2	55	.	1	Substitution - coding silent(1)	lung(1)	c.530_565del						.																																			SO:0001651	inframe_deletion	4153	exon4			.	AF360991	CCDS7247.1	10q11.2	2014-09-17	2011-02-02		ENSG00000165471	ENSG00000165471		"""Collectins"""	6922	protein-coding gene	gene with protein product		154545	"""mannose-binding lectin (protein C) 2, soluble (opsonic defect)"""	MBL		1675710, 1672848	Standard	NM_000242		Approved	COLEC1	uc001jjt.3	P11226	OTTHUMG00000150270	ENST00000373968.3:c.529_564delCTCATCAAGGAGGAAGCCTTCCTGGGCATCACTGAT	chr10.hg19:g.54528080_54528115delATCAGTGATGCCCAGGAAGGCTTCCTCCTTGATGAG	ENSP00000363079:p.Leu177_Asp188del	104.0	0.0		114.0	10.0	NM_000242	Q4VB12|Q4VB13|Q4VB14|Q5SQS3|Q86SI4|Q96KE4|Q96TF7|Q96TF8|Q96TF9	In_Frame_Del	DEL	ENST00000373968.3	hg19	CCDS7247.1																																																																																			.	.		0.479	MBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048115.1	NM_000242	
USP6NL	9712	hgsc.bcm.edu	37	10	11505654	11505655	+	In_Frame_Ins	INS	-	-	CGT			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr10:11505654_11505655insCGT	ENST00000609104.1	-	15	1666_1667	c.1272_1273insACG	c.(1270-1275)acgccc>acgACGccc	p.424_425insT	USP6NL_ENST00000277575.5_In_Frame_Ins_p.441_442insT|USP6NL_ENST00000379237.2_In_Frame_Ins_p.447_448insT	NM_014688.2	NP_055503.1	Q92738	US6NL_HUMAN	USP6 N-terminal like	424					Golgi organization (GO:0007030)|plasma membrane to endosome transport (GO:0048227)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of Golgi organization (GO:1903358)|retrograde transport, plasma membrane to Golgi (GO:0035526)|virion assembly (GO:0019068)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			endometrium(3)|kidney(2)|large_intestine(6)|lung(18)|prostate(1)|skin(1)|urinary_tract(1)	32						GCTCTCTCGGGCGTCCCGGTCC	0.653																																					p.P442delinsTP		Atlas-INDEL	.											.	USP6NL	57	.	0			c.1324_1325insACG						.																																			SO:0001652	inframe_insertion	9712	exon14			.	BC010351	CCDS44357.1, CCDS53492.1	10p13	2013-07-09			ENSG00000148429	ENSG00000148429			16858	protein-coding gene	gene with protein product	"""related to the N terminus of tre"""	605405	"""USP6NL intronic transcript 1 (non-protein coding)"""	USP6NL-IT1		8700515, 8700527, 12399475	Standard	XR_247492		Approved	RNTRE, KIAA0019, TRE2NL, RN-tre	uc001iks.1	Q92738	OTTHUMG00000017672	ENST00000609104.1:c.1270_1272dupACG	chr10.hg19:g.11505655_11505657dupCGT	ENSP00000476462:p.Thr424_Thr424dup	106.0	0.0		83.0	19.0	NM_001080491	A8KA79|Q15400|Q5VV10|Q7L0K9	In_Frame_Ins	INS	ENST00000609104.1	hg19	CCDS53492.1																																																																																			.	.		0.653	USP6NL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000046764.3	NM_014688	
TDRD1	56165	hgsc.bcm.edu	37	10	115977409	115977419	+	Splice_Site	DEL	TTGCAGGTAAG	TTGCAGGTAAG	-			TCGA-UB-AA0U-01A-11D-A382-10	TCGA-UB-AA0U-10A-01D-A385-10	TTGCAGGTAAG	TTGCAGGTAAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	86952660-bb3d-44f2-b8c2-842213a5fb20	d47d2cb3-bc69-4675-826a-152e65b30482	g.chr10:115977409_115977419delTTGCAGGTAAG	ENST00000369280.1	+	17	2778_2783	c.2318_2323delTTGCAGGTAAG	c.(2317-2325)tttgcaggt>tgt	p.FAG773fs	TDRD1_ENST00000422662.1_Splice_Site_p.FAG377fs|TDRD1_ENST00000369281.2_Splice_Site_p.FAG716fs|TDRD1_ENST00000369282.1_Splice_Site_p.FAG773fs|TDRD1_ENST00000251864.2_Splice_Site_p.FAG773fs			Q9BXT4	TDRD1_HUMAN	tudor domain containing 1	773	Tudor 3. {ECO:0000255|PROSITE- ProRule:PRU00211}.				DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ cell development (GO:0007281)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)	metal ion binding (GO:0046872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(5)	48		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		TGTGCTTTTTTTGCAGGTAAGTTGCAATTGA	0.336																																					p.773_775del		Atlas-INDEL	.											.	TDRD1	126	.	0			c.2317_2323del						.																																			SO:0001630	splice_region_variant	56165	exon17			.	AF285606	CCDS7588.1	10q26.11	2013-01-23			ENSG00000095627	ENSG00000095627		"""Tudor domain containing"""	11712	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.1"""	605796				11279525	Standard	NM_198795		Approved	CT41.1	uc001lbg.1	Q9BXT4	OTTHUMG00000019083	ENST00000369280.1:c.2323+1TTGCAGGTAAG>-	chr10.hg19:g.115977409_115977419delTTGCAGGTAAG		184.0	0.0		184.0	18.0	NM_198795	A6NEN3|A6NMN2|B3KVI4|B4E2L5|D3DRC2|Q4G0Y8|Q6P518|Q9H7B3	Frame_Shift_Del	DEL	ENST00000369280.1	hg19																																																																																				.	.		0.336	TDRD1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050457.2		Frame_Shift_Del
