#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
NADK	65220	hgsc.bcm.edu	37	1	1684446	1684446	+	Missense_Mutation	SNP	G	G	T			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr1:1684446G>T	ENST00000341426.5	-	12	1459	c.1238C>A	c.(1237-1239)cCc>cAc	p.P413H	NADK_ENST00000378625.1_Missense_Mutation_p.P558H|NADK_ENST00000342348.5_Missense_Mutation_p.P381H|NADK_ENST00000344463.4_Missense_Mutation_p.P558H|NADK_ENST00000341991.3_Missense_Mutation_p.P413H	NM_023018.4	NP_075394.3	O95544	NADK_HUMAN	NAD kinase	413					ATP metabolic process (GO:0046034)|NAD metabolic process (GO:0019674)|NADP biosynthetic process (GO:0006741)|phosphorylation (GO:0016310)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			NS(1)|autonomic_ganglia(1)|endometrium(4)|large_intestine(2)|lung(4)|ovary(1)|prostate(2)|stomach(1)|urinary_tract(1)	17	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.61e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;8.75e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.33e-23)|GBM - Glioblastoma multiforme(42;1.35e-07)|Colorectal(212;0.000203)|COAD - Colon adenocarcinoma(227;0.000225)|Kidney(185;0.00265)|STAD - Stomach adenocarcinoma(132;0.00655)|BRCA - Breast invasive adenocarcinoma(365;0.00855)|KIRC - Kidney renal clear cell carcinoma(229;0.0382)|Lung(427;0.207)		GTCGCTCACGGGGTCCCGCAC	0.637																																					p.P558H		Atlas-SNP	.											.	NADK	79	.	0			c.C1673A						.						45.0	32.0	36.0					1																	1684446		2200	4299	6499	SO:0001583	missense	65220	exon14			CTCACGGGGTCCC	BC001709	CCDS30565.1, CCDS55561.1, CCDS55562.1	1p36.33	2013-04-29			ENSG00000008130	ENSG00000008130	2.7.1.23		29831	protein-coding gene	gene with protein product		611616				11594753	Standard	NM_023018		Approved	FLJ13052	uc001aie.3	O95544	OTTHUMG00000000942	ENST00000341426.5:c.1238C>A	chr1.hg19:g.1684446G>T	ENSP00000341679:p.Pro413His	197.0	0.0		128.0	43.0	NM_001198994	A6NNN3|A8K296|B7Z434|F5GXR5|Q5QPS4|Q9H2P2|Q9H931	Missense_Mutation	SNP	ENST00000341426.5	hg19	CCDS30565.1	.	.	.	.	.	.	.	.	.	.	G	19.98	3.926685	0.73327	.	.	ENSG00000008130	ENST00000341426;ENST00000341991;ENST00000378625;ENST00000344463;ENST00000342348	T;T;T;T;T	0.40756	1.02;1.02;1.02;1.02;1.02	5.22	4.29	0.51040	ATP-NAD kinase, PpnK-type (1);	0.000000	0.85682	D	0.000000	T	0.44705	0.1306	M	0.72118	2.19	0.52501	D	0.999958	B;B;B	0.27192	0.171;0.049;0.157	B;B;B	0.28011	0.085;0.027;0.04	T	0.43940	-0.9360	10	0.51188	T	0.08	-16.1012	13.7765	0.63057	0.0:0.0:0.8449:0.1551	.	381;558;413	F5GXR5;Q5QPS4;O95544	.;.;NADK_HUMAN	H	413;413;558;558;381	ENSP00000341679:P413H;ENSP00000344340:P413H;ENSP00000367890:P558H;ENSP00000340925:P558H;ENSP00000339727:P381H	ENSP00000341679:P413H	P	-	2	0	NADK	1674306	1.000000	0.71417	0.620000	0.29132	0.978000	0.69477	5.978000	0.70501	1.181000	0.42912	0.561000	0.74099	CCC	.	.		0.637	NADK-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000002769.1	NM_023018	
PLCH2	9651	hgsc.bcm.edu	37	1	2430060	2430060	+	Missense_Mutation	SNP	G	G	A			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr1:2430060G>A	ENST00000419816.2	+	17	2597	c.2323G>A	c.(2323-2325)Gac>Aac	p.D775N	PLCH2_ENST00000378488.3_Missense_Mutation_p.D739N|PLCH2_ENST00000378486.3_Missense_Mutation_p.D775N|PLCH2_ENST00000449969.1_Missense_Mutation_p.D748N|PLCH2_ENST00000288766.5_Intron			O75038	PLCH2_HUMAN	phospholipase C, eta 2	775	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phosphatidylinositol metabolic process (GO:0046488)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(3)|skin(1)	20	all_cancers(77;0.000161)|all_epithelial(69;5.98e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;7.32e-16)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.44e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.78e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;4.19e-05)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00034)|BRCA - Breast invasive adenocarcinoma(365;0.00443)|KIRC - Kidney renal clear cell carcinoma(229;0.00548)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.2)		CAAGCCGCGCGACTCCATGCT	0.706																																					p.D775N		Atlas-SNP	.											.	PLCH2	131	.	0			c.G2323A						.						9.0	10.0	10.0					1																	2430060		1884	4063	5947	SO:0001583	missense	9651	exon17			CCGCGCGACTCCA	AB007919	CCDS59959.1	1p36.32	2013-01-10	2006-03-16	2006-03-16	ENSG00000149527	ENSG00000149527	3.1.4.11	"""EF-hand domain containing"""	29037	protein-coding gene	gene with protein product		612836	"""phospholipase C-like 4"""	PLCL4		15899900	Standard	XM_006711054		Approved	KIAA0450, PLCeta2, RP3-395M20.1, PLC-eta2	uc001aji.1	O75038	OTTHUMG00000000719	ENST00000419816.2:c.2323G>A	chr1.hg19:g.2430060G>A	ENSP00000389803:p.Asp775Asn	237.0	0.0		128.0	31.0	NM_014638	A2VCM3|B9DI80|Q3LUA8|Q86XJ2|Q86XU1|Q86YU7|Q8TEH5|Q8WUS6	Missense_Mutation	SNP	ENST00000419816.2	hg19		.	.	.	.	.	.	.	.	.	.	G	29.9	5.044346	0.93685	.	.	ENSG00000149527	ENST00000449969;ENST00000378486;ENST00000378488;ENST00000343889;ENST00000278878	T;T;T	0.26660	1.91;1.87;1.72	4.84	4.84	0.62591	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	2.401790	0.01812	N	0.033481	T	0.41743	0.1172	N	0.17278	0.47	0.80722	D	1	D;D;D;D	0.76494	0.996;0.999;0.995;0.996	P;D;P;D	0.68039	0.905;0.955;0.808;0.929	T	0.19614	-1.0300	10	0.38643	T	0.18	.	16.9045	0.86123	0.0:0.0:1.0:0.0	.	622;527;748;775	B9DI81;B9DI82;O75038-2;O75038	.;.;.;PLCH2_HUMAN	N	748;775;739;622;527	ENSP00000397289:D748N;ENSP00000367747:D775N;ENSP00000367749:D739N	ENSP00000278878:D527N	D	+	1	0	PLCH2	2419920	1.000000	0.71417	0.936000	0.37596	0.701000	0.40568	9.076000	0.94009	2.224000	0.72417	0.561000	0.74099	GAC	.	.		0.706	PLCH2-009	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000467514.1	NM_014638	
AK2	204	hgsc.bcm.edu	37	1	33478935	33478935	+	Silent	SNP	G	G	T			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr1:33478935G>T	ENST00000373449.2	-	6	608	c.567C>A	c.(565-567)gcC>gcA	p.A189A	AK2_ENST00000548033.1_Silent_p.A147A|AK2_ENST00000491241.1_5'Flank|AK2_ENST00000467905.1_Silent_p.A189A|AK2_ENST00000480134.1_3'UTR|AK2_ENST00000354858.6_Silent_p.A189A|RP1-117O3.2_ENST00000427524.1_RNA	NM_001199199.1|NM_013411.4	NP_001186128.1|NP_037543.1			adenylate kinase 2											kidney(1)|large_intestine(2)|lung(4)|skin(1)	8		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)				GAGTGTGGTAGGCTTGCAGGC	0.532																																					p.A189A		Atlas-SNP	.											.	AK2	27	.	0			c.C567A						.						112.0	103.0	106.0					1																	33478935		2203	4300	6503	SO:0001819	synonymous_variant	204	exon6			GTGGTAGGCTTGC	U84371	CCDS373.1, CCDS374.1	1p35.1	2014-09-17			ENSG00000004455	ENSG00000004455	2.7.4.3	"""Adenylate kinases"""	362	protein-coding gene	gene with protein product		103020				8843353, 6961883	Standard	NM_013411		Approved		uc001bwp.2	P54819	OTTHUMG00000004131	ENST00000373449.2:c.567C>A	chr1.hg19:g.33478935G>T		106.0	0.0		82.0	4.0	NM_013411		Silent	SNP	ENST00000373449.2	hg19	CCDS373.1																																																																																			.	.		0.532	AK2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011884.1	NM_001625	
KIAA0319L	79932	hgsc.bcm.edu	37	1	35972470	35972470	+	Missense_Mutation	SNP	C	C	T			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr1:35972470C>T	ENST00000325722.3	-	3	643	c.409G>A	c.(409-411)Gca>Aca	p.A137T		NM_024874.4	NP_079150.3	Q8IZA0	K319L_HUMAN	KIAA0319-like	137						cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(12)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	34		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				AAATCATCTGCAGTTTGGAAT	0.512																																					p.A137T		Atlas-SNP	.											.	KIAA0319L	156	.	0			c.G409A						.						80.0	88.0	86.0					1																	35972470		2203	4300	6503	SO:0001583	missense	79932	exon3			CATCTGCAGTTTG	AY163234	CCDS390.1	1p34.3	2008-10-24			ENSG00000142687	ENSG00000142687			30071	protein-coding gene	gene with protein product		613535				11347906	Standard	NM_024874		Approved	KIAA1837	uc001byx.3	Q8IZA0	OTTHUMG00000004370	ENST00000325722.3:c.409G>A	chr1.hg19:g.35972470C>T	ENSP00000318406:p.Ala137Thr	137.0	0.0		140.0	45.0	NM_024874	B1AN13|D3DPR8|O95010|Q6PJJ7|Q7L1C9|Q8N2B3|Q8NDA0|Q8WY39|Q8WYZ5|Q96IC3|Q96JJ0|Q9BUW6|Q9H7V0	Missense_Mutation	SNP	ENST00000325722.3	hg19	CCDS390.1	.	.	.	.	.	.	.	.	.	.	C	5.576	0.291067	0.10567	.	.	ENSG00000142687	ENST00000325722;ENST00000426982;ENST00000440579;ENST00000373258;ENST00000469892;ENST00000494948	T;T;T;T;T	0.44881	3.24;3.24;2.75;1.54;0.91	5.78	2.86	0.33363	.	0.960190	0.08638	N	0.915916	T	0.23289	0.0563	N	0.12746	0.255	0.09310	N	1	B;B;B	0.23185	0.081;0.028;0.0	B;B;B	0.20184	0.028;0.007;0.001	T	0.29027	-1.0025	10	0.13108	T	0.6	0.6907	7.8738	0.29582	0.0:0.6577:0.0:0.3423	.	137;137;137	B4DYG9;B1AN14;Q8IZA0	.;.;K319L_HUMAN	T	137	ENSP00000318406:A137T;ENSP00000395883:A137T;ENSP00000407576:A137T;ENSP00000362355:A137T;ENSP00000419396:A137T	ENSP00000318406:A137T	A	-	1	0	KIAA0319L	35745057	0.124000	0.22315	0.000000	0.03702	0.506000	0.33950	0.197000	0.17197	0.338000	0.23692	0.655000	0.94253	GCA	.	.		0.512	KIAA0319L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012684.2	NM_024874	
AMPD2	271	hgsc.bcm.edu	37	1	110173592	110173592	+	Missense_Mutation	SNP	T	T	A			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr1:110173592T>A	ENST00000256578.3	+	18	2818	c.2458T>A	c.(2458-2460)Tat>Aat	p.Y820N	AMPD2_ENST00000528667.1_Missense_Mutation_p.Y820N|AMPD2_ENST00000528454.1_Missense_Mutation_p.Y702N|AMPD2_ENST00000393688.3_Missense_Mutation_p.Y701N|RP5-1160K1.6_ENST00000369843.3_RNA|AMPD2_ENST00000342115.4_Missense_Mutation_p.Y739N|AMPD2_ENST00000358729.4_Missense_Mutation_p.Y745N	NM_004037.7	NP_004028.3	Q01433	AMPD2_HUMAN	adenosine monophosphate deaminase 2	820					cell death (GO:0008219)|cyclic purine nucleotide metabolic process (GO:0052652)|energy homeostasis (GO:0097009)|IMP biosynthetic process (GO:0006188)|IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			breast(1)|large_intestine(3)|ovary(2)|skin(1)	7		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Lung(183;0.0425)|all cancers(265;0.0884)|Colorectal(144;0.109)|Epithelial(280;0.111)|LUSC - Lung squamous cell carcinoma(189;0.228)		GGGACCCAACTATACCAAGGA	0.637																																					p.Y820N		Atlas-SNP	.											.	AMPD2	75	.	0			c.T2458A						.						45.0	49.0	48.0					1																	110173592		2203	4300	6503	SO:0001583	missense	271	exon18			CCCAACTATACCA	S47833	CCDS804.1, CCDS805.1, CCDS30796.1, CCDS58016.1	1p13.3	2014-03-03	2010-02-10		ENSG00000116337	ENSG00000116337	3.5.4.6		469	protein-coding gene	gene with protein product	"""AMPD isoform L"""	102771	"""adenosine monophosphate deaminase 2 (isoform L)"""			1400401, 24482476	Standard	NM_004037		Approved	SPG63	uc009wfh.2	Q01433	OTTHUMG00000011649	ENST00000256578.3:c.2458T>A	chr1.hg19:g.110173592T>A	ENSP00000256578:p.Tyr820Asn	304.0	0.0		238.0	60.0	NM_004037	B4DK50|B4DZI5|E9PNG0|Q14856|Q14857|Q16686|Q16687|Q16688|Q16729|Q5T693|Q5T695|Q96IA1|Q9UDX8|Q9UDX9|Q9UMU4	Missense_Mutation	SNP	ENST00000256578.3	hg19	CCDS805.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	28.6|28.6	4.933508|4.933508	0.92458|0.92458	.|.	.|.	ENSG00000116337|ENSG00000116337	ENST00000369840|ENST00000342115;ENST00000528667;ENST00000256578;ENST00000358729;ENST00000528454;ENST00000393688	.|D;D;D;D;D;D	.|0.83075	.|-1.68;-1.68;-1.68;-1.68;-1.68;-1.68	4.89|4.89	4.89|4.89	0.63831|0.63831	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.90359|0.90359	0.6983|0.6983	M|M	0.89601|0.89601	3.045|3.045	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;0.997;1.0	.|D;D;P;D	.|0.66847	.|0.944;0.947;0.862;0.947	D|D	0.92145|0.92145	0.5723|0.5723	5|10	.|0.66056	.|D	.|0.02	-20.7374|-20.7374	13.6159|13.6159	0.62108|0.62108	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|745;701;820;739	.|Q01433-4;Q01433-3;Q01433;Q01433-2	.|.;.;AMPD2_HUMAN;.	Q|N	801|739;820;820;745;702;701	.|ENSP00000345498:Y739N;ENSP00000436541:Y820N;ENSP00000256578:Y820N;ENSP00000351573:Y745N;ENSP00000437164:Y702N;ENSP00000377292:Y701N	.|ENSP00000256578:Y820N	L|Y	+|+	2|1	0|0	AMPD2|AMPD2	109975115|109975115	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.959000|0.959000	0.62525|0.62525	4.888000|4.888000	0.63164|0.63164	2.064000|2.064000	0.61679|0.61679	0.459000|0.459000	0.35465|0.35465	CTA|TAT	.	.		0.637	AMPD2-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390615.1		
PGLYRP4	57115	hgsc.bcm.edu	37	1	153317739	153317739	+	Missense_Mutation	SNP	G	G	T			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr1:153317739G>T	ENST00000359650.5	-	4	323	c.259C>A	c.(259-261)Ctg>Atg	p.L87M	PGLYRP4_ENST00000490266.1_5'UTR|PGLYRP4_ENST00000368739.3_Missense_Mutation_p.L83M	NM_020393.2	NP_065126.2	Q96LB8	PGRP4_HUMAN	peptidoglycan recognition protein 4	87					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(4)|lung(10)|ovary(3)|prostate(1)|skin(1)|stomach(1)	23	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)			TGACACTCCAGTCCAGGGACA	0.557																																					p.L87M		Atlas-SNP	.											.	PGLYRP4	45	.	0			c.C259A						.						125.0	105.0	112.0					1																	153317739		2203	4300	6503	SO:0001583	missense	57115	exon4			ACTCCAGTCCAGG	AF242518	CCDS30871.1	1q21	2008-02-05			ENSG00000163218	ENSG00000163218			30015	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein I beta precursor"""	608198				11461926	Standard	XR_241090		Approved	SBBI67, PGRPIB, PGLYRPIbeta, PGRP-Ibeta	uc001fbo.3	Q96LB8	OTTHUMG00000037057	ENST00000359650.5:c.259C>A	chr1.hg19:g.153317739G>T	ENSP00000352672:p.Leu87Met	27.0	0.0		57.0	36.0	NM_020393	A8K838|Q3B822|Q3B823|Q5SY63|Q5SY64|Q9HD75	Missense_Mutation	SNP	ENST00000359650.5	hg19	CCDS30871.1	.	.	.	.	.	.	.	.	.	.	G	4.518	0.096149	0.08681	.	.	ENSG00000163218	ENST00000368739;ENST00000359650	T;T	0.13778	2.56;2.56	3.2	1.2	0.21068	Peptidoglycan recognition protein family domain, metazoa/bacteria (1);N-acetylmuramoyl-L-alanine amidase domain (4);	.	.	.	.	T	0.02012	0.0063	N	0.10733	0.035	0.09310	N	0.999995	B;B	0.33826	0.427;0.344	B;B	0.33392	0.101;0.163	T	0.42258	-0.9462	9	0.54805	T	0.06	-10.9919	5.8315	0.18582	0.2582:0.0:0.7418:0.0	.	83;87	Q96LB8-2;Q96LB8	.;PGRP4_HUMAN	M	83;87	ENSP00000357728:L83M;ENSP00000352672:L87M	ENSP00000352672:L87M	L	-	1	2	PGLYRP4	151584363	0.031000	0.19500	0.400000	0.26346	0.156000	0.22039	-0.096000	0.11059	0.180000	0.19960	0.313000	0.20887	CTG	.	.		0.557	PGLYRP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000089978.1	NM_020393	
LYST	1130	hgsc.bcm.edu	37	1	235892901	235892901	+	Missense_Mutation	SNP	A	A	G			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr1:235892901A>G	ENST00000389794.3	-	37	9275	c.9101T>C	c.(9100-9102)tTa>tCa	p.L3034S	LYST_ENST00000389793.2_Missense_Mutation_p.L3034S|LYST_ENST00000473037.1_5'UTR			Q99698	LYST_HUMAN	lysosomal trafficking regulator	3034					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			CTTACCTAGTAACAATTCACC	0.328																																					p.L3034S		Atlas-SNP	.											.	LYST	370	.	0			c.T9101C						.						93.0	88.0	90.0					1																	235892901		2202	4299	6501	SO:0001583	missense	1130	exon37			CCTAGTAACAATT	U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.9101T>C	chr1.hg19:g.235892901A>G	ENSP00000374444:p.Leu3034Ser	51.0	0.0		95.0	17.0	NM_000081	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	ENST00000389794.3	hg19	CCDS31062.1	.	.	.	.	.	.	.	.	.	.	A	25.6	4.651337	0.88056	.	.	ENSG00000143669	ENST00000389794;ENST00000389793	T;T	0.64085	-0.08;-0.08	5.78	5.78	0.91487	PH-BEACH domain (1);	0.000000	0.85682	D	0.000000	T	0.78432	0.4282	M	0.69823	2.125	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.79359	-0.1836	10	0.51188	T	0.08	.	16.1167	0.81309	1.0:0.0:0.0:0.0	.	3034	Q99698	LYST_HUMAN	S	3034	ENSP00000374444:L3034S;ENSP00000374443:L3034S	ENSP00000374443:L3034S	L	-	2	0	LYST	233959524	1.000000	0.71417	0.997000	0.53966	0.979000	0.70002	8.862000	0.92283	2.204000	0.70986	0.528000	0.53228	TTA	.	.		0.328	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5		
FMN2	56776	hgsc.bcm.edu	37	1	240493999	240493999	+	Missense_Mutation	SNP	G	G	T			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr1:240493999G>T	ENST00000319653.9	+	11	4764	c.4534G>T	c.(4534-4536)Gat>Tat	p.D1512Y	FMN2_ENST00000545751.1_Missense_Mutation_p.D108Y	NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1512	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			AGGACAGGCAGATGGCTTTGG	0.423																																					p.D1512Y		Atlas-SNP	.											.	FMN2	451	.	0			c.G4534T						.						144.0	134.0	137.0					1																	240493999		2203	4300	6503	SO:0001583	missense	56776	exon11			CAGGCAGATGGCT	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.4534G>T	chr1.hg19:g.240493999G>T	ENSP00000318884:p.Asp1512Tyr	74.0	0.0		141.0	60.0	NM_020066	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	ENST00000319653.9	hg19	CCDS31069.2	.	.	.	.	.	.	.	.	.	.	G	34	5.292763	0.95546	.	.	ENSG00000155816	ENST00000319653;ENST00000545751;ENST00000537355	T;T	0.17528	2.27;2.27	5.67	5.67	0.87782	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.000000	0.64402	D	0.000006	T	0.42539	0.1207	M	0.64630	1.985	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.07770	-1.0755	10	0.49607	T	0.09	.	19.7714	0.96367	0.0:0.0:1.0:0.0	.	108;158;141;1512	B4DP05;F5H2C1;B4DN09;Q9NZ56	.;.;.;FMN2_HUMAN	Y	1512;108;139	ENSP00000318884:D1512Y;ENSP00000437918:D108Y	ENSP00000318884:D1512Y	D	+	1	0	FMN2	238560622	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	9.814000	0.99346	2.666000	0.90696	0.655000	0.94253	GAT	.	.		0.423	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
KLF11	8462	hgsc.bcm.edu	37	2	10188153	10188153	+	Missense_Mutation	SNP	C	C	G	rs370039403		TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr2:10188153C>G	ENST00000305883.1	+	3	851	c.689C>G	c.(688-690)tCc>tGc	p.S230C	KLF11_ENST00000540845.1_Missense_Mutation_p.S213C|KLF11_ENST00000535335.1_Missense_Mutation_p.S213C	NM_003597.4	NP_003588.1	O14901	KLF11_HUMAN	Kruppel-like factor 11	230					apoptotic process (GO:0006915)|cellular response to peptide (GO:1901653)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.133)|OV - Ovarian serous cystadenocarcinoma(76;0.228)		AACTTGGTGTCCTGTCAGCCC	0.532																																					p.S230C	Melanoma(56;431 1507 23687 50789)	Atlas-SNP	.											.	KLF11	45	.	0			c.C689G						.						101.0	95.0	97.0					2																	10188153		2203	4300	6503	SO:0001583	missense	8462	exon3			TGGTGTCCTGTCA	AF028008	CCDS1668.1, CCDS54333.1	2p25	2013-01-08	2004-11-29	2004-12-01	ENSG00000172059	ENSG00000172059		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	11811	protein-coding gene	gene with protein product		603301	"""TGFB inducible early growth response 2"""	TIEG2		9748269, 11087666	Standard	NM_001177716		Approved	Tieg3, MODY7	uc002raf.1	O14901	OTTHUMG00000119004	ENST00000305883.1:c.689C>G	chr2.hg19:g.10188153C>G	ENSP00000307023:p.Ser230Cys	102.0	0.0		64.0	17.0	NM_003597	B4DZE7|Q9EPF4	Missense_Mutation	SNP	ENST00000305883.1	hg19	CCDS1668.1	.	.	.	.	.	.	.	.	.	.	C	14.51	2.557236	0.45590	.	.	ENSG00000172059	ENST00000305883;ENST00000540845;ENST00000535335	T;T;T	0.15372	2.45;2.43;2.43	5.26	4.36	0.52297	.	0.610386	0.15778	N	0.245094	T	0.28433	0.0703	M	0.67953	2.075	0.09310	N	1	D	0.71674	0.998	P	0.54270	0.747	T	0.13229	-1.0517	9	.	.	.	.	6.7518	0.23491	0.1727:0.7118:0.0:0.1155	.	230	O14901	KLF11_HUMAN	C	230;213;213	ENSP00000307023:S230C;ENSP00000444690:S213C;ENSP00000442722:S213C	.	S	+	2	0	KLF11	10105604	0.018000	0.18449	0.116000	0.21606	0.710000	0.40934	1.819000	0.39022	1.154000	0.42482	0.407000	0.27541	TCC	.	.		0.532	KLF11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000239202.3	NM_003597	
ABCG5	64240	hgsc.bcm.edu	37	2	44041621	44041621	+	Missense_Mutation	SNP	G	G	C			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr2:44041621G>C	ENST00000260645.1	-	12	1896	c.1757C>G	c.(1756-1758)aCt>aGt	p.T586S	ABCG5_ENST00000543989.1_Missense_Mutation_p.T191S|ABCG5_ENST00000405322.1_Missense_Mutation_p.T415S	NM_022436.2	NP_071881.1	Q9H222	ABCG5_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 5	586	ABC transmembrane type-2.				ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|excretion (GO:0007588)|intestinal cholesterol absorption (GO:0030299)|negative regulation of intestinal cholesterol absorption (GO:0045796)|negative regulation of intestinal phytosterol absorption (GO:0010949)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cholesterol transporter activity (GO:0017127)|protein heterodimerization activity (GO:0046982)			breast(1)|kidney(2)|large_intestine(4)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	33		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)			Ezetimibe(DB00973)	CTTACCACAAGTGAAATTCAG	0.308																																					p.T586S		Atlas-SNP	.											.	ABCG5	72	.	0			c.C1757G						.						71.0	71.0	71.0					2																	44041621		2202	4294	6496	SO:0001583	missense	64240	exon12			CCACAAGTGAAAT	T93792	CCDS1814.1	2p21	2012-03-14	2008-07-31		ENSG00000138075	ENSG00000138075		"""ATP binding cassette transporters / subfamily G"""	13886	protein-coding gene	gene with protein product	"""sterolin 1"""	605459				11099417, 11452359	Standard	NM_022436		Approved	STSL	uc002rtn.3	Q9H222	OTTHUMG00000128758	ENST00000260645.1:c.1757C>G	chr2.hg19:g.44041621G>C	ENSP00000260645:p.Thr586Ser	240.0	0.0		199.0	53.0	NM_022436	Q2T9G2|Q96QZ2|Q96QZ3	Missense_Mutation	SNP	ENST00000260645.1	hg19	CCDS1814.1	.	.	.	.	.	.	.	.	.	.	G	19.40	3.819732	0.71028	.	.	ENSG00000138075	ENST00000260645;ENST00000405322;ENST00000543989	D;T;T	0.90004	-2.6;-1.21;1.1	5.09	4.22	0.49857	.	0.923410	0.09161	N	0.840237	D	0.92519	0.7624	M	0.61703	1.905	0.52099	D	0.999949	P;D	0.76494	0.695;0.999	B;D	0.80764	0.383;0.994	D	0.86197	0.1616	10	0.08599	T	0.76	.	13.493	0.61407	0.0759:0.0:0.9241:0.0	.	415;586	E7EX35;Q9H222	.;ABCG5_HUMAN	S	586;415;191	ENSP00000260645:T586S;ENSP00000384513:T415S;ENSP00000445107:T191S	ENSP00000260645:T586S	T	-	2	0	ABCG5	43895125	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.419000	0.66435	1.369000	0.46134	0.557000	0.71058	ACT	.	.		0.308	ABCG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250675.1	NM_022436	
GALNT5	11227	hgsc.bcm.edu	37	2	158140942	158140942	+	Missense_Mutation	SNP	G	G	C			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr2:158140942G>C	ENST00000259056.4	+	2	2088	c.1603G>C	c.(1603-1605)Gat>Cat	p.D535H		NM_014568.1	NP_055383.1	Q7Z7M9	GALT5_HUMAN	polypeptide N-acetylgalactosaminyltransferase 5	535	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|glycosaminoglycan biosynthetic process (GO:0006024)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(4)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	56						TCTGCTGGTAGATGACTTCAG	0.438																																					p.D535H		Atlas-SNP	.											.	GALNT5	112	.	0			c.G1603C						.						150.0	125.0	133.0					2																	158140942		2203	4300	6503	SO:0001583	missense	11227	exon2			CTGGTAGATGACT	AJ245539	CCDS2203.1	2q24.1	2014-03-13	2014-03-13		ENSG00000136542	ENSG00000136542	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4127	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 5"""	615129	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 (GalNAc-T5)"""			10545594	Standard	NM_014568		Approved	GalNAc-T5	uc002tzg.3	Q7Z7M9	OTTHUMG00000131965	ENST00000259056.4:c.1603G>C	chr2.hg19:g.158140942G>C	ENSP00000259056:p.Asp535His	47.0	0.0		88.0	26.0	NM_014568	A5PKZ1|Q9UGK7|Q9UHL6	Missense_Mutation	SNP	ENST00000259056.4	hg19	CCDS2203.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.686456	0.88639	.	.	ENSG00000136542	ENST00000259056	T	0.75704	-0.96	5.3	5.3	0.74995	Glycosyl transferase, family 2 (1);	0.047140	0.85682	D	0.000000	D	0.90738	0.7093	H	0.95745	3.715	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.92849	0.6295	10	0.87932	D	0	.	19.4456	0.94845	0.0:0.0:1.0:0.0	.	535	Q7Z7M9	GALT5_HUMAN	H	535	ENSP00000259056:D535H	ENSP00000259056:D535H	D	+	1	0	GALNT5	157849188	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	9.785000	0.99042	2.861000	0.98227	0.655000	0.94253	GAT	.	.		0.438	GALNT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254925.2	NM_014568	
FRZB	2487	hgsc.bcm.edu	37	2	183703315	183703315	+	Nonsense_Mutation	SNP	T	T	A			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr2:183703315T>A	ENST00000295113.4	-	4	1228	c.619A>T	c.(619-621)Aag>Tag	p.K207*		NM_001463.3	NP_001454.2	Q92765	SFRP3_HUMAN	frizzled-related protein	207	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				brain development (GO:0007420)|cochlea morphogenesis (GO:0090103)|convergent extension involved in organogenesis (GO:0060029)|epithelium development (GO:0060429)|gonad development (GO:0008406)|mammary gland involution (GO:0060056)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell development (GO:0010721)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of hepatocyte differentiation (GO:0070367)|negative regulation of Wnt signaling pathway (GO:0030178)|neural crest cell differentiation (GO:0014033)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fat cell differentiation (GO:0045600)|skeletal system development (GO:0001501)|somite development (GO:0061053)|vasculature development (GO:0001944)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane (GO:0016020)	PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)	21			OV - Ovarian serous cystadenocarcinoma(117;0.109)|Epithelial(96;0.231)			CACTTAGTCTTTATCTCTTTA	0.398																																					p.K207X		Atlas-SNP	.											.	FRZB	42	.	0			c.A619T						.						116.0	111.0	113.0					2																	183703315		2203	4300	6503	SO:0001587	stop_gained	2487	exon4			TAGTCTTTATCTC	U24163	CCDS2286.1	2q32.1	2013-09-19			ENSG00000162998	ENSG00000162998		"""Secreted frizzled-related proteins"""	3959	protein-coding gene	gene with protein product		605083				8824257, 9118218	Standard	NM_001463		Approved	FRZB-PEN, FRZB1, SRFP3, FRP-3, SFRP3, FRE, FRITZ, FRZB-1, FZRB, hFIZ	uc002upa.2	Q92765	OTTHUMG00000132597	ENST00000295113.4:c.619A>T	chr2.hg19:g.183703315T>A	ENSP00000295113:p.Lys207*	71.0	0.0		106.0	33.0	NM_001463	O00181|Q99686	Nonsense_Mutation	SNP	ENST00000295113.4	hg19	CCDS2286.1	.	.	.	.	.	.	.	.	.	.	T	42	9.698131	0.99241	.	.	ENSG00000162998	ENST00000295113	.	.	.	5.15	4.0	0.46444	.	0.045057	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.8213	0.46606	0.0:0.0742:0.0:0.9258	.	.	.	.	X	207	.	ENSP00000295113:K207X	K	-	1	0	FRZB	183411560	1.000000	0.71417	0.470000	0.27216	0.973000	0.67179	7.975000	0.88055	0.817000	0.34445	0.455000	0.32223	AAG	.	.		0.398	FRZB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255808.1	NM_001463	
STK17B	9262	hgsc.bcm.edu	37	2	197010770	197010770	+	Silent	SNP	A	A	C			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr2:197010770A>C	ENST00000263955.4	-	4	631	c.345T>G	c.(343-345)ggT>ggG	p.G115G	STK17B_ENST00000409228.1_Silent_p.G115G	NM_004226.3	NP_004217.1	O94768	ST17B_HUMAN	serine/threonine kinase 17b	115	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of fibroblast apoptotic process (GO:2000271)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|kidney(2)|large_intestine(1)|lung(10)	15			OV - Ovarian serous cystadenocarcinoma(117;0.141)			AAATTTCTCCACCTGCAGCAC	0.318																																					p.G115G		Atlas-SNP	.											.	STK17B	28	.	0			c.T345G						.						51.0	49.0	50.0					2																	197010770		2203	4300	6503	SO:0001819	synonymous_variant	9262	exon4			TTCTCCACCTGCA	AB011421	CCDS2315.1	2q33.1	2008-02-05	2007-02-12		ENSG00000081320	ENSG00000081320			11396	protein-coding gene	gene with protein product	"""death-associated protein kinase-related 2"""	604727	"""serine/threonine kinase 17b (apoptosis-inducing)"""			9786912	Standard	NM_004226		Approved	DRAK2	uc002utk.3	O94768	OTTHUMG00000132735	ENST00000263955.4:c.345T>G	chr2.hg19:g.197010770A>C		55.0	0.0		89.0	28.0	NM_004226		Silent	SNP	ENST00000263955.4	hg19	CCDS2315.1																																																																																			.	.		0.318	STK17B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256092.2		
EPHA4	2043	hgsc.bcm.edu	37	2	222290755	222290755	+	Missense_Mutation	SNP	G	G	T			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr2:222290755G>T	ENST00000281821.2	-	17	2995	c.2954C>A	c.(2953-2955)cCc>cAc	p.P985H	EPHA4_ENST00000469354.1_5'Flank|EPHA4_ENST00000392071.4_Missense_Mutation_p.P934H|EPHA4_ENST00000409854.1_3'UTR|EPHA4_ENST00000409938.1_Missense_Mutation_p.P985H	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4	985					adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		GGCTCAGACGGGAACCATTCT	0.433																																					p.P985H		Atlas-SNP	.											.	EPHA4	263	.	0			c.C2954A						.						231.0	214.0	220.0					2																	222290755		2203	4300	6503	SO:0001583	missense	2043	exon17			CAGACGGGAACCA	L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.2954C>A	chr2.hg19:g.222290755G>T	ENSP00000281821:p.Pro985His	91.0	0.0		94.0	24.0	NM_004438	A8K2P1|B2R601|B7Z6Q8|Q2M380	Missense_Mutation	SNP	ENST00000281821.2	hg19	CCDS2447.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.171916	0.78452	.	.	ENSG00000116106	ENST00000281821;ENST00000409938;ENST00000392071	T;T;T	0.71817	-0.6;-0.6;-0.6	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.75221	0.3820	L	0.35288	1.05	0.80722	D	1	D	0.71674	0.998	P	0.61397	0.888	T	0.66276	-0.5964	10	0.13108	T	0.6	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	985	P54764	EPHA4_HUMAN	H	985;985;934	ENSP00000281821:P985H;ENSP00000386829:P985H;ENSP00000375923:P934H	ENSP00000281821:P985H	P	-	2	0	EPHA4	221998999	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.476000	0.97823	2.941000	0.99782	0.655000	0.94253	CCC	.	.		0.433	EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256836.3		
NCL	4691	hgsc.bcm.edu	37	2	232325441	232325441	+	Missense_Mutation	SNP	G	G	T	rs66781921|rs534320031	byFrequency	TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr2:232325441G>T	ENST00000322723.4	-	4	990	c.750C>A	c.(748-750)gaC>gaA	p.D250E	SNORD82_ENST00000365530.1_RNA	NM_005381.2	NP_005372.2	P19338	NUCL_HUMAN	nucleolin	250	Asp/Glu-rich (acidic).				angiogenesis (GO:0001525)|positive regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901838)	cell cortex (GO:0005938)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)|telomeric DNA binding (GO:0042162)	p.D250E(1)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(7)|ovary(2)|pancreas(2)|prostate(2)|skin(3)	35		Ovarian(221;1.34e-05)|Renal(207;0.0112)|Lung NSC(271;0.0339)|all_lung(227;0.0616)|all_hematologic(139;0.0748)|Hepatocellular(293;0.137)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.65e-111)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)|COAD - Colon adenocarcinoma(134;0.141)|STAD - Stomach adenocarcinoma(1183;0.18)		catcatcttcgtcgtcgtcgt	0.433																																					p.D250E		Atlas-SNP	.											NCL,NS,carcinoma,0,1	NCL	80	.	1	Substitution - Missense(1)	endometrium(1)	c.C750A						.						249.0	205.0	220.0					2																	232325441		2203	4300	6503	SO:0001583	missense	4691	exon4			ATCTTCGTCGTCG		CCDS33397.1	2q37.1	2013-09-19			ENSG00000115053	ENSG00000115053		"""RNA binding motif (RRM) containing"""	7667	protein-coding gene	gene with protein product		164035				2394707, 3409881	Standard	NM_005381		Approved	C23	uc002vru.3	P19338	OTTHUMG00000153866	ENST00000322723.4:c.750C>A	chr2.hg19:g.232325441G>T	ENSP00000318195:p.Asp250Glu	78.0	1.0		46.0	2.0	NM_005381	Q53SK1|Q8NB06|Q9UCF0|Q9UDG1	Missense_Mutation	SNP	ENST00000322723.4	hg19	CCDS33397.1	.	.	.	.	.	.	.	.	.	.	G	0.938	-0.710431	0.03230	.	.	ENSG00000115053	ENST00000322723	T	0.19938	2.11	5.46	-10.9	0.00192	.	0.806964	0.11391	N	0.568775	T	0.06826	0.0174	N	0.22421	0.69	0.26746	N	0.970293	B	0.02656	0.0	B	0.04013	0.001	T	0.27226	-1.0080	10	0.07030	T	0.85	-2.921	3.1311	0.06424	0.3801:0.1164:0.3434:0.1601	.	250	P19338	NUCL_HUMAN	E	250	ENSP00000318195:D250E	ENSP00000318195:D250E	D	-	3	2	NCL	232033685	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-10.346000	0.00006	-3.764000	0.00110	-0.259000	0.10710	GAC	.	.		0.433	NCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332731.1	NM_005381	
C3orf20	84077	hgsc.bcm.edu	37	3	14755616	14755616	+	Silent	SNP	C	C	T			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr3:14755616C>T	ENST00000253697.3	+	8	1715	c.1263C>T	c.(1261-1263)gcC>gcT	p.A421A	C3orf20_ENST00000495387.1_3'UTR|C3orf20_ENST00000412910.1_Silent_p.A299A|C3orf20_ENST00000435614.1_Silent_p.A299A	NM_032137.4	NP_115513.4	Q8ND61	CC020_HUMAN	chromosome 3 open reading frame 20	421						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(13)|lung(11)|ovary(4)|skin(2)	40						CCTTGCTGGCCCTATTCAATA	0.502																																					p.A421A		Atlas-SNP	.											.	C3orf20	109	.	0			c.C1263T						.						94.0	86.0	89.0					3																	14755616		2203	4300	6503	SO:0001819	synonymous_variant	84077	exon8			GCTGGCCCTATTC	AL136781	CCDS33706.1, CCDS54555.1	3p25.1	2011-01-25			ENSG00000131379	ENSG00000131379			25320	protein-coding gene	gene with protein product						11230166	Standard	NM_032137		Approved	DKFZP434N1817	uc003byy.3	Q8ND61	OTTHUMG00000155545	ENST00000253697.3:c.1263C>T	chr3.hg19:g.14755616C>T		44.0	0.0		40.0	11.0	NM_032137	Q7L0U6|Q8NCP2|Q9H0I7	Silent	SNP	ENST00000253697.3	hg19	CCDS33706.1																																																																																			.	.		0.502	C3orf20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340586.1	NM_032137	
UBP1	7342	hgsc.bcm.edu	37	3	33481287	33481287	+	Missense_Mutation	SNP	G	G	C			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr3:33481287G>C	ENST00000283629.3	-	1	583	c.54C>G	c.(52-54)gaC>gaG	p.D18E	UBP1_ENST00000447368.2_Missense_Mutation_p.D18E|UBP1_ENST00000283628.5_Missense_Mutation_p.D18E	NM_001128161.1|NM_014517.4	NP_001121633.1|NP_055332.3	Q9NZI7	UBIP1_HUMAN	upstream binding protein 1 (LBP-1a)	18					angiogenesis (GO:0001525)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(2)|kidney(4)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|urinary_tract(2)	23						TGGCGTCGAAGTCGTGCACCA	0.692																																					p.D18E		Atlas-SNP	.											.	UBP1	42	.	0			c.C54G						.						52.0	55.0	54.0					3																	33481287		2203	4299	6502	SO:0001583	missense	7342	exon1			GTCGAAGTCGTGC	AF198487	CCDS2659.1, CCDS46788.1	3p22.3	2004-03-02			ENSG00000153560	ENSG00000153560			12507	protein-coding gene	gene with protein product		609784				8114710	Standard	NM_014517		Approved	LBP-1a	uc010hga.3	Q9NZI7	OTTHUMG00000130749	ENST00000283629.3:c.54C>G	chr3.hg19:g.33481287G>C	ENSP00000283629:p.Asp18Glu	190.0	0.0		214.0	72.0	NM_001128160	Q68CT0|Q86Y57|Q9H8V0|Q9UD76|Q9UD78	Missense_Mutation	SNP	ENST00000283629.3	hg19	CCDS2659.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.610799	0.87258	.	.	ENSG00000153560	ENST00000283629;ENST00000447368;ENST00000283628;ENST00000456378	T;T;T;T	0.51817	1.97;1.91;1.97;0.69	3.93	2.54	0.30619	.	0.000000	0.85682	D	0.000000	T	0.50650	0.1628	L	0.27053	0.805	0.51012	D	0.999906	P;D	0.65815	0.799;0.995	B;D	0.67548	0.199;0.952	T	0.50980	-0.8763	10	0.66056	D	0.02	-10.7836	10.2933	0.43610	0.1247:0.0:0.8753:0.0	.	18;18	Q9NZI7-4;Q9NZI7	.;UBIP1_HUMAN	E	18	ENSP00000283629:D18E;ENSP00000395558:D18E;ENSP00000283628:D18E;ENSP00000401614:D18E	ENSP00000283628:D18E	D	-	3	2	UBP1	33456291	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.044000	0.64214	0.688000	0.31529	0.555000	0.69702	GAC	.	.		0.692	UBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253249.2	NM_014517	
NBEAL2	23218	hgsc.bcm.edu	37	3	47049823	47049823	+	Silent	SNP	A	A	G			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr3:47049823A>G	ENST00000450053.3	+	51	7949	c.7770A>G	c.(7768-7770)gcA>gcG	p.A2590A	NBEAL2_ENST00000383740.2_Silent_p.A839A|NBEAL2_ENST00000292309.5_Silent_p.A2406A	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	2590					blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		TTGTAGCGGCACTACGGCCTC	0.592																																					p.A2590A		Atlas-SNP	.											.	NBEAL2	267	.	0			c.A7770G						.						55.0	53.0	54.0					3																	47049823		2034	4175	6209	SO:0001819	synonymous_variant	23218	exon51			AGCGGCACTACGG	AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.7770A>G	chr3.hg19:g.47049823A>G		113.0	0.0		63.0	18.0	NM_015175	O60288|Q6P994|Q6UX91|Q8NAC9	Silent	SNP	ENST00000450053.3	hg19	CCDS46817.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	3.108|3.108	-0.183326|-0.183326	0.06340|0.06340	.|.	.|.	ENSG00000160796|ENSG00000160796	ENST00000416683|ENST00000443829	.|.	.|.	.|.	5.16|5.16	1.23|1.23	0.21249|0.21249	.|.	.|.	.|.	.|.	.|.	T|T	0.51346|0.51346	0.1669|0.1669	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.38628|0.38628	-0.9652|-0.9652	4|4	.|.	.|.	.|.	.|.	5.0993|5.0993	0.14751|0.14751	0.6681:0.1534:0.1785:0.0|0.6681:0.1534:0.1785:0.0	.|.	.|.	.|.	.|.	R|A	1878|929	.|.	.|.	H|T	+|+	2|1	0|0	NBEAL2|NBEAL2	47024827|47024827	0.000000|0.000000	0.05858|0.05858	0.868000|0.868000	0.34077|0.34077	0.320000|0.320000	0.28249|0.28249	-1.412000|-1.412000	0.02476|0.02476	0.376000|0.376000	0.24707|0.24707	0.459000|0.459000	0.35465|0.35465	CAC|ACT	.	.		0.592	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344363.3	XM_291064	
COL7A1	1294	hgsc.bcm.edu	37	3	48626421	48626421	+	Missense_Mutation	SNP	C	C	A	rs146407483		TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr3:48626421C>A	ENST00000328333.8	-	18	2429	c.2322G>T	c.(2320-2322)gaG>gaT	p.E774D	COL7A1_ENST00000454817.1_Missense_Mutation_p.E774D	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	774	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.|Nonhelical region (NC1).				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GACCCACAGGCTCAGGGGCTG	0.582																																					p.E774D		Atlas-SNP	.											.	COL7A1	320	.	0			c.G2322T						.						69.0	69.0	69.0					3																	48626421		2203	4300	6503	SO:0001583	missense	1294	exon18			CACAGGCTCAGGG	L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.2322G>T	chr3.hg19:g.48626421C>A	ENSP00000332371:p.Glu774Asp	463.0	0.0		305.0	76.0	NM_000094	Q14054|Q16507	Missense_Mutation	SNP	ENST00000328333.8	hg19	CCDS2773.1	.	.	.	.	.	.	.	.	.	.	C	11.56	1.675701	0.29783	.	.	ENSG00000114270	ENST00000328333;ENST00000454817	T;T	0.56103	0.48;0.48	5.08	-0.0304	0.13914	Immunoglobulin-like fold (1);	0.664905	0.12803	N	0.437782	T	0.31482	0.0798	N	0.20766	0.605	0.23555	N	0.997425	B	0.06786	0.001	B	0.04013	0.001	T	0.16689	-1.0394	10	0.52906	T	0.07	.	4.0515	0.09798	0.1535:0.4965:0.0:0.3499	.	774	Q02388	CO7A1_HUMAN	D	774	ENSP00000332371:E774D;ENSP00000412569:E774D	ENSP00000332371:E774D	E	-	3	2	COL7A1	48601425	1.000000	0.71417	0.475000	0.27278	0.916000	0.54674	1.335000	0.33839	-0.235000	0.09767	0.462000	0.41574	GAG	.	C|1.000;T|0.000		0.582	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257519.1	NM_000094	
CISH	1154	hgsc.bcm.edu	37	3	50645277	50645277	+	Missense_Mutation	SNP	G	G	A			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr3:50645277G>A	ENST00000348721.3	-	3	718	c.538C>T	c.(538-540)Ccc>Tcc	p.P180S	CISH_ENST00000443053.2_Missense_Mutation_p.P197S	NM_145071.2	NP_659508.1	Q9NSE2	CISH_HUMAN	cytokine inducible SH2-containing protein	180					intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of signal transduction (GO:0009968)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)	cytosol (GO:0005829)|plasma membrane (GO:0005886)				breast(2)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)		GCCGGGGTGGGAGCAGGATCG	0.627																																					p.P197S		Atlas-SNP	.											.	CISH	27	.	0			c.C589T						.						53.0	56.0	55.0					3																	50645277		2203	4300	6503	SO:0001583	missense	1154	exon4			GGGTGGGAGCAGG	Z77852	CCDS2831.1, CCDS46834.1	3p21.3	2013-02-14			ENSG00000114737	ENSG00000114737		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	1984	protein-coding gene	gene with protein product		602441				9465889, 7796808	Standard	NM_013324		Approved	CIS, G18, CIS-1, SOCS	uc003dax.3	Q9NSE2	OTTHUMG00000156853	ENST00000348721.3:c.538C>T	chr3.hg19:g.50645277G>A	ENSP00000294173:p.Pro180Ser	81.0	0.0		78.0	23.0	NM_013324	B2R9N1|G5E9R1|Q9NS38|Q9Y5R1	Missense_Mutation	SNP	ENST00000348721.3	hg19	CCDS2831.1	.	.	.	.	.	.	.	.	.	.	G	7.554	0.663378	0.14710	.	.	ENSG00000114737	ENST00000443053;ENST00000348721	T;T	0.42900	0.96;1.0	5.9	4.09	0.47781	SH2 motif (1);	0.732533	0.13829	N	0.359889	T	0.36936	0.0985	L	0.58101	1.795	0.42300	D	0.992179	B;B	0.21452	0.056;0.008	B;B	0.32022	0.139;0.041	T	0.07424	-1.0773	10	0.10111	T	0.7	-0.2431	5.7517	0.18150	0.159:0.0:0.6742:0.1668	.	197;180	G5E9R1;Q9NSE2	.;CISH_HUMAN	S	197;180	ENSP00000409346:P197S;ENSP00000294173:P180S	ENSP00000294173:P180S	P	-	1	0	CISH	50620281	0.984000	0.35163	0.029000	0.17559	0.268000	0.26511	2.522000	0.45572	0.796000	0.33947	0.563000	0.77884	CCC	.	.		0.627	CISH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346245.1	NM_145071	
EPHA3	2042	hgsc.bcm.edu	37	3	89390994	89390994	+	Silent	SNP	C	C	A			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr3:89390994C>A	ENST00000336596.2	+	5	1285	c.1060C>A	c.(1060-1062)Cgg>Agg	p.R354R	EPHA3_ENST00000494014.1_Silent_p.R354R|EPHA3_ENST00000452448.2_Silent_p.R354R	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	354	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		CACAGGAGGCCGGAAAGATGT	0.458										TSP Lung(6;0.00050)																											p.R354R		Atlas-SNP	.											.	EPHA3	501	.	0			c.C1060A						.						95.0	94.0	94.0					3																	89390994		2203	4300	6503	SO:0001819	synonymous_variant	2042	exon5			GGAGGCCGGAAAG	M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.1060C>A	chr3.hg19:g.89390994C>A		129.0	0.0		182.0	56.0	NM_005233	Q9H2V3|Q9H2V4	Silent	SNP	ENST00000336596.2	hg19	CCDS2922.1																																																																																			.	.		0.458	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	NM_005233	
PHC3	80012	hgsc.bcm.edu	37	3	169840463	169840463	+	Silent	SNP	T	T	G			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr3:169840463T>G	ENST00000494943.1	-	9	1890	c.1822A>C	c.(1822-1824)Aga>Cga	p.R608R	PHC3_ENST00000495893.2_Silent_p.R620R|PHC3_ENST00000467570.1_Silent_p.R567R			Q8NDX5	PHC3_HUMAN	polyhomeotic homolog 3 (Drosophila)	608	Pro-rich.				multicellular organismal development (GO:0007275)	actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(12)|ovary(1)|upper_aerodigestive_tract(2)	26	all_cancers(22;2.67e-22)|all_epithelial(15;4.73e-27)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			GGTGGGGTTCTATCCATCCGG	0.433																																					p.R620R		Atlas-SNP	.											.	PHC3	113	.	0			c.A1858C						.						138.0	135.0	136.0					3																	169840463		1921	4135	6056	SO:0001819	synonymous_variant	80012	exon9			GGGTTCTATCCAT		CCDS46952.1	3q26.32	2014-01-28	2006-09-12		ENSG00000173889	ENSG00000173889		"""Sterile alpha motif (SAM) domain containing"""	15682	protein-coding gene	gene with protein product	"""early development regulator 3"", ""polyhomeotic like 3"""		"""polyhomeotic like 3 (Drosophila)"""			12167701, 12384788	Standard	NM_024947		Approved	EDR3, FLJ12967, FLJ12729, HPH3	uc003fgl.2	Q8NDX5	OTTHUMG00000158777	ENST00000494943.1:c.1822A>C	chr3.hg19:g.169840463T>G		93.0	0.0		135.0	26.0	NM_024947	A2RRP9|Q5HYF0|Q6NSG2|Q8NFT7|Q8NFZ1|Q8TBM2|Q9H971|Q9H9I4	Silent	SNP	ENST00000494943.1	hg19		.	.	.	.	.	.	.	.	.	.	T	3.909	-0.020481	0.07634	.	.	ENSG00000173889	ENST00000486042	.	.	.	6.16	3.72	0.42706	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-12.5244	13.4437	0.61127	0.0:0.0:0.2459:0.7541	.	.	.	.	S	81	.	.	X	-	2	0	PHC3	171323157	0.998000	0.40836	0.958000	0.39756	0.270000	0.26580	4.007000	0.57093	0.519000	0.28406	-0.321000	0.08615	TAG	.	.		0.433	PHC3-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000352182.3	NM_024947	
SLIT2	9353	hgsc.bcm.edu	37	4	20598095	20598095	+	Silent	SNP	T	T	C			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr4:20598095T>C	ENST00000504154.1	+	32	3630	c.3378T>C	c.(3376-3378)gaT>gaC	p.D1126D	SLIT2_ENST00000503823.1_Silent_p.D1118D|SLIT2_ENST00000273739.5_Silent_p.D1139D|SLIT2_ENST00000503837.1_Silent_p.D1122D	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	1126	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						GCCCCTGTGATAATTTTGATT	0.403																																					p.D1126D		Atlas-SNP	.											.	SLIT2	290	.	0			c.T3378C						.						109.0	110.0	110.0					4																	20598095		2203	4300	6503	SO:0001819	synonymous_variant	9353	exon32			CTGTGATAATTTT	AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.3378T>C	chr4.hg19:g.20598095T>C		101.0	0.0		106.0	10.0	NM_004787	B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Silent	SNP	ENST00000504154.1	hg19	CCDS3426.1																																																																																			.	.		0.403	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250396.2		
PTPN13	5783	hgsc.bcm.edu	37	4	87692453	87692453	+	Missense_Mutation	SNP	T	T	C			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr4:87692453T>C	ENST00000411767.2	+	31	4996	c.4933T>C	c.(4933-4935)Tcc>Ccc	p.S1645P	PTPN13_ENST00000316707.6_Missense_Mutation_p.S1454P|PTPN13_ENST00000436978.1_Missense_Mutation_p.S1650P|PTPN13_ENST00000427191.2_Missense_Mutation_p.S1626P|PTPN13_ENST00000511467.1_Missense_Mutation_p.S1650P			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	1645					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)			NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		ACAGTGCAAGTCCCCATCCAG	0.453																																					p.S1650P		Atlas-SNP	.											.	PTPN13	203	.	0			c.T4948C						.						51.0	51.0	51.0					4																	87692453		2057	4211	6268	SO:0001583	missense	5783	exon31			TGCAAGTCCCCAT		CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.4933T>C	chr4.hg19:g.87692453T>C	ENSP00000407249:p.Ser1645Pro	239.0	0.0		264.0	75.0	NM_080685	B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Missense_Mutation	SNP	ENST00000411767.2	hg19	CCDS47094.1	.	.	.	.	.	.	.	.	.	.	T	12.96	2.093373	0.36952	.	.	ENSG00000163629	ENST00000427191;ENST00000436978;ENST00000316707;ENST00000411767;ENST00000511467;ENST00000357349	T;T;T;T;T	0.55234	0.53;0.57;0.68;0.54;0.57	5.22	2.75	0.32379	.	0.280939	0.25523	N	0.030090	T	0.39708	0.1088	L	0.48642	1.525	0.31921	N	0.613487	B;B;B;B	0.13594	0.005;0.002;0.005;0.008	B;B;B;B	0.16289	0.007;0.009;0.007;0.015	T	0.40059	-0.9583	10	0.51188	T	0.08	.	3.382	0.07257	0.1363:0.073:0.1426:0.6482	.	1454;1626;1645;1650	Q12923-2;Q12923-3;Q12923;Q12923-4	.;.;PTN13_HUMAN;.	P	1626;1650;1454;1645;1650;1594	ENSP00000408368:S1626P;ENSP00000394794:S1650P;ENSP00000322675:S1454P;ENSP00000407249:S1645P;ENSP00000426626:S1650P	ENSP00000322675:S1454P	S	+	1	0	PTPN13	87911477	0.948000	0.32251	0.443000	0.26883	0.957000	0.61999	2.336000	0.43938	0.389000	0.25086	0.533000	0.62120	TCC	.	.		0.453	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363191.1		
RPS3A	6189	hgsc.bcm.edu	37	4	152021639	152021639	+	Missense_Mutation	SNP	T	T	C			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr4:152021639T>C	ENST00000274065.4	+	2	145	c.65T>C	c.(64-66)gTt>gCt	p.V22A	RPS3A_ENST00000509736.1_Intron|SNORD73_ENST00000364394.1_RNA|RPS3A_ENST00000514682.1_5'UTR|RPS3A_ENST00000512690.1_Missense_Mutation_p.V22A|RPS3A_ENST00000322686.6_Missense_Mutation_p.V9A|RPS3A_ENST00000506126.1_5'UTR	NM_001006.4	NP_000997.1			ribosomal protein S3A											endometrium(1)|lung(1)|ovary(1)|pancreas(1)	4	all_hematologic(180;0.093)					AAATCCAGGGTTGATCCATTT	0.348																																					p.V22A		Atlas-SNP	.											.	RPS3A	11	.	0			c.T65C						.						72.0	80.0	78.0					4																	152021639		2203	4300	6503	SO:0001583	missense	6189	exon2			CCAGGGTTGATCC	X87373	CCDS3775.1	4q31.2-q31.3	2011-04-05			ENSG00000145425	ENSG00000145425		"""S ribosomal proteins"""	10421	protein-coding gene	gene with protein product		180478		MFTL		8647443, 1398113	Standard	NM_001006		Approved	S3A	uc003ilz.4	P61247	OTTHUMG00000161445	ENST00000274065.4:c.65T>C	chr4.hg19:g.152021639T>C	ENSP00000346050:p.Val22Ala	41.0	0.0		43.0	7.0	NM_001006		Missense_Mutation	SNP	ENST00000274065.4	hg19	CCDS3775.1	.	.	.	.	.	.	.	.	.	.	T	18.14	3.557485	0.65425	.	.	ENSG00000145425	ENST00000274065;ENST00000322686;ENST00000515792;ENST00000510993	.	.	.	5.08	5.08	0.68730	.	.	.	.	.	T	0.75488	0.3856	M	0.79693	2.465	0.80722	D	1	P	0.43578	0.811	P	0.53649	0.731	T	0.78084	-0.2342	8	0.51188	T	0.08	.	14.8989	0.70664	0.0:0.0:0.0:1.0	.	22	P61247	RS3A_HUMAN	A	22;9;16;2	.	ENSP00000346050:V22A	V	+	2	0	RPS3A	152241089	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	7.860000	0.86993	1.914000	0.55421	0.374000	0.22700	GTT	.	.		0.348	RPS3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364957.1		
FGA	2243	hgsc.bcm.edu	37	4	155507395	155507395	+	Missense_Mutation	SNP	C	C	T			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr4:155507395C>T	ENST00000302053.3	-	5	1264	c.1186G>A	c.(1186-1188)Gat>Aat	p.D396N	FGA_ENST00000403106.3_Missense_Mutation_p.D396N	NM_000508.3	NP_000499.1	P02671	FIBA_HUMAN	fibrinogen alpha chain	396					blood coagulation (GO:0007596)|blood coagulation, common pathway (GO:0072377)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of blood coagulation, common pathway (GO:2000261)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	structural molecule activity (GO:0005198)			NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	73	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	CCTGGGCTATCTGGCCTAAAA	0.537																																					p.D396N	NSCLC(143;340 1922 20892 22370 48145)	Atlas-SNP	.											.	FGA	179	.	0			c.G1186A						.						84.0	89.0	88.0					4																	155507395		2203	4300	6503	SO:0001583	missense	2243	exon5			GGCTATCTGGCCT		CCDS3787.1, CCDS47152.1	4q28	2014-09-17			ENSG00000171560	ENSG00000171560		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3661	protein-coding gene	gene with protein product		134820	"""fibrinogen, A alpha polypeptide"""				Standard	NM_000508		Approved		uc003iod.1	P02671	OTTHUMG00000150330	ENST00000302053.3:c.1186G>A	chr4.hg19:g.155507395C>T	ENSP00000306361:p.Asp396Asn	70.0	0.0		73.0	22.0	NM_000508	A8K3E4|D3DP14|D3DP15|Q4QQH7|Q9BX62|Q9UCH2	Missense_Mutation	SNP	ENST00000302053.3	hg19	CCDS3787.1	.	.	.	.	.	.	.	.	.	.	C	17.29	3.352952	0.61293	.	.	ENSG00000171560	ENST00000302053;ENST00000403106	T;T	0.58940	0.3;2.67	5.37	4.49	0.54785	.	20.628700	0.00166	N	0.000000	T	0.72890	0.3517	M	0.72479	2.2	0.27544	N	0.950705	D;P	0.53462	0.96;0.933	P;P	0.52856	0.711;0.518	T	0.60068	-0.7335	10	0.72032	D	0.01	.	13.2259	0.59914	0.1592:0.8408:0.0:0.0	.	396;396	P02671-2;P02671	.;FIBA_HUMAN	N	396	ENSP00000306361:D396N;ENSP00000385981:D396N	ENSP00000306361:D396N	D	-	1	0	FGA	155726845	0.969000	0.33509	0.759000	0.31340	0.952000	0.60782	1.655000	0.37345	2.511000	0.84671	0.650000	0.86243	GAT	.	.		0.537	FGA-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317593.1	NM_000508	
IRX4	50805	hgsc.bcm.edu	37	5	1878257	1878257	+	Silent	SNP	G	G	A			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr5:1878257G>A	ENST00000505790.1	-	6	1842	c.1386C>T	c.(1384-1386)ggC>ggT	p.G462G	IRX4_ENST00000231357.2_Silent_p.G462G|IRX4_ENST00000505938.1_5'Flank|IRX4_ENST00000513692.1_Silent_p.G462G	NM_001278634.1	NP_001265563.1	P78413	IRX4_HUMAN	iroquois homeobox 4	462					establishment of organ orientation (GO:0048561)|heart development (GO:0007507)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|lung(7)|ovary(1)|prostate(1)	10				GBM - Glioblastoma multiforme(108;0.242)		CCAGGAGGGCGCCCTTGGCGG	0.706																																					p.G462G		Atlas-SNP	.											.	IRX4	45	.	0			c.C1386T						.						4.0	5.0	5.0					5																	1878257		2047	4066	6113	SO:0001819	synonymous_variant	50805	exon5			GAGGGCGCCCTTG	AF124733	CCDS3867.1, CCDS75225.1	5p15.33	2011-06-20	2007-07-13		ENSG00000113430	ENSG00000113430		"""Homeoboxes / TALE class"""	6129	protein-coding gene	gene with protein product		606199	"""iroquois homeobox protein 4"""			10625552	Standard	NM_016358		Approved		uc003jcz.2	P78413	OTTHUMG00000090411	ENST00000505790.1:c.1386C>T	chr5.hg19:g.1878257G>A		73.0	0.0		57.0	16.0	NM_016358	B2RMW5|D3DTC5|H1AFL0|H1AFL1|Q2NL64|Q9UHR2	Silent	SNP	ENST00000505790.1	hg19	CCDS3867.1																																																																																			.	.		0.706	IRX4-004	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365500.1	NM_016358	
C5orf22	55322	hgsc.bcm.edu	37	5	31538643	31538643	+	Silent	SNP	A	A	G			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr5:31538643A>G	ENST00000325366.9	+	4	781	c.654A>G	c.(652-654)ccA>ccG	p.P218P	C5orf22_ENST00000355907.3_5'UTR	NM_018356.2	NP_060826.2	Q49AR2	CE022_HUMAN	chromosome 5 open reading frame 22	218										kidney(3)|large_intestine(2)|lung(10)|ovary(2)|skin(1)	18						GCCTAGAACCATCATGTTCAT	0.428																																					p.P218P		Atlas-SNP	.											.	C5orf22	48	.	0			c.A654G						.						64.0	61.0	62.0					5																	31538643		2203	4300	6503	SO:0001819	synonymous_variant	55322	exon4			AGAACCATCATGT	AK002055	CCDS3895.1	5p13.3	2012-02-22			ENSG00000082213	ENSG00000082213			25639	protein-coding gene	gene with protein product							Standard	NM_018356		Approved	FLJ11193	uc003jhj.4	Q49AR2	OTTHUMG00000131067	ENST00000325366.9:c.654A>G	chr5.hg19:g.31538643A>G		202.0	0.0		225.0	90.0	NM_018356	Q8ND28|Q8WU61|Q9NUR1	Silent	SNP	ENST00000325366.9	hg19	CCDS3895.1																																																																																			.	.		0.428	C5orf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253726.2	NM_018356	
NNT	23530	hgsc.bcm.edu	37	5	43644303	43644303	+	Missense_Mutation	SNP	C	C	T			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr5:43644303C>T	ENST00000264663.5	+	8	1195	c.974C>T	c.(973-975)gCt>gTt	p.A325V	NNT_ENST00000512996.2_Missense_Mutation_p.A194V|NNT_ENST00000344920.4_Missense_Mutation_p.A325V	NM_012343.3	NP_036475.3	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase	325					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidation-reduction process (GO:0055114)|proton transport (GO:0015992)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)	NAD binding (GO:0051287)|NAD(P)+ transhydrogenase (AB-specific) activity (GO:0008750)|NAD(P)+ transhydrogenase (B-specific) activity (GO:0003957)|NAD(P)+ transhydrogenase activity (GO:0008746)|NADP binding (GO:0050661)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(7)|large_intestine(6)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(6;2.58e-06)					GGTAAAAAAGCTCCAGTTTTA	0.338																																					p.A325V		Atlas-SNP	.											.	NNT	92	.	0			c.C974T						.						59.0	65.0	63.0					5																	43644303		2203	4300	6503	SO:0001583	missense	23530	exon8			AAAAAGCTCCAGT	U40490	CCDS3949.1	5p12	2008-02-05			ENSG00000112992	ENSG00000112992	1.6.1.1		7863	protein-coding gene	gene with protein product		607878				9271681, 9524818	Standard	NM_182977		Approved		uc003jof.3	Q13423	OTTHUMG00000096961	ENST00000264663.5:c.974C>T	chr5.hg19:g.43644303C>T	ENSP00000264663:p.Ala325Val	183.0	0.0		211.0	69.0	NM_182977	Q16796|Q2TB60|Q8N3V4	Missense_Mutation	SNP	ENST00000264663.5	hg19	CCDS3949.1	.	.	.	.	.	.	.	.	.	.	C	33	5.261755	0.95368	.	.	ENSG00000112992	ENST00000264663;ENST00000344920;ENST00000512996	D;D;D	0.83837	-1.77;-1.77;-1.77	5.62	5.62	0.85841	Alanine dehydrogenase/PNT, C-terminal (1);	0.150606	0.64402	D	0.000012	D	0.95714	0.8606	H	0.99820	4.81	0.80722	D	1	D	0.71674	0.998	D	0.64410	0.925	D	0.97817	1.0254	10	0.87932	D	0	-6.5698	19.6476	0.95789	0.0:1.0:0.0:0.0	.	325	Q13423	NNTM_HUMAN	V	325;325;194	ENSP00000264663:A325V;ENSP00000343873:A325V;ENSP00000426343:A194V	ENSP00000264663:A325V	A	+	2	0	NNT	43680060	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.210000	0.77924	2.655000	0.90218	0.650000	0.86243	GCT	.	.		0.338	NNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214026.1	NM_182977	
SOWAHA	134548	hgsc.bcm.edu	37	5	132149934	132149934	+	Silent	SNP	A	A	T			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr5:132149934A>T	ENST00000378693.2	+	1	902	c.621A>T	c.(619-621)gcA>gcT	p.A207A		NM_175873.4	NP_787069.3	Q2M3V2	SWAHA_HUMAN	sosondowah ankyrin repeat domain family member A	207	Pro-rich.																GGCCCGGGGCAGCGAAAGGGC	0.776																																					p.A207A		Atlas-SNP	.											.	.	.	.	0			c.A621T						.						2.0	3.0	3.0					5																	132149934		977	2531	3508	SO:0001819	synonymous_variant	134548	exon1			CGGGGCAGCGAAA	AK090823	CCDS43361.1	5q23.3	2013-01-10	2012-01-12	2012-01-12	ENSG00000198944	ENSG00000198944		"""Ankyrin repeat domain containing"""	27033	protein-coding gene	gene with protein product			"""ankyrin repeat domain 43"""	ANKRD43		22234889	Standard	NM_175873		Approved		uc003kxw.3	Q2M3V2	OTTHUMG00000059844	ENST00000378693.2:c.621A>T	chr5.hg19:g.132149934A>T		47.0	0.0		35.0	14.0	NM_175873	Q8NAE7	Silent	SNP	ENST00000378693.2	hg19	CCDS43361.1																																																																																			.	.		0.776	SOWAHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133062.1	NM_175873	
DIAPH1	1729	hgsc.bcm.edu	37	5	140915624	140915624	+	Intron	SNP	T	T	C			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr5:140915624T>C	ENST00000398557.4	-	19	2623				DIAPH1_ENST00000253811.6_Intron|DIAPH1_ENST00000518047.1_Intron|DIAPH1_ENST00000494967.1_5'Flank|DIAPH1_ENST00000398566.3_Intron|DIAPH1_ENST00000389054.3_Intron|DIAPH1_ENST00000398562.2_Intron|DIAPH1_ENST00000389057.5_Intron|DIAPH1_ENST00000520569.1_Intron	NM_005219.4	NP_005210.3	O60610	DIAP1_HUMAN	diaphanous-related formin 1						actin filament polymerization (GO:0030041)|cellular response to histamine (GO:0071420)|cytoskeleton organization (GO:0007010)|positive regulation of cell migration (GO:0030335)|protein localization to microtubule (GO:0035372)|regulation of cell shape (GO:0008360)|regulation of microtubule-based process (GO:0032886)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|mitotic spindle (GO:0072686)|ruffle membrane (GO:0032587)	ion channel binding (GO:0044325)|poly(A) RNA binding (GO:0044822)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(12)|pancreas(1)|skin(2)|stomach(2)	23			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			cccagcactttggaaggctga	0.413																																					p.K827E		Atlas-SNP	.											.	DIAPH1	64	.	0			c.A2479G						.						87.0	72.0	77.0					5																	140915624		692	1591	2283	SO:0001627	intron_variant	1729	exon18			GCACTTTGGAAGG	BC007411		5q31	2013-05-24	2013-05-24		ENSG00000131504	ENSG00000131504			2876	protein-coding gene	gene with protein product		602121	"""diaphanous (Drosophila, homolog) 1"", ""diaphanous homolog 1 (Drosophila)"""	DFNA1		9360932, 1350680	Standard	NM_005219		Approved	hDIA1, LFHL1	uc003llb.4	O60610	OTTHUMG00000149893	ENST00000398557.4:c.2483-1624A>G	chr5.hg19:g.140915624T>C		506.0	1.0		376.0	131.0	NM_005219	A6NF18|B7ZKW2|E9PEZ2|Q17RN4|Q59FH8|Q9UC76	Missense_Mutation	SNP	ENST00000398557.4	hg19	CCDS43374.1																																																																																			.	.		0.413	DIAPH1-203	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_005219	
UBLCP1	134510	hgsc.bcm.edu	37	5	158697408	158697408	+	Missense_Mutation	SNP	T	T	G			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr5:158697408T>G	ENST00000296786.6	+	4	613	c.287T>G	c.(286-288)gTt>gGt	p.V96G		NM_145049.3	NP_659486.2	Q8WVY7	UBCP1_HUMAN	ubiquitin-like domain containing CTD phosphatase 1	96						nucleolus (GO:0005730)|nucleus (GO:0005634)	phosphoprotein phosphatase activity (GO:0004721)			endometrium(1)|kidney(3)|large_intestine(4)|ovary(1)	9	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GATGATGTTGTTAATGACTTT	0.323																																					p.V96G		Atlas-SNP	.											.	UBLCP1	27	.	0			c.T287G						.						154.0	157.0	156.0					5																	158697408		2203	4300	6503	SO:0001583	missense	134510	exon4			ATGTTGTTAATGA	AK057996	CCDS4345.1	5q33.3	2010-06-21			ENSG00000164332	ENSG00000164332	3.1.3.16	"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	28110	protein-coding gene	gene with protein product	"""CTD phosphatase-like with ubiquitin domain 1"""	609867				15883030	Standard	NM_145049		Approved	MGC10067, CPUB1	uc003lxq.2	Q8WVY7	OTTHUMG00000130305	ENST00000296786.6:c.287T>G	chr5.hg19:g.158697408T>G	ENSP00000296786:p.Val96Gly	82.0	0.0		93.0	43.0	NM_145049	D3DQJ7|Q96DK5	Missense_Mutation	SNP	ENST00000296786.6	hg19	CCDS4345.1	.	.	.	.	.	.	.	.	.	.	T	21.4	4.142989	0.77888	.	.	ENSG00000164332	ENST00000296786	.	.	.	5.92	5.92	0.95590	.	0.212531	0.48767	D	0.000179	T	0.61438	0.2347	M	0.70595	2.14	0.80722	D	1	D	0.53312	0.959	B	0.43575	0.424	T	0.67337	-0.5696	9	0.56958	D	0.05	-1.2641	16.3631	0.83280	0.0:0.0:0.0:1.0	.	96	Q8WVY7	UBCP1_HUMAN	G	96	.	ENSP00000296786:V96G	V	+	2	0	UBLCP1	158629986	1.000000	0.71417	0.986000	0.45419	0.915000	0.54546	7.698000	0.84413	2.266000	0.75297	0.533000	0.62120	GTT	.	.		0.323	UBLCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252650.2	NM_145049	
HLA-DMA	3108	hgsc.bcm.edu	37	6	32917403	32917403	+	Missense_Mutation	SNP	C	C	T			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr6:32917403C>T	ENST00000374843.4	-	3	722	c.637G>A	c.(637-639)Gca>Aca	p.A213T	HLA-DMA_ENST00000395305.3_Missense_Mutation_p.A118T|XXbac-BPG181M17.5_ENST00000429234.1_Intron|HLA-DMA_ENST00000395303.3_Missense_Mutation_p.A179T|HLA-DMA_ENST00000464392.1_5'UTR	NM_006120.3	NP_006111.2	P28067	DMA_HUMAN	major histocompatibility complex, class II, DM alpha	213	Alpha-2.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|chaperone mediated protein folding requiring cofactor (GO:0051085)|immunoglobulin mediated immune response (GO:0016064)|inner ear development (GO:0048839)|peptide antigen assembly with MHC class II protein complex (GO:0002503)|positive regulation of immune response (GO:0050778)|positive regulation of T cell differentiation (GO:0045582)|positive thymic T cell selection (GO:0045059)|protein transport (GO:0015031)	cell surface (GO:0009986)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|multivesicular body (GO:0005771)	MHC class II protein complex binding (GO:0023026)			kidney(1)|large_intestine(2)|lung(8)	11						TAGGCAATTGCTGTGTAGCGG	0.483																																					p.A213T		Atlas-SNP	.											.	HLA-DMA	20	.	0			c.G637A						.						101.0	99.0	99.0					6																	32917403		1511	2709	4220	SO:0001583	missense	3108	exon3			CAATTGCTGTGTA		CCDS4761.1	6p21.3	2013-01-11			ENSG00000204257	ENSG00000204257		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4934	protein-coding gene	gene with protein product		142855				1922385	Standard	NM_006120		Approved	D6S222E, RING6	uc003ocm.2	P28067	OTTHUMG00000031173	ENST00000374843.4:c.637G>A	chr6.hg19:g.32917403C>T	ENSP00000363976:p.Ala213Thr	138.0	0.0		218.0	43.0	NM_006120	Q29639|Q29640	Missense_Mutation	SNP	ENST00000374843.4	hg19	CCDS4761.1	.	.	.	.	.	.	.	.	.	.	C	12.43	1.934760	0.34189	.	.	ENSG00000204257	ENST00000395305;ENST00000395303;ENST00000374843;ENST00000456800	T;T;T;T	0.08193	3.12;4.92;3.12;3.12	5.13	3.35	0.38373	.	0.543879	0.21095	N	0.080254	T	0.02012	0.0063	L	0.29908	0.895	0.09310	N	0.999999	B	0.32245	0.361	B	0.26969	0.075	T	0.38757	-0.9646	10	0.66056	D	0.02	.	7.1458	0.25583	0.0:0.8052:0.0:0.1948	.	213	Q31604	.	T	118;179;213;243	ENSP00000378716:A118T;ENSP00000378714:A179T;ENSP00000363976:A213T;ENSP00000409668:A243T	ENSP00000363976:A213T	A	-	1	0	HLA-DMA	33025381	0.082000	0.21442	0.239000	0.24122	0.936000	0.57629	0.552000	0.23376	1.537000	0.49254	0.643000	0.83706	GCA	.	.		0.483	HLA-DMA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076325.2	NM_006120	
COL11A2	1302	hgsc.bcm.edu	37	6	33136316	33136316	+	Missense_Mutation	SNP	G	G	T			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr6:33136316G>T	ENST00000374708.4	-	52	3940	c.3682C>A	c.(3682-3684)Cca>Aca	p.P1228T	COL11A2_ENST00000361917.1_Missense_Mutation_p.P1207T|COL11A2_ENST00000374714.1_Missense_Mutation_p.P1288T|COL11A2_ENST00000341947.2_Missense_Mutation_p.P1314T|COL11A2_ENST00000395197.1_Missense_Mutation_p.P1254T|COL11A2_ENST00000357486.1_Missense_Mutation_p.P1293T|COL11A2_ENST00000374712.1_Missense_Mutation_p.P1233T|COL11A2_ENST00000477772.1_Intron|COL11A2_ENST00000374713.1_Missense_Mutation_p.P1267T	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2	1314	Triple-helical region.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						AGTGGCCCTGGGGGTCCATTC	0.632																																					p.P1314T	Melanoma(1;90 116 3946 5341 17093)	Atlas-SNP	.											.	COL11A2	124	.	0			c.C3940A						.						52.0	47.0	49.0					6																	33136316		1511	2709	4220	SO:0001583	missense	1302	exon54			GCCCTGGGGGTCC	U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.3682C>A	chr6.hg19:g.33136316G>T	ENSP00000363840:p.Pro1228Thr	103.0	0.0		128.0	22.0	NM_080680	A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Missense_Mutation	SNP	ENST00000374708.4	hg19	CCDS43452.1	.	.	.	.	.	.	.	.	.	.	G	15.63	2.891734	0.52014	.	.	ENSG00000204248	ENST00000374708;ENST00000341947;ENST00000357486;ENST00000374714;ENST00000374713;ENST00000395197;ENST00000374712;ENST00000361917	D;D;D;D;D;D;D;D	0.98666	-2.87;-5.06;-5.06;-5.06;-3.33;-2.84;-3.33;-3.33	4.25	4.25	0.50352	.	0.000000	0.85682	D	0.000000	D	0.96012	0.8701	L	0.41961	1.31	0.58432	D	0.999998	P;P;P	0.40180	0.705;0.705;0.58	B;B;B	0.40864	0.342;0.342;0.185	D	0.96418	0.9309	10	0.45353	T	0.12	.	14.2085	0.65750	0.0:0.0:1.0:0.0	.	1207;1228;1314	P13942-8;P13942-6;P13942	.;.;COBA2_HUMAN	T	1228;1314;1293;1288;1267;1254;1233;1207	ENSP00000363840:P1228T;ENSP00000339915:P1314T;ENSP00000350079:P1293T;ENSP00000363846:P1288T;ENSP00000363845:P1267T;ENSP00000378623:P1254T;ENSP00000363844:P1233T;ENSP00000355123:P1207T	ENSP00000339915:P1314T	P	-	1	0	COL11A2	33244294	0.907000	0.30839	0.999000	0.59377	0.994000	0.84299	1.847000	0.39299	2.205000	0.71048	0.551000	0.68910	CCA	.	.		0.632	COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076032.2		
RUNX2	860	hgsc.bcm.edu	37	6	45390520	45390520	+	Silent	SNP	T	T	G			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr6:45390520T>G	ENST00000371438.1	+	2	607	c.249T>G	c.(247-249)gcT>gcG	p.A83A	RUNX2_ENST00000541979.1_Silent_p.A151A|RUNX2_ENST00000352853.5_Silent_p.A151A|RP1-244F24.1_ENST00000606796.1_RNA|RUNX2_ENST00000576263.1_Silent_p.A83A|RUNX2_ENST00000465038.2_Silent_p.A83A|RUNX2_ENST00000371436.6_Silent_p.A83A|RUNX2_ENST00000371432.3_Silent_p.A69A|RUNX2_ENST00000359524.5_Silent_p.A69A	NM_001024630.3	NP_001019801.3	Q13950	RUNX2_HUMAN	runt-related transcription factor 2	83	Poly-Ala.		Missing. {ECO:0000269|PubMed:9182765}.		BMP signaling pathway (GO:0030509)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|chondrocyte development (GO:0002063)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|endochondral ossification (GO:0001958)|gene expression (GO:0010467)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|osteoblast fate commitment (GO:0002051)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|stem cell differentiation (GO:0048863)|T cell differentiation (GO:0030217)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(18)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						cggcggcggctgcggcggcgg	0.731																																					p.A83A		Atlas-SNP	.											.	RUNX2	128	.	0			c.T249G						.						3.0	5.0	5.0					6																	45390520		1080	2501	3581	SO:0001819	synonymous_variant	860	exon3			GGCGGCTGCGGCG	AF001450	CCDS43467.1, CCDS43468.1, CCDS43467.2, CCDS43468.2	6p21	2010-08-20			ENSG00000124813	ENSG00000124813			10472	protein-coding gene	gene with protein product		600211		CCD, CBFA1, CCD1		7835892	Standard	NM_001024630		Approved	AML3, PEBP2A1, PEBP2aA1	uc011dvx.2	Q13950	OTTHUMG00000014774	ENST00000371438.1:c.249T>G	chr6.hg19:g.45390520T>G		35.0	0.0		125.0	5.0	NM_001024630	O14614|O14615|O95181	Silent	SNP	ENST00000371438.1	hg19	CCDS43467.2																																																																																			.	.		0.731	RUNX2-003	KNOWN	not_organism_supported|upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040755.2	NM_004348	
KIAA1586	57691	hgsc.bcm.edu	37	6	56917588	56917588	+	Missense_Mutation	SNP	C	C	A			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr6:56917588C>A	ENST00000370733.4	+	4	498	c.291C>A	c.(289-291)caC>caA	p.H97Q	KIAA1586_ENST00000488682.1_3'UTR|KIAA1586_ENST00000545356.1_Missense_Mutation_p.H70Q	NM_020931.2	NP_065982.1	Q9HCI6	K1586_HUMAN	KIAA1586	97							nucleic acid binding (GO:0003676)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(9)|skin(1)	18	Lung NSC(77;0.0969)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			GCAAAAATCACTGCAGATTGT	0.333																																					p.H97Q		Atlas-SNP	.											.	KIAA1586	59	.	0			c.C291A						.						74.0	73.0	73.0					6																	56917588		2203	4300	6503	SO:0001583	missense	57691	exon4			AAATCACTGCAGA	AB046806	CCDS34480.1, CCDS69138.1	6p12.1	2014-03-27			ENSG00000168116	ENSG00000168116			21360	protein-coding gene	gene with protein product						10997877	Standard	NM_001286274		Approved		uc003pdj.3	Q9HCI6	OTTHUMG00000014915	ENST00000370733.4:c.291C>A	chr6.hg19:g.56917588C>A	ENSP00000359768:p.His97Gln	164.0	0.0		264.0	53.0	NM_020931	A8K4M3|Q8IW25	Missense_Mutation	SNP	ENST00000370733.4	hg19	CCDS34480.1	.	.	.	.	.	.	.	.	.	.	c	15.04	2.714653	0.48622	.	.	ENSG00000168116	ENST00000370733;ENST00000545356	T;T	0.35605	1.31;1.3	3.87	-7.23	0.01480	.	.	.	.	.	T	0.08714	0.0216	N	0.08118	0	0.09310	N	1	D;D	0.58620	0.983;0.983	P;P	0.49276	0.605;0.605	T	0.18967	-1.0320	9	0.72032	D	0.01	.	7.7501	0.28892	0.1469:0.5755:0.0:0.2776	.	70;97	F5H2N6;Q9HCI6	.;K1586_HUMAN	Q	97;70	ENSP00000359768:H97Q;ENSP00000445507:H70Q	ENSP00000359768:H97Q	H	+	3	2	KIAA1586	57025547	0.000000	0.05858	0.005000	0.12908	0.012000	0.07955	-1.280000	0.02804	-1.715000	0.01389	-0.600000	0.04104	CAC	.	.		0.333	KIAA1586-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041033.1	NM_020931	
SDK1	221935	hgsc.bcm.edu	37	7	3998631	3998631	+	Missense_Mutation	SNP	G	G	A			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr7:3998631G>A	ENST00000404826.2	+	8	1358	c.1219G>A	c.(1219-1221)Gga>Aga	p.G407R	SDK1_ENST00000389531.3_Missense_Mutation_p.G407R	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	407	Ig-like C2-type 4.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.G407R(1)		NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		TGTGGACATCGGATGTCAAGC	0.463																																					p.G407R		Atlas-SNP	.											SDK1,NS,carcinoma,0,1	SDK1	361	.	1	Substitution - Missense(1)	endometrium(1)	c.G1219A						.						109.0	106.0	107.0					7																	3998631		2203	4300	6503	SO:0001583	missense	221935	exon8			GACATCGGATGTC	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.1219G>A	chr7.hg19:g.3998631G>A	ENSP00000385899:p.Gly407Arg	88.0	0.0		81.0	30.0	NM_152744	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	hg19	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	G	2.682	-0.275082	0.05679	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.65916	-0.18;-0.18	5.35	-2.58	0.06228	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.646500	0.03537	N	0.223269	T	0.23688	0.0573	N	0.00661	-1.28	0.09310	N	1	P	0.35507	0.506	B	0.27887	0.084	T	0.08534	-1.0717	10	0.38643	T	0.18	.	3.2049	0.06662	0.3475:0.2714:0.299:0.0821	.	407	Q7Z5N4	SDK1_HUMAN	R	407	ENSP00000385899:G407R;ENSP00000374182:G407R	ENSP00000374182:G407R	G	+	1	0	SDK1	3965157	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	0.278000	0.18753	-0.401000	0.07644	-1.814000	0.00607	GGA	.	.		0.463	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744	
TNS3	64759	hgsc.bcm.edu	37	7	47343131	47343131	+	Silent	SNP	A	A	T			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr7:47343131A>T	ENST00000398879.1	-	22	3240	c.2874T>A	c.(2872-2874)gtT>gtA	p.V958V	TNS3_ENST00000311160.9_Silent_p.V958V|TNS3_ENST00000355730.3_Silent_p.V718V			Q68CZ2	TENS3_HUMAN	tensin 3	958					cell migration (GO:0016477)|lung alveolus development (GO:0048286)|positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)				NS(1)|autonomic_ganglia(1)|breast(17)|endometrium(5)|kidney(4)|large_intestine(7)|liver(1)|lung(16)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	64						CCAGCAGGGAAACCATGGGCT	0.612																																					p.V958V		Atlas-SNP	.											.	TNS3	140	.	0			c.T2874A						.						14.0	17.0	16.0					7																	47343131		2012	4183	6195	SO:0001819	synonymous_variant	64759	exon22			CAGGGAAACCATG	AF378756	CCDS5506.2	7p12.3	2013-02-14	2005-05-13	2005-05-13	ENSG00000136205	ENSG00000136205		"""SH2 domain containing"""	21616	protein-coding gene	gene with protein product	"""tumor endothelial marker 6"""	606825	"""tensin-like SH2 domain-containing 1"""	TENS1		11559528	Standard	NM_022748		Approved	TEM6, H_NH0549I23.2, FLJ13732	uc003tnw.3	Q68CZ2	OTTHUMG00000074075	ENST00000398879.1:c.2874T>A	chr7.hg19:g.47343131A>T		60.0	0.0		56.0	7.0	NM_022748	B2RNV1|Q6IPQ2|Q8IZW7|Q8NAD0|Q96PE0|Q96S48	Silent	SNP	ENST00000398879.1	hg19	CCDS5506.2																																																																																			.	.		0.612	TNS3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157253.1	NM_022748	
ABCA13	154664	hgsc.bcm.edu	37	7	48412063	48412063	+	Missense_Mutation	SNP	A	A	G			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr7:48412063A>G	ENST00000435803.1	+	33	11126	c.11102A>G	c.(11101-11103)aAc>aGc	p.N3701S		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	3701					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						GTTCTACATAACCAATTAAGT	0.333																																					p.N3701S		Atlas-SNP	.											.	ABCA13	1192	.	0			c.A11102G						.						100.0	93.0	95.0					7																	48412063		1860	4093	5953	SO:0001583	missense	154664	exon33			TACATAACCAATT	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.11102A>G	chr7.hg19:g.48412063A>G	ENSP00000411096:p.Asn3701Ser	68.0	0.0		58.0	12.0	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	hg19	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	A	12.70	2.017932	0.35606	.	.	ENSG00000179869	ENST00000435803	D	0.86865	-2.18	5.61	4.45	0.53987	.	0.222991	0.31102	N	0.008243	D	0.86826	0.6026	L	0.46741	1.465	0.44175	D	0.996981	B;P	0.50819	0.138;0.939	B;P	0.51453	0.027;0.67	D	0.86162	0.1594	10	0.54805	T	0.06	.	10.9893	0.47541	0.9266:0.0:0.0734:0.0	.	1403;3701	Q86UQ4-3;Q86UQ4	.;ABCAD_HUMAN	S	3701	ENSP00000411096:N3701S	ENSP00000411096:N3701S	N	+	2	0	ABCA13	48382609	0.977000	0.34250	0.277000	0.24703	0.050000	0.14768	1.899000	0.39818	1.062000	0.40625	0.533000	0.62120	AAC	.	.		0.333	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
MAGI2	9863	hgsc.bcm.edu	37	7	77807384	77807384	+	Silent	SNP	T	T	G			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr7:77807384T>G	ENST00000354212.4	-	14	2600	c.2347A>C	c.(2347-2349)Agg>Cgg	p.R783R	MAGI2_ENST00000522391.1_Silent_p.R783R|MAGI2_ENST00000419488.1_Silent_p.R769R	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	783	PDZ 4. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				GACTCCATCCTCCGAAGATGA	0.468																																					p.R783R		Atlas-SNP	.											.	MAGI2	246	.	0			c.A2347C						.						95.0	90.0	92.0					7																	77807384		2203	4300	6503	SO:0001819	synonymous_variant	9863	exon14			CCATCCTCCGAAG	AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.2347A>C	chr7.hg19:g.77807384T>G		65.0	0.0		95.0	22.0	NM_012301	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Silent	SNP	ENST00000354212.4	hg19	CCDS5594.1																																																																																			.	.		0.468	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253197.3	NM_012301	
ACHE	43	hgsc.bcm.edu	37	7	100488791	100488791	+	Splice_Site	SNP	G	G	A			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr7:100488791G>A	ENST00000412389.1	-	3	1877	c.1722C>T	c.(1720-1722)acC>acT	p.T574T	ACHE_ENST00000419336.2_Splice_Site_p.T486T|ACHE_ENST00000302913.4_Splice_Site_p.T574T|ACHE_ENST00000411582.1_Splice_Site_p.T574T|UFSP1_ENST00000388761.2_5'Flank|ACHE_ENST00000241069.5_Splice_Site_p.T574T|ACHE_ENST00000428317.1_Splice_Site_p.T574T			P22303	ACES_HUMAN	acetylcholinesterase (Yt blood group)	574					acetylcholine catabolic process (GO:0006581)|acetylcholine catabolic process in synaptic cleft (GO:0001507)|amyloid precursor protein metabolic process (GO:0042982)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|choline metabolic process (GO:0019695)|DNA replication (GO:0006260)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|negative regulation of synaptic transmission, cholinergic (GO:0032223)|nervous system development (GO:0007399)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter receptor biosynthetic process (GO:0045212)|osteoblast development (GO:0002076)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of protein secretion (GO:0050714)|protein tetramerization (GO:0051262)|receptor internalization (GO:0031623)|regulation of axonogenesis (GO:0050770)|regulation of dendrite morphogenesis (GO:0048814)|regulation of receptor recycling (GO:0001919)|response to wounding (GO:0009611)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|basal lamina (GO:0005605)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	acetylcholine binding (GO:0042166)|acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|cholinesterase activity (GO:0004104)|collagen binding (GO:0005518)|hydrolase activity (GO:0016787)|laminin binding (GO:0043236)|protein homodimerization activity (GO:0042803)|serine hydrolase activity (GO:0017171)			large_intestine(3)|lung(7)|skin(3)|urinary_tract(3)	16	Lung NSC(181;0.041)|all_lung(186;0.0581)				Ambenonium(DB01122)|Choline(DB00122)|Decamethonium(DB01245)|Demecarium(DB00944)|Dipivefrin(DB00449)|Donepezil(DB00843)|Edrophonium(DB01010)|Ephedrine(DB01364)|Galantamine(DB00674)|Gallamine Triethiodide(DB00483)|Isoflurophate(DB00677)|Mefloquine(DB00358)|Minaprine(DB00805)|Neostigmine(DB01400)|Physostigmine(DB00981)|Pralidoxime(DB00733)|Pyridostigmine(DB00545)|Rivastigmine(DB00989)|Tubocurarine(DB01199)	CCTGCATACCGGTGGCGCTGA	0.706																																					p.T574T		Atlas-SNP	.											.	ACHE	80	.	0			c.C1722T						.						6.0	7.0	6.0					7																	100488791		2056	4095	6151	SO:0001630	splice_region_variant	43	exon4			CATACCGGTGGCG		CCDS5709.1, CCDS5710.1, CCDS64736.1	7q22	2014-07-19	2014-01-02		ENSG00000087085	ENSG00000087085	3.1.1.7	"""Blood group antigens"""	108	protein-coding gene	gene with protein product	"""Yt blood group"""	100740	"""acetylcholinesterase (YT blood group)"", ""acetylcholinesterase (Yt blood group)"", ""acetylcholinesterase"""	YT		1380483	Standard	XM_005250357		Approved		uc003uxe.3	P22303	OTTHUMG00000157033	ENST00000412389.1:c.1723+1C>T	chr7.hg19:g.100488791G>A		184.0	0.0		146.0	6.0	NM_000665	A4D2E2|B7ZKZ0|D6W5X7|Q16169|Q29S23|Q2M324|Q504V3|Q53F46|Q86TM9|Q86YX9|Q9BXP7	Silent	SNP	ENST00000412389.1	hg19	CCDS5709.1																																																																																			.	.		0.706	ACHE-013	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347201.1	NM_015831	Silent
CTTNBP2	83992	hgsc.bcm.edu	37	7	117364621	117364621	+	Missense_Mutation	SNP	T	T	C			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr7:117364621T>C	ENST00000160373.3	-	19	4518	c.4427A>G	c.(4426-4428)aAg>aGg	p.K1476R		NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	1476					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)				breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		TAGGTCTGGCTTATTCCAGGT	0.502																																					p.K1476R		Atlas-SNP	.											.	CTTNBP2	200	.	0			c.A4427G						.						89.0	74.0	79.0					7																	117364621		2203	4300	6503	SO:0001583	missense	83992	exon19			TCTGGCTTATTCC		CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.4427A>G	chr7.hg19:g.117364621T>C	ENSP00000160373:p.Lys1476Arg	44.0	0.0		46.0	14.0	NM_033427	O43389|Q7LG11|Q9C0A5	Missense_Mutation	SNP	ENST00000160373.3	hg19	CCDS5774.1	.	.	.	.	.	.	.	.	.	.	T	14.21	2.467354	0.43839	.	.	ENSG00000077063	ENST00000160373	T	0.67698	-0.28	5.24	2.88	0.33553	.	0.561590	0.21322	N	0.076456	T	0.59918	0.2229	M	0.62723	1.935	0.27795	N	0.942677	B	0.20052	0.041	B	0.16722	0.016	T	0.51458	-0.8703	10	0.32370	T	0.25	-26.758	9.3473	0.38115	0.0:0.1479:0.0:0.8521	.	1476	Q8WZ74	CTTB2_HUMAN	R	1476	ENSP00000160373:K1476R	ENSP00000160373:K1476R	K	-	2	0	CTTNBP2	117151857	1.000000	0.71417	0.794000	0.32065	0.150000	0.21749	3.872000	0.56085	0.407000	0.25591	-0.250000	0.11733	AAG	.	.		0.502	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059201.4	NM_033427	
LMOD2	442721	hgsc.bcm.edu	37	7	123302963	123302963	+	Silent	SNP	T	T	A			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr7:123302963T>A	ENST00000458573.2	+	2	1480	c.1323T>A	c.(1321-1323)ccT>ccA	p.P441P	LMOD2_ENST00000456238.2_Intron	NM_207163.1	NP_997046.1	Q6P5Q4	LMOD2_HUMAN	leiomodin 2 (cardiac)	441	Pro-rich.					cytoskeleton (GO:0005856)		p.P441P(1)									tgccaccacctcctcctcctc	0.572																																					p.P441P		Atlas-SNP	.											LMOD2_ENST00000458573,NS,carcinoma,0,1	LMOD2	62	.	1	Substitution - coding silent(1)	endometrium(1)	c.T1323A						.						19.0	18.0	19.0					7																	123302963		1881	4064	5945	SO:0001819	synonymous_variant	442721	exon2			ACCACCTCCTCCT	AC006333	CCDS47693.1	7q31.32	2008-08-08			ENSG00000170807	ENSG00000170807			6648	protein-coding gene	gene with protein product		608006					Standard	NM_207163		Approved		uc003vky.2	Q6P5Q4	OTTHUMG00000157149	ENST00000458573.2:c.1323T>A	chr7.hg19:g.123302963T>A		75.0	1.0		95.0	4.0	NM_207163	A4D0W9|A4D0Y2|Q8WVJ8	Silent	SNP	ENST00000458573.2	hg19	CCDS47693.1																																																																																			.	.		0.572	LMOD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348525.1		
PODXL	5420	hgsc.bcm.edu	37	7	131241029	131241029	+	Silent	SNP	G	G	C	rs11277659|rs547816245|rs532078953|rs79759078|rs571821675	byFrequency	TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr7:131241029G>C	ENST00000378555.3	-	1	337	c.90C>G	c.(88-90)ccC>ccG	p.P30P	PODXL_ENST00000541194.1_Silent_p.P30P|PODXL_ENST00000322985.9_Silent_p.P30P|PODXL_ENST00000465001.1_Intron|PODXL_ENST00000537928.1_Silent_p.P30P			O00592	PODXL_HUMAN	podocalyxin-like	30					cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					CATTCTGGGAGggcgacggcg	0.751																																					p.P30P		Atlas-SNP	.											.	PODXL	53	.	0			c.C90G						.						5.0	7.0	6.0					7																	131241029		1981	3946	5927	SO:0001819	synonymous_variant	5420	exon1			CTGGGAGGGCGAC		CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.90C>G	chr7.hg19:g.131241029G>C		102.0	0.0		84.0	5.0	NM_001018111	A6NHX8|Q52LZ7|Q53ER6	Silent	SNP	ENST00000378555.3	hg19	CCDS34755.1																																																																																			.	.		0.751	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337627.2	NM_001018111	
TUSC3	7991	hgsc.bcm.edu	37	8	15601113	15601113	+	Missense_Mutation	SNP	A	A	G			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr8:15601113A>G	ENST00000503731.1	+	8	1077	c.929A>G	c.(928-930)aAa>aGa	p.K310R	TUSC3_ENST00000506802.1_Missense_Mutation_p.K310R|TUSC3_ENST00000382020.4_Missense_Mutation_p.K310R	NM_006765.3	NP_006756.2	Q13454	TUSC3_HUMAN	tumor suppressor candidate 3	310					cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|cognition (GO:0050890)|magnesium ion transport (GO:0015693)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|oligosaccharyltransferase complex (GO:0008250)	magnesium ion transmembrane transporter activity (GO:0015095)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(10)|ovary(2)	28				Colorectal(111;0.113)		GATGTTGGAAAAAGACGGAGT	0.393																																					p.K310R		Atlas-SNP	.											.	TUSC3	98	.	0			c.A929G						.						193.0	212.0	206.0					8																	15601113		2203	4300	6503	SO:0001583	missense	7991	exon8			TTGGAAAAAGACG	AK026149	CCDS5993.1, CCDS5994.1	8p22	2010-10-22			ENSG00000104723	ENSG00000104723			30242	protein-coding gene	gene with protein product	"""oligosaccharyltransferase 3 homolog A (S. cerevisiae)"""	601385				8661104, 10097140	Standard	NM_178234		Approved	MGC13453, N33, OST3A, MRT7	uc003wwt.3	Q13454	OTTHUMG00000094803	ENST00000503731.1:c.929A>G	chr8.hg19:g.15601113A>G	ENSP00000424544:p.Lys310Arg	69.0	0.0		45.0	4.0	NM_178234	A8MSM0|D3DSP2|Q14911|Q14912|Q96FW0	Missense_Mutation	SNP	ENST00000503731.1	hg19	CCDS5994.1	.	.	.	.	.	.	.	.	.	.	A	25.1	4.607140	0.87157	.	.	ENSG00000104723	ENST00000382020;ENST00000506802;ENST00000503731	T;T;T	0.79554	-1.28;-1.28;-1.28	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	D	0.86719	0.6000	L	0.56769	1.78	0.80722	D	1	D;D;P	0.56035	0.967;0.974;0.815	D;D;P	0.70487	0.928;0.969;0.534	D	0.84431	0.0577	10	0.26408	T	0.33	-19.3015	15.1798	0.72947	1.0:0.0:0.0:0.0	.	310;310;310	D6RIY7;Q13454-2;Q13454	.;.;TUSC3_HUMAN	R	310	ENSP00000371450:K310R;ENSP00000425777:K310R;ENSP00000424544:K310R	ENSP00000221167:K310R	K	+	2	0	TUSC3	15645484	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	8.894000	0.92506	2.247000	0.74100	0.477000	0.44152	AAA	.	.		0.393	TUSC3-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000365367.1	NM_006765	
ZCCHC6	79670	hgsc.bcm.edu	37	9	88938154	88938154	+	Missense_Mutation	SNP	C	C	A			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr9:88938154C>A	ENST00000375963.3	-	13	2683	c.2511G>T	c.(2509-2511)caG>caT	p.Q837H	ZCCHC6_ENST00000375961.2_Missense_Mutation_p.Q837H|ZCCHC6_ENST00000469004.1_5'Flank|ZCCHC6_ENST00000277141.6_Missense_Mutation_p.Q126H|ZCCHC6_ENST00000375960.2_Missense_Mutation_p.Q714H	NM_001185059.1|NM_024617.3	NP_001171988.1|NP_078893.2	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6	837	Glu-rich.				RNA 3'-end processing (GO:0031123)		poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	46						TTTCTGATGTCTGGCCCTGTA	0.458																																					p.Q837H		Atlas-SNP	.											.	ZCCHC6	105	.	0			c.G2511T						.						86.0	76.0	79.0					9																	88938154		2203	4300	6503	SO:0001583	missense	79670	exon13			TGATGTCTGGCCC	AL832026	CCDS35057.1, CCDS55323.1	9q21	2014-03-05			ENSG00000083223	ENSG00000083223		"""Zinc fingers, CCHC domain containing"""	25817	protein-coding gene	gene with protein product	"""TUTase7"""					11214970	Standard	NM_001185059		Approved	KIAA1711, FLJ13409, PAPD6, TUT7	uc004aoq.3	Q5VYS8	OTTHUMG00000020137	ENST00000375963.3:c.2511G>T	chr9.hg19:g.88938154C>A	ENSP00000365130:p.Gln837His	83.0	0.0		99.0	32.0	NM_024617	Q5H9T0|Q5VYS5|Q5VYS7|Q658Z9|Q659A2|Q6MZJ3|Q8N5F0|Q96N57|Q96NE8|Q9C0F2|Q9H8M6	Missense_Mutation	SNP	ENST00000375963.3	hg19	CCDS35057.1	.	.	.	.	.	.	.	.	.	.	C	11.12	1.545372	0.27652	.	.	ENSG00000083223	ENST00000277141;ENST00000375960;ENST00000375961;ENST00000375963	T;T;T;T	0.58797	0.31;0.74;0.78;0.79	5.39	-1.24	0.09435	.	0.763186	0.12704	N	0.446123	T	0.36220	0.0959	N	0.24115	0.695	0.09310	N	1	B;B	0.10296	0.003;0.0	B;B	0.09377	0.004;0.001	T	0.15809	-1.0424	10	0.46703	T	0.11	-11.2467	4.7547	0.13077	0.0982:0.3362:0.4017:0.1639	.	714;837	Q5VYS8-4;Q5VYS8	.;TUT7_HUMAN	H	126;714;837;837	ENSP00000277141:Q126H;ENSP00000365127:Q714H;ENSP00000365128:Q837H;ENSP00000365130:Q837H	ENSP00000277141:Q126H	Q	-	3	2	ZCCHC6	88127974	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-1.533000	0.02215	-0.392000	0.07751	0.585000	0.79938	CAG	.	.		0.458	ZCCHC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052918.1	NM_024617	
BICD2	23299	hgsc.bcm.edu	37	9	95491346	95491346	+	Missense_Mutation	SNP	T	T	C			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr9:95491346T>C	ENST00000375512.3	-	2	480	c.413A>G	c.(412-414)gAg>gGg	p.E138G	BICD2_ENST00000356884.6_Missense_Mutation_p.E138G	NM_015250.3	NP_056065.1	Q8TD16	BICD2_HUMAN	bicaudal D homolog 2 (Drosophila)	138					cell death (GO:0008219)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	Rab GTPase binding (GO:0017137)			cervix(3)|endometrium(4)|kidney(1)|large_intestine(6)|lung(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23						GCGCTCATTCTCCGACTGCGT	0.617																																					p.E138G		Atlas-SNP	.											.	BICD2	68	.	0			c.A413G						.						120.0	85.0	97.0					9																	95491346		2203	4300	6503	SO:0001583	missense	23299	exon2			TCATTCTCCGACT	AB014599	CCDS6700.1, CCDS35064.1	9q22.32	2008-02-05			ENSG00000185963	ENSG00000185963			17208	protein-coding gene	gene with protein product		609797				9734811	Standard	NM_001003800		Approved	KIAA0699	uc004asp.1	Q8TD16	OTTHUMG00000021036	ENST00000375512.3:c.413A>G	chr9.hg19:g.95491346T>C	ENSP00000364662:p.Glu138Gly	47.0	0.0		48.0	11.0	NM_001003800	O75181|Q5TBQ2|Q5TBQ3|Q96LH2|Q9BT84|Q9H561	Missense_Mutation	SNP	ENST00000375512.3	hg19	CCDS6700.1	.	.	.	.	.	.	.	.	.	.	T	30	5.055155	0.93793	.	.	ENSG00000185963	ENST00000356884;ENST00000375512	T;T	0.58358	0.34;0.34	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.68016	0.2955	M	0.84948	2.725	0.80722	D	1	D;P	0.56521	0.976;0.801	P;P	0.53360	0.724;0.516	T	0.74383	-0.3683	10	0.62326	D	0.03	-31.4664	13.6329	0.62206	0.0:0.0:0.0:1.0	.	138;138	Q8TD16-2;Q8TD16	.;BICD2_HUMAN	G	138	ENSP00000349351:E138G;ENSP00000364662:E138G	ENSP00000349351:E138G	E	-	2	0	BICD2	94531167	1.000000	0.71417	0.920000	0.36463	0.883000	0.51084	7.819000	0.86621	2.168000	0.68352	0.533000	0.62120	GAG	.	.		0.617	BICD2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055508.1	NM_015250	
LRRC8A	56262	hgsc.bcm.edu	37	9	131670444	131670444	+	Missense_Mutation	SNP	T	T	A			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr9:131670444T>A	ENST00000259324.5	+	3	1524	c.1001T>A	c.(1000-1002)cTc>cAc	p.L334H	LRRC8A_ENST00000372599.3_Missense_Mutation_p.L334H|LRRC8A_ENST00000372600.4_Missense_Mutation_p.L334H	NM_001127244.1	NP_001120716.1	Q8IWT6	LRC8A_HUMAN	leucine rich repeat containing 8 family, member A	334					anion transport (GO:0006820)|cell volume homeostasis (GO:0006884)|pre-B cell differentiation (GO:0002329)|response to osmotic stress (GO:0006970)	cell surface (GO:0009986)|ion channel complex (GO:0034702)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(3)	28						TTCTACGGCCTCATCTGCATG	0.577																																					p.L334H		Atlas-SNP	.											.	LRRC8A	69	.	0			c.T1001A						.						221.0	159.0	180.0					9																	131670444		2203	4300	6503	SO:0001583	missense	56262	exon3			ACGGCCTCATCTG	AB037858	CCDS35155.1	9q34.2	2014-09-17	2005-06-29	2005-06-29	ENSG00000136802	ENSG00000136802			19027	protein-coding gene	gene with protein product		608360	"""leucine rich repeat containing 8"""	LRRC8			Standard	NM_001127244		Approved	KIAA1437, FLJ10337	uc010myp.3	Q8IWT6	OTTHUMG00000020766	ENST00000259324.5:c.1001T>A	chr9.hg19:g.131670444T>A	ENSP00000259324:p.Leu334His	76.0	0.0		56.0	5.0	NM_001127244	Q6UXM2|Q8NCI0|Q9P2B1	Missense_Mutation	SNP	ENST00000259324.5	hg19	CCDS35155.1	.	.	.	.	.	.	.	.	.	.	T	17.40	3.379878	0.61845	.	.	ENSG00000136802	ENST00000372600;ENST00000372599;ENST00000259324	T;T;T	0.55930	0.49;0.49;0.49	5.27	5.27	0.74061	.	0.062950	0.64402	D	0.000004	T	0.65396	0.2687	M	0.73217	2.22	0.58432	D	0.999999	D	0.56968	0.978	P	0.54815	0.761	T	0.70666	-0.4809	10	0.87932	D	0	.	14.3778	0.66889	0.0:0.0:0.0:1.0	.	334	Q8IWT6	LRC8A_HUMAN	H	334	ENSP00000361682:L334H;ENSP00000361680:L334H;ENSP00000259324:L334H	ENSP00000259324:L334H	L	+	2	0	LRRC8A	130710265	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	8.040000	0.89188	1.997000	0.58415	0.379000	0.24179	CTC	.	.		0.577	LRRC8A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054516.2	NM_019594	
CRAT	1384	hgsc.bcm.edu	37	9	131866547	131866547	+	Silent	SNP	G	G	A			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr9:131866547G>A	ENST00000318080.2	-	3	624	c.330C>T	c.(328-330)taC>taT	p.Y110Y	AL158151.2_ENST00000408594.1_RNA|CRAT_ENST00000464290.1_Intron	NM_000755.3|NM_001257363.1	NP_000746|NP_001244292.1	P43155	CACP_HUMAN	carnitine O-acetyltransferase	110					carnitine metabolic process, CoA-linked (GO:0019254)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carnitine O-acetyltransferase activity (GO:0004092)|receptor binding (GO:0005102)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(4)|skin(1)|urinary_tract(2)	13				UCEC - Uterine corpus endometrioid carcinoma (4;0.0178)	L-Carnitine(DB00583)	CAGGCTGGCGGTACTGGAGGT	0.637																																					p.Y110Y		Atlas-SNP	.											.	CRAT	43	.	0			c.C330T						.						48.0	37.0	41.0					9																	131866547		2202	4300	6502	SO:0001819	synonymous_variant	1384	exon3			CTGGCGGTACTGG	X78706	CCDS6919.1	9q34.1	2010-04-27	2010-04-27		ENSG00000095321	ENSG00000095321	2.3.1.7		2342	protein-coding gene	gene with protein product		600184	"""carnitine acetyltransferase"""			7829107	Standard	NM_000755		Approved	CAT1	uc004bxh.3	P43155	OTTHUMG00000147343	ENST00000318080.2:c.330C>T	chr9.hg19:g.131866547G>A		262.0	0.0		198.0	54.0	NM_000755	Q5T952|Q9BW16	Silent	SNP	ENST00000318080.2	hg19	CCDS6919.1																																																																																			.	.		0.637	CRAT-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253700.1		
LHX3	8022	hgsc.bcm.edu	37	9	139089248	139089248	+	Missense_Mutation	SNP	C	C	A			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr9:139089248C>A	ENST00000371748.5	-	6	1213	c.1117G>T	c.(1117-1119)Ggg>Tgg	p.G373W	LHX3_ENST00000371746.3_Missense_Mutation_p.G378W	NM_178138.4	NP_835258.1	Q9UBR4	LHX3_HUMAN	LIM homeobox 3	373					inner ear development (GO:0048839)|lung development (GO:0030324)|medial motor column neuron differentiation (GO:0021526)|motor neuron axon guidance (GO:0008045)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|pituitary gland development (GO:0021983)|placenta development (GO:0001890)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|spinal cord association neuron differentiation (GO:0021527)|spinal cord motor neuron cell fate specification (GO:0021520)|ventral spinal cord interneuron specification (GO:0021521)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			large_intestine(2)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	8		Myeloproliferative disorder(178;0.0511)		Epithelial(140;8.43e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.26e-07)		CCGCTGCTCCCCGTGGATAGG	0.697																																					p.G378W		Atlas-SNP	.											.	LHX3	23	.	0			c.G1132T						.						12.0	16.0	14.0					9																	139089248		2165	4258	6423	SO:0001583	missense	8022	exon6			TGCTCCCCGTGGA	AF096169	CCDS6994.1, CCDS6995.1	9q34.3	2011-06-20			ENSG00000107187	ENSG00000107187		"""Homeoboxes / LIM class"""	6595	protein-coding gene	gene with protein product		600577				10598593, 10717474	Standard	NM_178138		Approved		uc004cgz.3	Q9UBR4	OTTHUMG00000020924	ENST00000371748.5:c.1117G>T	chr9.hg19:g.139089248C>A	ENSP00000360813:p.Gly373Trp	251.0	0.0		178.0	54.0	NM_014564	Q5TB39|Q5TB40|Q9NZB5|Q9P0I8|Q9P0I9	Missense_Mutation	SNP	ENST00000371748.5	hg19	CCDS6994.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.405285	0.83230	.	.	ENSG00000107187	ENST00000371748;ENST00000371746;ENST00000325195	D;D	0.90676	-2.56;-2.71	4.27	4.27	0.50696	.	0.063354	0.64402	D	0.000007	D	0.93828	0.8026	L	0.57536	1.79	0.80722	D	1	D;D	0.76494	0.999;0.988	D;P	0.72625	0.978;0.908	D	0.94529	0.7734	10	0.72032	D	0.01	.	15.846	0.78890	0.0:1.0:0.0:0.0	.	373;378	Q9UBR4;F1T0D9	LHX3_HUMAN;.	W	373;378;373	ENSP00000360813:G373W;ENSP00000360811:G378W	ENSP00000319224:G373W	G	-	1	0	LHX3	138229069	1.000000	0.71417	0.936000	0.37596	0.870000	0.49936	7.127000	0.77210	2.190000	0.69967	0.591000	0.81541	GGG	.	.		0.697	LHX3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055048.3		
SLC34A3	142680	hgsc.bcm.edu	37	9	140127035	140127035	+	Missense_Mutation	SNP	G	G	A	rs532224704	byFrequency	TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr9:140127035G>A	ENST00000538474.1	+	4	408	c.184G>A	c.(184-186)Gtg>Atg	p.V62M	SLC34A3_ENST00000361134.2_Missense_Mutation_p.V62M	NM_001177316.1|NM_001177317.1	NP_001170787|NP_001170788	Q8N130	NPT2C_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 3	62					cellular phosphate ion homeostasis (GO:0030643)|ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:phosphate symporter activity (GO:0005436)			kidney(3)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)		AGAGCTCCGCGTGGCCGGCAG	0.687																																					p.V62M		Atlas-SNP	.											.	SLC34A3	32	.	0			c.G184A						.						24.0	27.0	26.0					9																	140127035		2188	4267	6455	SO:0001583	missense	142680	exon4			CTCCGCGTGGCCG	AB055000	CCDS7038.1	9q34.3	2013-07-17	2013-07-17		ENSG00000198569	ENSG00000198569		"""Solute carriers"""	20305	protein-coding gene	gene with protein product		609826	"""solute carrier family 34 (sodium phosphate), member 3"""			11880379, 16358215, 16358214	Standard	NM_080877		Approved	NPTIIc, FLJ38680	uc004cmf.1	Q8N130	OTTHUMG00000131780	ENST00000538474.1:c.184G>A	chr9.hg19:g.140127035G>A	ENSP00000442397:p.Val62Met	62.0	0.0		48.0	5.0	NM_001177317	A2BFA1	Missense_Mutation	SNP	ENST00000538474.1	hg19	CCDS7038.1	.	.	.	.	.	.	.	.	.	.	g	9.266	1.044518	0.19748	.	.	ENSG00000198569	ENST00000538474;ENST00000361134	T;T	0.29917	1.55;1.55	3.74	-7.47	0.01365	.	1.172260	0.06411	N	0.720637	T	0.14442	0.0349	N	0.22421	0.69	0.09310	N	1	B	0.19583	0.037	B	0.06405	0.002	T	0.20405	-1.0276	10	0.41790	T	0.15	-5.0215	2.4859	0.04598	0.1622:0.2386:0.4809:0.1184	.	62	Q8N130	NPT2C_HUMAN	M	62	ENSP00000442397:V62M;ENSP00000355353:V62M	ENSP00000355353:V62M	V	+	1	0	SLC34A3	139246856	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.444000	0.02403	-1.584000	0.01636	-0.696000	0.03686	GTG	.	.		0.687	SLC34A3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254712.1	NM_080877	
PRTFDC1	56952	hgsc.bcm.edu	37	10	25140374	25140374	+	Silent	SNP	T	T	C			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr10:25140374T>C	ENST00000320152.6	-	8	601	c.573A>G	c.(571-573)ccA>ccG	p.P191P	PRTFDC1_ENST00000376378.1_Intron	NM_020200.5	NP_064585.1	Q9NRG1	PRDC1_HUMAN	phosphoribosyl transferase domain containing 1	191					nucleoside metabolic process (GO:0009116)	cytosol (GO:0005829)	magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	9						CAAATAAGTTTGGAATCTCAA	0.353																																					p.P191P		Atlas-SNP	.											.	PRTFDC1	29	.	0			c.A573G						.						83.0	84.0	84.0					10																	25140374		2203	4300	6503	SO:0001819	synonymous_variant	56952	exon8			TAAGTTTGGAATC	AF226056	CCDS7145.1, CCDS60506.1	10p12.31	2003-11-10			ENSG00000099256	ENSG00000099256			23333	protein-coding gene	gene with protein product		610751					Standard	XM_005252537		Approved	HHGP	uc001ise.1	Q9NRG1	OTTHUMG00000017829	ENST00000320152.6:c.573A>G	chr10.hg19:g.25140374T>C		43.0	0.0		40.0	9.0	NM_020200	B7Z1Z3|Q53HA7|Q59EL9|Q5VV18|Q5VV20	Silent	SNP	ENST00000320152.6	hg19	CCDS7145.1																																																																																			.	.		0.353	PRTFDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047243.2	NM_020200	
HIPK3	10114	hgsc.bcm.edu	37	11	33350093	33350093	+	Missense_Mutation	SNP	G	G	A			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr11:33350093G>A	ENST00000303296.4	+	3	1440	c.1135G>A	c.(1135-1137)Gcc>Acc	p.A379T	HIPK3_ENST00000379016.3_Missense_Mutation_p.A379T|HIPK3_ENST00000525975.1_Missense_Mutation_p.A379T|HIPK3_ENST00000456517.1_Missense_Mutation_p.A379T	NM_005734.3	NP_005725.3	Q9H422	HIPK3_HUMAN	homeodomain interacting protein kinase 3	379	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|mRNA transcription (GO:0009299)|negative regulation of apoptotic process (GO:0043066)|negative regulation of JUN kinase activity (GO:0043508)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			endometrium(3)|kidney(3)|large_intestine(9)|liver(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	39						ATTTTGTGAAGCCATAGACAT	0.373																																					p.A379T		Atlas-SNP	.											.	HIPK3	92	.	0			c.G1135A						.						113.0	112.0	113.0					11																	33350093		2202	4298	6500	SO:0001583	missense	10114	exon3			TGTGAAGCCATAG	AF004849	CCDS7884.1, CCDS41634.1	11p13	2008-07-18	2001-11-29		ENSG00000110422	ENSG00000110422			4915	protein-coding gene	gene with protein product		604424	"""homeodomain-interacting protein kinase 3"""			9373137, 9748262	Standard	NM_005734		Approved	PKY, DYRK6, YAK1, FIST3	uc031pzm.1	Q9H422	OTTHUMG00000132269	ENST00000303296.4:c.1135G>A	chr11.hg19:g.33350093G>A	ENSP00000304226:p.Ala379Thr	64.0	0.0		52.0	18.0	NM_001048200	O14632|Q2PBG4|Q2PBG5|Q92632|Q9HAS2	Missense_Mutation	SNP	ENST00000303296.4	hg19	CCDS7884.1	.	.	.	.	.	.	.	.	.	.	G	29.4	4.999085	0.93227	.	.	ENSG00000110422	ENST00000525975;ENST00000303296;ENST00000379016;ENST00000456517	T;T;T;T	0.22743	1.94;1.94;1.94;1.94	5.46	4.54	0.55810	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.100422	0.43747	D	0.000536	T	0.45216	0.1331	L	0.61036	1.89	0.80722	D	1	D;D	0.76494	0.995;0.999	D;D	0.83275	0.948;0.996	T	0.48714	-0.9011	10	0.87932	D	0	.	16.6049	0.84826	0.0:0.1303:0.8697:0.0	.	379;379	Q9H422-2;Q9H422	.;HIPK3_HUMAN	T	379	ENSP00000431710:A379T;ENSP00000304226:A379T;ENSP00000368301:A379T;ENSP00000398241:A379T	ENSP00000304226:A379T	A	+	1	0	HIPK3	33306669	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.781000	0.99029	1.410000	0.46936	0.563000	0.77884	GCC	.	.		0.373	HIPK3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255358.1	NM_005734	
OR5D14	219436	hgsc.bcm.edu	37	11	55563748	55563748	+	Silent	SNP	C	C	T			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr11:55563748C>T	ENST00000335605.1	+	1	717	c.717C>T	c.(715-717)gcC>gcT	p.A239A		NM_001004735.1	NP_001004735.1	Q8NGL3	OR5DE_HUMAN	olfactory receptor, family 5, subfamily D, member 14	239						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(30)|ovary(2)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	48		all_epithelial(135;0.196)				GCCACAAAGCCTTCTCCACCT	0.458																																					p.A239A		Atlas-SNP	.											.	OR5D14	116	.	0			c.C717T						.						125.0	117.0	120.0					11																	55563748		2200	4296	6496	SO:0001819	synonymous_variant	219436	exon1			CAAAGCCTTCTCC	AB065779	CCDS31508.1	11q11	2012-08-09			ENSG00000186113	ENSG00000186113		"""GPCR / Class A : Olfactory receptors"""	15281	protein-coding gene	gene with protein product							Standard	NM_001004735		Approved		uc010rim.2	Q8NGL3	OTTHUMG00000166809	ENST00000335605.1:c.717C>T	chr11.hg19:g.55563748C>T		102.0	0.0		100.0	35.0	NM_001004735	Q6IF69|Q6IFD4|Q96RB5	Silent	SNP	ENST00000335605.1	hg19	CCDS31508.1																																																																																			.	.		0.458	OR5D14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391513.1	NM_001004735	
OR5M10	390167	hgsc.bcm.edu	37	11	56344387	56344387	+	Missense_Mutation	SNP	A	A	T			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr11:56344387A>T	ENST00000526812.2	-	1	876	c.811T>A	c.(811-813)Tcc>Acc	p.S271T		NM_001004741.1	NP_001004741.1	Q6IEU7	OR5MA_HUMAN	olfactory receptor, family 5, subfamily M, member 10	271						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(15)|upper_aerodigestive_tract(2)|urinary_tract(2)	25						ATTATTTTGGACTCCTCTACA	0.413																																					p.S271T		Atlas-SNP	.											.	OR5M10	56	.	0			c.T811A						.						188.0	182.0	183.0					11																	56344387		1829	4084	5913	SO:0001583	missense	390167	exon1			TTTTGGACTCCTC	BK004515	CCDS53630.1	11q11	2012-08-09				ENSG00000254834		"""GPCR / Class A : Olfactory receptors"""	15290	protein-coding gene	gene with protein product							Standard	NM_001004741		Approved		uc001niz.1	Q6IEU7		ENST00000526812.2:c.811T>A	chr11.hg19:g.56344387A>T	ENSP00000436004:p.Ser271Thr	210.0	0.0		238.0	68.0	NM_001004741	B9EIL9	Missense_Mutation	SNP	ENST00000526812.2	hg19	CCDS53630.1	.	.	.	.	.	.	.	.	.	.	A	11.69	1.714139	0.30413	.	.	ENSG00000254834	ENST00000526812	T	0.00107	8.72	4.2	0.171	0.15026	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00109	0.0003	N	0.10837	0.055	0.09310	N	1	B	0.33919	0.432	B	0.40940	0.344	T	0.10753	-1.0616	9	0.72032	D	0.01	.	1.7829	0.03035	0.4346:0.3124:0.094:0.1591	.	271	Q6IEU7	OR5MA_HUMAN	T	271	ENSP00000436004:S271T	ENSP00000436004:S271T	S	-	1	0	OR5M10	56100963	0.000000	0.05858	0.001000	0.08648	0.307000	0.27823	-0.609000	0.05635	-0.075000	0.12798	0.514000	0.50259	TCC	.	.		0.413	OR5M10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391609.1	NM_001004741	
NPAS4	266743	hgsc.bcm.edu	37	11	66188745	66188745	+	Missense_Mutation	SNP	C	C	T			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr11:66188745C>T	ENST00000311034.2	+	1	271	c.95C>T	c.(94-96)gCg>gTg	p.A32V		NM_178864.3	NP_849195.2	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	32	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|kidney(3)|large_intestine(11)|liver(2)|lung(20)|ovary(1)|prostate(3)|skin(3)	49						CTGGCCGAAGCGGACAAGGTC	0.647																																					p.A32V		Atlas-SNP	.											.	NPAS4	133	.	0			c.C95T						.						66.0	53.0	57.0					11																	66188745		2200	4295	6495	SO:0001583	missense	266743	exon1			CCGAAGCGGACAA	AB049469	CCDS8138.1	11q13.2	2013-05-21			ENSG00000174576	ENSG00000174576		"""Basic helix-loop-helix proteins"""	18983	protein-coding gene	gene with protein product		608554				14701734	Standard	NM_178864		Approved	PASD10, NXF, Le-PAS, bHLHe79	uc001ohx.1	Q8IUM7	OTTHUMG00000167045	ENST00000311034.2:c.95C>T	chr11.hg19:g.66188745C>T	ENSP00000311196:p.Ala32Val	245.0	0.0		191.0	69.0	NM_178864	B7ZL81|Q8N8S5|Q8N9Q9	Missense_Mutation	SNP	ENST00000311034.2	hg19	CCDS8138.1	.	.	.	.	.	.	.	.	.	.	C	34	5.313768	0.95655	.	.	ENSG00000174576	ENST00000311034	T	0.51071	0.72	5.19	5.19	0.71726	Helix-loop-helix DNA-binding (1);	0.228511	0.31102	N	0.008255	T	0.42314	0.1197	N	0.14661	0.345	0.54753	D	0.99998	D	0.63880	0.993	P	0.53490	0.727	T	0.41016	-0.9532	10	0.62326	D	0.03	-4.3398	11.8591	0.52454	0.0:0.8243:0.1757:0.0	.	32	Q8IUM7	NPAS4_HUMAN	V	32	ENSP00000311196:A32V	ENSP00000311196:A32V	A	+	2	0	NPAS4	65945321	0.998000	0.40836	0.999000	0.59377	0.948000	0.59901	1.746000	0.38288	2.691000	0.91804	0.563000	0.77884	GCG	.	.		0.647	NPAS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392634.1	NM_178864	
UBE4A	9354	hgsc.bcm.edu	37	11	118242363	118242363	+	Silent	SNP	C	C	T			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr11:118242363C>T	ENST00000431736.2	+	5	615	c.543C>T	c.(541-543)ttC>ttT	p.F181F	UBE4A_ENST00000252108.3_Silent_p.F181F					ubiquitination factor E4A											autonomic_ganglia(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(7)|liver(2)|lung(14)|ovary(3)|prostate(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	56	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		ACTCCTGCTTCCAGAGAGCCA	0.433																																					p.F181F		Atlas-SNP	.											.	UBE4A	97	.	0			c.C543T						.						98.0	93.0	95.0					11																	118242363		2200	4296	6496	SO:0001819	synonymous_variant	9354	exon5			CTGCTTCCAGAGA	D50916	CCDS8396.1, CCDS55790.1	11q23.3	2013-01-28	2011-05-19					"""U-box domain containing"""	12499	protein-coding gene	gene with protein product		603753	"""ubiquitination factor E4A (homologous to yeast UFD2)"", ""ubiquitination factor E4A (UFD2 homolog, yeast)"""			10089879	Standard	NM_004788		Approved	UBOX2, UFD2, KIAA0126, E4	uc001psv.3	Q14139	OTTHUMG00000168100	ENST00000431736.2:c.543C>T	chr11.hg19:g.118242363C>T		52.0	0.0		35.0	9.0	NM_004788		Silent	SNP	ENST00000431736.2	hg19	CCDS8396.1																																																																																			.	.		0.433	UBE4A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398143.1	NM_004788	
TIMELESS	8914	hgsc.bcm.edu	37	12	56817448	56817448	+	Silent	SNP	C	C	T			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr12:56817448C>T	ENST00000553532.1	-	17	2160	c.2010G>A	c.(2008-2010)gaG>gaA	p.E670E	TIMELESS_ENST00000229201.4_Silent_p.E669E|TIMELESS_ENST00000554616.1_Intron					timeless circadian clock									p.E670E(1)		NS(1)|breast(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(8)|lung(14)|ovary(7)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	49						cctcctcctcctcttcttctt	0.527																																					p.E670E		Atlas-SNP	.											TIMELESS,NS,carcinoma,0,1	TIMELESS	107	.	1	Substitution - coding silent(1)	kidney(1)	c.G2010A						.						51.0	49.0	50.0					12																	56817448		2203	4300	6503	SO:0001819	synonymous_variant	8914	exon17			CTCCTCCTCTTCT	AF098162	CCDS8918.1	12q13.3	2012-12-14	2012-12-14		ENSG00000111602	ENSG00000111602			11813	protein-coding gene	gene with protein product	"""Tof1 homolog (S. cerevisiae)"", ""timeless circadian clock 1"""	603887	"""timeless (Drosophila) homolog"", ""timeless homolog (Drosophila)"""			9856465	Standard	NM_003920		Approved	hTIM, TIM, TIM1	uc001slf.2	Q9UNS1	OTTHUMG00000170600	ENST00000553532.1:c.2010G>A	chr12.hg19:g.56817448C>T		56.0	0.0		56.0	3.0	NM_003920		Silent	SNP	ENST00000553532.1	hg19	CCDS8918.1																																																																																			.	.		0.527	TIMELESS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409771.1	NM_003920	
ZMYM2	7750	hgsc.bcm.edu	37	13	20567236	20567236	+	Silent	SNP	A	A	G			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr13:20567236A>G	ENST00000382874.2	+	4	214	c.24A>G	c.(22-24)ggA>ggG	p.G8G	ZMYM2_ENST00000382881.3_Silent_p.G8G|ZMYM2_ENST00000382869.3_Silent_p.G8G|ZMYM2_ENST00000382871.2_Silent_p.G8G	NM_001190964.1	NP_001177893.1	Q9UBW7	ZMYM2_HUMAN	zinc finger, MYM-type 2	8					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|PML body (GO:0016605)	ubiquitin conjugating enzyme binding (GO:0031624)|zinc ion binding (GO:0008270)			large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	10		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		CAGTGGGAGGATTAGAATTGA	0.388																																					p.G8G		Atlas-SNP	.											.	ZMYM2	191	.	0			c.A24G						.						130.0	127.0	128.0					13																	20567236		2051	4253	6304	SO:0001819	synonymous_variant	7750	exon4			GGGAGGATTAGAA	AF012126	CCDS45016.1	13q11-q12	2013-01-08	2006-07-13	2006-07-13	ENSG00000121741	ENSG00000121741		"""Zinc fingers, MYM type"""	12989	protein-coding gene	gene with protein product		602221	"""zinc finger protein 198"""	ZNF198		9499416, 9425908	Standard	XM_005266517		Approved	RAMP, FIM, MYM	uc001ums.3	Q9UBW7	OTTHUMG00000016507	ENST00000382874.2:c.24A>G	chr13.hg19:g.20567236A>G		116.0	0.0		161.0	38.0	NM_001190964	A6NDG0|A6NI02|O43212|O43434|O60898|Q5W0Q4|Q5W0T3|Q63HP0|Q8NE39|Q9H0V5|Q9H538|Q9UEU2	Silent	SNP	ENST00000382874.2	hg19	CCDS45016.1																																																																																			.	.		0.388	ZMYM2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044051.2	NM_003453	
RB1	5925	hgsc.bcm.edu	37	13	48923090	48923090	+	Splice_Site	SNP	A	A	T			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr13:48923090A>T	ENST00000267163.4	+	6	677		c.e6-1			NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1						androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(6)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TTTGTTTAATAGGATATCTAC	0.259		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																											.		Atlas-SNP	.	yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	.,2	RB1	1068	.	21	Whole gene deletion(15)|Unknown(6)	bone(11)|breast(6)|eye(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)	c.540-2A>T	GRCh37	CS030548	RB1	S		.						54.0	58.0	57.0					13																	48923090		2194	4275	6469	SO:0001630	splice_region_variant	5925	exon6	Familial Cancer Database		TTTAATAGGATAT	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.540-1A>T	chr13.hg19:g.48923090A>T		40.0	0.0		33.0	19.0	NM_000321	A8K5E3|P78499|Q5VW46|Q8IZL4	Splice_Site	SNP	ENST00000267163.4	hg19	CCDS31973.1	.	.	.	.	.	.	.	.	.	.	A	19.66	3.870042	0.72065	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	.	.	.	5.23	5.23	0.72850	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.792	0.52075	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RB1	47821091	0.998000	0.40836	1.000000	0.80357	0.994000	0.84299	5.041000	0.64196	2.111000	0.64477	0.528000	0.53228	.	.	.		0.259	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000044884.1		Intron
PCDH17	27253	hgsc.bcm.edu	37	13	58208511	58208511	+	Missense_Mutation	SNP	C	C	A			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr13:58208511C>A	ENST00000377918.3	+	1	1857	c.1831C>A	c.(1831-1833)Cgc>Agc	p.R611S		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	611	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		GAGCACTGTGCGCGCCCTAGA	0.657																																					p.R611S	Melanoma(72;952 1291 1619 12849 33676)	Atlas-SNP	.											PCDH17,caecum,carcinoma,0,1	PCDH17	304	.	0			c.C1831A						.						34.0	33.0	34.0					13																	58208511		2202	4296	6498	SO:0001583	missense	27253	exon1			ACTGTGCGCGCCC	AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.1831C>A	chr13.hg19:g.58208511C>A	ENSP00000367151:p.Arg611Ser	45.0	0.0		50.0	2.0	NM_001040429	A8K1R5|Q5VVW9|Q5VVX0	Missense_Mutation	SNP	ENST00000377918.3	hg19	CCDS31986.1	.	.	.	.	.	.	.	.	.	.	C	8.436	0.849830	0.17034	.	.	ENSG00000118946	ENST00000377918	T	0.51071	0.72	5.36	4.46	0.54185	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.45518	0.1346	N	0.16066	0.365	0.48341	D	0.999635	P;D	0.57257	0.929;0.979	P;P	0.60789	0.705;0.879	T	0.31392	-0.9945	9	.	.	.	.	12.7714	0.57423	0.2873:0.7127:0.0:0.0	.	611;611	O14917-2;O14917	.;PCD17_HUMAN	S	611	ENSP00000367151:R611S	.	R	+	1	0	PCDH17	57106512	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	4.027000	0.57239	2.500000	0.84329	0.561000	0.74099	CGC	.	.		0.657	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045139.1	NM_001040429	
NFATC4	4776	hgsc.bcm.edu	37	14	24845640	24845640	+	Missense_Mutation	SNP	G	G	A			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr14:24845640G>A	ENST00000250373.4	+	9	2338	c.2197G>A	c.(2197-2199)Gaa>Aaa	p.E733K	NFATC4_ENST00000554591.1_Missense_Mutation_p.E796K|NFATC4_ENST00000556279.1_Missense_Mutation_p.E765K|NFATC4_ENST00000554966.1_Missense_Mutation_p.E746K|NFATC4_ENST00000553879.1_Missense_Mutation_p.E663K|NFATC4_ENST00000413692.2_Missense_Mutation_p.E796K|NFATC4_ENST00000556169.1_Missense_Mutation_p.E721K|NFATC4_ENST00000539237.2_Missense_Mutation_p.E765K|NFATC4_ENST00000424781.2_Missense_Mutation_p.E746K|NFATC4_ENST00000555393.1_Missense_Mutation_p.E21K|NFATC4_ENST00000556759.1_Missense_Mutation_p.E268K|NFATC4_ENST00000555590.1_Missense_Mutation_p.E746K|NFATC4_ENST00000555167.1_Missense_Mutation_p.E268K|NFATC4_ENST00000557767.1_Missense_Mutation_p.E21K|NFATC4_ENST00000554473.1_Missense_Mutation_p.E268K|NFATC4_ENST00000557451.1_Missense_Mutation_p.E663K|NFATC4_ENST00000554344.1_Missense_Mutation_p.E663K|NFATC4_ENST00000422617.3_Missense_Mutation_p.E721K|NFATC4_ENST00000553708.1_Missense_Mutation_p.E733K|NFATC4_ENST00000554661.1_Missense_Mutation_p.E663K|NFATC4_ENST00000554050.1_Missense_Mutation_p.E733K|NFATC4_ENST00000553469.1_Missense_Mutation_p.E765K|NFATC4_ENST00000555802.1_Missense_Mutation_p.E21K|NFATC4_ENST00000555453.1_Missense_Mutation_p.E721K	NM_004554.4	NP_004545.2	Q14934	NFAC4_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4	733	Pro-rich.				cellular respiration (GO:0045333)|cellular response to lithium ion (GO:0071285)|cellular response to UV (GO:0034644)|heart development (GO:0007507)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of synaptic plasticity (GO:0048167)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription coactivator activity (GO:0003713)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(7)|liver(4)|lung(12)|ovary(1)|skin(2)	34				GBM - Glioblastoma multiforme(265;0.018)		CCCTGCTTGCGAAACTCCTTA	0.617																																					p.E796K		Atlas-SNP	.											.	NFATC4	115	.	0			c.G2386A						.						59.0	63.0	62.0					14																	24845640		2203	4300	6503	SO:0001583	missense	4776	exon10			GCTTGCGAAACTC	BC053855	CCDS9629.1, CCDS45089.1, CCDS55909.1, CCDS55910.1, CCDS55911.1, CCDS73625.1	14q11.2	2009-11-24			ENSG00000100968	ENSG00000100968		"""Nuclear factor of activated T-cells"""	7778	protein-coding gene	gene with protein product		602699				7749981	Standard	NM_004554		Approved	NFAT3	uc010tok.2	Q14934	OTTHUMG00000029351	ENST00000250373.4:c.2197G>A	chr14.hg19:g.24845640G>A	ENSP00000250373:p.Glu733Lys	86.0	0.0		67.0	20.0	NM_001198967	B4DDG5|B4DY55|B5B2U7|B5B2U8|B5B2U9|B5B2V0|B5B2V1|B5B2V2|B5B2V3|B5B2V4|B5B2V5|B5B2V7|B5B2V8|B5B2V9|B5B2W0|B5B2W1|B5B2W2|B5B2W3|B5B2W4|B5B2W5|B5B2W6|B5B2W7|B5B2W8|B5B2W9|B5B2X0|Q7Z598|Q96H68	Missense_Mutation	SNP	ENST00000250373.4	hg19	CCDS9629.1	.	.	.	.	.	.	.	.	.	.	G	12.72	2.021647	0.35701	.	.	ENSG00000100968	ENST00000413692;ENST00000554591;ENST00000555590;ENST00000554966;ENST00000424781;ENST00000539237;ENST00000556279;ENST00000553469;ENST00000554050;ENST00000250373;ENST00000553708;ENST00000553879;ENST00000554344;ENST00000554661;ENST00000556169;ENST00000557451;ENST00000422617;ENST00000555453;ENST00000554473;ENST00000556759;ENST00000555167;ENST00000557767;ENST00000555393;ENST00000555802	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.56776	3.26;3.26;3.28;3.27;3.27;3.27;3.28;3.27;3.28;3.29;3.27;2.96;2.96;2.96;2.95;2.95;2.95;2.96;1.55;1.53;1.52;0.44;0.47	5.13	5.13	0.70059	.	0.000000	0.64402	D	0.000017	T	0.32406	0.0828	N	0.19112	0.55	0.27737	N	0.944606	B;B;B;B;B;B;B;B;B;B;B;B;B	0.33198	0.401;0.401;0.401;0.401;0.401;0.401;0.401;0.401;0.401;0.401;0.401;0.401;0.279	B;B;B;B;B;B;B;B;B;B;B;B;B	0.26770	0.03;0.044;0.044;0.044;0.044;0.044;0.044;0.044;0.073;0.073;0.073;0.044;0.02	T	0.13335	-1.0513	10	0.09590	T	0.72	-5.1132	13.9397	0.64048	0.0:0.0:1.0:0.0	.	721;721;765;765;746;746;746;796;796;721;765;796;733	Q14934-17;Q14934-9;Q14934-14;Q14934-4;Q14934-15;Q14934-6;Q14934-7;Q14934-2;Q14934-3;Q14934-10;Q14934-5;Q14934-11;Q14934	.;.;.;.;.;.;.;.;.;.;.;.;NFAC4_HUMAN	K	796;796;746;746;746;765;765;765;733;733;733;663;663;663;721;663;721;721;268;268;268;21;21;21	ENSP00000388910:E796K;ENSP00000452039:E796K;ENSP00000451224:E746K;ENSP00000450644:E746K;ENSP00000388668:E746K;ENSP00000439350:E765K;ENSP00000452270:E765K;ENSP00000451502:E765K;ENSP00000451151:E733K;ENSP00000250373:E733K;ENSP00000450590:E733K;ENSP00000452349:E663K;ENSP00000450469:E663K;ENSP00000450733:E663K;ENSP00000451454:E721K;ENSP00000451284:E663K;ENSP00000396788:E721K;ENSP00000450686:E721K;ENSP00000450810:E268K;ENSP00000451183:E268K;ENSP00000451395:E268K;ENSP00000451801:E21K;ENSP00000451590:E21K	ENSP00000250373:E733K	E	+	1	0	NFATC4	23915480	0.813000	0.29090	0.997000	0.53966	0.918000	0.54935	2.738000	0.47401	2.667000	0.90743	0.561000	0.74099	GAA	.	.		0.617	NFATC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000073206.6	NM_004554	
SEL1L	6400	hgsc.bcm.edu	37	14	82000074	82000074	+	Missense_Mutation	SNP	T	T	C			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr14:82000074T>C	ENST00000336735.4	-	1	131	c.15A>G	c.(13-15)atA>atG	p.I5M	SEL1L_ENST00000555824.1_Missense_Mutation_p.I5M	NM_005065.5	NP_005056.3	Q9UBV2	SE1L1_HUMAN	sel-1 suppressor of lin-12-like (C. elegans)	5					Notch signaling pathway (GO:0007219)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(3)	28				BRCA - Breast invasive adenocarcinoma(234;0.0299)		GCGTCAGCCCTATCCGGACCC	0.716																																					p.I5M		Atlas-SNP	.											.	SEL1L	67	.	0			c.A15G						.						43.0	35.0	38.0					14																	82000074		2202	4298	6500	SO:0001583	missense	6400	exon1			CAGCCCTATCCGG		CCDS9876.1, CCDS58333.1	14q31	2011-03-31	2001-11-28		ENSG00000071537	ENSG00000071537			10717	protein-coding gene	gene with protein product	"""sel-1 suppressor of lin-12-like 1 (C. elegans)"""	602329	"""sel-1 (suppressor of lin-12, C.elegans)-like"""			9417916, 10051412, 16331677	Standard	NM_005065		Approved	IBD2, SEL1L1	uc010tvv.2	Q9UBV2		ENST00000336735.4:c.15A>G	chr14.hg19:g.82000074T>C	ENSP00000337053:p.Ile5Met	104.0	0.0		106.0	36.0	NM_001244984	Q6UWT6|Q9P1T9|Q9UHK7	Missense_Mutation	SNP	ENST00000336735.4	hg19	CCDS9876.1	.	.	.	.	.	.	.	.	.	.	T	14.11	2.437859	0.43326	.	.	ENSG00000071537	ENST00000336735;ENST00000555824;ENST00000557372	T;T;T	0.38887	1.62;1.35;1.11	5.58	-5.48	0.02592	.	0.734945	0.12917	N	0.428472	T	0.15132	0.0365	N	0.08118	0	0.09310	N	1	B;B	0.14805	0.006;0.011	B;B	0.17722	0.006;0.019	T	0.10917	-1.0609	10	0.59425	D	0.04	-19.228	0.2545	0.00210	0.3384:0.2346:0.1985:0.2285	.	5;5	Q9UBV2;Q9UBV2-2	SE1L1_HUMAN;.	M	5	ENSP00000337053:I5M;ENSP00000450709:I5M;ENSP00000451144:I5M	ENSP00000337053:I5M	I	-	3	3	SEL1L	81069827	0.357000	0.24938	0.031000	0.17742	0.950000	0.60333	-0.201000	0.09464	-0.874000	0.04027	-1.142000	0.01873	ATA	.	.		0.716	SEL1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413325.1	NM_005065	
AHNAK2	113146	hgsc.bcm.edu	37	14	105406860	105406860	+	Silent	SNP	G	G	A			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr14:105406860G>A	ENST00000333244.5	-	7	15047	c.14928C>T	c.(14926-14928)gaC>gaT	p.D4976D	AHNAK2_ENST00000557457.1_5'UTR	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4976						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TGCATTCTGGGTCCACCTTTG	0.527																																					p.D4976D		Atlas-SNP	.											.	AHNAK2	719	.	0			c.C14928T						.						49.0	48.0	49.0					14																	105406860		2003	4169	6172	SO:0001819	synonymous_variant	113146	exon7			TTCTGGGTCCACC	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.14928C>T	chr14.hg19:g.105406860G>A		144.0	0.0		97.0	27.0	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	hg19	CCDS45177.1																																																																																			.	.		0.527	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
CHD9	80205	hgsc.bcm.edu	37	16	53338133	53338133	+	Missense_Mutation	SNP	T	T	C			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr16:53338133T>C	ENST00000398510.3	+	30	6302	c.6215T>C	c.(6214-6216)cTa>cCa	p.L2072P	CHD9_ENST00000447540.1_Missense_Mutation_p.L2072P|CHD9_ENST00000564845.1_Missense_Mutation_p.L2072P|CHD9_ENST00000566029.1_Missense_Mutation_p.L2072P			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	2072					cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				ACCAGGACACTAATAAAATCT	0.403																																					p.L2072P		Atlas-SNP	.											.	CHD9	203	.	0			c.T6215C						.						36.0	34.0	35.0					16																	53338133		1846	4080	5926	SO:0001583	missense	80205	exon31			GGACACTAATAAA	AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.6215T>C	chr16.hg19:g.53338133T>C	ENSP00000381522:p.Leu2072Pro	30.0	0.0		45.0	17.0	NM_025134	B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Missense_Mutation	SNP	ENST00000398510.3	hg19		.	.	.	.	.	.	.	.	.	.	T	10.14	1.268789	0.23136	.	.	ENSG00000177200	ENST00000447540;ENST00000398510	T;T	0.70516	-0.49;-0.49	6.16	3.74	0.42951	.	0.300668	0.23256	N	0.050190	T	0.46737	0.1408	N	0.03608	-0.345	0.43338	D	0.995381	B;P;B;P	0.36315	0.412;0.547;0.412;0.547	B;B;B;B	0.33960	0.133;0.173;0.084;0.173	T	0.48525	-0.9028	10	0.30854	T	0.27	-3.5851	14.6633	0.68888	0.0:0.0:0.3663:0.6337	.	2072;2072;2072;2072	B7ZML1;Q3L8U1-3;Q3L8U1;Q3L8U1-2	.;.;CHD9_HUMAN;.	P	2072	ENSP00000396345:L2072P;ENSP00000381522:L2072P	ENSP00000381522:L2072P	L	+	2	0	CHD9	51895634	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.913000	0.28611	1.131000	0.42111	0.528000	0.53228	CTA	.	.		0.403	CHD9-020	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000422345.1	NM_025134	
TANGO6	79613	hgsc.bcm.edu	37	16	69056820	69056820	+	Missense_Mutation	SNP	T	T	G			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr16:69056820T>G	ENST00000261778.1	+	16	2944	c.2932T>G	c.(2932-2934)Ttg>Gtg	p.L978V		NM_024562.1	NP_078838.1	Q9C0B7	TNG6_HUMAN	transport and golgi organization 6 homolog (Drosophila)	978						integral component of membrane (GO:0016021)											GGCCAGCAGCTTGGCCAACCT	0.512																																					p.L978V		Atlas-SNP	.											.	.	.	.	0			c.T2932G						.						42.0	43.0	43.0					16																	69056820		1941	4150	6091	SO:0001583	missense	79613	exon16			AGCAGCTTGGCCA		CCDS45516.1	16q22.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000103047	ENSG00000103047			25749	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 7"""	TMCO7		11214970	Standard	NM_024562		Approved	FLJ12688, KIAA1746	uc002ewi.4	Q9C0B7	OTTHUMG00000176743	ENST00000261778.1:c.2932T>G	chr16.hg19:g.69056820T>G	ENSP00000261778:p.Leu978Val	90.0	0.0		47.0	17.0	NM_024562	Q569F9|Q9H9K1	Missense_Mutation	SNP	ENST00000261778.1	hg19	CCDS45516.1	.	.	.	.	.	.	.	.	.	.	T	16.49	3.137422	0.56936	.	.	ENSG00000103047	ENST00000261778	T	0.68903	-0.36	4.31	-0.476	0.12100	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000003	T	0.78566	0.4303	M	0.83774	2.66	0.44275	D	0.997134	D	0.69078	0.997	D	0.78314	0.991	T	0.76528	-0.2926	10	0.59425	D	0.04	-4.1844	9.2696	0.37664	0.0:0.5982:0.0:0.4018	.	978	Q9C0B7	TMCO7_HUMAN	V	978	ENSP00000261778:L978V	ENSP00000261778:L978V	L	+	1	2	TMCO7	67614321	1.000000	0.71417	0.945000	0.38365	0.747000	0.42532	1.820000	0.39032	-0.152000	0.11156	0.363000	0.22086	TTG	.	.		0.512	TANGO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433471.2	XM_928235.2	
TP53	7157	hgsc.bcm.edu	37	17	7576928	7576928	+	Splice_Site	SNP	T	T	C	rs397516439		TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr17:7576928T>C	ENST00000269305.4	-	9	1109		c.e9-2		TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(28)|p.0?(8)|p.A307fs*34(1)|p.L308fs*31(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGGGCAGTGCTAGGAAAGAGG	0.493		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											.	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000455263,NS,carcinoma,0,37	TP53	33396	.	38	Unknown(28)|Whole gene deletion(8)|Deletion - Frameshift(2)	lung(11)|upper_aerodigestive_tract(6)|breast(5)|bone(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|urinary_tract(2)|liver(2)|large_intestine(1)|stomach(1)|gastrointestinal_tract_(site_indeterminate)(1)|ovary(1)	c.920-2A>G						.						137.0	124.0	129.0					17																	7576928		2203	4300	6503	SO:0001630	splice_region_variant	7157	exon10	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	CAGTGCTAGGAAA	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.920-2A>G	chr17.hg19:g.7576928T>C		195.0	0.0		81.0	40.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	T	8.085	0.773141	0.16051	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	4.71	3.58	0.41010	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.665	0.28426	0.187:0.0:0.0:0.813	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7517653	0.089000	0.21612	0.933000	0.37362	0.236000	0.25371	0.838000	0.27572	1.993000	0.58246	0.459000	0.35465	.	.	.		0.493	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Intron
KRT34	3885	hgsc.bcm.edu	37	17	39535325	39535325	+	Missense_Mutation	SNP	T	T	A			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr17:39535325T>A	ENST00000394001.1	-	6	1136	c.1106A>T	c.(1105-1107)gAg>gTg	p.E369V		NM_021013.3	NP_066293.2	O76011	KRT34_HUMAN	keratin 34	369	Coil 2.|Rod.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Breast(137;0.000496)				ACAGCGGATCTCTGCCAGCTG	0.622																																					p.E369V		Atlas-SNP	.											.	KRT34	71	.	0			c.A1106T						.						134.0	113.0	120.0					17																	39535325		2203	4300	6503	SO:0001583	missense	3885	exon6			CGGATCTCTGCCA	Y16790	CCDS11390.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000131737	ENSG00000131737		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6452	protein-coding gene	gene with protein product	"""hard keratin type I 4"""	602763	"""keratin, hair, acidic, 4"""	KRTHA4		2431943, 9756910, 16831889	Standard	NM_021013		Approved	Ha-4	uc002hwm.3	O76011	OTTHUMG00000133436	ENST00000394001.1:c.1106A>T	chr17.hg19:g.39535325T>A	ENSP00000377570:p.Glu369Val	75.0	0.0		92.0	27.0	NM_021013	Q8IUT8|Q8N4W2	Missense_Mutation	SNP	ENST00000394001.1	hg19	CCDS11390.1	.	.	.	.	.	.	.	.	.	.	N	13.09	2.134600	0.37630	.	.	ENSG00000131737	ENST00000394001;ENST00000251648	D	0.92348	-3.02	5.05	5.05	0.67936	Filament (1);	0.000000	0.64402	D	0.000004	D	0.96321	0.8800	M	0.91717	3.235	0.27353	N	0.956199	D	0.76494	0.999	D	0.78314	0.991	D	0.91692	0.5367	10	0.87932	D	0	.	10.3761	0.44083	0.0:0.0803:0.0:0.9197	.	369	O76011	KRT34_HUMAN	V	327;369	ENSP00000377570:E327V	ENSP00000251648:E369V	E	-	2	0	KRT34	36788851	0.005000	0.15991	0.970000	0.41538	0.067000	0.16453	0.881000	0.28173	2.031000	0.59945	0.528000	0.53228	GAG	.	.		0.622	KRT34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257304.3	NM_021013	
HOXB2	3212	hgsc.bcm.edu	37	17	46620596	46620596	+	Missense_Mutation	SNP	G	G	T			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr17:46620596G>T	ENST00000330070.4	-	2	2072	c.905C>A	c.(904-906)cCt>cAt	p.P302H	HOXB2_ENST00000504772.3_5'Flank|HOXB-AS1_ENST00000504972.3_RNA|HOXB-AS1_ENST00000435312.1_RNA|HOXB-AS1_ENST00000508688.1_RNA	NM_002145.3	NP_002136.1	P14652	HXB2_HUMAN	homeobox B2	302					anterior/posterior pattern specification (GO:0009952)|blood circulation (GO:0008015)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|facial nerve structural organization (GO:0021612)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|neural nucleus development (GO:0048857)|rhombomere 3 development (GO:0021569)|rhombomere 4 development (GO:0021570)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	11						GGGAAGGAAAGGTGAATCCTG	0.692																																					p.P302H		Atlas-SNP	.											.	HOXB2	23	.	0			c.C905A						.						39.0	45.0	43.0					17																	46620596		2203	4300	6503	SO:0001583	missense	3212	exon2			AGGAAAGGTGAAT		CCDS11527.1	17q21.32	2012-02-22	2005-12-22		ENSG00000173917	ENSG00000173917		"""Homeoboxes / ANTP class : HOXL subclass"""	5113	protein-coding gene	gene with protein product		142967	"""homeo box B2"""	HOX2, HOX2H		1973146, 1358459	Standard	XM_005257276		Approved		uc002inm.3	P14652	OTTHUMG00000159930	ENST00000330070.4:c.905C>A	chr17.hg19:g.46620596G>T	ENSP00000331741:p.Pro302His	66.0	0.0		66.0	24.0	NM_002145	P10913|P17485	Missense_Mutation	SNP	ENST00000330070.4	hg19	CCDS11527.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.846010	0.91277	.	.	ENSG00000173917	ENST00000330070	T	0.09723	2.95	5.57	4.57	0.56435	.	0.256303	0.40064	N	0.001185	T	0.10294	0.0252	L	0.32530	0.975	0.40052	D	0.975782	B	0.28760	0.221	B	0.22386	0.039	T	0.06862	-1.0803	10	0.87932	D	0	.	15.3464	0.74340	0.0:0.0:0.8592:0.1408	.	302	P14652	HXB2_HUMAN	H	302	ENSP00000331741:P302H	ENSP00000331741:P302H	P	-	2	0	HOXB2	43975595	0.998000	0.40836	0.212000	0.23672	0.843000	0.47879	4.899000	0.63245	1.324000	0.45282	0.650000	0.86243	CCT	.	.		0.692	HOXB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358384.2		
GPR142	350383	hgsc.bcm.edu	37	17	72367914	72367914	+	Silent	SNP	C	C	T			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr17:72367914C>T	ENST00000335666.4	+	4	612	c.564C>T	c.(562-564)acC>acT	p.T188T		NM_181790.1	NP_861455.1	Q7Z601	GP142_HUMAN	G protein-coupled receptor 142	188						cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(21)|ovary(2)|prostate(1)|skin(4)	35						CCACCAGGACCAGGAGGCCCT	0.637																																					p.T188T		Atlas-SNP	.											.	GPR142	74	.	0			c.C564T						.						52.0	46.0	48.0					17																	72367914		2203	4300	6503	SO:0001819	synonymous_variant	350383	exon4			CAGGACCAGGAGG	AY255622	CCDS11698.1	17q25.2	2012-08-21				ENSG00000257008		"""GPCR / Class A : Orphans"""	20088	protein-coding gene	gene with protein product		609046				14623098	Standard	NM_181790		Approved	PGR2	uc010wqy.2	Q7Z601		ENST00000335666.4:c.564C>T	chr17.hg19:g.72367914C>T		62.0	0.0		37.0	14.0	NM_181790	A4CYJ8|Q86SL3	Silent	SNP	ENST00000335666.4	hg19	CCDS11698.1																																																																																			.	.		0.637	GPR142-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442545.1	NM_181790	
MEX3C	51320	hgsc.bcm.edu	37	18	48723154	48723154	+	Intron	SNP	G	G	C	rs78074704|rs62092914|rs147438518		TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr18:48723154G>C	ENST00000591040.1	-	2	43				MEX3C_ENST00000592416.1_5'Flank			Q5U5Q3	MEX3C_HUMAN	mex-3 RNA binding family member C						chondrocyte hypertrophy (GO:0003415)|energy homeostasis (GO:0097009)|regulation of fat cell differentiation (GO:0045598)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(11)|ovary(1)|skin(1)	17		Colorectal(6;0.003)|all_epithelial(6;0.0473)		Colorectal(16;0.0175)|READ - Rectum adenocarcinoma(32;0.15)		ccgccgccgcggccgccgccT	0.771																																					p.A179A		Atlas-SNP	.											MEX3C_ENST00000406189,NS,carcinoma,0,1	MEX3C	77	.	0			c.C537G						.						3.0	3.0	3.0					18																	48723154		1139	2266	3405	SO:0001627	intron_variant	51320	exon1			CGCCGCGGCCGCC	BC041122	CCDS11951.2	18q21.1	2013-08-21	2013-08-21	2007-07-18	ENSG00000176624	ENSG00000176624		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	28040	protein-coding gene	gene with protein product		611005	"""ring finger and KH domain containing 2"", ""mex-3 homolog C (C. elegans)"""	RKHD2		17267406	Standard	NM_016626		Approved	FLJ38871, RNF194	uc002lfc.4	Q5U5Q3	OTTHUMG00000132693	ENST00000591040.1:c.757-19208C>G	chr18.hg19:g.48723154G>C		39.0	2.0		47.0	6.0	NM_016626	A1L022|Q9NZE3	Silent	SNP	ENST00000591040.1	hg19																																																																																				.	.		0.771	MEX3C-003	KNOWN	mRNA_end_NF|basic	processed_transcript	protein_coding	OTTHUMT00000449559.1	NM_016626	
CCDC151	115948	hgsc.bcm.edu	37	19	11532471	11532471	+	Silent	SNP	C	C	G			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr19:11532471C>G	ENST00000356392.4	-	11	1551	c.1464G>C	c.(1462-1464)ctG>ctC	p.L488L	CCDC151_ENST00000545100.1_Silent_p.L434L|CCDC151_ENST00000586836.1_Silent_p.L297L|CCDC151_ENST00000591179.1_Silent_p.L428L|RGL3_ENST00000393423.3_5'Flank|RGL3_ENST00000380456.3_5'Flank	NM_145045.4	NP_659482.3	A5D8V7	CC151_HUMAN	coiled-coil domain containing 151	488										endometrium(2)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)	12						CCTGGGGATCCAGCTCCTTTC	0.667																																					p.L488L		Atlas-SNP	.											.	CCDC151	44	.	0			c.G1464C						.						54.0	58.0	56.0					19																	11532471		1905	4095	6000	SO:0001819	synonymous_variant	115948	exon11			GGGATCCAGCTCC		CCDS42501.1	19p13.2	2014-02-20				ENSG00000198003			28303	protein-coding gene	gene with protein product		615956				24067530	Standard	NM_145045		Approved	MGC20983	uc002mrs.3	A5D8V7		ENST00000356392.4:c.1464G>C	chr19.hg19:g.11532471C>G		104.0	0.0		77.0	34.0	NM_145045	B4DXT0|Q96CG5	Silent	SNP	ENST00000356392.4	hg19	CCDS42501.1																																																																																			.	.		0.667	CCDC151-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458800.1	NM_145045	
FAM32A	26017	hgsc.bcm.edu	37	19	16296481	16296481	+	Missense_Mutation	SNP	A	A	G			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr19:16296481A>G	ENST00000263384.7	+	2	146	c.121A>G	c.(121-123)Atg>Gtg	p.M41V	CTD-2562J15.4_ENST00000591038.1_RNA|FAM32A_ENST00000588367.1_Missense_Mutation_p.M41V|FAM32A_ENST00000589852.1_Missense_Mutation_p.M21V	NM_014077.2	NP_054796.1	Q9Y421	FA32A_HUMAN	family with sequence similarity 32, member A	41	Lys-rich.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			lung(1)	1						CCTGGAAGCAATGGGAACGAG	0.592											OREG0025331	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.M41V		Atlas-SNP	.											.	FAM32A	6	.	0			c.A121G						.						36.0	38.0	37.0					19																	16296481		2196	4279	6475	SO:0001583	missense	26017	exon2			GAAGCAATGGGAA	BC000639	CCDS12341.1	19p13.12-p13.11	2013-09-19			ENSG00000105058	ENSG00000105058			24563	protein-coding gene	gene with protein product		614554				11230166, 10810093	Standard	NM_014077		Approved	DKFZP586O0120	uc002ndt.3	Q9Y421	OTTHUMG00000182279	ENST00000263384.7:c.121A>G	chr19.hg19:g.16296481A>G	ENSP00000263384:p.Met41Val	231.0	0.0	709	159.0	43.0	NM_014077	Q9BT02	Missense_Mutation	SNP	ENST00000263384.7	hg19	CCDS12341.1	.	.	.	.	.	.	.	.	.	.	A	6.820	0.520384	0.13005	.	.	ENSG00000105058	ENST00000263384	.	.	.	3.54	3.54	0.40534	.	0.322184	0.34314	N	0.004075	T	0.24431	0.0592	N	0.16066	0.365	0.25261	N	0.989597	B	0.19445	0.036	B	0.20184	0.028	T	0.13602	-1.0503	9	0.28530	T	0.3	-41.5663	10.2853	0.43564	1.0:0.0:0.0:0.0	.	41	Q9Y421	FA32A_HUMAN	V	41	.	ENSP00000263384:M41V	M	+	1	0	FAM32A	16157481	1.000000	0.71417	0.998000	0.56505	0.914000	0.54420	4.574000	0.60900	1.620000	0.50308	0.456000	0.33151	ATG	.	.		0.592	FAM32A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460346.1	NM_014077	
DPY19L3	147991	hgsc.bcm.edu	37	19	32968508	32968508	+	Missense_Mutation	SNP	T	T	A			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr19:32968508T>A	ENST00000342179.5	+	17	1993	c.1778T>A	c.(1777-1779)cTa>cAa	p.L593Q	DPY19L3_ENST00000586987.1_Missense_Mutation_p.L593Q|DPY19L3_ENST00000392250.2_Missense_Mutation_p.L593Q	NM_207325.2	NP_997208.2	Q6ZPD9	D19L3_HUMAN	dpy-19-like 3 (C. elegans)	593						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(17)|ovary(4)|pancreas(1)	32	Esophageal squamous(110;0.162)					GGAAGGACCCTAACCAACCAC	0.577																																					p.L593Q		Atlas-SNP	.											.	DPY19L3	70	.	0			c.T1778A						.						129.0	109.0	116.0					19																	32968508		2203	4300	6503	SO:0001583	missense	147991	exon17			GGACCCTAACCAA		CCDS12422.1	19q13.11	2008-02-05				ENSG00000178904			27120	protein-coding gene	gene with protein product		613894					Standard	NM_207325		Approved		uc002ntg.3	Q6ZPD9		ENST00000342179.5:c.1778T>A	chr19.hg19:g.32968508T>A	ENSP00000344937:p.Leu593Gln	88.0	0.0		113.0	36.0	NM_001172774	Q68DC7|Q6ZTB7|Q6ZTS2	Missense_Mutation	SNP	ENST00000342179.5	hg19	CCDS12422.1	.	.	.	.	.	.	.	.	.	.	T	27.6	4.848505	0.91277	.	.	ENSG00000178904	ENST00000392250;ENST00000342179	T;T	0.58060	0.36;0.36	5.4	5.4	0.78164	.	0.000000	0.64402	D	0.000008	T	0.72526	0.3471	M	0.74258	2.255	0.49798	D	0.999823	D	0.89917	1.0	D	0.91635	0.999	T	0.76537	-0.2923	10	0.87932	D	0	-2.0715	15.4079	0.74893	0.0:0.0:0.0:1.0	.	593	Q6ZPD9	D19L3_HUMAN	Q	593	ENSP00000376081:L593Q;ENSP00000344937:L593Q	ENSP00000344937:L593Q	L	+	2	0	DPY19L3	37660348	0.999000	0.42202	0.598000	0.28837	0.945000	0.59286	8.040000	0.89188	2.046000	0.60703	0.460000	0.39030	CTA	.	.		0.577	DPY19L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450311.1	NM_207325	
LRFN1	57622	hgsc.bcm.edu	37	19	39805160	39805160	+	Nonsense_Mutation	SNP	C	C	A			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr19:39805160C>A	ENST00000248668.4	-	1	816	c.817G>T	c.(817-819)Gag>Tag	p.E273*	CTC-246B18.8_ENST00000601911.1_RNA	NM_020862.1	NP_065913.1	Q9P244	LRFN1_HUMAN	leucine rich repeat and fibronectin type III domain containing 1	273	LRRCT.					cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	18	all_cancers(60;1.85e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;1.96e-27)|all cancers(26;2.05e-24)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)			GCGCAGGTCTCTAAGTCGTCC	0.687																																					p.E273X		Atlas-SNP	.											.	LRFN1	59	.	0			c.G817T						.						22.0	29.0	26.0					19																	39805160		2192	4290	6482	SO:0001587	stop_gained	57622	exon1			AGGTCTCTAAGTC	BC014678	CCDS46071.1	19q13.2	2013-02-11				ENSG00000128011		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29290	protein-coding gene	gene with protein product		612807				10819331, 16828986	Standard	NM_020862		Approved	KIAA1484, SALM2	uc002okw.2	Q9P244		ENST00000248668.4:c.817G>T	chr19.hg19:g.39805160C>A	ENSP00000248668:p.Glu273*	105.0	0.0		52.0	11.0	NM_020862	Q8TBS9	Nonsense_Mutation	SNP	ENST00000248668.4	hg19	CCDS46071.1	.	.	.	.	.	.	.	.	.	.	C	34	5.351134	0.95830	.	.	ENSG00000128011	ENST00000248668	.	.	.	4.3	4.3	0.51218	.	0.000000	0.44097	D	0.000499	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	.	14.2826	0.66224	0.0:1.0:0.0:0.0	.	.	.	.	X	273	.	ENSP00000248668:E273X	E	-	1	0	LRFN1	44497000	1.000000	0.71417	1.000000	0.80357	0.699000	0.40488	7.610000	0.82949	2.234000	0.73211	0.491000	0.48974	GAG	.	.		0.687	LRFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463835.1	NM_020862	
CLC	1178	hgsc.bcm.edu	37	19	40225044	40225044	+	Missense_Mutation	SNP	C	C	T	rs140514392	byFrequency	TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr19:40225044C>T	ENST00000221804.4	-	3	257	c.182G>A	c.(181-183)cGt>cAt	p.R61H		NM_001828.5	NP_001819.2	Q05315	LEG10_HUMAN	Charcot-Leyden crystal galectin	61	Galectin. {ECO:0000255|PROSITE- ProRule:PRU00639}.				multicellular organismal development (GO:0007275)|regulation of activated T cell proliferation (GO:0046006)|regulation of T cell anergy (GO:0002667)|regulation of T cell cytokine production (GO:0002724)|T cell apoptotic process (GO:0070231)	cytosol (GO:0005829)	carbohydrate binding (GO:0030246)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(2)|stomach(1)	12	all_cancers(60;2.99e-06)|all_lung(34;4.7e-08)|Lung NSC(34;5.46e-08)|Ovarian(47;0.06)	Renal(1328;0.000147)|Hepatocellular(1079;0.0202)|Myeloproliferative disorder(2;0.0255)	Epithelial(26;6.43e-25)|OV - Ovarian serous cystadenocarcinoma(5;1.07e-24)|all cancers(26;8.38e-23)	GBM - Glioblastoma multiforme(1328;4.97e-06)|STAD - Stomach adenocarcinoma(1328;0.00655)		CATGACCACACGACGACCAAA	0.488																																					p.R61H		Atlas-SNP	.											.	CLC	20	.	0			c.G182A						.						234.0	195.0	208.0					19																	40225044		2203	4300	6503	SO:0001583	missense	1178	exon3			ACCACACGACGAC	L01664	CCDS33025.1	19q13.1	2013-06-12	2013-06-12		ENSG00000105205	ENSG00000105205		"""Lectins, galactoside-binding"""	2014	protein-coding gene	gene with protein product	"""eosinophil lysophospholipase"", ""lysolecithin acylhydrolase"", ""galectin 10"", ""lectin, galactoside-binding, soluble, 10"""	153310	"""Charcot-Leyden crystal protein"""			1577491, 11834744	Standard	NM_001828		Approved	LGALS10, MGC149659, Gal-10	uc002omh.3	Q05315		ENST00000221804.4:c.182G>A	chr19.hg19:g.40225044C>T	ENSP00000221804:p.Arg61His	74.0	0.0		78.0	31.0	NM_001828	C5HZ13|C5HZ14|Q0VDE3	Missense_Mutation	SNP	ENST00000221804.4	hg19	CCDS33025.1	.	.	.	.	.	.	.	.	.	.	.	0.064	-1.217737	0.01542	.	.	ENSG00000105205	ENST00000221804	T	0.05513	3.43	1.3	-2.6	0.06190	Concanavalin A-like lectin/glucanase (1);Galectin, carbohydrate recognition domain (4);Concanavalin A-like lectin/glucanase, subgroup (1);	.	.	.	.	T	0.03434	0.0099	N	0.25647	0.755	0.09310	N	1	B	0.06786	0.001	B	0.13407	0.009	T	0.47522	-0.9111	9	0.15499	T	0.54	.	2.7047	0.05159	0.0:0.3035:0.2606:0.4359	.	61	Q05315	LPPL_HUMAN	H	61	ENSP00000221804:R61H	ENSP00000221804:R61H	R	-	2	0	CLC	44916884	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.490000	0.00453	-1.016000	0.03371	-0.704000	0.03662	CGT	.	C|0.999;A|0.001		0.488	CLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465225.1	NM_001828	
ZNF229	7772	hgsc.bcm.edu	37	19	44934548	44934548	+	Silent	SNP	A	A	G			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr19:44934548A>G	ENST00000588931.1	-	6	841	c.408T>C	c.(406-408)gaT>gaC	p.D136D	CTC-512J12.4_ENST00000588655.1_RNA|ZNF229_ENST00000591289.1_Intron|ZNF229_ENST00000291187.4_Silent_p.D130D	NM_014518.2	NP_055333.2	Q9UJW7	ZN229_HUMAN	zinc finger protein 229	136					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|central_nervous_system(2)|endometrium(6)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	45		Prostate(69;0.0352)				GGGGAGCAGCATCTTCTGAGA	0.488																																					p.D136D		Atlas-SNP	.											.	ZNF229	123	.	0			c.T408C						.						110.0	105.0	107.0					19																	44934548		1885	4105	5990	SO:0001819	synonymous_variant	7772	exon6			AGCAGCATCTTCT	AF192979	CCDS42574.1, CCDS62706.1	19q13.2	2013-01-08				ENSG00000278318		"""Zinc fingers, C2H2-type"", ""-"""	13022	protein-coding gene	gene with protein product							Standard	XM_006723372		Approved		uc002oze.1	Q9UJW7		ENST00000588931.1:c.408T>C	chr19.hg19:g.44934548A>G		66.0	0.0		80.0	24.0	NM_014518	B2RWN3|Q59FV2|Q86WL9	Silent	SNP	ENST00000588931.1	hg19	CCDS42574.1																																																																																			.	.		0.488	ZNF229-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460833.1	NM_014518	
ZNF766	90321	hgsc.bcm.edu	37	19	52794386	52794386	+	Missense_Mutation	SNP	T	T	G			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr19:52794386T>G	ENST00000439461.1	+	4	1385	c.1342T>G	c.(1342-1344)Ttt>Gtt	p.F448V	ZNF766_ENST00000593612.1_Intron|ZNF766_ENST00000599581.1_3'UTR|CTD-2525I3.5_ENST00000594865.1_RNA|ZNF766_ENST00000359102.4_Intron	NM_001010851.2	NP_001010851.1	Q5HY98	ZN766_HUMAN	zinc finger protein 766	448					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	17				GBM - Glioblastoma multiforme(134;0.00236)|OV - Ovarian serous cystadenocarcinoma(262;0.00871)		TGGTAAGGTCTTTAGGCACAG	0.413																																					p.F448V		Atlas-SNP	.											.	ZNF766	45	.	0			c.T1342G						.						142.0	149.0	147.0					19																	52794386		2202	4299	6501	SO:0001583	missense	90321	exon4			AAGGTCTTTAGGC	AK024074	CCDS46163.1	19q13.33	2013-01-08				ENSG00000196214		"""Zinc fingers, C2H2-type"", ""-"""	28063	protein-coding gene	gene with protein product							Standard	XM_006723458		Approved		uc002pyr.1	Q5HY98		ENST00000439461.1:c.1342T>G	chr19.hg19:g.52794386T>G	ENSP00000409652:p.Phe448Val	118.0	0.0		125.0	39.0	NM_001010851	B2RNE0|Q7Z326	Missense_Mutation	SNP	ENST00000439461.1	hg19	CCDS46163.1	.	.	.	.	.	.	.	.	.	.	T	15.00	2.702212	0.48307	.	.	ENSG00000196214	ENST00000439461	T	0.46063	0.88	2.17	2.17	0.27698	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.67748	0.2926	M	0.91561	3.22	0.80722	D	1	P	0.39940	0.696	P	0.62885	0.908	T	0.70525	-0.4848	9	0.87932	D	0	.	9.0249	0.36222	0.0:0.0:0.0:1.0	.	448	Q5HY98	ZN766_HUMAN	V	448	ENSP00000409652:F448V	ENSP00000409652:F448V	F	+	1	0	ZNF766	57486198	0.936000	0.31750	0.003000	0.11579	0.003000	0.03518	4.085000	0.57657	0.981000	0.38548	0.491000	0.48974	TTT	.	.		0.413	ZNF766-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462764.1	NM_001010851	
NLRP13	126204	hgsc.bcm.edu	37	19	56424387	56424387	+	Missense_Mutation	SNP	A	A	C			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr19:56424387A>C	ENST00000342929.3	-	5	795	c.796T>G	c.(796-798)Ttc>Gtc	p.F266V	NLRP13_ENST00000588751.1_Missense_Mutation_p.F266V	NM_176810.2	NP_789780.2	Q86W25	NAL13_HUMAN	NLR family, pyrin domain containing 13	266	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.						ATP binding (GO:0005524)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(58)|ovary(4)|pancreas(2)|prostate(2)|skin(13)|stomach(2)|urinary_tract(1)	109		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		CTGAGATAGAAAACATAGGAG	0.468																																					p.F266V		Atlas-SNP	.											.	NLRP13	220	.	0			c.T796G						.						64.0	68.0	67.0					19																	56424387		2203	4300	6503	SO:0001583	missense	126204	exon5			GATAGAAAACATA	AY154468	CCDS33119.1	19q13.43	2008-02-05	2006-12-08	2006-12-08	ENSG00000173572	ENSG00000173572		"""Nucleotide-binding domain and leucine rich repeat containing"""	22937	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 13"""	609660	"""NACHT, leucine rich repeat and PYD containing 13"""	NALP13		12563287	Standard	NM_176810		Approved	NOD14, PAN13, CLR19.7	uc010ygg.2	Q86W25	OTTHUMG00000167839	ENST00000342929.3:c.796T>G	chr19.hg19:g.56424387A>C	ENSP00000343891:p.Phe266Val	112.0	0.0		102.0	28.0	NM_176810	Q7RTR5	Missense_Mutation	SNP	ENST00000342929.3	hg19	CCDS33119.1	.	.	.	.	.	.	.	.	.	.	A	13.03	2.114372	0.37339	.	.	ENSG00000173572	ENST00000342929	D	0.87334	-2.24	2.81	2.81	0.32909	NACHT nucleoside triphosphatase (1);	.	.	.	.	D	0.91147	0.7212	M	0.69248	2.105	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80830	-0.1207	9	0.87932	D	0	.	7.7212	0.28733	1.0:0.0:0.0:0.0	.	266	Q86W25	NAL13_HUMAN	V	266	ENSP00000343891:F266V	ENSP00000343891:F266V	F	-	1	0	NLRP13	61116199	0.997000	0.39634	0.026000	0.17262	0.003000	0.03518	4.794000	0.62482	1.271000	0.44313	0.482000	0.46254	TTC	.	.		0.468	NLRP13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396560.1	NM_176810	
ZNF582	147948	hgsc.bcm.edu	37	19	56895920	56895920	+	Missense_Mutation	SNP	C	C	A			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr19:56895920C>A	ENST00000301310.4	-	5	1024	c.866G>T	c.(865-867)gGc>gTc	p.G289V	AC006116.12_ENST00000589671.1_RNA|ZNF582_ENST00000586929.1_Missense_Mutation_p.G289V	NM_144690.1	NP_653291.1	Q96NG8	ZN582_HUMAN	zinc finger protein 582	289					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0547)		GAAGGCCTTGCCACATTCCTT	0.413																																					p.G289V	Ovarian(183;1887 2032 4349 30507 51343)	Atlas-SNP	.											.	ZNF582	56	.	0			c.G866T						.						72.0	62.0	65.0					19																	56895920		2203	4300	6503	SO:0001583	missense	147948	exon5			GCCTTGCCACATT	AK055489	CCDS33121.1	19q13.43	2013-07-15			ENSG00000018869	ENSG00000018869		"""Zinc fingers, C2H2-type"", ""-"""	26421	protein-coding gene	gene with protein product		615600				12477932	Standard	NM_144690		Approved	FLJ30927	uc002qmz.1	Q96NG8	OTTHUMG00000181939	ENST00000301310.4:c.866G>T	chr19.hg19:g.56895920C>A	ENSP00000301310:p.Gly289Val	55.0	0.0		74.0	25.0	NM_144690	B4DQZ9|B7Z9R3|Q6PJT6	Missense_Mutation	SNP	ENST00000301310.4	hg19	CCDS33121.1	.	.	.	.	.	.	.	.	.	.	C	16.80	3.222858	0.58668	.	.	ENSG00000018869	ENST00000301310	T	0.01495	4.83	4.88	0.258	0.15578	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.431973	0.17275	N	0.180205	T	0.11537	0.0281	H	0.95187	3.635	0.44780	D	0.997788	D;D	0.76494	0.999;0.998	D;D	0.68483	0.958;0.914	T	0.00792	-1.1564	10	0.87932	D	0	.	5.9047	0.18986	0.0:0.6153:0.1392:0.2454	.	289;320	Q96NG8;B4DQZ9	ZN582_HUMAN;.	V	289	ENSP00000301310:G289V	ENSP00000301310:G289V	G	-	2	0	ZNF582	61587732	0.969000	0.33509	0.009000	0.14445	0.022000	0.10575	2.395000	0.44459	0.053000	0.16036	-0.140000	0.14226	GGC	.	.		0.413	ZNF582-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458387.2	NM_144690	
SNX5	27131	hgsc.bcm.edu	37	20	17934754	17934754	+	Missense_Mutation	SNP	G	G	C	rs6045116		TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr20:17934754G>C	ENST00000377768.3	-	5	587	c.275C>G	c.(274-276)cCt>cGt	p.P92R	SNX5_ENST00000377759.4_Missense_Mutation_p.P92R|SNX5_ENST00000483485.1_5'UTR	NM_152227.1	NP_689413.1	Q9Y5X3	SNX5_HUMAN	sorting nexin 5	92	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				intracellular protein transport (GO:0006886)|pinocytosis (GO:0006907)	cytoplasmic vesicle (GO:0031410)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|extrinsic component of endosome membrane (GO:0031313)|macropinocytic cup (GO:0070685)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	11						CGTAGGAGCAGGTGGAATCTG	0.502																																					p.P92R		Atlas-SNP	.											.	SNX5	38	.	0			c.C275G						.						105.0	101.0	102.0					20																	17934754		2203	4300	6503	SO:0001583	missense	27131	exon4			GGAGCAGGTGGAA	AF121855	CCDS13130.1	20p11	2008-05-22			ENSG00000089006	ENSG00000089006		"""Sorting nexins"""	14969	protein-coding gene	gene with protein product		605937				10600472, 17148574	Standard	NM_152227		Approved		uc002wqc.3	Q9Y5X3	OTTHUMG00000031953	ENST00000377768.3:c.275C>G	chr20.hg19:g.17934754G>C	ENSP00000366998:p.Pro92Arg	54.0	0.0		52.0	18.0	NM_014426	B7ZKN3|D3DW26|Q52LC4|Q7KZN0|Q9BWP0	Missense_Mutation	SNP	ENST00000377768.3	hg19	CCDS13130.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.920699	0.92249	.	.	ENSG00000089006	ENST00000377768;ENST00000377759;ENST00000431277;ENST00000419004	T;T;T;T	0.44083	0.93;0.93;0.93;0.93	5.6	5.6	0.85130	Phox homologous domain (5);	0.000000	0.85682	D	0.000000	T	0.80082	0.4558	H	0.98594	4.275	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.87407	0.2373	10	0.87932	D	0	-2.9516	19.9784	0.97317	0.0:0.0:1.0:0.0	.	113;92	B7Z476;Q9Y5X3	.;SNX5_HUMAN	R	92;92;55;57	ENSP00000366998:P92R;ENSP00000366988:P92R;ENSP00000404448:P55R;ENSP00000406731:P57R	ENSP00000366988:P92R	P	-	2	0	SNX5	17882754	1.000000	0.71417	0.968000	0.41197	0.923000	0.55619	9.787000	0.99055	2.800000	0.96347	0.455000	0.32223	CCT	.	.		0.502	SNX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078137.4		
CDH26	60437	hgsc.bcm.edu	37	20	58564168	58564168	+	Silent	SNP	T	T	C			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr20:58564168T>C	ENST00000244047.5	+	9	1544	c.1233T>C	c.(1231-1233)ccT>ccC	p.P411P	CDH26_ENST00000348616.4_Silent_p.P411P			Q8IXH8	CAD26_HUMAN	cadherin 26	411	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(11)|lung(14)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	44	all_lung(29;0.00963)		BRCA - Breast invasive adenocarcinoma(7;5.58e-09)			GCGCCAGGCCTGGGACCCTGT	0.552																																					p.P411P		Atlas-SNP	.											.	CDH26	229	.	0			c.T1233C						.						149.0	178.0	168.0					20																	58564168		2203	4300	6503	SO:0001819	synonymous_variant	60437	exon9			CAGGCCTGGGACC	AF169690, AK055202	CCDS13485.1, CCDS13486.1	20q13.33	2010-01-26	2009-11-20		ENSG00000124215	ENSG00000124215		"""Cadherins / Major cadherins"""	15902	protein-coding gene	gene with protein product			"""cadherin-like 26"""				Standard	NM_177980		Approved	VR20	uc002ybe.3	Q8IXH8	OTTHUMG00000032874	ENST00000244047.5:c.1233T>C	chr20.hg19:g.58564168T>C		89.0	0.0		104.0	36.0	NM_177980	A2A2M5|B3KNX3|Q6P5Y6|Q8TCH3|Q9BQN4|Q9NRU1	Silent	SNP	ENST00000244047.5	hg19		.	.	.	.	.	.	.	.	.	.	T	7.768	0.706872	0.15239	.	.	ENSG00000124215	ENST00000370991	.	.	.	5.06	-9.48	0.00591	.	.	.	.	.	T	0.31295	0.0792	.	.	.	0.48901	D	0.999721	.	.	.	.	.	.	T	0.39396	-0.9616	4	.	.	.	.	0.5394	0.00642	0.2141:0.2734:0.2199:0.2926	.	.	.	.	P	3	.	.	L	+	2	0	CDH26	57997563	0.012000	0.17670	0.001000	0.08648	0.055000	0.15305	-1.518000	0.02246	-2.180000	0.00766	0.533000	0.62120	CTG	.	.		0.552	CDH26-201	KNOWN	basic	protein_coding	protein_coding		NM_177980	
ITGB1BP2	26548	hgsc.bcm.edu	37	X	70524435	70524435	+	Missense_Mutation	SNP	C	C	A			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chrX:70524435C>A	ENST00000373829.3	+	10	870	c.797C>A	c.(796-798)gCa>gAa	p.A266E	ITGB1BP2_ENST00000465388.1_3'UTR|ITGB1BP2_ENST00000538820.1_Missense_Mutation_p.A248E	NM_012278.1	NP_036410.1	Q9UKP3	ITBP2_HUMAN	integrin beta 1 binding protein (melusin) 2	266	CS. {ECO:0000255|PROSITE- ProRule:PRU00547}.				muscle organ development (GO:0007517)|signal transduction (GO:0007165)	Z disc (GO:0030018)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|large_intestine(2)|lung(5)|ovary(1)	14	Renal(35;0.156)					GTGTTCCAAGCACAGATGAAG	0.488																																					p.A266E		Atlas-SNP	.											.	ITGB1BP2	35	.	0			c.C797A						.						122.0	97.0	106.0					X																	70524435		2203	4300	6503	SO:0001583	missense	26548	exon10			TCCAAGCACAGAT	AF140690	CCDS14411.1	Xq12.1-q13	2008-02-05			ENSG00000147166	ENSG00000147166			6154	protein-coding gene	gene with protein product		300332				10506186	Standard	XM_005262255		Approved	CHORDC3	uc004dzr.1	Q9UKP3	OTTHUMG00000021793	ENST00000373829.3:c.797C>A	chrX.hg19:g.70524435C>A	ENSP00000362935:p.Ala266Glu	41.0	0.0		37.0	11.0	NM_012278	Q32N04|Q549J7	Missense_Mutation	SNP	ENST00000373829.3	hg19	CCDS14411.1	.	.	.	.	.	.	.	.	.	.	C	0.578	-0.838456	0.02692	.	.	ENSG00000147166	ENST00000373829;ENST00000538820	T;T	0.14266	2.52;2.52	5.11	3.13	0.36017	CS-like domain (1);CS domain (1);HSP20-like chaperone (1);	0.399250	0.28414	N	0.015437	T	0.06096	0.0158	N	0.08118	0	0.32429	N	0.548342	B;B	0.18013	0.025;0.025	B;B	0.18561	0.022;0.022	T	0.24728	-1.0152	10	0.15499	T	0.54	-0.6733	8.6763	0.34181	0.4465:0.5535:0.0:0.0	.	248;266	Q32N04;Q9UKP3	.;ITBP2_HUMAN	E	266;248	ENSP00000362935:A266E;ENSP00000440289:A248E	ENSP00000362935:A266E	A	+	2	0	ITGB1BP2	70441160	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.088000	0.30877	1.088000	0.41272	0.513000	0.50165	GCA	.	.		0.488	ITGB1BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057126.1	NM_012278	
CDX4	1046	hgsc.bcm.edu	37	X	72667261	72667261	+	Missense_Mutation	SNP	C	C	A	rs373883804		TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chrX:72667261C>A	ENST00000373514.2	+	1	172	c.172C>A	c.(172-174)Cat>Aat	p.H58N		NM_005193.1	NP_005184.1	O14627	CDX4_HUMAN	caudal type homeobox 4	58					anterior/posterior pattern specification (GO:0009952)|blood vessel development (GO:0001568)|labyrinthine layer development (GO:0060711)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			endometrium(4)|kidney(1)|large_intestine(1)|lung(11)|skin(1)	18	Renal(35;0.156)					GGGGTATCCTCATATGCCCAG	0.637																																					p.H58N		Atlas-SNP	.											.	CDX4	52	.	0			c.C172A						.						50.0	43.0	45.0					X																	72667261		2203	4300	6503	SO:0001583	missense	1046	exon1			TATCCTCATATGC	AF029879	CCDS14424.1	Xq13.2	2012-03-09	2007-07-09		ENSG00000131264	ENSG00000131264		"""Homeoboxes / ANTP class : HOXL subclass"""	1808	protein-coding gene	gene with protein product		300025	"""caudal type homeo box transcription factor 4"""			7655457	Standard	NM_005193		Approved		uc011mqk.2	O14627	OTTHUMG00000021831	ENST00000373514.2:c.172C>A	chrX.hg19:g.72667261C>A	ENSP00000362613:p.His58Asn	117.0	0.0		123.0	34.0	NM_005193	A1A513|Q5JS20	Missense_Mutation	SNP	ENST00000373514.2	hg19	CCDS14424.1	.	.	.	.	.	.	.	.	.	.	.	12.92	2.083806	0.36758	.	.	ENSG00000131264	ENST00000373514	T	0.50548	0.74	2.57	2.57	0.30868	Caudal-like activation domain (1);	0.000000	0.85682	D	0.000000	T	0.66177	0.2763	M	0.83118	2.625	0.58432	D	0.999993	D	0.69078	0.997	D	0.77004	0.989	T	0.67677	-0.5609	10	0.40728	T	0.16	-10.0391	10.3983	0.44214	0.0:1.0:0.0:0.0	.	58	O14627	CDX4_HUMAN	N	58	ENSP00000362613:H58N	ENSP00000362613:H58N	H	+	1	0	CDX4	72583986	1.000000	0.71417	0.522000	0.27862	0.074000	0.17049	5.939000	0.70179	1.561000	0.49584	0.436000	0.28706	CAT	.	.		0.637	CDX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057229.2	NM_005193	
USP26	83844	hgsc.bcm.edu	37	X	132160217	132160217	+	Missense_Mutation	SNP	T	T	A			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chrX:132160217T>A	ENST00000511190.1	-	6	2501	c.2032A>T	c.(2032-2034)Agc>Tgc	p.S678C	USP26_ENST00000370832.1_Missense_Mutation_p.S678C|USP26_ENST00000406273.1_Missense_Mutation_p.S678C	NM_031907.1	NP_114113.1	Q9BXU7	UBP26_HUMAN	ubiquitin specific peptidase 26	678	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(11)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	60	Acute lymphoblastic leukemia(192;0.000127)					CCTGGGCTGCTGGCAGGTTTA	0.418																																					p.S678C	NSCLC(104;342 1621 36940 47097 52632)	Atlas-SNP	.											.	USP26	135	.	0			c.A2032T						.						83.0	79.0	80.0					X																	132160217		2203	4299	6502	SO:0001583	missense	83844	exon1			GGCTGCTGGCAGG	AF285593	CCDS14635.1	Xq26.2	2012-07-13	2005-08-08		ENSG00000134588	ENSG00000134588	3.4.19.12	"""Ubiquitin-specific peptidases"""	13485	protein-coding gene	gene with protein product		300309	"""ubiquitin specific protease 26"""			12838346	Standard	NM_031907		Approved		uc011mvf.2	Q9BXU7	OTTHUMG00000022429	ENST00000511190.1:c.2032A>T	chrX.hg19:g.132160217T>A	ENSP00000423390:p.Ser678Cys	77.0	0.0		91.0	30.0	NM_031907	B9WRT6|Q5H9H4	Missense_Mutation	SNP	ENST00000511190.1	hg19	CCDS14635.1	.	.	.	.	.	.	.	.	.	.	T	13.73	2.324474	0.41197	.	.	ENSG00000134588	ENST00000370832;ENST00000511190;ENST00000406273	T;T;T	0.61859	0.07;0.07;0.07	3.76	-0.233	0.13078	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.190917	0.25792	N	0.028280	T	0.63651	0.2529	M	0.62723	1.935	0.09310	N	1	D	0.89917	1.0	D	0.85130	0.997	T	0.54214	-0.8327	10	0.87932	D	0	-3.6931	1.5307	0.02535	0.1716:0.1053:0.1742:0.5488	.	678	Q9BXU7	UBP26_HUMAN	C	678	ENSP00000359869:S678C;ENSP00000423390:S678C;ENSP00000384360:S678C	ENSP00000359869:S678C	S	-	1	0	USP26	131987883	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.101000	0.15251	-0.125000	0.11703	-0.314000	0.08810	AGC	.	.		0.418	USP26-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359441.1	NM_031907	
SLITRK4	139065	hgsc.bcm.edu	37	X	142717487	142717487	+	Missense_Mutation	SNP	A	A	C			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chrX:142717487A>C	ENST00000381779.4	-	2	1663	c.1438T>G	c.(1438-1440)Tta>Gta	p.L480V	SLITRK4_ENST00000338017.4_Missense_Mutation_p.L480V|SLITRK4_ENST00000356928.1_Missense_Mutation_p.L480V	NM_001184749.2|NM_001184750.1|NM_173078.4	NP_001171678.1|NP_001171679.1|NP_775101.1	Q8IW52	SLIK4_HUMAN	SLIT and NTRK-like family, member 4	480						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(27)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	60	Acute lymphoblastic leukemia(192;6.56e-05)					TTATTGTTTAAGTACAGTAAC	0.408																																					p.L480V		Atlas-SNP	.											.	SLITRK4	162	.	0			c.T1438G						.						71.0	77.0	75.0					X																	142717487		2203	4300	6503	SO:0001583	missense	139065	exon2			TGTTTAAGTACAG	BC040986	CCDS14679.1	Xq27.3	2004-06-23			ENSG00000179542	ENSG00000179542			23502	protein-coding gene	gene with protein product		300562				14557068	Standard	NM_001184749		Approved	DKFZp547M2010	uc004fby.3	Q8IW52	OTTHUMG00000022580	ENST00000381779.4:c.1438T>G	chrX.hg19:g.142717487A>C	ENSP00000371198:p.Leu480Val	175.0	0.0		226.0	59.0	NM_001184750	Q5JXG3|Q8TCM8|Q96DL3	Missense_Mutation	SNP	ENST00000381779.4	hg19	CCDS14679.1	.	.	.	.	.	.	.	.	.	.	A	14.41	2.528030	0.44969	.	.	ENSG00000179542	ENST00000381779;ENST00000356928;ENST00000338017	T;T;T	0.74842	-0.88;-0.88;-0.88	5.49	1.5	0.22942	.	0.000000	0.64402	D	0.000001	T	0.81460	0.4827	M	0.70903	2.155	0.58432	D	0.999997	D	0.89917	1.0	D	0.97110	1.0	T	0.78553	-0.2160	10	0.62326	D	0.03	-5.0587	6.6644	0.23032	0.4439:0.0:0.5561:0.0	.	480	Q8IW52	SLIK4_HUMAN	V	480	ENSP00000371198:L480V;ENSP00000349400:L480V;ENSP00000336627:L480V	ENSP00000336627:L480V	L	-	1	2	SLITRK4	142545153	1.000000	0.71417	0.978000	0.43139	0.928000	0.56348	1.098000	0.31000	0.321000	0.23259	0.486000	0.48141	TTA	.	.		0.408	SLITRK4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058617.1	NM_173078	
AVPR2	554	hgsc.bcm.edu	37	X	153171245	153171245	+	Silent	SNP	C	C	T			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chrX:153171245C>T	ENST00000358927.2	+	3	494	c.285C>T	c.(283-285)ccC>ccT	p.P95P	AVPR2_ENST00000337474.5_Silent_p.P95P|AVPR2_ENST00000370049.1_Silent_p.P95P			P30518	V2R_HUMAN	arginine vasopressin receptor 2	95			P -> L (in XNDI).		activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|excretion (GO:0007588)|hemostasis (GO:0007599)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|interferon-gamma production (GO:0032609)|negative regulation of renal sodium excretion (GO:0035814)|negative regulation of urine volume (GO:0035811)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of systemic arterial blood pressure (GO:0003084)|response to cytokine (GO:0034097)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	vasopressin receptor activity (GO:0005000)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	26	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				Conivaptan(DB00872)|Desmopressin(DB00035)|Terlipressin(DB02638)|Tolvaptan(DB06212)|Vasopressin(DB00067)	AAGTGCTGCCCCAGCTGGCCT	0.657																																					p.P95P		Atlas-SNP	.											.	AVPR2	43	.	0			c.C285T						.						40.0	43.0	42.0					X																	153171245		2203	4300	6503	SO:0001819	synonymous_variant	554	exon2			GCTGCCCCAGCTG	Z11687	CCDS14735.1, CCDS55539.1	Xq28	2014-09-17	2008-08-01		ENSG00000126895	ENSG00000126895		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	897	protein-coding gene	gene with protein product	"""nephrogenic diabetes insipidus"""	300538		DIR3, DIR		1324225	Standard	NM_000054		Approved	V2R	uc004fjh.4	P30518	OTTHUMG00000024227	ENST00000358927.2:c.285C>T	chrX.hg19:g.153171245C>T		127.0	0.0		96.0	37.0	NM_001146151	C5HF20|O43192|Q3MJD3|Q9UCV9	Silent	SNP	ENST00000358927.2	hg19	CCDS14735.1																																																																																			.	.		0.657	AVPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061127.2		
MT-ND5	4540	hgsc.bcm.edu	37	M	12345	12345	+	Missense_Mutation	SNP	G	G	A			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chrM:12345G>A	ENST00000361567.2	+	1	9	c.9G>A	c.(7-9)atG>atA	p.M3I	MT-TL2_ENST00000387456.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TR_ENST00000387439.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	0					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						GTAATAACCATGCACACTACT	0.403																																					p.M3M		Atlas-SNP	.											.	.	.	.	0			c.G9A						.																																			SO:0001583	missense	0	exon1			AACCATGCACACT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.9G>A	chrM.hg19:g.12345G>A	ENSP00000354813:p.Met3Ile	8.0	0.0		82.0	28.0	ENST00000361567	Q34773|Q8WCY3	Silent	SNP	ENST00000361567.2	hg19																																																																																				.	.		0.403	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
MT-CYB	4519	hgsc.bcm.edu	37	M	15648	15648	+	Missense_Mutation	SNP	T	T	C			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chrM:15648T>C	ENST00000361789.2	+	1	902	c.902T>C	c.(901-903)cTa>cCa	p.L301P	MT-TT_ENST00000387460.2_RNA|MT-TE_ENST00000387459.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-ND6_ENST00000361681.2_5'Flank			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	301					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						CATCCTCATCCTAGCAATAAT	0.448											OREG0007583	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																									p.L301P		Atlas-SNP	.											.	.	.	.	0			c.T902C						.																																			SO:0001583	missense	0	exon1			TCATCCTAGCAAT			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.902T>C	chrM.hg19:g.15648T>C	ENSP00000354554:p.Leu301Pro	11.0	0.0	585	78.0	10.0	ENST00000361789	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Missense_Mutation	SNP	ENST00000361789.2	hg19																																																																																				.	.		0.448	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024038	
UBXN11	91544	hgsc.bcm.edu	37	1	26608874	26608879	+	In_Frame_Del	DEL	GGGGCC	GGGGCC	-	rs1134582|rs1134581|rs140364749	byFrequency	TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	GGGGCC	GGGGCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr1:26608874_26608879delGGGGCC	ENST00000374222.1	-	16	1938_1943	c.1474_1479delGGCCCC	c.(1474-1479)ggccccdel	p.GP492del	UBXN11_ENST00000374223.1_In_Frame_Del_p.GP249del|UBXN11_ENST00000374221.3_In_Frame_Del_p.GP492del|UBXN11_ENST00000314675.7_In_Frame_Del_p.GP372del|UBXN11_ENST00000357089.4_In_Frame_Del_p.GP459del|UBXN11_ENST00000374217.2_In_Frame_Del_p.GP459del			Q5T124	UBX11_HUMAN	UBX domain protein 11	492	3 X 8 AA tandem repeats of P-G-P-G-P-G-P- S.|Pro-rich.		Missing.|Missing. {ECO:0000269|PubMed:14702039, ECO:0000269|Ref.2}.			cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.G490_P515delGPGPSPGPGPGPSPGPGPGPSPCPGP(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(3)	23						gaccgggactggggccgggaccggga	0.714																																					p.492_494del		Atlas-INDEL	.											UBXN11,NS,carcinoma,0,1	UBXN11	54	.	1	Deletion - In frame(1)	ovary(1)	c.1475_1480del						.																																			SO:0001651	inframe_deletion	91544	exon16			.	AF521017	CCDS41286.1, CCDS41287.1, CCDS41288.1	1p36.11	2008-07-25	2008-07-25	2008-07-25	ENSG00000158062	ENSG00000158062		"""UBX domain containing"""	30600	protein-coding gene	gene with protein product	"""socius"""	609151	"""UBX domain containing 5"""	UBXD5		11940653	Standard	NM_183008		Approved	SOC, SOCI	uc001blw.3	Q5T124	OTTHUMG00000003382	ENST00000374222.1:c.1474_1479delGGCCCC	chr1.hg19:g.26608874_26608879delGGGGCC	ENSP00000363339:p.Gly492_Pro493del	33.0	0.0		27.0	10.0	NM_183008	D3DPK6|Q5T117|Q5T120|Q5T125|Q5T126|Q5T129|Q5T131|Q5T133|Q63HM6|Q71RB3|Q8IY27|Q8N1L6|Q8N9M4|Q8NA18|Q8NFE3|Q8NFE4|Q8NFE6	In_Frame_Del	DEL	ENST00000374222.1	hg19	CCDS41288.1																																																																																			.	.		0.714	UBXN11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000009500.1	NM_145345	
PZP	5858	hgsc.bcm.edu	37	12	9345225	9345240	+	Frame_Shift_Del	DEL	AATGTAACTTCCACTT	AATGTAACTTCCACTT	-	rs140140094|rs376566013	byFrequency	TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	AATGTAACTTCCACTT	AATGTAACTTCCACTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr12:9345225_9345240delAATGTAACTTCCACTT	ENST00000261336.2	-	12	1378_1393	c.1350_1365delAAGTGGAAGTTACATT	c.(1348-1365)ttaagtggaagttacattfs	p.LSGSYI450fs	PZP_ENST00000381997.2_Frame_Shift_Del_p.LSGSYI319fs	NM_002864.2	NP_002855.2	P20742	PZP_HUMAN	pregnancy-zone protein	450					female pregnancy (GO:0007565)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(21)|lung(46)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)	102						GCTCCAGGTGAATGTAACTTCCACTTAAGGAGAAAA	0.509																																					p.451_456del	Melanoma(125;1402 1695 4685 34487 38571)	Atlas-INDEL	.											.	PZP	422	.	0			c.1351_1366del						.																																			SO:0001589	frameshift_variant	5858	exon12			.	X54380, M24416, X51541	CCDS8600.1	12p13-p12.2	2008-02-01			ENSG00000126838	ENSG00000126838			9750	protein-coding gene	gene with protein product		176420					Standard	NM_002864		Approved	CPAMD6	uc001qvl.3	P20742	OTTHUMG00000154915	ENST00000261336.2:c.1350_1365delAAGTGGAAGTTACATT	chr12.hg19:g.9345225_9345240delAATGTAACTTCCACTT	ENSP00000261336:p.Leu450fs	76.0	0.0		85.0	20.0	NM_002864	A6ND27|Q15273|Q2NKL2|Q7M4N7	Frame_Shift_Del	DEL	ENST00000261336.2	hg19	CCDS8600.1																																																																																			.	.		0.509	PZP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337624.1	NM_002864	
SCP2	6342	hgsc.bcm.edu	37	1	53443897	53443897	+	Frame_Shift_Del	DEL	C	C	-			TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr1:53443897delC	ENST00000528311.1	+	8	736	c.440delC	c.(439-441)tcafs	p.S147fs	SCP2_ENST00000371513.5_Frame_Shift_Del_p.S184fs|SCP2_ENST00000473584.1_3'UTR|SCP2_ENST00000407246.2_Frame_Shift_Del_p.S204fs|SCP2_ENST00000371509.4_Frame_Shift_Del_p.S184fs|SCP2_ENST00000371514.3_Frame_Shift_Del_p.S228fs	NM_001193617.1	NP_001180546.1	Q9BX26	SYCP2_HUMAN	sterol carrier protein 2	868					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)			breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(1)	15						AGTCCCACTTCAGATGGTGCT	0.438																																					p.S228fs		Atlas-INDEL	.											.	SCP2	44	.	0			c.682delT						.						75.0	71.0	73.0					1																	53443897		2203	4300	6503	SO:0001589	frameshift_variant	6342	exon9			.	M75884	CCDS572.1, CCDS30719.1, CCDS41338.1, CCDS44149.1, CCDS44150.1, CCDS53317.1, CCDS53318.1, CCDS53319.1	1p32	2010-08-20			ENSG00000116171	ENSG00000116171			10606	protein-coding gene	gene with protein product		184755				1703300, 1718316	Standard	NM_001007098		Approved		uc001cur.2	P22307	OTTHUMG00000008936	ENST00000528311.1:c.440delC	chr1.hg19:g.53443897delC	ENSP00000434132:p.Ser147fs	58.0	0.0		57.0	22.0	NM_002979	A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Frame_Shift_Del	DEL	ENST00000528311.1	hg19	CCDS53319.1																																																																																			.	.		0.438	SCP2-010	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387558.1	NM_002979	
RAPGEF2	9693	hgsc.bcm.edu	37	4	160259466	160259467	+	Frame_Shift_Ins	INS	-	-	ATTG	rs574693523		TCGA-WX-AA44-01A-11D-A38X-10	TCGA-WX-AA44-10A-01D-A38X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	398106b4-bf09-4e9f-aeb5-3a8a1abdf3a0	126b3540-5f43-46f5-b374-f13a3d006e05	g.chr4:160259466_160259467insATTG	ENST00000264431.4	+	12	2075_2076	c.1656_1657insATTG	c.(1657-1659)attfs	p.-553fs		NM_014247.2	NP_055062.1	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor (GEF) 2						adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|blood vessel development (GO:0001568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|forebrain neuron development (GO:0021884)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of cell proliferation (GO:0008285)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of melanin biosynthetic process (GO:0048022)|nerve growth factor signaling pathway (GO:0038180)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of vasculogenesis (GO:2001214)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|regulation of synaptic plasticity (GO:0048167)|small GTPase mediated signal transduction (GO:0007264)|ventricular system development (GO:0021591)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	beta-1 adrenergic receptor binding (GO:0031697)|calcium ion binding (GO:0005509)|cAMP binding (GO:0030552)|diacylglycerol binding (GO:0019992)|PDZ domain binding (GO:0030165)|Rap GTPase activator activity (GO:0046582)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	70	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		TGTTCAGTGATATTGGGATTGG	0.351																																					p.D552fs		Atlas-INDEL	.											.	RAPGEF2	171	.	0			c.1656_1657insATTG						.																																			SO:0001589	frameshift_variant	9693	exon12			.	AB002311	CCDS43277.1	4q32.1	2004-03-01	2004-03-01	2004-03-01					16854	protein-coding gene	gene with protein product	"""Rap GEP"""	609530	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 1"""	PDZGEF1		9205841, 10934204	Standard	NM_014247		Approved	PDZ-GEF1, RA-GEF, DKFZP586O1422, KIAA0313	uc003iqg.4	Q9Y4G8		ENST00000264431.4:c.1657_1660dupATTG	chr4.hg19:g.160259467_160259470dupATTG	ENSP00000264431:p.Ile553fs	107.0	0.0		137.0	31.0	NM_014247	D3DP27	Frame_Shift_Ins	INS	ENST00000264431.4	hg19	CCDS43277.1																																																																																			.	.		0.351	RAPGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364980.2	NM_014247	
