#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
AJAP1	55966	hgsc.bcm.edu	37	1	4829928	4829928	+	Missense_Mutation	SNP	A	A	G			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr1:4829928A>G	ENST00000378191.4	+	3	1226	c.845A>G	c.(844-846)cAg>cGg	p.Q282R	AJAP1_ENST00000378190.3_Missense_Mutation_p.Q282R	NM_018836.3	NP_061324.1	Q9UKB5	AJAP1_HUMAN	adherens junctions associated protein 1	282					cell adhesion (GO:0007155)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|urinary_tract(1)	24	all_cancers(77;0.071)|Ovarian(185;0.0721)	all_cancers(23;1.77e-36)|all_epithelial(116;1.26e-21)|all_lung(118;3.51e-08)|Lung NSC(185;3.47e-06)|all_neural(13;8.84e-06)|all_hematologic(16;7.61e-05)|Breast(487;0.000507)|Renal(390;0.0007)|Colorectal(325;0.00117)|Hepatocellular(190;0.0071)|Glioma(11;0.0155)|Myeloproliferative disorder(586;0.0258)|Ovarian(437;0.0409)|Lung SC(97;0.133)|Medulloblastoma(700;0.215)		Epithelial(90;3.89e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.97e-19)|GBM - Glioblastoma multiforme(42;3.71e-19)|Colorectal(212;4.57e-06)|COAD - Colon adenocarcinoma(227;0.00019)|Kidney(185;0.000969)|BRCA - Breast invasive adenocarcinoma(365;0.00122)|STAD - Stomach adenocarcinoma(132;0.00578)|KIRC - Kidney renal clear cell carcinoma(229;0.0126)|READ - Rectum adenocarcinoma(331;0.0689)		GCTGTCCATCAGATCATCACC	0.552																																					p.Q282R		Atlas-SNP	.											.	AJAP1	68	.	0			c.A845G						.						216.0	196.0	203.0					1																	4829928		2203	4300	6503	SO:0001583	missense	55966	exon3			TCCATCAGATCAT	AF175409	CCDS54.1	1p36.32	2008-02-05	2008-01-08		ENSG00000196581	ENSG00000196581			30801	protein-coding gene	gene with protein product	"""transmembrane protein SHREW1"""	610972				14595118	Standard	NM_001042478		Approved	SHREW1, SHREW-1, MOT8	uc001aln.3	Q9UKB5	OTTHUMG00000000645	ENST00000378191.4:c.845A>G	chr1.hg19:g.4829928A>G	ENSP00000367433:p.Gln282Arg	62.0	0.0		75.0	16.0	NM_018836	Q9Y229	Missense_Mutation	SNP	ENST00000378191.4	hg19	CCDS54.1	.	.	.	.	.	.	.	.	.	.	A	17.15	3.315334	0.60524	.	.	ENSG00000196581	ENST00000378190;ENST00000378191	T;T	0.50548	0.74;0.74	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.58264	0.2110	L	0.32530	0.975	0.54753	D	0.999984	D	0.71674	0.998	D	0.80764	0.994	T	0.61257	-0.7099	10	0.62326	D	0.03	-28.3985	14.7407	0.69451	1.0:0.0:0.0:0.0	.	282	Q9UKB5	AJAP1_HUMAN	R	282	ENSP00000367432:Q282R;ENSP00000367433:Q282R	ENSP00000367432:Q282R	Q	+	2	0	AJAP1	4729788	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.613000	0.90913	2.081000	0.62600	0.383000	0.25322	CAG	.	.		0.552	AJAP1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001542.3	NM_018836	
OR10R2	343406	hgsc.bcm.edu	37	1	158449910	158449910	+	Missense_Mutation	SNP	C	C	A			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr1:158449910C>A	ENST00000368152.1	+	1	243	c.243C>A	c.(241-243)ttC>ttA	p.F81L	RP11-144L1.4_ENST00000426251.1_RNA|RP11-144L1.4_ENST00000419738.1_RNA	NM_001004472.1	NP_001004472.1	Q8NGX6	O10R2_HUMAN	olfactory receptor, family 10, subfamily R, member 2	81						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F81F(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(26)|pancreas(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	41	all_hematologic(112;0.0378)					CAATGTACTTCTTCCTTGGCA	0.413																																					p.F81L		Atlas-SNP	.											OR10R2,NS,carcinoma,0,1	OR10R2	81	.	1	Substitution - coding silent(1)	lung(1)	c.C243A						.						272.0	232.0	246.0					1																	158449910		2203	4300	6503	SO:0001583	missense	343406	exon1			GTACTTCTTCCTT	AB065640	CCDS30898.1	1q23.1	2012-08-09			ENSG00000198965	ENSG00000198965		"""GPCR / Class A : Olfactory receptors"""	14820	protein-coding gene	gene with protein product							Standard	NM_001004472		Approved	OR10R2Q	uc010pik.2	Q8NGX6	OTTHUMG00000019632	ENST00000368152.1:c.243C>A	chr1.hg19:g.158449910C>A	ENSP00000357134:p.Phe81Leu	119.0	0.0		125.0	39.0	NM_001004472	Q5VWM8|Q6IFS1|Q96R61	Missense_Mutation	SNP	ENST00000368152.1	hg19	CCDS30898.1	.	.	.	.	.	.	.	.	.	.	c	13.86	2.362679	0.41902	.	.	ENSG00000198965	ENST00000368152	T	0.00269	8.37	4.28	2.41	0.29592	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00039	0.0001	L	0.43923	1.385	0.25427	N	0.988216	P	0.37548	0.599	B	0.35607	0.206	T	0.00406	-1.1759	9	0.52906	T	0.07	.	3.1243	0.06402	0.1901:0.5082:0.0:0.3018	.	81	Q8NGX6	O10R2_HUMAN	L	81	ENSP00000357134:F81L	ENSP00000357134:F81L	F	+	3	2	OR10R2	156716534	0.000000	0.05858	0.991000	0.47740	0.799000	0.45148	-0.984000	0.03755	0.429000	0.26202	0.655000	0.94253	TTC	.	.		0.413	OR10R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051847.2	NM_001004472	
RGS13	6003	hgsc.bcm.edu	37	1	192613528	192613528	+	Splice_Site	SNP	A	A	G			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr1:192613528A>G	ENST00000391995.2	+	4	352	c.64A>G	c.(64-66)Aac>Gac	p.N22D	RGS13_ENST00000543215.1_Splice_Site_p.N22D	NM_002927.4	NP_002918.1	O14921	RGS13_HUMAN	regulator of G-protein signaling 13	22					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			endometrium(1)|kidney(1)|large_intestine(4)|lung(12)|skin(1)	19						GCCCCCTTCAAAGTAAGTAGC	0.294																																					p.N22D		Atlas-SNP	.											.	RGS13	31	.	0			c.A64G						.						113.0	126.0	121.0					1																	192613528		2203	4299	6502	SO:0001630	splice_region_variant	6003	exon4			CCTTCAAAGTAAG	AF030107	CCDS1376.1	1q31.2	2008-02-05	2007-08-14		ENSG00000127074	ENSG00000127074		"""Regulators of G-protein signaling"""	9995	protein-coding gene	gene with protein product		607190	"""regulator of G-protein signalling 13"""			11875076	Standard	NM_144766		Approved		uc001gsk.3	O14921	OTTHUMG00000035601	ENST00000391995.2:c.65+1A>G	chr1.hg19:g.192613528A>G		564.0	0.0		747.0	260.0	NM_002927	Q6PGR2|Q8TD63|Q9BX45	Missense_Mutation	SNP	ENST00000391995.2	hg19	CCDS1376.1	.	.	.	.	.	.	.	.	.	.	A	12.58	1.980030	0.34942	.	.	ENSG00000127074	ENST00000391995;ENST00000543215	T;T	0.28069	1.63;1.63	5.62	5.62	0.85841	.	0.584107	0.17614	N	0.167974	T	0.20210	0.0486	N	0.14661	0.345	0.30090	N	0.808437	B	0.06786	0.001	B	0.09377	0.004	T	0.08411	-1.0723	10	0.45353	T	0.12	.	12.4878	0.55883	1.0:0.0:0.0:0.0	.	22	O14921	RGS13_HUMAN	D	22	ENSP00000375853:N22D;ENSP00000442837:N22D	ENSP00000375853:N22D	N	+	1	0	RGS13	190880151	1.000000	0.71417	1.000000	0.80357	0.810000	0.45777	1.707000	0.37888	2.255000	0.74692	0.533000	0.62120	AAC	.	.		0.294	RGS13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086400.1	NM_002927	Missense_Mutation
SPATA17	128153	hgsc.bcm.edu	37	1	217856682	217856682	+	Missense_Mutation	SNP	C	C	T			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr1:217856682C>T	ENST00000366933.4	+	5	429	c.374C>T	c.(373-375)tCa>tTa	p.S125L		NM_138796.2	NP_620151.1	Q96L03	SPT17_HUMAN	spermatogenesis associated 17	125						cytoplasm (GO:0005737)		p.S125*(1)		endometrium(1)|kidney(1)|large_intestine(9)|lung(6)|pancreas(2)|prostate(1)|urinary_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(81;0.0516)|all cancers(67;0.0891)|GBM - Glioblastoma multiforme(131;0.117)		AAAGTCGTTTCAGAGACCAAT	0.353																																					p.S125L		Atlas-SNP	.											SPATA17,NS,carcinoma,0,2	SPATA17	59	.	1	Substitution - Nonsense(1)	pancreas(1)	c.C374T						.						94.0	109.0	104.0					1																	217856682		2201	4300	6501	SO:0001583	missense	128153	exon5			TCGTTTCAGAGAC	AK098591	CCDS1519.1	1q41	2008-02-05			ENSG00000162814	ENSG00000162814			25184	protein-coding gene	gene with protein product	"""IQ motif containing H"""	611032				16395525	Standard	NM_138796		Approved	IQCH	uc001hlh.1	Q96L03	OTTHUMG00000037875	ENST00000366933.4:c.374C>T	chr1.hg19:g.217856682C>T	ENSP00000355900:p.Ser125Leu	423.0	0.0		459.0	86.0	NM_138796	A5D6N2	Missense_Mutation	SNP	ENST00000366933.4	hg19	CCDS1519.1	.	.	.	.	.	.	.	.	.	.	C	15.95	2.984252	0.53827	.	.	ENSG00000162814	ENST00000366933	T	0.46063	0.88	5.43	5.43	0.79202	.	0.296074	0.32401	N	0.006152	T	0.42787	0.1218	M	0.68317	2.08	0.39486	D	0.967964	B	0.25563	0.129	B	0.24394	0.053	T	0.43637	-0.9379	10	0.09338	T	0.73	-14.4113	19.2545	0.93940	0.0:1.0:0.0:0.0	.	125	Q96L03	SPT17_HUMAN	L	125	ENSP00000355900:S125L	ENSP00000355900:S125L	S	+	2	0	SPATA17	215923305	0.998000	0.40836	1.000000	0.80357	0.446000	0.32137	4.485000	0.60279	2.537000	0.85549	0.555000	0.69702	TCA	.	.		0.353	SPATA17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092433.2	NM_138796	
THADA	63892	hgsc.bcm.edu	37	2	43801925	43801926	+	Nonsense_Mutation	DNP	CC	CC	AA			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr2:43801925_43801926CC>AA	ENST00000405006.4	-	11	1629_1630	c.1278_1279GG>TT	c.(1276-1281)gtGGaa>gtTTaa	p.E427*	THADA_ENST00000415080.2_Nonsense_Mutation_p.E137*|THADA_ENST00000330266.7_Nonsense_Mutation_p.E137*|THADA_ENST00000405975.2_Nonsense_Mutation_p.E427*|THADA_ENST00000403856.1_Nonsense_Mutation_p.E427*|THADA_ENST00000402360.2_Nonsense_Mutation_p.E427*|THADA_ENST00000404790.1_Nonsense_Mutation_p.E427*	NM_001083953.1|NM_001271643.1	NP_001077422.1|NP_001258572.1	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	427										breast(1)|endometrium(9)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	66		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				TCTGCACCTTCCACAGTGAGCC	0.431																																					p.E427X|p.V426V		Atlas-SNP	.											.	THADA	131	.	0			c.G1279T|c.G1278T						.																																			SO:0001587	stop_gained	63892	exon11			CACCTTCCACAGT|ACCTTCCACAGTG	AY149629	CCDS46268.1, CCDS62901.1, CCDS62902.1	2p21	2008-02-05			ENSG00000115970	ENSG00000115970			19217	protein-coding gene	gene with protein product		611800				12063398, 11214970	Standard	NM_022065		Approved	FLJ21877, KIAA1767, GITA	uc002rsx.4	Q6YHU6	OTTHUMG00000152398	ENST00000405006.4:c.1278_1279delinsAA	chr2.hg19:g.43801925_43801926delinsAA	ENSP00000385995:p.Glu427*	113.0|114.0	0.0		172.0	40.0	NM_001083953	A8K1V8|B7WNS6|Q3KR04|Q53RC6|Q53TB2|Q6YHU2|Q6ZU38|Q8IY32|Q8TAU8|Q96I88|Q9BZF7|Q9C096|Q9H6U0|Q9H6W7	Nonsense_Mutation|Silent	SNP	ENST00000405006.4	hg19	CCDS46268.1																																																																																			.	.		0.431	THADA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326070.3	NM_022065	
ANKRD53	79998	hgsc.bcm.edu	37	2	71212146	71212146	+	Missense_Mutation	SNP	C	C	T			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr2:71212146C>T	ENST00000360589.3	+	6	1343	c.1309C>T	c.(1309-1311)Cac>Tac	p.H437Y	ANKRD53_ENST00000441349.1_3'UTR|ANKRD53_ENST00000457410.1_Missense_Mutation_p.H403Y|AC007040.11_ENST00000606025.1_Intron|ANKRD53_ENST00000272421.6_3'UTR	NM_001115116.1	NP_001108588.1	Q8N9V6	ANR53_HUMAN	ankyrin repeat domain 53	437										endometrium(2)|large_intestine(3)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	11						TGCGCGGCTGCACACAGTGGA	0.662											OREG0014687	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.H437Y		Atlas-SNP	.											.,1	ANKRD53	55	.	0			c.C1309T						.						6.0	10.0	9.0					2																	71212146		674	1560	2234	SO:0001583	missense	79998	exon6			CGGCTGCACACAG	BC035234	CCDS1913.1, CCDS46321.1	2p13.3	2013-01-10			ENSG00000144031	ENSG00000144031		"""Ankyrin repeat domain containing"""	25691	protein-coding gene	gene with protein product							Standard	NM_024933		Approved	FLJ12056, FLJ36160	uc002shl.4	Q8N9V6	OTTHUMG00000129712	ENST00000360589.3:c.1309C>T	chr2.hg19:g.71212146C>T	ENSP00000353796:p.His437Tyr	64.0	0.0	1128	88.0	16.0	NM_001115116	Q8IYP8	Missense_Mutation	SNP	ENST00000360589.3	hg19	CCDS46321.1	.	.	.	.	.	.	.	.	.	.	C	15.67	2.902713	0.52227	.	.	ENSG00000144031	ENST00000457410;ENST00000360589	T;T	0.63255	0.05;-0.03	5.56	2.47	0.30058	.	1.366400	0.04579	N	0.394573	T	0.41213	0.1149	N	0.14661	0.345	0.09310	N	1	B	0.15473	0.013	B	0.09377	0.004	T	0.25779	-1.0122	10	0.02654	T	1	-3.9471	7.4216	0.27075	0.0:0.698:0.0:0.302	.	437	Q8N9V6	ANR53_HUMAN	Y	403;437	ENSP00000407004:H403Y;ENSP00000353796:H437Y	ENSP00000353796:H437Y	H	+	1	0	ANKRD53	71065654	0.000000	0.05858	0.037000	0.18230	0.053000	0.15095	-0.598000	0.05706	0.257000	0.21650	0.561000	0.74099	CAC	.	.		0.662	ANKRD53-004	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330275.2	NM_024933	
ALMS1	7840	hgsc.bcm.edu	37	2	73613065	73613065	+	Silent	SNP	G	G	A			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr2:73613065G>A	ENST00000264448.6	+	1	180	c.69G>A	c.(67-69)gaG>gaA	p.E23E	ALMS1_ENST00000377715.1_Silent_p.E23E|ALMS1_ENST00000409009.1_Silent_p.E23E	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	23	Glu-rich.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						aggaggaggaggaggaagagg	0.687																																					p.E23E		Atlas-SNP	.											.	ALMS1	384	.	0			c.G69A						.						6.0	9.0	8.0					2																	73613065		1849	3831	5680	SO:0001819	synonymous_variant	7840	exon1			GGAGGAGGAGGAA	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.69G>A	chr2.hg19:g.73613065G>A		450.0	0.0		501.0	34.0	NM_015120	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Silent	SNP	ENST00000264448.6	hg19	CCDS42697.1																																																																																			.	.		0.687	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120	
DGKD	8527	hgsc.bcm.edu	37	2	234355412	234355412	+	Silent	SNP	C	C	T			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr2:234355412C>T	ENST00000264057.2	+	12	1401	c.1389C>T	c.(1387-1389)acC>acT	p.T463T	DGKD_ENST00000409813.3_Silent_p.T419T	NM_152879.2	NP_690618.2	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa	463					blood coagulation (GO:0007596)|cell growth (GO:0016049)|diacylglycerol metabolic process (GO:0046339)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|protein homooligomerization (GO:0051260)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein transport (GO:0015031)|response to organic substance (GO:0010033)|second-messenger-mediated signaling (GO:0019932)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol binding (GO:0019992)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(13)|lung(15)|ovary(1)|pancreas(1)|skin(1)	38		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	CCTCCTCTACCGTCACCGAAG	0.602																																					p.T463T		Atlas-SNP	.											.	DGKD	106	.	0			c.C1389T						.						105.0	87.0	93.0					2																	234355412		2203	4300	6503	SO:0001819	synonymous_variant	8527	exon12			CTCTACCGTCACC	D63479	CCDS2504.1, CCDS46546.1	2q37	2013-01-10	2002-08-29		ENSG00000077044	ENSG00000077044		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2851	protein-coding gene	gene with protein product	"""diglyceride kinase"""	601826	"""diacylglycerol kinase, delta (130kD)"""			8626538, 12810723	Standard	NM_003648		Approved	KIAA0145, DGKdelta	uc002vui.1	Q16760	OTTHUMG00000133290	ENST00000264057.2:c.1389C>T	chr2.hg19:g.234355412C>T		77.0	0.0		62.0	22.0	NM_152879	Q14158|Q6PK55|Q8NG53	Silent	SNP	ENST00000264057.2	hg19	CCDS2504.1																																																																																			.	.		0.602	DGKD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257072.2	NM_003648	
TOPAZ1	375337	hgsc.bcm.edu	37	3	44286265	44286265	+	Missense_Mutation	SNP	C	C	A			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr3:44286265C>A	ENST00000309765.4	+	2	2435	c.2267C>A	c.(2266-2268)gCt>gAt	p.A756D		NM_001145030.1	NP_001138502.1	Q8N9V7	TOPZ1_HUMAN	testis and ovary specific PAZ domain containing 1	756						cytoplasm (GO:0005737)	metal ion binding (GO:0046872)										CCAGTGCAAGCTAGTTCTGAC	0.388																																					p.A756D		Atlas-SNP	.											.	.	.	.	0			c.C2267A						.						81.0	70.0	73.0					3																	44286265		692	1591	2283	SO:0001583	missense	375337	exon2			TGCAAGCTAGTTC	AK093476	CCDS46809.1	3p21.33	2012-10-08	2012-10-08	2012-10-08	ENSG00000173769	ENSG00000173769			24746	protein-coding gene	gene with protein product		614412	"""chromosome 3 open reading frame 77"""	C3orf77		22069478	Standard	NM_001145030		Approved	FLJ36157	uc003cna.4	Q8N9V7	OTTHUMG00000156172	ENST00000309765.4:c.2267C>A	chr3.hg19:g.44286265C>A	ENSP00000310303:p.Ala756Asp	101.0	0.0		113.0	23.0	NM_001145030		Missense_Mutation	SNP	ENST00000309765.4	hg19	CCDS46809.1	.	.	.	.	.	.	.	.	.	.	C	13.60	2.284774	0.40394	.	.	ENSG00000173769	ENST00000309765	T	0.11169	2.8	5.89	1.91	0.25777	.	.	.	.	.	T	0.05868	0.0153	N	0.19112	0.55	0.09310	N	1	B	0.23806	0.091	B	0.19946	0.027	T	0.39272	-0.9622	9	0.36615	T	0.2	-0.547	2.0438	0.03556	0.2396:0.4813:0.1178:0.1614	.	756	Q8N9V7	CC077_HUMAN	D	756	ENSP00000310303:A756D	ENSP00000310303:A756D	A	+	2	0	C3orf77	44261269	0.000000	0.05858	0.113000	0.21522	0.960000	0.62799	-0.557000	0.05985	0.392000	0.25172	0.585000	0.79938	GCT	.	.		0.388	TOPAZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343247.1	NM_001145030	
ACPP	55	hgsc.bcm.edu	37	3	132061467	132061467	+	Silent	SNP	C	C	A			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr3:132061467C>A	ENST00000336375.5	+	6	717	c.627C>A	c.(625-627)gtC>gtA	p.V209V	ACPP_ENST00000351273.7_Silent_p.V209V|ACPP_ENST00000475741.1_Silent_p.V176V	NM_001099.4	NP_001090.2	P15309	PPAP_HUMAN	acid phosphatase, prostate	209					adenosine metabolic process (GO:0046085)|dephosphorylation (GO:0016311)|nucleotide metabolic process (GO:0009117)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|purine nucleobase metabolic process (GO:0006144)|regulation of sensory perception of pain (GO:0051930)|thiamine metabolic process (GO:0006772)	apical part of cell (GO:0045177)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|Golgi cisterna (GO:0031985)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|vesicle membrane (GO:0012506)	5'-nucleotidase activity (GO:0008253)|acid phosphatase activity (GO:0003993)|choline binding (GO:0033265)|identical protein binding (GO:0042802)|lysophosphatidic acid phosphatase activity (GO:0052642)|phosphatase activity (GO:0016791)|thiamine phosphate phosphatase activity (GO:0042131)			NS(1)|breast(1)|endometrium(2)|large_intestine(5)|lung(13)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	27						GGAGTAAAGTCTACGACCCTT	0.313																																					p.V209V		Atlas-SNP	.											.	ACPP	118	.	0			c.C627A						.						101.0	106.0	104.0					3																	132061467		2203	4300	6503	SO:0001819	synonymous_variant	55	exon6			TAAAGTCTACGAC		CCDS3073.1, CCDS46916.1	3q22.1	2012-05-16			ENSG00000014257	ENSG00000014257	3.1.3.2		125	protein-coding gene	gene with protein product		171790					Standard	NM_001099		Approved	ACP3, ACP-3	uc003eop.4	P15309	OTTHUMG00000159650	ENST00000336375.5:c.627C>A	chr3.hg19:g.132061467C>A		97.0	0.0		62.0	9.0	NM_001099	D3DNC6|Q5FBY0|Q96KY0|Q96QK9|Q96QM0	Silent	SNP	ENST00000336375.5	hg19	CCDS3073.1																																																																																			.	.		0.313	ACPP-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000356699.2	NM_001099	
NLGN1	22871	hgsc.bcm.edu	37	3	173998485	173998485	+	Missense_Mutation	SNP	T	T	G			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr3:173998485T>G	ENST00000457714.1	+	7	2293	c.1864T>G	c.(1864-1866)Tat>Gat	p.Y622D	NLGN1_ENST00000401917.3_Missense_Mutation_p.Y662D|NLGN1_ENST00000361589.4_Missense_Mutation_p.Y622D|NLGN1_ENST00000545397.1_Missense_Mutation_p.Y622D	NM_014932.2	NP_055747.1	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	639					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|calcium-dependent cell-cell adhesion (GO:0016339)|cytoskeletal matrix organization at active zone (GO:0048789)|establishment of protein localization (GO:0045184)|heterophilic cell-cell adhesion (GO:0007157)|N-methyl-D-aspartate receptor clustering (GO:0097114)|nervous system development (GO:0007399)|neurexin clustering (GO:0097115)|neuron cell-cell adhesion (GO:0007158)|neuronal signal transduction (GO:0023041)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|positive regulation of synaptic vesicle exocytosis (GO:2000302)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|protein homooligomerization (GO:0051260)|protein localization to synapse (GO:0035418)|protein targeting (GO:0006605)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron differentiation (GO:0045664)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|synapse assembly (GO:0007416)|synaptic vesicle clustering (GO:0097091)|synaptic vesicle targeting (GO:0016080)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|filopodium tip (GO:0032433)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|PDZ domain binding (GO:0030165)|protein dimerization activity (GO:0046983)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(2)|lung(54)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	83	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			CATTTCTCAGTATACCTCTAC	0.413																																					p.Y622D		Atlas-SNP	.											.	NLGN1	209	.	0			c.T1864G						.						123.0	121.0	122.0					3																	173998485		2203	4300	6503	SO:0001583	missense	22871	exon7			TCTCAGTATACCT	AB028993	CCDS3222.1	3q26.32	2008-07-18			ENSG00000169760	ENSG00000169760			14291	protein-coding gene	gene with protein product		600568				10767552, 10819331	Standard	NM_014932		Approved	KIAA1070	uc003fio.1	Q8N2Q7	OTTHUMG00000157005	ENST00000457714.1:c.1864T>G	chr3.hg19:g.173998485T>G	ENSP00000392500:p.Tyr622Asp	132.0	0.0		136.0	31.0	NM_014932	Q9UPT2	Missense_Mutation	SNP	ENST00000457714.1	hg19	CCDS3222.1	.	.	.	.	.	.	.	.	.	.	T	10.37	1.332296	0.24167	.	.	ENSG00000169760	ENST00000457714;ENST00000361589;ENST00000545397;ENST00000401917	T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.18	5.59	5.59	0.84812	.	0.146153	0.48767	D	0.000165	T	0.55114	0.1900	L	0.39245	1.2	0.37444	D	0.914541	B	0.11235	0.004	B	0.10450	0.005	T	0.57619	-0.7780	10	0.52906	T	0.07	.	14.6374	0.68699	0.0:0.0:0.0:1.0	.	622	Q8N2Q7-2	.	D	622;622;622;662	ENSP00000392500:Y622D;ENSP00000354541:Y622D;ENSP00000441108:Y622D;ENSP00000385750:Y662D	ENSP00000354541:Y622D	Y	+	1	0	NLGN1	175481179	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.266000	0.43320	2.246000	0.74042	0.533000	0.62120	TAT	.	.		0.413	NLGN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347054.3	NM_014932	
MUC4	4585	hgsc.bcm.edu	37	3	195506118	195506118	+	Silent	SNP	C	C	T	rs375216275		TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr3:195506118C>T	ENST00000463781.3	-	2	12792	c.12333G>A	c.(12331-12333)acG>acA	p.T4111T	MUC4_ENST00000475231.1_Silent_p.T4111T|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CAGGAAGAGGCGTGGTGTCAC	0.592																																					p.T4111T		Atlas-SNP	.											.	MUC4	1505	.	0			c.G12333A						.						10.0	7.0	8.0					3																	195506118		557	1435	1992	SO:0001819	synonymous_variant	4585	exon2			AAGAGGCGTGGTG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12333G>A	chr3.hg19:g.195506118C>T		190.0	0.0		212.0	37.0	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	hg19	CCDS54700.1																																																																																			.	.		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
CCNA2	890	hgsc.bcm.edu	37	4	122743628	122743628	+	Missense_Mutation	SNP	A	A	C			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr4:122743628A>C	ENST00000274026.5	-	2	690	c.387T>G	c.(385-387)aaT>aaG	p.N129K		NM_001237.3	NP_001228	P20248	CCNA2_HUMAN	cyclin A2	129					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic G2 DNA damage checkpoint (GO:0007095)|mitotic nuclear division (GO:0007067)|organ regeneration (GO:0031100)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|response to estradiol (GO:0032355)|response to glucagon (GO:0033762)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	12						TAATGGCTGAATTAAAAGCCA	0.413																																					p.N129K		Atlas-SNP	.											.	CCNA2	30	.	0			c.T387G						.						98.0	96.0	96.0					4																	122743628		2203	4300	6503	SO:0001583	missense	890	exon2			GGCTGAATTAAAA		CCDS3723.1	4q27	2012-07-12			ENSG00000145386	ENSG00000145386			1578	protein-coding gene	gene with protein product		123835		CCNA, CCN1		1675006	Standard	NM_001237		Approved		uc003iec.4	P20248	OTTHUMG00000133072	ENST00000274026.5:c.387T>G	chr4.hg19:g.122743628A>C	ENSP00000274026:p.Asn129Lys	154.0	0.0		131.0	14.0	NM_001237	A8K7B6|Q2M3U6|Q4W5P4|Q6LER8	Missense_Mutation	SNP	ENST00000274026.5	hg19	CCDS3723.1	.	.	.	.	.	.	.	.	.	.	A	8.312	0.822373	0.16678	.	.	ENSG00000145386	ENST00000274026	T	0.14144	2.53	5.5	-2.16	0.07080	.	0.647659	0.14346	N	0.325384	T	0.07999	0.0200	L	0.55481	1.735	0.09310	N	1	B	0.19200	0.034	B	0.15870	0.014	T	0.44329	-0.9335	10	0.05436	T	0.98	.	2.4874	0.04601	0.5139:0.1113:0.2667:0.1081	.	129	P20248	CCNA2_HUMAN	K	129	ENSP00000274026:N129K	ENSP00000274026:N129K	N	-	3	2	CCNA2	122963078	0.462000	0.25791	0.351000	0.25721	0.772000	0.43724	0.723000	0.25939	-0.188000	0.10499	0.533000	0.62120	AAT	.	.		0.413	CCNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256712.2	NM_001237	
USP38	84640	hgsc.bcm.edu	37	4	144135474	144135474	+	Missense_Mutation	SNP	A	A	G			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr4:144135474A>G	ENST00000307017.4	+	9	2851	c.2345A>G	c.(2344-2346)gAc>gGc	p.D782G	USP38_ENST00000510377.1_Missense_Mutation_p.D782G	NM_032557.5	NP_115946.2	Q8NB14	UBP38_HUMAN	ubiquitin specific peptidase 38	782	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(3)	33	all_hematologic(180;0.158)					AAAATTTTAGACAATGTATCA	0.363																																					p.D782G		Atlas-SNP	.											.	USP38	92	.	0			c.A2345G						.						54.0	53.0	54.0					4																	144135474		2203	4300	6503	SO:0001583	missense	84640	exon9			TTTTAGACAATGT	AF211481	CCDS3758.1	4q31.1	2008-02-05	2005-08-08		ENSG00000170185	ENSG00000170185		"""Ubiquitin-specific peptidases"""	20067	protein-coding gene	gene with protein product			"""ubiquitin specific protease 38"""			12838346	Standard	NM_032557		Approved	KIAA1891, HP43.8KD	uc003ijb.3	Q8NB14	OTTHUMG00000161420	ENST00000307017.4:c.2345A>G	chr4.hg19:g.144135474A>G	ENSP00000303434:p.Asp782Gly	119.0	0.0		114.0	25.0	NM_032557	B3KX93|Q3ZCV1|Q8NDF5|Q96DK6|Q96PZ6|Q9BY55	Missense_Mutation	SNP	ENST00000307017.4	hg19	CCDS3758.1	.	.	.	.	.	.	.	.	.	.	A	17.87	3.495155	0.64186	.	.	ENSG00000170185	ENST00000510377;ENST00000307017	T;T	0.33865	1.39;1.39	5.78	5.78	0.91487	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.049173	0.85682	D	0.000000	T	0.60038	0.2238	M	0.71206	2.165	0.58432	D	0.999998	D;D	0.89917	0.974;1.0	P;D	0.80764	0.88;0.994	T	0.61342	-0.7082	10	0.51188	T	0.08	-3.4351	16.1082	0.81241	1.0:0.0:0.0:0.0	.	782;782	Q8NB14;Q3ZCV1	UBP38_HUMAN;.	G	782	ENSP00000427647:D782G;ENSP00000303434:D782G	ENSP00000303434:D782G	D	+	2	0	USP38	144354924	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.355000	0.79434	2.205000	0.71048	0.482000	0.46254	GAC	.	.		0.363	USP38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364869.1	NM_032557	
POU4F2	5458	hgsc.bcm.edu	37	4	147560457	147560457	+	Silent	SNP	T	T	C	rs530695040|rs5862765		TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr4:147560457T>C	ENST00000281321.3	+	1	413	c.165T>C	c.(163-165)ggT>ggC	p.G55G	AC093887.1_ENST00000584185.1_RNA	NM_004575.2	NP_004566.2	Q12837	PO4F2_HUMAN	POU class 4 homeobox 2	55	Poly-Gly.				axon extension (GO:0048675)|axon guidance (GO:0007411)|intracellular estrogen receptor signaling pathway (GO:0030520)|MAPK cascade (GO:0000165)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|retinal ganglion cell axon guidance (GO:0031290)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	33	all_hematologic(180;0.151)					ACGCTggtggtggcggcggcg	0.761																																					p.G55G		Atlas-SNP	.											.	POU4F2	83	.	0			c.T165C						.						3.0	3.0	3.0					4																	147560457		1733	3503	5236	SO:0001819	synonymous_variant	5458	exon1			TGGTGGTGGCGGC	U06233	CCDS34074.1	4q31.22	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9219	protein-coding gene	gene with protein product		113725	"""POU domain, class 4, transcription factor 2"", ""POU domain class 4, transcription factor 2"""	BRN3B		8332509	Standard	NM_004575		Approved	Brn-3b	uc003ikv.3	Q12837		ENST00000281321.3:c.165T>C	chr4.hg19:g.147560457T>C		121.0	0.0		122.0	5.0	NM_004575	B1PJR6|B2RC84|Q13883|Q14987	Silent	SNP	ENST00000281321.3	hg19	CCDS34074.1																																																																																			.	.		0.761	POU4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367020.1	NM_004575	
SPOCK3	50859	hgsc.bcm.edu	37	4	167675697	167675697	+	Missense_Mutation	SNP	G	G	T			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr4:167675697G>T	ENST00000357154.3	-	9	1039	c.902C>A	c.(901-903)tCt>tAt	p.S301Y	SPOCK3_ENST00000504953.1_Missense_Mutation_p.S298Y|SPOCK3_ENST00000502330.1_Missense_Mutation_p.S301Y|SPOCK3_ENST00000421836.2_Missense_Mutation_p.S250Y|SPOCK3_ENST00000507137.1_5'UTR|SPOCK3_ENST00000357545.4_Missense_Mutation_p.S298Y|SPOCK3_ENST00000506886.1_Missense_Mutation_p.S301Y|SPOCK3_ENST00000541637.1_Missense_Mutation_p.S203Y|SPOCK3_ENST00000535728.1_Missense_Mutation_p.S169Y|SPOCK3_ENST00000511269.1_Missense_Mutation_p.S298Y|SPOCK3_ENST00000512648.1_Missense_Mutation_p.S298Y|SPOCK3_ENST00000512681.1_Missense_Mutation_p.S203Y|SPOCK3_ENST00000541354.1_Missense_Mutation_p.S181Y|SPOCK3_ENST00000510741.1_Missense_Mutation_p.S258Y|SPOCK3_ENST00000511531.1_Missense_Mutation_p.S301Y|SPOCK3_ENST00000534949.1_Missense_Mutation_p.S205Y	NM_016950.2	NP_058646.2	Q9BQ16	TICN3_HUMAN	sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3	301					negative regulation of endopeptidase activity (GO:0010951)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|signal transduction (GO:0007165)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|metalloendopeptidase inhibitor activity (GO:0008191)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	38	all_hematologic(180;0.221)	Prostate(90;0.0181)|Renal(120;0.0184)|Melanoma(52;0.0198)		GBM - Glioblastoma multiforme(119;0.02)		CTCATTATTAGATATTAAACT	0.383																																					p.S301Y		Atlas-SNP	.											.	SPOCK3	90	.	0			c.C902A						.						133.0	123.0	127.0					4																	167675697		2203	4300	6503	SO:0001583	missense	50859	exon9			TTATTAGATATTA	AJ001454	CCDS34095.1, CCDS54817.1, CCDS56343.1, CCDS56344.1, CCDS56346.1, CCDS56347.1, CCDS58931.1, CCDS75207.1	4q32.3	2011-10-10			ENSG00000196104	ENSG00000196104			13565	protein-coding gene	gene with protein product		607989				11751414	Standard	NM_001204352		Approved	testican-3	uc003iri.1	Q9BQ16	OTTHUMG00000161190	ENST00000357154.3:c.902C>A	chr4.hg19:g.167675697G>T	ENSP00000349677:p.Ser301Tyr	86.0	0.0		92.0	11.0	NM_016950	B2R7M7|B3KR67|B4DGK5|B4DHB4|B4DHV3|B4DI46|B4DJY3|E7EP61|F5H099|O75705|Q6UW53|Q96Q26	Missense_Mutation	SNP	ENST00000357154.3	hg19	CCDS54817.1	.	.	.	.	.	.	.	.	.	.	G	17.97	3.517725	0.64634	.	.	ENSG00000196104	ENST00000357154;ENST00000357545;ENST00000504953;ENST00000506886;ENST00000511531;ENST00000502330;ENST00000510741;ENST00000541354;ENST00000512681;ENST00000511269;ENST00000535728;ENST00000421836;ENST00000541637;ENST00000534949;ENST00000512648	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18;-0.18;-0.18;-0.18;-0.18;-0.18;-0.18;-0.18;-0.18;-0.18;-0.18;1.84	5.64	5.64	0.86602	SPARC/Testican, calcium-binding domain (1);EF-hand-like domain (1);	0.057382	0.64402	D	0.000001	D	0.84079	0.5393	M	0.90425	3.115	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	0.999;1.0;1.0;0.999;0.999;1.0;1.0;0.999	D;D;D;D;D;D;D;D	0.91635	0.981;0.991;0.997;0.998;0.998;0.991;0.999;0.998	D	0.86420	0.1754	10	0.87932	D	0	-1.8575	20.0723	0.97728	0.0:0.0:1.0:0.0	.	203;205;250;310;258;301;298;301	B4DGK5;F5H099;B4DHB4;B4DFW5;E7EP61;Q9BQ16-2;Q9BQ16-1;Q9BQ16	.;.;.;.;.;.;.;TICN3_HUMAN	Y	301;298;298;301;301;301;258;181;203;298;169;250;203;205;298	ENSP00000349677:S301Y;ENSP00000350153:S298Y;ENSP00000425570:S298Y;ENSP00000420920:S301Y;ENSP00000423421:S301Y;ENSP00000423606:S301Y;ENSP00000426716:S258Y;ENSP00000444789:S181Y;ENSP00000426318:S203Y;ENSP00000425502:S298Y;ENSP00000441396:S169Y;ENSP00000411344:S250Y;ENSP00000445430:S203Y;ENSP00000438142:S205Y;ENSP00000426177:S298Y	ENSP00000349677:S301Y	S	-	2	0	SPOCK3	167912272	1.000000	0.71417	1.000000	0.80357	0.226000	0.24999	9.697000	0.98697	2.819000	0.97034	0.650000	0.86243	TCT	.	.		0.383	SPOCK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364091.1		
GALNTL6	442117	hgsc.bcm.edu	37	4	173734692	173734692	+	Splice_Site	SNP	C	C	G			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr4:173734692C>G	ENST00000506823.1	+	7	1398	c.741C>G	c.(739-741)aaC>aaG	p.N247K	GALNTL6_ENST00000508122.1_Splice_Site_p.N230K	NM_001034845.2	NP_001030017.2	Q49A17	GLTL6_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 6	247	Catalytic subdomain A.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(2)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	45						ATTTTTCAGACCAAATTGCAC	0.438																																					p.N247K		Atlas-SNP	.											.	GALNTL6	102	.	0			c.C741G						.						87.0	74.0	78.0					4																	173734692		2203	4300	6503	SO:0001630	splice_region_variant	442117	exon7			TTCAGACCAAATT		CCDS34104.1	4q34.1	2014-03-13	2014-03-13		ENSG00000174473	ENSG00000174473		"""Glycosyltransferase family 2 domain containing"""	33844	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 6"""	615138	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6"""				Standard	NM_001034845		Approved	GALNT17, GalNAc-T6L	uc003isv.3	Q49A17	OTTHUMG00000160807	ENST00000506823.1:c.740-1C>G	chr4.hg19:g.173734692C>G		79.0	0.0		88.0	18.0	NM_001034845	Q2L4S6	Missense_Mutation	SNP	ENST00000506823.1	hg19	CCDS34104.1	.	.	.	.	.	.	.	.	.	.	C	15.13	2.741642	0.49151	.	.	ENSG00000174473	ENST00000506823;ENST00000508122	T;T	0.58358	0.34;0.34	5.97	5.13	0.70059	Glycosyl transferase, family 2 (1);	0.000000	0.64402	D	0.000002	T	0.37732	0.1014	N	0.17379	0.485	0.54753	D	0.999988	B	0.27013	0.166	B	0.31101	0.124	T	0.22556	-1.0213	10	0.42905	T	0.14	.	11.7205	0.51678	0.0:0.8648:0.0:0.1352	.	247	Q49A17	GLTL6_HUMAN	K	247;230	ENSP00000423313:N247K;ENSP00000423827:N230K	ENSP00000423313:N247K	N	+	3	2	GALNTL6	173971267	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.685000	0.46959	2.836000	0.97738	0.655000	0.94253	AAC	.	.		0.438	GALNTL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362395.1	NM_001034845	Missense_Mutation
ICE1	23379	hgsc.bcm.edu	37	5	5463128	5463128	+	Silent	SNP	A	A	G			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr5:5463128A>G	ENST00000296564.7	+	13	3903	c.3681A>G	c.(3679-3681)gaA>gaG	p.E1227E		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		1227					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						GTGAGGAAGAAACACTTGGAA	0.368																																					p.E1227E		Atlas-SNP	.											.	KIAA0947	301	.	0			c.A3681G						.						48.0	48.0	48.0					5																	5463128		1847	4087	5934	SO:0001819	synonymous_variant	23379	exon13			GGAAGAAACACTT																												ENST00000296564.7:c.3681A>G	chr5.hg19:g.5463128A>G		171.0	0.0		165.0	42.0	NM_015325	Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Silent	SNP	ENST00000296564.7	hg19	CCDS47187.1																																																																																			.	.		0.368	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365575.1		
SRD5A1	6715	hgsc.bcm.edu	37	5	6633889	6633889	+	Missense_Mutation	SNP	C	C	A			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr5:6633889C>A	ENST00000274192.5	+	1	434	c.200C>A	c.(199-201)cCg>cAg	p.P67Q	SRD5A1_ENST00000538824.1_Missense_Mutation_p.R76S|NSUN2_ENST00000264670.6_5'Flank|SRD5A1_ENST00000504286.1_3'UTR|NSUN2_ENST00000506139.1_5'Flank|NSUN2_ENST00000539938.1_5'Flank|SRD5A1_ENST00000537411.1_Missense_Mutation_p.R76S	NM_001047.2	NP_001038.1	P18405	S5A1_HUMAN	steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 1)	67				Missing (in Ref. 4; AAF14869). {ECO:0000305}.	androgen biosynthetic process (GO:0006702)|cell differentiation (GO:0030154)|sex determination (GO:0007530)|sex differentiation (GO:0007548)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	3-oxo-5-alpha-steroid 4-dehydrogenase activity (GO:0003865)|cholestenone 5-alpha-reductase activity (GO:0047751)|electron carrier activity (GO:0009055)			endometrium(3)|kidney(1)|large_intestine(1)|lung(8)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19					Dutasteride(DB01126)|Finasteride(DB01216)|Levonorgestrel(DB00367)|Spironolactone(DB00421)	CTGGCCCTGCCGCTCTACCAG	0.706																																					p.P67Q		Atlas-SNP	.											.	SRD5A1	31	.	0			c.C200A						.						15.0	16.0	16.0					5																	6633889		2164	4230	6394	SO:0001583	missense	6715	exon1			CCCTGCCGCTCTA	M32313	CCDS3870.1	5p15.31	2008-02-05			ENSG00000145545	ENSG00000145545	1.3.99.5		11284	protein-coding gene	gene with protein product		184753				1686016	Standard	XR_427663		Approved		uc003jdw.3	P18405	OTTHUMG00000090456	ENST00000274192.5:c.200C>A	chr5.hg19:g.6633889C>A	ENSP00000274192:p.Pro67Gln	10.0	0.0		17.0	7.0	NM_001047	B2R7Q1|Q9UHY4|Q9UP36|Q9UP37	Missense_Mutation	SNP	ENST00000274192.5	hg19	CCDS3870.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.7|22.7	4.322329|4.322329	0.81580|0.81580	.|.	.|.	ENSG00000145545|ENSG00000145545	ENST00000274192|ENST00000537411;ENST00000538824	T|T	0.25085|0.23950	1.82|1.88	3.6|3.6	3.6|3.6	0.41247|0.41247	.|.	0.059678|.	0.64402|.	D|.	0.000002|.	T|T	0.48840|0.48840	0.1522|0.1522	M|M	0.85197|0.85197	2.74|2.74	0.34530|0.34530	D|D	0.70915|0.70915	D|D	0.55605|0.59767	0.972|0.986	D|P	0.65573|0.58780	0.936|0.845	T|T	0.68345|0.68345	-0.5433|-0.5433	10|9	0.52906|0.87932	T|D	0.07|0	-11.7956|-11.7956	12.6006|12.6006	0.56494|0.56494	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	67|76	P18405|F5GXK9	S5A1_HUMAN|.	Q|S	67|76	ENSP00000274192:P67Q|ENSP00000440186:R76S	ENSP00000274192:P67Q|ENSP00000446275:R76S	P|R	+|+	2|1	0|0	SRD5A1|SRD5A1	6686889|6686889	0.854000|0.854000	0.29725|0.29725	0.996000|0.996000	0.52242|0.52242	0.912000|0.912000	0.54170|0.54170	1.846000|1.846000	0.39289|0.39289	2.005000|2.005000	0.58758|0.58758	0.643000|0.643000	0.83706|0.83706	CCG|CGC	.	.		0.706	SRD5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206903.1	NM_001047	
OCLN	100506658	hgsc.bcm.edu	37	5	68805179	68805179	+	Missense_Mutation	SNP	G	G	T			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr5:68805179G>T	ENST00000355237.2	+	3	698	c.262G>T	c.(262-264)Gcc>Tcc	p.A88S	OCLN_ENST00000538151.1_Intron|OCLN_ENST00000380766.2_Missense_Mutation_p.A88S|OCLN_ENST00000396442.2_Missense_Mutation_p.A88S|OCLN_ENST00000542132.1_Intron	NM_002538.3	NP_002529.1	Q16625	OCLN_HUMAN	occludin	88	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				apoptotic process (GO:0006915)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|protein complex assembly (GO:0006461)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethionine metabolic process (GO:0046500)|tight junction assembly (GO:0070830)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cell junction (GO:0030054)|cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	protein domain specific binding (GO:0019904)|structural molecule activity (GO:0005198)|thiopurine S-methyltransferase activity (GO:0008119)			endometrium(2)|large_intestine(1)|liver(1)|prostate(1)|skin(1)	6		Lung NSC(167;4.15e-05)|Prostate(74;0.00996)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;3.04e-60)|Epithelial(20;7.09e-58)|all cancers(19;1.13e-53)|Lung(70;0.0174)		CTCCACGCTTGCCTGGGACAG	0.507																																					p.A88S		Atlas-SNP	.											.	OCLN	22	.	0			c.G262T						.						189.0	178.0	182.0					5																	68805179		2203	4300	6503	SO:0001583	missense	100506658	exon3			ACGCTTGCCTGGG	U49184	CCDS4006.1, CCDS54864.1	5q13.1	2014-06-13			ENSG00000197822	ENSG00000197822			8104	protein-coding gene	gene with protein product	"""tight junction protein occludin TM4 minus"", ""phosphatase 1, regulatory subunit 115"""	602876				8601611	Standard	NM_002538		Approved	PPP1R115	uc003jwu.3	Q16625	OTTHUMG00000099356	ENST00000355237.2:c.262G>T	chr5.hg19:g.68805179G>T	ENSP00000347379:p.Ala88Ser	128.0	0.0		163.0	29.0	NM_001205254	B5BU70|D2DU64|D2DU65|D2IGC0|D2IGC1|E2CYV9|Q5U1V4|Q8N6K1	Missense_Mutation	SNP	ENST00000355237.2	hg19	CCDS4006.1	.	.	.	.	.	.	.	.	.	.	G	15.90	2.968669	0.53614	.	.	ENSG00000197822	ENST00000355237;ENST00000396442;ENST00000380766	T;T;T	0.60040	0.22;0.22;1.73	6.04	6.04	0.98038	Marvel (1);MARVEL-like domain (1);	0.146506	0.64402	D	0.000009	T	0.69314	0.3097	M	0.79475	2.455	0.80722	D	1	P	0.43024	0.798	P	0.50378	0.639	T	0.71563	-0.4555	10	0.62326	D	0.03	-29.4195	14.0093	0.64486	0.0:0.2528:0.7472:0.0	.	88	Q16625	OCLN_HUMAN	S	88	ENSP00000347379:A88S;ENSP00000379719:A88S;ENSP00000370143:A88S	ENSP00000347379:A88S	A	+	1	0	OCLN	68840935	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.110000	0.57831	2.873000	0.98535	0.563000	0.77884	GCC	.	.		0.507	OCLN-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216794.1	NM_002538	
PCDHA3	56145	hgsc.bcm.edu	37	5	140182420	140182420	+	Silent	SNP	C	C	A			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr5:140182420C>A	ENST00000522353.2	+	1	1638	c.1638C>A	c.(1636-1638)ggC>ggA	p.G546G	PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000532566.2_Silent_p.G546G|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000520672.2_Intron	NM_018906.2	NP_061729.1	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3	546	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(16)|kidney(3)|large_intestine(19)|lung(36)|ovary(7)|prostate(8)|skin(3)|stomach(1)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCCTCTGGGCAGCAACGTGA	0.677																																					p.G546G		Atlas-SNP	.											.	PCDHA3	396	.	0			c.C1638A						.						88.0	89.0	89.0					5																	140182420		2203	4298	6501	SO:0001819	synonymous_variant	56145	exon1			TCTGGGCAGCAAC	AF152481	CCDS54915.1	5q31	2010-11-26				ENSG00000255408		"""Cadherins / Protocadherins : Clustered"""	8669	other	complex locus constituent	"""KIAA0345-like 11"""	606309				10380929	Standard	NM_018906		Approved	PCDH-ALPHA3		Q9Y5H8		ENST00000522353.2:c.1638C>A	chr5.hg19:g.140182420C>A		54.0	0.0		55.0	13.0	NM_031497	O75286	Silent	SNP	ENST00000522353.2	hg19	CCDS54915.1																																																																																			.	.		0.677	PCDHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372848.2	NM_018906	
EYS	346007	hgsc.bcm.edu	37	6	66204853	66204853	+	Missense_Mutation	SNP	C	C	A			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr6:66204853C>A	ENST00000370621.3	-	4	977	c.451G>T	c.(451-453)Gtt>Ttt	p.V151F	EYS_ENST00000342421.5_Missense_Mutation_p.V151F|EYS_ENST00000393380.2_Missense_Mutation_p.V151F|EYS_ENST00000370616.2_Missense_Mutation_p.V151F|EYS_ENST00000503581.1_Missense_Mutation_p.V151F|EYS_ENST00000370618.3_Missense_Mutation_p.V151F			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	151					detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						CTTGCCATAACTGTGATAAAA	0.428																																					p.V151F		Atlas-SNP	.											.	EYS	527	.	0			c.G451T						.						73.0	64.0	67.0					6																	66204853		2203	4300	6503	SO:0001583	missense	346007	exon4			CCATAACTGTGAT		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.451G>T	chr6.hg19:g.66204853C>A	ENSP00000359655:p.Val151Phe	128.0	0.0		156.0	65.0	NM_001142801	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	ENST00000370621.3	hg19		.	.	.	.	.	.	.	.	.	.	C	12.21	1.868234	0.32977	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616;ENST00000393380;ENST00000342421;ENST00000370618	D;D;D;D;D;D	0.87809	-2.3;-2.3;-2.3;-2.3;-2.3;-2.3	4.73	3.85	0.44370	.	.	.	.	.	T	0.77987	0.4213	N	0.08118	0	0.18873	N	0.999984	D;D;D	0.67145	0.996;0.996;0.994	D;D;D	0.71414	0.952;0.973;0.941	T	0.73000	-0.4120	9	0.35671	T	0.21	.	11.8543	0.52429	0.0:0.6615:0.3385:0.0	.	151;151;151	Q5T1H1-1;Q5T1H1-2;Q5SZM4	.;.;.	F	151	ENSP00000424243:V151F;ENSP00000359655:V151F;ENSP00000359650:V151F;ENSP00000377042:V151F;ENSP00000341818:V151F;ENSP00000359652:V151F	ENSP00000341818:V151F	V	-	1	0	EYS	66261574	0.019000	0.18553	0.929000	0.37066	0.948000	0.59901	0.112000	0.15479	1.074000	0.40909	0.591000	0.81541	GTT	.	.		0.428	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050	
BAI3	577	hgsc.bcm.edu	37	6	70070994	70070994	+	Missense_Mutation	SNP	T	T	A			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr6:70070994T>A	ENST00000370598.1	+	29	4650	c.3829T>A	c.(3829-3831)Ttg>Atg	p.L1277M	BAI3_ENST00000546190.1_Missense_Mutation_p.L241M|BAI3_ENST00000238918.8_Missense_Mutation_p.L483M	NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	1277					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				AAATAGTGAATTGCGGAGAAC	0.398																																					p.L1277M		Atlas-SNP	.											.	BAI3	451	.	0			c.T3829A						.						90.0	87.0	88.0					6																	70070994		2203	4298	6501	SO:0001583	missense	577	exon29			AGTGAATTGCGGA	AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.3829T>A	chr6.hg19:g.70070994T>A	ENSP00000359630:p.Leu1277Met	82.0	0.0		98.0	30.0	NM_001704	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	ENST00000370598.1	hg19	CCDS4968.1	.	.	.	.	.	.	.	.	.	.	T	7.343	0.621257	0.14193	.	.	ENSG00000135298	ENST00000370598;ENST00000238918;ENST00000546190	T;T;T	0.07114	3.22;3.22;3.22	5.34	2.55	0.30701	.	0.060503	0.64402	D	0.000002	T	0.01287	0.0042	N	0.05383	-0.06	0.32378	N	0.554921	B;B	0.21520	0.057;0.007	B;B	0.16289	0.015;0.002	T	0.49143	-0.8970	10	0.33141	T	0.24	.	9.0313	0.36260	0.0:0.2645:0.0:0.7355	.	483;1277	B7Z356;O60242	.;BAI3_HUMAN	M	1277;483;241	ENSP00000359630:L1277M;ENSP00000238918:L483M;ENSP00000441821:L241M	ENSP00000238918:L483M	L	+	1	2	BAI3	70127715	0.889000	0.30405	0.996000	0.52242	0.729000	0.41735	0.051000	0.14141	0.283000	0.22279	-0.376000	0.06991	TTG	.	.		0.398	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1		
EPHA7	2045	hgsc.bcm.edu	37	6	93955017	93955017	+	Splice_Site	SNP	C	C	A			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr6:93955017C>A	ENST00000369303.4	-	16	3065	c.2881G>T	c.(2881-2883)Gag>Tag	p.E961*		NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	961	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)			NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		TAAGCTTACTCAATAGTCATC	0.313																																					p.E961X		Atlas-SNP	.											.	EPHA7	251	.	0			c.G2881T						.						47.0	51.0	50.0					6																	93955017		2203	4300	6503	SO:0001630	splice_region_variant	2045	exon16			CTTACTCAATAGT	L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.2882+1G>T	chr6.hg19:g.93955017C>A		46.0	0.0		54.0	17.0	NM_004440	A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Nonsense_Mutation	SNP	ENST00000369303.4	hg19	CCDS5031.1	.	.	.	.	.	.	.	.	.	.	C	42	9.561575	0.99205	.	.	ENSG00000135333	ENST00000369303	.	.	.	5.95	5.95	0.96441	.	0.106709	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.3812	0.98933	0.0:1.0:0.0:0.0	.	.	.	.	X	961	.	ENSP00000358309:E961X	E	-	1	0	EPHA7	94011738	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.818000	0.86416	2.821000	0.97095	0.650000	0.86243	GAG	.	.		0.313	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041545.1		Nonsense_Mutation
FAM20C	56975	hgsc.bcm.edu	37	7	286468	286468	+	Silent	SNP	G	G	C	rs386709047		TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr7:286468G>C	ENST00000313766.5	+	4	1182	c.951G>C	c.(949-951)ctG>ctC	p.L317L		NM_020223.3	NP_064608.2	Q8IXL6	DMP4_HUMAN	family with sequence similarity 20, member C	317					dentinogenesis (GO:0097187)|enamel mineralization (GO:0070166)|odontoblast differentiation (GO:0071895)|osteoclast maturation (GO:0036179)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|protein phosphorylation (GO:0006468)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of phosphorus metabolic process (GO:0051174)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|lung(2)|urinary_tract(1)	4		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.57e-17)|Epithelial(4;1.26e-16)|all cancers(6;4.79e-14)		CCTTCCACCTGGACAGGTGAG	0.577																																					p.L317L		Atlas-SNP	.											.	FAM20C	18	.	0			c.G951C						.						171.0	156.0	161.0					7																	286468		692	1591	2283	SO:0001819	synonymous_variant	56975	exon4			CCACCTGGACAGG	BC040074	CCDS47522.1	7p22.3	2012-11-29			ENSG00000177706	ENSG00000177706			22140	protein-coding gene	gene with protein product	"""dentin matrix protein 4"""	611061				17369251, 17924334	Standard	NM_020223		Approved	IMAGE:4942737, DKFZp547D065, DMP4	uc003sip.3	Q8IXL6	OTTHUMG00000151401	ENST00000313766.5:c.951G>C	chr7.hg19:g.286468G>C		607.0	0.0		531.0	30.0	NM_020223	A4D2Q5|L8B5W8|Q5I0W9|Q7Z4I0|Q9NPT2	Silent	SNP	ENST00000313766.5	hg19	CCDS47522.1																																																																																			.	.		0.577	FAM20C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322476.2	NM_020223	
GPER1	2852	hgsc.bcm.edu	37	7	1131626	1131626	+	Missense_Mutation	SNP	C	C	T			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr7:1131626C>T	ENST00000297469.3	+	2	953	c.262C>T	c.(262-264)Cgc>Tgc	p.R88C	C7orf50_ENST00000397100.2_Intron|GPER1_ENST00000397088.3_Missense_Mutation_p.R88C|C7orf50_ENST00000357429.6_Intron|C7orf50_ENST00000397098.3_Intron|C7orf50_ENST00000488073.1_Intron|GPER1_ENST00000397092.1_Missense_Mutation_p.R88C|GPER1_ENST00000401670.1_Missense_Mutation_p.R88C	NM_001505.2	NP_001496.1	Q99527	GPER1_HUMAN	G protein-coupled estrogen receptor 1	88					apoptotic chromosome condensation (GO:0030263)|cell cycle (GO:0007049)|cellular response to estradiol stimulus (GO:0071392)|cellular response to glucose stimulus (GO:0071333)|cellular response to mineralocorticoid stimulus (GO:0071389)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to tumor necrosis factor (GO:0071356)|cytosolic calcium ion homeostasis (GO:0051480)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|mineralocorticoid receptor signaling pathway (GO:0031959)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA metabolic process (GO:0051053)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of gene expression (GO:0010629)|negative regulation of inflammatory response (GO:0050728)|negative regulation of leukocyte activation (GO:0002695)|negative regulation of lipid biosynthetic process (GO:0051055)|neuronal action potential (GO:0019228)|nuclear fragmentation involved in apoptotic nuclear change (GO:0030264)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of gene expression (GO:0010628)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|positive regulation of insulin secretion (GO:0032024)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neurogenesis (GO:0050769)|positive regulation of neurotransmitter secretion (GO:0001956)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of uterine smooth muscle contraction (GO:0070474)|positive regulation of vasodilation (GO:0045909)|steroid hormone mediated signaling pathway (GO:0043401)	axon (GO:0030424)|axon terminus (GO:0043679)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|dendritic spine head (GO:0044327)|dendritic spine membrane (GO:0032591)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|keratin filament (GO:0045095)|mitochondrial membrane (GO:0031966)|neuronal postsynaptic density (GO:0097481)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	chromatin binding (GO:0003682)|estrogen receptor activity (GO:0030284)|G-protein coupled receptor activity (GO:0004930)|mineralocorticoid receptor activity (GO:0017082)|steroid binding (GO:0005496)										CATCAGCTTCCGCGAGAAGAT	0.572																																					p.R88C		Atlas-SNP	.											.	GPER	25	.	0			c.C262T						.						150.0	125.0	133.0					7																	1131626		2203	4300	6503	SO:0001583	missense	2852	exon2			AGCTTCCGCGAGA	U63917	CCDS5322.1	7p22	2013-08-14	2007-07-03	2013-08-14	ENSG00000164850	ENSG00000164850			4485	protein-coding gene	gene with protein product		601805	"""G protein-coupled receptor 30"""	CMKRL2, GPR30, GPER		9479505, 17655271	Standard	NM_001098201		Approved	FEG-1, GPCR-Br, LERGU, LERGU2, DRY12, LyGPR, CEPR	uc003skb.2	Q99527	OTTHUMG00000023680	ENST00000297469.3:c.262C>T	chr7.hg19:g.1131626C>T	ENSP00000297469:p.Arg88Cys	137.0	0.0		125.0	41.0	NM_001505	A8K6C5|B5BUJ1|O00143|O43494|Q13631|Q6FHL1|Q96F42|Q99981	Missense_Mutation	SNP	ENST00000297469.3	hg19	CCDS5322.1	.	.	.	.	.	.	.	.	.	.	C	19.35	3.810061	0.70797	.	.	ENSG00000164850	ENST00000401670;ENST00000397092;ENST00000297469;ENST00000397088;ENST00000508834	T;T;T;T	0.42131	0.98;0.98;0.98;0.98	5.48	5.48	0.80851	GPCR, rhodopsin-like superfamily (1);	0.114379	0.56097	D	0.000021	T	0.70509	0.3232	M	0.87180	2.865	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	T	0.76011	-0.3115	10	0.87932	D	0	-19.7876	18.349	0.90331	0.0:1.0:0.0:0.0	.	88	Q99527	GPER_HUMAN	C	88	ENSP00000385151:R88C;ENSP00000380281:R88C;ENSP00000297469:R88C;ENSP00000380277:R88C	ENSP00000297469:R88C	R	+	1	0	GPER	1098152	1.000000	0.71417	0.993000	0.49108	0.918000	0.54935	4.453000	0.60061	2.584000	0.87258	0.643000	0.83706	CGC	.	.		0.572	GPER1-030	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060001.1	NM_001039966	
GLI3	2737	hgsc.bcm.edu	37	7	42005709	42005709	+	Missense_Mutation	SNP	C	C	T			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr7:42005709C>T	ENST00000395925.3	-	15	3046	c.2962G>A	c.(2962-2964)Ggg>Agg	p.G988R	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	988					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						TGGCGCCGCCCGTAGCCGTGG	0.761									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																												p.G988R		Atlas-SNP	.											.	GLI3	312	.	0			c.G2962A						.						4.0	5.0	4.0					7																	42005709		1829	3699	5528	SO:0001583	missense	2737	exon15	Familial Cancer Database	;	GCCGCCCGTAGCC		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.2962G>A	chr7.hg19:g.42005709C>T	ENSP00000379258:p.Gly988Arg	591.0	0.0		697.0	169.0	NM_000168	A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Missense_Mutation	SNP	ENST00000395925.3	hg19	CCDS5465.1	.	.	.	.	.	.	.	.	.	.	C	10.12	1.264134	0.23136	.	.	ENSG00000106571	ENST00000395925	T	0.14391	2.51	4.98	2.47	0.30058	.	0.372049	0.34200	N	0.004164	T	0.09818	0.0241	L	0.35854	1.095	0.80722	D	1	B	0.19331	0.035	B	0.15484	0.013	T	0.21930	-1.0231	10	0.27082	T	0.32	.	7.8654	0.29535	0.0:0.5894:0.0:0.4106	.	988	P10071	GLI3_HUMAN	R	988	ENSP00000379258:G988R	ENSP00000379258:G988R	G	-	1	0	GLI3	41972234	0.042000	0.20092	0.311000	0.25182	0.874000	0.50279	0.353000	0.20130	0.194000	0.20326	0.563000	0.77884	GGG	.	.		0.761	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	NM_000168	
ANKRD7	56311	hgsc.bcm.edu	37	7	117879966	117879966	+	Missense_Mutation	SNP	G	G	A			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr7:117879966G>A	ENST00000265224.4	+	6	871	c.716G>A	c.(715-717)aGa>aAa	p.R239K	ANKRD7_ENST00000477532.1_3'UTR|ANKRD7_ENST00000357099.4_Missense_Mutation_p.R259K|ANKRD7_ENST00000417525.1_Splice_Site|ANKRD7_ENST00000433239.1_Missense_Mutation_p.R186K	NM_019644.3	NP_062618.2	Q92527	ANKR7_HUMAN	ankyrin repeat domain 7	239					male gonad development (GO:0008584)	nucleus (GO:0005634)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)	29						TTTATAGATAGATACCCACAA	0.373																																					p.R239K		Atlas-SNP	.											ANKRD7,NS,carcinoma,0,1	ANKRD7	44	.	0			c.G716A						.						102.0	94.0	96.0					7																	117879966		1874	4109	5983	SO:0001583	missense	56311	exon6			TAGATAGATACCC	D78334	CCDS43638.1	7q31	2013-01-10			ENSG00000106013	ENSG00000106013		"""Ankyrin repeat domain containing"""	18588	protein-coding gene	gene with protein product	"""testis-specific ankyrin motif containing protein"""	610731				8812458	Standard	NM_019644		Approved	TSA806	uc003vji.3	Q92527	OTTHUMG00000156960	ENST00000265224.4:c.716G>A	chr7.hg19:g.117879966G>A	ENSP00000265224:p.Arg239Lys	48.0	0.0		56.0	18.0	NM_019644	B4DYF5|Q96QN1|Q9UDM3	Missense_Mutation	SNP	ENST00000265224.4	hg19	CCDS43638.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.655|8.655	0.899133|0.899133	0.17686|0.17686	.|.	.|.	ENSG00000106013|ENSG00000106013	ENST00000417525|ENST00000357099;ENST00000265224;ENST00000433239	.|T;T;T	.|0.38077	.|1.18;1.29;1.16	4.01|4.01	4.01|4.01	0.46588|0.46588	.|.	.|1.421560	.|0.05562	.|U	.|0.569396	.|T	.|0.28863	.|0.0716	N|N	0.22421|0.22421	0.69|0.69	0.09310|0.09310	N|N	1|1	.|D	.|0.61080	.|0.989	.|B	.|0.42916	.|0.402	.|T	.|0.10474	.|-1.0628	.|10	.|0.22109	.|T	.|0.4	.|0.1982	11.8083|11.8083	0.52169|0.52169	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|239	.|Q92527	.|ANKR7_HUMAN	.|K	-1|259;239;186	.|ENSP00000349612:R259K;ENSP00000265224:R239K;ENSP00000388473:R186K	.|ENSP00000265224:R239K	.|R	+|+	.|2	.|0	ANKRD7|ANKRD7	117667202|117667202	0.835000|0.835000	0.29415|0.29415	0.098000|0.098000	0.21074|0.21074	0.045000|0.045000	0.14185|0.14185	2.060000|2.060000	0.41394|0.41394	2.241000|2.241000	0.73720|0.73720	0.455000|0.455000	0.32223|0.32223	.|AGA	.	.		0.373	ANKRD7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346826.1	NM_001077708	
ZC3HAV1	56829	hgsc.bcm.edu	37	7	138764367	138764367	+	Silent	SNP	A	A	C			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr7:138764367A>C	ENST00000242351.5	-	4	1636	c.1320T>G	c.(1318-1320)acT>acG	p.T440T	ZC3HAV1_ENST00000464606.1_Silent_p.T440T|ZC3HAV1_ENST00000471652.1_Silent_p.T440T	NM_020119.3	NP_064504.2	Q7Z2W4	ZCCHV_HUMAN	zinc finger CCCH-type, antiviral 1	440					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral genome replication (GO:0045071)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of mRNA catabolic process (GO:0061014)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(4)|skin(1)	37						ATCTGGTAGAAGTTATATCTG	0.458																																					p.T440T		Atlas-SNP	.											.	ZC3HAV1	75	.	0			c.T1320G						.						106.0	107.0	107.0					7																	138764367		2203	4300	6503	SO:0001819	synonymous_variant	56829	exon4			GGTAGAAGTTATA	BX571742	CCDS5851.1, CCDS55171.1	7q34	2012-07-05			ENSG00000105939	ENSG00000105939		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	23721	protein-coding gene	gene with protein product	"""zinc finger antiviral protein"", "" CCCH-type zinc finger antiviral protein"""	607312				12215647, 12851707	Standard	NM_024625		Approved	ZAP, FLB6421, FLJ13288, MGC48898, ZC3HDC2, ZC3H2, PARP13	uc003vun.3	Q7Z2W4	OTTHUMG00000157471	ENST00000242351.5:c.1320T>G	chr7.hg19:g.138764367A>C		130.0	0.0		111.0	29.0	NM_024625	A4D1R2|A4D1S4|Q8IW57|Q8TAJ3|Q96N79|Q9H8R9|Q9P0Y7	Silent	SNP	ENST00000242351.5	hg19	CCDS5851.1																																																																																			.	.		0.458	ZC3HAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348915.1	NM_020119	
BMP1	649	hgsc.bcm.edu	37	8	22021530	22021530	+	5'Flank	SNP	C	C	T	rs529959941	byFrequency	TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr8:22021530C>T	ENST00000306385.5	+	0	0				BMP1_ENST00000354870.5_5'Flank|BMP1_ENST00000397814.3_5'Flank|BMP1_ENST00000397816.3_5'Flank|BMP1_ENST00000306349.8_5'Flank|SFTPC_ENST00000524255.1_Silent_p.G137G|SFTPC_ENST00000437090.2_3'UTR|SFTPC_ENST00000520605.1_Intron|SFTPC_ENST00000521315.1_Silent_p.G184G|SFTPC_ENST00000318561.3_Silent_p.G190G	NM_006129.4	NP_006120.1	P13497	BMP1_HUMAN	bone morphogenetic protein 1						cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|lipoprotein metabolic process (GO:0042157)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of cartilage development (GO:0061036)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(3)	30				Colorectal(74;0.00229)|COAD - Colon adenocarcinoma(73;0.0661)|READ - Rectum adenocarcinoma(644;0.11)		CCCTGTGTGGCGAGGTGCCGC	0.692													C|||	5	0.000998403	0.0	0.0	5008	,	,		16831	0.0		0.0	False		,,,				2504	0.0051				p.G190G		Atlas-SNP	.											.	SFTPC	19	.	0			c.C570T						.						41.0	49.0	47.0					8																	22021530		2051	4182	6233	SO:0001631	upstream_gene_variant	6440	exon5			GTGTGGCGAGGTG		CCDS6026.1, CCDS34856.1	8p21	2013-02-06	2004-08-09		ENSG00000168487	ENSG00000168487	3.4.24.19	"""Bone morphogenetic proteins"""	1067	protein-coding gene	gene with protein product	"""procollagen C-endopeptidase"""	112264	"""procollagen C-endopeptidase"""	PCOLC		2004778	Standard	NM_006129		Approved		uc003xbg.3	P13497	OTTHUMG00000097761		chr8.hg19:g.22021530C>T	Exception_encountered	153.0	0.0		129.0	38.0	NM_003018	A8K6F5|B2RN46|D3DSR0|Q13292|Q13872|Q14874|Q99421|Q99422|Q99423|Q9UL38	Silent	SNP	ENST00000306385.5	hg19	CCDS6026.1																																																																																			.	.		0.692	BMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214995.2	NM_006132	
ADAM18	8749	hgsc.bcm.edu	37	8	39537657	39537657	+	Missense_Mutation	SNP	G	G	T			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr8:39537657G>T	ENST00000265707.5	+	16	1778	c.1733G>T	c.(1732-1734)tGt>tTt	p.C578F	ADAM18_ENST00000541111.1_5'UTR|ADAM18_ENST00000379866.1_Missense_Mutation_p.C554F	NM_014237.2	NP_055052.1	Q9Y3Q7	ADA18_HUMAN	ADAM metallopeptidase domain 18	578	Cys-rich.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(31)|ovary(1)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)	71		all_cancers(7;1.32e-05)|all_epithelial(6;3.08e-10)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00769)|Breast(189;0.0112)	LUSC - Lung squamous cell carcinoma(45;0.000199)			GACCATGTATGTGTATCTATA	0.393																																					p.C578F		Atlas-SNP	.											.	ADAM18	169	.	0			c.G1733T						.						107.0	95.0	99.0					8																	39537657		2203	4300	6503	SO:0001583	missense	8749	exon16			ATGTATGTGTATC	AJ133004	CCDS6113.1, CCDS55225.1	8p11.22	2008-08-07	2005-08-18		ENSG00000168619	ENSG00000168619		"""ADAM metallopeptidase domain containing"""	196	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 18"""			12200459	Standard	NM_014237		Approved	tMDCIII, ADAM27	uc003xni.3	Q9Y3Q7	OTTHUMG00000164040	ENST00000265707.5:c.1733G>T	chr8.hg19:g.39537657G>T	ENSP00000265707:p.Cys578Phe	112.0	0.0		118.0	30.0	NM_014237	B2R9Y0|Q0VAI4|Q6IRW9|Q6UXJ9	Missense_Mutation	SNP	ENST00000265707.5	hg19	CCDS6113.1	.	.	.	.	.	.	.	.	.	.	G	13.40	2.225280	0.39300	.	.	ENSG00000168619	ENST00000265707;ENST00000379866;ENST00000522198	T;T	0.63580	-0.05;-0.05	3.85	3.85	0.44370	ADAM, cysteine-rich (2);	0.000000	0.41712	D	0.000821	D	0.82852	0.5127	H	0.94423	3.535	0.53005	D	0.999963	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.86556	0.1838	10	0.87932	D	0	.	11.5792	0.50881	0.0:0.0:1.0:0.0	.	554;578	Q9Y3Q7-2;Q9Y3Q7	.;ADA18_HUMAN	F	578;554;510	ENSP00000265707:C578F;ENSP00000369195:C554F	ENSP00000265707:C578F	C	+	2	0	ADAM18	39656814	0.802000	0.28943	0.055000	0.19348	0.010000	0.07245	3.770000	0.55310	2.451000	0.82905	0.563000	0.77884	TGT	.	.		0.393	ADAM18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376916.1	NM_014237	
ARFGEF1	10565	hgsc.bcm.edu	37	8	68208769	68208769	+	Missense_Mutation	SNP	T	T	C			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr8:68208769T>C	ENST00000262215.3	-	5	925	c.536A>G	c.(535-537)tAc>tGc	p.Y179C		NM_006421.4	NP_006412.2	Q9Y6D6	BIG1_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)	179	DCB; DCB:DCB domain and DCB:HUS domain interaction.				endomembrane system organization (GO:0010256)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein glycosylation in Golgi (GO:0090284)|positive regulation of wound healing (GO:0090303)|protein transport (GO:0015031)|regulation of ARF protein signal transduction (GO:0032012)|regulation of establishment of cell polarity (GO:2000114)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|small nuclear ribonucleoprotein complex (GO:0030532)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|guanyl-nucleotide exchange factor activity (GO:0005085)|myosin binding (GO:0017022)|protein kinase A regulatory subunit binding (GO:0034237)			breast(1)|endometrium(14)|kidney(4)|large_intestine(17)|lung(20)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			GTAGATATTGTAACATGTTCT	0.363																																					p.Y179C		Atlas-SNP	.											.	ARFGEF1	196	.	0			c.A536G						.						192.0	170.0	177.0					8																	68208769		2203	4300	6503	SO:0001583	missense	10565	exon5			ATATTGTAACATG	AF084520	CCDS6199.1	8q13	2011-08-18	2011-08-18		ENSG00000066777	ENSG00000066777			15772	protein-coding gene	gene with protein product		604141				10212200, 8917509	Standard	NM_006421		Approved	DKFZP434L057, BIG1, ARFGEP1, p200	uc003xxo.2	Q9Y6D6	OTTHUMG00000164626	ENST00000262215.3:c.536A>G	chr8.hg19:g.68208769T>C	ENSP00000262215:p.Tyr179Cys	90.0	0.0		93.0	23.0	NM_006421	Q9NV46|Q9UFV2|Q9UNL0	Missense_Mutation	SNP	ENST00000262215.3	hg19	CCDS6199.1	.	.	.	.	.	.	.	.	.	.	T	19.31	3.802530	0.70682	.	.	ENSG00000066777	ENST00000262215	T	0.40476	1.03	4.89	3.7	0.42460	Armadillo-type fold (1);	0.067502	0.64402	D	0.000008	T	0.73329	0.3573	H	0.96142	3.775	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.79715	-0.1687	10	0.87932	D	0	.	11.8351	0.52319	0.0:0.0:0.1463:0.8537	.	179	Q9Y6D6	BIG1_HUMAN	C	179	ENSP00000262215:Y179C	ENSP00000262215:Y179C	Y	-	2	0	ARFGEF1	68371323	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.103000	0.71492	0.694000	0.31654	0.477000	0.44152	TAC	.	.		0.363	ARFGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379441.4	NM_006421	
ZDHHC12	84885	hgsc.bcm.edu	37	9	131484347	131484347	+	Missense_Mutation	SNP	G	G	C			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr9:131484347G>C	ENST00000372663.4	-	3	268	c.256C>G	c.(256-258)Cag>Gag	p.Q86E	ZDHHC12_ENST00000467312.1_5'UTR|ZDHHC12_ENST00000372667.5_Missense_Mutation_p.Q100E|ZDHHC12_ENST00000372672.2_Missense_Mutation_p.Q86E|RP11-545E17.3_ENST00000443631.1_RNA	NM_032799.4	NP_116188	Q96GR4	ZDH12_HUMAN	zinc finger, DHHC-type containing 12	86					protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			central_nervous_system(1)|ovary(2)|upper_aerodigestive_tract(1)	4						ATGGCTGTCTGCTCCTCTTTG	0.622																																					p.Q86E		Atlas-SNP	.											.	ZDHHC12	14	.	0			c.C256G						.						132.0	111.0	118.0					9																	131484347		2203	4300	6503	SO:0001583	missense	84885	exon3			CTGTCTGCTCCTC	AK027430	CCDS6909.1	9q34.11	2008-02-05			ENSG00000160446	ENSG00000160446		"""Zinc fingers, DHHC-type"""	19159	protein-coding gene	gene with protein product							Standard	NM_032799		Approved	ZNF400, FLJ14524	uc004bvy.3	Q96GR4	OTTHUMG00000020756	ENST00000372663.4:c.256C>G	chr9.hg19:g.131484347G>C	ENSP00000361748:p.Gln86Glu	103.0	0.0		115.0	23.0	NM_032799	A6NH95|B2RE03|Q5T265|Q5T267|Q5T268|Q86VT5|Q96T09	Missense_Mutation	SNP	ENST00000372663.4	hg19	CCDS6909.1	.	.	.	.	.	.	.	.	.	.	G	8.339	0.828352	0.16749	.	.	ENSG00000160446	ENST00000372663;ENST00000372672;ENST00000372667;ENST00000372664;ENST00000452105;ENST00000406904	T;T;T;T	0.25085	1.82;1.82;1.82;1.82	4.21	4.21	0.49690	.	0.263978	0.37906	N	0.001890	T	0.19525	0.0469	L	0.56280	1.765	0.26449	N	0.975632	B;B	0.33000	0.218;0.393	B;B	0.29077	0.059;0.098	T	0.24440	-1.0160	10	0.02654	T	1	.	12.4505	0.55675	0.0:0.0:1.0:0.0	.	141;86	Q96GR4-3;Q96GR4	.;ZDH12_HUMAN	E	86;86;100;86;86;141	ENSP00000361748:Q86E;ENSP00000361752:Q100E;ENSP00000387587:Q86E;ENSP00000384205:Q141E	ENSP00000361748:Q86E	Q	-	1	0	ZDHHC12	130524168	0.989000	0.36119	1.000000	0.80357	0.475000	0.33008	3.606000	0.54095	2.074000	0.62210	0.456000	0.33151	CAG	.	.		0.622	ZDHHC12-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054484.1	NM_032799	
KIAA1217	56243	hgsc.bcm.edu	37	10	24816985	24816985	+	Missense_Mutation	SNP	A	A	T			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr10:24816985A>T	ENST00000376454.3	+	14	3049	c.3019A>T	c.(3019-3021)Atg>Ttg	p.M1007L	KIAA1217_ENST00000396445.1_Missense_Mutation_p.M690L|KIAA1217_ENST00000430453.2_3'UTR|KIAA1217_ENST00000376452.3_Missense_Mutation_p.M972L|KIAA1217_ENST00000376462.1_Missense_Mutation_p.M927L|KIAA1217_ENST00000458595.1_Missense_Mutation_p.M972L|KIAA1217_ENST00000307544.6_Missense_Mutation_p.M690L|KIAA1217_ENST00000396446.1_Missense_Mutation_p.M690L|KIAA1217_ENST00000376451.2_Missense_Mutation_p.M690L	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	1007					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)				breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						AAATCTGGAGATGCCGCCAGC	0.488																																					p.M1007L		Atlas-SNP	.											.	KIAA1217	235	.	0			c.A3019T						.						69.0	71.0	71.0					10																	24816985		2203	4300	6503	SO:0001583	missense	56243	exon14			CTGGAGATGCCGC	BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.3019A>T	chr10.hg19:g.24816985A>T	ENSP00000365637:p.Met1007Leu	144.0	0.0		162.0	34.0	NM_019590	A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Missense_Mutation	SNP	ENST00000376454.3	hg19	CCDS31165.1	.	.	.	.	.	.	.	.	.	.	A	17.46	3.394783	0.62066	.	.	ENSG00000120549	ENST00000376462;ENST00000458595;ENST00000442879;ENST00000376454;ENST00000376452;ENST00000307544;ENST00000450158;ENST00000396445;ENST00000376451;ENST00000396446	T;T;T;T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86	6.11	4.98	0.66077	.	0.214995	0.52532	D	0.000077	T	0.38348	0.1037	L	0.59436	1.845	0.31062	N	0.714028	B;B;B;B;P;B;P;B	0.44006	0.169;0.126;0.066;0.08;0.824;0.447;0.649;0.264	B;B;B;B;B;B;B;B	0.38880	0.082;0.035;0.049;0.074;0.284;0.108;0.266;0.131	T	0.39961	-0.9588	10	0.10902	T	0.67	.	9.1493	0.36953	0.8619:0.0:0.1381:0.0	.	972;972;690;690;690;690;1007;1007	Q5T5P2-7;A6NLF3;Q5T5P2-4;Q5T5P2-8;Q5T5P2-3;Q5T5P2-6;Q5T5P2;Q5T5P2-2	.;.;.;.;.;.;SKT_HUMAN;.	L	927;972;690;1007;972;690;690;690;690;690	ENSP00000365645:M927L;ENSP00000392625:M972L;ENSP00000365637:M1007L;ENSP00000365635:M972L;ENSP00000302343:M690L;ENSP00000379722:M690L;ENSP00000365634:M690L;ENSP00000379723:M690L	ENSP00000302343:M690L	M	+	1	0	KIAA1217	24856991	1.000000	0.71417	1.000000	0.80357	0.815000	0.46073	3.179000	0.50887	1.142000	0.42291	0.533000	0.62120	ATG	.	.		0.488	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047223.2	NM_019590	
OR51L1	119682	hgsc.bcm.edu	37	11	5020793	5020793	+	Missense_Mutation	SNP	C	C	G			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr11:5020793C>G	ENST00000321543.1	+	1	581	c.581C>G	c.(580-582)gCc>gGc	p.A194G		NM_001004755.1	NP_001004755.1	Q8NGJ5	O51L1_HUMAN	olfactory receptor, family 51, subfamily L, member 1	194						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A194D(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(19)|skin(2)|stomach(1)	31		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)		Epithelial(150;1.75e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGTACAGATGCCAGGACCAAC	0.428																																					p.A194G		Atlas-SNP	.											OR51L1,NS,carcinoma,0,1	OR51L1	60	.	1	Substitution - Missense(1)	lung(1)	c.C581G						.						223.0	190.0	202.0					11																	5020793		2201	4298	6499	SO:0001583	missense	119682	exon1			CAGATGCCAGGAC	AB065799	CCDS31369.1	11p15.4	2012-08-09			ENSG00000176798	ENSG00000176798		"""GPCR / Class A : Olfactory receptors"""	14759	protein-coding gene	gene with protein product							Standard	NM_001004755		Approved		uc010qyu.2	Q8NGJ5	OTTHUMG00000066605	ENST00000321543.1:c.581C>G	chr11.hg19:g.5020793C>G	ENSP00000322156:p.Ala194Gly	154.0	0.0		131.0	27.0	NM_001004755	Q6IFE5	Missense_Mutation	SNP	ENST00000321543.1	hg19	CCDS31369.1	.	.	.	.	.	.	.	.	.	.	C	12.22	1.871682	0.33069	.	.	ENSG00000176798	ENST00000321543	T	0.00158	8.65	5.18	5.18	0.71444	GPCR, rhodopsin-like superfamily (1);	0.157082	0.29916	N	0.010875	T	0.00328	0.0010	L	0.59436	1.845	0.09310	N	0.999999	D	0.67145	0.996	P	0.60173	0.87	T	0.56944	-0.7895	10	0.87932	D	0	.	10.9225	0.47174	0.0:0.9145:0.0:0.0855	.	194	Q8NGJ5	O51L1_HUMAN	G	194	ENSP00000322156:A194G	ENSP00000322156:A194G	A	+	2	0	OR51L1	4977369	0.000000	0.05858	0.992000	0.48379	0.029000	0.11900	-0.288000	0.08377	2.685000	0.91497	0.557000	0.71058	GCC	.	.		0.428	OR51L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142812.1	NM_001004755	
OR52W1	120787	hgsc.bcm.edu	37	11	6221115	6221115	+	Missense_Mutation	SNP	G	G	T			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr11:6221115G>T	ENST00000311352.2	+	1	740	c.662G>T	c.(661-663)gGc>gTc	p.G221V	RP11-290F24.6_ENST00000600308.1_lincRNA	NM_001005178.1	NP_001005178.1	Q6IF63	O52W1_HUMAN	olfactory receptor, family 52, subfamily W, member 1	221						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(2)|large_intestine(1)|lung(6)	11		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;2.13e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGTATCACTGGCTCCTATGGA	0.522																																					p.G221V		Atlas-SNP	.											OR52W1,NS,carcinoma,0,1	OR52W1	33	.	0			c.G662T						.						193.0	171.0	178.0					11																	6221115		2201	4296	6497	SO:0001583	missense	120787	exon1			TCACTGGCTCCTA	AB065511	CCDS31407.1	11p15.4	2012-08-09		2004-03-10	ENSG00000175485	ENSG00000175485		"""GPCR / Class A : Olfactory receptors"""	15239	protein-coding gene	gene with protein product				OR52W1P			Standard	NM_001005178		Approved		uc010qzz.2	Q6IF63	OTTHUMG00000165378	ENST00000311352.2:c.662G>T	chr11.hg19:g.6221115G>T	ENSP00000309673:p.Gly221Val	98.0	0.0		91.0	26.0	NM_001005178	Q8NH78	Missense_Mutation	SNP	ENST00000311352.2	hg19	CCDS31407.1	.	.	.	.	.	.	.	.	.	.	G	0.719	-0.784427	0.02907	.	.	ENSG00000175485	ENST00000311352	T	0.32753	1.44	4.7	1.54	0.23209	GPCR, rhodopsin-like superfamily (1);	0.401855	0.18065	N	0.152812	T	0.09949	0.0244	N	0.02876	-0.465	0.21355	N	0.999714	B	0.17268	0.021	B	0.15870	0.014	T	0.37103	-0.9720	10	0.02654	T	1	.	8.7092	0.34374	0.0:0.2509:0.463:0.2861	.	221	Q6IF63	O52W1_HUMAN	V	221	ENSP00000309673:G221V	ENSP00000309673:G221V	G	+	2	0	OR52W1	6177691	0.001000	0.12720	0.002000	0.10522	0.755000	0.42902	1.018000	0.30002	0.211000	0.20683	0.563000	0.77884	GGC	.	.		0.522	OR52W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383758.1	NM_001005178	
PCNXL3	399909	hgsc.bcm.edu	37	11	65380603	65380603	+	5'Flank	SNP	G	G	A			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr11:65380603G>A	ENST00000355703.3	+	0	0				MAP3K11_ENST00000309100.3_Missense_Mutation_p.R209C|MAP3K11_ENST00000530153.1_5'Flank	NM_032223.2	NP_115599.2	Q9H6A9	PCX3_HUMAN	pecanex-like 3 (Drosophila)							integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)	13						GGAGGCACGCGCCGCCCGGCC	0.657																																					p.R209C		Atlas-SNP	.											.	MAP3K11	67	.	0			c.C625T						.						46.0	46.0	46.0					11																	65380603		2200	4297	6497	SO:0001631	upstream_gene_variant	4296	exon1			GCACGCGCCGCCC	BX640978	CCDS44650.1	11q12.1	2008-07-21			ENSG00000197136	ENSG00000197136			18760	protein-coding gene	gene with protein product						15146197	Standard	NM_032223		Approved	FLJ22427	uc001oey.2	Q9H6A9	OTTHUMG00000166539		chr11.hg19:g.65380603G>A	Exception_encountered	57.0	0.0		69.0	16.0	NM_002419	Q6MZN8	Missense_Mutation	SNP	ENST00000355703.3	hg19	CCDS44650.1	.	.	.	.	.	.	.	.	.	.	G	11.99	1.802406	0.31869	.	.	ENSG00000173327	ENST00000309100	D	0.94092	-3.35	3.92	2.95	0.34219	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000004	D	0.95367	0.8496	M	0.73753	2.245	0.37551	D	0.9187	D	0.89917	1.0	D	0.74348	0.983	D	0.95631	0.8689	10	0.87932	D	0	.	9.0887	0.36596	0.0:0.0:0.6396:0.3604	.	209	Q16584	M3K11_HUMAN	C	209	ENSP00000309597:R209C	ENSP00000309597:R209C	R	-	1	0	MAP3K11	65137179	0.961000	0.32948	0.965000	0.40720	0.059000	0.15707	1.863000	0.39459	2.027000	0.59764	0.655000	0.94253	CGC	.	.		0.657	PCNXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390321.1	NM_032223	
OR10G4	390264	hgsc.bcm.edu	37	11	123886314	123886314	+	Silent	SNP	C	C	T			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr11:123886314C>T	ENST00000320891.4	+	1	33	c.33C>T	c.(31-33)atC>atT	p.I11I		NM_001004462.1	NP_001004462.1	Q8NGN3	O10G4_HUMAN	olfactory receptor, family 10, subfamily G, member 4	11						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)|skin(4)|stomach(6)|upper_aerodigestive_tract(1)	48		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		CAGCATTCATCCTCACAGGCC	0.547																																					p.I11I		Atlas-SNP	.											.	OR10G4	77	.	0			c.C33T						.						147.0	103.0	118.0					11																	123886314		2202	4299	6501	SO:0001819	synonymous_variant	390264	exon1			ATTCATCCTCACA	AB065757	CCDS31702.1	11q24.1	2012-08-09			ENSG00000254737	ENSG00000254737		"""GPCR / Class A : Olfactory receptors"""	14809	protein-coding gene	gene with protein product							Standard	NM_001004462		Approved		uc010sac.2	Q8NGN3	OTTHUMG00000165966	ENST00000320891.4:c.33C>T	chr11.hg19:g.123886314C>T		114.0	0.0		114.0	30.0	NM_001004462	Q6IEW0	Silent	SNP	ENST00000320891.4	hg19	CCDS31702.1																																																																																			.	.		0.547	OR10G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387268.1	NM_001004462	
C12orf40	283461	hgsc.bcm.edu	37	12	40076537	40076537	+	Missense_Mutation	SNP	G	G	T			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr12:40076537G>T	ENST00000324616.5	+	8	965	c.811G>T	c.(811-813)Ggg>Tgg	p.G271W	C12orf40_ENST00000398716.1_Missense_Mutation_p.G194W|C12orf40_ENST00000405531.3_Missense_Mutation_p.G271W	NM_001031748.2	NP_001026918.2	Q86WS4	CL040_HUMAN	chromosome 12 open reading frame 40	271										breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(14)|ovary(6)|prostate(1)|skin(2)	38						GCATATTTGGGGGAAAAATGG	0.348																																					p.G271W		Atlas-SNP	.											C12orf40,trunk,malignant_melanoma,-1,1	C12orf40	118	.	0			c.G811T						.						135.0	135.0	135.0					12																	40076537		1841	4083	5924	SO:0001583	missense	283461	exon8			ATTTGGGGGAAAA	AK097445	CCDS41770.1	12q12	2008-08-04			ENSG00000180116	ENSG00000180116			26846	protein-coding gene	gene with protein product						12477932	Standard	XM_005268806		Approved	FLJ40126	uc001rmc.3	Q86WS4	OTTHUMG00000133567	ENST00000324616.5:c.811G>T	chr12.hg19:g.40076537G>T	ENSP00000317671:p.Gly271Trp	107.0	0.0		124.0	21.0	NM_001031748	B7WNU1|Q8IXY6|Q8N818|V9HW02	Missense_Mutation	SNP	ENST00000324616.5	hg19	CCDS41770.1	.	.	.	.	.	.	.	.	.	.	G	7.838	0.721194	0.15372	.	.	ENSG00000180116	ENST00000405531;ENST00000398716;ENST00000324616	T;T	0.53206	0.63;0.64	5.26	3.42	0.39159	.	0.894443	0.09527	N	0.790054	T	0.53610	0.1807	L	0.27053	0.805	0.09310	N	1	D	0.57257	0.979	P	0.59948	0.866	T	0.49560	-0.8927	10	0.72032	D	0.01	.	12.644	0.56723	0.1515:0.0:0.8485:0.0	.	271	Q86WS4	CL040_HUMAN	W	271;194;271	ENSP00000383897:G271W;ENSP00000317671:G271W	ENSP00000317671:G271W	G	+	1	0	C12orf40	38362804	0.030000	0.19436	0.000000	0.03702	0.001000	0.01503	0.930000	0.28858	0.445000	0.26639	-1.094000	0.02160	GGG	.	.		0.348	C12orf40-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257664.2	NM_173599	
ARID2	196528	hgsc.bcm.edu	37	12	46254732	46254732	+	Splice_Site	SNP	A	A	C			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr12:46254732A>C	ENST00000334344.6	+	16	5094	c.4922A>C	c.(4921-4923)aAg>aCg	p.K1641T	ARID2_ENST00000457135.1_Splice_Site_p.K249T|ARID2_ENST00000444670.1_Splice_Site_p.K1251T|ARID2_ENST00000479608.1_3'UTR|ARID2_ENST00000422737.1_Splice_Site_p.K1492T	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	1641					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		TCTTGTAAAAAGTAAATGGCA	0.343			"""N, S, F"""		hepatocellular carcinoma																																p.K1641T		Atlas-SNP	.		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	.	ARID2	311	.	0			c.A4922C						.						44.0	46.0	45.0					12																	46254732		2203	4300	6503	SO:0001630	splice_region_variant	196528	exon16			GTAAAAAGTAAAT		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.4922+1A>C	chr12.hg19:g.46254732A>C		75.0	0.0		53.0	14.0	NM_152641	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Missense_Mutation	SNP	ENST00000334344.6	hg19	CCDS31783.1	.	.	.	.	.	.	.	.	.	.	A	17.52	3.411379	0.62399	.	.	ENSG00000189079	ENST00000334344;ENST00000549153;ENST00000338636;ENST00000422737;ENST00000444670;ENST00000457135	T;T	0.35048	1.33;1.52	5.86	5.86	0.93980	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.052017	0.64402	D	0.000001	T	0.52869	0.1761	L	0.49126	1.545	0.58432	D	0.999998	D;D;P	0.67145	0.996;0.996;0.783	P;P;B	0.61874	0.895;0.851;0.285	T	0.54695	-0.8255	10	0.87932	D	0	-8.3742	16.2644	0.82568	1.0:0.0:0.0:0.0	.	1641;1251;1641	Q68CP9-3;F8W108;Q68CP9	.;.;ARID2_HUMAN	T	1641;758;758;1492;1251;249	ENSP00000335044:K1641T;ENSP00000388357:K249T	ENSP00000335044:K1641T	K	+	2	0	ARID2	44540999	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.024000	0.76443	2.244000	0.73946	0.528000	0.53228	AAG	.	.		0.343	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875	Missense_Mutation
NCKAP1L	3071	hgsc.bcm.edu	37	12	54910690	54910690	+	Missense_Mutation	SNP	C	C	T			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr12:54910690C>T	ENST00000293373.6	+	11	1088	c.1009C>T	c.(1009-1011)Cat>Tat	p.H337Y	NCKAP1L_ENST00000545638.2_Missense_Mutation_p.H287Y|NCKAP1L_ENST00000552211.1_3'UTR	NM_005337.4	NP_005328.2	P55160	NCKPL_HUMAN	NCK-associated protein 1-like	337					actin polymerization-dependent cell motility (GO:0070358)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|chemotaxis (GO:0006935)|cortical actin cytoskeleton organization (GO:0030866)|erythrocyte development (GO:0048821)|maintenance of cell polarity (GO:0030011)|myeloid cell homeostasis (GO:0002262)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of myosin-light-chain-phosphatase activity (GO:0035509)|neutrophil chemotaxis (GO:0030593)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of CD8-positive, alpha-beta T cell differentiation (GO:0043378)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of lymphocyte differentiation (GO:0045621)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of T cell proliferation (GO:0042102)|protein complex assembly (GO:0006461)|response to drug (GO:0042493)|T cell homeostasis (GO:0043029)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)|protein kinase activator activity (GO:0030295)|Rac GTPase activator activity (GO:0030675)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(37)|ovary(3)|prostate(3)|skin(3)|stomach(2)	80						TGGCCAGTTTCATTGTCAACG	0.498																																					p.H337Y		Atlas-SNP	.											NCKAP1L,NS,lymphoid_neoplasm,0,1	NCKAP1L	180	.	0			c.C1009T						.						122.0	114.0	117.0					12																	54910690		2203	4300	6503	SO:0001583	missense	3071	exon11			CAGTTTCATTGTC	AI924363	CCDS31813.1, CCDS53799.1	12q13.1	2005-10-11	2005-10-11	2005-10-11		ENSG00000123338			4862	protein-coding gene	gene with protein product		141180	"""hematopoietic protein 1"""	HEM1		1932118	Standard	NM_005337		Approved		uc001sgc.4	P55160	OTTHUMG00000169843	ENST00000293373.6:c.1009C>T	chr12.hg19:g.54910690C>T	ENSP00000293373:p.His337Tyr	121.0	0.0		105.0	26.0	NM_005337	B4DUT5|Q52LW0	Missense_Mutation	SNP	ENST00000293373.6	hg19	CCDS31813.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808739	0.90707	.	.	ENSG00000123338	ENST00000293373;ENST00000545638	T;T	0.56444	0.46;0.46	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.71771	0.3379	M	0.79011	2.435	0.54753	D	0.999982	D	0.63046	0.992	D	0.64042	0.921	T	0.75792	-0.3193	10	0.87932	D	0	-18.2617	16.554	0.84481	0.0:1.0:0.0:0.0	.	337	P55160	NCKPL_HUMAN	Y	337;287	ENSP00000293373:H337Y;ENSP00000445596:H287Y	ENSP00000293373:H337Y	H	+	1	0	NCKAP1L	53196957	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.252000	0.78309	2.578000	0.87016	0.591000	0.81541	CAT	.	.		0.498	NCKAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406195.1	NM_005337	
NAV3	89795	hgsc.bcm.edu	37	12	78553012	78553012	+	Missense_Mutation	SNP	C	C	A			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr12:78553012C>A	ENST00000397909.2	+	23	4988	c.4815C>A	c.(4813-4815)agC>agA	p.S1605R	NAV3_ENST00000536525.2_Missense_Mutation_p.S1605R|NAV3_ENST00000266692.7_Missense_Mutation_p.S1428R|NAV3_ENST00000228327.6_Missense_Mutation_p.S1605R			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1605						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						TTGAAAAGAGCTTAGGGAATA	0.393										HNSCC(70;0.22)																											p.S1605R		Atlas-SNP	.											.	NAV3	506	.	0			c.C4815A						.						124.0	114.0	117.0					12																	78553012		1853	4091	5944	SO:0001583	missense	89795	exon23			AAAGAGCTTAGGG	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.4815C>A	chr12.hg19:g.78553012C>A	ENSP00000381007:p.Ser1605Arg	61.0	0.0		70.0	15.0	NM_014903	Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.27|18.27	3.587294|3.587294	0.66105|0.66105	.|.	.|.	ENSG00000067798|ENSG00000067798	ENST00000552895|ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692;ENST00000378640;ENST00000550788	.|D;D;D;D;D	.|0.94650	.|-3.48;-3.48;-3.48;-3.48;-3.48	5.44|5.44	-0.251|-0.251	0.13003|0.13003	.|.	.|0.000000	.|0.47852	.|U	.|0.000215	D|D	0.95984|0.95984	0.8692|0.8692	M|M	0.78049|0.78049	2.395|2.395	0.80722|0.80722	D|D	1|1	.|D;D;P;D	.|0.76494	.|0.983;0.997;0.954;0.999	.|P;D;B;D	.|0.80764	.|0.796;0.991;0.393;0.994	D|D	0.94241|0.94241	0.7485|0.7485	5|10	.|0.87932	.|D	.|0	-17.1767|-17.1767	8.7911|8.7911	0.34852|0.34852	0.0:0.6348:0.0:0.3652|0.0:0.6348:0.0:0.3652	.|.	.|1605;1428;1605;1605	.|E7EUC6;Q8IVL0-3;Q8IVL0;Q8IVL0-2	.|.;.;NAV3_HUMAN;.	I|R	500|1605;1605;1605;1428;226;234	.|ENSP00000446132:S1605R;ENSP00000381007:S1605R;ENSP00000228327:S1605R;ENSP00000266692:S1428R;ENSP00000448303:S234R	.|ENSP00000228327:S1605R	L|S	+|+	1|3	0|2	NAV3|NAV3	77077143|77077143	0.999000|0.999000	0.42202|0.42202	0.997000|0.997000	0.53966|0.53966	0.995000|0.995000	0.86356|0.86356	0.636000|0.636000	0.24644|0.24644	0.122000|0.122000	0.18314|0.18314	-0.290000|-0.290000	0.09829|0.09829	CTT|AGC	.	.		0.393	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383	
LINC00283	100874057	hgsc.bcm.edu	37	13	103398882	103398882	+	RNA	SNP	A	A	G			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr13:103398882A>G	ENST00000430111.1	+	0	3894									long intergenic non-protein coding RNA 283																		TCTAATTCTGATTTCTTTCTG	0.383																																					p.S1389P		Atlas-SNP	.											.	.	.	.	0			c.T4165C						.						158.0	137.0	143.0					13																	103398882		692	1591	2283			643677	exon4			ATTCTGATTTCTT			13q33.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000231633	ENSG00000231633		"""Long non-coding RNAs"""	38809	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 283"""	NCRNA00283			Standard			Approved				OTTHUMG00000017311		chr13.hg19:g.103398882A>G		49.0	0.0		62.0	12.0	NM_001146197		Missense_Mutation	SNP	ENST00000430111.1	hg19																																																																																				.	.		0.383	LINC00283-001	KNOWN	not_organism_supported|basic	antisense	antisense	OTTHUMT00000045714.1		
EIF2AK4	440275	hgsc.bcm.edu	37	15	40265138	40265138	+	Missense_Mutation	SNP	G	G	T			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr15:40265138G>T	ENST00000263791.5	+	10	1626	c.1583G>T	c.(1582-1584)tGg>tTg	p.W528L	EIF2AK4_ENST00000382727.2_Missense_Mutation_p.W528L|EIF2AK4_ENST00000559624.1_Missense_Mutation_p.W528L	NM_001013703.2	NP_001013725.2	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha kinase 4	528	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to starvation (GO:0009267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of translation (GO:0017148)|protein phosphorylation (GO:0006468)|regulation of translational initiation (GO:0006446)|regulation of translational initiation in response to stress (GO:0043558)	cytosolic ribosome (GO:0022626)	ATP binding (GO:0005524)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)	40		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		AAGGAAAGATGGAGTCCCCAG	0.423																																					p.W528L		Atlas-SNP	.											.	EIF2AK4	107	.	0			c.G1583T						.						116.0	112.0	114.0					15																	40265138		1895	4131	6026	SO:0001583	missense	440275	exon10			AAAGATGGAGTCC	AB037759	CCDS42016.1	15q13.3	2008-08-18				ENSG00000128829			19687	protein-coding gene	gene with protein product		609280				10504407	Standard	XM_005254392		Approved	GCN2, KIAA1338	uc001zkm.1	Q9P2K8		ENST00000263791.5:c.1583G>T	chr15.hg19:g.40265138G>T	ENSP00000263791:p.Trp528Leu	116.0	0.0		160.0	30.0	NM_001013703	C9JEC4|Q69YL7|Q6DC97|Q96GN6|Q9H5K1|Q9NSQ3|Q9NSZ5|Q9UJ56	Missense_Mutation	SNP	ENST00000263791.5	hg19	CCDS42016.1	.	.	.	.	.	.	.	.	.	.	G	19.02	3.745444	0.69418	.	.	ENSG00000128829	ENST00000263791;ENST00000382727	T;T	0.71461	-0.57;-0.57	5.84	5.84	0.93424	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.75317	0.3833	N	0.25825	0.765	0.80722	D	1	D;D	0.89917	1.0;0.995	D;D	0.91635	0.999;0.959	T	0.67130	-0.5748	10	0.10377	T	0.69	-9.6195	20.1336	0.98010	0.0:0.0:1.0:0.0	.	528;528	Q9P2K8;Q9P2K8-3	E2AK4_HUMAN;.	L	528	ENSP00000263791:W528L;ENSP00000372174:W528L	ENSP00000263791:W528L	W	+	2	0	EIF2AK4	38052430	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.179000	0.89692	2.767000	0.95098	0.591000	0.81541	TGG	.	.		0.423	EIF2AK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418395.1		
TLN2	83660	hgsc.bcm.edu	37	15	63011973	63011973	+	Missense_Mutation	SNP	C	C	A			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr15:63011973C>A	ENST00000561311.1	+	24	3115	c.2885C>A	c.(2884-2886)gCt>gAt	p.A962D	TLN2_ENST00000306829.6_Missense_Mutation_p.A962D			Q9Y4G6	TLN2_HUMAN	talin 2	962	Ala-rich.				cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						CAGGCAGTGGCTGATCACATC	0.537																																					p.A962D		Atlas-SNP	.											.	TLN2	253	.	0			c.C2885A						.						60.0	48.0	52.0					15																	63011973		2203	4300	6503	SO:0001583	missense	83660	exon22			CAGTGGCTGATCA	AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.2885C>A	chr15.hg19:g.63011973C>A	ENSP00000453508:p.Ala962Asp	23.0	0.0		29.0	10.0	NM_015059	A6NLB8	Missense_Mutation	SNP	ENST00000561311.1	hg19	CCDS32261.1	.	.	.	.	.	.	.	.	.	.	C	33	5.218013	0.95104	.	.	ENSG00000171914	ENST00000306829	T	0.69926	-0.44	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	D	0.82595	0.5071	M	0.78637	2.42	0.80722	D	1	D	0.69078	0.997	D	0.68943	0.961	D	0.83420	0.0032	10	0.62326	D	0.03	-12.2663	19.9103	0.97024	0.0:1.0:0.0:0.0	.	962	Q9Y4G6	TLN2_HUMAN	D	962	ENSP00000303476:A962D	ENSP00000303476:A962D	A	+	2	0	TLN2	60799265	1.000000	0.71417	0.999000	0.59377	0.926000	0.56050	7.772000	0.85439	2.765000	0.95021	0.650000	0.86243	GCT	.	.		0.537	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257878.2		
CLPX	10845	hgsc.bcm.edu	37	15	65472498	65472498	+	Missense_Mutation	SNP	C	C	T			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr15:65472498C>T	ENST00000300107.3	-	2	312	c.124G>A	c.(124-126)Ggg>Agg	p.G42R		NM_006660.3	NP_006651.2	O76031	CLPX_HUMAN	caseinolytic mitochondrial matrix peptidase chaperone subunit	42					ATP catabolic process (GO:0006200)|positive regulation of peptidase activity (GO:0010952)|protein folding (GO:0006457)|proteolysis involved in cellular protein catabolic process (GO:0051603)	endopeptidase Clp complex (GO:0009368)|mitochondrial endopeptidase Clp complex (GO:0009841)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|metal ion binding (GO:0046872)|peptidase activator activity (GO:0016504)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(4)|prostate(1)|skin(2)	16						TCAAATGTCCCAAGCCTTCCT	0.388																																					p.G42R		Atlas-SNP	.											.	CLPX	49	.	0			c.G124A						.						91.0	93.0	92.0					15																	65472498		2202	4299	6501	SO:0001583	missense	10845	exon2			ATGTCCCAAGCCT	AJ006267	CCDS10202.1	15q22.31	2013-09-12	2013-09-12		ENSG00000166855	ENSG00000166855		"""ATPases / AAA-type"""	2088	protein-coding gene	gene with protein product		615611	"""ClpX (caseinolytic protease X, E. coli) homolog"", ""ClpX caseinolytic protease X homolog (E. coli)"", ""ClpX caseinolytic peptidase X homolog (E. coli)"""			22841477	Standard	NM_006660		Approved		uc002aom.3	O76031	OTTHUMG00000133139	ENST00000300107.3:c.124G>A	chr15.hg19:g.65472498C>T	ENSP00000300107:p.Gly42Arg	104.0	0.0		155.0	39.0	NM_006660	A1L428|A8K8F1|B9EGI8|Q9H4D9	Missense_Mutation	SNP	ENST00000300107.3	hg19	CCDS10202.1	.	.	.	.	.	.	.	.	.	.	C	15.29	2.789190	0.49997	.	.	ENSG00000166855	ENST00000300107;ENST00000546194	T	0.17691	2.26	6.17	5.25	0.73442	.	0.101965	0.64402	D	0.000002	T	0.12178	0.0296	N	0.22421	0.69	0.47308	D	0.999384	B;B	0.14805	0.011;0.006	B;B	0.15052	0.012;0.012	T	0.08700	-1.0709	10	0.35671	T	0.21	.	11.0179	0.47701	0.0:0.8037:0.13:0.0663	.	42;42	Q9H072;O76031	.;CLPX_HUMAN	R	42	ENSP00000300107:G42R	ENSP00000300107:G42R	G	-	1	0	CLPX	63259551	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.705000	0.54823	1.616000	0.50265	0.655000	0.94253	GGG	.	.		0.388	CLPX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256828.2	NM_006660	
ANKFN1	162282	hgsc.bcm.edu	37	17	54535228	54535228	+	Missense_Mutation	SNP	C	C	T			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr17:54535228C>T	ENST00000318698.2	+	13	1489	c.1454C>T	c.(1453-1455)tCt>tTt	p.S485F	ANKFN1_ENST00000566473.2_Missense_Mutation_p.S485F	NM_153228.2	NP_694960.2	Q8N957	ANKF1_HUMAN	ankyrin-repeat and fibronectin type III domain containing 1	485										NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(11)|lung(27)|ovary(1)|prostate(1)|skin(1)	53						TTGCAGCTGTCTTGTATGTGG	0.473																																					p.S485F		Atlas-SNP	.											.	ANKFN1	115	.	0			c.C1454T						.						180.0	148.0	159.0					17																	54535228		2203	4300	6503	SO:0001583	missense	162282	exon13			AGCTGTCTTGTAT	AK095654	CCDS32686.1	17q23.2	2014-02-12	2005-11-15		ENSG00000153930	ENSG00000153930		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	26766	protein-coding gene	gene with protein product							Standard	NM_153228		Approved	FLJ38335	uc002iun.1	Q8N957	OTTHUMG00000155010	ENST00000318698.2:c.1454C>T	chr17.hg19:g.54535228C>T	ENSP00000321627:p.Ser485Phe	52.0	0.0		75.0	21.0	NM_153228		Missense_Mutation	SNP	ENST00000318698.2	hg19	CCDS32686.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.405288	0.83230	.	.	ENSG00000153930	ENST00000318698	T	0.29397	1.57	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.60431	0.2268	M	0.78637	2.42	0.80722	D	1	D	0.89917	1.0	D	0.71184	0.972	T	0.60198	-0.7310	10	0.87932	D	0	-12.508	20.8794	0.99867	0.0:1.0:0.0:0.0	.	485	Q8N957	ANKF1_HUMAN	F	485	ENSP00000321627:S485F	ENSP00000321627:S485F	S	+	2	0	ANKFN1	51890227	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.941000	0.99782	0.655000	0.94253	TCT	.	.		0.473	ANKFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338043.1	NM_153228	
AKAP1	8165	hgsc.bcm.edu	37	17	55182885	55182885	+	Silent	SNP	C	C	T			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr17:55182885C>T	ENST00000337714.3	+	2	293	c.60C>T	c.(58-60)ctC>ctT	p.L20L	AKAP1_ENST00000314126.3_Silent_p.L20L|AKAP1_ENST00000572557.1_Silent_p.L20L|AKAP1_ENST00000571629.1_Silent_p.L20L|AKAP1_ENST00000539273.1_Silent_p.L20L	NM_003488.3	NP_003479.1	Q92667	AKAP1_HUMAN	A kinase (PRKA) anchor protein 1	20					blood coagulation (GO:0007596)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.L20L(1)		endometrium(2)|liver(1)|lung(7)|ovary(2)|pancreas(1)|skin(1)	14	Breast(9;5.46e-08)					TGGCGCTCCTCGGCTGGTGGT	0.577																																					p.L20L		Atlas-SNP	.											AKAP1,NS,carcinoma,0,1	AKAP1	73	.	1	Substitution - coding silent(1)	endometrium(1)	c.C60T						.						61.0	58.0	59.0					17																	55182885		2203	4300	6503	SO:0001819	synonymous_variant	8165	exon3			GCTCCTCGGCTGG	X97335	CCDS11594.1	17q22	2013-01-23			ENSG00000121057	ENSG00000121057		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Tudor domain containing"""	367	protein-coding gene	gene with protein product	"""protein kinase anchoring protein 1"", ""dual specificity A-kinase-anchoring protein 1"", ""protein phosphatase 1, regulatory subunit 43"", ""tudor domain containing 17"""	602449		PRKA1		8769136, 7499250	Standard	NM_003488		Approved	AKAP121, AKAP149, SAKAP84, S-AKAP84, AKAP84, D-AKAP1, PPP1R43, TDRD17	uc002iux.3	Q92667	OTTHUMG00000140369	ENST00000337714.3:c.60C>T	chr17.hg19:g.55182885C>T		63.0	0.0		116.0	21.0	NM_001242902	A8K8Q1|D3DTZ0|Q13320|Q9BW14	Silent	SNP	ENST00000337714.3	hg19	CCDS11594.1																																																																																			.	.		0.577	AKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277069.1		
MED13	9969	hgsc.bcm.edu	37	17	60024360	60024360	+	Missense_Mutation	SNP	C	C	A			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr17:60024360C>A	ENST00000397786.2	-	29	6386	c.6310G>T	c.(6310-6312)Gtg>Ttg	p.V2104L		NM_005121.2	NP_005112.2	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	2104					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(4)|central_nervous_system(1)|endometrium(10)|kidney(24)|large_intestine(15)|liver(1)|lung(20)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						ACTGAAGGCACGTGGAGGTGC	0.418																																					p.V2104L		Atlas-SNP	.											.	MED13	181	.	0			c.G6310T						.						133.0	135.0	135.0					17																	60024360		1979	4172	6151	SO:0001583	missense	9969	exon29			AAGGCACGTGGAG	AB011165	CCDS42366.1	17q22-q23	2007-07-30	2007-07-30	2007-07-30		ENSG00000108510			22474	protein-coding gene	gene with protein product		603808	"""thyroid hormone receptor associated protein 1"""	THRAP1		1019863	Standard	NM_005121		Approved	KIAA0593, TRAP240	uc002izo.3	Q9UHV7		ENST00000397786.2:c.6310G>T	chr17.hg19:g.60024360C>A	ENSP00000380888:p.Val2104Leu	101.0	0.0		128.0	24.0	NM_005121	B2RU05|O60334	Missense_Mutation	SNP	ENST00000397786.2	hg19	CCDS42366.1	.	.	.	.	.	.	.	.	.	.	C	33	5.224811	0.95173	.	.	ENSG00000108510	ENST00000397786;ENST00000262436	D	0.86562	-2.14	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	D	0.92277	0.7550	L	0.60455	1.87	0.80722	D	1	D	0.69078	0.997	D	0.80764	0.994	D	0.91963	0.5580	10	0.48119	T	0.1	-8.027	18.9301	0.92561	0.0:1.0:0.0:0.0	.	2104	Q9UHV7	MED13_HUMAN	L	2104;2103	ENSP00000380888:V2104L	ENSP00000262436:V2103L	V	-	1	0	MED13	57379142	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.429000	0.80309	2.464000	0.83262	0.467000	0.42956	GTG	.	.		0.418	MED13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445461.1	NM_005121	
CCDC178	374864	hgsc.bcm.edu	37	18	30847217	30847217	+	Missense_Mutation	SNP	T	T	G			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr18:30847217T>G	ENST00000383096.3	-	13	1403	c.1221A>C	c.(1219-1221)caA>caC	p.Q407H	CCDC178_ENST00000300227.8_Missense_Mutation_p.Q407H|CCDC178_ENST00000579916.1_Intron|CCDC178_ENST00000402325.1_Missense_Mutation_p.Q407H|CCDC178_ENST00000403303.1_Missense_Mutation_p.Q407H|CCDC178_ENST00000583930.1_Missense_Mutation_p.Q407H|CCDC178_ENST00000406524.2_Missense_Mutation_p.Q407H|CCDC178_ENST00000579947.1_Missense_Mutation_p.Q407H			Q5BJE1	CC178_HUMAN	coiled-coil domain containing 178	407																	CATGACTTTTTTGCTTCCAGG	0.338																																					p.Q407H		Atlas-SNP	.											.	.	.	.	0			c.A1221C						.						78.0	81.0	80.0					18																	30847217		2203	4296	6499	SO:0001583	missense	374864	exon12			ACTTTTTTGCTTC	AK126038	CCDS11906.1, CCDS42424.1	18q12.1	2012-10-15	2012-10-15	2012-10-15	ENSG00000166960	ENSG00000166960			29588	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 34"""	C18orf34			Standard	NM_198995		Approved	FLJ44050	uc002kxn.2	Q5BJE1	OTTHUMG00000132279	ENST00000383096.3:c.1221A>C	chr18.hg19:g.30847217T>G	ENSP00000372576:p.Gln407His	146.0	0.0		199.0	49.0	NM_001105528	A6NDC6|J3KS92|Q6ZP67|Q6ZU20	Missense_Mutation	SNP	ENST00000383096.3	hg19	CCDS42424.1	.	.	.	.	.	.	.	.	.	.	T	5.640	0.302692	0.10678	.	.	ENSG00000166960	ENST00000403303;ENST00000383096;ENST00000300227;ENST00000406524;ENST00000402325	T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97	4.17	0.49	0.16861	.	.	.	.	.	T	0.33789	0.0875	L	0.34521	1.04	0.09310	N	1	P;P;P;P	0.40794	0.729;0.729;0.729;0.729	P;P;P;P	0.45138	0.471;0.471;0.471;0.471	T	0.17837	-1.0356	9	0.45353	T	0.12	-4.6522	5.9326	0.19148	0.0:0.3638:0.0:0.6362	.	407;407;407;407	F8W7A7;B5MD75;Q5BJE1-2;Q5BJE1	.;.;.;CR034_HUMAN	H	407	ENSP00000385591:Q407H;ENSP00000372576:Q407H;ENSP00000300227:Q407H;ENSP00000385867:Q407H;ENSP00000385234:Q407H	ENSP00000300227:Q407H	Q	-	3	2	C18orf34	29101215	0.063000	0.20901	0.002000	0.10522	0.032000	0.12392	0.237000	0.17985	0.080000	0.16959	0.383000	0.25322	CAA	.	.		0.338	CCDC178-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255373.2	NM_198995	
WDR7	23335	hgsc.bcm.edu	37	18	54687994	54687994	+	Missense_Mutation	SNP	G	G	A			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr18:54687994G>A	ENST00000254442.3	+	27	4394	c.4183G>A	c.(4183-4185)Gga>Aga	p.G1395R	WDR7_ENST00000589935.1_Intron|WDR7_ENST00000357574.3_Missense_Mutation_p.G1362R	NM_015285.2	NP_056100.2	Q9Y4E6	WDR7_HUMAN	WD repeat domain 7	1395					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|breast(5)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(37)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	78				Lung(128;0.0238)|Colorectal(16;0.0296)		TGGACACAAGGGACCAATCAC	0.393																																					p.G1395R		Atlas-SNP	.											.	WDR7	166	.	0			c.G4183A						.						156.0	135.0	142.0					18																	54687994		2203	4300	6503	SO:0001583	missense	23335	exon27			CACAAGGGACCAA	AB011113	CCDS11962.1, CCDS11963.1	18q21.31	2013-01-09			ENSG00000091157	ENSG00000091157		"""WD repeat domain containing"""	13490	protein-coding gene	gene with protein product		613473				10828621	Standard	XM_005266674		Approved	KIAA0541, TRAG	uc002lgk.1	Q9Y4E6	OTTHUMG00000132721	ENST00000254442.3:c.4183G>A	chr18.hg19:g.54687994G>A	ENSP00000254442:p.Gly1395Arg	107.0	0.0		110.0	23.0	NM_015285	A7E2C8|Q86UX5|Q86VP2|Q96PS7	Missense_Mutation	SNP	ENST00000254442.3	hg19	CCDS11962.1	.	.	.	.	.	.	.	.	.	.	G	32	5.144545	0.94603	.	.	ENSG00000091157	ENST00000254442;ENST00000357574;ENST00000444065;ENST00000398311	T;T	0.61859	0.07;0.07	6.17	6.17	0.99709	WD40/YVTN repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.72819	0.3508	L	0.46567	1.45	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.69815	-0.5043	10	0.51188	T	0.08	.	20.4745	0.99168	0.0:0.0:1.0:0.0	.	1362;1395	Q9Y4E6-2;Q9Y4E6	.;WDR7_HUMAN	R	1395;1362;720;1362	ENSP00000254442:G1395R;ENSP00000350187:G1362R	ENSP00000254442:G1395R	G	+	1	0	WDR7	52838992	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.693000	0.98684	2.941000	0.99782	0.655000	0.94253	GGA	.	.		0.393	WDR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256062.1		
SALL3	27164	hgsc.bcm.edu	37	18	76753074	76753074	+	Silent	SNP	G	G	A	rs377646222		TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr18:76753074G>A	ENST00000537592.2	+	2	1083	c.1083G>A	c.(1081-1083)ccG>ccA	p.P361P	SALL3_ENST00000536229.3_Silent_p.P228P|SALL3_ENST00000575389.2_Silent_p.P361P	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	361					forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		TGCCAAGTCCGCTTCTACCTC	0.726																																					p.P361P		Atlas-SNP	.											.	SALL3	162	.	0			c.G1083A						.	G		1,4335		0,1,2167	12.0	13.0	13.0		1083	-8.7	0.2	18		13	0,8518		0,0,4259	no	coding-synonymous	SALL3	NM_171999.2		0,1,6426	AA,AG,GG		0.0,0.0231,0.0078		361/1301	76753074	1,12853	2168	4259	6427	SO:0001819	synonymous_variant	27164	exon2			AAGTCCGCTTCTA	AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.1083G>A	chr18.hg19:g.76753074G>A		62.0	0.0		77.0	19.0	NM_171999	Q9UGH1	Silent	SNP	ENST00000537592.2	hg19	CCDS12013.1																																																																																			.	.		0.726	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256397.1	NM_171999	
COL5A3	50509	hgsc.bcm.edu	37	19	10097061	10097061	+	Missense_Mutation	SNP	C	C	A			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr19:10097061C>A	ENST00000264828.3	-	30	2367	c.2282G>T	c.(2281-2283)gGt>gTt	p.G761V		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	761	Triple-helical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			CCCCTCAGGACCATCCTCTCC	0.612																																					p.G761V		Atlas-SNP	.											.	COL5A3	243	.	0			c.G2282T						.						21.0	26.0	24.0					19																	10097061		2201	4300	6501	SO:0001583	missense	50509	exon30			TCAGGACCATCCT	AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.2282G>T	chr19.hg19:g.10097061C>A	ENSP00000264828:p.Gly761Val	73.0	0.0		59.0	8.0	NM_015719	Q9NZQ6	Missense_Mutation	SNP	ENST00000264828.3	hg19	CCDS12222.1	.	.	.	.	.	.	.	.	.	.	C	19.45	3.829691	0.71258	.	.	ENSG00000080573	ENST00000264828	D	0.99637	-6.29	4.2	4.2	0.49525	.	0.000000	0.64402	D	0.000001	D	0.99764	0.9904	H	0.97758	4.07	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96942	0.9688	10	0.72032	D	0.01	.	14.3955	0.67007	0.0:1.0:0.0:0.0	.	761	P25940	CO5A3_HUMAN	V	761	ENSP00000264828:G761V	ENSP00000264828:G761V	G	-	2	0	COL5A3	9958061	1.000000	0.71417	0.990000	0.47175	0.724000	0.41520	6.969000	0.76092	2.024000	0.59613	0.462000	0.41574	GGT	.	.		0.612	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315788.1	NM_015719	
ZNF99	7652	hgsc.bcm.edu	37	19	22940806	22940806	+	Silent	SNP	G	G	A			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr19:22940806G>A	ENST00000596209.1	-	4	1995	c.1905C>T	c.(1903-1905)acC>acT	p.T635T	ZNF99_ENST00000397104.3_Silent_p.T544T	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	635					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T544T(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				GTTTTCTAAGGGTTGAGGACT	0.378																																					p.T635T		Atlas-SNP	.											ZNF99,NS,carcinoma,0,1	ZNF99	273	.	1	Substitution - coding silent(1)	prostate(1)	c.C1905T						.						37.0	39.0	38.0					19																	22940806		1989	4186	6175	SO:0001819	synonymous_variant	7652	exon4			TCTAAGGGTTGAG	BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.1905C>T	chr19.hg19:g.22940806G>A		100.0	2.0		117.0	5.0	NM_001080409	M0R335	Silent	SNP	ENST00000596209.1	hg19	CCDS59369.1																																																																																			.	.		0.378	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	XM_065124	
ZNF536	9745	hgsc.bcm.edu	37	19	31048062	31048062	+	Splice_Site	SNP	A	A	T			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr19:31048062A>T	ENST00000355537.3	+	5	4042		c.e5-1			NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536						negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					ATTTTCTTGCAGGTAAGTGAC	0.458																																					.		Atlas-SNP	.											.	ZNF536	424	.	0			c.3896-2A>T						.						312.0	267.0	282.0					19																	31048062		2203	4300	6503	SO:0001630	splice_region_variant	9745	exon5			TCTTGCAGGTAAG		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.3896-1A>T	chr19.hg19:g.31048062A>T		142.0	0.0		164.0	40.0	NM_014717	A2RU18	Splice_Site	SNP	ENST00000355537.3	hg19	CCDS32984.1	.	.	.	.	.	.	.	.	.	.	A	13.94	2.387433	0.42308	.	.	ENSG00000198597	ENST00000355537	.	.	.	5.76	5.76	0.90799	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.4668	0.55764	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ZNF536	35739902	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	4.684000	0.61686	2.195000	0.70347	0.533000	0.62120	.	.	.		0.458	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717	Intron
ZNF880	400713	hgsc.bcm.edu	37	19	52887731	52887731	+	Missense_Mutation	SNP	G	G	A			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr19:52887731G>A	ENST00000422689.2	+	4	913	c.898G>A	c.(898-900)Gag>Aag	p.E300K		NM_001145434.1	NP_001138906.1	Q6PDB4	ZN880_HUMAN	zinc finger protein 880	300					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|skin(1)	10						CAAATGTAATGAGTGTGGCAA	0.398																																					p.E300K		Atlas-SNP	.											.	ZNF880	45	.	0			c.G898A						.						71.0	64.0	66.0					19																	52887731		1568	3582	5150	SO:0001583	missense	400713	exon4			TGTAATGAGTGTG	BC058819	CCDS46164.1	19q13.41	2013-01-08			ENSG00000221923	ENSG00000221923		"""Zinc fingers, C2H2-type"", ""-"""	37249	protein-coding gene	gene with protein product							Standard	NM_001145434		Approved		uc002pzc.3	Q6PDB4	OTTHUMG00000167972	ENST00000422689.2:c.898G>A	chr19.hg19:g.52887731G>A	ENSP00000406318:p.Glu300Lys	96.0	0.0		137.0	18.0	NM_001145434	B4DNA6	Missense_Mutation	SNP	ENST00000422689.2	hg19	CCDS46164.1	.	.	.	.	.	.	.	.	.	.	G	3.908	-0.020580	0.07634	.	.	ENSG00000221923	ENST00000422689	T	0.07327	3.2	1.89	-0.678	0.11353	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.12178	0.0296	L	0.37466	1.105	0.09310	N	1	P	0.51147	0.942	P	0.57244	0.816	T	0.24012	-1.0172	8	.	.	.	.	6.6328	0.22867	0.2778:0.0:0.7222:0.0	.	300	Q6PDB4	ZN880_HUMAN	K	300	ENSP00000406318:E300K	.	E	+	1	0	ZNF880	57579543	0.000000	0.05858	0.123000	0.21794	0.081000	0.17604	-0.261000	0.08694	-0.261000	0.09405	-0.404000	0.06349	GAG	.	.		0.398	ZNF880-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397374.1	NM_001145434	
SSC5D	284297	hgsc.bcm.edu	37	19	56028927	56028927	+	Missense_Mutation	SNP	C	C	T			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr19:56028927C>T	ENST00000389623.6	+	14	3307	c.3284C>T	c.(3283-3285)cCc>cTc	p.P1095L		NM_001144950.1	NP_001138422.1	A1L4H1	SRCRL_HUMAN	scavenger receptor cysteine rich family, 5 domains	1095	Pro-rich.|Thr-rich.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterial lipoprotein (GO:0042494)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of interleukin-8 secretion (GO:2000483)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|intracellular (GO:0005622)|membrane (GO:0016020)	extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|skin(2)	4						CCCACCTTGCCCAAAGAGCTG	0.587																																					p.P1095L		Atlas-SNP	.											.	SSC5D	65	.	0			c.C3284T						.						87.0	78.0	81.0					19																	56028927		692	1591	2283	SO:0001583	missense	284297	exon14			CCTTGCCCAAAGA		CCDS46196.1, CCDS59424.1	19q13.42	2014-07-09	2014-07-09		ENSG00000179954	ENSG00000179954			26641	protein-coding gene	gene with protein product	"""soluble scavenger with 5 domains"""		"""scavenger receptor cysteine rich domain containing (5 domains)"""			19535143	Standard	NM_001144950		Approved	FLJ35258	uc002qlg.4	A1L4H1		ENST00000389623.6:c.3284C>T	chr19.hg19:g.56028927C>T	ENSP00000374274:p.Pro1095Leu	136.0	0.0		169.0	70.0	NM_001144950	B5MDQ5|C7S7T9|C7S7U0|K7EP70	Missense_Mutation	SNP	ENST00000389623.6	hg19	CCDS46196.1	.	.	.	.	.	.	.	.	.	.	-	5.806	0.332930	0.11013	.	.	ENSG00000179954	ENST00000389623	T	0.02395	4.31	2.61	1.54	0.23209	.	9.019360	0.01235	U	0.008468	T	0.04048	0.0113	L	0.40543	1.245	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41770	-0.9490	10	0.72032	D	0.01	.	5.7131	0.17945	0.0:0.8352:0.0:0.1648	.	1095	A1L4H1	SRCRL_HUMAN	L	1095	ENSP00000374274:P1095L	ENSP00000374274:P1095L	P	+	2	0	SSC5D	60720739	0.005000	0.15991	0.007000	0.13788	0.062000	0.15995	1.101000	0.31037	0.442000	0.26555	-0.760000	0.03462	CCC	.	.		0.587	SSC5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453345.2	XM_001718392	
SIGLEC1	6614	hgsc.bcm.edu	37	20	3684557	3684557	+	Silent	SNP	G	G	A	rs2122216		TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr20:3684557G>A	ENST00000344754.4	-	4	887	c.888C>T	c.(886-888)gcC>gcT	p.A296A	SIGLEC1_ENST00000202578.4_Silent_p.A296A	NM_023068.3	NP_075556.1	Q9BZZ2	SN_HUMAN	sialic acid binding Ig-like lectin 1, sialoadhesin	296	Ig-like C2-type 2.				cell-matrix adhesion (GO:0007160)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of T cell apoptotic process (GO:0070234)|single organismal cell-cell adhesion (GO:0016337)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|liver(2)|lung(24)|ovary(3)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)	70						CATCGCTCCAGGCTGCCTGGG	0.582																																					p.A296A		Atlas-SNP	.											.	SIGLEC1	210	.	0			c.C888T						.						86.0	65.0	72.0					20																	3684557		2203	4300	6503	SO:0001819	synonymous_variant	6614	exon4			GCTCCAGGCTGCC	AF230073	CCDS13060.1	20p13	2013-01-29	2006-01-19	2006-01-19	ENSG00000088827	ENSG00000088827		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11127	protein-coding gene	gene with protein product		600751	"""sialoadhesin"""	SN		8530048	Standard	XM_006723610		Approved	SIGLEC-1, CD169, FLJ00051, FLJ00055, FLJ00073, FLJ32150, dJ1009E24.1, sialoadhesin	uc002wja.3	Q9BZZ2	OTTHUMG00000031757	ENST00000344754.4:c.888C>T	chr20.hg19:g.3684557G>A		74.0	0.0		39.0	8.0	NM_023068	Q96DL4|Q9GZS5|Q9H1H6|Q9H1H7|Q9H7L7	Silent	SNP	ENST00000344754.4	hg19	CCDS13060.1																																																																																			.	.		0.582	SIGLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077761.2	NM_023068	
SLPI	6590	hgsc.bcm.edu	37	20	43882264	43882264	+	Missense_Mutation	SNP	C	C	T			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr20:43882264C>T	ENST00000338380.2	-	2	216	c.196G>A	c.(196-198)Gac>Aac	p.D66N		NM_003064.2	NP_003055.1	P03973	SLPI_HUMAN	secretory leukocyte peptidase inhibitor	66	Trypsin inhibitory domain.|WAP 1. {ECO:0000255|PROSITE- ProRule:PRU00722}.				negative regulation of protein binding (GO:0032091)|negative regulation of viral genome replication (GO:0045071)	extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|enzyme binding (GO:0019899)|serine-type endopeptidase inhibitor activity (GO:0004867)			lung(3)|ovary(1)	4		Myeloproliferative disorder(115;0.0122)				CCACAAGTGTCAGGACAACAT	0.527																																					p.D66N	GBM(64;162 1089 31780 33427 34538)	Atlas-SNP	.											.	SLPI	13	.	0			c.G196A						.						116.0	98.0	104.0					20																	43882264		2203	4300	6503	SO:0001583	missense	6590	exon2			AAGTGTCAGGACA	X04502	CCDS13347.1	20q13.12	2013-01-21	2005-08-17		ENSG00000124107	ENSG00000124107		"""WAP four-disulfide core domain containing"""	11092	protein-coding gene	gene with protein product	"""antileukoproteinase"""	107285	"""secretory leukocyte protease inhibitor (antileukoproteinase)"""			3640338, 12206714	Standard	NM_003064		Approved	HUSI-I, ALK1, ALP, BLPI, HUSI, WAP4, WFDC4	uc002xnm.1	P03973	OTTHUMG00000033075	ENST00000338380.2:c.196G>A	chr20.hg19:g.43882264C>T	ENSP00000342082:p.Asp66Asn	124.0	0.0		141.0	20.0	NM_003064	B2R5H8|P07757	Missense_Mutation	SNP	ENST00000338380.2	hg19	CCDS13347.1	.	.	.	.	.	.	.	.	.	.	C	14.24	2.476336	0.44044	.	.	ENSG00000124107	ENST00000338380	T	0.70399	-0.48	5.05	1.43	0.22495	Whey acidic protein, 4-disulphide core (5);4-disulphide core (1);	0.674594	0.12875	N	0.431916	T	0.61489	0.2351	L	0.31476	0.935	0.09310	N	1	D	0.54772	0.968	P	0.49999	0.628	T	0.50074	-0.8870	10	0.27082	T	0.32	.	7.1501	0.25606	0.2344:0.4569:0.3087:0.0	.	66	P03973	SLPI_HUMAN	N	66	ENSP00000342082:D66N	ENSP00000342082:D66N	D	-	1	0	SLPI	43315678	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.368000	0.20399	0.620000	0.30215	-0.304000	0.09214	GAC	.	.		0.527	SLPI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080494.3		
CABIN1	23523	hgsc.bcm.edu	37	22	24492014	24492014	+	Missense_Mutation	SNP	G	G	A	rs193920999		TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr22:24492014G>A	ENST00000398319.2	+	25	4292	c.3907G>A	c.(3907-3909)Gag>Aag	p.E1303K	CABIN1_ENST00000405822.2_Missense_Mutation_p.E1253K|CABIN1_ENST00000263119.5_Missense_Mutation_p.E1303K	NM_001199281.1	NP_001186210.1	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	1303					cell surface receptor signaling pathway (GO:0007166)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of catalytic activity (GO:0043086)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(13)|liver(1)|lung(18)|ovary(5)|pancreas(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						TGCCAGGGGCGAGGAGAAGAA	0.552																																					p.E1303K		Atlas-SNP	.											CABIN1,NS,adenoma,0,1	CABIN1	153	.	0			c.G3907A						.						121.0	125.0	124.0					22																	24492014		2203	4300	6503	SO:0001583	missense	23523	exon25			AGGGGCGAGGAGA	AF072441	CCDS13823.1, CCDS74830.1	22q11.23	2008-09-16			ENSG00000099991	ENSG00000099991			24187	protein-coding gene	gene with protein product		604251				9655484, 9205841	Standard	NM_001199281		Approved	KIAA0330, PPP3IN	uc002zzi.1	Q9Y6J0	OTTHUMG00000150797	ENST00000398319.2:c.3907G>A	chr22.hg19:g.24492014G>A	ENSP00000381364:p.Glu1303Lys	107.0	0.0		68.0	24.0	NM_001199281	G5E9F3|Q6PHY0|Q9Y460	Missense_Mutation	SNP	ENST00000398319.2	hg19	CCDS13823.1	.	.	.	.	.	.	.	.	.	.	G	17.97	3.518608	0.64634	.	.	ENSG00000099991	ENST00000263119;ENST00000405822;ENST00000398319	T;T;T	0.65178	0.0;-0.14;0.0	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	T	0.44519	0.1297	L	0.28740	0.885	0.80722	D	1	P;P	0.40638	0.725;0.605	B;B	0.26770	0.073;0.033	T	0.44620	-0.9316	10	0.18276	T	0.48	.	17.5248	0.87796	0.0:0.0:1.0:0.0	.	1253;1303	G5E9F3;Q9Y6J0	.;CABIN_HUMAN	K	1303;1253;1303	ENSP00000263119:E1303K;ENSP00000384694:E1253K;ENSP00000381364:E1303K	ENSP00000263119:E1303K	E	+	1	0	CABIN1	22822014	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	8.616000	0.90924	2.468000	0.83385	0.650000	0.86243	GAG	.	.		0.552	CABIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320161.2	NM_012295	
CXorf22	170063	hgsc.bcm.edu	37	X	35988970	35988970	+	Missense_Mutation	SNP	C	C	T	rs17852470		TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chrX:35988970C>T	ENST00000297866.5	+	11	1966	c.1900C>T	c.(1900-1902)Cat>Tat	p.H634Y		NM_152632.3	NP_689845.2	Q6ZTR5	CX022_HUMAN	chromosome X open reading frame 22	634			H -> Y (in dbSNP:rs17852470). {ECO:0000269|PubMed:15489334}.							breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(3)	44						AAAGAAATTACATGAAAACTA	0.303																																					p.H634Y		Atlas-SNP	.											.	CXorf22	272	.	0			c.C1900T						.						40.0	36.0	37.0					X																	35988970		2202	4293	6495	SO:0001583	missense	170063	exon11			AAATTACATGAAA	BC027936	CCDS14237.2	Xp21.1	2014-08-07			ENSG00000165164	ENSG00000165164			28546	protein-coding gene	gene with protein product						12477932	Standard	NM_152632		Approved	MGC34831	uc004ddj.3	Q6ZTR5	OTTHUMG00000021350	ENST00000297866.5:c.1900C>T	chrX.hg19:g.35988970C>T	ENSP00000297866:p.His634Tyr	697.0	1.0		767.0	163.0	NM_152632	Q5JRM8|Q8N6X8	Missense_Mutation	SNP	ENST00000297866.5	hg19	CCDS14237.2	.	.	.	.	.	.	.	.	.	.	C	13.38	2.221188	0.39201	.	.	ENSG00000165164	ENST00000297866	T	0.18810	2.19	5.0	2.96	0.34315	.	0.255981	0.37809	N	0.001927	T	0.37812	0.1017	M	0.74881	2.28	0.09310	N	1	D	0.76494	0.999	D	0.66979	0.948	T	0.16335	-1.0406	10	0.20519	T	0.43	-35.2732	8.5209	0.33275	0.5292:0.4708:0.0:0.0	rs17852470	634	Q6ZTR5	CX022_HUMAN	Y	634	ENSP00000297866:H634Y	ENSP00000297866:H634Y	H	+	1	0	CXorf22	35898891	0.001000	0.12720	0.012000	0.15200	0.003000	0.03518	-0.515000	0.06290	0.865000	0.35603	0.589000	0.80489	CAT	.	C|1.000;|0.000		0.303	CXorf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056216.2	NM_152632	
HUWE1	10075	hgsc.bcm.edu	37	X	53579402	53579402	+	Splice_Site	SNP	G	G	T			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chrX:53579402G>T	ENST00000342160.3	-	62	9208	c.8751C>A	c.(8749-8751)agC>agA	p.S2917R	HUWE1_ENST00000262854.6_Splice_Site_p.S2917R			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	2917					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						CAGGTGGGGAGCTGAGGGAAA	0.488																																					p.S2917R		Atlas-SNP	.											.	HUWE1	724	.	0			c.C8751A						.						49.0	44.0	46.0					X																	53579402		2203	4300	6503	SO:0001630	splice_region_variant	10075	exon63			TGGGGAGCTGAGG	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.8751-1C>A	chrX.hg19:g.53579402G>T		303.0	0.0		303.0	61.0	NM_031407	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	hg19	CCDS35301.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.94|14.94	2.685282|2.685282	0.47991|0.47991	.|.	.|.	ENSG00000086758|ENSG00000086758	ENST00000427052|ENST00000342160;ENST00000262854	.|T;T	.|0.35973	.|1.28;1.28	5.95|5.95	5.95|5.95	0.96441|0.96441	.|.	.|0.642748	.|0.17050	.|N	.|0.188954	T|T	0.25568|0.25568	0.0622|0.0622	N|N	0.14661|0.14661	0.345|0.345	0.45183|0.45183	D|D	0.998197|0.998197	.|B;B	.|0.21905	.|0.022;0.062	.|B;B	.|0.23716	.|0.004;0.048	T|T	0.10405|0.10405	-1.0631|-1.0631	5|10	.|0.13470	.|T	.|0.59	.|.	18.0042|18.0042	0.89205|0.89205	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|2917;2917	.|Q7Z6Z7;Q7Z6Z7-2	.|HUWE1_HUMAN;.	I|R	1951|2917	.|ENSP00000340648:S2917R;ENSP00000262854:S2917R	.|ENSP00000262854:S2917R	L|S	-|-	1|3	0|2	HUWE1|HUWE1	53596127|53596127	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.936000|0.936000	0.57629|0.57629	2.999000|2.999000	0.49473|0.49473	2.528000|2.528000	0.85240|0.85240	0.529000|0.529000	0.55759|0.55759	CTC|AGC	.	.		0.488	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119	Missense_Mutation
FAM120C	54954	hgsc.bcm.edu	37	X	54209302	54209302	+	Silent	SNP	G	G	C			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chrX:54209302G>C	ENST00000375180.2	-	1	386	c.330C>G	c.(328-330)ccC>ccG	p.P110P	FAM120C_ENST00000497680.1_5'Flank|FAM120C_ENST00000477084.1_Silent_p.P110P|FAM120C_ENST00000328235.4_Silent_p.P110P	NM_017848.4	NP_060318.3	Q9NX05	F120C_HUMAN	family with sequence similarity 120C	110							poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						GCAGCTGAGGGGGCGGCGGCG	0.746																																					p.P110P		Atlas-SNP	.											.	FAM120C	89	.	0			c.C330G						.						3.0	4.0	3.0					X																	54209302		1733	3249	4982	SO:0001819	synonymous_variant	54954	exon1			CTGAGGGGGCGGC	AY150025	CCDS14356.1, CCDS55421.1, CCDS75987.1	Xp11.22	2011-04-13	2006-07-04	2006-07-04	ENSG00000184083	ENSG00000184083			16949	protein-coding gene	gene with protein product		300741	"""chromosome X open reading frame 17"""	CXorf17		14585507	Standard	XM_006724589		Approved	ORF34, FLJ20506	uc004dsz.4	Q9NX05	OTTHUMG00000021625	ENST00000375180.2:c.330C>G	chrX.hg19:g.54209302G>C		95.0	0.0		111.0	5.0	NM_017848	B2RMT7	Silent	SNP	ENST00000375180.2	hg19	CCDS14356.1																																																																																			.	.		0.746	FAM120C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056795.2	NM_017848	
FAM120C	54954	hgsc.bcm.edu	37	X	54209318	54209318	+	Missense_Mutation	SNP	A	A	G	rs199506922		TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chrX:54209318A>G	ENST00000375180.2	-	1	370	c.314T>C	c.(313-315)cTg>cCg	p.L105P	FAM120C_ENST00000497680.1_5'Flank|FAM120C_ENST00000477084.1_Missense_Mutation_p.L105P|FAM120C_ENST00000328235.4_Missense_Mutation_p.L105P	NM_017848.4	NP_060318.3	Q9NX05	F120C_HUMAN	family with sequence similarity 120C	105							poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						CGGCGGCGGCAGCGGAGGGTG	0.746													a|||	2	0.000529801	0.0	0.0	3775	,	,		7371	0.0		0.001	False		,,,				2504	0.001				p.L105P		Atlas-SNP	.											.	FAM120C	89	.	0			c.T314C						.						3.0	4.0	3.0					X																	54209318		1477	2706	4183	SO:0001583	missense	54954	exon1			GGCGGCAGCGGAG	AY150025	CCDS14356.1, CCDS55421.1, CCDS75987.1	Xp11.22	2011-04-13	2006-07-04	2006-07-04	ENSG00000184083	ENSG00000184083			16949	protein-coding gene	gene with protein product		300741	"""chromosome X open reading frame 17"""	CXorf17		14585507	Standard	XM_006724589		Approved	ORF34, FLJ20506	uc004dsz.4	Q9NX05	OTTHUMG00000021625	ENST00000375180.2:c.314T>C	chrX.hg19:g.54209318A>G	ENSP00000364324:p.Leu105Pro	99.0	0.0		100.0	9.0	NM_017848	B2RMT7	Missense_Mutation	SNP	ENST00000375180.2	hg19	CCDS14356.1	.	.	.	.	.	.	.	.	.	.	a	9.339	1.062497	0.19987	.	.	ENSG00000184083	ENST00000375180;ENST00000328235;ENST00000477084	T;T;T	0.47869	1.82;1.36;0.83	2.73	1.45	0.22620	.	0.278989	0.27531	N	0.018943	T	0.19327	0.0464	N	0.03608	-0.345	0.47476	D	0.999433	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.03008	-1.1083	10	0.32370	T	0.25	0.3639	4.7246	0.12935	0.4324:0.0:0.5676:0.0	.	105;105;105	F8W881;Q9NX05-2;Q9NX05	.;.;F120C_HUMAN	P	105	ENSP00000364324:L105P;ENSP00000329896:L105P;ENSP00000420718:L105P	ENSP00000329896:L105P	L	-	2	0	FAM120C	54226043	0.970000	0.33590	0.968000	0.41197	0.426000	0.31534	0.267000	0.18552	0.262000	0.21774	0.378000	0.23410	CTG	.	.		0.746	FAM120C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056795.2	NM_017848	
KCNK16	83795	hgsc.bcm.edu	37	6	39286869	39286870	+	Frame_Shift_Del	DEL	CC	CC	-	rs146890431		TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	CC	CC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr6:39286869_39286870delCC	ENST00000373229.5	-	2	266_267	c.253_254delGG	c.(253-255)ggcfs	p.G85fs	KCNK16_ENST00000373227.4_Frame_Shift_Del_p.G85fs|KCNK16_ENST00000507712.1_Frame_Shift_Del_p.G20fs|KCNK16_ENST00000437525.2_Frame_Shift_Del_p.G85fs|KCNK16_ENST00000425054.2_Frame_Shift_Del_p.G85fs	NM_032115.3	NP_115491.1	Q96T55	KCNKG_HUMAN	potassium channel, subfamily K, member 16	85					potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)	13						GGTAGAGTTGCCTTTGGGGTTC	0.545																																					p.85_85del		Atlas-INDEL	.											.	KCNK16	59	.	0			c.254_255del						.																																			SO:0001589	frameshift_variant	83795	exon2			.	AF358909	CCDS4843.1, CCDS47420.1, CCDS47421.1, CCDS47422.1	6p21.2-p21.1	2012-03-07			ENSG00000095981	ENSG00000095981		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	14464	protein-coding gene	gene with protein product		607369				11263999, 16382106	Standard	NM_032115		Approved	K2p16.1, TALK-1, TALK1	uc003ooq.3	Q96T55	OTTHUMG00000014645	ENST00000373229.5:c.253_254delGG	chr6.hg19:g.39286869_39286870delCC	ENSP00000362326:p.Gly85fs	61.0	0.0		81.0	38.0	NM_001135106	B5TJL9|Q2M2N9|Q5TCF3|Q6X6Z3|Q6X6Z4|Q6X6Z5|Q9H591	Frame_Shift_Del	DEL	ENST00000373229.5	hg19	CCDS4843.1																																																																																			.	.		0.545	KCNK16-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040452.2	NM_032115	
SPRY4	81848	hgsc.bcm.edu	37	5	141694360	141694361	+	In_Frame_Ins	INS	-	-	TGC			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr5:141694360_141694361insTGC	ENST00000434127.2	-	2	556_557	c.313_314insGCA	c.(313-315)aca>aGCAca	p.104_105insS	SPRY4_ENST00000503582.1_5'Flank|SPRY4_ENST00000344120.4_In_Frame_Ins_p.127_128insS	NM_001127496.1	NP_001120968.1	Q9C004	SPY4_HUMAN	sprouty homolog 4 (Drosophila)	104	Poly-Ser.				multicellular organismal development (GO:0007275)|negative regulation of MAP kinase activity (GO:0043407)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(1)	18		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTCAGAGGATGTGCTGCTGCTG	0.658									Testicular Cancer, Familial Clustering of																												p.T128delinsST		Atlas-INDEL	.											.	SPRY4	31	.	0			c.383_384insGCA						.		,	1,4263		0,1,2131					,	5.8	1.0			70	2,8250		0,2,4124	no	coding,coding	SPRY4	NM_030964.3,NM_001127496.1	,	0,3,6255	A1A1,A1R,RR		0.0242,0.0235,0.024	,	,		3,12513				SO:0001652	inframe_insertion	81848	exon3	Familial Cancer Database		.	AF227516	CCDS4274.1, CCDS47296.1	5q31.3	2010-08-05			ENSG00000187678	ENSG00000187678			15533	protein-coding gene	gene with protein product		607984				16465403	Standard	NM_030964		Approved		uc010jgi.1	Q9C004	OTTHUMG00000129663	ENST00000434127.2:c.311_313dupGCA	chr5.hg19:g.141694367_141694369dupTGC	ENSP00000399468:p.Ser106_Ser107dup	55.0	0.0		66.0	11.0	NM_030964	A4FVB2|A4FVB3|Q6QIX2|Q9C003	In_Frame_Ins	INS	ENST00000434127.2	hg19	CCDS47296.1																																																																																			.	.		0.658	SPRY4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370652.1		
CDKN1A	1026	hgsc.bcm.edu	37	6	36652098	36652098	+	Frame_Shift_Del	DEL	C	C	-			TCGA-XR-A8TD-01A-12D-A38X-10	TCGA-XR-A8TD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	76dab338-0a6f-42fe-a0f3-d9427f704348	156d13f3-f11c-4ebf-9efe-80eab3ac25e7	g.chr6:36652098delC	ENST00000405375.1	+	2	455	c.220delC	c.(220-222)cccfs	p.P74fs	CDKN1A_ENST00000373711.2_Frame_Shift_Del_p.P74fs|CDKN1A_ENST00000478800.1_3'UTR|CDKN1A_ENST00000244741.5_Frame_Shift_Del_p.P74fs|CDKN1A_ENST00000448526.2_Frame_Shift_Del_p.P108fs	NM_001220778.1	NP_001207707.1	P38936	CDN1A_HUMAN	cyclin-dependent kinase inhibitor 1A (p21, Cip1)	74					cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to extracellular stimulus (GO:0031668)|cellular response to ionizing radiation (GO:0071479)|cellular senescence (GO:0090398)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle (GO:0000278)|mitotic cell cycle arrest (GO:0071850)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of gene expression (GO:0010629)|negative regulation of phosphorylation (GO:0042326)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ regeneration (GO:0031100)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of DNA biosynthetic process (GO:2000278)|regulation of protein import into nucleus, translocation (GO:0033158)|response to arsenic-containing substance (GO:0046685)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to hyperoxia (GO:0055093)|response to organonitrogen compound (GO:0010243)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|stress-induced premature senescence (GO:0090400)	cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCNA-p21 complex (GO:0070557)	cyclin-dependent protein kinase activating kinase activity (GO:0019912)|cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|urinary_tract(5)	15						CCTTGGCCTGCCCAAGCTCTA	0.672																																					p.L73fs		Atlas-INDEL	.											.	CDKN1A	27	.	0			c.219delG						.						39.0	36.0	37.0					6																	36652098		2203	4300	6503	SO:0001589	frameshift_variant	1026	exon2			.	U03106	CCDS4824.1	6p21.1	2009-01-21			ENSG00000124762	ENSG00000124762			1784	protein-coding gene	gene with protein product		116899		CDKN1			Standard	NM_000389		Approved	P21, CIP1, WAF1, SDI1, CAP20, p21CIP1, p21Cip1/Waf1	uc021yzb.1	P38936	OTTHUMG00000014603	ENST00000405375.1:c.220delC	chr6.hg19:g.36652098delC	ENSP00000384849:p.Pro74fs	59.0	0.0		71.0	30.0	NM_000389	Q14010|Q6FI05|Q9BUT4	Frame_Shift_Del	DEL	ENST00000405375.1	hg19	CCDS4824.1																																																																																			.	.		0.672	CDKN1A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040354.1	NM_078467	
