#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PSME4	23198	hgsc.bcm.edu	37	2	54135494	54135494	+	Missense_Mutation	SNP	T	T	G			TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chr2:54135494T>G	ENST00000404125.1	-	24	2802	c.2747A>C	c.(2746-2748)aAa>aCa	p.K916T	PSME4_ENST00000421748.2_Missense_Mutation_p.K60T	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	916					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)			breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			GTTGAAGCTTTTCCATCGGGA	0.333																																					p.K916T		Atlas-SNP	.											.	PSME4	247	.	0			c.A2747C						.						57.0	57.0	57.0					2																	54135494		2203	4298	6501	SO:0001583	missense	23198	exon24			AAGCTTTTCCATC	D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.2747A>C	chr2.hg19:g.54135494T>G	ENSP00000384211:p.Lys916Thr	112.0	0.0		89.0	14.0	NM_014614	Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	Missense_Mutation	SNP	ENST00000404125.1	hg19	CCDS33197.2	.	.	.	.	.	.	.	.	.	.	T	24.2	4.504778	0.85176	.	.	ENSG00000068878	ENST00000421748;ENST00000404125	T;T	0.12465	2.68;2.68	5.36	5.36	0.76844	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.37919	0.1021	M	0.77820	2.39	0.80722	D	1	D;D;D	0.76494	0.982;0.999;0.985	P;D;P	0.73708	0.819;0.981;0.729	T	0.13098	-1.0522	10	0.36615	T	0.2	.	15.3474	0.74350	0.0:0.0:0.0:1.0	.	291;60;916	Q14997-2;Q14997-3;Q14997	.;.;PSME4_HUMAN	T	60;916	ENSP00000410830:K60T;ENSP00000384211:K916T	ENSP00000384211:K916T	K	-	2	0	PSME4	53988998	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.040000	0.89188	2.012000	0.59069	0.533000	0.62120	AAA	.	.		0.333	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324163.1	XM_040158	
ALMS1	7840	hgsc.bcm.edu	37	2	73613036	73613037	+	Missense_Mutation	DNP	GA	GA	CT	rs61156725|rs72319667|rs3074417	byFrequency	TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	G|A	G|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chr2:73613036_73613037GA>CT	ENST00000264448.6	+	1	151_152	c.40_41GA>CT	c.(40-42)GAg>CTg	p.E14L	ALMS1_ENST00000377715.1_Missense_Mutation_p.E14L|ALMS1_ENST00000409009.1_Missense_Mutation_p.E14L	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	14	Glu-rich.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.E27_E28delEE(1)		breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						CGAGCTggaggaggaggaggag	0.693																																					p.E14Q|p.E14V		Atlas-SNP	.											.	ALMS1	384	.	1	Deletion - In frame(1)	ovary(1)	c.G40C|c.A41T						.																																			SO:0001583	missense	7840	exon1			CTGGAGGAGGAGG|TGGAGGAGGAGGA	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	Exception_encountered	chr2.hg19:g.73613036_73613037delinsCT	ENSP00000264448:p.Glu14Leu	172.0|169.0	0.0		175.0|179.0	9.0|13.0	NM_015120	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	ENST00000264448.6	hg19	CCDS42697.1																																																																																			.	.		0.693	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120	
ICA1L	130026	hgsc.bcm.edu	37	2	203693673	203693673	+	Silent	SNP	T	T	C			TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chr2:203693673T>C	ENST00000392237.2	-	3	217	c.60A>G	c.(58-60)caA>caG	p.Q20Q	ICA1L_ENST00000418208.1_Silent_p.Q20Q|ICA1L_ENST00000425178.1_Silent_p.Q20Q|ICA1L_ENST00000358299.2_Silent_p.Q20Q	NM_138468.4	NP_612477.3	Q8NDH6	ICA1L_HUMAN	islet cell autoantigen 1,69kDa-like	20										breast(1)|endometrium(1)|large_intestine(7)|lung(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						AGTATTTCTTTTGCATTCTTC	0.388																																					p.Q20Q		Atlas-SNP	.											.	ICA1L	33	.	0			c.A60G						.						171.0	153.0	159.0					2																	203693673		2203	4300	6503	SO:0001819	synonymous_variant	130026	exon4			TTTCTTTTGCATT	AB053317	CCDS2354.1, CCDS74632.1	2q33	2008-02-05	2006-05-26	2006-05-26	ENSG00000163596	ENSG00000163596			14442	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 15"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 14"""	ALS2CR15, ALS2CR14		11586298	Standard	NM_138468		Approved		uc002uzh.1	Q8NDH6	OTTHUMG00000132856	ENST00000392237.2:c.60A>G	chr2.hg19:g.203693673T>C		129.0	0.0		124.0	8.0	NM_178231	B3KRW6|Q53P45|Q53QZ4|Q53T97|Q96N47|Q96Q32|Q9BVQ2	Silent	SNP	ENST00000392237.2	hg19	CCDS2354.1																																																																																			.	.		0.388	ICA1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256330.1	NM_138468	
CACNA1D	776	hgsc.bcm.edu	37	3	53835443	53835443	+	Missense_Mutation	SNP	G	G	T			TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chr3:53835443G>T	ENST00000350061.5	+	42	5910	c.5399G>T	c.(5398-5400)aGt>aTt	p.S1800I	CACNA1D_ENST00000422281.2_Missense_Mutation_p.S1785I|CACNA1D_ENST00000288139.4_Missense_Mutation_p.S1820I|CACNA1D_ENST00000544977.1_Missense_Mutation_p.S179I	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	1800					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	AGAAGGTCCAGTGTGAAAAGG	0.542																																					p.S1820I		Atlas-SNP	.											.	CACNA1D	324	.	0			c.G5459T						.						88.0	85.0	86.0					3																	53835443		2203	4300	6503	SO:0001583	missense	776	exon43			GGTCCAGTGTGAA	AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.5399G>T	chr3.hg19:g.53835443G>T	ENSP00000288133:p.Ser1800Ile	52.0	0.0		54.0	9.0	NM_000720	B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Missense_Mutation	SNP	ENST00000350061.5	hg19	CCDS46848.1	.	.	.	.	.	.	.	.	.	.	G	3.603	-0.081132	0.07141	.	.	ENSG00000157388	ENST00000350061;ENST00000288139;ENST00000422281;ENST00000481478;ENST00000544977	D;D;D;D	0.96041	-3.87;-3.89;-3.88;-3.88	4.26	3.38	0.38709	.	8.018100	0.00166	N	0.000000	D	0.93396	0.7894	L	0.44542	1.39	0.42929	D	0.99431	B;B;B;B	0.17038	0.02;0.0;0.0;0.0	B;B;B;B	0.11329	0.006;0.001;0.0;0.001	T	0.77838	-0.2439	10	0.37606	T	0.19	.	9.3501	0.38133	0.0821:0.1451:0.7728:0.0	.	1785;1493;1800;1820	B0FYA3;Q59GD8;Q01668;Q01668-2	.;.;CAC1D_HUMAN;.	I	1800;1820;1785;1493;179	ENSP00000288133:S1800I;ENSP00000288139:S1820I;ENSP00000409174:S1785I;ENSP00000418014:S1493I	ENSP00000288139:S1820I	S	+	2	0	CACNA1D	53810483	1.000000	0.71417	0.998000	0.56505	0.313000	0.28021	3.473000	0.53122	1.104000	0.41587	-0.379000	0.06801	AGT	.	.		0.542	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350557.1	NM_000720	
CHRD	8646	hgsc.bcm.edu	37	3	184103890	184103890	+	Silent	SNP	C	C	T			TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chr3:184103890C>T	ENST00000204604.1	+	15	2121	c.1875C>T	c.(1873-1875)ggC>ggT	p.G625G	CHRD_ENST00000348986.3_Silent_p.G585G|EIF2B5_ENST00000444495.1_Intron|CHRD_ENST00000450923.1_Silent_p.G625G|CHRD_ENST00000545352.1_Silent_p.G255G	NM_003741.2	NP_003732.2	Q9H2X0	CHRD_HUMAN	chordin	625	CHRD 4. {ECO:0000255|PROSITE- ProRule:PRU00230}.				BMP signaling pathway involved in spinal cord dorsal/ventral patterning (GO:0021919)|floor plate development (GO:0033504)|forebrain development (GO:0030900)|gastrulation with mouth forming second (GO:0001702)|mesoderm formation (GO:0001707)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell migration (GO:0030336)|negative regulation of osteoblast differentiation (GO:0045668)|osteoblast differentiation (GO:0001649)|positive regulation of cell adhesion (GO:0045785)|positive regulation of mesenchymal cell proliferation (GO:0002053)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)	cytokine binding (GO:0019955)|heparin binding (GO:0008201)			NS(1)|biliary_tract(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(23)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TGGCAAAAGGCATGGCCTCCC	0.622																																					p.G625G		Atlas-SNP	.											.	CHRD	149	.	0			c.C1875T						.						91.0	92.0	92.0					3																	184103890		2203	4300	6503	SO:0001819	synonymous_variant	8646	exon15			AAAAGGCATGGCC	AF076612	CCDS3266.1	3q27	2008-07-18			ENSG00000090539	ENSG00000090539			1949	protein-coding gene	gene with protein product		603475				9782094, 11472837	Standard	NM_003741		Approved		uc003fov.3	Q9H2X0	OTTHUMG00000141267	ENST00000204604.1:c.1875C>T	chr3.hg19:g.184103890C>T		257.0	0.0		216.0	9.0	NM_003741	O95254|Q2M1I8|Q6UW83|Q9H2D3|Q9H2W8|Q9H2W9|Q9P0Z2|Q9P0Z3|Q9P0Z4|Q9P0Z5	Silent	SNP	ENST00000204604.1	hg19	CCDS3266.1																																																																																			.	.		0.622	CHRD-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000280432.1	NM_003741	
RXFP1	59350	hgsc.bcm.edu	37	4	159566234	159566234	+	Missense_Mutation	SNP	G	G	T			TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chr4:159566234G>T	ENST00000307765.5	+	15	1540	c.1289G>T	c.(1288-1290)cGa>cTa	p.R430L	RXFP1_ENST00000460056.2_Missense_Mutation_p.R349L|RXFP1_ENST00000448688.2_Missense_Mutation_p.R325L|RXFP1_ENST00000343542.5_Missense_Mutation_p.R382L|RXFP1_ENST00000470033.1_Missense_Mutation_p.R397L	NM_001253727.1|NM_001253728.1|NM_001253730.1|NM_001253732.1|NM_001253733.1|NM_021634.3	NP_001240656.1|NP_001240657.1|NP_001240659.1|NP_001240661.1|NP_001240662.1|NP_067647.2	Q9HBX9	RXFP1_HUMAN	relaxin/insulin-like family peptide receptor 1	430					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|lung connective tissue development (GO:0060427)|nipple morphogenesis (GO:0060658)|parturition (GO:0007567)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|hormone binding (GO:0042562)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|liver(2)|lung(22)|prostate(1)|skin(10)	49	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0219)		ATTTGCATGCGACCTTATATC	0.378																																					p.R457L		Atlas-SNP	.											.	RXFP1	98	.	0			c.G1370T						.						126.0	118.0	120.0					4																	159566234		1882	4120	6002	SO:0001583	missense	59350	exon15			GCATGCGACCTTA	AF190500	CCDS43276.1, CCDS58929.1, CCDS58930.1, CCDS75204.1, CCDS75205.1, CCDS75206.1	4q31.3	2012-08-08	2006-05-09	2006-05-09	ENSG00000171509	ENSG00000171509		"""GPCR / Class A : Relaxin family peptide receptors"""	19718	protein-coding gene	gene with protein product		606654	"""leucine-rich repeat-containing G protein-coupled receptor 7"""	LGR7		15956688, 16507880	Standard	NM_021634		Approved	RXFPR1	uc003ipz.3	Q9HBX9	OTTHUMG00000149973	ENST00000307765.5:c.1289G>T	chr4.hg19:g.159566234G>T	ENSP00000303248:p.Arg430Leu	130.0	0.0		93.0	15.0	NM_001253727	B4DHD1|B4DTV2|Q2M215|Q3KU24|Q3KU25|Q3KU26	Missense_Mutation	SNP	ENST00000307765.5	hg19	CCDS43276.1	.	.	.	.	.	.	.	.	.	.	G	35	5.544072	0.96488	.	.	ENSG00000171509	ENST00000460056;ENST00000307765;ENST00000448688;ENST00000343542;ENST00000470033;ENST00000440678	T;T;T;T;T	0.30448	1.53;1.53;1.53;1.53;1.53	5.76	5.76	0.90799	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.48589	0.1508	L	0.55103	1.725	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;0.998;1.0;1.0	T	0.31194	-0.9952	10	0.02654	T	1	.	19.9731	0.97292	0.0:0.0:1.0:0.0	.	441;457;325;382;397;349;300;430	B3KV27;B4DGP2;B4DHD1;Q9HBX9-4;Q9HBX9-2;E9PCA3;Q59H16;Q9HBX9	.;.;.;.;.;.;.;RXFP1_HUMAN	L	349;430;325;382;397;300	ENSP00000423306:R349L;ENSP00000303248:R430L;ENSP00000414885:R325L;ENSP00000345889:R382L;ENSP00000420712:R397L	ENSP00000303248:R430L	R	+	2	0	RXFP1	159785684	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.661000	0.98601	2.715000	0.92844	0.563000	0.77884	CGA	.	.		0.378	RXFP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314865.1	NM_021634	
DDX60L	91351	hgsc.bcm.edu	37	4	169336626	169336626	+	Missense_Mutation	SNP	C	C	A			TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chr4:169336626C>A	ENST00000511577.1	-	22	3159	c.2912G>T	c.(2911-2913)tGt>tTt	p.C971F	DDX60L_ENST00000260184.7_Missense_Mutation_p.C971F|DDX60L_ENST00000505890.1_Missense_Mutation_p.C971F			Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like	971							ATP binding (GO:0005524)|helicase activity (GO:0004386)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		TTTTACTGAACATATATGCTT	0.333																																					p.C971F		Atlas-SNP	.											.	DDX60L	116	.	0			c.G2912T						.						106.0	102.0	103.0					4																	169336626		1903	4113	6016	SO:0001583	missense	91351	exon22			ACTGAACATATAT	AK092461	CCDS47161.1	4q32.3	2008-01-08				ENSG00000181381			26429	protein-coding gene	gene with protein product							Standard	XM_005263341		Approved	FLJ31033	uc003irq.4	Q5H9U9		ENST00000511577.1:c.2912G>T	chr4.hg19:g.169336626C>A	ENSP00000422423:p.Cys971Phe	289.0	0.0		198.0	8.0	NM_001012967	Q96ND6	Missense_Mutation	SNP	ENST00000511577.1	hg19		.	.	.	.	.	.	.	.	.	.	C	14.52	2.560079	0.45590	.	.	ENSG00000181381	ENST00000260184;ENST00000511577;ENST00000505890;ENST00000505863	T;T;T;T	0.18960	2.19;2.19;2.18;2.91	3.23	3.23	0.37069	.	0.000000	0.41712	U	0.000825	T	0.39835	0.1093	M	0.62723	1.935	0.32137	N	0.586006	D;P;D	0.89917	1.0;0.881;1.0	D;P;D	0.91635	0.999;0.569;0.999	T	0.45948	-0.9226	10	0.18710	T	0.47	.	14.3534	0.66719	0.0:1.0:0.0:0.0	.	971;971;971	E9PAP8;D6R906;Q5H9U9	.;.;DDX6L_HUMAN	F	971;971;971;667	ENSP00000260184:C971F;ENSP00000422423:C971F;ENSP00000422202:C971F;ENSP00000421026:C667F	ENSP00000260184:C971F	C	-	2	0	DDX60L	169573201	0.989000	0.36119	0.065000	0.19835	0.858000	0.48976	3.216000	0.51176	1.481000	0.48307	0.313000	0.20887	TGT	.	.		0.333	DDX60L-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000364839.1	NM_001012967	
SCRG1	11341	hgsc.bcm.edu	37	4	174312527	174312527	+	Silent	SNP	A	A	T			TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chr4:174312527A>T	ENST00000296506.3	-	2	521	c.39T>A	c.(37-39)acT>acA	p.T13T		NM_007281.2	NP_009212.1	O75711	SCRG1_HUMAN	stimulator of chondrogenesis 1	13					nervous system development (GO:0007399)	extracellular space (GO:0005615)				large_intestine(1)|lung(4)|skin(1)	6		Prostate(90;0.00601)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_neural(102;0.0837)|all_hematologic(60;0.107)		all cancers(43;1.15e-17)|Epithelial(43;4.33e-16)|OV - Ovarian serous cystadenocarcinoma(60;6.62e-09)|STAD - Stomach adenocarcinoma(60;0.00278)|GBM - Glioblastoma multiforme(59;0.00659)|LUSC - Lung squamous cell carcinoma(193;0.0919)		CTAGCAGCAAAGTTAGCCCAA	0.408																																					p.T13T		Atlas-SNP	.											.	SCRG1	9	.	0			c.T39A						.						167.0	154.0	158.0					4																	174312527		2203	4300	6503	SO:0001819	synonymous_variant	11341	exon2			CAGCAAAGTTAGC	AJ224677	CCDS3818.1	4q34.1	2009-07-09				ENSG00000164106			17036	protein-coding gene	gene with protein product	"""scrapie responsive gene 1"""	603163				9660755, 9516475	Standard	NM_007281		Approved	SCRG-1	uc003ite.3	O75711		ENST00000296506.3:c.39T>A	chr4.hg19:g.174312527A>T		110.0	0.0		101.0	8.0	NM_007281		Silent	SNP	ENST00000296506.3	hg19	CCDS3818.1																																																																																			.	.		0.408	SCRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364304.2	NM_007281	
MYO10	4651	hgsc.bcm.edu	37	5	16794770	16794770	+	Missense_Mutation	SNP	T	T	C			TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chr5:16794770T>C	ENST00000513610.1	-	4	906	c.452A>G	c.(451-453)cAg>cGg	p.Q151R		NM_012334.2	NP_036466.2	Q9HD67	MYO10_HUMAN	myosin X	151	Myosin motor.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|regulation of cell shape (GO:0008360)|regulation of filopodium assembly (GO:0051489)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|plus-end directed microfilament motor activity (GO:0060002)|spectrin binding (GO:0030507)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	86						GAGGATGCACTGGTTGTCGTG	0.647																																					p.Q151R		Atlas-SNP	.											.	MYO10	198	.	0			c.A452G						.						30.0	35.0	33.0					5																	16794770		2144	4242	6386	SO:0001583	missense	4651	exon4			ATGCACTGGTTGT	AF247457	CCDS54834.1	5p15.1-p14.3	2013-01-10				ENSG00000145555		"""Myosins / Myosin superfamily : Class X"", ""Pleckstrin homology (PH) domain containing"""	7593	protein-coding gene	gene with protein product		601481				8884266	Standard	NM_012334		Approved	KIAA0799	uc003jft.4	Q9HD67		ENST00000513610.1:c.452A>G	chr5.hg19:g.16794770T>C	ENSP00000421280:p.Gln151Arg	74.0	0.0		76.0	14.0	NM_012334	A7E2D1|O94893|Q8IVX5|Q9NYM7|Q9P110|Q9P111|Q9UHF6	Missense_Mutation	SNP	ENST00000513610.1	hg19	CCDS54834.1	.	.	.	.	.	.	.	.	.	.	T	24.9	4.580132	0.86645	.	.	ENSG00000145555	ENST00000513610;ENST00000513882;ENST00000502436	D;D;D	0.92495	-3.05;-3.05;-3.05	4.76	4.76	0.60689	Myosin head, motor domain (3);	.	.	.	.	D	0.97670	0.9236	H	0.98426	4.23	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.99126	1.0851	9	0.87932	D	0	.	14.5927	0.68378	0.0:0.0:0.0:1.0	.	118;151	E9PCN3;Q9HD67	.;MYO10_HUMAN	R	151;162;118	ENSP00000421280:Q151R;ENSP00000421309:Q162R;ENSP00000426783:Q118R	ENSP00000426783:Q118R	Q	-	2	0	MYO10	16847770	1.000000	0.71417	1.000000	0.80357	0.839000	0.47603	7.990000	0.88215	1.899000	0.54978	0.459000	0.35465	CAG	.	.		0.647	MYO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366167.1	NM_012334	
RHOBTB3	22836	hgsc.bcm.edu	37	5	95067705	95067705	+	Missense_Mutation	SNP	A	A	G			TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chr5:95067705A>G	ENST00000379982.3	+	2	653	c.145A>G	c.(145-147)Acg>Gcg	p.T49A	CTD-2154I11.2_ENST00000512486.1_RNA|RHOBTB3_ENST00000515852.1_3'UTR|RHOBTB3_ENST00000506817.1_Missense_Mutation_p.T49A|CTD-2154I11.2_ENST00000513235.1_RNA	NM_014899.3	NP_055714.3	O94955	RHBT3_HUMAN	Rho-related BTB domain containing 3	49	Rho-like.				ATP catabolic process (GO:0006200)|retrograde transport, endosome to Golgi (GO:0042147)|small GTPase mediated signal transduction (GO:0007264)	Golgi apparatus (GO:0005794)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|GTP binding (GO:0005525)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|skin(1)	16		all_cancers(142;2.58e-06)|all_epithelial(76;4.19e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0164)|Colorectal(57;0.0846)|Breast(839;0.198)		all cancers(79;8.79e-16)		CGCGGCCAGCACGGTCGCGCG	0.632																																					p.T49A		Atlas-SNP	.											.	RHOBTB3	43	.	0			c.A145G						.						69.0	59.0	63.0					5																	95067705		2203	4300	6503	SO:0001583	missense	22836	exon2			GCCAGCACGGTCG	AB020685	CCDS4077.1	5q15	2014-05-09			ENSG00000164292	ENSG00000164292		"""BTB/POZ domain containing"""	18757	protein-coding gene	gene with protein product		607353				11222756, 17035353	Standard	NM_014899		Approved	KIAA0878	uc003klm.3	O94955	OTTHUMG00000121171	ENST00000379982.3:c.145A>G	chr5.hg19:g.95067705A>G	ENSP00000369318:p.Thr49Ala	194.0	0.0		178.0	8.0	NM_014899	A0PJA4|A8K1W9|Q8IW06	Missense_Mutation	SNP	ENST00000379982.3	hg19	CCDS4077.1	.	.	.	.	.	.	.	.	.	.	A	16.93	3.256781	0.59321	.	.	ENSG00000164292	ENST00000506959;ENST00000506817;ENST00000379982	T;T;T	0.63417	1.56;1.51;-0.04	4.86	2.01	0.26516	.	0.419325	0.24289	N	0.039839	T	0.31827	0.0809	N	0.08118	0	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.002	T	0.04320	-1.0960	10	0.14252	T	0.57	-4.2856	3.5973	0.08010	0.6012:0.0:0.1084:0.2904	.	49;49	O94955;D6RG10	RHBT3_HUMAN;.	A	55;49;49	ENSP00000423688:T55A;ENSP00000426479:T49A;ENSP00000369318:T49A	ENSP00000369318:T49A	T	+	1	0	RHOBTB3	95093461	0.012000	0.17670	1.000000	0.80357	0.986000	0.74619	0.346000	0.19997	0.808000	0.34231	-0.379000	0.06801	ACG	.	.		0.632	RHOBTB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241658.1	NM_014899	
GABRG2	2566	hgsc.bcm.edu	37	5	161580308	161580308	+	Silent	SNP	G	G	T			TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chr5:161580308G>T	ENST00000361925.4	+	9	1558	c.1338G>T	c.(1336-1338)cgG>cgT	p.R446R	GABRG2_ENST00000414552.2_Silent_p.R494R|GABRG2_ENST00000356592.3_Silent_p.R454R|GABRG2_ENST00000393933.4_Silent_p.R351R			P18507	GBRG2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 2	446					adult behavior (GO:0030534)|cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|post-embryonic development (GO:0009791)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|GABA-A receptor complex (GO:1902711)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(15)|lung(24)|ovary(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	62	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CCTATGCTCGGATCTTCTTCC	0.458																																					p.R494R		Atlas-SNP	.											.	GABRG2	142	.	0			c.G1482T						.						277.0	278.0	278.0					5																	161580308		2203	4300	6503	SO:0001819	synonymous_variant	2566	exon11			TGCTCGGATCTTC		CCDS4358.1, CCDS4359.1, CCDS47333.1	5q34	2012-06-22			ENSG00000113327	ENSG00000113327		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4087	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma 2"""	137164					Standard	NM_198904		Approved		uc010jjc.3	P18507	OTTHUMG00000130350	ENST00000361925.4:c.1338G>T	chr5.hg19:g.161580308G>T		118.0	0.0		127.0	7.0	NM_198903	F5HB82|Q6GRL6|Q6PCC3|Q9UDB3|Q9UN15	Silent	SNP	ENST00000361925.4	hg19	CCDS4358.1																																																																																			.	.		0.458	GABRG2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252706.1		
PHYKPL	85007	hgsc.bcm.edu	37	5	177652372	177652372	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chr5:177652372C>T	ENST00000308158.5	-	4	631	c.397G>A	c.(397-399)Gtg>Atg	p.V133M	PHYKPL_ENST00000481811.1_Intron	NM_153373.2	NP_699204.1	Q8IUZ5	AT2L2_HUMAN	5-phosphohydroxy-L-lysine phospho-lyase	133						mitochondrion (GO:0005739)	lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)									L-Alanine(DB00160)	AATACCACCACGTCCTGGTGT	0.562																																					p.V133M		Atlas-SNP	.											.	AGXT2L2	51	.	0			c.G397A						.						99.0	81.0	87.0					5																	177652372		2203	4300	6503	SO:0001583	missense	85007	exon4			CCACCACGTCCTG	BC037567	CCDS4434.1	5q35.3	2013-06-12	2013-06-12	2013-06-12	ENSG00000175309	ENSG00000175309	4.2.3.134		28249	protein-coding gene	gene with protein product	"""5-phosphonooxy-L-lysine phospho-lyase"""	614683	"""alanine-glyoxylate aminotransferase 2-like 2"""	AGXT2L2		22241472	Standard	NM_153373		Approved	MGC15875	uc003miz.3	Q8IUZ5	OTTHUMG00000130892	ENST00000308158.5:c.397G>A	chr5.hg19:g.177652372C>T	ENSP00000310978:p.Val133Met	105.0	0.0		85.0	15.0	NM_153373	A8K7P6|B3KN36|D3DWP9|Q8WYS6|Q96HW8	Missense_Mutation	SNP	ENST00000308158.5	hg19	CCDS4434.1	.	.	.	.	.	.	.	.	.	.	C	16.09	3.025058	0.54683	.	.	ENSG00000175309	ENST00000308158;ENST00000323594	D;T	0.86627	-2.15;0.62	5.05	5.05	0.67936	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.91563	0.7335	M	0.82923	2.615	0.80722	D	1	D	0.59767	0.986	P	0.57057	0.812	D	0.89596	0.3831	10	0.16896	T	0.51	-10.0767	16.2489	0.82472	0.0:1.0:0.0:0.0	.	133	Q8IUZ5	AT2L2_HUMAN	M	133;147	ENSP00000310978:V133M;ENSP00000321290:V147M	ENSP00000310978:V133M	V	-	1	0	AGXT2L2	177584978	0.841000	0.29509	1.000000	0.80357	0.814000	0.46013	1.696000	0.37773	2.510000	0.84645	0.462000	0.41574	GTG	.	.		0.562	PHYKPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253477.1	NM_032921	
TRIM26	7726	hgsc.bcm.edu	37	6	30166750	30166750	+	Missense_Mutation	SNP	C	C	T	rs371459188		TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chr6:30166750C>T	ENST00000454678.2	-	4	567	c.131G>A	c.(130-132)cGc>cAc	p.R44H	TRIM26_ENST00000487829.1_5'UTR|TRIM26_ENST00000453195.1_Missense_Mutation_p.R44H|TRIM26_ENST00000437089.1_Missense_Mutation_p.R44H	NM_003449.4	NP_003440.1	Q12899	TRI26_HUMAN	tripartite motif containing 26	44					innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)	cytoplasm (GO:0005737)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)			lung(1)|ovary(2)	3						TGAGATGGGGCGGACGTCTGT	0.602																																					p.R44H		Atlas-SNP	.											.	TRIM26	74	.	0			c.G131A						.	C	HIS/ARG,HIS/ARG	0,3020		0,0,1510	48.0	45.0	46.0		131,131	5.6	0.9	6		46	1,5417		0,1,2708	no	missense,missense	TRIM26	NM_003449.4,NM_001242783.1	29,29	0,1,4218	TT,TC,CC		0.0185,0.0,0.0119	benign,benign	44/540,44/540	30166750	1,8437	1510	2709	4219	SO:0001583	missense	7726	exon3			ATGGGGCGGACGT	AB088090	CCDS4678.1	6p21.3	2013-01-09	2011-01-25	2001-11-23	ENSG00000234127	ENSG00000234127		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	12962	protein-coding gene	gene with protein product		600830	"""tripartite motif-containing 26"""	ZNF173		8530076	Standard	NM_003449		Approved	RNF95	uc003npt.3	Q12899	OTTHUMG00000031041	ENST00000454678.2:c.131G>A	chr6.hg19:g.30166750C>T	ENSP00000410446:p.Arg44His	83.0	0.0		73.0	11.0	NM_001242783	A6NG96|Q5SRL2	Missense_Mutation	SNP	ENST00000454678.2	hg19	CCDS4678.1	.	.	.	.	.	.	.	.	.	.	C	13.03	2.116427	0.37339	0.0	1.85E-4	ENSG00000234127	ENST00000453195;ENST00000454678;ENST00000437089;ENST00000416596;ENST00000420345;ENST00000418026;ENST00000434785	T;T;T;T;T;T	0.08282	3.11;3.11;3.11;3.11;3.11;3.11	5.59	5.59	0.84812	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.265447	0.27302	N	0.019995	T	0.04634	0.0126	L	0.58354	1.805	0.38578	D	0.950108	B	0.32245	0.361	B	0.22753	0.041	T	0.32587	-0.9901	10	0.22109	T	0.4	.	17.0723	0.86578	0.0:1.0:0.0:0.0	.	44	Q12899	TRI26_HUMAN	H	44	ENSP00000391879:R44H;ENSP00000410446:R44H;ENSP00000395491:R44H;ENSP00000413673:R44H;ENSP00000387530:R44H;ENSP00000400920:R44H	ENSP00000413673:R44H	R	-	2	0	TRIM26	30274729	0.002000	0.14202	0.911000	0.35937	0.044000	0.14063	-0.183000	0.09712	2.631000	0.89168	0.643000	0.83706	CGC	.	.		0.602	TRIM26-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253442.1	NM_003449	
GNMT	27232	hgsc.bcm.edu	37	6	42931160	42931160	+	Missense_Mutation	SNP	C	C	A			TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chr6:42931160C>A	ENST00000372808.3	+	5	699	c.689C>A	c.(688-690)gCt>gAt	p.A230D		NM_018960.4	NP_061833.1	Q14749	GNMT_HUMAN	glycine N-methyltransferase	230					cellular protein modification process (GO:0006464)|glycogen metabolic process (GO:0005977)|methionine metabolic process (GO:0006555)|one-carbon metabolic process (GO:0006730)|protein homotetramerization (GO:0051289)|regulation of gluconeogenesis (GO:0006111)|S-adenosylmethionine metabolic process (GO:0046500)	cytoplasm (GO:0005737)	folic acid binding (GO:0005542)|glycine binding (GO:0016594)|glycine N-methyltransferase activity (GO:0017174)			kidney(2)|large_intestine(1)|lung(1)	4	Colorectal(47;0.196)		all cancers(41;0.00196)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0461)		Glycine(DB00145)|S-Adenosylmethionine(DB00118)	GTGCCGGGGGCTGGCCAGGAT	0.587																																					p.A230D		Atlas-SNP	.											.	GNMT	13	.	0			c.C689A						.						44.0	41.0	42.0					6																	42931160		2203	4300	6503	SO:0001583	missense	27232	exon5			CGGGGGCTGGCCA	AF101475	CCDS4876.1	6p12	2008-02-05			ENSG00000124713	ENSG00000124713			4415	protein-coding gene	gene with protein product		606628				10843803, 9495250	Standard	NM_018960		Approved		uc003otd.3	Q14749	OTTHUMG00000014712	ENST00000372808.3:c.689C>A	chr6.hg19:g.42931160C>A	ENSP00000361894:p.Ala230Asp	105.0	0.0		97.0	13.0	NM_018960	Q5T8W2|Q9NNZ1|Q9NS24	Missense_Mutation	SNP	ENST00000372808.3	hg19	CCDS4876.1	.	.	.	.	.	.	.	.	.	.	C	9.897	1.205836	0.22205	.	.	ENSG00000124713	ENST00000372808	T	0.69306	-0.39	5.74	5.74	0.90152	.	0.227351	0.45867	D	0.000335	T	0.45438	0.1342	L	0.59436	1.845	0.09310	N	1	B	0.13594	0.008	B	0.10450	0.005	T	0.19224	-1.0312	10	0.17369	T	0.5	-11.7295	15.1868	0.73009	0.1416:0.8584:0.0:0.0	.	230	Q14749	GNMT_HUMAN	D	230	ENSP00000361894:A230D	ENSP00000361894:A230D	A	+	2	0	GNMT	43039138	0.007000	0.16637	0.029000	0.17559	0.912000	0.54170	2.302000	0.43637	2.715000	0.92844	0.549000	0.68633	GCT	.	.		0.587	GNMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040568.1	NM_018960	
PEX7	5191	hgsc.bcm.edu	37	6	137191048	137191048	+	Silent	SNP	G	G	T			TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chr6:137191048G>T	ENST00000318471.4	+	7	735	c.654G>T	c.(652-654)gcG>gcT	p.A218A	PEX7_ENST00000541292.1_Silent_p.A218A	NM_000288.3	NP_000279.1	O00628	PEX7_HUMAN	peroxisomal biogenesis factor 7	218			A -> V (in RCDP1). {ECO:0000269|PubMed:9090381}.		endochondral ossification (GO:0001958)|ether lipid biosynthetic process (GO:0008611)|fatty acid beta-oxidation (GO:0006635)|neuron migration (GO:0001764)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)	cytosol (GO:0005829)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	enzyme binding (GO:0019899)|peroxisome matrix targeting signal-2 binding (GO:0005053)|protein homodimerization activity (GO:0042803)	p.A218A(1)		lung(7)|prostate(1)	8	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000257)|OV - Ovarian serous cystadenocarcinoma(155;0.00492)		TGACCGGGGCGGTTGACTGTA	0.403																																					p.A218A		Atlas-SNP	.											.	PEX7	24	.	1	Substitution - coding silent(1)	lung(1)	c.G654T						.						234.0	238.0	237.0					6																	137191048		2203	4300	6503	SO:0001819	synonymous_variant	5191	exon7			CGGGGCGGTTGAC	AF180814	CCDS5180.1	6q21-q22.2	2013-01-10			ENSG00000112357	ENSG00000112357		"""WD repeat domain containing"""	8860	protein-coding gene	gene with protein product	"""Refsum disease"""	601757				9090381, 10673331	Standard	NM_000288		Approved	PTS2R, RD	uc003qhd.3	O00628	OTTHUMG00000015650	ENST00000318471.4:c.654G>T	chr6.hg19:g.137191048G>T		97.0	0.0		68.0	13.0	NM_000288	C0H5X6	Silent	SNP	ENST00000318471.4	hg19	CCDS5180.1																																																																																			.	.		0.403	PEX7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042387.2	NM_000288	
TFB1M	51106	hgsc.bcm.edu	37	6	155618121	155618121	+	Missense_Mutation	SNP	T	T	C			TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chr6:155618121T>C	ENST00000367166.4	-	4	567	c.512A>G	c.(511-513)cAg>cGg	p.Q171R		NM_016020.3	NP_057104.2	Q8WVM0	TFB1M_HUMAN	transcription factor B1, mitochondrial	171					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	mitochondrial nucleoid (GO:0042645)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|rRNA (adenine-N6,N6-)-dimethyltransferase activity (GO:0000179)			lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;1.48e-12)|BRCA - Breast invasive adenocarcinoma(81;0.0131)		CAAAGTCATCTGAGTTCTGCC	0.328																																					p.Q171R		Atlas-SNP	.											.	TFB1M	30	.	0			c.A512G						.						82.0	82.0	82.0					6																	155618121		2203	4300	6503	SO:0001583	missense	51106	exon4			GTCATCTGAGTTC	AF151833	CCDS5248.1	6q25.1-q25.3	2011-01-28			ENSG00000029639	ENSG00000029639			17037	protein-coding gene	gene with protein product	"""dimethyladenosine transferase 1, mitochondrial"""	607033				10810093, 11809803	Standard	NM_016020		Approved	mtTFB, CGI-75	uc003qqj.4	Q8WVM0	OTTHUMG00000015881	ENST00000367166.4:c.512A>G	chr6.hg19:g.155618121T>C	ENSP00000356134:p.Gln171Arg	63.0	0.0		72.0	9.0	NM_016020	Q05DR0|Q9Y384	Missense_Mutation	SNP	ENST00000367166.4	hg19	CCDS5248.1	.	.	.	.	.	.	.	.	.	.	T	8.239	0.806507	0.16467	.	.	ENSG00000029639	ENST00000367166	T	0.26373	1.74	6.08	0.845	0.18950	Ribosomal RNA adenine methylase transferase, N-terminal (1);	0.433285	0.27016	N	0.021360	T	0.02767	0.0083	N	0.04508	-0.205	0.33269	D	0.560762	B	0.02656	0.0	B	0.09377	0.004	T	0.44651	-0.9314	10	0.16896	T	0.51	-4.0831	6.8761	0.24147	0.0:0.1265:0.2543:0.6192	.	171	Q8WVM0	TFB1M_HUMAN	R	171	ENSP00000356134:Q171R	ENSP00000356134:Q171R	Q	-	2	0	TFB1M	155659813	1.000000	0.71417	0.996000	0.52242	0.885000	0.51271	1.722000	0.38042	-0.069000	0.12931	0.482000	0.46254	CAG	.	.		0.328	TFB1M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042809.1		
DTX2	113878	hgsc.bcm.edu	37	7	76132782	76132782	+	Nonsense_Mutation	SNP	G	G	T			TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chr7:76132782G>T	ENST00000324432.5	+	10	1939	c.1429G>T	c.(1429-1431)Gga>Tga	p.G477*	DTX2_ENST00000446820.2_Nonsense_Mutation_p.G430*|DTX2_ENST00000307569.8_Nonsense_Mutation_p.G430*|DTX2_ENST00000430490.2_Nonsense_Mutation_p.G477*|DTX2_ENST00000413936.2_Nonsense_Mutation_p.G477*|DTX2_ENST00000446600.1_Nonsense_Mutation_p.G386*	NM_020892.2	NP_065943.2	Q86UW9	DTX2_HUMAN	deltex 2, E3 ubiquitin ligase	477					Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(1)|skin(1)|stomach(2)	27						AACCATCTATGGAGAGAAGAC	0.572																																					p.G477X		Atlas-SNP	.											.	DTX2	64	.	0			c.G1429T						.						72.0	68.0	69.0					7																	76132782		2202	4297	6499	SO:0001587	stop_gained	113878	exon9			ATCTATGGAGAGA		CCDS5587.1, CCDS43605.1	7q11.23	2014-01-28	2014-01-28		ENSG00000091073	ENSG00000091073		"""RING-type (C3HC4) zinc fingers"""	15973	protein-coding gene	gene with protein product		613141	"""deltex (Drosophila) homolog 2"", ""deltex homolog 2 (Drosophila)"""			12670957	Standard	NM_020892		Approved	RNF58, KIAA1528	uc003ufh.4	Q86UW9	OTTHUMG00000162594	ENST00000324432.5:c.1429G>T	chr7.hg19:g.76132782G>T	ENSP00000322885:p.Gly477*	158.0	0.0		202.0	22.0	NM_001102594	Q6XM87|Q6XM88|Q96H69|Q9H890|Q9P200	Nonsense_Mutation	SNP	ENST00000324432.5	hg19	CCDS5587.1	.	.	.	.	.	.	.	.	.	.	.	41	8.707606	0.98922	.	.	ENSG00000091073	ENST00000324432;ENST00000307569;ENST00000541989;ENST00000446600;ENST00000413936;ENST00000430490;ENST00000446820	.	.	.	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-16.9077	18.9568	0.92661	0.0:0.0:1.0:0.0	.	.	.	.	X	477;430;386;386;477;477;430	.	ENSP00000305242:G430X	G	+	1	0	AC005522.1	75970718	1.000000	0.71417	0.995000	0.50966	0.707000	0.40811	9.823000	0.99369	2.725000	0.93324	0.655000	0.94253	GGA	.	.		0.572	DTX2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253104.2		
BSPRY	54836	hgsc.bcm.edu	37	9	116122865	116122865	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chr9:116122865C>T	ENST00000374183.4	+	3	418	c.379C>T	c.(379-381)Cgg>Tgg	p.R127W	BSPRY_ENST00000462085.1_3'UTR	NM_017688.2	NP_060158.2	Q5W0U4	BSPRY_HUMAN	B-box and SPRY domain containing	127					calcium ion transport (GO:0006816)	cell leading edge (GO:0031252)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|lung(4)|urinary_tract(1)	8						CGAGGAGCAGCGGTTACTGGA	0.582																																					p.R127W		Atlas-SNP	.											.	BSPRY	21	.	0			c.C379T						.						55.0	64.0	61.0					9																	116122865		2173	4281	6454	SO:0001583	missense	54836	exon3			GAGCAGCGGTTAC	AJ276691	CCDS43868.1	9q33.1	2008-02-05			ENSG00000119411	ENSG00000119411			18232	protein-coding gene	gene with protein product						10978534, 11099500	Standard	NM_017688		Approved	FLJ20150	uc004bhg.4	Q5W0U4	OTTHUMG00000021006	ENST00000374183.4:c.379C>T	chr9.hg19:g.116122865C>T	ENSP00000363298:p.Arg127Trp	91.0	0.0		66.0	7.0	NM_017688	B3KS19|Q96DJ2|Q9H4E4|Q9NXN0	Missense_Mutation	SNP	ENST00000374183.4	hg19	CCDS43868.1	.	.	.	.	.	.	.	.	.	.	C	19.28	3.797842	0.70567	.	.	ENSG00000119411	ENST00000374183	T	0.06371	3.31	5.84	0.296	0.15757	.	0.000000	0.85682	D	0.000000	T	0.15609	0.0376	L	0.36672	1.1	0.52099	D	0.999944	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.996	T	0.00293	-1.1841	10	0.72032	D	0.01	-9.6949	16.0697	0.80914	0.6051:0.3948:0.0:0.0	.	127;127	Q5W0U4-2;Q5W0U4	.;BSPRY_HUMAN	W	127	ENSP00000363298:R127W	ENSP00000363298:R127W	R	+	1	2	BSPRY	115162686	1.000000	0.71417	0.877000	0.34402	0.657000	0.38888	1.183000	0.32041	0.048000	0.15891	-0.188000	0.12872	CGG	.	.		0.582	BSPRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055399.1	NM_017688	
CTNNA3	29119	hgsc.bcm.edu	37	10	69281647	69281647	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chr10:69281647C>T	ENST00000433211.2	-	5	706	c.532G>A	c.(532-534)Ggg>Agg	p.G178R	CTNNA3_ENST00000373744.4_Missense_Mutation_p.G178R|CTNNA3_ENST00000545309.1_Missense_Mutation_p.G178R	NM_013266.2	NP_037398.2			catenin (cadherin-associated protein), alpha 3											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(1)|lung(50)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	95						AGCTCCTTCCCAAGCTTCTGG	0.418																																					p.G178R		Atlas-SNP	.											.	CTNNA3	401	.	0			c.G532A						.						111.0	109.0	110.0					10																	69281647		2203	4300	6503	SO:0001583	missense	29119	exon5			CCTTCCCAAGCTT	AF091606	CCDS7269.1	10q21	2006-11-24			ENSG00000183230	ENSG00000183230			2511	protein-coding gene	gene with protein product		607667				12596047, 11590244	Standard	XM_005269717		Approved	VR22, MGC26194	uc001jmw.2	Q9UI47	OTTHUMG00000018334	ENST00000433211.2:c.532G>A	chr10.hg19:g.69281647C>T	ENSP00000389714:p.Gly178Arg	97.0	0.0		68.0	12.0	NM_013266		Missense_Mutation	SNP	ENST00000433211.2	hg19	CCDS7269.1	.	.	.	.	.	.	.	.	.	.	C	12.55	1.972476	0.34848	.	.	ENSG00000183230	ENST00000433211;ENST00000373744;ENST00000545309;ENST00000330298;ENST00000540598	T;T;T;T	0.39406	1.08;1.08;1.08;1.08	5.19	5.19	0.71726	.	0.255475	0.27640	N	0.018470	T	0.57344	0.2047	L	0.46819	1.47	0.42570	D	0.993174	D;D;B;D	0.89917	1.0;1.0;0.071;1.0	D;D;B;D	0.97110	1.0;1.0;0.073;0.999	T	0.58405	-0.7642	10	0.56958	D	0.05	-12.085	14.2164	0.65795	0.0:1.0:0.0:0.0	.	178;178;178;178	A8K141;F2Z2R0;Q9UI47-2;Q9UI47	.;.;.;CTNA3_HUMAN	R	178	ENSP00000389714:G178R;ENSP00000362849:G178R;ENSP00000441444:G178R;ENSP00000330570:G178R	ENSP00000330570:G178R	G	-	1	0	CTNNA3	68951653	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.261000	0.43276	2.430000	0.82344	0.467000	0.42956	GGG	.	.		0.418	CTNNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048282.2	NM_013266	
LZTS2	84445	hgsc.bcm.edu	37	10	102770293	102770293	+	IGR	SNP	T	T	G	rs200896335|rs71013480	byFrequency	TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chr10:102770293T>G	ENST00000370220.1	+	0	5741									leucine zipper, putative tumor suppressor 2											breast(1)|large_intestine(6)|lung(7)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22				Epithelial(162;7.3e-09)|all cancers(201;3.72e-07)		TGACCCCGgctgctgcggctg	0.697																																					p.S785R	Esophageal Squamous(8;38 437 13604 19902 37640)	Atlas-SNP	.											.	PDZD7	101	.	0			c.A2353C						.																																			SO:0001628	intergenic_variant	79955	exon15			CCCGGCTGCTGCG	AB058716	CCDS7507.1	10q24	2004-03-18			ENSG00000107816	ENSG00000107816			29381	protein-coding gene	gene with protein product		610454				11347906, 11709705	Standard	NM_032429		Approved	KIAA1813, LAPSER1	uc001ksj.3	Q9BRK4	OTTHUMG00000018914		chr10.hg19:g.102770293T>G		378.0	0.0		329.0	17.0	NM_001195263		Missense_Mutation	SNP	ENST00000370220.1	hg19	CCDS7507.1	.	.	.	.	.	.	.	.	.	.	T	2.648	-0.282573	0.05642	.	.	ENSG00000186862	ENST00000393462	.	.	.	3.99	2.83	0.33086	.	.	.	.	.	T	0.29716	0.0742	N	0.24115	0.695	0.28374	N	0.919888	.	.	.	.	.	.	T	0.21793	-1.0235	6	0.20046	T	0.44	.	9.5348	0.39216	0.0:0.0:0.1777:0.8222	.	.	.	.	R	785	.	ENSP00000377106:S785R	S	-	1	0	PDZD7	102760283	0.123000	0.22298	0.736000	0.30914	0.083000	0.17756	0.220000	0.17660	0.649000	0.30751	-0.680000	0.03767	AGC	.	.		0.697	LZTS2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049872.1	XM_046743	
MUC2	4583	hgsc.bcm.edu	37	11	1104063	1104063	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chr11:1104063G>A	ENST00000441003.2	+	49	8281	c.8254G>A	c.(8254-8256)Gcc>Acc	p.A2752T		NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	5114					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.A2752S(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	CAAGGCCCAGGCCCTGGACCA	0.682																																					p.A2748T		Atlas-SNP	.											MUC2_ENST00000441003,NS,carcinoma,0,2	MUC2	614	.	1	Substitution - Missense(1)	lung(1)	c.G8242A						.						16.0	20.0	19.0					11																	1104063		2031	4186	6217	SO:0001583	missense	4583	exon50			GCCCAGGCCCTGG	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.8254G>A	chr11.hg19:g.1104063G>A	ENSP00000415183:p.Ala2752Thr	122.0	0.0		99.0	21.0	NM_002457	Q14878	Missense_Mutation	SNP	ENST00000441003.2	hg19		.	.	.	.	.	.	.	.	.	.	G	0.676	-0.800040	0.02841	.	.	ENSG00000198788	ENST00000441003	T	0.11277	2.79	3.73	-5.78	0.02362	.	.	.	.	.	T	0.06188	0.0160	L	0.38953	1.18	0.09310	N	1	B	0.15930	0.015	B	0.09377	0.004	T	0.43893	-0.9363	9	0.12103	T	0.63	.	6.1504	0.20308	0.2051:0.0:0.4581:0.3368	.	2752	E7EUV1	.	T	2752	ENSP00000415183:A2752T	ENSP00000415183:A2752T	A	+	1	0	MUC2	1094063	0.000000	0.05858	0.004000	0.12327	0.026000	0.11368	-0.633000	0.05483	-1.827000	0.01204	-2.023000	0.00429	GCC	.	.		0.682	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
LUM	4060	hgsc.bcm.edu	37	12	91502234	91502234	+	Missense_Mutation	SNP	C	C	A			TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chr12:91502234C>A	ENST00000266718.4	-	2	977	c.523G>T	c.(523-525)Gct>Tct	p.A175S	LUM_ENST00000548071.1_Intron	NM_002345.3	NP_002336.1	P51884	LUM_HUMAN	lumican	175					carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to growth factor (GO:0070848)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrillar collagen trimer (GO:0005583)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	24						GCTGAAACAGCATCCTCTTTC	0.448																																					p.A175S		Atlas-SNP	.											.	LUM	65	.	0			c.G523T						.						104.0	104.0	104.0					12																	91502234		2203	4300	6503	SO:0001583	missense	4060	exon2			AAACAGCATCCTC	BT006707	CCDS9038.1	12q21.33	2014-06-13			ENSG00000139329			"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	6724	protein-coding gene	gene with protein product	"""lumican proteoglycan"""	600616		LDC		7558030	Standard	NM_002345		Approved	SLRR2D	uc001tbm.3	P51884	OTTHUMG00000170074	ENST00000266718.4:c.523G>T	chr12.hg19:g.91502234C>A	ENSP00000266718:p.Ala175Ser	110.0	0.0		98.0	7.0	NM_002345	B2R6R5|Q96QM7	Missense_Mutation	SNP	ENST00000266718.4	hg19	CCDS9038.1	.	.	.	.	.	.	.	.	.	.	C	4.671	0.124668	0.08931	.	.	ENSG00000139329	ENST00000266718	T	0.58506	0.33	5.45	0.574	0.17368	.	0.468197	0.23836	N	0.044090	T	0.25457	0.0619	N	0.02973	-0.45	0.09310	N	1	B	0.12630	0.006	B	0.16722	0.016	T	0.13953	-1.0490	10	0.23891	T	0.37	-10.0698	4.7996	0.13290	0.2155:0.3543:0.0:0.4303	.	175	P51884	LUM_HUMAN	S	175	ENSP00000266718:A175S	ENSP00000266718:A175S	A	-	1	0	LUM	90026365	0.001000	0.12720	0.000000	0.03702	0.446000	0.32137	0.038000	0.13862	-0.166000	0.10890	-0.259000	0.10710	GCT	.	.		0.448	LUM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407150.2	NM_002345	
CCDC168	643677	hgsc.bcm.edu	37	13	103384823	103384823	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chr13:103384823C>T	ENST00000322527.2	-	1	4336	c.4337G>A	c.(4336-4338)cGt>cAt	p.R1446H		NM_001146197.1	NP_001139669.1	Q8NDH2	CC168_HUMAN	coiled-coil domain containing 168	1446			R -> C (in dbSNP:rs9300756).														CTGATCTTTACGTTTGGGAGA	0.318																																					p.R6075H		Atlas-SNP	.											.	.	.	.	0			c.G18224A						.						140.0	102.0	114.0					13																	103384823		692	1590	2282	SO:0001583	missense	643677	exon4			TCTTTACGTTTGG		CCDS73596.1	13q33.1	2014-06-17	2011-08-09	2011-08-09	ENSG00000175820	ENSG00000175820			26851	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 40"""	C13orf40			Standard	NM_001146197		Approved	FLJ40176	uc001vpm.3	Q8NDH2	OTTHUMG00000187287	ENST00000322527.2:c.4337G>A	chr13.hg19:g.103384823C>T	ENSP00000320232:p.Arg1446His	81.0	0.0		79.0	16.0	NM_001146197	Q8N800	Missense_Mutation	SNP	ENST00000322527.2	hg19		.	.	.	.	.	.	.	.	.	.	C	0.548	-0.850815	0.02651	.	.	ENSG00000175820	ENST00000322527	T	0.03635	3.86	2.62	-1.25	0.09405	.	.	.	.	.	T	0.01592	0.0051	N	0.08118	0	0.09310	N	1	B	0.15473	0.013	B	0.04013	0.001	T	0.49021	-0.8982	9	0.13470	T	0.59	.	3.2101	0.06680	0.4021:0.258:0.3399:0.0	.	1446	Q8NDH2	CC168_HUMAN	H	1446	ENSP00000320232:R1446H	ENSP00000320232:R1446H	R	-	2	0	CCDC168	102182824	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.826000	0.04429	-0.272000	0.09259	-1.120000	0.02017	CGT	.	.		0.318	CCDC168-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001146197	
DAOA	267012	hgsc.bcm.edu	37	13	106142224	106142224	+	Intron	SNP	C	C	T			TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chr13:106142224C>T	ENST00000375936.3	+	4	327				DAOA_ENST00000329625.5_Intron|DAOA-AS1_ENST00000448407.1_RNA	NM_001161812.1|NM_172370.3	NP_001155284.1|NP_758958.3	P59103	DAOA_HUMAN	D-amino acid oxidase activator						negative regulation of D-amino-acid oxidase activity (GO:1900758)|positive regulation of catalytic activity (GO:0043085)	Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)	enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|skin(1)	13	Lung NSC(43;0.01)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)					caagacctggccaactgagac	0.493																																					p.P58S		Atlas-SNP	.											.	DAOA	26	.	0			c.C172T						.						81.0	87.0	85.0					13																	106142224		2192	4295	6487	SO:0001627	intron_variant	267012	exon4			ACCTGGCCAACTG	AY138547	CCDS41905.1, CCDS53880.1, CCDS59242.1	13q33.2	2011-08-01			ENSG00000182346	ENSG00000182346			21191	protein-coding gene	gene with protein product	"""G72 transcript"""	607408				12364586, 15057823	Standard	NM_001161814		Approved	G72	uc010tjg.2	P59103	OTTHUMG00000041333	ENST00000375936.3:c.282-26C>T	chr13.hg19:g.106142224C>T		117.0	0.0		68.0	12.0	NM_001161812	A6NKG7|Q0VAE6|Q5VX59|Q86Y17|Q8IWM4	Missense_Mutation	SNP	ENST00000375936.3	hg19	CCDS41905.1																																																																																			.	.		0.493	DAOA-005	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000099040.2	NM_172370	
NPAP1	23742	hgsc.bcm.edu	37	15	24923717	24923717	+	Silent	SNP	T	T	C			TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chr15:24923717T>C	ENST00000329468.2	+	1	3177	c.2703T>C	c.(2701-2703)ctT>ctC	p.L901L		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	901					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											ATTCCACACTTGGGGCCACTG	0.502																																					p.L901L		Atlas-SNP	.											.	.	.	.	0			c.T2703C						.						126.0	134.0	131.0					15																	24923717		2203	4300	6503	SO:0001819	synonymous_variant	23742	exon1			CACACTTGGGGCC	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.2703T>C	chr15.hg19:g.24923717T>C		59.0	0.0		51.0	9.0	NM_018958		Silent	SNP	ENST00000329468.2	hg19	CCDS10015.1																																																																																			.	.		0.502	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958	
EPB42	2038	hgsc.bcm.edu	37	15	43507436	43507436	+	Missense_Mutation	SNP	T	T	A			TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chr15:43507436T>A	ENST00000441366.2	-	3	512	c.287A>T	c.(286-288)gAg>gTg	p.E96V	EPB42_ENST00000540029.1_Intron|EPB42_ENST00000300215.3_Missense_Mutation_p.E126V	NM_000119.2|NM_001114134.1	NP_000110.2|NP_001107606.1	P16452	EPB42_HUMAN	erythrocyte membrane protein band 4.2	96					cell morphogenesis (GO:0000902)|erythrocyte maturation (GO:0043249)|hemoglobin metabolic process (GO:0020027)|iron ion homeostasis (GO:0055072)|peptide cross-linking (GO:0018149)|regulation of cell shape (GO:0008360)|spleen development (GO:0048536)	cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)|structural constituent of cytoskeleton (GO:0005200)			endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.7e-07)		GGCATCTCTCTCCTCCACCAC	0.572																																					p.E126V		Atlas-SNP	.											.	EPB42	53	.	0			c.A377T						.						163.0	126.0	138.0					15																	43507436		2203	4299	6502	SO:0001583	missense	2038	exon3			TCTCTCTCCTCCA	M60298	CCDS10093.1, CCDS45249.1	15q15-q21	2013-05-02			ENSG00000166947	ENSG00000166947		"""Transglutaminases"""	3381	protein-coding gene	gene with protein product	"""Erythrocyte surface protein band 4.2"""	177070				1284644	Standard	NM_000119		Approved	PA, MGC116735, MGC116737	uc001zrb.4	P16452	OTTHUMG00000130701	ENST00000441366.2:c.287A>T	chr15.hg19:g.43507436T>A	ENSP00000396616:p.Glu96Val	98.0	0.0		100.0	6.0	NM_000119	Q4KKX0|Q4VB97	Missense_Mutation	SNP	ENST00000441366.2	hg19	CCDS45249.1	.	.	.	.	.	.	.	.	.	.	T	14.32	2.499570	0.44455	.	.	ENSG00000166947	ENST00000300215;ENST00000441366;ENST00000397027	D;D	0.85629	-2.01;-2.01	5.29	5.29	0.74685	Immunoglobulin E-set (1);Transglutaminase, N-terminal (1);Immunoglobulin-like fold (1);	0.411934	0.29594	N	0.011709	T	0.81187	0.4770	L	0.49640	1.575	0.38806	D	0.955304	B;B	0.34290	0.447;0.316	B;B	0.34385	0.153;0.181	T	0.82669	-0.0343	10	0.54805	T	0.06	-11.2564	11.5398	0.50659	0.0:0.0:0.0:1.0	.	126;96	P16452-2;P16452	.;EPB42_HUMAN	V	126;96;96	ENSP00000300215:E126V;ENSP00000396616:E96V	ENSP00000300215:E126V	E	-	2	0	EPB42	41294728	0.069000	0.21087	1.000000	0.80357	0.560000	0.35617	2.135000	0.42112	2.228000	0.72767	0.533000	0.62120	GAG	.	.		0.572	EPB42-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432219.1	NM_000119	
TRAF7	84231	hgsc.bcm.edu	37	16	2221291	2221291	+	Silent	SNP	C	C	G			TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chr16:2221291C>G	ENST00000326181.6	+	6	507	c.375C>G	c.(373-375)ccC>ccG	p.P125P		NM_032271.2	NP_115647.2	Q6Q0C0	TRAF7_HUMAN	TNF receptor-associated factor 7, E3 ubiquitin protein ligase	125					activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of MAPK cascade (GO:0043410)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasmic vesicle (GO:0031410)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	23						CGGAGCAGCCCTCGGTGAAGC	0.687																																					p.P125P		Atlas-SNP	.											.	TRAF7	158	.	0			c.C375G						.						24.0	19.0	21.0					16																	2221291		2164	4249	6413	SO:0001819	synonymous_variant	84231	exon6			GCAGCCCTCGGTG	AL136921	CCDS10461.1	16p13.3	2013-01-10	2012-02-23	2004-06-04	ENSG00000131653	ENSG00000131653		"""RING-type (C3HC4) zinc fingers"", ""WD repeat domain containing"""	20456	protein-coding gene	gene with protein product		606692	"""ring finger and WD repeat domain 1"", ""TNF receptor-associated factor 7"""	RFWD1		11230166, 15001576	Standard	NM_032271		Approved	RNF119, DKFZp586I021, MGC7807	uc002cow.3	Q6Q0C0	OTTHUMG00000128826	ENST00000326181.6:c.375C>G	chr16.hg19:g.2221291C>G		45.0	0.0		32.0	6.0	NM_032271	Q9H073	Silent	SNP	ENST00000326181.6	hg19	CCDS10461.1																																																																																			.	.		0.687	TRAF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250762.1	NM_032271	
ERCC4	2072	hgsc.bcm.edu	37	16	14016042	14016042	+	Missense_Mutation	SNP	A	A	G			TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chr16:14016042A>G	ENST00000311895.7	+	2	371	c.362A>G	c.(361-363)gAt>gGt	p.D121G	ERCC4_ENST00000575156.1_Missense_Mutation_p.D121G	NM_005236.2	NP_005227.1	Q92889	XPF_HUMAN	excision repair cross-complementation group 4	121	Helicase-like.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|negative regulation of telomere maintenance (GO:0032205)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair involved in interstrand cross-link repair (GO:1901255)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|nucleotide-excision repair, DNA incision, 5'-to lesion (GO:0006296)|resolution of meiotic recombination intermediates (GO:0000712)|response to UV (GO:0009411)|telomere maintenance (GO:0000723)|telomere maintenance via telomere shortening (GO:0010834)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	chromosome, telomeric region (GO:0000781)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleotide-excision repair factor 1 complex (GO:0000110)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	damaged DNA binding (GO:0003684)|endodeoxyribonuclease activity (GO:0004520)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(5)|lung(12)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	38						TTCTTGACTGATAGAATACCT	0.289			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																												p.D121G		Atlas-SNP	.	yes	Rec		Xeroderma pigmentosum (F)	16	16p13.3-p13.13	2072	"""excision repair cross-complementing rodent repair deficiency, complementation group 4"""		E	.	ERCC4	100	.	0			c.A362G						.						58.0	48.0	51.0					16																	14016042		2197	4300	6497	SO:0001583	missense	2072	exon2	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	TGACTGATAGAAT	L76568	CCDS32390.1	16p13.3	2014-09-17	2014-03-07		ENSG00000175595	ENSG00000175595			3436	protein-coding gene	gene with protein product	"""xeroderma pigmentosum, complementation group F"""	133520	"""excision repair cross-complementing rodent repair deficiency, complementation group 4"""	XPF		9579555, 8887684	Standard	NM_005236		Approved	RAD1, FANCQ	uc002dce.2	Q92889	OTTHUMG00000048194	ENST00000311895.7:c.362A>G	chr16.hg19:g.14016042A>G	ENSP00000310520:p.Asp121Gly	90.0	0.0		79.0	12.0	NM_005236	A5PKV6|A8K111|O00140|Q8TD83	Missense_Mutation	SNP	ENST00000311895.7	hg19	CCDS32390.1	.	.	.	.	.	.	.	.	.	.	A	13.50	2.255417	0.39896	.	.	ENSG00000175595	ENST00000311895;ENST00000439007;ENST00000389138	T	0.57595	0.39	5.33	4.24	0.50183	.	0.187561	0.56097	N	0.000038	T	0.32346	0.0826	N	0.13352	0.335	0.46241	D	0.998949	B;B	0.12630	0.006;0.002	B;B	0.13407	0.009;0.003	T	0.06661	-1.0814	10	0.21540	T	0.41	-18.006	9.6103	0.39659	0.9164:0.0:0.0835:0.0	.	121;121	A5PKV6;Q92889	.;XPF_HUMAN	G	121;110;110	ENSP00000310520:D121G	ENSP00000310520:D121G	D	+	2	0	ERCC4	13923543	1.000000	0.71417	0.093000	0.20910	0.813000	0.45954	7.073000	0.76784	0.864000	0.35578	0.533000	0.62120	GAT	.	.		0.289	ERCC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109634.2	NM_005236	
EIF4A1	1973	hgsc.bcm.edu	37	17	7477593	7477593	+	Silent	SNP	C	C	G			TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chr17:7477593C>G	ENST00000293831.8	+	2	55	c.39C>G	c.(37-39)ggC>ggG	p.G13G	EIF4A1_ENST00000577269.1_Silent_p.G13G|SENP3-EIF4A1_ENST00000579777.1_RNA|EIF4A1_ENST00000380512.5_5'UTR|SNORA48_ENST00000386847.1_RNA|EIF4A1_ENST00000582746.1_Silent_p.G13G|SNORD10_ENST00000459579.1_RNA	NM_001416.3	NP_001407.1	P60842	IF4A1_HUMAN	eukaryotic translation initiation factor 4A1	13					cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|organ regeneration (GO:0031100)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			NS(1)|breast(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	22						GAGACAATGGCCCCGATGGGA	0.532																																					p.G13G	Melanoma(120;278 1668 15796 27423 46368)	Atlas-SNP	.											.	EIF4A1	38	.	0			c.C39G						.						71.0	68.0	69.0					17																	7477593		2203	4300	6503	SO:0001819	synonymous_variant	1973	exon2			CAATGGCCCCGAT	D13748	CCDS11113.1, CCDS58511.1	17p13	2012-02-23	2010-02-10		ENSG00000161960	ENSG00000161960		"""DEAD-boxes"""	3282	protein-coding gene	gene with protein product		602641	"""eukaryotic translation initiation factor 4A, isoform 1"""	EIF4A		8493113, 9790779	Standard	NM_001416		Approved	DDX2A, EIF-4A		P60842	OTTHUMG00000108149	ENST00000293831.8:c.39C>G	chr17.hg19:g.7477593C>G		106.0	0.0		72.0	11.0	NM_001416	B2R6L8|D3DTP9|J3QLC4|P04765|Q5U018|Q61516	Silent	SNP	ENST00000293831.8	hg19	CCDS11113.1																																																																																			.	.		0.532	EIF4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226952.6	NM_001416	
GAS2L2	246176	hgsc.bcm.edu	37	17	34073120	34073120	+	Nonsense_Mutation	SNP	C	C	A	rs139624793	byFrequency	TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chr17:34073120C>A	ENST00000254466.6	-	6	1423	c.1396G>T	c.(1396-1398)Gag>Tag	p.E466*	GAS2L2_ENST00000587565.1_Nonsense_Mutation_p.E450*	NM_139285.3	NP_644814.1	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2	466					cell cycle arrest (GO:0007050)|microtubule bundle formation (GO:0001578)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	actin filament binding (GO:0051015)|cytoskeletal adaptor activity (GO:0008093)|microtubule binding (GO:0008017)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CCCAGGCACTCGGCTGGGCCA	0.622																																					p.E466X		Atlas-SNP	.											.	GAS2L2	94	.	0			c.G1396T						.						94.0	107.0	103.0					17																	34073120		2203	4300	6503	SO:0001587	stop_gained	246176	exon6			GGCACTCGGCTGG	AF508784	CCDS11298.1	17q21	2014-05-06			ENSG00000132139	ENSG00000270765			24846	protein-coding gene	gene with protein product		611398				12584248	Standard	NM_139285		Approved	GAR17	uc002hjv.2	Q8NHY3	OTTHUMG00000188386	ENST00000254466.6:c.1396G>T	chr17.hg19:g.34073120C>A	ENSP00000254466:p.Glu466*	100.0	0.0		100.0	16.0	NM_139285	Q8NHY4	Nonsense_Mutation	SNP	ENST00000254466.6	hg19	CCDS11298.1	.	.	.	.	.	.	.	.	.	.	C	15.46	2.839368	0.51057	.	.	ENSG00000132139	ENST00000254466	.	.	.	4.92	1.16	0.20824	.	4.932270	0.00166	N	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.9581	4.4245	0.11497	0.0:0.1775:0.3302:0.4923	.	.	.	.	X	466	.	ENSP00000254466:E466X	E	-	1	0	GAS2L2	31097233	0.000000	0.05858	0.047000	0.18901	0.062000	0.15995	-0.099000	0.11007	0.026000	0.15269	-0.290000	0.09829	GAG	.	C|0.997;T|0.003		0.622	GAS2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256497.1	NM_139285	
PIP4K2B	8396	hgsc.bcm.edu	37	17	36935649	36935649	+	Missense_Mutation	SNP	T	T	G			TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chr17:36935649T>G	ENST00000269554.3	-	5	1121	c.641A>C	c.(640-642)aAg>aCg	p.K214T	PIP4K2B_ENST00000311500.6_5'UTR	NM_003559.4	NP_003550.1	P78356	PI42B_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type II, beta	214	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				cell surface receptor signaling pathway (GO:0007166)|intracellular signal transduction (GO:0035556)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|1-phosphatidylinositol-5-phosphate 4-kinase activity (GO:0016309)|ATP binding (GO:0005524)|receptor signaling protein activity (GO:0005057)			endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(8)|ovary(1)	19						GAGGTCATACTTGCGATGCAC	0.557																																					p.K214T		Atlas-SNP	.											.	PIP4K2B	35	.	0			c.A641C						.						174.0	143.0	154.0					17																	36935649		2203	4300	6503	SO:0001583	missense	8396	exon5			TCATACTTGCGAT	U85245	CCDS11329.1	17q21.2	2007-08-14	2007-08-14	2007-08-14		ENSG00000276293	2.7.1.149		8998	protein-coding gene	gene with protein product		603261	"""phosphatidylinositol-4-phosphate 5-kinase, type II, beta"""	PIP5K2B		9038203, 14691457, 9367159	Standard	NM_003559		Approved	PIP5KIIB, PIP5KIIbeta	uc002hqs.3	P78356		ENST00000269554.3:c.641A>C	chr17.hg19:g.36935649T>G	ENSP00000269554:p.Lys214Thr	98.0	0.0		74.0	13.0	NM_003559	Q5U0E8|Q8TBP2	Missense_Mutation	SNP	ENST00000269554.3	hg19	CCDS11329.1	.	.	.	.	.	.	.	.	.	.	T	28.8	4.952131	0.92660	.	.	ENSG00000141720	ENST00000269554;ENST00000311500	T	0.32023	1.47	5.1	5.1	0.69264	Phosphatidylinositol-4-phosphate 5-kinase, core (2);Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.50309	0.1608	M	0.65320	2	0.80722	D	1	D;D;D	0.76494	0.997;0.999;0.998	D;D;D	0.78314	0.988;0.98;0.991	T	0.41752	-0.9491	10	0.28530	T	0.3	-22.5609	13.8398	0.63432	0.0:0.0:0.0:1.0	.	214;214;214	C9JMM2;P78356-2;P78356	.;.;PI42B_HUMAN	T	214	ENSP00000269554:K214T	ENSP00000269554:K214T	K	-	2	0	PIP4K2B	34189175	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.522000	0.81844	2.139000	0.66308	0.533000	0.62120	AAG	.	.		0.557	PIP4K2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256791.1	NM_003559	
KAT2A	2648	hgsc.bcm.edu	37	17	40269500	40269500	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chr17:40269500G>A	ENST00000225916.5	-	10	1596	c.1543C>T	c.(1543-1545)Cgg>Tgg	p.R515W		NM_021078.2	NP_066564.2	Q92830	KAT2A_HUMAN	K(lysine) acetyltransferase 2A	515	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				cell proliferation (GO:0008283)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|histone deubiquitination (GO:0016578)|histone H3 acetylation (GO:0043966)|histone H3-K14 acetylation (GO:0044154)|in utero embryonic development (GO:0001701)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|positive regulation of gluconeogenesis (GO:0045722)|regulation of protein stability (GO:0031647)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|somitogenesis (GO:0001756)|telencephalon development (GO:0021537)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|extracellular space (GO:0005615)|mitotic spindle (GO:0072686)|nucleoplasm (GO:0005654)|STAGA complex (GO:0030914)|transcription factor TFTC complex (GO:0033276)	chromatin binding (GO:0003682)|H3 histone acetyltransferase activity (GO:0010484)|histone acetyltransferase activity (GO:0004402)|histone acetyltransferase activity (H4-K12 specific) (GO:0043997)|histone deacetylase binding (GO:0042826)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(4)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						AGCAACACCCGCCGGTTGGCC	0.642																																					p.R515W		Atlas-SNP	.											.	KAT2A	54	.	0			c.C1543T						.						26.0	25.0	25.0					17																	40269500		2182	4276	6458	SO:0001583	missense	2648	exon10			ACACCCGCCGGTT	AF029777	CCDS11417.1	17q12-q21	2011-07-01	2008-07-04	2008-07-04	ENSG00000108773	ENSG00000108773		"""Chromatin-modifying enzymes / K-acetyltransferases"""	4201	protein-coding gene	gene with protein product		602301	"""GCN5 general control of amino-acid synthesis 5-like 2 (yeast)"""	GCN5L2		8552087	Standard	NM_021078		Approved	GCN5, PCAF-b	uc002hyx.2	Q92830	OTTHUMG00000133504	ENST00000225916.5:c.1543C>T	chr17.hg19:g.40269500G>A	ENSP00000225916:p.Arg515Trp	174.0	0.0		134.0	8.0	NM_021078	Q8N1A2|Q9UCW1	Missense_Mutation	SNP	ENST00000225916.5	hg19	CCDS11417.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.257103	0.80246	.	.	ENSG00000108773	ENST00000225916	T	0.05258	3.47	4.8	3.81	0.43845	GCN5-related N-acetyltransferase (GNAT) domain (1);Acyl-CoA N-acyltransferase (2);	0.132557	0.51477	D	0.000095	T	0.11965	0.0291	L	0.50333	1.59	0.47214	D	0.999354	D	0.76494	0.999	P	0.51355	0.667	T	0.01334	-1.1382	10	0.87932	D	0	-19.9842	11.7634	0.51916	0.0:0.0:0.5065:0.4935	.	515	Q92830	KAT2A_HUMAN	W	515	ENSP00000225916:R515W	ENSP00000225916:R515W	R	-	1	2	KAT2A	37523026	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.053000	0.57427	0.997000	0.38969	0.561000	0.74099	CGG	.	.		0.642	KAT2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257458.1	NM_021078	
KDM4B	23030	hgsc.bcm.edu	37	19	5047661	5047661	+	Missense_Mutation	SNP	T	T	G			TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chr19:5047661T>G	ENST00000159111.4	+	6	825	c.607T>G	c.(607-609)Ttt>Gtt	p.F203V	KDM4B_ENST00000536461.1_Missense_Mutation_p.F203V|KDM4B_ENST00000592175.1_3'UTR|KDM4B_ENST00000381759.4_Missense_Mutation_p.F203V	NM_015015.2	NP_055830	O94953	KDM4B_HUMAN	lysine (K)-specific demethylase 4B	203	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(1)|liver(1)|lung(14)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32						CTACCTGCACTTTGGGGAGCC	0.642																																					p.F203V		Atlas-SNP	.											.	KDM4B	120	.	0			c.T607G						.						232.0	158.0	183.0					19																	5047661		2203	4300	6503	SO:0001583	missense	23030	exon6			CTGCACTTTGGGG	AB020683	CCDS12138.1	19p13.3	2013-01-23	2009-04-06	2009-04-06		ENSG00000127663		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	29136	protein-coding gene	gene with protein product	"""tudor domain containing 14B"""	609765	"""jumonji domain containing 2B"""	JMJD2B		10048485, 15138608	Standard	NM_015015		Approved	KIAA0876, TDRD14B	uc002mbq.4	O94953		ENST00000159111.4:c.607T>G	chr19.hg19:g.5047661T>G	ENSP00000159111:p.Phe203Val	68.0	0.0		72.0	5.0	NM_015015	B9EGN8|D6W631|O75274|Q6P3R5|Q9P1V1|Q9UF40	Missense_Mutation	SNP	ENST00000159111.4	hg19	CCDS12138.1	.	.	.	.	.	.	.	.	.	.	T	25.1	4.606350	0.87157	.	.	ENSG00000127663	ENST00000159111;ENST00000381759;ENST00000536461	T;T;T	0.72394	-0.65;-0.65;-0.65	4.32	4.32	0.51571	Transcription factor jumonji/aspartyl beta-hydroxylase (2);Transcription factor jumonji (1);	0.000000	0.85682	D	0.000000	D	0.83653	0.5301	M	0.83118	2.625	0.80722	D	1	B;D;P	0.62365	0.376;0.991;0.753	B;D;P	0.68943	0.328;0.961;0.696	D	0.86435	0.1763	10	0.72032	D	0.01	-26.1242	13.6209	0.62136	0.0:0.0:0.0:1.0	.	203;203;203	F5GX28;O94953-2;O94953	.;.;KDM4B_HUMAN	V	203	ENSP00000159111:F203V;ENSP00000371178:F203V;ENSP00000440495:F203V	ENSP00000159111:F203V	F	+	1	0	KDM4B	4998661	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	7.779000	0.85648	1.803000	0.52742	0.533000	0.62120	TTT	.	.		0.642	KDM4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450558.1	NM_015015	
CATSPERD	257062	hgsc.bcm.edu	37	19	5719823	5719823	+	5'Flank	SNP	C	C	T			TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chr19:5719823C>T	ENST00000381624.3	+	0	0				LONP1_ENST00000360614.3_Silent_p.P107P|CATSPERD_ENST00000381614.2_5'Flank|LONP1_ENST00000590729.1_5'UTR|LONP1_ENST00000593119.1_Silent_p.P43P|LONP1_ENST00000585374.1_5'UTR|LONP1_ENST00000540670.2_Intron|LONP1_ENST00000590511.1_5'UTR	NM_152784.3	NP_689997.3	Q86XM0	CTSRD_HUMAN	catsper channel auxiliary subunit delta						multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)											CCGTTATGACCGGGCCTTccc	0.726																																					p.F107L		Atlas-SNP	.											.	LONP1	66	.	0			c.T321A						.						24.0	28.0	26.0					19																	5719823		2203	4299	6502	SO:0001631	upstream_gene_variant	9361	exon1			TATGACCGGGCCT	BC043005	CCDS12149.2	19p13.3	2013-10-11	2012-02-22	2012-02-22	ENSG00000174898	ENSG00000174898			28598	protein-coding gene	gene with protein product			"""transmembrane protein 146"""	TMEM146		21224844	Standard	NM_152784		Approved	MGC39581	uc002mda.3	Q86XM0	OTTHUMG00000143036		chr19.hg19:g.5719823C>T	Exception_encountered	116.0	0.0		90.0	11.0	NM_004793	Q6ZRP1	Missense_Mutation	SNP	ENST00000381624.3	hg19	CCDS12149.2																																																																																			.	.		0.726	CATSPERD-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000286953.2	NM_152784	
UPF1	5976	hgsc.bcm.edu	37	19	18965500	18965500	+	Missense_Mutation	SNP	A	A	G			TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chr19:18965500A>G	ENST00000599848.1	+	9	1489	c.1280A>G	c.(1279-1281)aAg>aGg	p.K427R	UPF1_ENST00000262803.5_Missense_Mutation_p.K416R			Q92900	RENT1_HUMAN	UPF1 regulator of nonsense transcripts homolog (yeast)	427					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|dosage compensation by inactivation of X chromosome (GO:0009048)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational termination (GO:0006449)|RNA metabolic process (GO:0016070)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40						TTTGTGTGGAAGTCGACCTCC	0.562																																					p.K416R		Atlas-SNP	.											.	UPF1	88	.	0			c.A1247G						.						171.0	154.0	160.0					19																	18965500		2203	4300	6503	SO:0001583	missense	5976	exon9			TGTGGAAGTCGAC	AF074016	CCDS12386.1, CCDS74315.1	19p13.2-p13.11	2012-02-29	2006-02-07	2006-02-07	ENSG00000005007	ENSG00000005007			9962	protein-coding gene	gene with protein product	"""UP Frameshift 1"", ""smg-2 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	601430	"""regulator of nonsense transcripts 1"""	RENT1		8855285, 9064659	Standard	XM_005260015		Approved	HUPF1, KIAA0221, NORF1, pNORF1, smg-2	uc002nkf.3	Q92900		ENST00000599848.1:c.1280A>G	chr19.hg19:g.18965500A>G	ENSP00000470142:p.Lys427Arg	90.0	0.0		92.0	10.0	NM_002911	O00239|O43343|Q86Z25|Q92842	Missense_Mutation	SNP	ENST00000599848.1	hg19		.	.	.	.	.	.	.	.	.	.	A	17.54	3.415892	0.62511	.	.	ENSG00000005007	ENST00000262803	D	0.90955	-2.76	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	D	0.89674	0.6783	M	0.69248	2.105	0.80722	D	1	B;B	0.24317	0.061;0.101	B;B	0.27887	0.084;0.083	D	0.88140	0.2844	10	0.62326	D	0.03	-41.0483	13.8928	0.63750	1.0:0.0:0.0:0.0	.	427;416	Q92900;Q92900-2	RENT1_HUMAN;.	R	416	ENSP00000262803:K416R	ENSP00000262803:K416R	K	+	2	0	UPF1	18826500	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	8.925000	0.92832	1.896000	0.54893	0.533000	0.62120	AAG	.	.		0.562	UPF1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000464684.1	NM_002911	
ZNF611	81856	hgsc.bcm.edu	37	19	53209500	53209500	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chr19:53209500G>A	ENST00000319783.1	-	7	1124	c.808C>T	c.(808-810)Cac>Tac	p.H270Y	ZNF611_ENST00000602162.1_Missense_Mutation_p.H201Y|ZNF611_ENST00000595798.1_Missense_Mutation_p.H201Y|ZNF611_ENST00000540744.1_Missense_Mutation_p.H270Y|ZNF611_ENST00000602046.1_5'Flank|ZNF611_ENST00000453741.2_Missense_Mutation_p.H201Y|ZNF611_ENST00000543227.1_Missense_Mutation_p.H270Y	NM_030972.3	NP_112234.3	Q8N823	ZN611_HUMAN	zinc finger protein 611	270					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H270Y(1)		breast(1)|endometrium(4)|kidney(4)|large_intestine(10)|lung(12)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(262;0.0233)|GBM - Glioblastoma multiforme(134;0.04)		TATTGCTCGTGATTAAAGAGC	0.413																																					p.H270Y		Atlas-SNP	.											ZNF611,NS,carcinoma,0,1	ZNF611	72	.	1	Substitution - Missense(1)	kidney(1)	c.C808T						.						182.0	178.0	179.0					19																	53209500		2203	4300	6503	SO:0001583	missense	81856	exon7			GCTCGTGATTAAA	AK091389	CCDS12855.1, CCDS54312.1	19q13.42	2013-01-08			ENSG00000213020	ENSG00000213020		"""Zinc fingers, C2H2-type"", ""-"""	28766	protein-coding gene	gene with protein product						12477932	Standard	NM_030972		Approved	MGC5384	uc010ydq.2	Q8N823	OTTHUMG00000154908	ENST00000319783.1:c.808C>T	chr19.hg19:g.53209500G>A	ENSP00000322427:p.His270Tyr	133.0	0.0		134.0	19.0	NM_030972	B3KRD5|Q69YG9	Missense_Mutation	SNP	ENST00000319783.1	hg19	CCDS12855.1	.	.	.	.	.	.	.	.	.	.	.	1.672	-0.508772	0.04231	.	.	ENSG00000213020	ENST00000543227;ENST00000540744;ENST00000453741;ENST00000319783	T;T;T;T	0.06528	3.29;3.29;3.29;3.29	1.2	-2.4	0.06583	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04407	0.0121	N	0.25380	0.74	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.38156	-0.9674	9	0.41790	T	0.15	.	6.1684	0.20404	0.6045:0.0:0.3955:0.0	.	270	Q8N823	ZN611_HUMAN	Y	270;270;201;270	ENSP00000437616:H270Y;ENSP00000439211:H270Y;ENSP00000443505:H201Y;ENSP00000322427:H270Y	ENSP00000322427:H270Y	H	-	1	0	ZNF611	57901312	.	.	0.000000	0.03702	0.000000	0.00434	.	.	-1.461000	0.01909	-2.696000	0.00138	CAC	.	.		0.413	ZNF611-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337612.1	NM_030972	
MXRA5	25878	hgsc.bcm.edu	37	X	3235500	3235500	+	Silent	SNP	C	C	A			TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chrX:3235500C>A	ENST00000217939.6	-	6	6376	c.6222G>T	c.(6220-6222)gcG>gcT	p.A2074A		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	2074	Ig-like C2-type 5.					extracellular vesicular exosome (GO:0070062)		p.A2074A(2)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				TGGGCAGGGGCGCAGCCTTGG	0.647																																					p.A2074A		Atlas-SNP	.											.	MXRA5	815	.	2	Substitution - coding silent(2)	lung(2)	c.G6222T						.						27.0	23.0	24.0					X																	3235500		2181	4278	6459	SO:0001819	synonymous_variant	25878	exon6			CAGGGGCGCAGCC	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.6222G>T	chrX.hg19:g.3235500C>A		152.0	0.0		97.0	8.0	NM_015419	Q6P1M7|Q9Y3Y8	Silent	SNP	ENST00000217939.6	hg19	CCDS14124.1																																																																																			.	.		0.647	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419	
CDKL5	6792	hgsc.bcm.edu	37	X	18627641	18627641	+	Silent	SNP	A	A	G			TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chrX:18627641A>G	ENST00000379989.3	+	15	2388	c.2103A>G	c.(2101-2103)agA>agG	p.R701R	CDKL5_ENST00000379996.3_Silent_p.R701R|CDKL5_ENST00000463994.1_3'UTR	NM_001037343.1	NP_001032420.1	O76039	CDKL5_HUMAN	cyclin-dependent kinase-like 5	701					neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of Rac GTPase activity (GO:0032855)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite development (GO:0050773)	cytoplasm (GO:0005737)|dendrite cytoplasm (GO:0032839)|dendritic growth cone (GO:0044294)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|skin(5)|stomach(1)	44	Hepatocellular(33;0.183)					AAGAAAATAGACACCTATACA	0.478																																					p.R701R		Atlas-SNP	.											.	CDKL5	124	.	0			c.A2103G						.						142.0	124.0	130.0					X																	18627641		2203	4300	6503	SO:0001819	synonymous_variant	6792	exon14			AAATAGACACCTA	Y15057	CCDS14186.1	Xp22	2011-11-04	2002-11-26	2002-11-29	ENSG00000008086	ENSG00000008086		"""Cyclin-dependent kinases"""	11411	protein-coding gene	gene with protein product		300203	"""serine/threonine kinase 9"""	STK9		9721213, 16935860	Standard	XM_005274584		Approved	EIEE2	uc004cym.3	O76039	OTTHUMG00000021214	ENST00000379989.3:c.2103A>G	chrX.hg19:g.18627641A>G		212.0	0.0		180.0	9.0	NM_003159	G9B9X4|Q14198|Q5H985|Q8IYC7|Q9UJL6	Silent	SNP	ENST00000379989.3	hg19	CCDS14186.1																																																																																			.	.		0.478	CDKL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055945.2	NM_003159	
EDA2R	60401	hgsc.bcm.edu	37	X	65822603	65822603	+	Missense_Mutation	SNP	G	G	T			TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chrX:65822603G>T	ENST00000374719.3	-	5	445	c.389C>A	c.(388-390)cCc>cAc	p.P130H	EDA2R_ENST00000253392.5_Missense_Mutation_p.P130H|EDA2R_ENST00000451436.2_Silent_p.T36T|EDA2R_ENST00000450752.1_Missense_Mutation_p.P130H|EDA2R_ENST00000396050.1_Missense_Mutation_p.P130H|EDA2R_ENST00000456230.2_Missense_Mutation_p.P130H	NM_021783.3	NP_068555	Q9HAV5	TNR27_HUMAN	ectodysplasin A2 receptor	130					cell differentiation (GO:0030154)|embryo development (GO:0009790)|epidermis development (GO:0008544)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)|tumor necrosis factor-activated receptor activity (GO:0005031)			breast(1)|endometrium(2)|large_intestine(4)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	13						GGGCACTGTGGGTGTATCTGC	0.557																																					p.P130H		Atlas-SNP	.											.	EDA2R	30	.	0			c.C389A						.						49.0	33.0	39.0					X																	65822603		2203	4298	6501	SO:0001583	missense	60401	exon4			ACTGTGGGTGTAT	AF298812	CCDS14386.1, CCDS56603.1	Xq11.1	2013-05-22			ENSG00000131080	ENSG00000131080		"""Tumor necrosis factor receptor superfamily"""	17756	protein-coding gene	gene with protein product		300276				11039935	Standard	NM_021783		Approved	XEDAR, EDA-A2R, EDAA2R, TNFRSF27	uc004dwt.2	Q9HAV5	OTTHUMG00000021736	ENST00000374719.3:c.389C>A	chrX.hg19:g.65822603G>T	ENSP00000363851:p.Pro130His	353.0	0.0		301.0	50.0	NM_001242310	Q5VYX9|Q5VYY0|Q6UWM2|Q8IZA6	Missense_Mutation	SNP	ENST00000374719.3	hg19	CCDS14386.1	.	.	.	.	.	.	.	.	.	.	G	8.677	0.904193	0.17760	.	.	ENSG00000131080	ENST00000374719;ENST00000396050;ENST00000253392;ENST00000456230;ENST00000450752	D;D;D;D;D	0.85013	-1.91;-1.91;-1.93;-1.91;-1.93	4.37	0.177	0.15054	.	0.379278	0.21973	N	0.066424	T	0.70029	0.3177	L	0.27053	0.805	0.09310	N	0.999997	B;B;B	0.20671	0.047;0.006;0.001	B;B;B	0.20955	0.032;0.007;0.002	T	0.56420	-0.7982	10	0.46703	T	0.11	0.0451	2.1098	0.03700	0.1057:0.1612:0.3809:0.3523	.	130;130;130	Q9HAV5-2;B2RBZ9;Q9HAV5	.;.;TNR27_HUMAN	H	130	ENSP00000363851:P130H;ENSP00000379365:P130H;ENSP00000253392:P130H;ENSP00000393935:P130H;ENSP00000402929:P130H	ENSP00000253392:P130H	P	-	2	0	EDA2R	65739328	0.948000	0.32251	0.030000	0.17652	0.890000	0.51754	0.763000	0.26517	-0.514000	0.06488	0.600000	0.82982	CCC	.	.		0.557	EDA2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057002.1	NM_021783	
DRP2	1821	hgsc.bcm.edu	37	X	100496711	100496711	+	Missense_Mutation	SNP	C	C	G			TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chrX:100496711C>G	ENST00000395209.3	+	7	1141	c.614C>G	c.(613-615)gCg>gGg	p.A205G	DRP2_ENST00000538510.1_Missense_Mutation_p.A205G|DRP2_ENST00000541709.1_Missense_Mutation_p.A127G|DRP2_ENST00000402866.1_Missense_Mutation_p.A205G	NM_001939.2	NP_001930.2	Q13474	DRP2_HUMAN	dystrophin related protein 2	205					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(3)|prostate(1)|skin(2)|urinary_tract(2)	31						TGGAAGCAGGCGACGGTGGCC	0.587																																					p.A205G		Atlas-SNP	.											.	DRP2	98	.	0			c.C614G						.						67.0	57.0	60.0					X																	100496711		2203	4300	6503	SO:0001583	missense	1821	exon7			AGCAGGCGACGGT	U43519	CCDS14480.2, CCDS55465.1	Xq22	2008-02-05			ENSG00000102385	ENSG00000102385			3032	protein-coding gene	gene with protein product		300052				8640231	Standard	NM_001939		Approved		uc004egz.2	Q13474	OTTHUMG00000022020	ENST00000395209.3:c.614C>G	chrX.hg19:g.100496711C>G	ENSP00000378635:p.Ala205Gly	99.0	0.0		66.0	12.0	NM_001939	A6ZKI5|A8K1B0|B1B1F3|B4DIZ0	Missense_Mutation	SNP	ENST00000395209.3	hg19	CCDS14480.2	.	.	.	.	.	.	.	.	.	.	C	19.31	3.803446	0.70682	.	.	ENSG00000102385	ENST00000402866;ENST00000395209;ENST00000541709;ENST00000538510	T;T;T;T	0.06608	3.38;3.38;3.28;3.38	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.20820	0.0501	M	0.64997	1.995	0.58432	D	0.999996	D	0.67145	0.996	P	0.59288	0.855	T	0.00175	-1.1955	10	0.72032	D	0.01	-10.1184	18.5061	0.90898	0.0:1.0:0.0:0.0	.	205	Q13474	DRP2_HUMAN	G	205;205;127;205	ENSP00000385038:A205G;ENSP00000378635:A205G;ENSP00000444752:A127G;ENSP00000441051:A205G	ENSP00000362007:A205G	A	+	2	0	DRP2	100383367	1.000000	0.71417	0.966000	0.40874	0.445000	0.32107	7.449000	0.80643	2.313000	0.78055	0.529000	0.55759	GCG	.	.		0.587	DRP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057522.3	NM_001939	
FATE1	89885	hgsc.bcm.edu	37	X	150889930	150889930	+	Nonsense_Mutation	SNP	G	G	T	rs150252397	byFrequency	TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chrX:150889930G>T	ENST00000370350.3	+	3	383	c.298G>T	c.(298-300)Gag>Tag	p.E100*		NM_033085.2	NP_149076.1	Q969F0	FATE1_HUMAN	fetal and adult testis expressed 1	100						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(2)|lung(6)|ovary(1)	15	Acute lymphoblastic leukemia(192;6.56e-05)					CCATCTCCAGGAGTACGCTGG	0.567																																					p.E100X		Atlas-SNP	.											.	FATE1	30	.	0			c.G298T						.						107.0	86.0	93.0					X																	150889930		2203	4300	6503	SO:0001587	stop_gained	89885	exon3			CTCCAGGAGTACG	AF249872	CCDS14700.1	Xq28	2009-03-25			ENSG00000147378	ENSG00000147378			24683	protein-coding gene	gene with protein product	"""cancer/testis antigen 43"""	300450				11694338	Standard	NM_033085		Approved	FATE, CT43	uc004fex.3	Q969F0	OTTHUMG00000024172	ENST00000370350.3:c.298G>T	chrX.hg19:g.150889930G>T	ENSP00000359375:p.Glu100*	248.0	0.0		224.0	37.0	NM_033085		Nonsense_Mutation	SNP	ENST00000370350.3	hg19	CCDS14700.1	.	.	.	.	.	.	.	.	.	.	G	15.65	2.895857	0.52121	.	.	ENSG00000147378	ENST00000370350	.	.	.	3.8	3.8	0.43715	.	0.510762	0.16569	N	0.208726	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	-4.6367	10.2153	0.43164	0.0:0.0:1.0:0.0	.	.	.	.	X	100	.	ENSP00000359375:E100X	E	+	1	0	FATE1	150640586	0.974000	0.33945	0.024000	0.17045	0.053000	0.15095	3.539000	0.53604	2.166000	0.68216	0.436000	0.28706	GAG	.	G|1.000;C|0.000		0.567	FATE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060885.1	NM_033085	
GABRQ	55879	hgsc.bcm.edu	37	X	151817747	151817747	+	Silent	SNP	G	G	A			TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chrX:151817747G>A	ENST00000370306.2	+	5	581	c.561G>A	c.(559-561)ctG>ctA	p.L187L		NM_018558.2	NP_061028.3	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) A receptor, theta	187					neurotransmitter transport (GO:0006836)|signal transduction (GO:0007165)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|neurotransmitter transporter activity (GO:0005326)|transmembrane signaling receptor activity (GO:0004888)	p.L187L(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(9)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	52	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CCCTGGATCTGCATAAATTCC	0.502																																					p.L187L		Atlas-SNP	.											.	GABRQ	131	.	1	Substitution - coding silent(1)	lung(1)	c.G561A						.						191.0	147.0	162.0					X																	151817747		2203	4300	6503	SO:0001819	synonymous_variant	55879	exon5			GGATCTGCATAAA	U47334	CCDS14707.1	Xq28	2012-06-22	2012-02-03		ENSG00000147402	ENSG00000268089		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	14454	protein-coding gene	gene with protein product	"""GABA(A) receptor, theta"""	300349	"""gamma-aminobutyric acid (GABA) receptor, theta"""			10804200, 10449790	Standard	NM_018558		Approved	THETA	uc004ffp.1	Q9UN88	OTTHUMG00000022649	ENST00000370306.2:c.561G>A	chrX.hg19:g.151817747G>A		134.0	0.0		108.0	18.0	NM_018558	A6NFN1|Q32MB4|Q9NZK8	Silent	SNP	ENST00000370306.2	hg19	CCDS14707.1																																																																																			.	.		0.502	GABRQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058763.2	NM_018558	
MUC2	4583	hgsc.bcm.edu	37	11	1092613	1092618	+	In_Frame_Del	DEL	AGCCCT	AGCCCT	-	rs201595190|rs201608750		TCGA-UB-AA0V-01A-11D-A382-10	TCGA-UB-AA0V-10A-01D-A385-10	AGCCCT	AGCCCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	68f1e904-8781-4297-b29d-d1307a32cccd	57fd105f-1165-48c1-bbee-848f6cd31d51	g.chr11:1092613_1092618delAGCCCT	ENST00000441003.2	+	30	4459_4464	c.4432_4437delAGCCCT	c.(4432-4437)agccctdel	p.SP1478del	MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_In_Frame_Del_p.SP1479del	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	4213	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	caccactcccagccctccaaccacca	0.636																																					p.1477_1479del		Atlas-INDEL	.											.	MUC2	614	.	0			c.4431_4436del						.																																			SO:0001651	inframe_deletion	4583	exon30			.	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4432_4437delAGCCCT	chr11.hg19:g.1092613_1092618delAGCCCT	ENSP00000415183:p.Ser1478_Pro1479del	83.0	0.0		86.0	10.0	NM_002457	Q14878	In_Frame_Del	DEL	ENST00000441003.2	hg19																																																																																				.	.		0.636	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
