#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
DOCK7	85440	hgsc.bcm.edu	37	1	62958432	62958432	+	Silent	SNP	G	G	A			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr1:62958432G>A	ENST00000340370.5	-	40	5228	c.5211C>T	c.(5209-5211)taC>taT	p.Y1737Y	DOCK7_ENST00000251157.5_Silent_p.Y1759Y	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	1768	DHR-2.				activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						ACTCAGTAAAGTATTTTCCAG	0.388																																					p.Y1759Y		Atlas-SNP	.											.	DOCK7	184	.	0			c.C5277T						.						110.0	103.0	105.0					1																	62958432		2203	4300	6503	SO:0001819	synonymous_variant	85440	exon41			AGTAAAGTATTTT		CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.5211C>T	chr1.hg19:g.62958432G>A		353.0	0.0		227.0	171.0	NM_001271999	Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	Silent	SNP	ENST00000340370.5	hg19	CCDS30734.1	.	.	.	.	.	.	.	.	.	.	G	8.518	0.868061	0.17250	.	.	ENSG00000116641	ENST00000454575	.	.	.	5.52	5.52	0.82312	.	.	.	.	.	T	0.57636	0.2067	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56498	-0.7969	4	.	.	.	.	7.2236	0.26002	0.2058:0.0:0.7942:0.0	.	.	.	.	F	931	.	.	L	-	1	0	DOCK7	62731020	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.485000	0.53208	2.596000	0.87737	0.585000	0.79938	CTT	.	.		0.388	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036806.1	NM_033407	
ATXN7L2	127002	hgsc.bcm.edu	37	1	110034053	110034053	+	Missense_Mutation	SNP	G	G	A	rs377112437		TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr1:110034053G>A	ENST00000369870.3	+	10	1883	c.1868G>A	c.(1867-1869)cGg>cAg	p.R623Q	CYB561D1_ENST00000420578.2_5'Flank|CYB561D1_ENST00000528785.1_5'Flank|CYB561D1_ENST00000369868.3_5'Flank|CYB561D1_ENST00000310611.4_5'Flank|CYB561D1_ENST00000527072.1_5'Flank|CYB561D1_ENST00000496961.1_5'Flank|CYB561D1_ENST00000393709.3_5'Flank|CYB561D1_ENST00000430195.2_5'Flank|ATXN7L2_ENST00000459635.1_3'UTR|CYB561D1_ENST00000533024.1_5'Flank	NM_153340.4	NP_699171.3	Q5T6C5	AT7L2_HUMAN	ataxin 7-like 2	623										breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)	17		all_epithelial(167;0.00197)|all_lung(203;0.00291)|Lung NSC(277;0.00453)		Colorectal(144;0.0129)|Lung(183;0.0426)|Epithelial(280;0.0675)|READ - Rectum adenocarcinoma(129;0.0693)|all cancers(265;0.071)|LUSC - Lung squamous cell carcinoma(189;0.228)		AGAGTGAAGCGGGCAGGGCCC	0.607																																					p.R623Q		Atlas-SNP	.											ATXN7L2,colon,carcinoma,0,1	ATXN7L2	60	.	0			c.G1868A						.	G	GLN/ARG	0,4406		0,0,2203	37.0	43.0	41.0		1868	5.4	1.0	1		41	1,8599	1.2+/-3.3	0,1,4299	no	missense	ATXN7L2	NM_153340.4	43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	623/723	110034053	1,13005	2203	4300	6503	SO:0001583	missense	127002	exon10			TGAAGCGGGCAGG	BC037582	CCDS30794.1	1p13.2	2008-02-05			ENSG00000162650	ENSG00000162650			28713	protein-coding gene	gene with protein product						12477932	Standard	NM_153340		Approved	MGC46534, FLJ00381	uc001dxr.3	Q5T6C5	OTTHUMG00000011027	ENST00000369870.3:c.1868G>A	chr1.hg19:g.110034053G>A	ENSP00000358886:p.Arg623Gln	192.0	0.0		110.0	69.0	NM_153340		Missense_Mutation	SNP	ENST00000369870.3	hg19	CCDS30794.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.172916	0.78452	0.0	1.16E-4	ENSG00000162650	ENST00000369870;ENST00000369869	T	0.32515	1.45	5.36	5.36	0.76844	.	0.573844	0.15973	N	0.235687	T	0.26340	0.0643	N	0.19112	0.55	0.33363	D	0.572545	D;D	0.76494	0.998;0.999	D;D	0.72625	0.929;0.978	T	0.02553	-1.1142	10	0.16420	T	0.52	-5.1715	16.1282	0.81408	0.0:0.0:1.0:0.0	.	250;623	Q5T6C4;Q5T6C5	.;AT7L2_HUMAN	Q	623;250	ENSP00000358886:R623Q	ENSP00000358885:R250Q	R	+	2	0	ATXN7L2	109835576	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.533000	0.67160	2.793000	0.96121	0.561000	0.74099	CGG	.	.		0.607	ATXN7L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030331.1	NM_153340	
GPR161	23432	hgsc.bcm.edu	37	1	168074111	168074111	+	5'UTR	SNP	G	G	T			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr1:168074111G>T	ENST00000367838.1	-	0	291				GPR161_ENST00000546300.1_Intron|GPR161_ENST00000271357.5_5'UTR|GPR161_ENST00000367836.1_Intron|GPR161_ENST00000539777.1_Intron|GPR161_ENST00000537209.1_Missense_Mutation_p.T13N|GPR161_ENST00000367835.1_5'UTR|GPR161_ENST00000361697.2_5'UTR	NM_001267611.1|NM_153832.2	NP_001254540.1|NP_722561.1	Q8N6U8	GP161_HUMAN	G protein-coupled receptor 161						G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)|recycling endosome (GO:0055037)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|skin(1)	26	all_hematologic(923;0.215)					TCGGCGTGGGGTGGGCAGAGC	0.567																																					p.T13N		Atlas-SNP	.											.	GPR161	56	.	0			c.C38A						.						53.0	48.0	50.0					1																	168074111		2203	4300	6503	SO:0001623	5_prime_UTR_variant	23432	exon3			CGTGGGGTGGGCA	AF091890	CCDS1268.1, CCDS58042.1, CCDS58043.1, CCDS58044.1, CCDS58045.1, CCDS72978.1	1q23.3	2012-08-21			ENSG00000143147	ENSG00000143147		"""GPCR / Class A : Orphans"""	23694	protein-coding gene	gene with protein product		612250				11959142	Standard	NM_153832		Approved	RE2	uc009wvo.4	Q8N6U8	OTTHUMG00000034651	ENST00000367838.1:c.-23C>A	chr1.hg19:g.168074111G>T		57.0	0.0		94.0	28.0	NM_001267609	B3KV34|B7Z5D7|B7Z5E8|B7Z5Z6|F5GXD6|F5H6J7|O75963|Q5TGK0|Q5TGK1|Q5TGK2	Missense_Mutation	SNP	ENST00000367838.1	hg19	CCDS1268.1	.	.	.	.	.	.	.	.	.	.	G	8.367	0.834546	0.16820	.	.	ENSG00000143147	ENST00000537209	T	0.61274	0.12	5.24	3.33	0.38152	.	.	.	.	.	T	0.19927	0.0479	.	.	.	0.20703	N	0.999861	B;B	0.17038	0.02;0.012	B;B	0.23419	0.046;0.021	T	0.18493	-1.0335	8	0.22109	T	0.4	.	6.8581	0.24052	0.1557:0.1588:0.6855:0.0	.	13;13	F5GXD6;B7Z5Z6	.;.	N	13	ENSP00000441039:T13N	ENSP00000441039:T13N	T	-	2	0	GPR161	166340735	0.996000	0.38824	0.643000	0.29450	0.255000	0.26057	1.187000	0.32090	1.195000	0.43115	-0.311000	0.09066	ACC	.	.		0.567	GPR161-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083829.1	NM_007369	
FMO4	2329	hgsc.bcm.edu	37	1	171289026	171289026	+	Missense_Mutation	SNP	G	G	A			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr1:171289026G>A	ENST00000367749.3	+	3	392	c.62G>A	c.(61-63)tGt>tAt	p.C21Y		NM_002022.1	NP_002013.1	P31512	FMO4_HUMAN	flavin containing monooxygenase 4	21					drug catabolic process (GO:0042737)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	33	all_cancers(6;3.9e-08)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)					ATCAAATGCTGTGTGGATGAG	0.473																																					p.C21Y	Pancreas(24;816 862 7754 7993 32832)	Atlas-SNP	.											.	FMO4	64	.	0			c.G62A						.						235.0	218.0	224.0					1																	171289026		2203	4300	6503	SO:0001583	missense	2329	exon3			AATGCTGTGTGGA	BC002780	CCDS1295.1	1q24.3	2011-08-04			ENSG00000076258	ENSG00000076258	1.14.13.8		3772	protein-coding gene	gene with protein product		136131		FMO2		8311461	Standard	NM_002022		Approved		uc001gho.3	P31512	OTTHUMG00000035506	ENST00000367749.3:c.62G>A	chr1.hg19:g.171289026G>A	ENSP00000356723:p.Cys21Tyr	77.0	0.0		175.0	90.0	NM_002022	Q53XR0	Missense_Mutation	SNP	ENST00000367749.3	hg19	CCDS1295.1	.	.	.	.	.	.	.	.	.	.	G	19.51	3.840706	0.71488	.	.	ENSG00000076258	ENST00000367749	T	0.64991	-0.13	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	D	0.83078	0.5176	H	0.94734	3.575	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88063	0.2795	10	0.87932	D	0	-17.2113	17.477	0.87661	0.0:0.0:1.0:0.0	.	21	P31512	FMO4_HUMAN	Y	21	ENSP00000356723:C21Y	ENSP00000356723:C21Y	C	+	2	0	FMO4	169555650	1.000000	0.71417	1.000000	0.80357	0.419000	0.31324	9.396000	0.97270	2.404000	0.81709	0.650000	0.86243	TGT	.	.		0.473	FMO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086223.1	NM_002022	
GPR52	9293	hgsc.bcm.edu	37	1	174417781	174417781	+	Missense_Mutation	SNP	T	T	C			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr1:174417781T>C	ENST00000367685.2	+	1	570	c.532T>C	c.(532-534)Ttt>Ctt	p.F178L	RABGAP1L_ENST00000367689.3_Intron|RABGAP1L_ENST00000357444.6_Intron|RABGAP1L_ENST00000251507.4_Intron	NM_005684.4	NP_005675.3	Q9Y2T5	GPR52_HUMAN	G protein-coupled receptor 52	178					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(3)|kidney(3)|large_intestine(3)|liver(1)|lung(7)|prostate(1)|skin(2)	20						GCCTTCCTTTTTTGGCTGGGG	0.433																																					p.F178L	Ovarian(92;924 1390 1930 16467 40583)	Atlas-SNP	.											.	GPR52	40	.	0			c.T532C						.						204.0	199.0	201.0					1																	174417781		2203	4300	6503	SO:0001583	missense	9293	exon1			TCCTTTTTTGGCT	AF096784	CCDS30941.1	1q24	2012-08-21			ENSG00000203737	ENSG00000203737		"""GPCR / Class A : Orphans"""	4508	protein-coding gene	gene with protein product		604106				9931487	Standard	NM_005684		Approved		uc001gka.1	Q9Y2T5	OTTHUMG00000034901	ENST00000367685.2:c.532T>C	chr1.hg19:g.174417781T>C	ENSP00000356658:p.Phe178Leu	70.0	0.0		142.0	25.0	NM_005684	O75654|Q4VBL6|Q6ISM0	Missense_Mutation	SNP	ENST00000367685.2	hg19	CCDS30941.1	.	.	.	.	.	.	.	.	.	.	T	7.181	0.589605	0.13812	.	.	ENSG00000203737	ENST00000367685	T	0.36340	1.26	5.9	5.9	0.94986	GPCR, rhodopsin-like superfamily (1);	0.072916	0.53938	N	0.000041	T	0.22437	0.0541	N	0.10945	0.07	0.43766	D	0.996286	B	0.23650	0.089	B	0.26517	0.07	T	0.11060	-1.0603	10	0.12766	T	0.61	-12.3619	16.3322	0.83039	0.0:0.0:0.0:1.0	.	178	Q9Y2T5	GPR52_HUMAN	L	178	ENSP00000356658:F178L	ENSP00000356658:F178L	F	+	1	0	GPR52	172684404	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.634000	0.83273	2.251000	0.74343	0.528000	0.53228	TTT	.	.		0.433	GPR52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084511.1	NM_005684	
INTS7	25896	hgsc.bcm.edu	37	1	212161330	212161330	+	Missense_Mutation	SNP	C	C	T			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr1:212161330C>T	ENST00000366994.3	-	8	999	c.895G>A	c.(895-897)Gcc>Acc	p.A299T	INTS7_ENST00000440600.2_Missense_Mutation_p.A250T|INTS7_ENST00000366993.3_Missense_Mutation_p.A299T|INTS7_ENST00000469606.1_5'UTR|INTS7_ENST00000366992.3_Missense_Mutation_p.A299T	NM_001199811.1|NM_001199812.1|NM_015434.3	NP_001186740.1|NP_001186741.1|NP_056249.1	Q9NVH2	INT7_HUMAN	integrator complex subunit 7	299					cellular response to ionizing radiation (GO:0071479)|DNA damage checkpoint (GO:0000077)|snRNA processing (GO:0016180)	chromosome (GO:0005694)|integrator complex (GO:0032039)				NS(1)|breast(1)|kidney(1)|large_intestine(8)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20				OV - Ovarian serous cystadenocarcinoma(81;0.00584)|all cancers(67;0.0318)|Epithelial(68;0.0852)		GTCTGGAGGGCACACTCACAA	0.393																																					p.A299T		Atlas-SNP	.											.	INTS7	68	.	0			c.G895A						.						107.0	95.0	99.0					1																	212161330		2203	4300	6503	SO:0001583	missense	25896	exon8			GGAGGGCACACTC	AK022509	CCDS1501.1, CCDS55684.1, CCDS55683.1, CCDS55685.1	1q32.3	2008-02-05	2006-03-15	2006-03-15	ENSG00000143493	ENSG00000143493			24484	protein-coding gene	gene with protein product		611350	"""chromosome 1 open reading frame 73"""	C1orf73		16239144	Standard	NM_015434		Approved	DKFZP434B168, INT7	uc001hiw.2	Q9NVH2	OTTHUMG00000037119	ENST00000366994.3:c.895G>A	chr1.hg19:g.212161330C>T	ENSP00000355961:p.Ala299Thr	64.0	0.0		124.0	32.0	NM_015434	B4DLZ6|B7WNP6|B7WPB6|Q8N4K7|Q8WUH5|Q9H9V3|Q9NVU5|Q9UFC6|Q9UFM3	Missense_Mutation	SNP	ENST00000366994.3	hg19	CCDS1501.1	.	.	.	.	.	.	.	.	.	.	C	16.13	3.036277	0.54896	.	.	ENSG00000143493	ENST00000366994;ENST00000366993;ENST00000366992;ENST00000440600	T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.16	4.94	4.94	0.65067	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.66723	0.2818	N	0.16166	0.38	0.80722	D	1	D;D;D;D	0.67145	0.996;0.996;0.969;0.969	D;D;P;P	0.77557	0.99;0.99;0.685;0.766	T	0.61252	-0.7100	10	0.08599	T	0.76	-9.4479	18.1681	0.89734	0.0:1.0:0.0:0.0	.	250;299;299;299	B4DLZ6;Q9NVH2-3;Q9NVH2-2;Q9NVH2	.;.;.;INT7_HUMAN	T	299;299;299;250	ENSP00000355961:A299T;ENSP00000355960:A299T;ENSP00000355959:A299T;ENSP00000388908:A250T	ENSP00000355959:A299T	A	-	1	0	INTS7	210227953	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.295000	0.65692	2.292000	0.77174	0.591000	0.81541	GCC	.	.		0.393	INTS7-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090142.1	NM_015434	
CDC42BPA	8476	hgsc.bcm.edu	37	1	227300124	227300124	+	Splice_Site	SNP	C	C	T			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr1:227300124C>T	ENST00000366769.3	-	14	3182		c.e14-1		CDC42BPA_ENST00000535525.1_Splice_Site|CDC42BPA_ENST00000366765.3_Splice_Site|CDC42BPA_ENST00000366766.2_Splice_Site|CDC42BPA_ENST00000366764.2_Splice_Site|CDC42BPA_ENST00000366767.3_Splice_Site|CDC42BPA_ENST00000334218.5_Splice_Site	NM_003607.3	NP_003598.2			CDC42 binding protein kinase alpha (DMPK-like)											NS(1)|breast(4)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(12)|lung(32)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|urinary_tract(2)	77		all_cancers(173;0.156)|Prostate(94;0.0792)				GAACTTCCAGCTTTAAAACAG	0.353																																					.		Atlas-SNP	.											.	CDC42BPA	528	.	0			c.1891-1G>A						.						130.0	128.0	129.0					1																	227300124		2203	4300	6503	SO:0001630	splice_region_variant	8476	exon15			TTCCAGCTTTAAA	U59305	CCDS1558.1, CCDS1559.1	1q42.11	2011-11-23	2001-11-28		ENSG00000143776	ENSG00000143776			1737	protein-coding gene	gene with protein product	"""myotonic dystrophy kinase-related Cdc42-binding kinase"""	603412	"""CDC42-binding protein kinase alpha (DMPK-like)"""				Standard	NM_003607		Approved	MRCKA, PK428, FLJ23347, KIAA0451, MRCK	uc001hqr.3	Q5VT25	OTTHUMG00000037618	ENST00000366769.3:c.1891-1G>A	chr1.hg19:g.227300124C>T		63.0	0.0		107.0	25.0	NM_003607		Splice_Site	SNP	ENST00000366769.3	hg19	CCDS1558.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.945207	0.73672	.	.	ENSG00000143776	ENST00000366769;ENST00000366767;ENST00000334218;ENST00000366766;ENST00000366764;ENST00000535525;ENST00000366765	.	.	.	5.52	5.52	0.82312	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4394	0.94811	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CDC42BPA	225366747	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	6.063000	0.71162	2.572000	0.86782	0.585000	0.79938	.	.	.		0.353	CDC42BPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091696.1	NM_014826	Intron
HADHA	3030	hgsc.bcm.edu	37	2	26416514	26416514	+	Missense_Mutation	SNP	A	A	G			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr2:26416514A>G	ENST00000380649.3	-	17	1946	c.1817T>C	c.(1816-1818)gTc>gCc	p.V606A		NM_000182.4	NP_000173.2	P40939	ECHA_HUMAN	hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit	606					cardiolipin acyl-chain remodeling (GO:0035965)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|response to drug (GO:0042493)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	mitochondrial fatty acid beta-oxidation multienzyme complex (GO:0016507)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|acetyl-CoA C-acetyltransferase activity (GO:0003985)|enoyl-CoA hydratase activity (GO:0004300)|fatty-acyl-CoA binding (GO:0000062)|long-chain-3-hydroxyacyl-CoA dehydrogenase activity (GO:0016509)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|NAD binding (GO:0051287)			autonomic_ganglia(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(4)|skin(1)	30	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTCCCCAAAGACTTTGCCCAG	0.537																																					p.V606A		Atlas-SNP	.											.	HADHA	87	.	0			c.T1817C						.						172.0	163.0	166.0					2																	26416514		2203	4300	6503	SO:0001583	missense	3030	exon17			CCAAAGACTTTGC	D16480	CCDS1721.1	2p23	2014-09-17	2010-04-30		ENSG00000084754	ENSG00000084754	1.1.1.211, 4.2.1.17		4801	protein-coding gene	gene with protein product	"""gastrin-binding protein"", ""long-chain-3-hydroxyacyl-CoA dehydrogenase"", ""long-chain 2-enoyl-CoA hydratase"", ""mitochondrial trifunctional protein, alpha subunit"""	600890	"""hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), alpha subunit"""			9605857, 7918661	Standard	NM_000182		Approved	GBP, LCEH, LCHAD, MTPA	uc002rgy.3	P40939	OTTHUMG00000096979	ENST00000380649.3:c.1817T>C	chr2.hg19:g.26416514A>G	ENSP00000370023:p.Val606Ala	152.0	0.0		137.0	47.0	NM_000182	B2R7L4|B4DYP2|Q16679|Q53T69|Q53TA2|Q96GT7|Q9UQC5	Missense_Mutation	SNP	ENST00000380649.3	hg19	CCDS1721.1	.	.	.	.	.	.	.	.	.	.	A	7.150	0.583637	0.13749	.	.	ENSG00000084754	ENST00000380649;ENST00000492433	D;D	0.88741	-2.42;-2.42	5.97	3.11	0.35812	3-hydroxyacyl-CoA dehydrogenase, C-terminal (1);Dehydrogenase, multihelical (1);6-phosphogluconate dehydrogenase, C-terminal-like (1);	0.148266	0.64402	N	0.000009	T	0.61899	0.2384	N	0.00633	-1.31	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.59177	-0.7503	10	0.02654	T	1	-37.444	7.8159	0.29258	0.1411:0.0:0.7267:0.1321	.	606;606	E9KL44;P40939	.;ECHA_HUMAN	A	606;92	ENSP00000370023:V606A;ENSP00000438039:V92A	ENSP00000370023:V606A	V	-	2	0	HADHA	26270018	1.000000	0.71417	0.999000	0.59377	0.981000	0.71138	4.743000	0.62110	0.413000	0.25759	-0.177000	0.13119	GTC	.	.		0.537	HADHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214051.1	NM_000182	
DRD3	1814	hgsc.bcm.edu	37	3	113890665	113890665	+	Missense_Mutation	SNP	C	C	A			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr3:113890665C>A	ENST00000460779.1	-	3	464	c.175G>T	c.(175-177)Gcc>Tcc	p.A59S	DRD3_ENST00000295881.7_Missense_Mutation_p.A59S|DRD3_ENST00000467632.1_Missense_Mutation_p.A59S|DRD3_ENST00000383673.2_Missense_Mutation_p.A59S	NM_001282563.1	NP_001269492.1	P35462	DRD3_HUMAN	dopamine receptor D3	59					acid secretion (GO:0046717)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|arachidonic acid secretion (GO:0050482)|behavioral response to cocaine (GO:0048148)|cellular calcium ion homeostasis (GO:0006874)|circadian regulation of gene expression (GO:0032922)|dopamine metabolic process (GO:0042417)|G-protein coupled receptor internalization (GO:0002031)|G-protein coupled receptor signaling pathway (GO:0007186)|gastric emptying (GO:0035483)|learning (GO:0007612)|learning or memory (GO:0007611)|locomotory behavior (GO:0007626)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of blood pressure (GO:0045776)|negative regulation of dopamine receptor signaling pathway (GO:0060160)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein secretion (GO:0050709)|negative regulation of sodium:proton antiporter activity (GO:0032416)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of mitosis (GO:0045840)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prepulse inhibition (GO:0060134)|regulation of blood volume by renin-angiotensin (GO:0002016)|regulation of cAMP metabolic process (GO:0030814)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|regulation of dopamine secretion (GO:0014059)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of lipid metabolic process (GO:0019216)|regulation of locomotion involved in locomotory behavior (GO:0090325)|regulation of multicellular organism growth (GO:0040014)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to histamine (GO:0034776)|response to morphine (GO:0043278)|social behavior (GO:0035176)|synaptic transmission, dopaminergic (GO:0001963)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|cell projection (GO:0042995)|endocytic vesicle (GO:0030139)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity, coupled via Gi/Go (GO:0001591)|drug binding (GO:0008144)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(23)|ovary(1)|pancreas(1)|skin(1)	36					Amisulpride(DB06288)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clozapine(DB00363)|Domperidone(DB01184)|Dopamine(DB00988)|Haloperidol(DB00502)|Iloperidone(DB04946)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pimozide(DB01100)|Pramipexole(DB00413)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sulpiride(DB00391)|Yohimbine(DB01392)|Ziprasidone(DB00246)	GTCTGCAGGGCCCGCTCCTTC	0.612																																					p.A59S		Atlas-SNP	.											.	DRD3	76	.	0			c.G175T						.						101.0	89.0	93.0					3																	113890665		2203	4300	6503	SO:0001583	missense	1814	exon2			GCAGGGCCCGCTC		CCDS2978.1, CCDS33829.1	3q13.3	2012-08-08			ENSG00000151577	ENSG00000151577		"""GPCR / Class A : Dopamine receptors"""	3024	protein-coding gene	gene with protein product		126451				1916765	Standard	XM_005247171		Approved		uc003ebc.1	P35462	OTTHUMG00000159334	ENST00000460779.1:c.175G>T	chr3.hg19:g.113890665C>A	ENSP00000419402:p.Ala59Ser	128.0	0.0		144.0	61.0	NM_033663	A1A4V5|Q4VBM8	Missense_Mutation	SNP	ENST00000460779.1	hg19	CCDS2978.1	.	.	.	.	.	.	.	.	.	.	C	12.88	2.071838	0.36566	.	.	ENSG00000151577	ENST00000460779;ENST00000467632;ENST00000383673;ENST00000281274;ENST00000295881	T;T;T;T	0.71341	-0.56;-0.56;-0.56;-0.56	5.0	3.07	0.35406	GPCR, rhodopsin-like superfamily (1);	0.266401	0.38778	N	0.001576	T	0.49047	0.1534	N	0.12961	0.28	0.38964	D	0.958611	B;B;B;B	0.14438	0.01;0.01;0.01;0.0	B;B;B;B	0.28385	0.089;0.089;0.089;0.006	T	0.37549	-0.9701	10	0.23891	T	0.37	.	5.0636	0.14570	0.1778:0.6045:0.0:0.2177	.	59;59;59;59	A1A4V4;A8K8E4;P35462;E9PCM4	.;.;DRD3_HUMAN;.	S	59	ENSP00000419402:A59S;ENSP00000420662:A59S;ENSP00000373169:A59S;ENSP00000295881:A59S	ENSP00000281274:A59S	A	-	1	0	DRD3	115373355	0.121000	0.22262	0.940000	0.37924	0.951000	0.60555	0.626000	0.24492	1.351000	0.45789	-0.126000	0.14955	GCC	.	.		0.612	DRD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354699.1	NM_000796.3	
CCKAR	886	hgsc.bcm.edu	37	4	26483375	26483376	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr4:26483375_26483376GG>TT	ENST00000295589.3	-	5	1365_1366	c.1171_1172CC>AA	c.(1171-1173)CCt>AAt	p.P391N		NM_000730.2	NP_000721.1	P32238	CCKAR_HUMAN	cholecystokinin A receptor	391					axonogenesis (GO:0007409)|cholecystokinin signaling pathway (GO:0038188)|digestion (GO:0007586)|feeding behavior (GO:0007631)|forebrain development (GO:0030900)|neuron migration (GO:0001764)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|response to nutrient (GO:0007584)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cholecystokinin receptor activity (GO:0004951)			NS(2)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|liver(1)|lung(14)|pancreas(1)|skin(1)	29		Breast(46;0.0503)			Ceruletide(DB00403)	TGGGGGACCAGGATTGGGGCAG	0.624																																					p.P391H|p.P391T		Atlas-SNP	.											.	CCKAR	74	.	0			c.C1172A|c.C1171A						.																																			SO:0001583	missense	886	exon5			GGACCAGGATTGG|GACCAGGATTGGG	L19315	CCDS3438.1	4p15.2	2013-09-20			ENSG00000163394	ENSG00000163394		"""GPCR / Class A : Cholecystokinin receptors"""	1570	protein-coding gene	gene with protein product		118444					Standard	NM_000730		Approved		uc003gse.1	P32238	OTTHUMG00000128567	ENST00000295589.3:c.1171_1172delinsTT	chr4.hg19:g.26483375_26483376delinsTT	ENSP00000295589:p.Pro391Asn	136.0	0.0		168.0|169.0	57.0|59.0	NM_000730	B2R9Z5	Missense_Mutation	SNP	ENST00000295589.3	hg19	CCDS3438.1																																																																																			.	.		0.624	CCKAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250418.2		
IQGAP2	10788	hgsc.bcm.edu	37	5	75991366	75991366	+	Missense_Mutation	SNP	G	G	C			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr5:75991366G>C	ENST00000274364.6	+	32	4378	c.4081G>C	c.(4081-4083)Gaa>Caa	p.E1361Q	IQGAP2_ENST00000396234.3_Missense_Mutation_p.E857Q|IQGAP2_ENST00000379730.3_Missense_Mutation_p.E863Q|IQGAP2_ENST00000502745.1_Missense_Mutation_p.E857Q|CTD-2384B11.2_ENST00000507514.1_RNA	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	1361					negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		ATCTATGATTGAAGATGCACA	0.458																																					p.E1361Q		Atlas-SNP	.											.	IQGAP2	186	.	0			c.G4081C						.						97.0	87.0	90.0					5																	75991366		2203	4300	6503	SO:0001583	missense	10788	exon32			ATGATTGAAGATG	U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.4081G>C	chr5.hg19:g.75991366G>C	ENSP00000274364:p.Glu1361Gln	336.0	0.0		374.0	156.0	NM_006633	A8K4V1|B7Z8A4|J3KR91	Missense_Mutation	SNP	ENST00000274364.6	hg19	CCDS34188.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.012935	0.75161	.	.	ENSG00000145703	ENST00000274364;ENST00000379730;ENST00000505766;ENST00000396234;ENST00000502745	T;T;T;T;T	0.02916	4.24;4.11;4.24;4.11;4.11	5.48	4.61	0.57282	.	0.154446	0.56097	D	0.000028	T	0.06142	0.0159	M	0.69823	2.125	0.80722	D	1	B;B;B	0.33000	0.393;0.393;0.273	B;B;B	0.35813	0.211;0.211;0.105	T	0.21724	-1.0237	10	0.38643	T	0.18	-15.9353	13.8002	0.63194	0.0734:0.0:0.9266:0.0	.	863;857;1361	F5H7S7;Q13576-2;Q13576	.;.;IQGA2_HUMAN	Q	1361;863;1311;857;857	ENSP00000274364:E1361Q;ENSP00000442313:E863Q;ENSP00000421097:E1311Q;ENSP00000379535:E857Q;ENSP00000426027:E857Q	ENSP00000274364:E1361Q	E	+	1	0	IQGAP2	76027122	1.000000	0.71417	0.501000	0.27601	0.751000	0.42716	7.920000	0.87521	1.306000	0.44926	0.655000	0.94253	GAA	.	.		0.458	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368877.1	NM_006633	
APC	324	hgsc.bcm.edu	37	5	112162900	112162901	+	Missense_Mutation	DNP	GG	GG	AT			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr5:112162900_112162901GG>AT	ENST00000457016.1	+	12	1884_1885	c.1504_1505GG>AT	c.(1504-1506)GGa>ATa	p.G502I	APC_ENST00000257430.4_Missense_Mutation_p.G502I|APC_ENST00000508376.2_Missense_Mutation_p.G502I|CTC-554D6.1_ENST00000520401.1_5'Flank			P25054	APC_HUMAN	adenomatous polyposis coli	502	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		ACGATATGCTGGAATGGCTTTG	0.366		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.G502R|p.G502V	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	Atlas-SNP	.	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	APC	4158	.	1	Unknown(1)	skin(1)	c.G1504A|c.G1505T						.																																			SO:0001583	missense	324	exon13	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	TATGCTGGAATGG|ATGCTGGAATGGC	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	Exception_encountered	chr5.hg19:g.112162900_112162901delinsAT	ENSP00000413133:p.Gly502Ile	138.0	0.0		123.0	51.0	NM_001127510	D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	ENST00000457016.1	hg19	CCDS4107.1																																																																																			.	.		0.366	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
HLA-C	3107	hgsc.bcm.edu	37	6	31239099	31239099	+	Missense_Mutation	SNP	C	C	G			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr6:31239099C>G	ENST00000376228.5	-	3	384	c.370G>C	c.(370-372)Ggc>Cgc	p.G124R	HLA-C_ENST00000383329.3_Missense_Mutation_p.G124R	NM_002117.5	NP_002108.4	Q95604	1C17_HUMAN	major histocompatibility complex, class I, C	124	Alpha-2.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	17						AGGTCGCAGCCAGACATCCTC	0.721																																					p.G124R		Atlas-SNP	.											.	HLA-C	92	.	0			c.G370C						.						22.0	21.0	21.0					6																	31239099		2157	4193	6350	SO:0001583	missense	3107	exon3			CGCAGCCAGACAT	M11886	CCDS34393.1	6p21.3	2014-01-30			ENSG00000204525	ENSG00000204525		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4933	protein-coding gene	gene with protein product		142840	"""psoriasis susceptibility 1"""	HLA-JY3, D6S204, PSORS1		3863816, 16642438	Standard	NM_001243042		Approved		uc003nsy.3	P04222	OTTHUMG00000031154	ENST00000376228.5:c.370G>C	chr6.hg19:g.31239099C>G	ENSP00000365402:p.Gly124Arg	83.0	0.0		214.0	21.0	NM_002117	O02864|O02958|Q29643|Q9MY30	Missense_Mutation	SNP	ENST00000376228.5	hg19	CCDS34393.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	13.38|13.38	2.219532|2.219532	0.39201|0.39201	.|.	.|.	ENSG00000204525|ENSG00000204525	ENST00000376228;ENST00000383329;ENST00000396254;ENST00000539307|ENST00000415537	T;T|.	0.02916|.	4.11;4.11|.	2.81|2.81	1.9|1.9	0.25705|0.25705	MHC class I, alpha chain, alpha1/alpha2 (2);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);|.	0.000000|.	0.37012|.	U|.	0.002289|.	T|T	0.75989|0.75989	0.3925|0.3925	H|H	0.99058|0.99058	4.415|4.415	0.30556|0.30556	N|N	0.764949|0.764949	D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D|.	0.97110|.	1.0;1.0;1.0;1.0;1.0|.	T|T	0.72007|0.72007	-0.4420|-0.4420	10|6	0.87932|0.87932	D|D	0|0	.|.	9.0174|9.0174	0.36179|0.36179	0.2222:0.7778:0.0:0.0|0.2222:0.7778:0.0:0.0	.|.	124;99;124;124;124|.	A2AEA4;Q92671;A6H578;A2AEA2;P10321|.	.;.;.;.;1C07_HUMAN|.	R|S	124;124;124;161|123	ENSP00000365402:G124R;ENSP00000372819:G124R|.	ENSP00000365402:G124R|ENSP00000365412:W118S	G|W	-|-	1|2	0|0	HLA-C|HLA-C	31347078|31347078	0.987000|0.987000	0.35691|0.35691	0.126000|0.126000	0.21872|0.21872	0.004000|0.004000	0.04260|0.04260	3.034000|3.034000	0.49751|0.49751	0.722000|0.722000	0.32252|0.32252	0.305000|0.305000	0.20034|0.20034	GGC|TGG	.	.		0.721	HLA-C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076281.3	NM_002117	
BTNL2	56244	hgsc.bcm.edu	37	6	32369565	32369565	+	Missense_Mutation	SNP	G	G	T			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr6:32369565G>T	ENST00000374993.1	-	4	726	c.727C>A	c.(727-729)Ctg>Atg	p.L243M	BTNL2_ENST00000544175.1_De_novo_Start_InFrame|BTNL2_ENST00000454136.3_Missense_Mutation_p.L243M|BTNL2_ENST00000540315.1_Intron|BTNL2_ENST00000374995.3_Intron|BTNL2_ENST00000414363.1_Missense_Mutation_p.L33M|BTNL2_ENST00000429232.2_Intron	NM_019602.1	NP_062548.1	Q9UIR0	BTNL2_HUMAN	butyrophilin-like 2 (MHC class II associated)	243	Ig-like V-type 3.					integral component of membrane (GO:0016021)				central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|prostate(1)|urinary_tract(1)	19						TACTTACCCAGCTCAGTCTGG	0.468																																					p.L243M		Atlas-SNP	.											.	BTNL2	50	.	0			c.C727A						.						49.0	51.0	50.0					6																	32369565		2203	4300	6503	SO:0001583	missense	56244	exon4			TACCCAGCTCAGT	AF186588		6p21.3	2014-01-14			ENSG00000204290	ENSG00000204290		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1142	protein-coding gene	gene with protein product		606000				10803852, 15735647	Standard	XM_006726138		Approved	HSBLMHC1, BTL-II, BTN7	uc003obg.1	Q9UIR0	OTTHUMG00000031102	ENST00000374993.1:c.727C>A	chr6.hg19:g.32369565G>T	ENSP00000364132:p.Leu243Met	62.0	0.0		153.0	13.0	NM_019602	A0PJV5|B0UYW9|B0V0N6|O98261|Q08E96|Q58R22|Q58R23|Q5JYF9|Q5MP42|Q5MP43|Q5RIF8|Q5SP08|Q5SP09|Q5SRW3|Q5SRW4|Q5SU36|Q95HK0	Missense_Mutation	SNP	ENST00000374993.1	hg19		.	.	.	.	.	.	.	.	.	.	G	8.623	0.891864	0.17613	.	.	ENSG00000204290	ENST00000468270;ENST00000414363;ENST00000374993	T;T	0.04234	4.26;3.67	5.16	-0.234	0.13074	Immunoglobulin-like (1);	0.409388	0.18106	N	0.151532	T	0.01835	0.0058	L	0.53780	1.695	0.80722	D	1	B;B	0.27380	0.112;0.177	B;B	0.23716	0.048;0.03	T	0.44832	-0.9302	10	0.33141	T	0.24	.	9.2919	0.37791	0.0747:0.0:0.2703:0.6549	.	33;243	Q9UIR0-4;Q9UIR0	.;BTNL2_HUMAN	M	243;33;243	ENSP00000390512:L33M;ENSP00000364132:L243M	ENSP00000364132:L243M	L	-	1	2	BTNL2	32477543	0.998000	0.40836	0.884000	0.34674	0.428000	0.31595	0.455000	0.21843	-0.258000	0.09446	-0.211000	0.12701	CTG	.	.		0.468	BTNL2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_019602	
CDKN1A	1026	hgsc.bcm.edu	37	6	36652015	36652015	+	Missense_Mutation	SNP	G	G	T			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr6:36652015G>T	ENST00000405375.1	+	2	372	c.137G>T	c.(136-138)cGt>cTt	p.R46L	CDKN1A_ENST00000373711.2_Missense_Mutation_p.R46L|CDKN1A_ENST00000478800.1_3'UTR|CDKN1A_ENST00000244741.5_Missense_Mutation_p.R46L|CDKN1A_ENST00000448526.2_Missense_Mutation_p.R80L	NM_001220778.1	NP_001207707.1	P38936	CDN1A_HUMAN	cyclin-dependent kinase inhibitor 1A (p21, Cip1)	46					cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to extracellular stimulus (GO:0031668)|cellular response to ionizing radiation (GO:0071479)|cellular senescence (GO:0090398)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle (GO:0000278)|mitotic cell cycle arrest (GO:0071850)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of gene expression (GO:0010629)|negative regulation of phosphorylation (GO:0042326)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ regeneration (GO:0031100)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of DNA biosynthetic process (GO:2000278)|regulation of protein import into nucleus, translocation (GO:0033158)|response to arsenic-containing substance (GO:0046685)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to hyperoxia (GO:0055093)|response to organonitrogen compound (GO:0010243)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|stress-induced premature senescence (GO:0090400)	cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCNA-p21 complex (GO:0070557)	cyclin-dependent protein kinase activating kinase activity (GO:0019912)|cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|urinary_tract(5)	15						CAGGAGGCCCGTGAGCGATGG	0.662																																					p.R46L		Atlas-SNP	.											.	CDKN1A	27	.	0			c.G137T						.						51.0	46.0	48.0					6																	36652015		2203	4300	6503	SO:0001583	missense	1026	exon2			AGGCCCGTGAGCG	U03106	CCDS4824.1	6p21.1	2009-01-21			ENSG00000124762	ENSG00000124762			1784	protein-coding gene	gene with protein product		116899		CDKN1			Standard	NM_000389		Approved	P21, CIP1, WAF1, SDI1, CAP20, p21CIP1, p21Cip1/Waf1	uc021yzb.1	P38936	OTTHUMG00000014603	ENST00000405375.1:c.137G>T	chr6.hg19:g.36652015G>T	ENSP00000384849:p.Arg46Leu	47.0	0.0		75.0	41.0	NM_001220778	Q14010|Q6FI05|Q9BUT4	Missense_Mutation	SNP	ENST00000405375.1	hg19	CCDS4824.1	.	.	.	.	.	.	.	.	.	.	G	11.96	1.795480	0.31777	.	.	ENSG00000124762	ENST00000448526;ENST00000244741;ENST00000405375;ENST00000373711	D;D;D;D	0.83673	-1.75;-1.75;-1.75;-1.75	5.06	4.11	0.48088	.	0.506057	0.17321	N	0.178490	T	0.63954	0.2555	L	0.46157	1.445	0.28243	N	0.925595	P;B;P	0.39282	0.666;0.165;0.524	B;B;B	0.36922	0.236;0.118;0.153	T	0.58769	-0.7578	10	0.44086	T	0.13	-5.9852	7.5934	0.28033	0.1161:0.0:0.8839:0.0	.	80;46;46	B4DQP9;P38936;Q96LE1	.;CDN1A_HUMAN;.	L	80;46;46;46	ENSP00000409259:R80L;ENSP00000244741:R46L;ENSP00000384849:R46L;ENSP00000362815:R46L	ENSP00000244741:R46L	R	+	2	0	CDKN1A	36759993	0.581000	0.26741	0.906000	0.35671	0.400000	0.30750	2.014000	0.40951	2.642000	0.89623	0.561000	0.74099	CGT	.	.		0.662	CDKN1A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040354.1	NM_078467	
RBM28	55131	hgsc.bcm.edu	37	7	127964620	127964620	+	Missense_Mutation	SNP	C	C	A			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr7:127964620C>A	ENST00000223073.2	-	12	1445	c.1331G>T	c.(1330-1332)cGa>cTa	p.R444L	RBM28_ENST00000415472.2_Missense_Mutation_p.R303L	NM_018077.2	NP_060547.2	Q9NW13	RBM28_HUMAN	RNA binding motif protein 28	444					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleolus (GO:0005730)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|kidney(7)|large_intestine(3)|lung(8)|ovary(2)	21						ACAGCCTTCTCGGGCCAGATA	0.517																																					p.R444L		Atlas-SNP	.											.	RBM28	71	.	0			c.G1331T						.						137.0	132.0	133.0					7																	127964620		2203	4300	6503	SO:0001583	missense	55131	exon12			CCTTCTCGGGCCA	AK001239	CCDS5801.1, CCDS55159.1	7q32.2	2013-02-12			ENSG00000106344	ENSG00000106344		"""RNA binding motif (RRM) containing"""	21863	protein-coding gene	gene with protein product		612074					Standard	NM_018077		Approved	FLJ10377	uc003vmp.2	Q9NW13	OTTHUMG00000157711	ENST00000223073.2:c.1331G>T	chr7.hg19:g.127964620C>A	ENSP00000223073:p.Arg444Leu	113.0	0.0		118.0	40.0	NM_018077	A4D100|B4DU52|E9PDD9|Q53H65|Q96CV3	Missense_Mutation	SNP	ENST00000223073.2	hg19	CCDS5801.1	.	.	.	.	.	.	.	.	.	.	C	32	5.105540	0.94245	.	.	ENSG00000106344	ENST00000223073;ENST00000415472	T;T	0.22336	2.9;1.96	5.63	5.63	0.86233	.	0.118400	0.53938	D	0.000045	T	0.48003	0.1476	M	0.77486	2.375	0.80722	D	1	P;D;P	0.69078	0.457;0.997;0.457	P;D;P	0.76071	0.485;0.987;0.485	T	0.39231	-0.9624	10	0.51188	T	0.08	-9.3348	15.5476	0.76118	0.0:1.0:0.0:0.0	.	303;444;303	E9PDD9;Q9NW13;B4DU52	.;RBM28_HUMAN;.	L	444;303	ENSP00000223073:R444L;ENSP00000390517:R303L	ENSP00000223073:R444L	R	-	2	0	RBM28	127751856	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.107000	0.71517	2.826000	0.97356	0.655000	0.94253	CGA	.	.		0.517	RBM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349442.2	NM_018077	
WHSC1L1	54904	hgsc.bcm.edu	37	8	38146244	38146244	+	Nonsense_Mutation	SNP	G	G	A			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr8:38146244G>A	ENST00000317025.8	-	19	3779	c.3262C>T	c.(3262-3264)Cag>Tag	p.Q1088*	WHSC1L1_ENST00000527502.1_Nonsense_Mutation_p.Q1088*|WHSC1L1_ENST00000433384.2_Nonsense_Mutation_p.Q1039*	NM_023034.1	NP_075447.1	Q9BZ95	NSD3_HUMAN	Wolf-Hirschhorn syndrome candidate 1-like 1	1088					histone lysine methylation (GO:0034968)|histone methylation (GO:0016571)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	24	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)			TCAGCAACCTGGATCTGCACC	0.478			T	NUP98	AML																																p.Q1088X		Atlas-SNP	.		Dom	yes		8	8p12	54904	Wolf-Hirschhorn syndrome candidate 1-like 1 (NSD3)		L	.	WHSC1L1	137	.	0			c.C3262T						.						90.0	88.0	89.0					8																	38146244		1980	4192	6172	SO:0001587	stop_gained	54904	exon19			CAACCTGGATCTG	AF332469	CCDS6105.1, CCDS43729.1	8p11.2	2013-05-20			ENSG00000147548	ENSG00000147548			12767	protein-coding gene	gene with protein product		607083				10802047, 23269674	Standard	NM_023034		Approved	FLJ20353, NSD3	uc003xli.3	Q9BZ95		ENST00000317025.8:c.3262C>T	chr8.hg19:g.38146244G>A	ENSP00000313983:p.Gln1088*	97.0	0.0		159.0	51.0	NM_023034	B7ZL11|D3DSX1|Q1RMD3|Q3B796|Q6ZSA5|Q9BYU8|Q9BYU9|Q9H2M8|Q9H9W9|Q9NXA6	Nonsense_Mutation	SNP	ENST00000317025.8	hg19	CCDS43729.1	.	.	.	.	.	.	.	.	.	.	G	45	11.868959	0.99612	.	.	ENSG00000147548	ENST00000433384;ENST00000317025;ENST00000446459;ENST00000527502	.	.	.	6.17	6.17	0.99709	.	0.295611	0.23977	U	0.042714	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	.	.	.	X	1039;1088;1025;1088	.	ENSP00000313983:Q1088X	Q	-	1	0	WHSC1L1	38265401	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.062000	0.89475	2.941000	0.99782	0.655000	0.94253	CAG	.	.		0.478	WHSC1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381924.3	NM_023034	
STK3	6788	hgsc.bcm.edu	37	8	99608325	99608325	+	Missense_Mutation	SNP	C	C	T			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr8:99608325C>T	ENST00000419617.2	-	7	897	c.757G>A	c.(757-759)Gat>Aat	p.D253N	STK3_ENST00000521768.1_5'UTR|STK3_ENST00000523601.1_Missense_Mutation_p.D281N	NM_006281.3	NP_006272.2	Q13188	STK3_HUMAN	serine/threonine kinase 3	253	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell differentiation involved in embryonic placenta development (GO:0060706)|central nervous system development (GO:0007417)|endocardium development (GO:0003157)|hepatocyte apoptotic process (GO:0097284)|hippo signaling (GO:0035329)|intracellular signal transduction (GO:0035556)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of organ growth (GO:0046621)|neural tube formation (GO:0001841)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|primitive hemopoiesis (GO:0060215)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein dimerization activity (GO:0046983)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	17	Breast(36;2.4e-06)	Breast(495;0.106)	OV - Ovarian serous cystadenocarcinoma(57;0.0382)	KIRC - Kidney renal clear cell carcinoma(542;9.44e-06)		TTAACAAAATCGGTGAAATCA	0.398																																					p.D281N		Atlas-SNP	.											.	STK3	47	.	0			c.G841A						.						79.0	76.0	77.0					8																	99608325		1846	4100	5946	SO:0001583	missense	6788	exon9			CAAAATCGGTGAA	BC010640	CCDS47900.1, CCDS59108.1, CCDS75774.1	8q22.2	2011-05-24	2010-06-25		ENSG00000104375	ENSG00000104375			11406	protein-coding gene	gene with protein product		605030	"""serine/threonine kinase 3 (Ste20, yeast homolog)"""			8816758	Standard	NM_006281		Approved	MST2, KRS1	uc003yip.4	Q13188	OTTHUMG00000164651	ENST00000419617.2:c.757G>A	chr8.hg19:g.99608325C>T	ENSP00000390500:p.Asp253Asn	199.0	0.0		315.0	87.0	NM_001256312	A8K722|B3KYA7|Q15445|Q15801|Q96FM6	Missense_Mutation	SNP	ENST00000419617.2	hg19	CCDS47900.1	.	.	.	.	.	.	.	.	.	.	C	18.77	3.695478	0.68386	.	.	ENSG00000104375	ENST00000419617;ENST00000523601;ENST00000518165	T;T;T	0.16597	2.33;2.33;2.92	5.28	5.28	0.74379	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.26774	0.0655	L	0.50919	1.6	0.80722	D	1	P;P;P	0.52061	0.95;0.709;0.836	P;B;B	0.48227	0.571;0.308;0.378	T	0.00778	-1.1570	10	0.52906	T	0.07	.	19.2729	0.94018	0.0:1.0:0.0:0.0	.	142;253;281	E5RFQ9;Q13188;B3KYA7	.;STK3_HUMAN;.	N	253;281;142	ENSP00000390500:D253N;ENSP00000429744:D281N;ENSP00000428014:D142N	ENSP00000390500:D253N	D	-	1	0	STK3	99677501	1.000000	0.71417	0.991000	0.47740	0.983000	0.72400	7.776000	0.85560	2.638000	0.89438	0.467000	0.42956	GAT	.	.		0.398	STK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379635.1	NM_006281	
DOCK8	81704	hgsc.bcm.edu	37	9	396879	396879	+	Missense_Mutation	SNP	C	C	T			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr9:396879C>T	ENST00000453981.1	+	25	3177	c.3065C>T	c.(3064-3066)aCt>aTt	p.T1022I	DOCK8_ENST00000382331.1_Missense_Mutation_p.T324I|DOCK8_ENST00000382329.1_Missense_Mutation_p.T489I|DOCK8_ENST00000469391.1_Missense_Mutation_p.T922I|DOCK8_ENST00000432829.2_Missense_Mutation_p.T954I			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	1022					blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		GACATAACTACTATTGTTAAT	0.413																																					p.T1022I		Atlas-SNP	.											.	DOCK8	401	.	0			c.C3065T						.						167.0	160.0	162.0					9																	396879		2203	4300	6503	SO:0001583	missense	81704	exon25			TAACTACTATTGT	AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.3065C>T	chr9.hg19:g.396879C>T	ENSP00000408464:p.Thr1022Ile	198.0	0.0		185.0	66.0	NM_203447	A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Missense_Mutation	SNP	ENST00000453981.1	hg19	CCDS6440.2	.	.	.	.	.	.	.	.	.	.	C	28.7	4.941247	0.92526	.	.	ENSG00000107099	ENST00000453981;ENST00000287364;ENST00000432829;ENST00000469391;ENST00000382331;ENST00000382329	T;T;T;T;T	0.23147	1.92;1.92;1.92;1.92;1.92	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.57080	0.2029	M	0.82517	2.595	0.80722	D	1	D;P;P;D	0.89917	1.0;0.935;0.935;0.967	D;P;P;P	0.91635	0.999;0.512;0.615;0.661	T	0.56032	-0.8046	10	0.41790	T	0.15	.	19.8411	0.96685	0.0:1.0:0.0:0.0	.	324;922;489;1022	A2A370;E9PH09;A2A369;Q8NF50	.;.;.;DOCK8_HUMAN	I	1022;990;954;922;324;489	ENSP00000408464:T1022I;ENSP00000394888:T954I;ENSP00000419438:T922I;ENSP00000371768:T324I;ENSP00000371766:T489I	ENSP00000287364:T990I	T	+	2	0	DOCK8	386879	1.000000	0.71417	0.980000	0.43619	0.782000	0.44232	7.663000	0.83820	2.683000	0.91414	0.655000	0.94253	ACT	.	.		0.413	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171792.5	XM_036307	
KCNV2	169522	hgsc.bcm.edu	37	9	2718363	2718363	+	Silent	SNP	C	C	T			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr9:2718363C>T	ENST00000382082.3	+	1	862	c.624C>T	c.(622-624)gaC>gaT	p.D208D		NM_133497.3	NP_598004.1	Q8TDN2	KCNV2_HUMAN	potassium channel, subfamily V, member 2	208					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(2)	35				GBM - Glioblastoma multiforme(50;0.0257)		AGCGGCGCGACGAGCTGAGCG	0.692																																					p.D208D		Atlas-SNP	.											.	KCNV2	72	.	0			c.C624T						.						9.0	8.0	8.0					9																	2718363		2119	4191	6310	SO:0001819	synonymous_variant	169522	exon1			GCGCGACGAGCTG	AF348983	CCDS6447.1	9p24.2	2011-07-05			ENSG00000168263	ENSG00000168263		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	19698	protein-coding gene	gene with protein product		607604				12060745, 16382104	Standard	NM_133497		Approved	Kv8.2	uc003zho.2	Q8TDN2	OTTHUMG00000019449	ENST00000382082.3:c.624C>T	chr9.hg19:g.2718363C>T		58.0	0.0		86.0	37.0	NM_133497	Q5T6X0	Silent	SNP	ENST00000382082.3	hg19	CCDS6447.1																																																																																			.	.		0.692	KCNV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051528.1	NM_133497	
NANS	54187	hgsc.bcm.edu	37	9	100823187	100823187	+	Nonsense_Mutation	SNP	C	C	T			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr9:100823187C>T	ENST00000210444.5	+	2	326	c.256C>T	c.(256-258)Cga>Tga	p.R86*		NM_018946.3	NP_061819.2	Q9NR45	SIAS_HUMAN	N-acetylneuraminic acid synthase	86					lipopolysaccharide biosynthetic process (GO:0009103)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	N-acetylneuraminate synthase activity (GO:0050462)|N-acylneuraminate cytidylyltransferase activity (GO:0008781)|N-acylneuraminate-9-phosphate synthase activity (GO:0047444)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)	11		Acute lymphoblastic leukemia(62;0.0559)				GGAGCACAAACGACATCTGGA	0.537																																					p.R86X		Atlas-SNP	.											.	NANS	24	.	0			c.C256T						.						223.0	206.0	212.0					9																	100823187		2203	4300	6503	SO:0001587	stop_gained	54187	exon2			CACAAACGACATC	AF161387	CCDS6733.1	9p24.1-p23	2008-07-31	2008-07-31		ENSG00000095380	ENSG00000095380			19237	protein-coding gene	gene with protein product	"""sialic acid synthase"""	605202				10749855	Standard	NM_018946		Approved	SAS	uc004ayc.3	Q9NR45	OTTHUMG00000020341	ENST00000210444.5:c.256C>T	chr9.hg19:g.100823187C>T	ENSP00000210444:p.Arg86*	140.0	0.0		162.0	62.0	NM_018946	B2RE98|Q8WUV9|Q9BWS6|Q9NVD4	Nonsense_Mutation	SNP	ENST00000210444.5	hg19	CCDS6733.1	.	.	.	.	.	.	.	.	.	.	C	34	5.346147	0.95807	.	.	ENSG00000095380	ENST00000210444	.	.	.	5.73	4.83	0.62350	.	0.094643	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.7221	14.1947	0.65662	0.1509:0.8491:0.0:0.0	.	.	.	.	X	86	.	ENSP00000210444:R86X	R	+	1	2	NANS	99863008	1.000000	0.71417	0.930000	0.37139	0.806000	0.45545	5.470000	0.66756	1.556000	0.49512	-0.181000	0.13052	CGA	.	.		0.537	NANS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053359.1	NM_018946	
GARNL3	84253	hgsc.bcm.edu	37	9	130104554	130104554	+	Missense_Mutation	SNP	C	C	T			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr9:130104554C>T	ENST00000373387.4	+	14	1544	c.1192C>T	c.(1192-1194)Cgt>Tgt	p.R398C	GARNL3_ENST00000314904.5_Missense_Mutation_p.R398C|GARNL3_ENST00000435213.2_Missense_Mutation_p.R376C	NM_032293.4	NP_115669.3	Q5VVW2	GARL3_HUMAN	GTPase activating Rap/RanGAP domain-like 3	398	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)|small GTPase regulator activity (GO:0005083)			NS(1)|central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(24)|ovary(1)|skin(1)|urinary_tract(2)	41						GAAACGTCGGCGTACCCTGGA	0.388																																					p.R398C		Atlas-SNP	.											.	GARNL3	83	.	0			c.C1192T						.						160.0	150.0	154.0					9																	130104554		2203	4300	6503	SO:0001583	missense	84253	exon14			CGTCGGCGTACCC	BC034983	CCDS6869.2, CCDS69663.1	9q34.13	2009-09-14	2004-08-09		ENSG00000136895	ENSG00000136895			25425	protein-coding gene	gene with protein product			"""GTPase activating RANGAP domain-like 3"""			11230166	Standard	NM_032293		Approved	DKFZp761J1523, bA356B19.1	uc011mae.2	Q5VVW2	OTTHUMG00000020700	ENST00000373387.4:c.1192C>T	chr9.hg19:g.130104554C>T	ENSP00000362485:p.Arg398Cys	107.0	0.0		108.0	40.0	NM_032293	B4DEP7|B7Z3Q6|Q8IYU1|Q8N951|Q8ND89|Q9BQH6	Missense_Mutation	SNP	ENST00000373387.4	hg19	CCDS6869.2	.	.	.	.	.	.	.	.	.	.	C	24.8	4.572632	0.86542	.	.	ENSG00000136895	ENST00000435213;ENST00000314904;ENST00000373387	D;D;D	0.95588	-3.75;-3.75;-3.75	5.38	4.45	0.53987	Rap/ran-GAP (2);	0.000000	0.85682	D	0.000000	D	0.98150	0.9389	M	0.93594	3.435	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98805	1.0741	9	.	.	.	.	14.2203	0.65823	0.1496:0.8504:0.0:0.0	.	398;376;339	Q5VVW2;B7Z3Q6;Q5VVW4	GARL3_HUMAN;.;.	C	376;398;398	ENSP00000396205:R376C;ENSP00000313970:R398C;ENSP00000362485:R398C	.	R	+	1	0	GARNL3	129144375	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.661000	0.68025	2.491000	0.84063	0.650000	0.86243	CGT	.	.		0.388	GARNL3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054151.3	NM_032293	
CXCL12	6387	hgsc.bcm.edu	37	10	44880397	44880397	+	Missense_Mutation	SNP	G	G	C			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr10:44880397G>C	ENST00000374429.2	-	1	143	c.57C>G	c.(55-57)agC>agG	p.S19R	CXCL12_ENST00000496375.1_Intron|CXCL12_ENST00000395794.2_Missense_Mutation_p.S19R|CXCL12_ENST00000395795.4_Missense_Mutation_p.S19R|CXCL12_ENST00000343575.6_Missense_Mutation_p.S19R|CXCL12_ENST00000395793.3_Missense_Mutation_p.S19R|CXCL12_ENST00000374426.2_Missense_Mutation_p.S19R	NM_000609.5|NM_001277990.1	NP_000600.1|NP_001264919.1	P48061	SDF1_HUMAN	chemokine (C-X-C motif) ligand 12	19					adult locomotory behavior (GO:0008344)|ameboidal cell migration (GO:0001667)|blood circulation (GO:0008015)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cellular calcium ion homeostasis (GO:0006874)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|germ cell development (GO:0007281)|germ cell migration (GO:0008354)|immune response (GO:0006955)|induction of positive chemotaxis (GO:0050930)|motor neuron axon guidance (GO:0008045)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of leukocyte apoptotic process (GO:2000107)|negative regulation of leukocyte tethering or rolling (GO:1903237)|neuron migration (GO:0001764)|organ regeneration (GO:0031100)|patterning of blood vessels (GO:0001569)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cell adhesion (GO:0045785)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of T cell migration (GO:2000406)|regulation of actin polymerization or depolymerization (GO:0008064)|response to heat (GO:0009408)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|response to peptide hormone (GO:0043434)|response to radiation (GO:0009314)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation (GO:0042098)|telencephalon cell migration (GO:0022029)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	chemokine activity (GO:0008009)|chemokine receptor binding (GO:0042379)|CXCR chemokine receptor binding (GO:0045236)|receptor binding (GO:0005102)			endometrium(1)|large_intestine(1)|lung(3)|skin(1)	6					Tinzaparin(DB06822)	ACTTACCGTCGCTGAGGCAGA	0.766																																					p.S19R		Atlas-SNP	.											.	CXCL12	37	.	0			c.C57G						.						6.0	7.0	7.0					10																	44880397		2015	4006	6021	SO:0001583	missense	6387	exon1			ACCGTCGCTGAGG	L36033	CCDS7207.1, CCDS31186.1, CCDS44373.1, CCDS53527.1, CCDS60518.1	10q11.1	2013-02-28	2010-05-11	2002-08-23	ENSG00000107562	ENSG00000107562		"""Endogenous ligands"""	10672	protein-coding gene	gene with protein product		600835	"""stromal cell-derived factor 1"""	SDF1A, SDF1B, SDF1		7490086	Standard	NM_001033886		Approved	SCYB12, SDF-1a, SDF-1b, PBSF, TLSF-a, TLSF-b, TPAR1	uc021ppm.1	P48061	OTTHUMG00000018054	ENST00000374429.2:c.57C>G	chr10.hg19:g.44880397G>C	ENSP00000363551:p.Ser19Arg	38.0	0.0		51.0	22.0	NM_199168	B2R4G0|E7EVL0|H7BYN8|Q2L985|Q2L986|Q2L988|Q5IT36|Q6ICW0|Q9H554	Missense_Mutation	SNP	ENST00000374429.2	hg19	CCDS44373.1	.	.	.	.	.	.	.	.	.	.	G	19.60	3.858620	0.71834	.	.	ENSG00000107562	ENST00000395795;ENST00000374429;ENST00000395793;ENST00000374426;ENST00000343575;ENST00000395794	T;T;T;T;T	0.26660	1.72;1.75;1.77;1.73;1.72	5.37	-1.72	0.08107	.	0.143577	0.64402	D	0.000004	T	0.13543	0.0328	.	.	.	0.38404	D	0.945757	B;B	0.09022	0.001;0.002	B;B	0.09377	0.002;0.004	T	0.11567	-1.0582	9	0.66056	D	0.02	.	0.3982	0.00421	0.2598:0.1405:0.3126:0.2871	.	19;19	P48061-3;P48061	.;SDF1_HUMAN	R	19	ENSP00000379141:S19R;ENSP00000363551:S19R;ENSP00000363548:S19R;ENSP00000339913:S19R;ENSP00000379140:S19R	ENSP00000339913:S19R	S	-	3	2	CXCL12	44200403	0.889000	0.30405	0.994000	0.49952	0.422000	0.31414	-0.253000	0.08794	-0.180000	0.10637	-0.181000	0.13052	AGC	.	.		0.766	CXCL12-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047738.2	NM_000609	
H2AFY2	55506	hgsc.bcm.edu	37	10	71835496	71835496	+	Missense_Mutation	SNP	C	C	G			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr10:71835496C>G	ENST00000373255.4	+	2	346	c.82C>G	c.(82-84)Ctg>Gtg	p.L28V		NM_018649.2	NP_061119.1	Q9P0M6	H2AW_HUMAN	H2A histone family, member Y2	28	Histone H2A.				brain development (GO:0007420)|chromatin modification (GO:0016568)|dosage compensation (GO:0007549)|establishment of protein localization to chromatin (GO:0071169)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901837)|nucleosome assembly (GO:0006334)	Barr body (GO:0001740)|extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|transcription regulatory region DNA binding (GO:0044212)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(4)|skin(1)	15						AGTGGGGAGGCTGATGCGTTA	0.547																																					p.L28V		Atlas-SNP	.											.	H2AFY2	30	.	0			c.C82G						.						184.0	147.0	159.0					10																	71835496		2203	4300	6503	SO:0001583	missense	55506	exon2			GGGAGGCTGATGC	AF336304	CCDS7296.1	10q22.1	2011-01-27			ENSG00000099284	ENSG00000099284		"""Histones / Replication-independent"""	14453	protein-coding gene	gene with protein product						11331621, 11262398	Standard	NM_018649		Approved	macroH2A2	uc001jqm.3	Q9P0M6	OTTHUMG00000018396	ENST00000373255.4:c.82C>G	chr10.hg19:g.71835496C>G	ENSP00000362352:p.Leu28Val	186.0	0.0		242.0	147.0	NM_018649	Q5SQT2	Missense_Mutation	SNP	ENST00000373255.4	hg19	CCDS7296.1	.	.	.	.	.	.	.	.	.	.	C	11.69	1.712714	0.30413	.	.	ENSG00000099284	ENST00000373255;ENST00000395046;ENST00000455786	T;T	0.64803	-0.12;-0.12	5.82	2.69	0.31865	Histone-fold (2);Histone core (1);Histone H2A (2);	0.046830	0.85682	D	0.000000	T	0.21962	0.0529	N	0.00525	-1.395	0.40353	D	0.979153	B	0.15473	0.013	B	0.18871	0.023	T	0.03423	-1.1038	10	0.12103	T	0.63	.	4.7294	0.12957	0.3537:0.4558:0.0:0.1905	.	28	Q9P0M6	H2AW_HUMAN	V	28	ENSP00000362352:L28V;ENSP00000404584:L28V	ENSP00000362352:L28V	L	+	1	2	H2AFY2	71505502	1.000000	0.71417	0.996000	0.52242	0.968000	0.65278	3.943000	0.56621	0.792000	0.33850	-0.258000	0.10820	CTG	.	.		0.547	H2AFY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048480.2	NM_018649	
MUC5B	727897	hgsc.bcm.edu	37	11	1282675	1282675	+	Missense_Mutation	SNP	G	G	A	rs372911529		TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr11:1282675G>A	ENST00000529681.1	+	49	17184	c.17126G>A	c.(17125-17127)cGg>cAg	p.R5709Q	MUC5B_ENST00000447027.1_Missense_Mutation_p.R5712Q	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	5709	CTCK. {ECO:0000255|PROSITE- ProRule:PRU00039}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CAGGAGAGGCGGGTCCACGAG	0.652													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18334	0.0		0.0	False		,,,				2504	0.0				p.R5709Q		Atlas-SNP	.											.	MUC5B	473	.	0			c.G17126A						.	G	GLN/ARG	1,4333		0,1,2166	26.0	38.0	34.0		17126	-2.0	0.0	11		34	0,8460		0,0,4230	no	missense	MUC5B	NM_002458.2	43	0,1,6396	AA,AG,GG		0.0,0.0231,0.0078	benign	5709/5763	1282675	1,12793	2167	4230	6397	SO:0001583	missense	727897	exon49			AGAGGCGGGTCCA	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.17126G>A	chr11.hg19:g.1282675G>A	ENSP00000436812:p.Arg5709Gln	34.0	0.0		35.0	16.0	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	hg19	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	G	5.261	0.233574	0.09969	2.31E-4	0.0	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000546052;ENST00000406844	T;T	0.16073	2.37;2.55	4.31	-2.02	0.07388	.	.	.	.	.	T	0.06917	0.0176	N	0.16708	0.43	0.09310	N	1	B;P	0.35011	0.319;0.48	B;B	0.17979	0.018;0.02	T	0.25187	-1.0139	9	0.87932	D	0	.	3.6219	0.08099	0.4318:0.0:0.2859:0.2823	.	6046;5712	A7Y9J9;E9PBJ0	.;.	Q	5709;5712;5653;608;5421	ENSP00000436812:R5709Q;ENSP00000415793:R5712Q	ENSP00000343037:R5653Q	R	+	2	0	MUC5B	1239251	0.000000	0.05858	0.000000	0.03702	0.046000	0.14306	-0.757000	0.04772	-0.303000	0.08856	-0.254000	0.11334	CGG	.	.		0.652	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
ST5	6764	hgsc.bcm.edu	37	11	8734241	8734241	+	Missense_Mutation	SNP	G	G	A			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr11:8734241G>A	ENST00000534127.1	-	12	2414	c.2029C>T	c.(2029-2031)Cgc>Tgc	p.R677C	ST5_ENST00000526099.1_Missense_Mutation_p.R190C|ST5_ENST00000530438.1_Missense_Mutation_p.R257C|ST5_ENST00000357665.1_Missense_Mutation_p.R677C|ST5_ENST00000313726.6_Missense_Mutation_p.R677C|ST5_ENST00000530991.1_Missense_Mutation_p.R149C|RPL27A_ENST00000531102.1_Intron|ST5_ENST00000526757.1_Missense_Mutation_p.R257C	NM_005418.3	NP_005409.3	P78524	ST5_HUMAN	suppression of tumorigenicity 5	677					positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(13)|liver(1)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	39				Epithelial(150;2.63e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0352)		CTGGGGGCGCGCTTCAGCATC	0.587																																					p.R677C		Atlas-SNP	.											.	ST5	85	.	0			c.C2029T						.						46.0	41.0	43.0					11																	8734241		2201	4296	6497	SO:0001583	missense	6764	exon12			GGGCGCGCTTCAG	U15131	CCDS7791.1, CCDS7792.1	11p15	2012-10-04				ENSG00000166444		"""DENN/MADD domain containing"""	11350	protein-coding gene	gene with protein product	"""DENN/MADD domain containing 2B"""	140750				1390339	Standard	NM_005418		Approved	HTS1, DENND2B, p126	uc001mgt.3	P78524		ENST00000534127.1:c.2029C>T	chr11.hg19:g.8734241G>A	ENSP00000433528:p.Arg677Cys	30.0	0.0		38.0	9.0	NM_005418	B2R6X7|B3KXQ6|P78523|Q16492|Q7KYY2|Q7KZ12|Q8NE12|Q9BQQ6	Missense_Mutation	SNP	ENST00000534127.1	hg19	CCDS7791.1	.	.	.	.	.	.	.	.	.	.	G	16.73	3.205042	0.58234	.	.	ENSG00000166444	ENST00000526757;ENST00000534127;ENST00000313726;ENST00000530991;ENST00000357665;ENST00000526099;ENST00000530438;ENST00000533020;ENST00000447053;ENST00000530593;ENST00000528527	T;T;T;T;T;T;T;T;T;T	0.39997	2.88;2.88;2.88;2.88;2.88;2.88;2.88;2.88;1.05;2.88	5.28	4.31	0.51392	.	0.000000	0.85682	D	0.000000	T	0.35941	0.0949	L	0.58810	1.83	0.80722	D	1	B;P;P	0.38148	0.028;0.539;0.62	B;B;B	0.28709	0.013;0.071;0.093	T	0.45804	-0.9236	10	0.87932	D	0	-8.1483	13.2376	0.59979	0.0:0.0:0.7611:0.2389	.	190;257;677	B4DDL8;P78524-2;P78524	.;.;ST5_HUMAN	C	257;677;677;149;677;190;257;149;287;134;149	ENSP00000435097:R257C;ENSP00000433528:R677C;ENSP00000319678:R677C;ENSP00000432887:R149C;ENSP00000350294:R677C;ENSP00000436808:R190C;ENSP00000436802:R257C;ENSP00000433588:R149C;ENSP00000437096:R134C;ENSP00000431580:R149C	ENSP00000319678:R677C	R	-	1	0	ST5	8690817	1.000000	0.71417	0.998000	0.56505	0.920000	0.55202	3.142000	0.50601	2.467000	0.83353	0.655000	0.94253	CGC	.	.		0.587	ST5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386518.1	NM_005418	
CORO1B	57175	hgsc.bcm.edu	37	11	67209971	67209971	+	Silent	SNP	G	G	C			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr11:67209971G>C	ENST00000341356.5	-	2	239	c.129C>G	c.(127-129)gtC>gtG	p.V43V	CORO1B_ENST00000539724.1_5'Flank|CORO1B_ENST00000453768.2_Silent_p.V43V|CORO1B_ENST00000545016.1_Silent_p.V43V|CORO1B_ENST00000393893.1_Silent_p.V43V	NM_020441.2	NP_065174.1	Q9BR76	COR1B_HUMAN	coronin, actin binding protein, 1B	43					actin cytoskeleton organization (GO:0030036)|actin filament branching (GO:0090135)|actin filament bundle assembly (GO:0051017)|cell migration (GO:0016477)|endothelial cell chemotaxis (GO:0035767)|negative regulation of Arp2/3 complex-mediated actin nucleation (GO:0034316)|positive regulation of lamellipodium morphogenesis (GO:2000394)|protein localization to cell leading edge (GO:1902463)|ruffle organization (GO:0031529)|wound healing (GO:0042060)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)|Arp2/3 complex binding (GO:0071933)|identical protein binding (GO:0042802)			cervix(1)|endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	13			BRCA - Breast invasive adenocarcinoma(15;3.26e-06)			ACTTGGGGTTGACGGCGCAGA	0.607																																					p.V43V		Atlas-SNP	.											.	CORO1B	30	.	0			c.C129G						.						98.0	75.0	83.0					11																	67209971		2199	4295	6494	SO:0001819	synonymous_variant	57175	exon2			GGGGTTGACGGCG	AK000860	CCDS8164.1	11q13.1	2013-01-10	2001-11-28		ENSG00000172725	ENSG00000172725		"""Coronins"", ""WD repeat domain containing"""	2253	protein-coding gene	gene with protein product		609849	"""coronin, actin-binding protein, 1B"""			9778037	Standard	NM_001018070		Approved	coronin-2	uc001olk.1	Q9BR76	OTTHUMG00000167775	ENST00000341356.5:c.129C>G	chr11.hg19:g.67209971G>C		98.0	0.0		82.0	33.0	NM_020441	B2RD45	Silent	SNP	ENST00000341356.5	hg19	CCDS8164.1																																																																																			.	.		0.607	CORO1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396220.1	NM_020441	
CHD4	1108	hgsc.bcm.edu	37	12	6701864	6701864	+	Missense_Mutation	SNP	G	G	C			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr12:6701864G>C	ENST00000357008.2	-	18	2935	c.2772C>G	c.(2770-2772)ttC>ttG	p.F924L	CHD4_ENST00000309577.6_Missense_Mutation_p.F924L|CHD4_ENST00000544040.1_Missense_Mutation_p.F917L|CHD4_ENST00000544484.1_Missense_Mutation_p.F921L	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	924					ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)			central_nervous_system(2)	2						ATACTTACTGGAACCTCTCGG	0.433																																					p.F924L	Colon(32;586 792 4568 16848 45314)	Atlas-SNP	.											.	CHD4	539	.	0			c.C2772G						.						117.0	116.0	116.0					12																	6701864		2203	4300	6503	SO:0001583	missense	1108	exon18			TTACTGGAACCTC	X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.2772C>G	chr12.hg19:g.6701864G>C	ENSP00000349508:p.Phe924Leu	91.0	0.0		103.0	48.0	NM_001273	Q8IXZ5	Missense_Mutation	SNP	ENST00000357008.2	hg19	CCDS8552.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.632359	0.87660	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464	D;D;D;D	0.92699	-3.09;-3.09;-3.09;-3.09	5.66	4.78	0.61160	DEAD-like helicase (1);SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.92916	0.7746	L	0.35542	1.07	0.80722	D	1	D;D;D	0.63046	0.992;0.973;0.974	D;D;D	0.75484	0.986;0.961;0.969	D	0.93303	0.6678	10	0.87932	D	0	-5.0299	11.6259	0.51145	0.1421:0.0:0.8579:0.0	.	924;924;917	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	L	921;917;924;924;898	ENSP00000440392:F921L;ENSP00000440542:F917L;ENSP00000312419:F924L;ENSP00000349508:F924L	ENSP00000312419:F924L	F	-	3	2	CHD4	6572125	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	4.944000	0.63561	1.396000	0.46663	0.557000	0.71058	TTC	.	.		0.433	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001273	
STAB2	55576	hgsc.bcm.edu	37	12	104056724	104056724	+	Missense_Mutation	SNP	T	T	C			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr12:104056724T>C	ENST00000388887.2	+	18	2174	c.1970T>C	c.(1969-1971)aTt>aCt	p.I657T		NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						CCTCCCTCCATTGTCCCGATT	0.453																																					p.I657T		Atlas-SNP	.											.	STAB2	370	.	0			c.T1970C						.						146.0	140.0	142.0					12																	104056724		2203	4300	6503	SO:0001583	missense	55576	exon18			CCTCCATTGTCCC	AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.1970T>C	chr12.hg19:g.104056724T>C	ENSP00000373539:p.Ile657Thr	128.0	0.0		218.0	137.0	NM_017564		Missense_Mutation	SNP	ENST00000388887.2	hg19	CCDS31888.1	.	.	.	.	.	.	.	.	.	.	T	15.96	2.987176	0.53934	.	.	ENSG00000136011	ENST00000388887	T	0.66280	-0.2	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.73961	0.3654	M	0.83603	2.65	0.48975	D	0.999732	D	0.63880	0.993	P	0.52109	0.69	T	0.78388	-0.2223	10	0.52906	T	0.07	.	14.9618	0.71161	0.0:0.0:0.0:1.0	.	657	Q8WWQ8	STAB2_HUMAN	T	657	ENSP00000373539:I657T	ENSP00000373539:I657T	I	+	2	0	STAB2	102580854	1.000000	0.71417	0.900000	0.35374	0.204000	0.24138	6.656000	0.74396	2.006000	0.58801	0.533000	0.62120	ATT	.	.		0.453	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1		
DDX54	79039	hgsc.bcm.edu	37	12	113600779	113600779	+	Missense_Mutation	SNP	T	T	C			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr12:113600779T>C	ENST00000306014.5	-	17	2180	c.2153A>G	c.(2152-2154)gAt>gGt	p.D718G	DDX54_ENST00000314045.7_Missense_Mutation_p.D718G|DDX54_ENST00000549271.1_5'Flank	NM_024072.3	NP_076977.3	Q8TDD1	DDX54_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 54	718					ATP catabolic process (GO:0006200)|intracellular estrogen receptor signaling pathway (GO:0030520)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|receptor binding (GO:0005102)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						CTGGGCTTCATCCCCCATCAA	0.627																																					p.D718G		Atlas-SNP	.											.	DDX54	73	.	0			c.A2153G						.						60.0	53.0	56.0					12																	113600779		2203	4300	6503	SO:0001583	missense	79039	exon17			GCTTCATCCCCCA	AF144056	CCDS31907.1, CCDS44984.1	12q24.11	2006-01-30				ENSG00000123064		"""DEAD-boxes"""	20084	protein-coding gene	gene with protein product		611665				12466272	Standard	NM_001111322		Approved	MGC2835, APR-5, DP97	uc001tuq.4	Q8TDD1	OTTHUMG00000169676	ENST00000306014.5:c.2153A>G	chr12.hg19:g.113600779T>C	ENSP00000304072:p.Asp718Gly	24.0	0.0		45.0	5.0	NM_024072	Q86YT8|Q9BRZ1	Missense_Mutation	SNP	ENST00000306014.5	hg19	CCDS31907.1	.	.	.	.	.	.	.	.	.	.	T	29.9	5.047035	0.93740	.	.	ENSG00000123064	ENST00000314045;ENST00000306014	T;T	0.32272	1.46;1.54	5.41	5.41	0.78517	DBP10CT (2);	0.046715	0.85682	D	0.000000	T	0.63295	0.2499	M	0.90483	3.12	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.72014	-0.4418	10	0.72032	D	0.01	.	15.1093	0.72343	0.0:0.0:0.0:1.0	.	718;718	Q8TDD1-2;Q8TDD1	.;DDX54_HUMAN	G	718	ENSP00000323858:D718G;ENSP00000304072:D718G	ENSP00000304072:D718G	D	-	2	0	DDX54	112085162	1.000000	0.71417	0.979000	0.43373	0.927000	0.56198	7.616000	0.83018	2.043000	0.60533	0.523000	0.50628	GAT	.	.		0.627	DDX54-002	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405435.1	NM_024072	
FERMT2	10979	hgsc.bcm.edu	37	14	53360119	53360119	+	Missense_Mutation	SNP	G	G	C			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr14:53360119G>C	ENST00000395631.2	-	4	634	c.418C>G	c.(418-420)Ctc>Gtc	p.L140V	FERMT2_ENST00000553373.1_Missense_Mutation_p.L140V|FERMT2_ENST00000341590.3_Missense_Mutation_p.L140V|FERMT2_ENST00000399304.3_Missense_Mutation_p.L140V|FERMT2_ENST00000343279.4_Missense_Mutation_p.L140V			Q96AC1	FERM2_HUMAN	fermitin family member 2	140					cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|focal adhesion assembly (GO:0048041)|integrin activation (GO:0033622)|integrin-mediated signaling pathway (GO:0007229)|protein localization to membrane (GO:0072657)|regulation of cell shape (GO:0008360)|substrate adhesion-dependent cell spreading (GO:0034446)|transforming growth factor beta receptor signaling pathway (GO:0007179)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|filamentous actin (GO:0031941)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|stress fiber (GO:0001725)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)		ERO1L/FERMT2(2)	NS(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	20	Breast(41;0.0342)					TTCTTTAAGAGAGAAAGTTCT	0.338																																					p.L140V		Atlas-SNP	.											.	FERMT2	59	.	0			c.C418G						.						72.0	78.0	76.0					14																	53360119		2203	4300	6503	SO:0001583	missense	10979	exon4			TTAAGAGAGAAAG	Z24725	CCDS9713.1, CCDS45107.1, CCDS45108.1	14q22.1	2013-01-10	2010-06-24	2007-12-14	ENSG00000073712	ENSG00000073712		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	15767	protein-coding gene	gene with protein product	"""kindlin-2"""	607746	"""pleckstrin homology domain containing, family C (with FERM domain) member 1"", ""fermitin family homolog 2 (Drosophila)"""	PLEKHC1		8175911, 12697302	Standard	NM_006832		Approved	mig-2, KIND2, UNC112B	uc001xac.3	Q96AC1	OTTHUMG00000140309	ENST00000395631.2:c.418C>G	chr14.hg19:g.53360119G>C	ENSP00000378993:p.Leu140Val	54.0	0.0		60.0	27.0	NM_001135000	B5TJY2|Q14840|Q86TY7	Missense_Mutation	SNP	ENST00000395631.2	hg19	CCDS9713.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.680462	0.88542	.	.	ENSG00000073712	ENST00000395631;ENST00000341590;ENST00000554152;ENST00000343279;ENST00000553373;ENST00000399304;ENST00000554288;ENST00000555692;ENST00000554712	D;D;D;D;D;D;T;T	0.89415	-2.51;-2.51;-2.51;-2.51;-2.51;-2.51;0.67;0.44	5.73	5.73	0.89815	FERM, N-terminal (1);Band 4.1 domain (1);	0.000000	0.85682	D	0.000000	D	0.91462	0.7305	L	0.49126	1.545	0.80722	D	1	P;P;P	0.41848	0.72;0.763;0.763	P;P;P	0.51453	0.54;0.507;0.67	D	0.91514	0.5229	10	0.72032	D	0.01	.	19.959	0.97233	0.0:0.0:1.0:0.0	.	140;140;140	Q96AC1-2;Q96AC1;B5TJY2	.;FERM2_HUMAN;.	V	140;140;82;140;140;140;35;96;140	ENSP00000378993:L140V;ENSP00000340391:L140V;ENSP00000450741:L82V;ENSP00000342858:L140V;ENSP00000451084:L140V;ENSP00000382243:L140V;ENSP00000451268:L35V;ENSP00000452472:L96V	ENSP00000340391:L140V	L	-	1	0	FERMT2	52429869	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.271000	0.78506	2.720000	0.93068	0.644000	0.83932	CTC	.	.		0.338	FERMT2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276907.2	NM_006832	
PCNXL4	64430	hgsc.bcm.edu	37	14	60590986	60590986	+	Silent	SNP	T	T	G			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr14:60590986T>G	ENST00000406854.1	+	9	2651	c.2097T>G	c.(2095-2097)gtT>gtG	p.V699V	PCNXL4_ENST00000404681.2_Silent_p.V699V|PCNXL4_ENST00000317623.4_Silent_p.V465V|PCNXL4_ENST00000535349.1_5'UTR|PCNXL4_ENST00000406949.1_Silent_p.V465V			Q63HM2	PCX4_HUMAN	pecanex-like 4 (Drosophila)	699						integral component of membrane (GO:0016021)											CTCGCAGAGTTGATGAAGTTT	0.353																																					p.V465V		Atlas-SNP	.											.	.	.	.	0			c.T1395G						.						50.0	48.0	48.0					14																	60590986		2203	4300	6503	SO:0001819	synonymous_variant	64430	exon8			CAGAGTTGATGAA	AK022861		14q23.1	2012-07-18	2012-07-18	2012-07-18	ENSG00000126773	ENSG00000126773			20349	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 135"""	C14orf135			Standard	NM_022495		Approved		uc001xer.4	Q63HM2	OTTHUMG00000150361	ENST00000406854.1:c.2097T>G	chr14.hg19:g.60590986T>G		89.0	0.0		116.0	37.0	NM_022495	A8MXM2|Q9BQG8|Q9H9F2	Silent	SNP	ENST00000406854.1	hg19		.	.	.	.	.	.	.	.	.	.	T	8.974	0.973726	0.18736	.	.	ENSG00000126773	ENST00000554534	.	.	.	5.71	4.58	0.56647	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.0216	0.30412	0.0:0.0737:0.1478:0.7785	.	.	.	.	G	118	.	.	X	+	1	0	C14orf135	59660739	0.930000	0.31532	1.000000	0.80357	0.997000	0.91878	-0.086000	0.11233	2.180000	0.69256	0.528000	0.53228	TGA	.	.		0.353	PCNXL4-005	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000317847.1	NM_022495	
PDE8A	5151	hgsc.bcm.edu	37	15	85656625	85656625	+	Missense_Mutation	SNP	C	C	G			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr15:85656625C>G	ENST00000310298.4	+	14	1384	c.1132C>G	c.(1132-1134)Cac>Gac	p.H378D	PDE8A_ENST00000557957.1_Missense_Mutation_p.H306D|PDE8A_ENST00000339708.5_Missense_Mutation_p.H332D|PDE8A_ENST00000557819.2_3'UTR|PDE8A_ENST00000394553.1_Missense_Mutation_p.H378D			O60658	PDE8A_HUMAN	phosphodiesterase 8A	378					cAMP catabolic process (GO:0006198)|cyclic nucleotide metabolic process (GO:0009187)|phosphorelay signal transduction system (GO:0000160)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	25	Colorectal(223;0.227)		BRCA - Breast invasive adenocarcinoma(143;0.0608)		Caffeine(DB00201)|Ketotifen(DB00920)	CCAGAGACGACACTCTTCCAT	0.532																																					p.H378D		Atlas-SNP	.											.	PDE8A	50	.	0			c.C1132G						.						166.0	138.0	148.0					15																	85656625		2203	4299	6502	SO:0001583	missense	5151	exon13			AGACGACACTCTT	AF056490	CCDS10336.1, CCDS10337.1, CCDS58397.1	15q25.3	2008-05-14			ENSG00000073417	ENSG00000073417	3.1.4.17	"""Phosphodiesterases"""	8793	protein-coding gene	gene with protein product		602972				9618252	Standard	NM_001243137		Approved	HsT19550	uc002blh.3	O60658	OTTHUMG00000148670	ENST00000310298.4:c.1132C>G	chr15.hg19:g.85656625C>G	ENSP00000311453:p.His378Asp	66.0	0.0		105.0	48.0	NM_002605	B3KXE6|H0YMZ7|Q6P9H3|Q969I1|Q96PC9|Q96PD0|Q96PD1|Q96T71|Q9UMB7|Q9UMC3	Missense_Mutation	SNP	ENST00000310298.4	hg19	CCDS10336.1	.	.	.	.	.	.	.	.	.	.	C	12.86	2.065415	0.36470	.	.	ENSG00000073417	ENST00000310298;ENST00000394553;ENST00000339708	T;T;T	0.69561	-0.41;-0.41;-0.41	4.92	4.92	0.64577	.	0.419670	0.25032	N	0.033662	T	0.74245	0.3691	M	0.68317	2.08	0.53688	D	0.999978	P;P	0.51351	0.823;0.944	P;P	0.52109	0.69;0.644	T	0.77357	-0.2618	10	0.62326	D	0.03	.	15.6911	0.77453	0.0:1.0:0.0:0.0	.	332;378	O60658-2;O60658	.;PDE8A_HUMAN	D	378;378;332	ENSP00000311453:H378D;ENSP00000378056:H378D;ENSP00000340679:H332D	ENSP00000311453:H378D	H	+	1	0	PDE8A	83457629	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	3.378000	0.52432	2.550000	0.86006	0.655000	0.94253	CAC	.	.		0.532	PDE8A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000309018.1	NM_002605	
AXIN1	8312	hgsc.bcm.edu	37	16	347849	347849	+	Nonsense_Mutation	SNP	C	C	A			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr16:347849C>A	ENST00000262320.3	-	6	2028	c.1657G>T	c.(1657-1659)Gag>Tag	p.E553*	AXIN1_ENST00000354866.3_Nonsense_Mutation_p.E553*|AXIN1_ENST00000481769.1_5'UTR	NM_003502.3	NP_003493.1	O15169	AXIN1_HUMAN	axin 1	553	Interaction with RNF111.				activation of JUN kinase activity (GO:0007257)|activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|axial mesoderm formation (GO:0048320)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060823)|cell death (GO:0008219)|cellular protein complex assembly (GO:0043623)|cellular response to organic cyclic compound (GO:0071407)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|dorsal/ventral axis specification (GO:0009950)|embryonic eye morphogenesis (GO:0048048)|embryonic skeletal joint morphogenesis (GO:0060272)|forebrain anterior/posterior pattern specification (GO:0021797)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein metabolic process (GO:0051248)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of Wnt signaling pathway (GO:0030178)|nucleocytoplasmic transport (GO:0006913)|olfactory placode formation (GO:0030910)|optic placode formation (GO:0001743)|positive regulation of GTPase activity (GO:0043547)|positive regulation of JNK cascade (GO:0046330)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|post-anal tail morphogenesis (GO:0036342)|protein catabolic process (GO:0030163)|protein homooligomerization (GO:0051260)|protein polyubiquitination (GO:0000209)|regulation of catenin import into nucleus (GO:0035412)|sensory perception of sound (GO:0007605)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)|Wnt-activated signaling pathway involved in forebrain neuron fate commitment (GO:0021881)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|ubiquitin protein ligase binding (GO:0031625)			biliary_tract(27)|breast(4)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(20)|liver(81)|lung(5)|ovary(2)|prostate(3)|salivary_gland(7)|skin(5)|stomach(4)|thyroid(41)|upper_aerodigestive_tract(4)|urinary_tract(2)	221		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				CGGGTGGCCTCGGCCTCCACC	0.706																																					p.E553X		Atlas-SNP	.											.	AXIN1	290	.	0			c.G1657T						.						41.0	38.0	39.0					16																	347849		2201	4298	6499	SO:0001587	stop_gained	8312	exon6			TGGCCTCGGCCTC	AF009674	CCDS10405.1, CCDS10406.1	16p13.3	2012-04-17			ENSG00000103126	ENSG00000103126		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	903	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 49"""	603816				9230313	Standard	NM_003502		Approved	PPP1R49	uc002cgp.2	O15169	OTTHUMG00000064930	ENST00000262320.3:c.1657G>T	chr16.hg19:g.347849C>A	ENSP00000262320:p.Glu553*	52.0	0.0		37.0	28.0	NM_181050	Q4TT26|Q4TT27|Q86YA7|Q8WVW6|Q96S28	Nonsense_Mutation	SNP	ENST00000262320.3	hg19	CCDS10405.1	.	.	.	.	.	.	.	.	.	.	C	35	5.528516	0.96446	.	.	ENSG00000103126	ENST00000262320;ENST00000354866	.	.	.	5.37	5.37	0.77165	.	0.123114	0.64402	D	0.000016	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-34.046	19.0878	0.93212	0.0:1.0:0.0:0.0	.	.	.	.	X	553	.	ENSP00000262320:E553X	E	-	1	0	AXIN1	287850	1.000000	0.71417	0.879000	0.34478	0.160000	0.22226	7.003000	0.76310	2.531000	0.85337	0.478000	0.44815	GAG	.	.		0.706	AXIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139441.3		
KRT33A	3883	hgsc.bcm.edu	37	17	39506783	39506783	+	Silent	SNP	C	C	A			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr17:39506783C>A	ENST00000007735.3	-	1	281	c.237G>T	c.(235-237)cgG>cgT	p.R79R		NM_004138.3	NP_004129.2	O76009	KT33A_HUMAN	keratin 33A	79	Coil 1A.|Rod.					extracellular space (GO:0005615)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	21		Breast(137;0.000496)				CCGCGTTGTCCCGCTCCAGCT	0.602																																					p.R79R		Atlas-SNP	.											.	KRT33A	53	.	0			c.G237T						.						94.0	88.0	90.0					17																	39506783		2203	4300	6503	SO:0001819	synonymous_variant	3883	exon1			GTTGTCCCGCTCC	Y16788	CCDS11388.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000006059	ENSG00000006059		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6450	protein-coding gene	gene with protein product	"""hard keratin type I 3I"""	602761	"""keratin, hair, acidic, 3A"""	KRTHA3A		7565656, 16831889	Standard	NM_004138		Approved	Ha-3I, Krt1-3	uc002hwk.2	O76009	OTTHUMG00000133432	ENST00000007735.3:c.237G>T	chr17.hg19:g.39506783C>A		126.0	0.0		119.0	44.0	NM_004138	B2RA87|Q6NTB9|Q6ZZB9	Silent	SNP	ENST00000007735.3	hg19	CCDS11388.1																																																																																			.	.		0.602	KRT33A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257295.1	NM_004138	
ADAM11	4185	hgsc.bcm.edu	37	17	42853002	42853002	+	Missense_Mutation	SNP	C	C	A			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr17:42853002C>A	ENST00000200557.6	+	17	1612	c.1443C>A	c.(1441-1443)caC>caA	p.H481Q	ADAM11_ENST00000535346.1_Missense_Mutation_p.H281Q	NM_002390.4	NP_002381.2	O75078	ADA11_HUMAN	ADAM metallopeptidase domain 11	481	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				integrin-mediated signaling pathway (GO:0007229)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(15)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33		Prostate(33;0.0959)				CCCTGACTCACGACGCCATGT	0.682																																					p.H481Q		Atlas-SNP	.											.	ADAM11	118	.	0			c.C1443A						.						10.0	9.0	10.0					17																	42853002		2185	4261	6446	SO:0001583	missense	4185	exon17			GACTCACGACGCC	D17390	CCDS11486.1	17q21.3	2014-08-12	2005-08-18		ENSG00000073670			"""ADAM metallopeptidase domain containing"""	189	protein-coding gene	gene with protein product	"""metalloproteinase-like, disintegrin-like, cysteine-rich protein"""	155120	"""a disintegrin and metalloproteinase domain 11"""	MDC		8252040	Standard	XM_005257373		Approved		uc002ihh.3	O75078	OTTHUMG00000179038	ENST00000200557.6:c.1443C>A	chr17.hg19:g.42853002C>A	ENSP00000200557:p.His481Gln	60.0	0.0		71.0	26.0	NM_002390	Q14808|Q14809|Q14810	Missense_Mutation	SNP	ENST00000200557.6	hg19	CCDS11486.1	.	.	.	.	.	.	.	.	.	.	C	4.406	0.075076	0.08485	.	.	ENSG00000073670	ENST00000200557;ENST00000535346;ENST00000355638	T;T	0.10382	2.88;2.88	4.42	1.38	0.22167	Blood coagulation inhibitor, Disintegrin (4);	0.000000	0.85682	D	0.000000	T	0.04724	0.0128	N	0.04275	-0.24	0.54753	D	0.999981	B;P	0.37781	0.051;0.608	B;B	0.41946	0.085;0.371	T	0.49799	-0.8901	10	0.12766	T	0.61	.	6.8839	0.24189	0.0:0.527:0.0:0.473	.	281;481	B4DKD2;O75078	.;ADA11_HUMAN	Q	481;281;381	ENSP00000200557:H481Q;ENSP00000443773:H281Q	ENSP00000200557:H481Q	H	+	3	2	ADAM11	40208528	0.010000	0.17322	0.999000	0.59377	0.940000	0.58332	-1.022000	0.03611	0.146000	0.19002	-0.272000	0.10252	CAC	.	.		0.682	ADAM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444531.1	NM_002390	
HOXB2	3212	hgsc.bcm.edu	37	17	46620730	46620730	+	Missense_Mutation	SNP	G	G	C			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr17:46620730G>C	ENST00000330070.4	-	2	1938	c.771C>G	c.(769-771)agC>agG	p.S257R	HOXB-AS1_ENST00000508688.1_RNA|HOXB-AS1_ENST00000504972.3_RNA|HOXB2_ENST00000504772.3_5'Flank|HOXB-AS1_ENST00000435312.1_RNA	NM_002145.3	NP_002136.1	P14652	HXB2_HUMAN	homeobox B2	257					anterior/posterior pattern specification (GO:0009952)|blood circulation (GO:0008015)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|facial nerve structural organization (GO:0021612)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|neural nucleus development (GO:0048857)|rhombomere 3 development (GO:0021569)|rhombomere 4 development (GO:0021570)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	11						GGGGGTCCGCGCTTAAGGCCC	0.786																																					p.S257R		Atlas-SNP	.											.	HOXB2	23	.	0			c.C771G						.						5.0	8.0	7.0					17																	46620730		1750	3505	5255	SO:0001583	missense	3212	exon2			GTCCGCGCTTAAG		CCDS11527.1	17q21.32	2012-02-22	2005-12-22		ENSG00000173917	ENSG00000173917		"""Homeoboxes / ANTP class : HOXL subclass"""	5113	protein-coding gene	gene with protein product		142967	"""homeo box B2"""	HOX2, HOX2H		1973146, 1358459	Standard	XM_005257276		Approved		uc002inm.3	P14652	OTTHUMG00000159930	ENST00000330070.4:c.771C>G	chr17.hg19:g.46620730G>C	ENSP00000331741:p.Ser257Arg	55.0	0.0		57.0	24.0	NM_002145	P10913|P17485	Missense_Mutation	SNP	ENST00000330070.4	hg19	CCDS11527.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	2.970|2.970	-0.212559|-0.212559	0.06140|0.06140	.|.	.|.	ENSG00000173917|ENSG00000173917	ENST00000326226|ENST00000330070	.|D	.|0.88818	.|-2.43	4.06|4.06	0.491|0.491	0.16867|0.16867	.|.	.|1.635550	.|0.03482	.|N	.|0.215219	T|T	0.76278|0.76278	0.3965|0.3965	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|B	.|0.06786	.|0.001	.|B	.|0.04013	.|0.001	T|T	0.64441|0.64441	-0.6407|-0.6407	6|10	0.20519|0.40728	T|T	0.43|0.16	.|.	2.6608|2.6608	0.05026|0.05026	0.1061:0.3428:0.3759:0.1752|0.1061:0.3428:0.3759:0.1752	.|.	.|257	.|P14652	.|HXB2_HUMAN	G|R	165|257	.|ENSP00000331741:S257R	ENSP00000316334:R165G|ENSP00000331741:S257R	R|S	-|-	1|3	0|2	HOXB2|HOXB2	43975729|43975729	0.000000|0.000000	0.05858|0.05858	0.022000|0.022000	0.16811|0.16811	0.030000|0.030000	0.12068|0.12068	0.022000|0.022000	0.13511|0.13511	0.432000|0.432000	0.26286|0.26286	0.556000|0.556000	0.70494|0.70494	CGC|AGC	.	.		0.786	HOXB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358384.2		
PRAC1	84366	hgsc.bcm.edu	37	17	46799700	46799700	+	Missense_Mutation	SNP	T	T	C			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr17:46799700T>C	ENST00000290294.3	-	1	184	c.55A>G	c.(55-57)Agt>Ggt	p.S19G	PRAC2_ENST00000432056.1_RNA|MIR3185_ENST00000583892.1_RNA|PRAC2_ENST00000422730.2_RNA	NM_032391.2	NP_115767.1	Q96KF2	PRAC1_HUMAN	prostate cancer susceptibility candidate 1	19						nucleus (GO:0005634)											AGAAAAGCACTCTTGGAGGTA	0.537																																					p.S19G		Atlas-SNP	.											.	PRAC	6	.	0			c.A55G						.						104.0	94.0	98.0					17																	46799700		2203	4300	6503	SO:0001583	missense	84366	exon1			AAGCACTCTTGGA	AF331165	CCDS11535.1	17q21	2013-08-29	2013-08-29	2013-08-29	ENSG00000159182	ENSG00000159182			30591	protein-coding gene	gene with protein product	"""prostate, rectum and colon"""	609819	"""chromosome 17 open reading frame 92"", ""prostate cancer susceptibility candidate"""	C17orf92, PRAC		11340635	Standard	NM_032391		Approved		uc002iny.3	Q96KF2	OTTHUMG00000159899	ENST00000290294.3:c.55A>G	chr17.hg19:g.46799700T>C	ENSP00000290294:p.Ser19Gly	82.0	0.0		96.0	37.0	NM_032391		Missense_Mutation	SNP	ENST00000290294.3	hg19	CCDS11535.1	.	.	.	.	.	.	.	.	.	.	T	10.39	1.337740	0.24253	.	.	ENSG00000159182	ENST00000290294	T	0.58358	0.34	3.78	0.227	0.15359	.	.	.	.	.	T	0.36193	0.0958	.	.	.	0.09310	N	1	B	0.17038	0.02	B	0.13407	0.009	T	0.32824	-0.9892	8	0.87932	D	0	.	3.2764	0.06899	0.0:0.2312:0.2115:0.5573	.	19	Q96KF2	PRAC_HUMAN	G	19	ENSP00000290294:S19G	ENSP00000290294:S19G	S	-	1	0	PRAC	44154699	0.143000	0.22626	0.001000	0.08648	0.394000	0.30568	0.626000	0.24492	-0.003000	0.14444	0.482000	0.46254	AGT	.	.		0.537	PRAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358086.1	NM_032391	
UNK	85451	hgsc.bcm.edu	37	17	73808617	73808617	+	Silent	SNP	G	G	A			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr17:73808617G>A	ENST00000589666.1	+	4	683	c.573G>A	c.(571-573)gcG>gcA	p.A191A	UNK_ENST00000293218.3_Silent_p.A267A	NM_001080419.2	NP_001073888.2	Q9C0B0	UNK_HUMAN	unkempt family zinc finger	191							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			cervix(3)|endometrium(8)|kidney(2)|large_intestine(5)|lung(3)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	25			all cancers(21;2.61e-06)|Epithelial(20;7.39e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|LUSC - Lung squamous cell carcinoma(166;0.154)			CTGGGGCTGCGAGCCATGCCA	0.607																																					p.A191A		Atlas-SNP	.											.	UNK	87	.	0			c.G573A						.						35.0	42.0	40.0					17																	73808617		2034	4190	6224	SO:0001819	synonymous_variant	85451	exon4			GGCTGCGAGCCAT	AB051540	CCDS45778.1, CCDS45778.2	17q25.3	2013-10-17	2013-10-17	2007-02-06		ENSG00000132478		"""Zinc fingers, CCCH-type domain containing"""	29369	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 5"", ""zinc finger CCCH-type containing 5"", ""unkempt homolog (Drosophila)"""	ZC3HDC5, ZC3H5		11214970	Standard	NM_001080419		Approved	KIAA1753	uc021udd.2	Q9C0B0		ENST00000589666.1:c.573G>A	chr17.hg19:g.73808617G>A		116.0	0.0		89.0	41.0	NM_001080419		Silent	SNP	ENST00000589666.1	hg19	CCDS45778.2																																																																																			.	.		0.607	UNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448835.1	NM_001080419	
RPTOR	57521	hgsc.bcm.edu	37	17	78931502	78931503	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr17:78931502_78931503GG>TT	ENST00000306801.3	+	29	3811_3812	c.3449_3450GG>TT	c.(3448-3450)tGG>tTT	p.W1150F	RPTOR_ENST00000575542.1_3'UTR|RPTOR_ENST00000544334.2_Missense_Mutation_p.W992F	NM_020761.2	NP_065812.1	Q8N122	RPTOR_HUMAN	regulatory associated protein of MTOR, complex 1	1150					cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nutrient levels (GO:0031669)|insulin receptor signaling pathway (GO:0008286)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|regulation of cell size (GO:0008361)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|TORC1 complex (GO:0031931)	14-3-3 protein binding (GO:0071889)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	44						GTCCGGATCTGGGACACAGACC	0.619																																					p.W1150L|p.W1150C		Atlas-SNP	.											RPTOR,colon,carcinoma,0,1|.	RPTOR	122	.	0			c.G3449T|c.G3450T						.																																			SO:0001583	missense	57521	exon29			GGATCTGGGACAC|GATCTGGGACACA		CCDS11773.1, CCDS54175.1	17q25.3	2013-01-10				ENSG00000141564		"""WD repeat domain containing"""	30287	protein-coding gene	gene with protein product	"""regulatory associated protein of mTOR"""	607130				10718198, 12150926	Standard	NM_001163034		Approved	KOG1, Mip1, KIAA1303, raptor	uc002jyt.1	Q8N122		Exception_encountered	chr17.hg19:g.78931502_78931503delinsTT	ENSP00000307272:p.Trp1150Phe	57.0|56.0	0.0		52.0|51.0	22.0|21.0	NM_020761	B2RN36|C6KEF2|F5H7J5|Q8N4V9|Q8TB32|Q9P2P3	Missense_Mutation	SNP	ENST00000306801.3	hg19	CCDS11773.1																																																																																			.	.		0.619	RPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438125.1	NM_020761	
VSTM2B	342865	hgsc.bcm.edu	37	19	30054822	30054822	+	Missense_Mutation	SNP	G	G	C			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr19:30054822G>C	ENST00000335523.7	+	5	924	c.839G>C	c.(838-840)cGc>cCc	p.R280P		NM_001146339.1	NP_001139811.1	A6NLU5	VTM2B_HUMAN	V-set and transmembrane domain containing 2B	280						integral component of membrane (GO:0016021)				breast(2)	2						AAGTTCCTGCGCCTGCTCTTG	0.587																																					p.R280P		Atlas-SNP	.											.	VSTM2B	15	.	0			c.G839C						.						165.0	135.0	144.0					19																	30054822		692	1591	2283	SO:0001583	missense	342865	exon5			TCCTGCGCCTGCT		CCDS46034.1	19q12	2013-01-11			ENSG00000187135	ENSG00000187135		"""Immunoglobulin superfamily / V-set domain containing"""	33595	protein-coding gene	gene with protein product							Standard	NM_001146339		Approved		uc010xrl.1	A6NLU5		ENST00000335523.7:c.839G>C	chr19.hg19:g.30054822G>C	ENSP00000335038:p.Arg280Pro	72.0	0.0		59.0	11.0	NM_001146339		Missense_Mutation	SNP	ENST00000335523.7	hg19	CCDS46034.1	.	.	.	.	.	.	.	.	.	.	G	1.542	-0.541431	0.04053	.	.	ENSG00000187135	ENST00000335523	T	0.08102	3.13	5.69	-4.04	0.04010	.	.	.	.	.	T	0.03695	0.0105	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.44112	-0.9349	9	0.30854	T	0.27	.	8.218	0.31524	0.606:0.1149:0.2791:0.0	.	280	A6NLU5	VTM2B_HUMAN	P	280	ENSP00000335038:R280P	ENSP00000335038:R280P	R	+	2	0	VSTM2B	34746662	0.996000	0.38824	0.000000	0.03702	0.001000	0.01503	0.876000	0.28092	-0.726000	0.04895	-2.698000	0.00137	CGC	.	.		0.587	VSTM2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458601.1	NM_001146339	
PSG6	5675	hgsc.bcm.edu	37	19	43420327	43420327	+	Missense_Mutation	SNP	C	C	T			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr19:43420327C>T	ENST00000292125.2	-	2	421	c.377G>A	c.(376-378)cGa>cAa	p.R126Q	PSG6_ENST00000187910.2_Missense_Mutation_p.R126Q|PSG6_ENST00000402603.4_Missense_Mutation_p.R126Q|PSG6_ENST00000601833.1_Missense_Mutation_p.R55Q	NM_002782.4	NP_002773.1	Q00889	PSG6_HUMAN	pregnancy specific beta-1-glycoprotein 6	126	Ig-like V-type.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)		p.R126Q(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(19)|ovary(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44		Prostate(69;0.00899)				CCCATCGCCTCGCTTTATGAT	0.498																																					p.R126Q		Atlas-SNP	.											PSG6,NS,carcinoma,0,1	PSG6	89	.	1	Substitution - Missense(1)	prostate(1)	c.G377A						.						301.0	266.0	278.0					19																	43420327		2201	4299	6500	SO:0001583	missense	5675	exon2			TCGCCTCGCTTTA		CCDS12613.1, CCDS33038.1	19q13.2	2013-01-29			ENSG00000170848	ENSG00000170848		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9523	protein-coding gene	gene with protein product		176395				1690992	Standard	NM_002782		Approved			Q00889	OTTHUMG00000151127	ENST00000292125.2:c.377G>A	chr19.hg19:g.43420327C>T	ENSP00000292125:p.Arg126Gln	70.0	0.0		91.0	8.0	NM_001031850	O75244|Q15224|Q15235|Q549K1	Missense_Mutation	SNP	ENST00000292125.2	hg19	CCDS12613.1	.	.	.	.	.	.	.	.	.	.	N	1.797	-0.478133	0.04414	.	.	ENSG00000170848	ENST00000187910;ENST00000402603;ENST00000292125;ENST00000402456	T;T;T	0.64803	-0.12;-0.12;-0.12	2.24	-4.48	0.03515	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.33089	0.0851	N	0.16037	0.36	0.09310	N	1	P;B;B	0.42584	0.784;0.132;0.128	B;B;B	0.37508	0.252;0.024;0.152	T	0.26018	-1.0115	9	0.22109	T	0.4	.	3.76	0.08601	0.1727:0.2354:0.0:0.5919	.	126;126;126	Q00889;Q00889-2;B5MCE1	PSG6_HUMAN;.;.	Q	126	ENSP00000187910:R126Q;ENSP00000385736:R126Q;ENSP00000292125:R126Q	ENSP00000187910:R126Q	R	-	2	0	PSG6	48112167	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-3.320000	0.00513	-1.530000	0.01751	-1.111000	0.02071	CGA	.	.		0.498	PSG6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321436.1	NM_002782	
ERCC2	2068	hgsc.bcm.edu	37	19	45867148	45867148	+	Missense_Mutation	SNP	C	C	G			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr19:45867148C>G	ENST00000391945.4	-	11	1048	c.971G>C	c.(970-972)cGc>cCc	p.R324P	ERCC2_ENST00000485403.2_Missense_Mutation_p.R300P|ERCC2_ENST00000391944.3_Missense_Mutation_p.R246P|ERCC2_ENST00000391940.4_Missense_Mutation_p.R300P|ERCC2_ENST00000221481.6_3'UTR	NM_000400.3	NP_000391.1	P18074	ERCC2_HUMAN	excision repair cross-complementation group 2	324					7-methylguanosine mRNA capping (GO:0006370)|aging (GO:0007568)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|central nervous system myelin formation (GO:0032289)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|embryonic cleavage (GO:0040016)|erythrocyte maturation (GO:0043249)|extracellular matrix organization (GO:0030198)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|hair follicle maturation (GO:0048820)|hematopoietic stem cell differentiation (GO:0060218)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|MMXD complex (GO:0071817)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|stomach(1)	9		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		CTCGGCCGTGCGGATGGAGCC	0.701			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																												p.R324P		Atlas-SNP	.	yes	Rec		Xeroderma pigmentosum (D)	19	19q13.2-q13.3	2068	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)"""		E	.	ERCC2	78	.	0			c.G971C						.						12.0	13.0	13.0					19																	45867148		2175	4249	6424	SO:0001583	missense	2068	exon11	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	GCCGTGCGGATGG		CCDS33049.1, CCDS46112.1	19q13.3	2014-09-17	2014-03-07		ENSG00000104884	ENSG00000104884	3.6.4.12	"""General transcription factor IIH complex subunits"""	3434	protein-coding gene	gene with protein product	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 protein"", ""TFIIH basal transcription factor complex helicase XPB subunit"""	126340	"""xeroderma pigmentosum complementary group D"", ""excision repair cross-complementing rodent repair deficiency, complementation group 2"""	XPD		8413672, 2184031	Standard	NM_000400		Approved	MAG, EM9, MGC102762, MGC126218, MGC126219, TFIIH	uc002pbj.2	P18074	OTTHUMG00000048190	ENST00000391945.4:c.971G>C	chr19.hg19:g.45867148C>G	ENSP00000375809:p.Arg324Pro	20.0	0.0		30.0	16.0	NM_000400	Q2TB78|Q2YDY2|Q7KZU6|Q8N721	Missense_Mutation	SNP	ENST00000391945.4	hg19	CCDS33049.1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.955504	0.92726	.	.	ENSG00000104884	ENST00000391941;ENST00000391942;ENST00000391945;ENST00000391944;ENST00000391940	D;D;D	0.84370	-1.84;-1.84;-1.84	5.62	5.62	0.85841	Domain of unknown function DUF1227 (1);	0.099070	0.64402	D	0.000001	D	0.94850	0.8336	H	0.95539	3.685	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	D	0.96014	0.9004	10	0.87932	D	0	-25.3123	17.1426	0.86758	0.0:1.0:0.0:0.0	.	246;300;324	E7EVE9;Q7KZU6;P18074	.;.;ERCC2_HUMAN	P	274;300;324;246;300	ENSP00000375809:R324P;ENSP00000375808:R246P;ENSP00000375804:R300P	ENSP00000375804:R300P	R	-	2	0	ERCC2	50558988	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	5.052000	0.64263	2.637000	0.89404	0.561000	0.74099	CGC	.	.		0.701	ERCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109626.2	NM_000400	
ARHGAP40	343578	hgsc.bcm.edu	37	20	37267403	37267403	+	Splice_Site	SNP	G	G	T			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr20:37267403G>T	ENST00000373345.4	+	8	1050		c.e8-1			NM_001164431.1	NP_001157903.1	Q5TG30	RHG40_HUMAN	Rho GTPase activating protein 40						regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)	1						CTTTCTGACAGCTGCTGTCCT	0.498																																					.		Atlas-SNP	.											.	ARHGAP40	50	.	0			c.1039-1G>T						.						101.0	93.0	96.0					20																	37267403		692	1591	2283	SO:0001630	splice_region_variant	343578	exon8			CTGACAGCTGCTG	AL035419		20q11.23	2011-06-29	2010-04-14	2010-04-14	ENSG00000124143	ENSG00000124143		"""Rho GTPase activating proteins"""	16226	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 95"""	C20orf95			Standard	NM_001164431		Approved	dJ1100H13.4	uc021wdn.1	Q5TG30	OTTHUMG00000032453	ENST00000373345.4:c.883-1G>T	chr20.hg19:g.37267403G>T		95.0	0.0		121.0	5.0	NM_001164431		Splice_Site	SNP	ENST00000373345.4	hg19		.	.	.	.	.	.	.	.	.	.	G	19.98	3.926400	0.73327	.	.	ENSG00000124143	ENST00000373345;ENST00000243967	.	.	.	4.71	4.71	0.59529	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1538	0.72723	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ARHGAP40	36700817	1.000000	0.71417	0.995000	0.50966	0.877000	0.50540	8.454000	0.90352	2.157000	0.67596	0.563000	0.77884	.	.	.		0.498	ARHGAP40-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		XM_293123	Intron
TBC1D10A	83874	hgsc.bcm.edu	37	22	30722679	30722679	+	Silent	SNP	C	C	A	rs375400780		TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr22:30722679C>A	ENST00000215790.7	-	1	356	c.192G>T	c.(190-192)tcG>tcT	p.S64S	TBC1D10A_ENST00000403477.3_Silent_p.S64S|TBC1D10A_ENST00000490449.1_5'UTR	NM_031937.2	NP_114143.1	Q9BXI6	TB10A_HUMAN	TBC1 domain family, member 10A	64					activation of cysteine-type endopeptidase activity (GO:0097202)|positive regulation of proteolysis (GO:0045862)|retrograde transport, endosome to Golgi (GO:0042147)	extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rab GTPase activator activity (GO:0005097)			cervix(2)|endometrium(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	23						CGGCGCCCTGCGAGCCCACGA	0.716																																					p.S64S		Atlas-SNP	.											.	TBC1D10A	49	.	0			c.G192T						.	C	,	2,4384		0,2,2191	17.0	22.0	20.0		192,192	-5.0	0.9	22		20	0,8550		0,0,4275	no	coding-synonymous,coding-synonymous	TBC1D10A	NM_001204240.1,NM_031937.2	,	0,2,6466	AA,AC,CC		0.0,0.0456,0.0155	,	64/516,64/509	30722679	2,12934	2193	4275	6468	SO:0001819	synonymous_variant	83874	exon1			GCCCTGCGAGCCC	AF331038	CCDS13874.1, CCDS56227.1	22q12.2	2013-07-09	2005-03-10	2005-03-10	ENSG00000099992	ENSG00000099992			23609	protein-coding gene	gene with protein product	"""EBP50-PDZ interactor of 64 kD"""	610020	"""TBC1 domain family, member 10"""	TBC1D10		11285285, 20404108	Standard	NM_001204240		Approved	EPI64, AC004997.C22.2	uc010gvu.3	Q9BXI6	OTTHUMG00000150924	ENST00000215790.7:c.192G>T	chr22.hg19:g.30722679C>A		119.0	0.0		108.0	54.0	NM_031937	B3KXT8|O76053|Q20WK7|Q543A2	Silent	SNP	ENST00000215790.7	hg19	CCDS13874.1																																																																																			.	.		0.716	TBC1D10A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000320550.1	NM_031937	
RBM10	8241	hgsc.bcm.edu	37	X	47030582	47030582	+	Missense_Mutation	SNP	G	G	T			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chrX:47030582G>T	ENST00000377604.3	+	4	1099	c.357G>T	c.(355-357)gaG>gaT	p.E119D	RBM10_ENST00000345781.6_Intron|RBM10_ENST00000329236.7_Intron	NM_001204467.1|NM_001204468.1|NM_005676.4	NP_001191396.1|NP_001191397.1|NP_005667.2	P98175	RBM10_HUMAN	RNA binding motif protein 10	119	Poly-Glu.				3'-UTR-mediated mRNA stabilization (GO:0070935)|mRNA processing (GO:0006397)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	48						aggaggaggaggatgaggagg	0.662																																					p.E184D	Melanoma(171;120 2705 19495 39241)	Atlas-SNP	.											.	RBM10	117	.	0			c.G552T						.						20.0	19.0	19.0					X																	47030582		2202	4294	6496	SO:0001583	missense	8241	exon4			GGAGGAGGATGAG	U35373	CCDS14274.1, CCDS56600.1, CCDS75969.1	Xp11.3	2014-06-09			ENSG00000182872	ENSG00000182872		"""Zinc fingers, RAN-binding domain containing"", ""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9896	protein-coding gene	gene with protein product		300080				8590280, 8808293	Standard	NM_005676		Approved	DXS8237E, KIAA0122, GPATC9, ZRANB5, GPATCH9	uc004dhi.3	P98175	OTTHUMG00000021432	ENST00000377604.3:c.357G>T	chrX.hg19:g.47030582G>T	ENSP00000366829:p.Glu119Asp	99.0	0.0		110.0	5.0	NM_001204468	C4AM81|Q14136|Q5JRR2|Q9BTE4|Q9BTX0|Q9NTB1	Missense_Mutation	SNP	ENST00000377604.3	hg19	CCDS14274.1	.	.	.	.	.	.	.	.	.	.	G	7.514	0.655267	0.14580	.	.	ENSG00000182872	ENST00000377604	T	0.11169	2.8	3.1	1.15	0.20763	Nucleotide-binding, alpha-beta plait (1);	0.859005	0.09469	N	0.797951	T	0.04815	0.0130	N	0.08118	0	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.38628	-0.9652	10	0.11182	T	0.66	-1.7872	6.9396	0.24486	0.0:0.0:0.4873:0.5127	.	184;119;119	Q7Z3D7;P98175-2;P98175	.;.;RBM10_HUMAN	D	119	ENSP00000366829:E119D	ENSP00000366829:E119D	E	+	3	2	RBM10	46915526	1.000000	0.71417	0.776000	0.31678	0.914000	0.54420	0.961000	0.29267	0.165000	0.19558	0.502000	0.49764	GAG	.	.		0.662	RBM10-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056381.1	NM_005676	
SUV39H1	6839	hgsc.bcm.edu	37	X	48558697	48558697	+	Silent	SNP	G	G	C			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chrX:48558697G>C	ENST00000376687.3	+	3	571	c.381G>C	c.(379-381)gcG>gcC	p.A127A	AF196970.3_ENST00000416061.1_RNA|SUV39H1_ENST00000453214.2_Intron|SUV39H1_ENST00000337852.6_Silent_p.A138A	NM_003173.2	NP_003164.1	O43463	SUV91_HUMAN	suppressor of variegation 3-9 homolog 1 (Drosophila)	127					cell cycle (GO:0007049)|cell differentiation (GO:0030154)|chromatin organization (GO:0006325)|chromatin silencing at rDNA (GO:0000183)|histone H3-K9 dimethylation (GO:0036123)|histone H3-K9 trimethylation (GO:0036124)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription, DNA-templated (GO:0045892)|rhythmic process (GO:0048511)|rRNA processing (GO:0006364)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin silencing complex (GO:0005677)|chromosome, centromeric region (GO:0000775)|condensed nuclear chromosome (GO:0000794)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|rDNA heterochromatin (GO:0033553)	chromatin binding (GO:0003682)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|protein N-terminus binding (GO:0047485)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	14						AGAGGCGGGCGCTCCGTCGCT	0.662																																					p.A127A		Atlas-SNP	.											.	SUV39H1	36	.	0			c.G381C						.						25.0	22.0	23.0					X																	48558697		2201	4299	6500	SO:0001819	synonymous_variant	6839	exon3			GCGGGCGCTCCGT	AF019968	CCDS14304.1, CCDS65252.1	Xp11.23	2011-07-01	2001-11-28		ENSG00000101945	ENSG00000101945		"""Chromatin-modifying enzymes / K-methyltransferases"""	11479	protein-coding gene	gene with protein product		300254	"""suppressor of variegation 3-9 (Drosophila) homolog 1"""	SUV39H		10202156	Standard	NM_001282166		Approved	KMT1A	uc004dkn.3	O43463	OTTHUMG00000022701	ENST00000376687.3:c.381G>C	chrX.hg19:g.48558697G>C		179.0	0.0		188.0	78.0	NM_003173	B2R6E8|B4DST0|Q53G60|Q6FHK6	Silent	SNP	ENST00000376687.3	hg19	CCDS14304.1	.	.	.	.	.	.	.	.	.	.	G	2.233	-0.375765	0.05034	.	.	ENSG00000101945	ENST00000448548	.	.	.	4.82	-9.65	0.00537	.	0.191102	0.44902	D	0.000408	T	0.44265	0.1285	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57562	-0.7790	6	0.30854	T	0.27	.	5.8447	0.18659	0.6066:0.2217:0.0944:0.0773	.	.	.	.	P	127	.	ENSP00000410043:A127P	A	+	1	0	SUV39H1	48443641	0.000000	0.05858	0.073000	0.20177	0.568000	0.35870	-2.881000	0.00715	-2.425000	0.00561	-1.189000	0.01698	GCT	.	.		0.662	SUV39H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058909.1	NM_003173	
VSIG4	11326	hgsc.bcm.edu	37	X	65242305	65242305	+	Missense_Mutation	SNP	T	T	A			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chrX:65242305T>A	ENST00000374737.4	-	8	1108	c.1000A>T	c.(1000-1002)Atg>Ttg	p.M334L	VSIG4_ENST00000455586.2_3'UTR|VSIG4_ENST00000412866.2_Missense_Mutation_p.M240L	NM_001257403.1|NM_007268.2	NP_001244332.1|NP_009199.1	Q9Y279	VSIG4_HUMAN	V-set and immunoglobulin domain containing 4	334					complement activation, alternative pathway (GO:0006957)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of T cell proliferation (GO:0042130)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GCCACCCTCATGGTTTCTCCA	0.567																																					p.M334L		Atlas-SNP	.											.	VSIG4	54	.	0			c.A1000T						.						59.0	42.0	47.0					X																	65242305		2203	4300	6503	SO:0001583	missense	11326	exon8			CCCTCATGGTTTC	AJ132502	CCDS14383.1, CCDS48132.1, CCDS55435.1	Xq12-q13.3	2013-01-29			ENSG00000155659	ENSG00000155659		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17032	protein-coding gene	gene with protein product		300353				10899594, 11004523, 17016555, 17016562	Standard	NM_007268		Approved	Z39IG	uc004dwh.2	Q9Y279	OTTHUMG00000021727	ENST00000374737.4:c.1000A>T	chrX.hg19:g.65242305T>A	ENSP00000363869:p.Met334Leu	100.0	0.0		112.0	28.0	NM_007268	Q6UXI4	Missense_Mutation	SNP	ENST00000374737.4	hg19	CCDS14383.1	.	.	.	.	.	.	.	.	.	.	T	0.593	-0.832346	0.02713	.	.	ENSG00000155659	ENST00000374737;ENST00000412866	T;T	0.25414	1.8;2.27	4.51	-1.35	0.09114	.	0.845481	0.10185	N	0.705309	T	0.20007	0.0481	L	0.51422	1.61	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.30909	-0.9962	10	0.56958	D	0.05	-1.622	4.7901	0.13245	0.5245:0.0:0.1633:0.3121	.	240;334	Q9Y279-3;Q9Y279	.;VSIG4_HUMAN	L	334;240	ENSP00000363869:M334L;ENSP00000394143:M240L	ENSP00000363869:M334L	M	-	1	0	VSIG4	65159030	0.010000	0.17322	0.004000	0.12327	0.023000	0.10783	0.202000	0.17295	-0.099000	0.12263	-0.567000	0.04161	ATG	.	.		0.567	VSIG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056986.1	NM_007268	
MT-CO1	4512	hgsc.bcm.edu	37	M	7236	7236	+	Missense_Mutation	SNP	G	G	A			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chrM:7236G>A	ENST00000361624.2	+	1	1333	c.1333G>A	c.(1333-1335)Gat>Aat	p.D445N	MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-ND3_ENST00000361227.2_5'Flank|MT-TQ_ENST00000387372.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-CO3_ENST00000362079.2_5'Flank|MT-TM_ENST00000387377.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	445					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						CGGACTACCCCGATGCATACA	0.408																																					p.D445N		Atlas-SNP	.											.	.	.	.	0			c.G1333A						.																																			SO:0001583	missense	5742	exon1			TACCCCGATGCAT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.1333G>A	chrM.hg19:g.7236G>A	ENSP00000354499:p.Asp445Asn	11.0	0.0		53.0	11.0	ENST00000361624	Q34770	Missense_Mutation	SNP	ENST00000361624.2	hg19																																																																																				.	.		0.408	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024028	
MT-ND4	4538	hgsc.bcm.edu	37	M	11453	11453	+	Missense_Mutation	SNP	G	G	A			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chrM:11453G>A	ENST00000361381.2	+	1	694	c.694G>A	c.(694-696)Gcc>Acc	p.A232T	MT-TL2_ENST00000387456.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TS2_ENST00000387449.1_RNA			P03905	NU4M_HUMAN	mitochondrially encoded NADH dehydrogenase 4	232					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|prostate(1)	13						CAATAGTACTTGCCGCAGTAC	0.453																																					p.A232T		Atlas-SNP	.											.	.	.	.	0			c.G694A						.																																			SO:0001583	missense	0	exon1			GTACTTGCCGCAG			mitochondria	2014-02-03	2005-02-15	2005-02-16	ENSG00000198886	ENSG00000198886	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7459	protein-coding gene	gene with protein product	"""complex I ND4 subunit"", ""NADH-ubiquinone oxidoreductase chain 4"""	516003	"""NADH dehydrogenase 4"", ""Leber optic neuropathy"""	MTND4, LHON		8103501	Standard			Approved	ND4, NAD4		P03905		ENST00000361381.2:c.694G>A	chrM.hg19:g.11453G>A	ENSP00000354961:p.Ala232Thr	14.0	0.0		60.0	57.0	ENST00000361381	Q6RL39|Q6RQN9|Q8HNR8	Missense_Mutation	SNP	ENST00000361381.2	hg19																																																																																				.	.		0.453	MT-ND4-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024035	
HADHA	3030	hgsc.bcm.edu	37	2	26416510	26416510	+	Frame_Shift_Del	DEL	A	A	-			TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr2:26416510delA	ENST00000380649.3	-	17	1950	c.1821delT	c.(1819-1821)tttfs	p.F607fs		NM_000182.4	NP_000173.2	P40939	ECHA_HUMAN	hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit	607					cardiolipin acyl-chain remodeling (GO:0035965)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|response to drug (GO:0042493)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	mitochondrial fatty acid beta-oxidation multienzyme complex (GO:0016507)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|acetyl-CoA C-acetyltransferase activity (GO:0003985)|enoyl-CoA hydratase activity (GO:0004300)|fatty-acyl-CoA binding (GO:0000062)|long-chain-3-hydroxyacyl-CoA dehydrogenase activity (GO:0016509)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|NAD binding (GO:0051287)			autonomic_ganglia(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(4)|skin(1)	30	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ACCGCTCCCCAAAGACTTTGC	0.522																																					p.G608fs		Atlas-INDEL	.											.	HADHA	87	.	0			c.1822delG						.						167.0	160.0	163.0					2																	26416510		2203	4300	6503	SO:0001589	frameshift_variant	3030	exon17			.	D16480	CCDS1721.1	2p23	2014-09-17	2010-04-30		ENSG00000084754	ENSG00000084754	1.1.1.211, 4.2.1.17		4801	protein-coding gene	gene with protein product	"""gastrin-binding protein"", ""long-chain-3-hydroxyacyl-CoA dehydrogenase"", ""long-chain 2-enoyl-CoA hydratase"", ""mitochondrial trifunctional protein, alpha subunit"""	600890	"""hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), alpha subunit"""			9605857, 7918661	Standard	NM_000182		Approved	GBP, LCEH, LCHAD, MTPA	uc002rgy.3	P40939	OTTHUMG00000096979	ENST00000380649.3:c.1821delT	chr2.hg19:g.26416510delA	ENSP00000370023:p.Phe607fs	154.0	0.0		136.0	46.0	NM_000182	B2R7L4|B4DYP2|Q16679|Q53T69|Q53TA2|Q96GT7|Q9UQC5	Frame_Shift_Del	DEL	ENST00000380649.3	hg19	CCDS1721.1																																																																																			.	.		0.522	HADHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214051.1	NM_000182	
COL18A1	80781	hgsc.bcm.edu	37	21	46875754	46875756	+	In_Frame_Del	DEL	GAG	GAG	-	rs377623821	byFrequency	TCGA-XR-A8TC-01A-11D-A35Z-10	TCGA-XR-A8TC-10A-01D-A35Z-10	GAG	GAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f6f8eb64-43ca-4cbb-996d-6a32332040cb	7fbbfbff-4266-4236-98a1-03b439b86b0a	g.chr21:46875754_46875756delGAG	ENST00000359759.4	+	1	331_333	c.310_312delGAG	c.(310-312)gagdel	p.E105del	COL18A1_ENST00000400337.2_Intron|COL18A1_ENST00000355480.5_In_Frame_Del_p.E105del			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	105					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		GGACGCGCCAGAGGAGAACATTG	0.64																																					p.103_104del		Atlas-INDEL	.											.	COL18A1	129	.	0			c.309_311del						.																																			SO:0001651	inframe_deletion	80781	exon1			.		CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.310_312delGAG	chr21.hg19:g.46875757_46875759delGAG	ENSP00000352798:p.Glu105del	108.0	0.0		104.0	39.0	NM_030582	A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	In_Frame_Del	DEL	ENST00000359759.4	hg19																																																																																				.	.		0.640	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206827.1		
