#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PHF13	148479	hgsc.bcm.edu	37	1	6681657	6681657	+	Missense_Mutation	SNP	A	A	G			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr1:6681657A>G	ENST00000377648.4	+	4	1245	c.863A>G	c.(862-864)aAc>aGc	p.N288S	PHF13_ENST00000495385.1_Intron	NM_153812.2	NP_722519.2	Q86YI8	PHF13_HUMAN	PHD finger protein 13	288					chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(1)|lung(3)	7	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;1.46e-33)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.19e-07)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000501)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|STAD - Stomach adenocarcinoma(132;0.0165)|READ - Rectum adenocarcinoma(331;0.0642)		CGCCGTTCCAACCGCTCGCGG	0.587																																					p.N288S		Atlas-SNP	.											.	PHF13	24	.	0			c.A863G						.						49.0	47.0	47.0					1																	6681657		2203	4300	6503	SO:0001583	missense	148479	exon4			GTTCCAACCGCTC	AK027492	CCDS85.1	1p36.23	2013-01-28			ENSG00000116273	ENSG00000116273		"""Zinc fingers, PHD-type"""	22983	protein-coding gene	gene with protein product							Standard	NM_153812		Approved	MGC43399	uc001aob.4	Q86YI8	OTTHUMG00000001439	ENST00000377648.4:c.863A>G	chr1.hg19:g.6681657A>G	ENSP00000366876:p.Asn288Ser	156.0	0.0		110.0	6.0	NM_153812	B3KUQ7|Q59FB6|Q5TH65|Q8N551|Q9UJP2	Missense_Mutation	SNP	ENST00000377648.4	hg19	CCDS85.1	.	.	.	.	.	.	.	.	.	.	A	15.31	2.794796	0.50102	.	.	ENSG00000116273	ENST00000377648	T	0.46819	0.86	5.66	3.33	0.38152	Zinc finger, FYVE/PHD-type (1);	0.251869	0.45606	N	0.000345	T	0.30135	0.0755	N	0.24115	0.695	0.51482	D	0.999924	B	0.02656	0.0	B	0.04013	0.001	T	0.05099	-1.0906	10	0.27082	T	0.32	31.1691	8.5183	0.33259	0.8345:0.0:0.1655:0.0	.	288	Q86YI8	PHF13_HUMAN	S	288	ENSP00000366876:N288S	ENSP00000366876:N288S	N	+	2	0	PHF13	6604244	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.168000	0.58216	0.419000	0.25927	0.533000	0.62120	AAC	.	.		0.587	PHF13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004201.1	NM_153812	
FBXO2	26232	hgsc.bcm.edu	37	1	11710798	11710798	+	Missense_Mutation	SNP	T	T	G			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr1:11710798T>G	ENST00000354287.4	-	2	457	c.116A>C	c.(115-117)gAg>gCg	p.E39A	FBXO2_ENST00000475961.1_5'UTR	NM_012168.5	NP_036300.2	Q9UK22	FBX2_HUMAN	F-box protein 2	39					cellular protein modification process (GO:0006464)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|glycoprotein catabolic process (GO:0006516)|negative regulation of cell proliferation (GO:0008285)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of protein ubiquitination (GO:0031396)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	cytosol (GO:0005829)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|SCF ubiquitin ligase complex (GO:0019005)	beta-amyloid binding (GO:0001540)|carbohydrate binding (GO:0030246)|ubiquitin-protein transferase activity (GO:0004842)			kidney(1)|large_intestine(1)|lung(4)	6	Ovarian(185;0.249)	Lung NSC(185;9.37e-06)|all_lung(284;1.39e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|BRCA - Breast invasive adenocarcinoma(304;1.88e-06)|Colorectal(212;4.88e-06)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|Lung(427;0.0146)|LUSC - Lung squamous cell carcinoma(448;0.0228)|READ - Rectum adenocarcinoma(331;0.0649)		GGccgccgcctcctcctcctg	0.761																																					p.E39A		Atlas-SNP	.											FBXO2,NS,carcinoma,0,1	FBXO2	25	.	0			c.A116C						.						2.0	2.0	2.0					1																	11710798		1686	3300	4986	SO:0001583	missense	26232	exon2			GCCGCCTCCTCCT	AF174594	CCDS130.1	1p36.21	2010-04-21	2004-06-15		ENSG00000116661	ENSG00000116661		"""F-boxes /  ""other"""""	13581	protein-coding gene	gene with protein product		607112	"""F-box only protein 2"", ""organ of Corti protein 1"""	OCP1		10531035, 10531037	Standard	NM_012168		Approved	FBX2, Nfb42, Fbs1, Fbg1	uc001asj.3	Q9UK22	OTTHUMG00000002072	ENST00000354287.4:c.116A>C	chr1.hg19:g.11710798T>G	ENSP00000346240:p.Glu39Ala	25.0	0.0		16.0	2.0	NM_012168	B2R7K7|Q5TGY0|Q6FGJ7|Q8TB29|Q9UKC6	Missense_Mutation	SNP	ENST00000354287.4	hg19	CCDS130.1	.	.	.	.	.	.	.	.	.	.	T	7.272	0.607315	0.14002	.	.	ENSG00000116661	ENST00000354287;ENST00000452872	T	0.25579	1.79	4.36	-8.72	0.00845	F-box domain, Skp2-like (1);	0.961229	0.08522	N	0.933284	T	0.08670	0.0215	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.35450	-0.9788	10	0.14252	T	0.57	-18.8732	7.4313	0.27128	0.1044:0.0755:0.6098:0.2103	.	39;39	A6NNP0;Q9UK22	.;FBX2_HUMAN	A	39	ENSP00000346240:E39A	ENSP00000346240:E39A	E	-	2	0	FBXO2	11633385	0.000000	0.05858	0.000000	0.03702	0.077000	0.17291	-0.403000	0.07214	-1.473000	0.01881	0.454000	0.30748	GAG	.	.		0.761	FBXO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005764.1	NM_012168	
TNFRSF8	943	hgsc.bcm.edu	37	1	12169683	12169683	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr1:12169683C>T	ENST00000263932.2	+	5	704	c.482C>T	c.(481-483)gCc>gTc	p.A161V	TNFRSF8_ENST00000417814.2_Missense_Mutation_p.A50V	NM_001243.3|NM_001281430.1	NP_001234.2|NP_001268359.1	P28908	TNR8_HUMAN	tumor necrosis factor receptor superfamily, member 8	161					cellular response to mechanical stimulus (GO:0071260)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of TRAIL biosynthetic process (GO:0045556)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	27	Ovarian(185;0.249)	Lung NSC(185;8.71e-05)|all_lung(284;9.89e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	Brentuximab vedotin(DB08870)	CCTGCCTGTGCCAGCCCAGAG	0.637																																					p.A161V		Atlas-SNP	.											.	TNFRSF8	70	.	0			c.C482T						.						48.0	50.0	49.0					1																	12169683		2203	4300	6503	SO:0001583	missense	943	exon5			CCTGTGCCAGCCC	M83554	CCDS144.1, CCDS59989.1	1p36	2008-02-05			ENSG00000120949	ENSG00000120949		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11923	protein-coding gene	gene with protein product		153243		CD30, D1S166E		1330892, 1310894	Standard	XM_006711049		Approved	KI-1	uc001atq.3	P28908	OTTHUMG00000001827	ENST00000263932.2:c.482C>T	chr1.hg19:g.12169683C>T	ENSP00000263932:p.Ala161Val	85.0	0.0		68.0	4.0	NM_001243	B1AN79|B9EGD9|D3YTD8|Q6P4D9	Missense_Mutation	SNP	ENST00000263932.2	hg19	CCDS144.1	.	.	.	.	.	.	.	.	.	.	.	14.55	2.568433	0.45798	.	.	ENSG00000120949	ENST00000263932;ENST00000417814	T;T	0.08282	3.11;3.11	3.86	2.93	0.34026	.	1.566950	0.03490	N	0.216408	T	0.11537	0.0281	L	0.36672	1.1	0.21184	N	0.999767	P;B	0.38300	0.626;0.437	B;B	0.40782	0.34;0.115	T	0.36016	-0.9765	10	0.54805	T	0.06	-2.817	9.6714	0.40015	0.0:0.7892:0.2108:0.0	.	50;161	D3YTD8;P28908	.;TNR8_HUMAN	V	161;50	ENSP00000263932:A161V;ENSP00000390650:A50V	ENSP00000263932:A161V	A	+	2	0	TNFRSF8	12092270	0.006000	0.16342	0.473000	0.27253	0.159000	0.22180	0.332000	0.19751	1.158000	0.42547	0.563000	0.77884	GCC	.	.		0.637	TNFRSF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005130.1		
PADI2	11240	hgsc.bcm.edu	37	1	17410314	17410314	+	Silent	SNP	C	C	T	rs141844952		TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr1:17410314C>T	ENST00000375486.4	-	9	1020	c.957G>A	c.(955-957)ctG>ctA	p.L319L	PADI2_ENST00000466151.1_5'Flank|PADI2_ENST00000375481.1_Silent_p.L319L|PADI2_ENST00000444885.2_Silent_p.L203L	NM_007365.2	NP_031391.2	Q9Y2J8	PADI2_HUMAN	peptidyl arginine deiminase, type II	319					chromatin-mediated maintenance of transcription (GO:0048096)|histone H3-R26 citrullination (GO:0036413)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of lymphocyte chemotaxis (GO:1901624)|protein citrullination (GO:0018101)|regulation of chromatin disassembly (GO:0010848)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|transcriptionally active chromatin (GO:0035327)	calcium ion binding (GO:0005509)|estrogen receptor binding (GO:0030331)|protein-arginine deiminase activity (GO:0004668)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(12)|ovary(4)|pancreas(1)|skin(5)|urinary_tract(3)	29		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000422)|Renal(390;0.000518)|all_lung(284;0.000546)|Ovarian(437;0.00671)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;1.49e-05)|COAD - Colon adenocarcinoma(227;1.54e-05)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)	L-Citrulline(DB00155)	CTTTCAGGAACAGGTAATTAT	0.522																																					p.L319L		Atlas-SNP	.											.	PADI2	72	.	0			c.G957A						.	C		1,4405	2.1+/-5.4	0,1,2202	116.0	112.0	114.0		957	3.8	1.0	1	dbSNP_134	114	0,8600		0,0,4300	no	coding-synonymous	PADI2	NM_007365.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		319/666	17410314	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	11240	exon9			CAGGAACAGGTAA	AB030176	CCDS177.1	1p35.2-p35.1	2008-02-05			ENSG00000117115	ENSG00000117115	3.5.3.15	"""Peptidyl arginine deiminases"""	18341	protein-coding gene	gene with protein product		607935				2768262	Standard	NM_007365		Approved	KIAA0994, PDI2	uc001baf.3	Q9Y2J8	OTTHUMG00000002295	ENST00000375486.4:c.957G>A	chr1.hg19:g.17410314C>T		93.0	0.0		67.0	30.0	NM_007365	Q96DA7|Q9UPN2	Silent	SNP	ENST00000375486.4	hg19	CCDS177.1																																																																																			.	C|1.000;T|0.000		0.522	PADI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006624.1		
FAM110D	79927	hgsc.bcm.edu	37	1	26487902	26487902	+	Missense_Mutation	SNP	G	G	T			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr1:26487902G>T	ENST00000374268.3	+	2	307	c.120G>T	c.(118-120)gaG>gaT	p.E40D		NM_024869.2	NP_079145.2	Q8TAY7	F110D_HUMAN	family with sequence similarity 110, member D	40																	GGCGACAGGAGCCAGCCCTGC	0.701																																					p.E40D		Atlas-SNP	.											.	.	.	.	0			c.G120T						.						16.0	21.0	19.0					1																	26487902		2003	4161	6164	SO:0001583	missense	79927	exon2			ACAGGAGCCAGCC		CCDS41285.1	1p36.11	2011-12-01	2011-12-01	2011-12-01	ENSG00000197245	ENSG00000197245			25860	protein-coding gene	gene with protein product			"""glycine/arginine rich protein 1"""	GRRP1		12477932	Standard	NM_024869		Approved	FLJ14050	uc001blk.3	Q8TAY7	OTTHUMG00000007537	ENST00000374268.3:c.120G>T	chr1.hg19:g.26487902G>T	ENSP00000363386:p.Glu40Asp	149.0	0.0		92.0	33.0	NM_024869	A8K3V0|Q9H7Z4	Missense_Mutation	SNP	ENST00000374268.3	hg19	CCDS41285.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.017441	0.75161	.	.	ENSG00000197245	ENST00000374268	T	0.52983	0.64	4.95	3.04	0.35103	.	0.124706	0.52532	U	0.000064	T	0.57621	0.2066	M	0.62723	1.935	0.39180	D	0.962763	D	0.69078	0.997	P	0.62885	0.908	T	0.57435	-0.7812	10	0.28530	T	0.3	.	9.9245	0.41483	0.1717:0.0:0.8283:0.0	.	40	Q8TAY7	GRPP1_HUMAN	D	40	ENSP00000363386:E40D	ENSP00000363386:E40D	E	+	3	2	GRRP1	26360489	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	2.496000	0.45346	1.216000	0.43427	0.543000	0.68304	GAG	.	.		0.701	FAM110D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019841.1	NM_024869	
IPP	3652	hgsc.bcm.edu	37	1	46195357	46195357	+	Missense_Mutation	SNP	T	T	G			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr1:46195357T>G	ENST00000396478.3	-	4	911	c.809A>C	c.(808-810)aAg>aCg	p.K270T		NM_005897.2	NP_005888.1	Q9Y573	IPP_HUMAN	intracisternal A particle-promoted polypeptide	270						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	actin binding (GO:0003779)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|stomach(2)	20	Acute lymphoblastic leukemia(166;0.155)					ACTACAAAACTTGTTCTCTTT	0.368																																					p.K270T		Atlas-SNP	.											.	IPP	66	.	0			c.A809C						.						115.0	118.0	117.0					1																	46195357		2203	4300	6503	SO:0001583	missense	3652	exon4			CAAAACTTGTTCT	BC032544	CCDS30702.1, CCDS44132.1	1p34-p32	2013-01-30			ENSG00000197429	ENSG00000197429		"""Kelch-like"", ""BTB/POZ domain containing"""	6108	protein-coding gene	gene with protein product	"""kelch-like family member 27"""	147485				1905535, 8432546	Standard	NM_005897		Approved	KLHL27	uc001cou.3	Q9Y573	OTTHUMG00000008004	ENST00000396478.3:c.809A>C	chr1.hg19:g.46195357T>G	ENSP00000379739:p.Lys270Thr	294.0	0.0		247.0	52.0	NM_001145349	A2A6V4|D3DQ11|Q8N5C3	Missense_Mutation	SNP	ENST00000396478.3	hg19	CCDS30702.1	.	.	.	.	.	.	.	.	.	.	T	13.72	2.322093	0.41096	.	.	ENSG00000197429	ENST00000359942;ENST00000396478	T;T	0.74526	-0.67;-0.85	5.67	2.99	0.34606	.	0.193743	0.52532	D	0.000068	T	0.53706	0.1813	N	0.08118	0	0.50467	D	0.999871	B;B	0.28713	0.04;0.22	B;B	0.30495	0.066;0.116	T	0.55347	-0.8155	10	0.72032	D	0.01	.	9.1481	0.36946	0.0:0.0737:0.1264:0.7998	.	270;270	Q9Y573;A2A6V3	IPP_HUMAN;.	T	270	ENSP00000353024:K270T;ENSP00000379739:K270T	ENSP00000353024:K270T	K	-	2	0	IPP	45967944	1.000000	0.71417	0.995000	0.50966	0.669000	0.39330	4.668000	0.61568	0.965000	0.38133	0.459000	0.35465	AAG	.	.		0.368	IPP-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021974.3	NM_005897	
CA14	23632	hgsc.bcm.edu	37	1	150235583	150235583	+	Missense_Mutation	SNP	G	G	T			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr1:150235583G>T	ENST00000369111.4	+	7	1675	c.705G>T	c.(703-705)caG>caT	p.Q235H	snoU13_ENST00000458929.1_RNA	NM_012113.1	NP_036245.1	Q9ULX7	CAH14_HUMAN	carbonic anhydrase XIV	235					bicarbonate transport (GO:0015701)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbonate dehydratase activity (GO:0004089)|metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)	18	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)		Acetazolamide(DB00819)|Zonisamide(DB00909)	GAAGGTCCCAGATTTCAATGG	0.517																																					p.Q235H		Atlas-SNP	.											.	CA14	37	.	0			c.G705T						.						85.0	89.0	88.0					1																	150235583		2203	4300	6503	SO:0001583	missense	23632	exon7			GTCCCAGATTTCA	AB025904	CCDS947.1	1q21	2008-02-05			ENSG00000118298	ENSG00000118298		"""Carbonic anhydrases"""	1372	protein-coding gene	gene with protein product		604832				10512682	Standard	XM_005245059		Approved		uc001etx.3	Q9ULX7	OTTHUMG00000012549	ENST00000369111.4:c.705G>T	chr1.hg19:g.150235583G>T	ENSP00000358107:p.Gln235His	165.0	0.0		211.0	11.0	NM_012113	Q5TB24|Q8NCF4	Missense_Mutation	SNP	ENST00000369111.4	hg19	CCDS947.1	.	.	.	.	.	.	.	.	.	.	G	11.64	1.699784	0.30142	.	.	ENSG00000118298	ENST00000369111	T	0.67865	-0.29	5.65	3.73	0.42828	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.181255	0.50627	D	0.000107	T	0.64114	0.2569	L	0.46885	1.475	0.42869	D	0.994131	D	0.69078	0.997	P	0.61874	0.895	T	0.67515	-0.5651	10	0.62326	D	0.03	.	12.0904	0.53722	0.0724:0.1231:0.8045:0.0	.	235	Q9ULX7	CAH14_HUMAN	H	235	ENSP00000358107:Q235H	ENSP00000358107:Q235H	Q	+	3	2	CA14	148502207	1.000000	0.71417	1.000000	0.80357	0.099000	0.18886	0.766000	0.26560	0.459000	0.27016	-0.797000	0.03246	CAG	.	.		0.517	CA14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035064.2	NM_012113	
TADA1	117143	hgsc.bcm.edu	37	1	166826920	166826920	+	Missense_Mutation	SNP	C	C	G			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr1:166826920C>G	ENST00000367874.4	-	8	985	c.892G>C	c.(892-894)Gct>Cct	p.A298P	TADA1_ENST00000467021.1_5'UTR	NM_053053.3	NP_444281.1	Q96BN2	TADA1_HUMAN	transcriptional adaptor 1	298					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|STAGA complex (GO:0030914)	transcription coactivator activity (GO:0003713)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)	11						ATGTTAAGAGCATAGACAGTA	0.428																																					p.A298P		Atlas-SNP	.											.	TADA1	32	.	0			c.G892C						.						144.0	142.0	142.0					1																	166826920		2203	4300	6503	SO:0001583	missense	117143	exon8			TAAGAGCATAGAC	BC015401	CCDS1255.1	1q24.1	2009-10-02	2009-10-02	2009-10-02	ENSG00000152382	ENSG00000152382			30631	protein-coding gene	gene with protein product		612763	"""transcriptional adaptor 1 (HFI1 homolog, yeast)-like"", ""transcriptional adaptor 1 (HFI1 homolog, yeast)"""	TADA1L		11564863	Standard	NM_053053		Approved	STAF42, ADA1, hADA1, HFI1	uc001gdw.3	Q96BN2	OTTHUMG00000034321	ENST00000367874.4:c.892G>C	chr1.hg19:g.166826920C>G	ENSP00000356848:p.Ala298Pro	152.0	0.0		172.0	59.0	NM_053053	A8K4J9	Missense_Mutation	SNP	ENST00000367874.4	hg19	CCDS1255.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.803470	0.90623	.	.	ENSG00000152382	ENST00000367874	T	0.51817	0.69	4.53	4.53	0.55603	.	0.000000	0.85682	D	0.000000	T	0.56906	0.2017	M	0.65498	2.005	0.48087	D	0.999580	D	0.69078	0.997	D	0.63597	0.916	T	0.62525	-0.6836	9	0.66056	D	0.02	-8.9363	15.1518	0.72706	0.0:1.0:0.0:0.0	.	298	Q96BN2	TADA1_HUMAN	P	298	ENSP00000356848:A298P	ENSP00000356848:A298P	A	-	1	0	TADA1	165093544	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.182000	0.77689	2.486000	0.83907	0.655000	0.94253	GCT	.	.		0.428	TADA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082881.1	NM_053053	
HMCN1	83872	hgsc.bcm.edu	37	1	186047303	186047303	+	Silent	SNP	T	T	A			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr1:186047303T>A	ENST00000271588.4	+	55	8779	c.8550T>A	c.(8548-8550)gcT>gcA	p.A2850A	HMCN1_ENST00000367492.2_Silent_p.A2850A	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	2850	Ig-like C2-type 26.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CATGTGTGGCTGTGAATGAGG	0.398																																					p.A2850A		Atlas-SNP	.											.	HMCN1	797	.	0			c.T8550A						.						225.0	210.0	215.0					1																	186047303		2203	4300	6503	SO:0001819	synonymous_variant	83872	exon55			TGTGGCTGTGAAT	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.8550T>A	chr1.hg19:g.186047303T>A		179.0	0.0		214.0	32.0	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Silent	SNP	ENST00000271588.4	hg19	CCDS30956.1																																																																																			.	.		0.398	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
PGBD5	79605	hgsc.bcm.edu	37	1	230492809	230492809	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr1:230492809C>T	ENST00000525115.1	-	2	406	c.383G>A	c.(382-384)cGc>cAc	p.R128H	PGBD5_ENST00000321327.2_Missense_Mutation_p.R227H|PGBD5_ENST00000391860.1_Missense_Mutation_p.R82H			Q8N414	PGBD5_HUMAN	piggyBac transposable element derived 5	128						integral component of membrane (GO:0016021)				biliary_tract(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(2)|skin(1)	33	Breast(184;0.0397)	Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;0.201)		GGCGAGGCTGCGGTTGCTGTA	0.617																																					p.R197H		Atlas-SNP	.											PGBD5,rectum,carcinoma,-1,1	PGBD5	73	.	0			c.G590A						.						97.0	79.0	85.0					1																	230492809		2203	4300	6503	SO:0001583	missense	79605	exon2			AGGCTGCGGTTGC	AK021475		1q42.13	2008-02-05			ENSG00000177614	ENSG00000177614			19405	protein-coding gene	gene with protein product							Standard	NM_001258311		Approved	DKFZp761A0620, FLJ11413	uc031psq.1	Q8N414	OTTHUMG00000037759	ENST00000525115.1:c.383G>A	chr1.hg19:g.230492809C>T	ENSP00000431404:p.Arg128His	134.0	0.0		134.0	6.0	NM_001258311	A0PJF3|B9EK58|Q5SR37|Q6PJN2	Missense_Mutation	SNP	ENST00000525115.1	hg19		.	.	.	.	.	.	.	.	.	.	C	13.52	2.261577	0.39995	.	.	ENSG00000177614	ENST00000391860;ENST00000321327;ENST00000525115	T;T;T	0.17213	2.29;2.29;2.29	6.03	-0.976	0.10286	.	0.230823	0.43110	D	0.000606	T	0.06735	0.0172	N	0.11560	0.145	0.21897	N	0.999483	B	0.19706	0.038	B	0.12837	0.008	T	0.30238	-0.9985	10	0.29301	T	0.29	-24.9672	6.1131	0.20112	0.0:0.3787:0.1334:0.4879	.	128	Q8N414	PGBD5_HUMAN	H	82;227;128	ENSP00000375733:R82H;ENSP00000322530:R227H;ENSP00000431404:R128H	ENSP00000322530:R227H	R	-	2	0	PGBD5	228559432	0.020000	0.18652	0.181000	0.23098	0.929000	0.56500	0.340000	0.19892	-0.053000	0.13289	-0.880000	0.02959	CGC	.	.		0.617	PGBD5-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000382617.1	NM_024554	
LRPPRC	10128	hgsc.bcm.edu	37	2	44152227	44152227	+	Missense_Mutation	SNP	A	A	G			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr2:44152227A>G	ENST00000260665.7	-	27	2932	c.2875T>C	c.(2875-2877)Tac>Cac	p.Y959H		NM_133259.3	NP_573566.2	P42704	LPPRC_HUMAN	leucine-rich pentatricopeptide repeat containing	959					mitochondrion transport along microtubule (GO:0047497)|mRNA transport (GO:0051028)|negative regulation of mitochondrial RNA catabolic process (GO:0000961)|regulation of mitochondrial translation (GO:0070129)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|microtubule (GO:0005874)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(3)|endometrium(3)|kidney(5)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|skin(2)	41		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				AGCAGATTGTAGTACATCTGG	0.358																																					p.Y959H		Atlas-SNP	.											.	LRPPRC	105	.	0			c.T2875C						.						164.0	171.0	169.0					2																	44152227		2203	4300	6503	SO:0001583	missense	10128	exon27			GATTGTAGTACAT	M92439	CCDS33189.1	2p21	2012-02-24	2012-02-24		ENSG00000138095	ENSG00000138095			15714	protein-coding gene	gene with protein product		607544	"""Leigh syndrome, French-Canadian type (cytochrome oxidase deficiency)"""	LSFC		8012652, 8619474, 22045337	Standard	NM_133259		Approved	GP130, LRP130	uc002rtr.2	P42704	OTTHUMG00000152782	ENST00000260665.7:c.2875T>C	chr2.hg19:g.44152227A>G	ENSP00000260665:p.Tyr959His	95.0	0.0		63.0	13.0	NM_133259	A0PJE3|A8K1V1|Q53PC0|Q53QN7|Q6ZUD8|Q7Z7A6|Q96D84	Missense_Mutation	SNP	ENST00000260665.7	hg19	CCDS33189.1	.	.	.	.	.	.	.	.	.	.	A	14.33	2.503770	0.44558	.	.	ENSG00000138095	ENST00000465633;ENST00000260665	T	0.13089	2.62	5.72	5.72	0.89469	Tetratricopeptide-like helical (1);	0.244318	0.43110	D	0.000603	T	0.12987	0.0315	L	0.41824	1.3	0.80722	D	1	P;B	0.39443	0.674;0.221	B;B	0.36959	0.237;0.086	T	0.12268	-1.0554	10	0.17369	T	0.5	-3.5427	16.2988	0.82793	1.0:0.0:0.0:0.0	.	859;959	F5H4J6;P42704	.;LPPRC_HUMAN	H	859;959	ENSP00000260665:Y959H	ENSP00000260665:Y959H	Y	-	1	0	LRPPRC	44005731	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	5.259000	0.65485	2.311000	0.77944	0.533000	0.62120	TAC	.	.		0.358	LRPPRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327823.1	NM_133259	
ANTXR1	84168	hgsc.bcm.edu	37	2	69408989	69408989	+	Silent	SNP	C	C	T			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr2:69408989C>T	ENST00000303714.4	+	15	1483	c.1161C>T	c.(1159-1161)ggC>ggT	p.G387G	RNU6-1216P_ENST00000362590.2_RNA|RNA5SP96_ENST00000516041.1_RNA	NM_032208.2	NP_115584.1	Q9H6X2	ANTR1_HUMAN	anthrax toxin receptor 1	387					actin cytoskeleton reorganization (GO:0031532)|reproductive process (GO:0022414)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|integral component of membrane (GO:0016021)|lamellipodium membrane (GO:0031258)	actin filament binding (GO:0051015)|collagen binding (GO:0005518)|metal ion binding (GO:0046872)|transmembrane signaling receptor activity (GO:0004888)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(16)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	29						GTGGGAGAGGCGTTGGAGGCA	0.488									Familial Infantile Hemangioma																												p.G387G		Atlas-SNP	.											.	ANTXR1	128	.	0			c.C1161T						.						118.0	110.0	113.0					2																	69408989		2203	4300	6503	SO:0001819	synonymous_variant	84168	exon15	Familial Cancer Database	Infantile Capillary Hemangioma, HCI, Hereditary Capillary Hemangioma	GAGAGGCGTTGGA	AF421380	CCDS1892.1, CCDS46313.1, CCDS46314.1	2p13.1	2006-04-12			ENSG00000169604	ENSG00000169604			21014	protein-coding gene	gene with protein product	"""anthrax toxin receptor"", ""tumor endothelial marker 8 precursor"""	606410				10947988, 11559528	Standard	NM_032208		Approved	TEM8, FLJ21776, FLJ10601, ATR	uc002sfg.3	Q9H6X2	OTTHUMG00000129575	ENST00000303714.4:c.1161C>T	chr2.hg19:g.69408989C>T		154.0	0.0		96.0	23.0	NM_032208	A8K7U8|J7K7G4|J7KF88|Q4ZFV6|Q53QD8|Q96P02|Q9NVP3	Silent	SNP	ENST00000303714.4	hg19	CCDS1892.1																																																																																			.	.		0.488	ANTXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251770.2	NM_032208	
DPP4	1803	hgsc.bcm.edu	37	2	162894911	162894911	+	Missense_Mutation	SNP	T	T	C			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr2:162894911T>C	ENST00000360534.3	-	8	1074	c.514A>G	c.(514-516)Att>Gtt	p.I172V		NM_001935.3	NP_001926.2	P27487	DPP4_HUMAN	dipeptidyl-peptidase 4	172					cell adhesion (GO:0007155)|endothelial cell migration (GO:0043542)|negative regulation of extracellular matrix disassembly (GO:0010716)|positive regulation of cell proliferation (GO:0008284)|regulation of cell-cell adhesion mediated by integrin (GO:0033632)|response to hypoxia (GO:0001666)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercellular canaliculus (GO:0046581)|invadopodium membrane (GO:0071438)|lamellipodium (GO:0030027)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dipeptidyl-peptidase activity (GO:0008239)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(21)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	48					Alogliptin(DB06203)|Atorvastatin(DB01076)|Linagliptin(DB08882)|Liraglutide(DB06655)|Saxagliptin(DB06335)|Sitagliptin(DB01261)|Vildagliptin(DB04876)	TTAACATAAATGTCATTGTTC	0.303																																					p.I172V		Atlas-SNP	.											.	DPP4	90	.	0			c.A514G						.						61.0	60.0	60.0					2																	162894911		2201	4285	6486	SO:0001583	missense	1803	exon8			CATAAATGTCATT	M74777	CCDS2216.1	2q24.2	2013-09-19	2008-08-01		ENSG00000197635	ENSG00000197635	3.4.14.5	"""CD molecules"""	3009	protein-coding gene	gene with protein product		102720	"""dipeptidylpeptidase IV (CD26, adenosine deaminase complexing protein 2)"", ""adenosine deaminase complexing protein 2"""	CD26, ADCP2		8101391	Standard	NM_001935		Approved	DPPIV	uc002ubz.3	P27487	OTTHUMG00000132056	ENST00000360534.3:c.514A>G	chr2.hg19:g.162894911T>C	ENSP00000353731:p.Ile172Val	271.0	0.0		186.0	19.0	NM_001935	Q53TN1	Missense_Mutation	SNP	ENST00000360534.3	hg19	CCDS2216.1	.	.	.	.	.	.	.	.	.	.	T	13.54	2.267346	0.40095	.	.	ENSG00000197635	ENST00000360534	T	0.35421	1.31	6.03	-3.32	0.04973	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.613796	0.17661	N	0.166325	T	0.24084	0.0583	N	0.25992	0.78	0.47584	D	0.999464	B	0.09022	0.002	B	0.20577	0.03	T	0.06752	-1.0809	10	0.42905	T	0.14	-6.6896	14.2923	0.66286	0.0:0.4933:0.0:0.5067	.	172	P27487	DPP4_HUMAN	V	172	ENSP00000353731:I172V	ENSP00000353731:I172V	I	-	1	0	DPP4	162603157	0.147000	0.22687	0.985000	0.45067	0.992000	0.81027	-0.527000	0.06200	-0.374000	0.07967	0.455000	0.32223	ATT	.	.		0.303	DPP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255079.2		
ANKRD44	91526	hgsc.bcm.edu	37	2	197948233	197948233	+	Splice_Site	SNP	C	C	T			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr2:197948233C>T	ENST00000328737.2	-	14	1318	c.1242G>A	c.(1240-1242)agG>agA	p.R414R	ANKRD44_ENST00000337207.5_Splice_Site_p.R414R|ANKRD44_ENST00000282272.8_Splice_Site_p.R431R|ANKRD44_ENST00000477852.1_5'UTR|ANKRD44_ENST00000450567.1_Splice_Site_p.R414R|ANKRD44_ENST00000409153.1_Splice_Site_p.R439R|ANKRD44_ENST00000539527.1_Splice_Site_p.R367R			Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44	439										NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(20)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.246)			GCAAAGGGGTCCTGAAAAACA	0.468																																					p.R439R		Atlas-SNP	.											.	ANKRD44	281	.	0			c.G1317A						.						98.0	86.0	90.0					2																	197948233		2203	4300	6503	SO:0001630	splice_region_variant	91526	exon14			AGGGGTCCTGAAA	AK097086	CCDS33355.1, CCDS33355.2, CCDS74619.1	2q33.1	2013-01-10			ENSG00000065413	ENSG00000065413		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	25259	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit B"""						Standard	NM_153697		Approved	PP6-ARS-B	uc021vuj.1	Q8N8A2	OTTHUMG00000154411	ENST00000328737.2:c.1242-1G>A	chr2.hg19:g.197948233C>T		88.0	0.0		74.0	11.0	NM_001195144	Q53SL9|Q6P480|Q86VL5|Q8IZ72|Q9UFA4	Silent	SNP	ENST00000328737.2	hg19																																																																																				.	.		0.468	ANKRD44-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000335113.1	NM_153697	Silent
SIAH2	6478	hgsc.bcm.edu	37	3	150480232	150480232	+	Silent	SNP	C	C	T			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr3:150480232C>T	ENST00000312960.3	-	1	932	c.405G>A	c.(403-405)ctG>ctA	p.L135L	SIAH2_ENST00000472885.1_5'Flank|SIAH2-AS1_ENST00000461943.1_RNA	NM_005067.5	NP_005058.3	O43255	SIAH2_HUMAN	siah E3 ubiquitin protein ligase 2	135	SBD.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|cellular protein catabolic process (GO:0044257)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|regulation of protein ubiquitination (GO:0031396)|regulation of RNA biosynthetic process (GO:2001141)|small GTPase mediated signal transduction (GO:0007264)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	ligase activity (GO:0016874)|transcription corepressor activity (GO:0003714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|pancreas(1)	16			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			TACAGGGAAACAGGACTGCCG	0.667																																					p.L135L		Atlas-SNP	.											.	SIAH2	33	.	0			c.G405A						.						24.0	23.0	23.0					3																	150480232		2203	4300	6503	SO:0001819	synonymous_variant	6478	exon1			GGGAAACAGGACT	U76248	CCDS3152.1	3q25	2012-02-23	2012-02-23		ENSG00000181788	ENSG00000181788	6.3.2.1		10858	protein-coding gene	gene with protein product		602213	"""seven in absentia (Drosophila) homolog 2"", ""seven in absentia homolog 2 (Drosophila)"""			9334332	Standard	NM_005067		Approved		uc003eyi.3	O43255	OTTHUMG00000159847	ENST00000312960.3:c.405G>A	chr3.hg19:g.150480232C>T		94.0	0.0		52.0	23.0	NM_005067	O43270	Silent	SNP	ENST00000312960.3	hg19	CCDS3152.1																																																																																			.	.		0.667	SIAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357697.1	NM_005067	
ATP13A3	79572	hgsc.bcm.edu	37	3	194140666	194140666	+	Missense_Mutation	SNP	T	T	C			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr3:194140666T>C	ENST00000439040.1	-	31	4135	c.3344A>G	c.(3343-3345)tAt>tGt	p.Y1115C	ATP13A3_ENST00000256031.4_Missense_Mutation_p.Y1115C			Q9H7F0	AT133_HUMAN	ATPase type 13A3	1115						integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	24	all_cancers(143;6.01e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;3.83e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;5.98e-05)		tataaaaatatataaaaaaat	0.294																																					p.Y1115C		Atlas-SNP	.											.	ATP13A3	94	.	0			c.A3344G						.						24.0	24.0	24.0					3																	194140666		1775	4045	5820	SO:0001583	missense	79572	exon30			AAAATATATAAAA	AJ306929	CCDS43187.1	3q29	2010-04-20			ENSG00000133657	ENSG00000133657		"""ATPases / P-type"""	24113	protein-coding gene	gene with protein product	"""ATPase family homolog up regulated in senescence cells"""	610232				11867234	Standard	NM_024524		Approved	AFURS1	uc003fty.4	Q9H7F0	OTTHUMG00000156034	ENST00000439040.1:c.3344A>G	chr3.hg19:g.194140666T>C	ENSP00000416508:p.Tyr1115Cys	717.0	0.0		620.0	30.0	NM_024524	Q8NC11|Q96KS1	Missense_Mutation	SNP	ENST00000439040.1	hg19	CCDS43187.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.34|10.34	1.321999|1.321999	0.23994|0.23994	.|.	.|.	ENSG00000133657|ENSG00000133657	ENST00000429136|ENST00000439040;ENST00000256031	.|D;D	.|0.88896	.|-2.44;-2.44	5.63|5.63	3.16|3.16	0.36331|0.36331	.|.	.|0.062472	.|0.64402	.|D	.|0.000003	D|D	0.84817|0.84817	0.5556|0.5556	L|L	0.44542|0.44542	1.39|1.39	0.46774|0.46774	D|D	0.999192|0.999192	.|B	.|0.33073	.|0.396	.|B	.|0.39068	.|0.289	T|T	0.79293|0.79293	-0.1863|-0.1863	5|10	.|0.48119	.|T	.|0.1	-0.8404|-0.8404	8.1453|8.1453	0.31108|0.31108	0.1333:0.0:0.1397:0.7269|0.1333:0.0:0.1397:0.7269	.|.	.|1115	.|Q9H7F0	.|AT133_HUMAN	M|C	20|1115	.|ENSP00000416508:Y1115C;ENSP00000256031:Y1115C	.|ENSP00000256031:Y1115C	I|Y	-|-	3|2	3|0	ATP13A3|ATP13A3	195621955|195621955	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.312000|0.312000	0.27988|0.27988	3.153000|3.153000	0.50685|0.50685	0.374000|0.374000	0.24650|0.24650	0.528000|0.528000	0.53228|0.53228	ATA|TAT	.	.		0.294	ATP13A3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342799.2	NM_024524	
ALB	213	hgsc.bcm.edu	37	4	74280793	74280793	+	Missense_Mutation	SNP	T	T	C			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr4:74280793T>C	ENST00000503124.1	+	7	857	c.650T>C	c.(649-651)gTc>gCc	p.V217A	ALB_ENST00000295897.4_Missense_Mutation_p.V367A|ALB_ENST00000509063.1_Missense_Mutation_p.V367A|ALB_ENST00000415165.2_Missense_Mutation_p.V175A|ALB_ENST00000505649.1_3'UTR|ALB_ENST00000401494.3_Missense_Mutation_p.V252A			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GATTACTCTGTCGTGCTGCTG	0.393																																					p.V367A		Atlas-SNP	.											.	ALB	132	.	0			c.T1100C						.						152.0	150.0	150.0					4																	74280793		2203	4300	6503	SO:0001583	missense	213	exon9			ACTCTGTCGTGCT	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.650T>C	chr4.hg19:g.74280793T>C	ENSP00000421027:p.Val217Ala	132.0	0.0		80.0	34.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Missense_Mutation	SNP	ENST00000503124.1	hg19		.	.	.	.	.	.	.	.	.	.	T	3.922	-0.017930	0.07681	.	.	ENSG00000163631	ENST00000295897;ENST00000415165;ENST00000503124;ENST00000509063;ENST00000401494;ENST00000430202	T;T;T;T;T	0.72167	-0.63;-0.63;-0.63;-0.63;-0.63	5.84	-3.86	0.04230	Serum albumin-like (1);Serum albumin, N-terminal (3);	1.621470	0.03192	N	0.173403	T	0.64438	0.2598	L	0.39326	1.205	0.09310	N	1	B;B;B;B;B	0.20887	0.049;0.005;0.005;0.001;0.0	B;B;B;B;B	0.33521	0.165;0.017;0.025;0.017;0.01	T	0.57613	-0.7781	10	0.52906	T	0.07	-3.9051	7.6293	0.28230	0.1091:0.4242:0.0:0.4667	.	252;175;217;367;367	B7WNR0;C9JKR2;D6RHD5;A6NBZ8;P02768	.;.;.;.;ALBU_HUMAN	A	367;175;217;367;252;376	ENSP00000295897:V367A;ENSP00000401820:V175A;ENSP00000421027:V217A;ENSP00000422784:V367A;ENSP00000384695:V252A	ENSP00000295897:V367A	V	+	2	0	ALB	74499657	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.891000	0.04135	-0.563000	0.06078	-0.959000	0.02639	GTC	.	.		0.393	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477	
PDHA2	5161	hgsc.bcm.edu	37	4	96761441	96761441	+	Missense_Mutation	SNP	G	G	T			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr4:96761441G>T	ENST00000295266.4	+	1	203	c.140G>T	c.(139-141)gGt>gTt	p.G47V		NM_005390.4	NP_005381.1	P29803	ODPAT_HUMAN	pyruvate dehydrogenase (lipoamide) alpha 2	47					glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(23)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	46		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)		TTGGAAGAGGGTCCCCCTGTC	0.493																																					p.G47V		Atlas-SNP	.											.	PDHA2	118	.	0			c.G140T						.						61.0	60.0	60.0					4																	96761441		2203	4300	6503	SO:0001583	missense	5161	exon1			AAGAGGGTCCCCC		CCDS3644.1	4q22-q23	2009-11-09			ENSG00000163114	ENSG00000163114	1.2.4.1		8807	protein-coding gene	gene with protein product		179061		PDHAL			Standard	NM_005390		Approved		uc003htr.4	P29803	OTTHUMG00000130990	ENST00000295266.4:c.140G>T	chr4.hg19:g.96761441G>T	ENSP00000295266:p.Gly47Val	183.0	0.0		137.0	25.0	NM_005390	B2R9Q3|Q0VDI5|Q4VC02|Q6NXQ1	Missense_Mutation	SNP	ENST00000295266.4	hg19	CCDS3644.1	.	.	.	.	.	.	.	.	.	.	G	17.31	3.357804	0.61403	.	.	ENSG00000163114	ENST00000295266	D	0.97455	-4.39	4.64	3.79	0.43588	.	0.114328	0.64402	D	0.000019	D	0.97040	0.9033	M	0.86178	2.8	0.80722	D	1	D	0.56968	0.978	P	0.49252	0.604	D	0.96691	0.9511	10	0.87932	D	0	-7.6399	10.5765	0.45229	0.0974:0.0:0.9026:0.0	.	47	P29803	ODPAT_HUMAN	V	47	ENSP00000295266:G47V	ENSP00000295266:G47V	G	+	2	0	PDHA2	96980464	1.000000	0.71417	0.708000	0.30435	0.114000	0.19823	3.147000	0.50639	2.581000	0.87130	0.467000	0.42956	GGT	.	.		0.493	PDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253608.1		
CDKN2AIP	55602	hgsc.bcm.edu	37	4	184367702	184367702	+	Nonsense_Mutation	SNP	G	G	T			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr4:184367702G>T	ENST00000504169.1	+	3	1072	c.865G>T	c.(865-867)Gag>Tag	p.E289*	CDKN2AIP_ENST00000506835.1_3'UTR|CDKN2AIP_ENST00000302350.4_3'UTR	NM_017632.2	NP_060102.1	Q9NXV6	CARF_HUMAN	CDKN2A interacting protein	289	Ser-rich.				negative regulation of cell growth (GO:0030308)|positive regulation of signal transduction (GO:0009967)|regulation of protein stability (GO:0031647)	cytoplasm (GO:0005737)|granular component (GO:0001652)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	p53 binding (GO:0002039)|RNA binding (GO:0003723)			endometrium(1)|kidney(2)|large_intestine(2)|lung(1)	6		all_lung(41;6.9e-12)|Lung NSC(41;1.28e-11)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;1.15e-26)|Epithelial(43;2.98e-22)|OV - Ovarian serous cystadenocarcinoma(60;7.64e-10)|GBM - Glioblastoma multiforme(59;4.22e-06)|Colorectal(24;5.87e-06)|STAD - Stomach adenocarcinoma(60;2.09e-05)|COAD - Colon adenocarcinoma(29;5.15e-05)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)		CTCAGAGATCGAGGTGCCCTT	0.473																																					p.E289X		Atlas-SNP	.											.	CDKN2AIP	31	.	0			c.G865T						.						61.0	60.0	60.0					4																	184367702		2203	4300	6503	SO:0001587	stop_gained	55602	exon3			GAGATCGAGGTGC	AK000043	CCDS34110.1	4q35.1	2008-02-05			ENSG00000168564	ENSG00000168564			24325	protein-coding gene	gene with protein product	"""collaborates/cooperates with ARF (alternate reading frame) protein"""	615914				12154087, 16803988	Standard	NM_017632		Approved	FLJ20036, CARF	uc003ivp.1	Q9NXV6	OTTHUMG00000160626	ENST00000504169.1:c.865G>T	chr4.hg19:g.184367702G>T	ENSP00000427108:p.Glu289*	172.0	0.0		159.0	39.0	NM_017632	Q8TBM5|Q9NYH0	Nonsense_Mutation	SNP	ENST00000504169.1	hg19	CCDS34110.1	.	.	.	.	.	.	.	.	.	.	G	32	5.173377	0.94807	.	.	ENSG00000168564	ENST00000504169	.	.	.	5.55	4.69	0.59074	.	0.224065	0.31472	N	0.007594	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	-3.1462	13.9202	0.63926	0.0:0.1825:0.8175:0.0	.	.	.	.	X	289	.	ENSP00000427108:E289X	E	+	1	0	CDKN2AIP	184604696	0.244000	0.23889	0.907000	0.35723	0.748000	0.42578	1.034000	0.30204	1.582000	0.49881	0.655000	0.94253	GAG	.	.		0.473	CDKN2AIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361488.1	NM_017632	
ANKRD55	79722	hgsc.bcm.edu	37	5	55422893	55422893	+	Missense_Mutation	SNP	T	T	G			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr5:55422893T>G	ENST00000341048.4	-	8	804	c.653A>C	c.(652-654)cAc>cCc	p.H218P	RNU6-299P_ENST00000517223.1_RNA|ANKRD55_ENST00000504958.2_Missense_Mutation_p.H175P|ANKRD55_ENST00000505970.2_Intron	NM_024669.2	NP_078945.2	Q3KP44	ANR55_HUMAN	ankyrin repeat domain 55	218										breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(1)	34		Lung NSC(810;8.69e-05)|Prostate(74;0.00634)|Breast(144;0.0334)|Ovarian(174;0.223)				CGGCCCCTGGTGATGGCTCAG	0.468																																					p.H218P		Atlas-SNP	.											.	ANKRD55	70	.	0			c.A653C						.						104.0	101.0	102.0					5																	55422893		2203	4300	6503	SO:0001583	missense	79722	exon8			CCCTGGTGATGGC	AK021857	CCDS34161.1	5q11.2	2013-01-10			ENSG00000164512	ENSG00000164512		"""Ankyrin repeat domain containing"""	25681	protein-coding gene	gene with protein product		615189					Standard	XM_005248599		Approved	FLJ11795	uc003jqu.3	Q3KP44	OTTHUMG00000162305	ENST00000341048.4:c.653A>C	chr5.hg19:g.55422893T>G	ENSP00000342295:p.His218Pro	150.0	0.0		187.0	57.0	NM_024669	B3KVT8|Q3KP45|Q9HAD3	Missense_Mutation	SNP	ENST00000341048.4	hg19	CCDS34161.1	.	.	.	.	.	.	.	.	.	.	T	11.35	1.613934	0.28712	.	.	ENSG00000164512	ENST00000507283;ENST00000341048;ENST00000504958	T;T	0.52526	2.44;0.66	5.62	1.76	0.24704	.	0.565396	0.18369	N	0.143301	T	0.30417	0.0764	L	0.29908	0.895	0.09310	N	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.15009	-1.0452	10	0.39692	T	0.17	.	5.6323	0.17518	0.0:0.2:0.2783:0.5217	.	218	B3KVT8	.	P	218;218;175	ENSP00000342295:H218P;ENSP00000424230:H175P	ENSP00000342295:H218P	H	-	2	0	ANKRD55	55458650	1.000000	0.71417	0.909000	0.35828	0.799000	0.45148	1.024000	0.30077	0.428000	0.26173	0.460000	0.39030	CAC	.	.		0.468	ANKRD55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368510.4	NM_024669	
DOCK2	1794	hgsc.bcm.edu	37	5	169507279	169507280	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr5:169507279_169507280CC>AA	ENST00000256935.8	+	50	5359_5360	c.5279_5280CC>AA	c.(5278-5280)aCC>aAA	p.T1760K	DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000520908.1_Missense_Mutation_p.T1252K|DOCK2_ENST00000540750.1_Missense_Mutation_p.T821K	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1760					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TCCATGCCTACCATCCCAGGTA	0.574																																					p.T1760N|p.T1760T		Atlas-SNP	.											.	DOCK2	389	.	0			c.C5279A|c.C5280A						.																																			SO:0001583	missense	1794	exon50			TGCCTACCATCCC|GCCTACCATCCCA	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	Exception_encountered	chr5.hg19:g.169507279_169507280delinsAA	ENSP00000256935:p.Thr1760Lys	78.0|77.0	0.0		91.0|90.0	26.0|27.0	NM_004946	Q2M3I0|Q96AK7	Missense_Mutation|Silent	SNP	ENST00000256935.8	hg19	CCDS4371.1																																																																																			.	.		0.574	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	
PKHD1	5314	hgsc.bcm.edu	37	6	51910977	51910977	+	Missense_Mutation	SNP	A	A	G			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr6:51910977A>G	ENST00000371117.3	-	24	2692	c.2417T>C	c.(2416-2418)gTa>gCa	p.V806A	PKHD1_ENST00000340994.4_Missense_Mutation_p.V806A	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	806					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					AGAAATTTGTACAGGGACATC	0.418																																					p.V806A		Atlas-SNP	.											.	PKHD1	927	.	0			c.T2417C						.						175.0	160.0	165.0					6																	51910977		2203	4300	6503	SO:0001583	missense	5314	exon24			ATTTGTACAGGGA	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.2417T>C	chr6.hg19:g.51910977A>G	ENSP00000360158:p.Val806Ala	151.0	0.0		105.0	11.0	NM_170724	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	hg19	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	A	12.46	1.945864	0.34377	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.87029	-2.01;-2.2	5.74	4.58	0.56647	.	0.079049	0.52532	N	0.000068	D	0.82508	0.5052	L	0.50333	1.59	0.30216	N	0.797228	D;D	0.67145	0.986;0.996	P;P	0.61070	0.775;0.883	T	0.75513	-0.3291	10	0.18710	T	0.47	.	9.6843	0.40089	0.9182:0.0:0.0818:0.0	.	806;806	P08F94-2;P08F94	.;PKHD1_HUMAN	A	806	ENSP00000360158:V806A;ENSP00000341097:V806A	ENSP00000341097:V806A	V	-	2	0	PKHD1	52018936	0.998000	0.40836	0.728000	0.30774	0.083000	0.17756	3.868000	0.56055	1.014000	0.39417	0.459000	0.35465	GTA	.	.		0.418	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
COL12A1	1303	hgsc.bcm.edu	37	6	75847218	75847218	+	Missense_Mutation	SNP	T	T	C			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr6:75847218T>C	ENST00000322507.8	-	31	5638	c.5329A>G	c.(5329-5331)Agt>Ggt	p.S1777G	COL12A1_ENST00000345356.6_Missense_Mutation_p.S613G|COL12A1_ENST00000483888.2_Missense_Mutation_p.S1777G|COL12A1_ENST00000416123.2_Missense_Mutation_p.S1777G	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	1777	Fibronectin type-III 13. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						ACACGACCACTAGCAGGATCC	0.398																																					p.S1777G		Atlas-SNP	.											.	COL12A1	385	.	0			c.A5329G						.						82.0	78.0	79.0					6																	75847218		1889	4108	5997	SO:0001583	missense	1303	exon31			GACCACTAGCAGG	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.5329A>G	chr6.hg19:g.75847218T>C	ENSP00000325146:p.Ser1777Gly	125.0	0.0		99.0	33.0	NM_004370	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	ENST00000322507.8	hg19	CCDS43482.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	9.404|9.404	1.078749|1.078749	0.20227|0.20227	.|.	.|.	ENSG00000111799|ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000345356;ENST00000416123;ENST00000483888|ENST00000419671	T;T;T;T|.	0.55760|.	0.5;0.5;0.5;0.5|.	5.31|5.31	4.15|4.15	0.48705|0.48705	Fibronectin, type III (4);Immunoglobulin-like fold (1);|.	0.133460|.	0.52532|.	D|.	0.000062|.	T|.	0.40222|.	0.1108|.	M|M	0.69358|0.69358	2.11|2.11	0.30327|0.30327	N|N	0.786996|0.786996	B;P|.	0.43431|.	0.003;0.807|.	B;B|.	0.41510|.	0.002;0.359|.	T|.	0.31475|.	-0.9942|.	10|.	0.32370|.	T|.	0.25|.	.|.	11.2307|11.2307	0.48910|0.48910	0.0:0.0723:0.0:0.9277|0.0:0.0723:0.0:0.9277	.|.	613;1777|.	Q99715-2;Q99715|.	.;COCA1_HUMAN|.	G|W	1777;1777;613;1777;1777|511	ENSP00000325146:S1777G;ENSP00000305147:S613G;ENSP00000412864:S1777G;ENSP00000421216:S1777G|.	ENSP00000325146:S1777G|.	S|X	-|-	1|2	0|0	COL12A1|COL12A1	75903938|75903938	0.998000|0.998000	0.40836|0.40836	1.000000|1.000000	0.80357|0.80357	0.424000|0.424000	0.31475|0.31475	4.008000|4.008000	0.57103|0.57103	0.960000|0.960000	0.38005|0.38005	-0.353000|-0.353000	0.07706|0.07706	AGT|TAG	.	.		0.398	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
PRDM13	59336	hgsc.bcm.edu	37	6	100057092	100057092	+	Missense_Mutation	SNP	G	G	T			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr6:100057092G>T	ENST00000369215.4	+	3	611	c.306G>T	c.(304-306)caG>caT	p.Q102H		NM_021620.3	NP_067633.2	Q9H4Q3	PRD13_HUMAN	PR domain containing 13	102	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurogenesis (GO:0022008)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(9)|prostate(1)	17		all_cancers(76;1.64e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0128)|Colorectal(196;0.069)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.0598)		GAGACGTCCAGCCAGGGGAGG	0.507																																					p.Q102H		Atlas-SNP	.											.	PRDM13	65	.	0			c.G306T						.						58.0	64.0	62.0					6																	100057092		2101	4232	6333	SO:0001583	missense	59336	exon3			CGTCCAGCCAGGG	AY004253	CCDS43487.1	6q16.2	2012-03-28			ENSG00000112238	ENSG00000112238			13998	protein-coding gene	gene with protein product							Standard	NM_021620		Approved		uc003pqg.1	Q9H4Q3	OTTHUMG00000015269	ENST00000369215.4:c.306G>T	chr6.hg19:g.100057092G>T	ENSP00000358217:p.Gln102His	114.0	0.0		99.0	37.0	NM_021620	Q5TGC1|Q5TGC2	Missense_Mutation	SNP	ENST00000369215.4	hg19	CCDS43487.1	.	.	.	.	.	.	.	.	.	.	G	15.43	2.831009	0.50845	.	.	ENSG00000112238	ENST00000369215;ENST00000369214	D;D	0.86030	-2.06;-2.06	5.51	4.64	0.57946	SET domain (2);	0.000000	0.37095	N	0.002247	D	0.85344	0.5675	L	0.43152	1.355	0.36210	D	0.851305	D	0.67145	0.996	P	0.61800	0.894	D	0.87446	0.2398	10	0.87932	D	0	-28.6127	14.3412	0.66627	0.0736:0.0:0.9264:0.0	.	102	Q9H4Q3	PRD13_HUMAN	H	102;112	ENSP00000358217:Q102H;ENSP00000358216:Q112H	ENSP00000358216:Q112H	Q	+	3	2	PRDM13	100163813	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.650000	0.46665	2.620000	0.88729	0.456000	0.33151	CAG	.	.		0.507	PRDM13-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041619.2		
PCLO	27445	hgsc.bcm.edu	37	7	82545902	82545902	+	Silent	SNP	G	G	A			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr7:82545902G>A	ENST00000333891.9	-	7	11737	c.11400C>T	c.(11398-11400)taC>taT	p.Y3800Y	PCLO_ENST00000423517.2_Silent_p.Y3800Y|PCLO_ENST00000437081.1_Silent_p.Y520Y	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						CCATTTCCAGGTATCGTAGCT	0.443																																					p.Y3800Y		Atlas-SNP	.											PCLO_ENST00000333891,right_upper_lobe,carcinoma,0,2	PCLO	1506	.	0			c.C11400T						.						175.0	155.0	162.0					7																	82545902		1896	4127	6023	SO:0001819	synonymous_variant	27445	exon7			TTCCAGGTATCGT	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.11400C>T	chr7.hg19:g.82545902G>A		144.0	0.0		129.0	9.0	NM_014510		Silent	SNP	ENST00000333891.9	hg19	CCDS47630.1																																																																																			.	.		0.443	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
DPP6	1804	hgsc.bcm.edu	37	7	154667719	154667719	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr7:154667719C>T	ENST00000377770.3	+	20	2128	c.1987C>T	c.(1987-1989)Cgt>Tgt	p.R663C	DPP6_ENST00000427557.1_Missense_Mutation_p.R556C|DPP6_ENST00000332007.3_Missense_Mutation_p.R601C|DPP6_ENST00000404039.1_Missense_Mutation_p.R599C			P42658	DPP6_HUMAN	dipeptidyl-peptidase 6	663					cell death (GO:0008219)|neuronal action potential (GO:0019228)|positive regulation of potassium ion transmembrane transport (GO:1901381)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(3)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(35)|pancreas(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	71	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			GTGTGACGGCCGTGGCAGCGG	0.657																																					p.R663C	NSCLC(125;1384 1783 2490 7422 34254)	Atlas-SNP	.											.	DPP6	383	.	0			c.C1987T						.						26.0	33.0	30.0					7																	154667719		2046	4179	6225	SO:0001583	missense	1804	exon20			GACGGCCGTGGCA	M96859	CCDS75682.1, CCDS75683.1, CCDS75684.1	7q36.2	2006-08-07	2006-01-12		ENSG00000130226	ENSG00000130226			3010	protein-coding gene	gene with protein product		126141	"""dipeptidylpeptidase VI"", ""dipeptidylpeptidase 6"""			1729689	Standard	XM_006715871		Approved	DPPX	uc003wlk.3	P42658	OTTHUMG00000151511	ENST00000377770.3:c.1987C>T	chr7.hg19:g.154667719C>T	ENSP00000367001:p.Arg663Cys	106.0	0.0		94.0	16.0	NM_130797		Missense_Mutation	SNP	ENST00000377770.3	hg19		.	.	.	.	.	.	.	.	.	.	C	20.7	4.035684	0.75617	.	.	ENSG00000130226	ENST00000404039;ENST00000377770;ENST00000332007;ENST00000427557	T;T;T;T	0.61040	0.14;0.14;0.14;0.14	4.92	4.92	0.64577	Peptidase S9, prolyl oligopeptidase, catalytic domain (1);	0.057468	0.64402	D	0.000001	D	0.82609	0.5074	M	0.94101	3.495	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.995;0.997;0.997	D	0.87920	0.2703	10	0.87932	D	0	-10.5253	18.0911	0.89476	0.0:1.0:0.0:0.0	.	556;601;663;599	E9PDL2;P42658-2;P42658;E9PF59	.;.;DPP6_HUMAN;.	C	599;663;601;556	ENSP00000385578:R599C;ENSP00000367001:R663C;ENSP00000328226:R601C;ENSP00000397303:R556C	ENSP00000328226:R601C	R	+	1	0	DPP6	154298652	1.000000	0.71417	0.996000	0.52242	0.622000	0.37654	3.714000	0.54889	2.246000	0.74042	0.430000	0.28490	CGT	.	.		0.657	DPP6-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000322932.1	NM_130797	
ANGPT1	284	hgsc.bcm.edu	37	8	108315574	108315574	+	Missense_Mutation	SNP	C	C	A			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr8:108315574C>A	ENST00000520734.1	-	4	515	c.230G>T	c.(229-231)aGa>aTa	p.R77I	ANGPT1_ENST00000520052.1_Missense_Mutation_p.R76I|ANGPT1_ENST00000518386.1_Intron			Q15389	ANGP1_HUMAN	angiopoietin 1	277					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cell-substrate adhesion (GO:0031589)|glomerulus vasculature development (GO:0072012)|hemopoiesis (GO:0030097)|heparin biosynthetic process (GO:0030210)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of vascular permeability (GO:0043116)|positive chemotaxis (GO:0050918)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of receptor internalization (GO:0002092)|protein localization to cell surface (GO:0034394)|regulation of satellite cell proliferation (GO:0014842)|sprouting angiogenesis (GO:0002040)|Tie signaling pathway (GO:0048014)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(13)|ovary(4)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	43	Breast(1;5.06e-08)		OV - Ovarian serous cystadenocarcinoma(57;5.53e-09)			CTCTTCCTCTCTTTTTCCTCC	0.318																																					p.R277I		Atlas-SNP	.											.	ANGPT1	111	.	0			c.G830T						.						87.0	97.0	94.0					8																	108315574		2202	4300	6502	SO:0001583	missense	284	exon5			TCCTCTCTTTTTC	D13628	CCDS6306.1, CCDS56551.1	8q23.1	2013-02-06			ENSG00000154188	ENSG00000154188		"""Fibrinogen C domain containing"""	484	protein-coding gene	gene with protein product		601667				9545648	Standard	NM_001146		Approved	KIAA0003, Ang1	uc003ymn.3	Q15389	OTTHUMG00000164812	ENST00000520734.1:c.230G>T	chr8.hg19:g.108315574C>A	ENSP00000430750:p.Arg77Ile	99.0	0.0		141.0	8.0	NM_001146	Q5HYA0	Missense_Mutation	SNP	ENST00000520734.1	hg19		.	.	.	.	.	.	.	.	.	.	C	12.91	2.080763	0.36758	.	.	ENSG00000154188	ENST00000517746;ENST00000297450;ENST00000395820;ENST00000520734;ENST00000520052	T;T;T;T	0.55413	0.52;0.93;0.56;0.55	4.45	1.55	0.23275	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (1);	0.547716	0.21379	N	0.075514	T	0.40067	0.1102	L	0.44542	1.39	0.39218	D	0.963449	B;B;B	0.06786	0.0;0.001;0.001	B;B;B	0.04013	0.001;0.001;0.001	T	0.18366	-1.0339	10	0.40728	T	0.16	.	7.5852	0.27989	0.0:0.4198:0.0:0.5802	.	76;277;277	E7ERK4;Q5HYA0;Q15389	.;.;ANGP1_HUMAN	I	277;276;89;77;76	ENSP00000428340:R277I;ENSP00000297450:R276I;ENSP00000430750:R77I;ENSP00000429349:R76I	ENSP00000297450:R276I	R	-	2	0	ANGPT1	108384750	0.954000	0.32549	1.000000	0.80357	0.999000	0.98932	0.007000	0.13174	0.107000	0.17824	0.650000	0.86243	AGA	.	.		0.318	ANGPT1-002	PUTATIVE	alternative_5_UTR|basic	protein_coding	protein_coding	OTTHUMT00000380428.2	NM_001146, NM_139290	
COL22A1	169044	hgsc.bcm.edu	37	8	139601631	139601631	+	Silent	SNP	G	G	A			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr8:139601631G>A	ENST00000303045.6	-	65	5192	c.4746C>T	c.(4744-4746)ggC>ggT	p.G1582G	COL22A1_ENST00000341807.4_5'UTR|COL22A1_ENST00000435777.1_Silent_p.G1562G	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1582	Collagen-like 16.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CCCCTTGAGGGCCAGGGATCC	0.602										HNSCC(7;0.00092)																											p.G1582G		Atlas-SNP	.											.	COL22A1	390	.	0			c.C4746T						.						53.0	46.0	48.0					8																	139601631		2203	4300	6503	SO:0001819	synonymous_variant	169044	exon65			TTGAGGGCCAGGG	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.4746C>T	chr8.hg19:g.139601631G>A		233.0	0.0		338.0	33.0	NM_152888	B7ZMH0|C9K0G4|Q8IVT9	Silent	SNP	ENST00000303045.6	hg19	CCDS6376.1																																																																																			.	.		0.602	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257	
TOPORS	10210	hgsc.bcm.edu	37	9	32543499	32543499	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr9:32543499G>A	ENST00000360538.2	-	3	1140	c.1024C>T	c.(1024-1026)Cca>Tca	p.P342S	TOPORS_ENST00000379858.1_Missense_Mutation_p.P277S	NM_005802.4	NP_005793.2	Q9NS56	TOPRS_HUMAN	topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase	342	Required for DNA-binding.				cellular response to DNA damage stimulus (GO:0006974)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of apoptotic process (GO:0043066)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein localization to nucleus (GO:0034504)|protein monoubiquitination (GO:0006513)|protein sumoylation (GO:0016925)|regulation of cell proliferation (GO:0042127)|retina layer formation (GO:0010842)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|gamma-tubulin complex (GO:0000930)|midbody (GO:0030496)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|PML body (GO:0016605)|spindle pole (GO:0000922)|ubiquitin ligase complex (GO:0000151)	antigen binding (GO:0003823)|DNA binding (GO:0003677)|DNA topoisomerase binding (GO:0044547)|SUMO ligase activity (GO:0019789)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.0018)		AGTAAAAATGGTCTTAAATCA	0.373																																					p.P342S		Atlas-SNP	.											.	TOPORS	127	.	0			c.C1024T						.						55.0	55.0	55.0					9																	32543499		2202	4300	6502	SO:0001583	missense	10210	exon3			AAAATGGTCTTAA	AF098300	CCDS6527.1, CCDS56566.1	9p21	2013-01-09	2010-09-17		ENSG00000197579	ENSG00000197579		"""RING-type (C3HC4) zinc fingers"""	21653	protein-coding gene	gene with protein product		609507	"""retinitis pigmentosa 31 (autosomal dominant)"", ""topoisomerase I binding, arginine/serine-rich"""	RP31		10352183, 12083797, 17924349	Standard	NM_005802		Approved	TP53BPL, LUN	uc003zrb.3	Q9NS56	OTTHUMG00000019743	ENST00000360538.2:c.1024C>T	chr9.hg19:g.32543499G>A	ENSP00000353735:p.Pro342Ser	68.0	0.0		69.0	15.0	NM_005802	O43273|Q6P987|Q9NS55|Q9UNR9	Missense_Mutation	SNP	ENST00000360538.2	hg19	CCDS6527.1	.	.	.	.	.	.	.	.	.	.	G	10.46	1.355316	0.24512	.	.	ENSG00000197579	ENST00000360538;ENST00000379858	T;T	0.18810	2.19;2.21	5.93	5.93	0.95920	.	0.000000	0.49916	D	0.000125	T	0.29524	0.0736	L	0.54323	1.7	0.58432	D	0.999993	D	0.62365	0.991	P	0.50192	0.634	T	0.00577	-1.1662	10	0.41790	T	0.15	-32.9389	13.1153	0.59297	0.0766:0.0:0.9234:0.0	.	342	Q9NS56	TOPRS_HUMAN	S	342;277	ENSP00000353735:P342S;ENSP00000369187:P277S	ENSP00000353735:P342S	P	-	1	0	TOPORS	32533499	1.000000	0.71417	1.000000	0.80357	0.417000	0.31264	7.623000	0.83113	2.805000	0.96524	0.655000	0.94253	CCA	.	.		0.373	TOPORS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052007.1	NM_005802	
TRPM3	80036	hgsc.bcm.edu	37	9	73213415	73213415	+	Missense_Mutation	SNP	T	T	A			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr9:73213415T>A	ENST00000377111.2	-	20	3175	c.2932A>T	c.(2932-2934)Att>Ttt	p.I978F	TRPM3_ENST00000408909.2_Missense_Mutation_p.I837F|TRPM3_ENST00000377110.3_Missense_Mutation_p.I978F|TRPM3_ENST00000377105.1_Missense_Mutation_p.I837F|TRPM3_ENST00000357533.2_Missense_Mutation_p.I982F|TRPM3_ENST00000377106.1_Missense_Mutation_p.I850F|TRPM3_ENST00000396285.1_Missense_Mutation_p.I825F|TRPM3_ENST00000423814.3_Missense_Mutation_p.I1005F|TRPM3_ENST00000360823.2_Missense_Mutation_p.I840F|TRPM3_ENST00000396292.4_Missense_Mutation_p.I850F|TRPM3_ENST00000358082.3_Missense_Mutation_p.I840F|TRPM3_ENST00000396280.5_Missense_Mutation_p.I827F	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	1003					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						TACCAGTAAATGATGTTCACG	0.478																																					p.I978F		Atlas-SNP	.											.	TRPM3	700	.	0			c.A2932T						.						137.0	129.0	132.0					9																	73213415		2203	4300	6503	SO:0001583	missense	80036	exon20			AGTAAATGATGTT	AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.2932A>T	chr9.hg19:g.73213415T>A	ENSP00000366315:p.Ile978Phe	179.0	0.0		183.0	29.0	NM_001007471	A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Missense_Mutation	SNP	ENST00000377111.2	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.33|17.33	3.361424|3.361424	0.61403|0.61403	.|.	.|.	ENSG00000083067|ENSG00000083067	ENST00000396280|ENST00000377111;ENST00000377110;ENST00000377106;ENST00000360823;ENST00000377105;ENST00000357533;ENST00000408909;ENST00000396285;ENST00000396292;ENST00000358082;ENST00000423814	.|T;T;T;T;T;T;T;T;T;T;T	.|0.74737	.|-0.87;-0.87;-0.87;-0.87;-0.87;-0.87;-0.87;-0.87;-0.87;-0.87;-0.87	4.87|4.87	3.7|3.7	0.42460|0.42460	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.85026|0.85026	0.5603|0.5603	M|M	0.80422|0.80422	2.495|2.495	0.46927|0.46927	D|D	0.999253|0.999253	.|D;B;D;D;B;P;P;B	.|0.76494	.|0.963;0.169;0.999;0.97;0.027;0.884;0.95;0.001	.|P;B;D;P;B;P;P;B	.|0.87578	.|0.723;0.227;0.998;0.819;0.174;0.8;0.712;0.018	D|D	0.85462|0.85462	0.1167|0.1167	5|10	.|0.72032	.|D	.|0.01	-13.6893|-13.6893	11.0597|11.0597	0.47940|0.47940	0.1393:0.0:0.0:0.8607|0.1393:0.0:0.0:0.8607	.|.	.|978;978;968;982;840;837;950;825	.|Q9HCF6-2;Q9HCF6-10;Q9HCF6-4;A2A3F7;A2A3F4;G5E9G1;Q9HCF6-8;A2A3F3	.|.;.;.;.;.;.;.;.	L|F	826|978;978;850;840;837;982;837;825;850;840;1005	.|ENSP00000366315:I978F;ENSP00000366314:I978F;ENSP00000366310:I850F;ENSP00000354066:I840F;ENSP00000366309:I837F;ENSP00000350140:I982F;ENSP00000386127:I837F;ENSP00000379581:I825F;ENSP00000379587:I850F;ENSP00000350791:I840F;ENSP00000389542:I1005F	.|ENSP00000350140:I982F	H|I	-|-	2|1	0|0	TRPM3|TRPM3	72403235|72403235	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.984000|0.984000	0.73092|0.73092	8.031000|8.031000	0.88826|0.88826	0.780000|0.780000	0.33566|0.33566	0.467000|0.467000	0.42956|0.42956	CAT|ATT	.	.		0.478	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000214157.5	NM_206945	
TRIM32	22954	hgsc.bcm.edu	37	9	119460448	119460448	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr9:119460448G>A	ENST00000450136.1	+	2	588	c.427G>A	c.(427-429)Gag>Aag	p.E143K	ASTN2_ENST00000361209.2_Intron|ASTN2_ENST00000361477.3_Intron|ASTN2_ENST00000313400.4_Intron|ASTN2_ENST00000373996.3_Intron|TRIM32_ENST00000373983.2_Missense_Mutation_p.E143K	NM_001099679.1|NM_012210.3	NP_001093149.1|NP_036342.2	Q13049	TRI32_HUMAN	tripartite motif containing 32	143					fat cell differentiation (GO:0045444)|innate immune response (GO:0045087)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell motility (GO:2000147)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neurogenesis (GO:0050769)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of proteolysis (GO:0045862)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of type I interferon production (GO:0032481)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of type I interferon production (GO:0032479)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|striated muscle myosin thick filament (GO:0005863)	ligase activity (GO:0016874)|myosin binding (GO:0017022)|protein self-association (GO:0043621)|RNA binding (GO:0003723)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|translation initiation factor binding (GO:0031369)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(5)|liver(1)|lung(6)|prostate(1)|skin(2)|urinary_tract(1)	26						AGAAGCAGCTGAGGAGCGGCG	0.592																																					p.E143K	Esophageal Squamous(92;212 1916 19711 26951)	Atlas-SNP	.											.	TRIM32	67	.	0			c.G427A						.						49.0	56.0	53.0					9																	119460448		2202	4299	6501	SO:0001583	missense	22954	exon2			GCAGCTGAGGAGC	U18543	CCDS6817.1	9q33.1	2014-09-17	2011-01-25		ENSG00000119401	ENSG00000119401		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16380	protein-coding gene	gene with protein product		602290	"""limb girdle muscular dystrophy 2H (autosomal recessive)"", ""tripartite motif-containing 32"""	LGMD2H		11331580, 7778269, 16606853	Standard	NM_001099679		Approved	HT2A, TATIP, BBS11	uc004bjx.2	Q13049	OTTHUMG00000021026	ENST00000450136.1:c.427G>A	chr9.hg19:g.119460448G>A	ENSP00000408292:p.Glu143Lys	110.0	0.0		106.0	50.0	NM_012210	Q9NQP8	Missense_Mutation	SNP	ENST00000450136.1	hg19	CCDS6817.1	.	.	.	.	.	.	.	.	.	.	G	15.06	2.719889	0.48728	.	.	ENSG00000119401	ENST00000450136;ENST00000373983;ENST00000411410	T;T;T	0.65178	-0.14;-0.14;0.4	5.36	5.36	0.76844	.	0.140662	0.45867	D	0.000331	T	0.45597	0.1350	L	0.27053	0.805	0.47994	D	0.999568	B	0.31318	0.319	B	0.24701	0.055	T	0.40040	-0.9584	9	.	.	.	-20.3697	12.4378	0.55608	0.0767:0.0:0.9233:0.0	.	143	Q13049	TRI32_HUMAN	K	143	ENSP00000408292:E143K;ENSP00000363095:E143K;ENSP00000412603:E143K	.	E	+	1	0	TRIM32	118500269	1.000000	0.71417	0.981000	0.43875	0.952000	0.60782	7.630000	0.83225	2.486000	0.83907	0.655000	0.94253	GAG	.	.		0.592	TRIM32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055466.2	NM_012210	
ATRNL1	26033	hgsc.bcm.edu	37	10	117278802	117278802	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr10:117278802G>A	ENST00000355044.3	+	25	3810	c.3684G>A	c.(3682-3684)atG>atA	p.M1228I	ATRNL1_ENST00000423111.2_Missense_Mutation_p.M279I|ATRNL1_ENST00000303745.7_Missense_Mutation_p.M21I	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	1228					G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		ATACAATCATGGACCTTGTGC	0.328																																					p.M1228I		Atlas-SNP	.											.	ATRNL1	219	.	0			c.G3684A						.						140.0	133.0	135.0					10																	117278802		2202	4300	6502	SO:0001583	missense	26033	exon25			AATCATGGACCTT	AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.3684G>A	chr10.hg19:g.117278802G>A	ENSP00000347152:p.Met1228Ile	102.0	0.0		96.0	42.0	NM_207303	O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Missense_Mutation	SNP	ENST00000355044.3	hg19	CCDS7592.1	.	.	.	.	.	.	.	.	.	.	G	16.69	3.192783	0.58017	.	.	ENSG00000107518	ENST00000355044;ENST00000423111;ENST00000303745	T;T;T	0.44881	0.91;0.91;0.91	5.98	5.98	0.97165	.	0.034093	0.85682	D	0.000000	T	0.25901	0.0631	N	0.05306	-0.075	0.41861	D	0.990225	B;B	0.12013	0.005;0.001	B;B	0.11329	0.006;0.002	T	0.07751	-1.0756	10	0.28530	T	0.3	-15.5861	17.3533	0.87329	0.0:0.0:1.0:0.0	.	279;1228	B4DH41;Q5VV63	.;ATRN1_HUMAN	I	1228;279;21	ENSP00000347152:M1228I;ENSP00000409624:M279I;ENSP00000307660:M21I	ENSP00000307660:M21I	M	+	3	0	ATRNL1	117268792	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.537000	0.82033	2.843000	0.97960	0.585000	0.79938	ATG	.	.		0.328	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050507.3	XM_049349	
FOXI2	399823	hgsc.bcm.edu	37	10	129537185	129537185	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr10:129537185C>T	ENST00000388920.4	+	2	952	c.913C>T	c.(913-915)Cgc>Tgc	p.R305C		NM_207426.2	NP_997309.2	Q6ZQN5	FOXI2_HUMAN	forkhead box I2	305					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R305G(1)|p.R121G(1)		large_intestine(1)|lung(3)	4		all_epithelial(44;0.0021)|all_lung(145;0.0586)|Lung NSC(174;0.0765)|all_neural(114;0.201)|Glioma(114;0.222)				CGCCGGCTTCCGCCTCAGTCA	0.697																																					p.R305C	Esophageal Squamous(54;1038 1280 2528 31583)	Atlas-SNP	.											FOXI2_ENST00000388920,NS,carcinoma,0,2	FOXI2	35	.	2	Substitution - Missense(2)	lung(2)	c.C913T						.						9.0	13.0	12.0					10																	129537185		2153	4242	6395	SO:0001583	missense	399823	exon2			GGCTTCCGCCTCA	AK128865	CCDS7655.2	10q26.2	2008-04-10			ENSG00000186766	ENSG00000186766		"""Forkhead boxes"""	32448	protein-coding gene	gene with protein product							Standard	NM_207426		Approved	FLJ46831	uc009yas.2	Q6ZQN5	OTTHUMG00000019250	ENST00000388920.4:c.913C>T	chr10.hg19:g.129537185C>T	ENSP00000373572:p.Arg305Cys	63.0	0.0		72.0	6.0	NM_207426		Missense_Mutation	SNP	ENST00000388920.4	hg19	CCDS7655.2	.	.	.	.	.	.	.	.	.	.	C	11.67	1.707772	0.30322	.	.	ENSG00000186766	ENST00000388920	D	0.93133	-3.17	4.14	2.06	0.26882	.	0.117488	0.52532	D	0.000074	D	0.86506	0.5949	L	0.32530	0.975	0.31787	N	0.630135	D	0.61697	0.99	B	0.43809	0.432	D	0.85324	0.1086	10	0.87932	D	0	.	2.4968	0.04623	0.2033:0.5074:0.1818:0.1075	.	305	Q6ZQN5	FOXI2_HUMAN	C	305	ENSP00000373572:R305C	ENSP00000373572:R305C	R	+	1	0	FOXI2	129427175	0.658000	0.27402	0.951000	0.38953	0.499000	0.33736	0.440000	0.21592	0.883000	0.36040	0.555000	0.69702	CGC	.	.		0.697	FOXI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050984.2	NM_207426	
MUC6	4588	hgsc.bcm.edu	37	11	1031883	1031883	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr11:1031883G>A	ENST00000421673.2	-	3	336	c.286C>T	c.(286-288)Cgg>Tgg	p.R96W		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	96	VWFD 1. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		ACGATGATCCGCGAGATGCTC	0.657																																					p.R96W		Atlas-SNP	.											.	MUC6	408	.	0			c.C286T						.						53.0	59.0	57.0					11																	1031883		2132	4223	6355	SO:0001583	missense	4588	exon3			TGATCCGCGAGAT	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.286C>T	chr11.hg19:g.1031883G>A	ENSP00000406861:p.Arg96Trp	63.0	0.0		73.0	9.0	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	hg19	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	G	9.224	1.034049	0.19590	.	.	ENSG00000184956	ENST00000421673;ENST00000525923	T;T	0.59772	0.24;0.24	4.03	0.176	0.15049	von Willebrand factor, type D domain (3);	0.000000	0.28555	U	0.014939	T	0.72463	0.3463	M	0.78344	2.41	0.09310	N	1	D	0.89917	1.0	D	0.87578	0.998	T	0.65344	-0.6191	10	0.62326	D	0.03	.	12.1996	0.54317	0.0:0.0:0.4457:0.5543	.	96	Q6W4X9	MUC6_HUMAN	W	96;120	ENSP00000406861:R96W;ENSP00000433790:R120W	ENSP00000406861:R96W	R	-	1	2	MUC6	1021883	0.024000	0.19004	0.043000	0.18650	0.036000	0.12997	1.104000	0.31074	0.282000	0.22254	-0.360000	0.07572	CGG	.	.		0.657	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
MUC5B	727897	hgsc.bcm.edu	37	11	1251007	1251007	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr11:1251007G>A	ENST00000529681.1	+	10	1248	c.1190G>A	c.(1189-1191)gGc>gAc	p.G397D	MUC5B_ENST00000447027.1_Missense_Mutation_p.G400D	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	397					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		TACAGCCCGGGCACCTCCTTC	0.677																																					p.G397D		Atlas-SNP	.											.	MUC5B	473	.	0			c.G1190A						.						17.0	21.0	20.0					11																	1251007		2113	4204	6317	SO:0001583	missense	727897	exon10			GCCCGGGCACCTC	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.1190G>A	chr11.hg19:g.1251007G>A	ENSP00000436812:p.Gly397Asp	41.0	0.0		45.0	14.0	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	hg19	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	G	11.87	1.767852	0.31320	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.27890	1.64;1.89	3.82	3.82	0.43975	VWC out (1);	.	.	.	.	T	0.64538	0.2607	M	0.92507	3.315	0.49915	D	0.999837	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	T	0.76597	-0.2901	9	0.87932	D	0	.	15.9105	0.79470	0.0:0.0:1.0:0.0	.	397;1056;400	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	D	397;400;398;433	ENSP00000436812:G397D;ENSP00000415793:G400D	ENSP00000343037:G398D	G	+	2	0	MUC5B	1207583	1.000000	0.71417	0.147000	0.22382	0.293000	0.27360	6.443000	0.73447	1.972000	0.57404	0.313000	0.20887	GGC	.	.		0.677	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
TCIRG1	10312	hgsc.bcm.edu	37	11	67815394	67815394	+	Silent	SNP	C	C	T			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr11:67815394C>T	ENST00000265686.3	+	13	1617	c.1509C>T	c.(1507-1509)aaC>aaT	p.N503N	TCIRG1_ENST00000532635.1_Silent_p.N287N|RP11-802E16.3_ENST00000529934.1_RNA	NM_006019.3	NP_006010.2	Q13488	VPP3_HUMAN	T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3	503					ATP hydrolysis coupled proton transport (GO:0015991)|cellular defense response (GO:0006968)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of cell proliferation (GO:0008284)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	hydrogen ion transmembrane transporter activity (GO:0015078)|transporter activity (GO:0005215)			breast(1)|endometrium(4)|large_intestine(3)|lung(4)|ovary(3)|prostate(1)	16						TGGATCCCAACGTCACCGGTG	0.662																																					p.N503N		Atlas-SNP	.											.	TCIRG1	40	.	0			c.C1509T						.						123.0	101.0	109.0					11																	67815394		2200	4294	6494	SO:0001819	synonymous_variant	10312	exon13			TCCCAACGTCACC	AF025374	CCDS8177.1, CCDS53670.1	11q13.2	2014-09-17	2006-01-20		ENSG00000110719	ENSG00000110719		"""ATPases / V-type"""	11647	protein-coding gene	gene with protein product	"""T-cell immune response cDNA 7"""	604592	"""T-cell, immune regulator 1"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein a isoform 3"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3"""			8579597, 9806637	Standard	NM_006019		Approved	TIRC7, OC-116, OC116, ATP6N1C, Atp6i, a3, ATP6V0A3	uc001one.3	Q13488	OTTHUMG00000167358	ENST00000265686.3:c.1509C>T	chr11.hg19:g.67815394C>T		140.0	0.0		118.0	36.0	NM_006019	O75877|Q8WVC5	Silent	SNP	ENST00000265686.3	hg19	CCDS8177.1																																																																																			.	.		0.662	TCIRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394305.1	NM_006019	
CCDC60	160777	hgsc.bcm.edu	37	12	119978493	119978493	+	Silent	SNP	C	C	T			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr12:119978493C>T	ENST00000327554.2	+	14	2091	c.1626C>T	c.(1624-1626)ccC>ccT	p.P542P	RP11-768F21.1_ENST00000509470.2_lincRNA	NM_178499.3	NP_848594.2	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60	542										endometrium(4)|kidney(3)|large_intestine(8)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		TCAACATACCCATTGGGCCCT	0.532																																					p.P542P		Atlas-SNP	.											.	CCDC60	84	.	0			c.C1626T						.						112.0	104.0	106.0					12																	119978493		2203	4300	6503	SO:0001819	synonymous_variant	160777	exon14			CATACCCATTGGG	BC040553	CCDS9190.1	12q24.23	2006-02-03			ENSG00000183273	ENSG00000183273			28610	protein-coding gene	gene with protein product						12477932	Standard	NM_178499		Approved	MGC39827	uc001txe.3	Q8IWA6	OTTHUMG00000168943	ENST00000327554.2:c.1626C>T	chr12.hg19:g.119978493C>T		72.0	0.0		57.0	18.0	NM_178499		Silent	SNP	ENST00000327554.2	hg19	CCDS9190.1																																																																																			.	.		0.532	CCDC60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401680.1	NM_178499	
COG3	83548	hgsc.bcm.edu	37	13	46085912	46085912	+	Missense_Mutation	SNP	C	C	A			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr13:46085912C>A	ENST00000349995.5	+	16	1844	c.1732C>A	c.(1732-1734)Caa>Aaa	p.Q578K	COG3_ENST00000465942.1_3'UTR	NM_031431.3	NP_113619	Q96JB2	COG3_HUMAN	component of oligomeric golgi complex 3	578					ER to Golgi vesicle-mediated transport (GO:0006888)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|protein glycosylation (GO:0006486)|protein localization to organelle (GO:0033365)|protein stabilization (GO:0050821)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|skin(2)|stomach(1)	24		Lung NSC(96;0.000145)|Breast(56;0.000596)|Prostate(109;0.00438)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000124)		GGCAGTGTTCCAAGGATTATC	0.398																																					p.Q578K	Ovarian(150;1048 1859 18083 21577 42700)	Atlas-SNP	.											.	COG3	52	.	0			c.C1732A						.						118.0	106.0	110.0					13																	46085912		2203	4300	6503	SO:0001583	missense	83548	exon16			GTGTTCCAAGGAT	AF131829	CCDS9398.1	13q14.11	2008-02-05			ENSG00000136152	ENSG00000136152		"""Components of oligomeric golgi complex"""	18619	protein-coding gene	gene with protein product		606975				11980916	Standard	NM_031431		Approved	SEC34	uc001vak.3	Q96JB2	OTTHUMG00000016855	ENST00000349995.5:c.1732C>A	chr13.hg19:g.46085912C>A	ENSP00000258654:p.Gln578Lys	82.0	0.0		83.0	9.0	NM_031431	B2RAW5|Q5VT70|Q8IXX4|Q9BZ92	Missense_Mutation	SNP	ENST00000349995.5	hg19	CCDS9398.1	.	.	.	.	.	.	.	.	.	.	C	19.92	3.916668	0.73098	.	.	ENSG00000136152	ENST00000349995	T	0.41065	1.01	5.41	5.41	0.78517	.	0.059460	0.64402	D	0.000001	T	0.49029	0.1533	M	0.77820	2.39	0.80722	D	1	B;B	0.22909	0.077;0.045	B;B	0.25614	0.062;0.042	T	0.44097	-0.9350	10	0.35671	T	0.21	-11.8392	18.3612	0.90375	0.0:1.0:0.0:0.0	.	415;578	B4E2F3;Q96JB2	.;COG3_HUMAN	K	578	ENSP00000258654:Q578K	ENSP00000258654:Q578K	Q	+	1	0	COG3	44983913	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.601000	0.67606	2.814000	0.96858	0.591000	0.81541	CAA	.	.		0.398	COG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044777.2		
FAM179B	23116	hgsc.bcm.edu	37	14	45496671	45496671	+	Silent	SNP	A	A	G			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr14:45496671A>G	ENST00000361577.3	+	9	3712	c.3498A>G	c.(3496-3498)gaA>gaG	p.E1166E	FAM179B_ENST00000382233.2_3'UTR|KLHL28_ENST00000553817.1_Intron|FAM179B_ENST00000361462.2_Silent_p.E1166E	NM_015091.2	NP_055906.2	Q9Y4F4	F179B_HUMAN	family with sequence similarity 179, member B	1166										endometrium(4)|kidney(5)|large_intestine(12)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	45						TTGAGAATGAAAAAGATGTAA	0.303																																					p.E1166E		Atlas-SNP	.											.	FAM179B	115	.	0			c.A3498G						.						42.0	43.0	43.0					14																	45496671		2203	4300	6503	SO:0001819	synonymous_variant	23116	exon9			GAATGAAAAAGAT	AB007883	CCDS9681.1	14q21.3	2008-07-21	2008-07-21	2008-07-21	ENSG00000198718	ENSG00000198718			19959	protein-coding gene	gene with protein product			"""KIAA0423"""	KIAA0423			Standard	XM_005267451		Approved		uc001wvv.3	Q9Y4F4	OTTHUMG00000140264	ENST00000361577.3:c.3498A>G	chr14.hg19:g.45496671A>G		210.0	0.0		167.0	39.0	NM_015091	Q68D66|Q6PG27	Silent	SNP	ENST00000361577.3	hg19	CCDS9681.1																																																																																			.	.		0.303	FAM179B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276791.1	XM_113781	
ZFP36L1	677	hgsc.bcm.edu	37	14	69256295	69256295	+	Silent	SNP	T	T	G			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr14:69256295T>G	ENST00000439696.2	-	2	1273	c.972A>C	c.(970-972)tcA>tcC	p.S324S	ZFP36L1_ENST00000336440.3_Silent_p.S324S|ZFP36L1_ENST00000555997.1_3'UTR	NM_001244701.1|NM_004926.3	NP_001231630.1|NP_004917.2	Q07352	TISB_HUMAN	ZFP36 ring finger protein-like 1	324					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|T cell differentiation in thymus (GO:0033077)|vasculogenesis (GO:0001570)	cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|kidney(1)|large_intestine(1)|liver(2)|lung(9)|ovary(1)|prostate(2)|urinary_tract(1)	21				all cancers(60;0.00203)|BRCA - Breast invasive adenocarcinoma(234;0.00205)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		GCAGGCGTCTTGAGTTGTCCA	0.612											OREG0022753	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S393S		Atlas-SNP	.											.	ZFP36L1	47	.	0			c.A1179C						.						93.0	95.0	95.0					14																	69256295		2203	4300	6503	SO:0001819	synonymous_variant	677	exon3			GCGTCTTGAGTTG	X79066	CCDS9791.1	14q22-q24	2012-11-27	2012-11-27	2001-11-23		ENSG00000185650		"""RING-type (C3HC4) zinc fingers"""	1107	protein-coding gene	gene with protein product		601064	"""zinc finger protein, C3H type, 36-like 1"", ""zinc finger protein 36, C3H type-like 1"""	BRF1		8024689	Standard	NM_004926		Approved	RNF162B, Berg36, ERF1, TIS11B, cMG1	uc021rve.1	Q07352		ENST00000439696.2:c.972A>C	chr14.hg19:g.69256295T>G		105.0	0.0	1113	73.0	11.0	NM_001244701	Q13851	Silent	SNP	ENST00000439696.2	hg19	CCDS9791.1																																																																																			.	.		0.612	ZFP36L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413227.1		
GABRA5	2558	hgsc.bcm.edu	37	15	27193200	27193200	+	Silent	SNP	C	C	A			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr15:27193200C>A	ENST00000335625.5	+	11	2097	c.1209C>A	c.(1207-1209)gtC>gtA	p.V403V	GABRA5_ENST00000400081.3_Silent_p.V403V|GABRA5_ENST00000355395.5_Silent_p.V403V	NM_000810.3	NP_000801.1	P31644	GBRA5_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 5	403					associative learning (GO:0008306)|behavioral fear response (GO:0001662)|brain development (GO:0007420)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(1)|upper_aerodigestive_tract(1)	49		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zopiclone(DB01198)	CAACCTCAGTCTCAGTAAAAC	0.428																																					p.V403V		Atlas-SNP	.											.	GABRA5	127	.	0			c.C1209A						.						48.0	46.0	46.0					15																	27193200		1853	4099	5952	SO:0001819	synonymous_variant	2558	exon11			CTCAGTCTCAGTA		CCDS45194.1	15q12	2012-06-22			ENSG00000186297	ENSG00000186297		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4079	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 5"""	137142				1321750	Standard	NM_000810		Approved		uc021sgi.1	P31644	OTTHUMG00000171824	ENST00000335625.5:c.1209C>A	chr15.hg19:g.27193200C>A		395.0	0.0		427.0	180.0	NM_001165037	A8K338|Q14DC2|Q53XL6|Q9NYT3|Q9NYT4|Q9NYT5	Silent	SNP	ENST00000335625.5	hg19	CCDS45194.1																																																																																			.	.		0.428	GABRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415234.1		
PARP6	56965	hgsc.bcm.edu	37	15	72541642	72541642	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr15:72541642G>A	ENST00000569795.1	-	20	2192	c.1505C>T	c.(1504-1506)gCc>gTc	p.A502V	PARP6_ENST00000260376.7_Intron|PARP6_ENST00000413097.2_Intron|PARP6_ENST00000287196.9_Missense_Mutation_p.A502V			Q2NL67	PARP6_HUMAN	poly (ADP-ribose) polymerase family, member 6	502	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.						NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(8)|skin(1)|urinary_tract(1)	18						TTTGCCATAGGCTGCTCCATG	0.493																																					p.A502V		Atlas-SNP	.											.	PARP6	44	.	0			c.C1505T						.						85.0	86.0	86.0					15																	72541642		1939	4130	6069	SO:0001583	missense	56965	exon19			CCATAGGCTGCTC	AL390093	CCDS10241.2	15q22	2010-02-16			ENSG00000137817	ENSG00000137817		"""Poly (ADP-ribose) polymerases"""	26921	protein-coding gene	gene with protein product						15273990	Standard	XM_005254557		Approved	pART17	uc002auc.3	Q2NL67	OTTHUMG00000133443	ENST00000569795.1:c.1505C>T	chr15.hg19:g.72541642G>A	ENSP00000456348:p.Ala502Val	58.0	0.0		70.0	31.0	NM_020214	Q9H7C5|Q9H9X6|Q9HAF3|Q9NPS6|Q9UFG4	Missense_Mutation	SNP	ENST00000569795.1	hg19	CCDS10241.2	.	.	.	.	.	.	.	.	.	.	G	26.1	4.704153	0.88924	.	.	ENSG00000137817	ENST00000419739;ENST00000287196	T;T	0.13089	2.62;2.62	4.93	4.93	0.64822	Poly(ADP-ribose) polymerase, catalytic domain (2);	0.000000	0.64402	U	0.000002	T	0.28200	0.0696	L	0.39514	1.22	0.80722	D	1	P;D;D	0.69078	0.94;0.997;0.995	P;D;P	0.74348	0.842;0.983;0.893	T	0.00662	-1.1621	10	0.26408	T	0.33	-31.6893	17.6582	0.88184	0.0:0.0:1.0:0.0	.	503;502;435	Q0VDG0;Q2NL67;A0PJ50	.;PARP6_HUMAN;.	V	503;502	ENSP00000403265:A503V;ENSP00000287196:A502V	ENSP00000287196:A502V	A	-	2	0	PARP6	70328696	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.645000	0.83430	2.719000	0.93026	0.655000	0.94253	GCC	.	.		0.493	PARP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257315.2	NM_020214	
BAIAP3	8938	hgsc.bcm.edu	37	16	1396324	1396324	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr16:1396324C>T	ENST00000324385.5	+	25	2718	c.2560C>T	c.(2560-2562)Cgg>Tgg	p.R854W	BAIAP3_ENST00000397488.2_Missense_Mutation_p.R836W|BAIAP3_ENST00000564213.1_3'UTR|BAIAP3_ENST00000426824.3_Missense_Mutation_p.R819W|BAIAP3_ENST00000562208.1_Missense_Mutation_p.R796W|BAIAP3_ENST00000421665.2_Missense_Mutation_p.R783W|BAIAP3_ENST00000397489.1_Missense_Mutation_p.R836W|BAIAP3_ENST00000568887.1_Missense_Mutation_p.R791W	NM_003933.4	NP_003924.2	O94812	BAIP3_HUMAN	BAI1-associated protein 3	854					G-protein coupled receptor signaling pathway (GO:0007186)|neurotransmitter secretion (GO:0007269)		protein C-terminus binding (GO:0008022)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(25)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42		Hepatocellular(780;0.0893)				TGATCTGCAACGGGAGGCCCA	0.701																																					p.R854W		Atlas-SNP	.											.	BAIAP3	88	.	0			c.C2560T						.						37.0	39.0	38.0					16																	1396324		2195	4297	6492	SO:0001583	missense	8938	exon25			CTGCAACGGGAGG	AB017111	CCDS10434.1, CCDS55978.1, CCDS55979.1, CCDS58402.1, CCDS58403.1, CCDS66894.1	16p13.3	2008-07-04			ENSG00000007516	ENSG00000007516			948	protein-coding gene	gene with protein product		604009				9790924	Standard	NM_003933		Approved	BAP3, KIAA0734	uc002clk.2	O94812	OTTHUMG00000047833	ENST00000324385.5:c.2560C>T	chr16.hg19:g.1396324C>T	ENSP00000324510:p.Arg854Trp	171.0	0.0		153.0	50.0	NM_003933	A2A2B2|B2RCD7|B4DGS5|B4DIK3|B4DRK9|B4DRP1|E7EUB9|H3BUH8|H3BVI3|H7C2Q1|O94839|Q2M226|Q658J2|Q76N05|Q96RZ3|Q9UJK1	Missense_Mutation	SNP	ENST00000324385.5	hg19	CCDS10434.1	.	.	.	.	.	.	.	.	.	.	C	16.24	3.067661	0.55539	.	.	ENSG00000007516	ENST00000426824;ENST00000397488;ENST00000324385;ENST00000397489;ENST00000421665	T;T;T;T;T	0.72394	-0.65;-0.65;-0.65;-0.65;-0.62	3.98	2.94	0.34122	.	0.187167	0.43416	D	0.000562	T	0.76011	0.3928	L	0.59436	1.845	0.54753	D	0.999984	D;D;D;D	0.89917	0.999;0.999;0.999;1.0	P;P;P;D	0.63192	0.614;0.684;0.781;0.912	T	0.76926	-0.2778	10	0.66056	D	0.02	-20.9903	8.256	0.31756	0.3634:0.6366:0.0:0.0	.	783;796;854;836	E7EUB9;B4DIK3;O94812;A2A2B2	.;.;BAIP3_HUMAN;.	W	819;836;854;836;783	ENSP00000407242:R819W;ENSP00000380625:R836W;ENSP00000324510:R854W;ENSP00000380626:R836W;ENSP00000409533:R783W	ENSP00000324510:R854W	R	+	1	2	BAIAP3	1336325	0.724000	0.28038	0.996000	0.52242	0.221000	0.24807	0.919000	0.28692	2.046000	0.60703	0.491000	0.48974	CGG	.	.		0.701	BAIAP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109056.3		
TP53	7157	hgsc.bcm.edu	37	17	7577538	7577538	+	Missense_Mutation	SNP	C	C	T	rs11540652		TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr17:7577538C>T	ENST00000269305.4	-	7	932	c.743G>A	c.(742-744)cGg>cAg	p.R248Q	TP53_ENST00000445888.2_Missense_Mutation_p.R248Q|TP53_ENST00000413465.2_Missense_Mutation_p.R248Q|TP53_ENST00000359597.4_Missense_Mutation_p.R248Q|TP53_ENST00000455263.2_Missense_Mutation_p.R248Q|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.R248Q	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	248	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:7682763}.|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs11540652). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:7887414}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1978757, ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248Q(580)|p.R248L(75)|p.R248P(19)|p.R155Q(18)|p.0?(8)|p.?(5)|p.R155L(3)|p.R155P(2)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.M246_P250delMNRRP(2)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*96(1)|p.R248fs*>39(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GATGGGCCTCCGGTTCATGCC	0.572	R248Q(BL41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CA46_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(EM2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HCC1143_BREAST)|R248Q(HCC70_BREAST)|R248Q(HEC1A_ENDOMETRIUM)|R248Q(HS683_CENTRAL_NERVOUS_SYSTEM)|R248Q(HSC4_UPPER_AERODIGESTIVE_TRACT)|R248Q(KASUMI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYSE150_OESOPHAGUS)|R248Q(MOLM6_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NAMALWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NB4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIH211_LUNG)|R248Q(NCIN87_STOMACH)|R248Q(NIHOVCAR3_OVARY)|R248Q(NUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(P12ICHIKAWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PANC0203_PANCREAS)|R248Q(PC14_LUNG)|R248Q(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(RT112_URINARY_TRACT)|R248Q(SEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SF295_CENTRAL_NERVOUS_SYSTEM)|R248Q(SKUT1_SOFT_TISSUE)|R248Q(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SW1463_LARGE_INTESTINE)|R248Q(WSUDLCL2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R248Q	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000545858,NS,adenocarcinoma,0,4	TP53	33396	.	725	Substitution - Missense(698)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(6)|Insertion - Frameshift(3)|Deletion - Frameshift(2)|Complex - compound substitution(1)	large_intestine(138)|breast(83)|haematopoietic_and_lymphoid_tissue(74)|lung(71)|upper_aerodigestive_tract(63)|central_nervous_system(46)|oesophagus(37)|urinary_tract(37)|ovary(36)|stomach(35)|endometrium(23)|skin(18)|prostate(11)|bone(10)|biliary_tract(9)|liver(9)|pancreas(7)|vulva(3)|kidney(3)|cervix(3)|peritoneum(2)|thyroid(2)|soft_tissue(1)|pituitary(1)|adrenal_gland(1)|small_intestine(1)|thymus(1)	c.G743A	GRCh37	CM920675	TP53	M	rs11540652	.	C	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	0,4406		0,0,2203	152.0	112.0	126.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	743,743,743,743,347,347,347	3.7	1.0	17	dbSNP_120	126	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense,missense	TP53	NM_000546.4,NM_001126112.1,NM_001126113.1,NM_001126114.1,NM_001126115.1,NM_001126116.1,NM_001126117.1	43,43,43,43,43,43,43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	248/394,248/394,248/347,248/342,116/262,116/210,116/215	7577538	1,13005	2203	4300	6503	SO:0001583	missense	7157	exon7	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	GGCCTCCGGTTCA	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.743G>A	chr17.hg19:g.7577538C>T	ENSP00000269305:p.Arg248Gln	98.0	0.0		86.0	18.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.822907	0.90873	0.0	1.16E-4	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99864	-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28	4.62	3.65	0.41850	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99840	0.9927	M	0.88640	2.97	0.58432	A	0.999994	D;D;D;D;D;D	0.89917	1.0;0.994;1.0;1.0;1.0;1.0	D;P;D;D;D;D	0.91635	0.996;0.882;0.999;0.995;0.996;0.995	D	0.96819	0.9602	9	0.72032	D	0.01	-9.5643	10.6687	0.45745	0.0:0.9059:0.0:0.0941	rs11540652;rs11540652	248;248;155;248;248;248	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	Q	248;248;248;248;248;248;237;155;116;155	ENSP00000410739:R248Q;ENSP00000352610:R248Q;ENSP00000269305:R248Q;ENSP00000398846:R248Q;ENSP00000391127:R248Q;ENSP00000391478:R248Q;ENSP00000425104:R116Q;ENSP00000423862:R155Q	ENSP00000269305:R248Q	R	-	2	0	TP53	7518263	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	5.884000	0.69729	1.305000	0.44909	0.462000	0.41574	CGG	.	.		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
SOX9	6662	hgsc.bcm.edu	37	17	70120053	70120053	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr17:70120053C>T	ENST00000245479.2	+	3	1427	c.1055C>T	c.(1054-1056)gCc>gTc	p.A352V		NM_000346.3	NP_000337.1	P48436	SOX9_HUMAN	SRY (sex determining region Y)-box 9	352	Gln/Pro-rich.				astrocyte fate commitment (GO:0060018)|branching involved in ureteric bud morphogenesis (GO:0001658)|cAMP-mediated signaling (GO:0019933)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cell fate specification (GO:0001708)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to heparin (GO:0071504)|cellular response to interleukin-1 (GO:0071347)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|chondrocyte hypertrophy (GO:0003415)|chromatin remodeling (GO:0006338)|cochlea morphogenesis (GO:0090103)|cytoskeleton organization (GO:0007010)|endocardial cushion morphogenesis (GO:0003203)|endocrine pancreas development (GO:0031018)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation involved in prostatic bud elongation (GO:0060517)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|heart valve development (GO:0003170)|heart valve formation (GO:0003188)|heart valve morphogenesis (GO:0003179)|intestinal epithelial structure maintenance (GO:0060729)|intrahepatic bile duct development (GO:0035622)|limb bud formation (GO:0060174)|lung epithelial cell differentiation (GO:0060487)|male germ-line sex determination (GO:0019100)|male gonad development (GO:0008584)|mammary gland development (GO:0030879)|metanephric nephron tubule formation (GO:0072289)|morphogenesis of a branching epithelium (GO:0061138)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biomineral tissue development (GO:0070168)|negative regulation of bone mineralization (GO:0030502)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of immune system process (GO:0002683)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of ossification (GO:0030279)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell development (GO:0014032)|notochord development (GO:0030903)|nucleosome assembly (GO:0006334)|oligodendrocyte differentiation (GO:0048709)|ossification (GO:0001503)|otic vesicle formation (GO:0030916)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation involved in heart morphogenesis (GO:2000138)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of extracellular matrix assembly (GO:1901203)|positive regulation of kidney development (GO:0090184)|positive regulation of male gonad development (GO:2000020)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein complex assembly (GO:0006461)|protein kinase B signaling (GO:0043491)|regulation of apoptotic process (GO:0042981)|regulation of branching involved in lung morphogenesis (GO:0061046)|regulation of cell adhesion (GO:0030155)|regulation of cell cycle process (GO:0010564)|regulation of cell proliferation (GO:0042127)|regulation of cell proliferation involved in tissue homeostasis (GO:0060784)|regulation of epithelial cell proliferation involved in lung morphogenesis (GO:2000794)|renal vesicle induction (GO:0072034)|retina development in camera-type eye (GO:0060041)|retinal rod cell differentiation (GO:0060221)|Sertoli cell development (GO:0060009)|Sertoli cell differentiation (GO:0060008)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|spermatogenesis (GO:0007283)|tissue homeostasis (GO:0001894)|transcription from RNA polymerase II promoter (GO:0006366)|ureter morphogenesis (GO:0072197)|ureter smooth muscle cell differentiation (GO:0072193)|ureter urothelium development (GO:0072190)	nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|enhancer binding (GO:0035326)|enhancer sequence-specific DNA binding (GO:0001158)|pre-mRNA intronic binding (GO:0097157)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase activity (GO:0004672)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(4)|large_intestine(11)|lung(5)|pancreas(1)|upper_aerodigestive_tract(2)	26		Colorectal(1115;0.245)	STAD - Stomach adenocarcinoma(260;0.119)			cccccacaggccccgccggcc	0.796																																					p.A352V	Pancreas(42;83 1041 2320 35205 39456)	Atlas-SNP	.											.	SOX9	91	.	0			c.C1055T						.						1.0	1.0	1.0					17																	70120053		522	1250	1772	SO:0001583	missense	6662	exon3			CACAGGCCCCGCC	S74506	CCDS11689.1	17q24.3	2013-10-17	2008-07-31		ENSG00000125398	ENSG00000125398		"""SRY (sex determining region Y)-boxes"""	11204	protein-coding gene	gene with protein product		608160	"""campomelic dysplasia, autosomal sex-reversal"""	CMD1, CMPD1		8348155	Standard	NM_000346		Approved	SRA1	uc002jiw.3	P48436	OTTHUMG00000166300	ENST00000245479.2:c.1055C>T	chr17.hg19:g.70120053C>T	ENSP00000245479:p.Ala352Val	135.0	0.0		61.0	23.0	NM_000346	Q53Y80	Missense_Mutation	SNP	ENST00000245479.2	hg19	CCDS11689.1	.	.	.	.	.	.	.	.	.	.	C	12.70	2.017390	0.35606	.	.	ENSG00000125398	ENST00000245479	T	0.77877	-1.13	3.95	1.68	0.24146	.	0.708385	0.11410	U	0.566885	T	0.61261	0.2333	N	0.19112	0.55	0.09310	N	1	B	0.12013	0.005	B	0.11329	0.006	T	0.45145	-0.9281	10	0.22109	T	0.4	.	9.3668	0.38230	0.3819:0.6181:0.0:0.0	.	352	P48436	SOX9_HUMAN	V	352	ENSP00000245479:A352V	ENSP00000245479:A352V	A	+	2	0	SOX9	67631648	.	.	0.953000	0.39169	0.700000	0.40528	.	.	0.607000	0.29982	0.313000	0.20887	GCC	.	.		0.796	SOX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389032.1	NM_000346	
UNK	85451	hgsc.bcm.edu	37	17	73805893	73805893	+	Missense_Mutation	SNP	T	T	C			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr17:73805893T>C	ENST00000589666.1	+	2	267	c.157T>C	c.(157-159)Tgc>Cgc	p.C53R	UNK_ENST00000293218.3_Missense_Mutation_p.C129R	NM_001080419.2	NP_001073888.2	Q9C0B0	UNK_HUMAN	unkempt family zinc finger	53							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			cervix(3)|endometrium(8)|kidney(2)|large_intestine(5)|lung(3)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	25			all cancers(21;2.61e-06)|Epithelial(20;7.39e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|LUSC - Lung squamous cell carcinoma(166;0.154)			GCAACACAAATGCACGCAGCA	0.617																																					p.C53R		Atlas-SNP	.											.	UNK	87	.	0			c.T157C						.						28.0	33.0	32.0					17																	73805893		2168	4287	6455	SO:0001583	missense	85451	exon2			CACAAATGCACGC	AB051540	CCDS45778.1, CCDS45778.2	17q25.3	2013-10-17	2013-10-17	2007-02-06		ENSG00000132478		"""Zinc fingers, CCCH-type domain containing"""	29369	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 5"", ""zinc finger CCCH-type containing 5"", ""unkempt homolog (Drosophila)"""	ZC3HDC5, ZC3H5		11214970	Standard	NM_001080419		Approved	KIAA1753	uc021udd.2	Q9C0B0		ENST00000589666.1:c.157T>C	chr17.hg19:g.73805893T>C	ENSP00000464893:p.Cys53Arg	154.0	0.0		124.0	29.0	NM_001080419		Missense_Mutation	SNP	ENST00000589666.1	hg19	CCDS45778.2	.	.	.	.	.	.	.	.	.	.	T	25.5	4.649439	0.87958	.	.	ENSG00000132478	ENST00000293218	.	.	.	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.77903	0.4200	M	0.73319	2.225	0.80722	D	1	D	0.71674	0.998	D	0.80764	0.994	T	0.80928	-0.1163	9	0.87932	D	0	-2.283	15.1024	0.72292	0.0:0.0:0.0:1.0	.	53	Q9C0B0	UNK_HUMAN	R	129	.	ENSP00000293218:C129R	C	+	1	0	UNK	71317488	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.040000	0.89188	1.971000	0.57363	0.459000	0.35465	TGC	.	.		0.617	UNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448835.1	NM_001080419	
ZNF91	7644	hgsc.bcm.edu	37	19	23542679	23542679	+	Silent	SNP	G	G	A			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr19:23542679G>A	ENST00000300619.7	-	4	3307	c.3102C>T	c.(3100-3102)tcC>tcT	p.S1034S	ZNF91_ENST00000397082.2_Silent_p.S1002S|ZNF91_ENST00000599743.1_Intron|ZNF91_ENST00000596528.1_5'Flank	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	1034					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)						all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				TAAGCTTTGAGGATCGATTAA	0.388																																					p.S1034S		Atlas-SNP	.											.	ZNF91	349	.	0			c.C3102T						.						76.0	79.0	78.0					19																	23542679		2193	4290	6483	SO:0001819	synonymous_variant	7644	exon4			CTTTGAGGATCGA	M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.3102C>T	chr19.hg19:g.23542679G>A		38.0	0.0		50.0	4.0	NM_003430	A8K5E1|B7Z6G6	Silent	SNP	ENST00000300619.7	hg19	CCDS42541.1																																																																																			.	.		0.388	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465891.1	NM_003430	
KLK10	5655	hgsc.bcm.edu	37	19	51520439	51520439	+	Missense_Mutation	SNP	C	C	A			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr19:51520439C>A	ENST00000309958.3	-	3	414	c.196G>T	c.(196-198)Ggc>Tgc	p.G66C	CTC-518B2.12_ENST00000596286.1_RNA|KLK10_ENST00000358789.3_Missense_Mutation_p.G66C|KLK10_ENST00000391805.1_Missense_Mutation_p.G66C	NM_002776.4	NP_002767.2	O43240	KLK10_HUMAN	kallikrein-related peptidase 10	66	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cell cycle (GO:0007049)	extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	13		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00885)		AACGAGAGGCCGTTGAAGAGC	0.682											OREG0025646	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G66C		Atlas-SNP	.											.	KLK10	32	.	0			c.G196T						.						19.0	20.0	20.0					19																	51520439		2201	4298	6499	SO:0001583	missense	5655	exon3			AGAGGCCGTTGAA	AF024605	CCDS12817.1	19q13	2011-03-07	2006-10-27			ENSG00000129451		"""Kallikreins"""	6358	protein-coding gene	gene with protein product		602673	"""kallikrein 10"""	PRSSL1		8764136, 9533035, 16800724, 16800723, 10675891	Standard	NM_145888		Approved	NES1	uc002pva.3	O43240		ENST00000309958.3:c.196G>T	chr19.hg19:g.51520439C>A	ENSP00000311746:p.Gly66Cys	125.0	0.0	978	120.0	7.0	NM_145888	A6NC12|Q53YL3|Q99920|Q9GZW9	Missense_Mutation	SNP	ENST00000309958.3	hg19	CCDS12817.1	.	.	.	.	.	.	.	.	.	.	c	19.88	3.909627	0.72868	.	.	ENSG00000129451	ENST00000391805;ENST00000309958;ENST00000358789	D;D;D	0.93712	-3.27;-3.27;-3.27	4.21	2.02	0.26589	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.460059	0.16140	N	0.227786	D	0.96719	0.8929	H	0.94771	3.58	0.25555	N	0.98704	D	0.76494	0.999	D	0.72982	0.979	D	0.89774	0.3956	10	0.72032	D	0.01	.	5.5442	0.17055	0.0:0.7345:0.0:0.2655	.	66	O43240	KLK10_HUMAN	C	66	ENSP00000375681:G66C;ENSP00000311746:G66C;ENSP00000351640:G66C	ENSP00000311746:G66C	G	-	1	0	KLK10	56212251	0.000000	0.05858	0.964000	0.40570	0.967000	0.64934	0.744000	0.26245	0.854000	0.35336	0.491000	0.48974	GGC	.	.		0.682	KLK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464337.2	NM_002776	
ZNF665	79788	hgsc.bcm.edu	37	19	53668097	53668097	+	Missense_Mutation	SNP	T	T	C			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr19:53668097T>C	ENST00000600412.1	-	2	1566	c.1451A>G	c.(1450-1452)aAg>aGg	p.K484R	CTD-2245F17.2_ENST00000600257.1_RNA|ZNF665_ENST00000396424.3_Missense_Mutation_p.K549R			Q9H7R5	ZN665_HUMAN	zinc finger protein 665	484					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	35				GBM - Glioblastoma multiforme(134;0.0196)		TCTGAAGACCTTGCCGCAATC	0.383																																					p.K549R		Atlas-SNP	.											.	ZNF665	136	.	0			c.A1646G						.						147.0	157.0	154.0					19																	53668097		2200	4300	6500	SO:0001583	missense	79788	exon4			AAGACCTTGCCGC		CCDS46169.1	19q13.42	2013-01-08				ENSG00000197497		"""Zinc fingers, C2H2-type"", ""-"""	25885	protein-coding gene	gene with protein product							Standard	NM_024733		Approved	FLJ14345	uc010eqm.1	Q9H7R5		ENST00000600412.1:c.1451A>G	chr19.hg19:g.53668097T>C	ENSP00000469154:p.Lys484Arg	121.0	0.0		96.0	22.0	NM_024733	A8K5T8	Missense_Mutation	SNP	ENST00000600412.1	hg19		.	.	.	.	.	.	.	.	.	.	T	14.94	2.686521	0.47991	.	.	ENSG00000197497	ENST00000396424	T	0.26223	1.75	2.44	1.35	0.21983	.	.	.	.	.	T	0.42539	0.1207	M	0.64080	1.96	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.14896	-1.0456	9	0.49607	T	0.09	.	6.7458	0.23460	0.2103:0.0:0.0:0.7897	.	549	Q9H7R5-2	.	R	549	ENSP00000379702:K549R	ENSP00000379702:K549R	K	-	2	0	ZNF665	58359909	0.042000	0.20092	0.001000	0.08648	0.032000	0.12392	1.624000	0.37018	0.158000	0.19367	0.443000	0.29094	AAG	.	.		0.383	ZNF665-002	PUTATIVE	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000464179.1	NM_024733	
VSTM1	284415	hgsc.bcm.edu	37	19	54545432	54545432	+	Missense_Mutation	SNP	G	G	C			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr19:54545432G>C	ENST00000338372.2	-	6	681	c.506C>G	c.(505-507)tCc>tGc	p.S169C	VSTM1_ENST00000366170.2_Missense_Mutation_p.S81C|VSTM1_ENST00000376626.1_Missense_Mutation_p.S138C|VSTM1_ENST00000425006.2_3'UTR	NM_198481.3	NP_940883.2	Q6UX27	VSTM1_HUMAN	V-set and transmembrane domain containing 1	169					immune system process (GO:0002376)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)		p.S169Y(1)		breast(1)|large_intestine(3)|lung(11)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.165)		CCTCTTGGTGGATTCCTCAGA	0.502																																					p.S169C		Atlas-SNP	.											VSTM1,NS,carcinoma,0,1	VSTM1	30	.	1	Substitution - Missense(1)	lung(1)	c.C506G						.						151.0	154.0	153.0					19																	54545432		2203	4300	6503	SO:0001583	missense	284415	exon6			TTGGTGGATTCCT	AY358542	CCDS12872.1, CCDS74441.1, CCDS74442.1	19q13.42	2013-01-11			ENSG00000189068	ENSG00000189068		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29455	protein-coding gene	gene with protein product						12975309	Standard	NM_198481		Approved	UNQ3033	uc002qcw.4	Q6UX27	OTTHUMG00000064906	ENST00000338372.2:c.506C>G	chr19.hg19:g.54545432G>C	ENSP00000343366:p.Ser169Cys	147.0	0.0		101.0	36.0	NM_198481	B6A8C6|D2DJS3|D2DJS4|Q496B6|Q496B7	Missense_Mutation	SNP	ENST00000338372.2	hg19	CCDS12872.1	.	.	.	.	.	.	.	.	.	.	G	13.70	2.315608	0.40996	.	.	ENSG00000189068	ENST00000419106;ENST00000338372;ENST00000376626;ENST00000366170	T;T;T;T	0.53640	2.22;6.65;6.42;0.61	3.24	3.24	0.37175	.	0.864640	0.09428	U	0.803465	T	0.45478	0.1344	N	0.19112	0.55	0.31378	N	0.679365	D;D	0.71674	0.996;0.998	P;P	0.54372	0.75;0.75	T	0.48043	-0.9069	10	0.56958	D	0.05	-12.1574	10.3077	0.43691	0.0:0.0:1.0:0.0	.	138;169	D2DJS4;Q6UX27	.;VSTM1_HUMAN	C	59;169;138;81	ENSP00000409412:S59C;ENSP00000343366:S169C;ENSP00000365813:S138C;ENSP00000444153:S81C	ENSP00000343366:S169C	S	-	2	0	VSTM1	59237244	0.009000	0.17119	0.003000	0.11579	0.006000	0.05464	2.618000	0.46393	2.151000	0.67156	0.543000	0.68304	TCC	.	.		0.502	VSTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139358.3	NM_198481	
LILRA3	11026	hgsc.bcm.edu	37	19	54802132	54802132	+	Missense_Mutation	SNP	C	C	G			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr19:54802132C>G	ENST00000251390.3	-	6	1147	c.1056G>C	c.(1054-1056)atG>atC	p.M352I	LILRA3_ENST00000391745.1_Missense_Mutation_p.M369I|LILRA3_ENST00000391744.3_Missense_Mutation_p.M288I	NM_006865.3	NP_006856.3	Q8N6C8	LIRA3_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3	352	Ig-like C2-type 4.				defense response (GO:0006952)|immune system process (GO:0002376)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			NS(3)|breast(1)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GGAAAGTGTGCATCCCTCCCT	0.582																																					p.M352I		Atlas-SNP	.											.	LILRA3	65	.	0			c.G1056C						.						94.0	81.0	86.0					19																	54802132		2194	4154	6348	SO:0001583	missense	11026	exon6			AGTGTGCATCCCT	U91926		19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6604	protein-coding gene	gene with protein product		604818				9278324, 9548455	Standard	XM_006710242		Approved	LIR-4, HM43, ILT6, HM31, LIR4, CD85e		Q8N6C8		ENST00000251390.3:c.1056G>C	chr19.hg19:g.54802132C>G	ENSP00000251390:p.Met352Ile	93.0	0.0		88.0	34.0	NM_006865	J3KPM2|O15469|O15470|O75016|Q8N151|Q8N154|Q8NHJ1|Q8NHJ2|Q8NHJ3|Q8NHJ4	Missense_Mutation	SNP	ENST00000251390.3	hg19	CCDS12887.1	.	.	.	.	.	.	.	.	.	.	C	5.534	0.283521	0.10458	.	.	ENSG00000170866	ENST00000251390;ENST00000391744;ENST00000391745	T;T;T	0.02863	4.13;4.13;4.13	2.4	-0.0432	0.13860	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	4.906520	0.00589	N	0.000348	T	0.03608	0.0103	L	0.40543	1.245	0.09310	N	1	B;B	0.16603	0.018;0.006	B;B	0.23574	0.047;0.023	T	0.44081	-0.9351	10	0.30078	T	0.28	.	4.5605	0.12158	0.2569:0.4922:0.2509:0.0	.	352;352	E7EU74;Q8N6C8	.;LIRA3_HUMAN	I	352;288;369	ENSP00000251390:M352I;ENSP00000375624:M288I;ENSP00000375625:M369I	ENSP00000251390:M352I	M	-	3	0	LILRA3	59493944	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.083000	0.03397	0.093000	0.17368	0.586000	0.80456	ATG	.	.		0.582	LILRA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140236.1		
LENG8	114823	hgsc.bcm.edu	37	19	54967900	54967900	+	Nonsense_Mutation	SNP	A	A	T			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr19:54967900A>T	ENST00000326764.5	+	11	2010	c.1531A>T	c.(1531-1533)Aag>Tag	p.K511*	LENG8_ENST00000376514.2_Intron	NM_052925.2	NP_443157.1	Q96PV6	LENG8_HUMAN	leukocyte receptor cluster (LRC) member 8	474										breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	30	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.139)		GAAGAAGCAGAAGCGGGCAGC	0.662																																					p.K511X		Atlas-SNP	.											.	LENG8	73	.	0			c.A1531T						.						25.0	30.0	28.0					19																	54967900		2199	4299	6498	SO:0001587	stop_gained	114823	exon11			AAGCAGAAGCGGG	AF211975	CCDS12894.1	19q13.4	2008-02-05			ENSG00000167615	ENSG00000167615			15500	protein-coding gene	gene with protein product						10941842	Standard	XM_005278248		Approved	KIAA1932, MGC40108, pp13842	uc002qfw.2	Q96PV6	OTTHUMG00000065548	ENST00000326764.5:c.1531A>T	chr19.hg19:g.54967900A>T	ENSP00000318374:p.Lys511*	127.0	0.0		123.0	5.0	NM_052925	B0VJY9|Q8IZ27|Q8NCX6	Nonsense_Mutation	SNP	ENST00000326764.5	hg19	CCDS12894.1	.	.	.	.	.	.	.	.	.	.	A	42	9.764237	0.99257	.	.	ENSG00000167615	ENST00000326764;ENST00000301196;ENST00000376526;ENST00000431846	.	.	.	4.11	4.11	0.48088	.	0.356790	0.28241	N	0.016067	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-30.1172	11.6829	0.51468	1.0:0.0:0.0:0.0	.	.	.	.	X	511;474;474;511	.	ENSP00000301196:K474X	K	+	1	0	LENG8	59659712	1.000000	0.71417	0.998000	0.56505	0.795000	0.44927	5.760000	0.68793	1.816000	0.52996	0.379000	0.24179	AAG	.	.		0.662	LENG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140523.2	NM_052925	
U2AF2	11338	hgsc.bcm.edu	37	19	56180129	56180129	+	Missense_Mutation	SNP	G	G	C			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr19:56180129G>C	ENST00000308924.4	+	9	956	c.916G>C	c.(916-918)Gag>Cag	p.E306Q	CTD-2537I9.13_ENST00000592252.1_RNA|U2AF2_ENST00000590551.1_Missense_Mutation_p.E142Q|U2AF2_ENST00000450554.2_Missense_Mutation_p.E306Q|CTD-2537I9.12_ENST00000589456.1_RNA|CTD-2537I9.12_ENST00000585940.1_RNA			P26368	U2AF2_HUMAN	U2 small nuclear RNA auxiliary factor 2	306	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	enzyme binding (GO:0019899)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			biliary_tract(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|urinary_tract(2)	21		Colorectal(82;0.00244)|Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)		CGCCTTCTGTGAGTACGTGGA	0.617																																					p.E306Q		Atlas-SNP	.											.	U2AF2	62	.	0			c.G916C						.						70.0	68.0	69.0					19																	56180129		2203	4300	6503	SO:0001583	missense	11338	exon9			TTCTGTGAGTACG	BC008740	CCDS12933.1, CCDS46197.1	19q13.43	2014-09-17	2006-04-11			ENSG00000063244		"""RNA binding motif (RRM) containing"""	23156	protein-coding gene	gene with protein product	"""U2 small nuclear ribonucleoprotein auxiliary factor (65kD)"", ""splicing factor U2AF 65 kD subunit"", ""U2 snRNP auxiliary factor large subunit"""	191318	"""U2 (RNU2) small nuclear RNA auxiliary factor 2"""			1538748	Standard	XM_006722994		Approved	U2AF65	uc002qlu.3	P26368		ENST00000308924.4:c.916G>C	chr19.hg19:g.56180129G>C	ENSP00000307863:p.Glu306Gln	72.0	0.0		73.0	19.0	NM_001012478	Q96HC5	Missense_Mutation	SNP	ENST00000308924.4	hg19	CCDS12933.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.974313	0.92919	.	.	ENSG00000063244	ENST00000308924;ENST00000450554	T;T	0.20069	2.1;2.1	4.4	4.4	0.53042	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.51381	0.1671	M	0.87269	2.87	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.992	T	0.58999	-0.7536	10	0.46703	T	0.11	-24.3302	16.1527	0.81634	0.0:0.0:1.0:0.0	.	306;306	P26368;P26368-2	U2AF2_HUMAN;.	Q	306	ENSP00000307863:E306Q;ENSP00000388475:E306Q	ENSP00000307863:E306Q	E	+	1	0	U2AF2	60871941	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.145000	0.94634	2.184000	0.69523	0.655000	0.94253	GAG	.	.		0.617	U2AF2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453599.1	NM_007279	
PREX1	57580	hgsc.bcm.edu	37	20	47267479	47267479	+	Missense_Mutation	SNP	C	C	A			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr20:47267479C>A	ENST00000371941.3	-	23	2792	c.2770G>T	c.(2770-2772)Gac>Tac	p.D924Y	PREX1_ENST00000396220.1_Missense_Mutation_p.D924Y	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	924					actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			AGCTTGGTGTCACAGATGTTG	0.602																																					p.D924Y		Atlas-SNP	.											.	PREX1	441	.	0			c.G2770T						.						104.0	80.0	88.0					20																	47267479		2203	4300	6503	SO:0001583	missense	57580	exon23			TGGTGTCACAGAT	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.2770G>T	chr20.hg19:g.47267479C>A	ENSP00000361009:p.Asp924Tyr	63.0	0.0		77.0	16.0	NM_020820	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Missense_Mutation	SNP	ENST00000371941.3	hg19	CCDS13410.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.325429	0.81580	.	.	ENSG00000124126	ENST00000371941;ENST00000396220	T;T	0.49139	0.79;0.79	5.11	5.11	0.69529	.	0.099066	0.41294	U	0.000919	T	0.65863	0.2732	L	0.54323	1.7	0.58432	D	0.999999	D;D	0.89917	0.972;1.0	P;D	0.76575	0.707;0.988	T	0.68667	-0.5348	10	0.72032	D	0.01	.	18.5354	0.91009	0.0:1.0:0.0:0.0	.	924;221	Q8TCU6;Q8TCU6-2	PREX1_HUMAN;.	Y	924	ENSP00000361009:D924Y;ENSP00000379522:D924Y	ENSP00000361009:D924Y	D	-	1	0	PREX1	46700886	1.000000	0.71417	0.982000	0.44146	0.882000	0.50991	4.292000	0.59031	2.365000	0.80145	0.462000	0.41574	GAC	.	.		0.602	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	NM_020820	
PREX1	57580	hgsc.bcm.edu	37	20	47267528	47267528	+	Silent	SNP	C	C	T			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr20:47267528C>T	ENST00000371941.3	-	23	2743	c.2721G>A	c.(2719-2721)ctG>ctA	p.L907L	PREX1_ENST00000396220.1_Silent_p.L907L	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	907					actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			TGGCGCTGCTCAGGGCCATGA	0.572																																					p.L907L		Atlas-SNP	.											.	PREX1	441	.	0			c.G2721A						.						90.0	73.0	79.0					20																	47267528		2203	4300	6503	SO:0001819	synonymous_variant	57580	exon23			GCTGCTCAGGGCC	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.2721G>A	chr20.hg19:g.47267528C>T		74.0	0.0		92.0	17.0	NM_020820	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Silent	SNP	ENST00000371941.3	hg19	CCDS13410.1																																																																																			.	.		0.572	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	NM_020820	
PREX1	57580	hgsc.bcm.edu	37	20	47267976	47267976	+	Silent	SNP	C	C	T			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr20:47267976C>T	ENST00000371941.3	-	22	2635	c.2613G>A	c.(2611-2613)gaG>gaA	p.E871E	PREX1_ENST00000396220.1_Silent_p.E871E	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	871					actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			CCACGATCTTCTCCAGCACAT	0.627																																					p.E871E		Atlas-SNP	.											.	PREX1	441	.	0			c.G2613A						.						60.0	50.0	54.0					20																	47267976		2203	4300	6503	SO:0001819	synonymous_variant	57580	exon22			GATCTTCTCCAGC	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.2613G>A	chr20.hg19:g.47267976C>T		85.0	0.0		112.0	14.0	NM_020820	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Silent	SNP	ENST00000371941.3	hg19	CCDS13410.1																																																																																			.	.		0.627	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	NM_020820	
TSHZ2	128553	hgsc.bcm.edu	37	20	51870809	51870809	+	Missense_Mutation	SNP	C	C	A			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr20:51870809C>A	ENST00000371497.5	+	2	1699	c.812C>A	c.(811-813)gCt>gAt	p.A271D	RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000603338.2_Missense_Mutation_p.A268D|TSHZ2_ENST00000329613.6_Missense_Mutation_p.A268D	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	271					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A271D(1)		NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			AAAGAGGATGCTCAAAAGGTT	0.438																																					p.A271D		Atlas-SNP	.											TSHZ2,NS,carcinoma,0,1	TSHZ2	209	.	1	Substitution - Missense(1)	lung(1)	c.C812A						.						74.0	57.0	63.0					20																	51870809		2203	4300	6503	SO:0001583	missense	128553	exon2			AGGATGCTCAAAA	AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.812C>A	chr20.hg19:g.51870809C>A	ENSP00000360552:p.Ala271Asp	207.0	1.0		281.0	12.0	NM_173485	B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Missense_Mutation	SNP	ENST00000371497.5	hg19	CCDS33490.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.599344	0.87055	.	.	ENSG00000182463	ENST00000371497;ENST00000329613	T;T	0.43294	0.95;0.95	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.64832	0.2634	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.66011	-0.6029	10	0.87932	D	0	-1.2317	19.7465	0.96253	0.0:1.0:0.0:0.0	.	271	Q9NRE2	TSH2_HUMAN	D	271;268	ENSP00000360552:A271D;ENSP00000333114:A268D	ENSP00000333114:A268D	A	+	2	0	TSHZ2	51304216	1.000000	0.71417	0.992000	0.48379	0.935000	0.57460	7.440000	0.80464	2.732000	0.93576	0.643000	0.83706	GCT	.	.		0.438	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080398.6	NM_173485	
CCT8L2	150160	hgsc.bcm.edu	37	22	17071949	17071949	+	Missense_Mutation	SNP	T	T	C			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr22:17071949T>C	ENST00000359963.3	-	1	1751	c.1492A>G	c.(1492-1494)Ata>Gta	p.I498V		NM_014406.4	NP_055221.1	Q96SF2	TCPQM_HUMAN	chaperonin containing TCP1, subunit 8 (theta)-like 2	498					anion transport (GO:0006820)|cellular protein metabolic process (GO:0044267)|potassium ion transmembrane transport (GO:0071805)|transport (GO:0006810)	cytoplasm (GO:0005737)	anion channel activity (GO:0005253)|ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)			breast(3)|endometrium(7)|kidney(1)|large_intestine(8)|liver(2)|lung(37)|ovary(3)|prostate(3)|skin(2)|stomach(1)	67	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				GCTTTGACTATTAGGGTGTCC	0.517																																					p.I498V		Atlas-SNP	.											.	CCT8L2	150	.	0			c.A1492G						.						120.0	115.0	116.0					22																	17071949		2203	4298	6501	SO:0001583	missense	150160	exon1			TGACTATTAGGGT	AP003553	CCDS13738.1	22q11.1	2011-09-01			ENSG00000198445	ENSG00000198445			15553	protein-coding gene	gene with protein product							Standard	NM_014406		Approved	CESK1	uc002zlp.1	Q96SF2	OTTHUMG00000141302	ENST00000359963.3:c.1492A>G	chr22.hg19:g.17071949T>C	ENSP00000353048:p.Ile498Val	165.0	0.0		156.0	68.0	NM_014406	A4QPH3|Q9UJS3	Missense_Mutation	SNP	ENST00000359963.3	hg19	CCDS13738.1	.	.	.	.	.	.	.	.	.	.	t	0.014	-1.584846	0.00872	.	.	ENSG00000198445	ENST00000359963	T	0.78595	-1.19	1.98	0.89	0.19218	.	1.691540	0.03909	N	0.281555	T	0.53706	0.1813	N	0.04203	-0.255	0.09310	N	1	B	0.06786	0.001	B	0.14023	0.01	T	0.42548	-0.9445	10	0.12766	T	0.61	-0.1711	3.786	0.08700	0.0:0.208:0.0:0.792	.	498	Q96SF2	TCPQM_HUMAN	V	498	ENSP00000353048:I498V	ENSP00000353048:I498V	I	-	1	0	CCT8L2	15451949	0.000000	0.05858	0.077000	0.20336	0.207000	0.24258	-0.124000	0.10595	0.063000	0.16370	0.312000	0.20444	ATA	.	.		0.517	CCT8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280580.1		
RYR1	6261	hgsc.bcm.edu	37	19	38964339	38964340	+	In_Frame_Ins	INS	-	-	GGG			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr19:38964339_38964340insGGG	ENST00000359596.3	+	28	4088_4089	c.4088_4089insGGG	c.(4087-4092)gcgggg>gcGGGgggg	p.1365_1366insG	RYR1_ENST00000355481.4_In_Frame_Ins_p.1365_1366insG|RYR1_ENST00000360985.3_In_Frame_Ins_p.1365_1366insG			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	1365	6 X approximate repeats.|B30.2/SPRY 3. {ECO:0000255|PROSITE- ProRule:PRU00548}.			GEAQ -> RGA (in Ref. 1; AA sequence). {ECO:0000305}.	calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	ACCCCGCAGGCGGGGGGAGAGG	0.678																																					p.A1363delinsAG		Atlas-INDEL	.											.	RYR1	708	.	0			c.4088_4089insGGG						.																																			SO:0001652	inframe_insertion	6261	exon28			.	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.4092_4094dupGGG	chr19.hg19:g.38964343_38964345dupGGG	ENSP00000352608:p.Gly1365_Gly1365dup	367.0	0.0		357.0	32.0	NM_001042723	Q16314|Q16368|Q9NPK1|Q9P1U4	In_Frame_Ins	INS	ENST00000359596.3	hg19	CCDS33011.1																																																																																			.	.		0.678	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
ZNF800	168850	hgsc.bcm.edu	37	7	127014205	127014205	+	Frame_Shift_Del	DEL	T	T	-			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr7:127014205delT	ENST00000393313.1	-	5	1776	c.1185delA	c.(1183-1185)aaafs	p.K395fs	ZNF800_ENST00000485577.1_5'Flank|ZNF800_ENST00000265827.3_Frame_Shift_Del_p.K395fs|ZNF800_ENST00000393312.1_Frame_Shift_Del_p.K395fs			Q2TB10	ZN800_HUMAN	zinc finger protein 800	395					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(8)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	32						TATTAGGGCCTTTTTCTCTTT	0.358																																					p.G396fs		Atlas-INDEL	.											.	ZNF800	78	.	0			c.1186delG						.						94.0	102.0	99.0					7																	127014205		2202	4297	6499	SO:0001589	frameshift_variant	168850	exon5			.	AF218032	CCDS5795.1	7q31.33	2008-05-02			ENSG00000048405	ENSG00000048405		"""Zinc fingers, C2H2-type"""	27267	protein-coding gene	gene with protein product						12477932	Standard	NM_176814		Approved		uc003vly.1	Q2TB10	OTTHUMG00000023456	ENST00000393313.1:c.1185delA	chr7.hg19:g.127014205delT	ENSP00000376989:p.Lys395fs	135.0	0.0		155.0	24.0	NM_176814	Q9HBN0	Frame_Shift_Del	DEL	ENST00000393313.1	hg19	CCDS5795.1																																																																																			.	.		0.358	ZNF800-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141823.1	NM_176814	
NKX2-2	4821	hgsc.bcm.edu	37	20	21493051	21493065	+	In_Frame_Del	DEL	GACTCGTCGGCCGAG	GACTCGTCGGCCGAG	-	rs375040957		TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	GACTCGTCGGCCGAG	GACTCGTCGGCCGAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr20:21493051_21493065delGACTCGTCGGCCGAG	ENST00000377142.4	-	2	674_688	c.318_332delCTCGGCCGACGAGTC	c.(316-333)ccctcggccgacgagtca>cca	p.SADES107del	NKX2-2-AS1_ENST00000549659.1_RNA	NM_002509.3	NP_002500.1	O95096	NKX22_HUMAN	NK2 homeobox 2	107					astrocyte differentiation (GO:0048708)|brain development (GO:0007420)|digestive tract development (GO:0048565)|endocrine pancreas development (GO:0031018)|negative regulation of neuron differentiation (GO:0045665)|neuron fate specification (GO:0048665)|oligodendrocyte development (GO:0014003)|optic nerve development (GO:0021554)|pancreatic A cell fate commitment (GO:0003326)|pancreatic PP cell fate commitment (GO:0003329)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to glucose (GO:0009749)|response to progesterone (GO:0032570)|smoothened signaling pathway (GO:0007224)|spinal cord motor neuron differentiation (GO:0021522)|spinal cord oligodendrocyte cell fate specification (GO:0021530)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell development (GO:0003323)|type B pancreatic cell fate commitment (GO:0003327)|ventral spinal cord interneuron fate determination (GO:0060580)	nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|core promoter proximal region DNA binding (GO:0001159)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(2)|kidney(2)|large_intestine(2)|lung(10)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21						ATTGTCCGGTGACTCGTCGGCCGAGGGCTCCGGGG	0.693																																					p.107_111del		Atlas-INDEL	.											.	NKX2-2	49	.	0			c.319_333del						.																																			SO:0001651	inframe_deletion	4821	exon2			.	AF019415	CCDS13145.1	20p11.22	2012-03-09	2007-07-09	2002-10-04	ENSG00000125820	ENSG00000125820		"""Homeoboxes / ANTP class : NKL subclass"""	7835	protein-coding gene	gene with protein product		604612	"""NK-2 (Drosophila) homolog B"", ""NK2 transcription factor related, locus 2 (Drosophila)"""	NKX2B		9703340, 1346742	Standard	NM_002509		Approved	NKX2.2	uc002wsi.3	O95096	OTTHUMG00000170524	ENST00000377142.4:c.318_332delCTCGGCCGACGAGTC	chr20.hg19:g.21493051_21493065delGACTCGTCGGCCGAG	ENSP00000366347:p.Ser107_Ser111del	54.0	0.0		55.0	25.0	NM_002509		In_Frame_Del	DEL	ENST00000377142.4	hg19	CCDS13145.1																																																																																			.	.		0.693	NKX2-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078278.9		
NLGN4Y	22829	hgsc.bcm.edu	37	Y	16941993	16942000	+	3'UTR	DEL	GTGTCCAA	GTGTCCAA	-			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	GTGTCCAA	GTGTCCAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chrY:16941993_16942000delGTGTCCAA	ENST00000476359.1	+	0	1740_1747							Q8NFZ3	NLGNY_HUMAN	neuroligin 4, Y-linked						learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			large_intestine(3)|lung(7)|prostate(2)|skin(2)	14						TGACTTCTCCGTGTCCAACTTCGTGGAC	0.543																																					p.398_401del		Atlas-INDEL	.											.	NLGN4Y	44	.	0			c.1194_1201del						.																																			SO:0001624	3_prime_UTR_variant	22829	exon5			.		CCDS14788.1, CCDS55553.1, CCDS56619.1	Yq11.221	2013-09-20	2004-05-21		ENSG00000165246	ENSG00000165246			15529	protein-coding gene	gene with protein product		400028	"""neuroligin 4, Y linked"""			10231032	Standard	NM_014893		Approved	KIAA0951	uc004ftg.2	Q8NFZ3	OTTHUMG00000036618	ENST00000476359.1:c.*1744GTGTCCAA>-	chrY.hg19:g.16941993_16942000delGTGTCCAA		290.0	0.0		223.0	36.0	NM_014893	F5H6W0|Q14D08|Q7Z3T5|Q8N5B6|Q9Y2F8	Frame_Shift_Del	DEL	ENST00000476359.1	hg19																																																																																				.	.		0.543	NLGN4Y-004	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000089064.2	NM_014893	
NLGN4Y	22829	hgsc.bcm.edu	37	Y	16942005	16942017	+	3'UTR	DEL	GTGGACAACCTTT	GTGGACAACCTTT	-			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	GTGGACAACCTTT	GTGGACAACCTTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chrY:16942005_16942017delGTGGACAACCTTT	ENST00000476359.1	+	0	1752_1764							Q8NFZ3	NLGNY_HUMAN	neuroligin 4, Y-linked						learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			large_intestine(3)|lung(7)|prostate(2)|skin(2)	14						GTCCAACTTCGTGGACAACCTTTACGGCTACCC	0.554																																					p.402_406del		Atlas-INDEL	.											.	NLGN4Y	44	.	0			c.1206_1218del						.																																			SO:0001624	3_prime_UTR_variant	22829	exon5			.		CCDS14788.1, CCDS55553.1, CCDS56619.1	Yq11.221	2013-09-20	2004-05-21		ENSG00000165246	ENSG00000165246			15529	protein-coding gene	gene with protein product		400028	"""neuroligin 4, Y linked"""			10231032	Standard	NM_014893		Approved	KIAA0951	uc004ftg.2	Q8NFZ3	OTTHUMG00000036618	ENST00000476359.1:c.*1761GTGGACAACCTTT>-	chrY.hg19:g.16942005_16942017delGTGGACAACCTTT		270.0	0.0		225.0	36.0	NM_014893	F5H6W0|Q14D08|Q7Z3T5|Q8N5B6|Q9Y2F8	Frame_Shift_Del	DEL	ENST00000476359.1	hg19																																																																																				.	.		0.554	NLGN4Y-004	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000089064.2	NM_014893	
UPF3B	65109	hgsc.bcm.edu	37	X	118975107	118975108	+	Frame_Shift_Ins	INS	-	-	A			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chrX:118975107_118975108insA	ENST00000276201.2	-	7	807_808	c.738_739insT	c.(736-741)gatatafs	p.I247fs	UPF3B_ENST00000345865.2_Frame_Shift_Ins_p.I247fs|UPF3B_ENST00000478840.1_5'UTR	NM_080632.2	NP_542199.1	Q9BZI7	REN3B_HUMAN	UPF3 regulator of nonsense transcripts homolog B (yeast)	247	Necessary for interaction with UPF2.|Sufficient for association with EJC core.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(12)|ovary(2)|prostate(1)	30						AGcttttctatatctttccttt	0.347																																					p.I247fs		Atlas-INDEL	.											.	UPF3B	74	.	0			c.739_740insT						.																																			SO:0001589	frameshift_variant	65109	exon7			.	AF318576	CCDS14587.1, CCDS14588.1	Xq25-q26	2014-01-31			ENSG00000125351	ENSG00000125351			20439	protein-coding gene	gene with protein product		300298	"""mental retardation, X-linked 62"""	MRX62		11113196, 11163187, 19238151	Standard	NM_023010		Approved	RENT3B, UPF3X, HUPF3B	uc004erz.2	Q9BZI7	OTTHUMG00000022282	ENST00000276201.2:c.739dupT	chrX.hg19:g.118975108_118975108dupA	ENSP00000276201:p.Ile247fs	40.0	0.0		53.0	33.0	NM_023010	D3DWI3|D3DWI4|Q0VAK8|Q9H1J0	Frame_Shift_Ins	INS	ENST00000276201.2	hg19	CCDS14588.1																																																																																			.	.		0.347	UPF3B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058068.1		
ALB	213	hgsc.bcm.edu	37	4	74272459	74272459	+	Frame_Shift_Del	DEL	A	A	-			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr4:74272459delA	ENST00000503124.1	+	2	220	c.13delA	c.(13-15)aaafs	p.K5fs	ALB_ENST00000295897.4_Frame_Shift_Del_p.E84fs|ALB_ENST00000509063.1_Frame_Shift_Del_p.E84fs|ALB_ENST00000415165.2_Intron|ALB_ENST00000401494.3_Intron			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GAGTCAGCTGAAAATTGTGAC	0.318																																					p.E84fs		Atlas-INDEL	.											.,1	ALB	132	.	0			c.250delG						.						98.0	91.0	93.0					4																	74272459		2203	4300	6503	SO:0001589	frameshift_variant	213	exon3			.	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.13delA	chr4.hg19:g.74272459delA	ENSP00000421027:p.Lys5fs	92.0	0.0		75.0	12.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Frame_Shift_Del	DEL	ENST00000503124.1	hg19																																																																																				.	.		0.318	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477	
TBX18	9096	hgsc.bcm.edu	37	6	85446692	85446699	+	Frame_Shift_Del	DEL	TGGTTAGT	TGGTTAGT	-			TCGA-WQ-AB4B-01A-11D-A40P-10	TCGA-WQ-AB4B-10A-01D-A40P-10	TGGTTAGT	TGGTTAGT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1df28a1-65e0-4a10-b05b-7e20735cf012	3fa70dca-15c8-4428-978e-0c1403b4f704	g.chr6:85446692_85446699delTGGTTAGT	ENST00000369663.5	-	8	1865_1872	c.1528_1535delACTAACCA	c.(1528-1536)actaaccagfs	p.TNQ510fs	TBX18_ENST00000606784.1_Intron	NM_001080508.1	NP_001073977.1	O95935	TBX18_HUMAN	T-box 18	510					anterior/posterior axis specification (GO:0009948)|cochlea morphogenesis (GO:0090103)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060829)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal cell proliferation involved in ureter development (GO:2000729)|sensory perception of sound (GO:0007605)|sinoatrial node development (GO:0003163)|smooth muscle cell differentiation (GO:0051145)|somitogenesis (GO:0001756)|ureter development (GO:0072189)	nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(9)|liver(1)|lung(31)|ovary(2)|pancreas(3)|prostate(6)|skin(3)	61		all_cancers(76;0.000283)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0858)		BRCA - Breast invasive adenocarcinoma(108;0.0267)		CTGATGGGTCTGGTTAGTGGCGAAGGCA	0.51																																					p.510_512del		Atlas-INDEL	.											.	TBX18	131	.	0			c.1529_1536del						.																																			SO:0001589	frameshift_variant	9096	exon8			.	AJ010278	CCDS34495.1	6q14.1-q15	2012-12-19			ENSG00000112837	ENSG00000112837		"""T-boxes"""	11595	protein-coding gene	gene with protein product		604613				9888994, 16688725, 23242162	Standard	NM_001080508		Approved		uc003pkl.2	O95935	OTTHUMG00000015129	ENST00000369663.5:c.1528_1535delACTAACCA	chr6.hg19:g.85446692_85446699delTGGTTAGT	ENSP00000358677:p.Thr510fs	174.0	0.0		129.0	28.0	NM_001080508	A2RU13|Q7Z6U4|Q9UJI6	Frame_Shift_Del	DEL	ENST00000369663.5	hg19	CCDS34495.1																																																																																			.	.		0.510	TBX18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041378.2	NM_001080508	
