#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
LSM10	84967	hgsc.bcm.edu	37	1	36859597	36859597	+	Missense_Mutation	SNP	T	T	A			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr1:36859597T>A	ENST00000315732.2	-	2	283	c.134A>T	c.(133-135)aAt>aTt	p.N45I	LSM10_ENST00000476041.1_5'UTR	NM_032881.1	NP_116270.1	Q969L4	LSM10_HUMAN	LSM10, U7 small nuclear RNA associated	45					gene expression (GO:0010467)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U7 snRNP (GO:0005683)	histone pre-mRNA DCP binding (GO:0071208)			upper_aerodigestive_tract(1)|urinary_tract(1)	2		Myeloproliferative disorder(586;0.0393)				AGCATCGACATTGTCTATGCG	0.577																																					p.N45I		Atlas-SNP	.											.	LSM10	9	.	0			c.A134T						.						172.0	137.0	149.0					1																	36859597		2203	4300	6503	SO:0001583	missense	84967	exon2			TCGACATTGTCTA	AF394685	CCDS408.1	1p34.3	2008-02-05			ENSG00000181817	ENSG00000181817			17562	protein-coding gene	gene with protein product						11574479	Standard	NM_032881		Approved	MGC15749	uc001cao.1	Q969L4	OTTHUMG00000008140	ENST00000315732.2:c.134A>T	chr1.hg19:g.36859597T>A	ENSP00000319341:p.Asn45Ile	74.0	0.0		105.0	40.0	NM_032881		Missense_Mutation	SNP	ENST00000315732.2	hg19	CCDS408.1	.	.	.	.	.	.	.	.	.	.	T	20.1	3.937724	0.73557	.	.	ENSG00000181817	ENST00000315732	T	0.43294	0.95	6.11	6.11	0.99139	Like-Sm ribonucleoprotein (LSM) domain (1);Like-Sm ribonucleoprotein (LSM)-related domain (1);	0.040882	0.85682	D	0.000000	T	0.57007	0.2024	M	0.65975	2.015	0.80722	D	1	D	0.54397	0.966	P	0.58331	0.837	T	0.59899	-0.7367	10	0.59425	D	0.04	-36.5114	11.7047	0.51592	0.0:0.0701:0.0:0.9299	.	45	Q969L4	LSM10_HUMAN	I	45	ENSP00000319341:N45I	ENSP00000319341:N45I	N	-	2	0	LSM10	36632184	1.000000	0.71417	0.939000	0.37840	0.854000	0.48673	3.627000	0.54252	2.343000	0.79666	0.496000	0.49642	AAT	.	.		0.577	LSM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022294.1	NM_032881	
ZC3H12A	80149	hgsc.bcm.edu	37	1	37945929	37945929	+	Missense_Mutation	SNP	T	T	A			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr1:37945929T>A	ENST00000373087.6	+	3	598	c.482T>A	c.(481-483)cTg>cAg	p.L161Q		NM_025079.2	NP_079355.2			zinc finger CCCH-type containing 12A											NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CGGGGCATCCTGCTGGCAGTG	0.627																																					p.L161Q		Atlas-SNP	.											.	ZC3H12A	58	.	0			c.T482A						.						84.0	74.0	77.0					1																	37945929		2203	4300	6503	SO:0001583	missense	80149	exon3			GCATCCTGCTGGC		CCDS417.1	1p34.3	2012-07-05			ENSG00000163874	ENSG00000163874		"""Zinc fingers, CCCH-type domain containing"""	26259	protein-coding gene	gene with protein product	"""MCP induced protein 1"""	610562				18178554, 22055188	Standard	NM_025079		Approved	FLJ23231, MCPIP1	uc001cbb.4	Q5D1E8	OTTHUMG00000004221	ENST00000373087.6:c.482T>A	chr1.hg19:g.37945929T>A	ENSP00000362179:p.Leu161Gln	62.0	0.0		76.0	28.0	NM_025079		Missense_Mutation	SNP	ENST00000373087.6	hg19	CCDS417.1	.	.	.	.	.	.	.	.	.	.	T	16.81	3.225566	0.58668	.	.	ENSG00000163874	ENST00000373087;ENST00000373082	T	0.45276	0.9	4.8	4.8	0.61643	Ribonuclease Zc3h12a-like (1);	0.156336	0.43579	D	0.000556	T	0.22126	0.0533	N	0.01446	-0.86	0.49213	D	0.999765	B	0.24963	0.115	B	0.37989	0.262	T	0.17501	-1.0367	10	0.10377	T	0.69	-19.9641	14.6504	0.68792	0.0:0.0:0.0:1.0	.	161	Q5D1E8	ZC12A_HUMAN	Q	161	ENSP00000362179:L161Q	ENSP00000362174:L161Q	L	+	2	0	ZC3H12A	37718516	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.993000	0.49425	1.934000	0.56057	0.460000	0.39030	CTG	.	.		0.627	ZC3H12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012154.2	NM_025079	
FAAH	2166	hgsc.bcm.edu	37	1	46876499	46876499	+	Missense_Mutation	SNP	C	C	T			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr1:46876499C>T	ENST00000243167.8	+	11	1373	c.1289C>T	c.(1288-1290)tCa>tTa	p.S430L		NM_001441.2	NP_001432.2	O00519	FAAH1_HUMAN	fatty acid amide hydrolase	430					fatty acid catabolic process (GO:0009062)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|organelle membrane (GO:0031090)	acylglycerol lipase activity (GO:0047372)|carbon-nitrogen ligase activity, with glutamine as amido-N-donor (GO:0016884)|fatty acid amide hydrolase activity (GO:0017064)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	22	Acute lymphoblastic leukemia(166;0.155)				Propofol(DB00818)|Thiopental(DB00599)	CCAAGGCTGTCAGCTTTCCTC	0.597																																					p.S430L		Atlas-SNP	.											.	FAAH	36	.	0			c.C1289T						.						97.0	85.0	89.0					1																	46876499		2203	4300	6503	SO:0001583	missense	2166	exon11			GGCTGTCAGCTTT	U82535	CCDS535.1	1p35-p34	2008-02-05			ENSG00000117480	ENSG00000117480			3553	protein-coding gene	gene with protein product		602935				9122178	Standard	NM_001441		Approved	FAAH-1	uc001cpu.2	O00519	OTTHUMG00000007811	ENST00000243167.8:c.1289C>T	chr1.hg19:g.46876499C>T	ENSP00000243167:p.Ser430Leu	55.0	0.0		53.0	10.0	NM_001441	D3DQ19|Q52M86|Q5TDF8	Missense_Mutation	SNP	ENST00000243167.8	hg19	CCDS535.1	.	.	.	.	.	.	.	.	.	.	C	10.61	1.398996	0.25291	.	.	ENSG00000117480	ENST00000243167;ENST00000396325	T	0.55052	0.54	5.28	3.37	0.38596	Amidase signature domain (2);	0.475716	0.22230	N	0.062822	T	0.46054	0.1373	L	0.41415	1.275	0.18873	N	0.999982	B	0.26318	0.146	B	0.36186	0.219	T	0.48007	-0.9072	10	0.66056	D	0.02	-17.4305	8.3105	0.32068	0.0:0.8167:0.0:0.1833	.	430	O00519	FAAH1_HUMAN	L	430;137	ENSP00000243167:S430L	ENSP00000243167:S430L	S	+	2	0	FAAH	46649086	0.005000	0.15991	0.755000	0.31263	0.174000	0.22865	1.579000	0.36536	1.472000	0.48140	-0.140000	0.14226	TCA	.	.		0.597	FAAH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021443.1	NM_001441	
GSTM3	2947	hgsc.bcm.edu	37	1	110280323	110280323	+	Silent	SNP	T	T	C			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr1:110280323T>C	ENST00000540225.1	-	7	733	c.423A>G	c.(421-423)caA>caG	p.Q141Q	GSTM3_ENST00000361066.2_Silent_p.Q141Q|GSTM3_ENST00000256594.3_Silent_p.Q141Q|GSTM3_ENST00000488824.1_5'UTR|RP4-735C1.4_ENST00000431955.1_RNA			P21266	GSTM3_HUMAN	glutathione S-transferase mu 3 (brain)	141	GST C-terminal.				cellular detoxification of nitrogen compound (GO:0070458)|establishment of blood-nerve barrier (GO:0008065)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|nitrobenzene metabolic process (GO:0018916)|response to estrogen (GO:0043627)|small molecule metabolic process (GO:0044281)|xenobiotic catabolic process (GO:0042178)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	enzyme binding (GO:0019899)|glutathione binding (GO:0043295)|glutathione transferase activity (GO:0004364)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|skin(1)	9		all_epithelial(167;1.95e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)		Colorectal(144;0.0339)|Lung(183;0.0426)|all cancers(265;0.113)|Epithelial(280;0.125)|COAD - Colon adenocarcinoma(174;0.134)|LUSC - Lung squamous cell carcinoma(189;0.228)	Glutathione(DB00143)|Vitamin E(DB00163)	ACATGGAGAATTGTTTCAGTT	0.423																																					p.Q141Q		Atlas-SNP	.											.	GSTM3	21	.	0			c.A423G						.						121.0	136.0	131.0					1																	110280323		2203	4300	6503	SO:0001819	synonymous_variant	2947	exon7			GGAGAATTGTTTC	BC000088	CCDS812.1	1p13.3	2012-06-21	2008-11-26		ENSG00000134202	ENSG00000134202	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4635	protein-coding gene	gene with protein product		138390	"""glutathione S-transferase M3 (brain)"""			2345169	Standard	NM_000849		Approved	GST5	uc001dyo.2	P21266	OTTHUMG00000011640	ENST00000540225.1:c.423A>G	chr1.hg19:g.110280323T>C		191.0	0.0		267.0	110.0	NM_000849	O60550|Q96HA3	Silent	SNP	ENST00000540225.1	hg19	CCDS812.1																																																																																			.	.		0.423	GSTM3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032182.1	NM_000849	
CHD1L	9557	hgsc.bcm.edu	37	1	146765405	146765405	+	Splice_Site	SNP	A	A	C			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr1:146765405A>C	ENST00000369258.4	+	21	2525	c.2505A>C	c.(2503-2505)aaA>aaC	p.K835N	CHD1L_ENST00000369259.3_Splice_Site_p.K631N|CHD1L_ENST00000361293.5_Splice_Site_p.K554N|CHD1L_ENST00000431239.1_Splice_Site_p.K741N|CHD1L_ENST00000467213.1_3'UTR	NM_001256336.1|NM_004284.4|NM_024568.2	NP_001243265.1|NP_004275.4|NP_078844.2	Q86WJ1	CHD1L_HUMAN	chromodomain helicase DNA binding protein 1-like	835	Macro. {ECO:0000255|PROSITE- ProRule:PRU00490}.				ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|nucleotide binding (GO:0000166)			breast(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(923;0.0487)					AAAAGAAGAAAGGTAAGCTCT	0.428																																					p.K835N		Atlas-SNP	.											.	CHD1L	72	.	0			c.A2505C						.						94.0	94.0	94.0					1																	146765405		2203	4300	6503	SO:0001630	splice_region_variant	9557	exon21			GAAGAAAGGTAAG	AF054177	CCDS927.1, CCDS58021.1, CCDS58022.1, CCDS72882.1	1q21.1	2008-02-05			ENSG00000131778	ENSG00000131778			1916	protein-coding gene	gene with protein product		613039				9653160	Standard	NM_004284		Approved	ALC1	uc001epm.5	Q86WJ1	OTTHUMG00000150271	ENST00000369258.4:c.2506+1A>C	chr1.hg19:g.146765405A>C		46.0	0.0		82.0	5.0	NM_004284	A5YM64|B4DDE1|B5MDZ7|Q53EZ3|Q5VXX7|Q6DD94|Q6PK83|Q86XH3|Q96HF7|Q96SP3|Q9BVJ1|Q9NVV8	Missense_Mutation	SNP	ENST00000369258.4	hg19	CCDS927.1	.	.	.	.	.	.	.	.	.	.	A	10.73	1.431463	0.25813	.	.	ENSG00000131778	ENST00000431239;ENST00000369259;ENST00000369258;ENST00000361293	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	5.27	2.85	0.33270	Appr-1-p processing (1);	0.099970	0.64402	D	0.000002	T	0.09598	0.0236	N	0.16903	0.455	0.47819	D	0.999528	B;B;B	0.28783	0.222;0.047;0.012	B;B;B	0.33196	0.159;0.033;0.016	T	0.10428	-1.0630	10	0.10111	T	0.7	.	4.5306	0.12002	0.7002:0.2001:0.0997:0.0	.	741;631;835	Q86WJ1-2;Q86WJ1-3;Q86WJ1	.;.;CHD1L_HUMAN	N	741;631;835;554	ENSP00000389031:K741N;ENSP00000358263:K631N;ENSP00000358262:K835N;ENSP00000355100:K554N	ENSP00000355100:K554N	K	+	3	2	CHD1L	145232029	0.998000	0.40836	1.000000	0.80357	0.905000	0.53344	0.595000	0.24029	2.118000	0.64928	0.455000	0.32223	AAA	.	.		0.428	CHD1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040377.1	NM_004284	Missense_Mutation
FLG2	388698	hgsc.bcm.edu	37	1	152328015	152328015	+	Silent	SNP	C	C	G			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr1:152328015C>G	ENST00000388718.5	-	3	2319	c.2247G>C	c.(2245-2247)ggG>ggC	p.G749G	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	749	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGAGCCAGACCCATGTTGTC	0.507																																					p.G749G		Atlas-SNP	.											.	FLG2	431	.	0			c.G2247C						.						290.0	274.0	279.0					1																	152328015		2203	4300	6503	SO:0001819	synonymous_variant	388698	exon3			GCCAGACCCATGT	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.2247G>C	chr1.hg19:g.152328015C>G		125.0	0.0		210.0	107.0	NM_001014342	Q9H4U1	Silent	SNP	ENST00000388718.5	hg19	CCDS30861.1																																																																																			.	.		0.507	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342	
SSR2	6746	hgsc.bcm.edu	37	1	155984782	155984782	+	Silent	SNP	A	A	C			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr1:155984782A>C	ENST00000295702.4	-	4	404	c.333T>G	c.(331-333)acT>acG	p.T111T	SSR2_ENST00000529008.1_Intron|SSR2_ENST00000480567.1_Silent_p.T111T|SSR2_ENST00000496742.1_Intron	NM_003145.3	NP_003136.1	P43308	SSRB_HUMAN	signal sequence receptor, beta (translocon-associated protein beta)	111					cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|gene expression (GO:0010467)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|stomach(1)	10	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					GGGCCAGGTAAGTAATTGTTG	0.527																																					p.T111T		Atlas-SNP	.											.	SSR2	20	.	0			c.T333G						.						95.0	86.0	89.0					1																	155984782		2203	4300	6503	SO:0001819	synonymous_variant	6746	exon4			CAGGTAAGTAATT	BC000341	CCDS1126.1	1q21-q23	2008-02-05			ENSG00000163479	ENSG00000163479			11324	protein-coding gene	gene with protein product		600867				7789174	Standard	NM_003145		Approved	TLAP, TRAPB	uc001fmx.3	P43308	OTTHUMG00000017456	ENST00000295702.4:c.333T>G	chr1.hg19:g.155984782A>C		96.0	0.0		261.0	51.0	NM_003145	B2R9K9|D3DVA7|Q53HI0|Q5VY95|Q5VY96|Q6IB31|Q9BWE4	Silent	SNP	ENST00000295702.4	hg19	CCDS1126.1																																																																																			.	.		0.527	SSR2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046172.2	NM_003145	
CEP350	9857	hgsc.bcm.edu	37	1	180000501	180000501	+	Missense_Mutation	SNP	G	G	C			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr1:180000501G>C	ENST00000367607.3	+	15	4015	c.3597G>C	c.(3595-3597)gaG>gaC	p.E1199D		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	1199	Ser-rich.				microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						TTCTTGATGAGGAAAAAGCAG	0.378																																					p.E1199D		Atlas-SNP	.											.	CEP350	418	.	0			c.G3597C						.						59.0	61.0	60.0					1																	180000501		2203	4300	6503	SO:0001583	missense	9857	exon15			TGATGAGGAAAAA	AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.3597G>C	chr1.hg19:g.180000501G>C	ENSP00000356579:p.Glu1199Asp	280.0	0.0		564.0	310.0	NM_014810	O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	ENST00000367607.3	hg19	CCDS1336.1	.	.	.	.	.	.	.	.	.	.	G	18.17	3.564312	0.65651	.	.	ENSG00000135837	ENST00000367607	T	0.59364	0.27	5.93	0.141	0.14811	.	0.000000	0.47455	D	0.000223	T	0.56717	0.2004	L	0.32530	0.975	0.35699	D	0.815498	D;D	0.69078	0.994;0.997	D;D	0.72625	0.97;0.978	T	0.58825	-0.7568	9	.	.	.	.	5.6332	0.17522	0.5918:0.1616:0.2466:0.0	.	1199;1199	E7EU22;Q5VT06	.;CE350_HUMAN	D	1199	ENSP00000356579:E1199D	.	E	+	3	2	CEP350	178267124	1.000000	0.71417	0.997000	0.53966	0.751000	0.42716	0.678000	0.25277	0.109000	0.17891	-0.142000	0.14014	GAG	.	.		0.378	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	NM_014810	
TPR	7175	hgsc.bcm.edu	37	1	186322973	186322973	+	Missense_Mutation	SNP	C	C	A			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr1:186322973C>A	ENST00000367478.4	-	18	2477	c.2181G>T	c.(2179-2181)atG>atT	p.M727I	TPR_ENST00000474852.1_5'UTR	NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	727					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)			autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		TATCTTGCAGCATTTCATAAC	0.343			T	NTRK1	papillary thyroid																																p.M727I		Atlas-SNP	.		Dom	yes		1	1q25	7175	translocated promoter region		E	.	TPR	441	.	0			c.G2181T						.						179.0	154.0	162.0					1																	186322973		1871	4106	5977	SO:0001583	missense	7175	exon18			TTGCAGCATTTCA	U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.2181G>T	chr1.hg19:g.186322973C>A	ENSP00000356448:p.Met727Ile	31.0	0.0		81.0	14.0	NM_003292	Q15655|Q5SWY0|Q99968	Missense_Mutation	SNP	ENST00000367478.4	hg19	CCDS41446.1	.	.	.	.	.	.	.	.	.	.	C	18.79	3.698055	0.68386	.	.	ENSG00000047410	ENST00000367478	T	0.16743	2.32	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.24198	0.0586	M	0.65975	2.015	0.80722	D	1	B	0.30824	0.296	B	0.28991	0.097	T	0.01666	-1.1300	10	0.33940	T	0.23	.	20.1162	0.97934	0.0:1.0:0.0:0.0	.	727	P12270	TPR_HUMAN	I	727	ENSP00000356448:M727I	ENSP00000356448:M727I	M	-	3	0	TPR	184589596	1.000000	0.71417	0.998000	0.56505	0.972000	0.66771	7.445000	0.80570	2.756000	0.94617	0.655000	0.94253	ATG	.	.		0.343	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086353.2	NM_003292	
KIAA1804	84451	hgsc.bcm.edu	37	1	233514789	233514789	+	Missense_Mutation	SNP	G	G	T			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr1:233514789G>T	ENST00000366624.3	+	9	2298	c.2037G>T	c.(2035-2037)caG>caT	p.Q679H	MLK4_ENST00000366622.1_Missense_Mutation_p.Q125H	NM_032435.2	NP_115811.2												p.N682fs*21(1)									AAGATGCTCAGAGAGAGAATC	0.458																																					p.Q679H		Atlas-SNP	.											.	KIAA1804	129	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.G2037T						.						64.0	70.0	68.0					1																	233514789		2203	4300	6503	SO:0001583	missense	0	exon9			TGCTCAGAGAGAG																												ENST00000366624.3:c.2037G>T	chr1.hg19:g.233514789G>T	ENSP00000355583:p.Gln679His	211.0	0.0		259.0	20.0	NM_032435		Missense_Mutation	SNP	ENST00000366624.3	hg19	CCDS1598.1	.	.	.	.	.	.	.	.	.	.	G	7.118	0.577427	0.13686	.	.	ENSG00000143674	ENST00000366624;ENST00000366622	T;T	0.30182	1.54;1.54	4.95	3.08	0.35506	.	0.479096	0.19657	N	0.109078	T	0.27866	0.0686	L	0.59436	1.845	0.28267	N	0.924563	B;B	0.17268	0.021;0.012	B;B	0.18561	0.021;0.022	T	0.22382	-1.0218	10	0.56958	D	0.05	.	6.8224	0.23864	0.1654:0.163:0.6716:0.0	.	126;679	Q5TCX8-3;Q5TCX8	.;M3KL4_HUMAN	H	679;125	ENSP00000355583:Q679H;ENSP00000355581:Q125H	ENSP00000355581:Q125H	Q	+	3	2	RP5-862P8.2	231581412	1.000000	0.71417	0.491000	0.27477	0.253000	0.25986	2.447000	0.44917	0.680000	0.31366	0.655000	0.94253	CAG	.	.		0.458	MLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092495.1		
EHD3	30845	hgsc.bcm.edu	37	2	31472315	31472315	+	Silent	SNP	G	G	A			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr2:31472315G>A	ENST00000322054.5	+	3	768	c.483G>A	c.(481-483)gaG>gaA	p.E161E	EHD3_ENST00000541626.1_Silent_p.E161E	NM_014600.2	NP_055415.1	Q9NZN3	EHD3_HUMAN	EH-domain containing 3	161	Dynamin-type G.				blood coagulation (GO:0007596)|endocytic recycling (GO:0032456)|protein homooligomerization (GO:0051260)|protein targeting to plasma membrane (GO:0072661)|regulation of cardiac muscle cell membrane potential (GO:0086036)	cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|nucleic acid binding (GO:0003676)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(11)|lung(12)|ovary(1)|skin(3)	33	Acute lymphoblastic leukemia(172;0.155)					TCTCTGGGGAGAAGCAGAGGA	0.577																																					p.E161E		Atlas-SNP	.											.	EHD3	90	.	0			c.G483A						.						95.0	86.0	89.0					2																	31472315		2203	4300	6503	SO:0001819	synonymous_variant	30845	exon3			TGGGGAGAAGCAG	AF181264	CCDS1774.1	2p21	2013-01-10			ENSG00000013016	ENSG00000013016		"""EF-hand domain containing"""	3244	protein-coding gene	gene with protein product		605891		PAST3		10673336	Standard	NM_014600		Approved		uc002rnu.3	Q9NZN3	OTTHUMG00000099365	ENST00000322054.5:c.483G>A	chr2.hg19:g.31472315G>A		61.0	0.0		69.0	37.0	NM_014600	B4DFR5|D6W574|Q8N514|Q9NZB3	Silent	SNP	ENST00000322054.5	hg19	CCDS1774.1																																																																																			.	.		0.577	EHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216810.1	NM_014600	
BIRC6	57448	hgsc.bcm.edu	37	2	32689764	32689764	+	Missense_Mutation	SNP	C	C	G			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr2:32689764C>G	ENST00000421745.2	+	25	5263	c.5129C>G	c.(5128-5130)aCt>aGt	p.T1710S		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	1710					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					CCACCACTCACTCCACCCAAT	0.483																																					p.T1710S	Pancreas(94;175 1509 16028 18060 45422)	Atlas-SNP	.											.	BIRC6	838	.	0			c.C5129G						.						148.0	139.0	142.0					2																	32689764		2203	4300	6503	SO:0001583	missense	57448	exon25			CACTCACTCCACC	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.5129C>G	chr2.hg19:g.32689764C>G	ENSP00000393596:p.Thr1710Ser	119.0	0.0		112.0	46.0	NM_016252	Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	hg19	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	C	31	5.096664	0.94197	.	.	ENSG00000115760	ENST00000421745	T	0.74947	-0.89	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.79885	0.4523	L	0.31065	0.9	0.80722	D	1	D	0.63880	0.993	D	0.68192	0.956	T	0.75878	-0.3162	10	0.28530	T	0.3	.	20.1551	0.98106	0.0:1.0:0.0:0.0	.	1710	Q9NR09	BIRC6_HUMAN	S	1710	ENSP00000393596:T1710S	ENSP00000393596:T1710S	T	+	2	0	BIRC6	32543268	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.818000	0.86416	2.760000	0.94817	0.655000	0.94253	ACT	.	.		0.483	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	
PCBP1	5093	hgsc.bcm.edu	37	2	70315913	70315913	+	Missense_Mutation	SNP	G	G	T			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr2:70315913G>T	ENST00000303577.5	+	1	1329	c.1038G>T	c.(1036-1038)agG>agT	p.R346S	PCBP1-AS1_ENST00000366234.3_RNA|PCBP1-AS1_ENST00000449178.1_RNA|PCBP1-AS1_ENST00000421843.1_RNA|PCBP1-AS1_ENST00000422515.1_RNA|PCBP1-AS1_ENST00000416395.1_RNA|PCBP1-AS1_ENST00000416068.1_RNA|PCBP1-AS1_ENST00000594548.1_RNA|PCBP1-AS1_ENST00000601396.1_RNA|PCBP1-AS1_ENST00000413069.1_RNA|PCBP1-AS1_ENST00000411429.1_RNA|PCBP1-AS1_ENST00000610168.1_RNA|PCBP1-AS1_ENST00000415742.1_RNA|PCBP1-AS1_ENST00000457770.1_RNA|PCBP1-AS1_ENST00000432604.1_RNA|PCBP1-AS1_ENST00000442040.1_RNA|PCBP1-AS1_ENST00000596573.1_RNA|PCBP1-AS1_ENST00000415222.1_RNA|PCBP1-AS1_ENST00000439892.1_RNA|PCBP1-AS1_ENST00000458686.1_RNA|PCBP1-AS1_ENST00000423402.1_RNA|PCBP1-AS1_ENST00000420309.1_RNA|PCBP1-AS1_ENST00000609075.1_RNA|PCBP1-AS1_ENST00000413791.1_RNA|PCBP1-AS1_ENST00000599673.1_RNA|PCBP1-AS1_ENST00000437456.1_RNA|PCBP1-AS1_ENST00000418564.1_RNA|PCBP1-AS1_ENST00000437019.1_RNA|PCBP1-AS1_ENST00000452431.1_RNA|PCBP1-AS1_ENST00000444410.1_RNA|PCBP1-AS1_ENST00000429599.2_RNA|PCBP1-AS1_ENST00000425333.1_RNA|PCBP1-AS1_ENST00000415060.2_RNA|PCBP1-AS1_ENST00000413436.1_RNA|PCBP1-AS1_ENST00000596028.1_RNA|PCBP1-AS1_ENST00000596665.1_RNA|PCBP1-AS1_ENST00000458698.2_RNA|PCBP1-AS1_ENST00000425601.1_RNA|PCBP1-AS1_ENST00000435880.2_RNA|PCBP1-AS1_ENST00000418308.1_RNA|PCBP1-AS1_ENST00000457076.1_RNA|PCBP1-AS1_ENST00000595459.1_RNA|PCBP1-AS1_ENST00000419963.1_RNA|AC016700.2_ENST00000455541.1_lincRNA|PCBP1-AS1_ENST00000456161.1_RNA|PCBP1-AS1_ENST00000444320.1_RNA|PCBP1-AS1_ENST00000434781.1_RNA|PCBP1-AS1_ENST00000439670.2_RNA	NM_006196.3	NP_006187.2	Q15365	PCBP1_HUMAN	poly(rC) binding protein 1	346					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			endometrium(2)|kidney(1)|large_intestine(6)|lung(2)|skin(1)	12						TCAATGCCAGGCTTTCCTCTG	0.498																																					p.R346S	Colon(85;1146 1307 3484 18706 25380)	Atlas-SNP	.											.	PCBP1	28	.	0			c.G1038T						.						34.0	36.0	35.0					2																	70315913		2203	4300	6503	SO:0001583	missense	5093	exon1			TGCCAGGCTTTCC		CCDS1898.1	2p13-p12	2013-07-16	2001-11-28		ENSG00000169564	ENSG00000169564			8647	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein E1"""	601209	"""poly(rC)-binding protein 1"""			8833161	Standard	NM_006196		Approved	HNRPE1, hnRNP-E1, HNRPX, hnRNP-X	uc002sgf.3	Q15365	OTTHUMG00000129645	ENST00000303577.5:c.1038G>T	chr2.hg19:g.70315913G>T	ENSP00000305556:p.Arg346Ser	60.0	0.0		64.0	34.0	NM_006196	Q13157|Q14975	Missense_Mutation	SNP	ENST00000303577.5	hg19	CCDS1898.1	.	.	.	.	.	.	.	.	.	.	G	12.37	1.918614	0.33908	.	.	ENSG00000169564	ENST00000303577	T	0.36157	1.27	3.66	3.66	0.41972	K Homology (1);	0.180691	0.32901	N	0.005520	T	0.31167	0.0788	L	0.52823	1.66	0.80722	D	1	B	0.17268	0.021	B	0.15870	0.014	T	0.08848	-1.0702	10	0.25106	T	0.35	.	11.1467	0.48434	0.0:0.0:1.0:0.0	.	346	Q15365	PCBP1_HUMAN	S	346	ENSP00000305556:R346S	ENSP00000305556:R346S	R	+	3	2	PCBP1	70169417	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.512000	0.98008	2.345000	0.79718	0.563000	0.77884	AGG	.	.		0.498	PCBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251844.1	NM_006196	
C2orf81	388963	hgsc.bcm.edu	37	2	74642705	74642705	+	Nonsense_Mutation	SNP	C	C	T			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr2:74642705C>T	ENST00000517883.1	-	1	1005	c.314G>A	c.(313-315)tGg>tAg	p.W105*	C2orf81_ENST00000290390.5_Nonsense_Mutation_p.W173*			A6NN90	CB081_HUMAN	chromosome 2 open reading frame 81	166										endometrium(3)|kidney(1)	4						TCGACCCATCCACGACCTTCC	0.612																																					p.W173X		Atlas-SNP	.											.	C2orf81	23	.	0			c.G518A						.						24.0	26.0	25.0					2																	74642705		692	1591	2283	SO:0001587	stop_gained	388963	exon4			CCCATCCACGACC	AC005041, CH471053		2p13.1	2012-08-07			ENSG00000159239	ENSG00000159239			34350	protein-coding gene	gene with protein product						15815621	Standard	NM_001145054		Approved	LOC388963, hCG40743	uc010yrq.1	A6NN90	OTTHUMG00000164184	ENST00000517883.1:c.314G>A	chr2.hg19:g.74642705C>T	ENSP00000431103:p.Trp105*	40.0	0.0		65.0	27.0	NM_001145054		Nonsense_Mutation	SNP	ENST00000517883.1	hg19		.	.	.	.	.	.	.	.	.	.	C	38	6.917009	0.97932	.	.	ENSG00000159239	ENST00000517883;ENST00000290390;ENST00000518863	.	.	.	4.81	3.93	0.45458	.	0.000000	0.47455	D	0.000227	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.1018	7.364	0.26762	0.0:0.8064:0.0:0.1936	.	.	.	.	X	105;173;105	.	ENSP00000290390:W173X	W	-	2	0	C2orf81	74496213	0.009000	0.17119	0.054000	0.19295	0.207000	0.24258	1.104000	0.31074	1.383000	0.46405	0.561000	0.74099	TGG	.	.		0.612	C2orf81-002	PUTATIVE	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000377683.1	NM_001145054	
REG3G	130120	hgsc.bcm.edu	37	2	79254181	79254181	+	Missense_Mutation	SNP	T	T	C			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr2:79254181T>C	ENST00000272324.5	+	4	401	c.217T>C	c.(217-219)Tct>Cct	p.S73P	REG3G_ENST00000409471.1_Intron|REG3G_ENST00000393897.2_Missense_Mutation_p.S73P	NM_001008387.2	NP_001008388.1	Q6UW15	REG3G_HUMAN	regenerating islet-derived 3 gamma	73	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				acute-phase response (GO:0006953)|defense response to Gram-positive bacterium (GO:0050830)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of keratinocyte differentiation (GO:0045617)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of wound healing (GO:0090303)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(27)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GAAGCGGCCCTCTGGAAAACT	0.557																																					p.S73P		Atlas-SNP	.											.	REG3G	67	.	0			c.T217C						.						138.0	135.0	136.0					2																	79254181		2203	4300	6503	SO:0001583	missense	130120	exon4			CGGCCCTCTGGAA	AY359047	CCDS1962.1, CCDS58714.1	2p12	2005-02-11			ENSG00000143954	ENSG00000143954			29595	protein-coding gene	gene with protein product		609933				12975309	Standard	NM_001008387		Approved	UNQ429, LPPM429, PAP1B	uc002snx.4	Q6UW15	OTTHUMG00000130018	ENST00000272324.5:c.217T>C	chr2.hg19:g.79254181T>C	ENSP00000272324:p.Ser73Pro	74.0	0.0		90.0	4.0	NM_198448	A8K980|D6W5J6|Q3SYE4|Q3SYE6|Q6FH18	Missense_Mutation	SNP	ENST00000272324.5	hg19	CCDS1962.1	.	.	.	.	.	.	.	.	.	.	T	16.31	3.088220	0.55968	.	.	ENSG00000143954	ENST00000393897;ENST00000272324	T;T	0.19938	2.11;2.11	4.83	3.65	0.41850	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.336224	0.21857	N	0.068091	T	0.49474	0.1559	M	0.93283	3.4	0.19300	N	0.999971	P	0.51537	0.946	P	0.61132	0.884	T	0.48175	-0.9058	10	0.59425	D	0.04	.	8.6682	0.34134	0.0:0.0:0.1933:0.8067	.	73	Q6UW15	REG3G_HUMAN	P	73	ENSP00000377475:S73P;ENSP00000272324:S73P	ENSP00000272324:S73P	S	+	1	0	REG3G	79107689	0.004000	0.15560	0.035000	0.18076	0.789000	0.44602	1.200000	0.32247	0.949000	0.37715	0.533000	0.62120	TCT	.	.		0.557	REG3G-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328247.1	NM_198448	
IL18RAP	8807	hgsc.bcm.edu	37	2	103057777	103057777	+	Missense_Mutation	SNP	G	G	A			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr2:103057777G>A	ENST00000264260.2	+	7	1325	c.736G>A	c.(736-738)Gac>Aac	p.D246N	AC007278.3_ENST00000450893.1_RNA|IL18RAP_ENST00000409369.1_Missense_Mutation_p.D104N	NM_003853.2	NP_003844.1	O95256	I18RA_HUMAN	interleukin 18 receptor accessory protein	246					cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|inflammatory response (GO:0006954)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(5)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(4)	37						TTCAGTGGGAGACACTAAACT	0.438																																					p.D246N		Atlas-SNP	.											.	IL18RAP	102	.	0			c.G736A						.						122.0	106.0	112.0					2																	103057777		2203	4300	6503	SO:0001583	missense	8807	exon7			GTGGGAGACACTA	AF077346	CCDS2061.1	2q12.1	2013-01-11			ENSG00000115607	ENSG00000115607		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5989	protein-coding gene	gene with protein product		604509				9792649	Standard	XM_005264034		Approved	AcPL, CD218b	uc002tbx.3	O95256	OTTHUMG00000130777	ENST00000264260.2:c.736G>A	chr2.hg19:g.103057777G>A	ENSP00000264260:p.Asp246Asn	48.0	0.0		68.0	32.0	NM_003853	B2RPJ3|Q3KPE7|Q3KPE8|Q53TT4|Q53TU5	Missense_Mutation	SNP	ENST00000264260.2	hg19	CCDS2061.1	.	.	.	.	.	.	.	.	.	.	G	0.096	-1.159443	0.01686	.	.	ENSG00000115607	ENST00000264260;ENST00000409369	T;T	0.02421	4.37;4.3	5.31	-1.3	0.09259	.	0.951031	0.08821	N	0.888745	T	0.01835	0.0058	N	0.19112	0.55	0.19575	N	0.999967	B	0.02656	0.0	B	0.04013	0.001	T	0.49588	-0.8924	10	0.17369	T	0.5	.	4.6111	0.12402	0.6157:0.0:0.2154:0.1688	.	246	O95256	I18RA_HUMAN	N	246;104	ENSP00000264260:D246N;ENSP00000387201:D104N	ENSP00000264260:D246N	D	+	1	0	IL18RAP	102424209	0.008000	0.16893	0.073000	0.20177	0.220000	0.24768	-0.095000	0.11077	-0.138000	0.11434	0.491000	0.48974	GAC	.	.		0.438	IL18RAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253291.2	NM_003853	
HOXD12	3238	hgsc.bcm.edu	37	2	176964607	176964607	+	Silent	SNP	C	C	T			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr2:176964607C>T	ENST00000406506.2	+	1	150	c.78C>T	c.(76-78)ttC>ttT	p.F26F	HOXD12_ENST00000404162.2_Silent_p.F26F			P35452	HXD12_HUMAN	homeobox D12	26					embryonic digit morphogenesis (GO:0042733)|pattern specification process (GO:0007389)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|large_intestine(1)|lung(7)|ovary(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0521)|READ - Rectum adenocarcinoma(9;0.0678)		CTTTCTACTTCTCCAACCTGA	0.657																																					p.F26F		Atlas-SNP	.											.	HOXD12	25	.	0			c.C78T						.						55.0	60.0	59.0					2																	176964607		1860	4076	5936	SO:0001819	synonymous_variant	3238	exon1			CTACTTCTCCAAC		CCDS46456.1	2q31.1	2011-06-20	2005-12-22		ENSG00000170178	ENSG00000170178		"""Homeoboxes / ANTP class : HOXL subclass"""	5135	protein-coding gene	gene with protein product		142988	"""homeo box D12"""	HOX4H		1675198, 1973146	Standard	NM_021193		Approved		uc010zev.1	P35452	OTTHUMG00000150358	ENST00000406506.2:c.78C>T	chr2.hg19:g.176964607C>T		80.0	0.0		99.0	35.0	NM_021193	B5MCP0|Q0VAD7|Q0VAD8|Q9NS03	Silent	SNP	ENST00000406506.2	hg19	CCDS46456.1																																																																																			.	.		0.657	HOXD12-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359253.2	NM_021193	
FSIP2	401024	hgsc.bcm.edu	37	2	186673007	186673007	+	Missense_Mutation	SNP	T	T	G			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr2:186673007T>G	ENST00000424728.1	+	17	18974	c.18974T>G	c.(18973-18975)aTt>aGt	p.I6325S	FSIP2_ENST00000343098.5_Missense_Mutation_p.I6414S			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	6325										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						GTGATCAAAATTATTGATGAA	0.338																																					p.I6414S		Atlas-SNP	.											FSIP2_ENST00000343098,colon,carcinoma,0,2	FSIP2	251	.	0			c.T19241G						.						33.0	32.0	33.0					2																	186673007		1808	4051	5859	SO:0001583	missense	401024	exon17			TCAAAATTATTGA	AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.18974T>G	chr2.hg19:g.186673007T>G	ENSP00000401306:p.Ile6325Ser	182.0	0.0		253.0	45.0	NM_173651	Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Missense_Mutation	SNP	ENST00000424728.1	hg19		.	.	.	.	.	.	.	.	.	.	T	14.20	2.465493	0.43839	.	.	ENSG00000188738	ENST00000343098;ENST00000424728	T;T	0.58358	0.34;0.34	5.21	5.21	0.72293	.	0.112312	0.40144	N	0.001173	T	0.54870	0.1885	L	0.47190	1.495	0.37090	D	0.899402	.	.	.	.	.	.	T	0.59963	-0.7355	8	0.35671	T	0.21	.	11.3941	0.49832	0.0:0.0:0.0:1.0	.	.	.	.	S	6414;6325	ENSP00000344403:I6414S;ENSP00000401306:I6325S	ENSP00000344403:I6414S	I	+	2	0	FSIP2	186381252	0.996000	0.38824	0.868000	0.34077	0.489000	0.33432	1.615000	0.36922	2.188000	0.69820	0.482000	0.46254	ATT	.	.		0.338	FSIP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000332778.3	NM_173651	
FSIP2	401024	hgsc.bcm.edu	37	2	186673014	186673014	+	Missense_Mutation	SNP	T	T	A			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr2:186673014T>A	ENST00000424728.1	+	17	18981	c.18981T>A	c.(18979-18981)gaT>gaA	p.D6327E	FSIP2_ENST00000343098.5_Missense_Mutation_p.D6416E			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	6327										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						AAATTATTGATGAACTTAAGT	0.333																																					p.D6416E		Atlas-SNP	.											.	FSIP2	251	.	0			c.T19248A						.						33.0	32.0	32.0					2																	186673014		1810	4051	5861	SO:0001583	missense	401024	exon17			TATTGATGAACTT	AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.18981T>A	chr2.hg19:g.186673014T>A	ENSP00000401306:p.Asp6327Glu	183.0	0.0		255.0	45.0	NM_173651	Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Missense_Mutation	SNP	ENST00000424728.1	hg19		.	.	.	.	.	.	.	.	.	.	T	11.36	1.614971	0.28712	.	.	ENSG00000188738	ENST00000343098;ENST00000424728	T;T	0.51574	0.7;0.7	5.17	1.22	0.21188	.	0.234668	0.30159	N	0.010263	T	0.35008	0.0917	L	0.49778	1.585	0.09310	N	0.999998	.	.	.	.	.	.	T	0.15122	-1.0448	8	0.11794	T	0.64	.	3.9746	0.09468	0.3217:0.0893:0.0:0.589	.	.	.	.	E	6416;6327	ENSP00000344403:D6416E;ENSP00000401306:D6327E	ENSP00000344403:D6416E	D	+	3	2	FSIP2	186381259	0.981000	0.34729	0.228000	0.23943	0.146000	0.21551	1.031000	0.30165	0.409000	0.25649	-0.353000	0.07706	GAT	.	.		0.333	FSIP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000332778.3	NM_173651	
LAMB2	3913	hgsc.bcm.edu	37	3	49169137	49169138	+	Missense_Mutation	DNP	AT	AT	CA			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	A|T	A|T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr3:49169137_49169138AT>CA	ENST00000418109.1	-	6	642_643	c.478_479AT>TG	c.(478-480)ATg>TGg	p.M160W	LAMB2_ENST00000305544.4_Missense_Mutation_p.M160W	NM_002292.3	NP_002283.3	P55268	LAMB2_HUMAN	laminin, beta 2 (laminin S)	160	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				astrocyte development (GO:0014002)|axon extension involved in regeneration (GO:0048677)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|metanephric glomerular basement membrane development (GO:0072274)|metanephric glomerular visceral epithelial cell development (GO:0072249)|neuromuscular junction development (GO:0007528)|retina development in camera-type eye (GO:0060041)|Schwann cell development (GO:0014044)|visual perception (GO:0007601)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-11 complex (GO:0043260)|laminin-3 complex (GO:0005608)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(15)|kidney(3)|large_intestine(6)|lung(21)|ovary(4)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		TTCCACCAGCATGGCAGCAGGG	0.599																																					p.M160R|p.M160L		Atlas-SNP	.											.	LAMB2	156	.	0			c.T479G|c.A478T						.																																			SO:0001583	missense	3913	exon5			ACCAGCATGGCAG|CCAGCATGGCAGC		CCDS2789.1	3p21.3-p21.2	2013-03-01			ENSG00000172037	ENSG00000172037		"""Laminins"""	6487	protein-coding gene	gene with protein product	"""laminin S"""	150325		LAMS		2922051, 10393422	Standard	NM_002292		Approved		uc003cwe.3	P55268	OTTHUMG00000156807	ENST00000418109.1:c.478_479delinsCA	chr3.hg19:g.49169137_49169138delinsCA	ENSP00000388325:p.Met160Trp	50.0	0.0		83.0|82.0	6.0	NM_002292	Q16321	Missense_Mutation	SNP	ENST00000418109.1	hg19	CCDS2789.1																																																																																			.	.		0.599	LAMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345939.1	NM_002292	
PEX5L	51555	hgsc.bcm.edu	37	3	179689381	179689381	+	Splice_Site	SNP	C	C	T			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr3:179689381C>T	ENST00000467460.1	-	2	424		c.e2+1		PEX5L_ENST00000485199.1_Splice_Site|PEX5L_ENST00000464614.1_Splice_Site|PEX5L_ENST00000465751.1_Intron|PEX5L_ENST00000468741.1_Splice_Site|PEX5L_ENST00000263962.8_Intron|PEX5L_ENST00000476138.1_Splice_Site|PEX5L_ENST00000472994.1_Intron	NM_001256751.1|NM_016559.2	NP_001243680.1|NP_057643.1	Q8IYB4	PEX5R_HUMAN	peroxisomal biogenesis factor 5-like						maintenance of protein location (GO:0045185)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome matrix, docking (GO:0016560)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of membrane potential (GO:0042391)	cytosol (GO:0005829)|dendrite (GO:0030425)|peroxisomal membrane (GO:0005778)|receptor complex (GO:0043235)	peroxisome matrix targeting signal-1 binding (GO:0005052)|peroxisome targeting sequence binding (GO:0000268)|small GTPase binding (GO:0031267)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(23)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	all_cancers(143;3.94e-14)|Ovarian(172;0.0338)|Breast(254;0.183)		OV - Ovarian serous cystadenocarcinoma(80;1.75e-26)|GBM - Glioblastoma multiforme(14;0.000518)			tattcacttacctgcttttga	0.343																																					.		Atlas-SNP	.											.	PEX5L	104	.	0			c.93+1G>A						.						192.0	181.0	185.0					3																	179689381		2203	4299	6502	SO:0001630	splice_region_variant	51555	exon3			CACTTACCTGCTT	AJ245503	CCDS3236.1, CCDS58861.1, CCDS58862.1, CCDS58863.1, CCDS58864.1, CCDS58865.1, CCDS58866.1, CCDS58867.1	3q27.1	2013-01-10			ENSG00000114757	ENSG00000114757		"""Tetratricopeptide (TTC) repeat domain containing"""	30024	protein-coding gene	gene with protein product		611058				11463335	Standard	NM_016559		Approved	PEX5R, PXR2	uc003fki.2	Q8IYB4	OTTHUMG00000157363	ENST00000467460.1:c.93+1G>A	chr3.hg19:g.179689381C>T		56.0	0.0		78.0	31.0	NM_001256752	B7Z2A5|B7Z305|B7Z318|B7Z5Z5|B7Z8P2|E7EUV8|E7EUZ0|E9PEC1|E9PH97|Q9NQD1|Q9P2U3|Q9P2U4	Splice_Site	SNP	ENST00000467460.1	hg19	CCDS3236.1																																																																																			.	.		0.343	PEX5L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348577.1	NM_016559	Intron
ADD1	118	hgsc.bcm.edu	37	4	2909499	2909499	+	Silent	SNP	C	C	A			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr4:2909499C>A	ENST00000398129.1	+	10	1463	c.1443C>A	c.(1441-1443)tcC>tcA	p.S481S	ADD1_ENST00000446856.1_Silent_p.S481S|ADD1_ENST00000398123.2_Silent_p.S512S|ADD1_ENST00000513328.2_Silent_p.S481S|ADD1_ENST00000355842.3_Silent_p.S481S|ADD1_ENST00000503455.2_Silent_p.S512S|ADD1_ENST00000264758.7_Silent_p.S512S|ADD1_ENST00000398125.1_Silent_p.S512S			P35611	ADDA_HUMAN	adducin 1 (alpha)	481					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cell morphogenesis (GO:0000902)|cell volume homeostasis (GO:0006884)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to retinoic acid (GO:0071300)|endoplasmic reticulum unfolded protein response (GO:0030968)|erythrocyte differentiation (GO:0030218)|hemoglobin metabolic process (GO:0020027)|homeostasis of number of cells within a tissue (GO:0048873)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein binding (GO:0032092)	cytosol (GO:0005829)|dendritic spine (GO:0043197)|F-actin capping protein complex (GO:0008290)|focal adhesion (GO:0005925)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)|transcription factor binding (GO:0008134)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		ATAGAACTTCCACCTCTGCTG	0.448																																					p.S512S	Esophageal Squamous(71;505 1201 20414 34538 37449)	Atlas-SNP	.											.	ADD1	56	.	0			c.C1536A						.						213.0	188.0	196.0					4																	2909499		2203	4300	6503	SO:0001819	synonymous_variant	118	exon11			AACTTCCACCTCT	L07261	CCDS3363.1, CCDS3364.1, CCDS43205.1, CCDS75094.1	4p16.3	2009-04-22			ENSG00000087274	ENSG00000087274			243	protein-coding gene	gene with protein product		102680				1840603	Standard	NM_001119		Approved		uc003gfq.3	P35611	OTTHUMG00000122080	ENST00000398129.1:c.1443C>A	chr4.hg19:g.2909499C>A		102.0	0.0		159.0	17.0	NM_176801	A2A3N8|A2A3P0|B4DI79|D3DVR3|D3DVR4|D3DVR5|Q13734|Q14729|Q16156|Q86XM2|Q9UJB6	Silent	SNP	ENST00000398129.1	hg19	CCDS43205.1	.	.	.	.	.	.	.	.	.	.	C	10.27	1.303737	0.23736	.	.	ENSG00000087274	ENST00000514940	.	.	.	5.59	5.59	0.84812	.	.	.	.	.	T	0.76557	0.4004	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.74228	-0.3733	4	.	.	.	-26.4874	19.9513	0.97200	0.0:1.0:0.0:0.0	.	.	.	.	Q	218	.	.	P	+	2	0	ADD1	2879297	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.628000	0.67791	2.790000	0.95986	0.655000	0.94253	CCA	.	.		0.448	ADD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242840.1	NM_014189	
SLAIN2	57606	hgsc.bcm.edu	37	4	48385695	48385695	+	Silent	SNP	C	C	A			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr4:48385695C>A	ENST00000264313.6	+	6	1672	c.1254C>A	c.(1252-1254)tcC>tcA	p.S418S	SLAIN2_ENST00000512093.1_Silent_p.S225S	NM_020846.1	NP_065897.1	Q9P270	SLAI2_HUMAN	SLAIN motif family, member 2	418					cytoplasmic microtubule organization (GO:0031122)|microtubule nucleation (GO:0007020)|positive regulation of microtubule polymerization (GO:0031116)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(7)|prostate(1)	13						CAAACCTGTCCCGAACATCTA	0.358																																					p.S418S		Atlas-SNP	.											.	SLAIN2	31	.	0			c.C1254A						.						53.0	48.0	50.0					4																	48385695		1841	4094	5935	SO:0001819	synonymous_variant	57606	exon6			CCTGTCCCGAACA	BC006139	CCDS47051.1	4p12	2008-02-05	2006-09-12	2006-09-12	ENSG00000109171	ENSG00000109171			29282	protein-coding gene	gene with protein product		610492	"""KIAA1458"""	KIAA1458		16546155	Standard	NM_020846		Approved	FLJ21611	uc003gya.4	Q9P270	OTTHUMG00000161701	ENST00000264313.6:c.1254C>A	chr4.hg19:g.48385695C>A		240.0	0.0		485.0	21.0	NM_020846	A8K4P1|Q8N5R3	Silent	SNP	ENST00000264313.6	hg19	CCDS47051.1	.	.	.	.	.	.	.	.	.	.	C	8.966	0.971715	0.18736	.	.	ENSG00000109171	ENST00000510595	.	.	.	5.55	3.82	0.43975	.	.	.	.	.	T	0.69940	0.3167	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.66060	-0.6017	4	.	.	.	-6.8365	14.8188	0.70055	0.0:0.869:0.0:0.131	.	.	.	.	T	1	.	.	P	+	1	0	SLAIN2	48080452	0.998000	0.40836	1.000000	0.80357	0.976000	0.68499	0.478000	0.22212	0.321000	0.23259	-1.134000	0.01955	CCG	.	.		0.358	SLAIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365807.4	NM_020846	
YTHDC1	91746	hgsc.bcm.edu	37	4	69179869	69179869	+	Missense_Mutation	SNP	C	C	A			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr4:69179869C>A	ENST00000344157.4	-	17	2467	c.2132G>T	c.(2131-2133)cGa>cTa	p.R711L	YTHDC1_ENST00000579690.1_Missense_Mutation_p.R719L|YTHDC1_ENST00000355665.3_Missense_Mutation_p.R693L	NM_001031732.2	NP_001026902.1	Q96MU7	YTDC1_HUMAN	YTH domain containing 1	711	Arg-rich.				mRNA splice site selection (GO:0006376)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	30						atcacataatcgctctctttc	0.463																																					p.R711L		Atlas-SNP	.											YTHDC1,NS,carcinoma,0,1	YTHDC1	81	.	0			c.G2132T						.						78.0	72.0	74.0					4																	69179869		2203	4300	6503	SO:0001583	missense	91746	exon17			CATAATCGCTCTC	AK098515	CCDS3522.2, CCDS33992.1	4q13.3	2009-01-14			ENSG00000083896	ENSG00000083896			30626	protein-coding gene	gene with protein product						12368078, 10564280	Standard	XM_005265706		Approved	YT521, KIAA1966, YT521-B	uc003hdx.3	Q96MU7	OTTHUMG00000129306	ENST00000344157.4:c.2132G>T	chr4.hg19:g.69179869C>A	ENSP00000339245:p.Arg711Leu	82.0	0.0		123.0	28.0	NM_001031732	Q4W5Q3|Q7Z622|Q8TF35	Missense_Mutation	SNP	ENST00000344157.4	hg19	CCDS33992.1	.	.	.	.	.	.	.	.	.	.	C	17.01	3.279710	0.59758	.	.	ENSG00000083896	ENST00000344157;ENST00000355665	T;T	0.34667	1.38;1.35	5.56	5.56	0.83823	.	0.222920	0.44285	D	0.000480	T	0.40743	0.1129	N	0.24115	0.695	0.49582	D	0.999803	D;P	0.56035	0.974;0.956	P;P	0.52481	0.7;0.504	T	0.35574	-0.9783	10	0.87932	D	0	.	19.1452	0.93463	0.0:1.0:0.0:0.0	.	693;711	Q96MU7-2;Q96MU7	.;YTDC1_HUMAN	L	711;693	ENSP00000339245:R711L;ENSP00000347888:R693L	ENSP00000339245:R711L	R	-	2	0	YTHDC1	68862464	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.795000	0.69074	2.619000	0.88677	0.467000	0.42956	CGA	.	.		0.463	YTHDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251437.1	NM_133370	
ANK2	287	hgsc.bcm.edu	37	4	114274408	114274408	+	Missense_Mutation	SNP	C	C	G			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr4:114274408C>G	ENST00000357077.4	+	38	4687	c.4634C>G	c.(4633-4635)cCa>cGa	p.P1545R	ANK2_ENST00000510275.2_Intron|ANK2_ENST00000509550.1_Intron|ANK2_ENST00000394537.3_Intron|ANK2_ENST00000264366.6_Missense_Mutation_p.P1512R|ANK2_ENST00000506722.1_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	1545					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GAGGAAGAGCCAGGAGAGCCT	0.438																																					p.P1545R		Atlas-SNP	.											.	ANK2	576	.	0			c.C4634G						.						54.0	56.0	55.0					4																	114274408		2203	4300	6503	SO:0001583	missense	287	exon38			AAGAGCCAGGAGA	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.4634C>G	chr4.hg19:g.114274408C>G	ENSP00000349588:p.Pro1545Arg	138.0	0.0		107.0	84.0	NM_001148	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	hg19	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	C	19.35	3.810136	0.70797	.	.	ENSG00000145362	ENST00000503423;ENST00000504454;ENST00000357077;ENST00000264366	T;T;T;T	0.67698	-0.02;-0.16;-0.28;-0.27	5.62	5.62	0.85841	.	0.000000	0.53938	D	0.000044	T	0.78929	0.4361	L	0.51422	1.61	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.74023	0.943;0.982	T	0.78145	-0.2318	10	0.51188	T	0.08	.	19.662	0.95877	0.0:1.0:0.0:0.0	.	1512;1545	Q01484;Q01484-4	ANK2_HUMAN;.	R	1458;1560;1545;1512	ENSP00000421011:P1458R;ENSP00000424722:P1560R;ENSP00000349588:P1545R;ENSP00000264366:P1512R	ENSP00000264366:P1512R	P	+	2	0	ANK2	114493857	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.079000	0.71291	2.649000	0.89929	0.650000	0.86243	CCA	.	.		0.438	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
LARP1B	55132	hgsc.bcm.edu	37	4	129019441	129019441	+	Nonsense_Mutation	SNP	C	C	T			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr4:129019441C>T	ENST00000326639.6	+	8	980	c.769C>T	c.(769-771)Cag>Tag	p.Q257*	LARP1B_ENST00000354456.3_5'UTR|LARP1B_ENST00000394288.3_Nonsense_Mutation_p.Q257*|LARP1B_ENST00000432347.2_Nonsense_Mutation_p.Q257*|LARP1B_ENST00000512292.1_Nonsense_Mutation_p.Q257*|LARP1B_ENST00000427266.1_Nonsense_Mutation_p.Q257*|LARP1B_ENST00000264584.5_Nonsense_Mutation_p.Q210*|LARP1B_ENST00000441387.1_Nonsense_Mutation_p.Q257*	NM_018078.2	NP_060548.2	Q659C4	LAR1B_HUMAN	La ribonucleoprotein domain family, member 1B	257	HTH La-type RNA-binding. {ECO:0000255|PROSITE-ProRule:PRU00332}.					nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(11)|ovary(1)|prostate(3)	34						TGCTGGTTTTCAGCGTGTTCA	0.378																																					p.Q257X		Atlas-SNP	.											.	LARP1B	120	.	0			c.C769T						.						96.0	83.0	87.0					4																	129019441		2203	4300	6503	SO:0001587	stop_gained	55132	exon8			GGTTTTCAGCGTG		CCDS3738.1, CCDS47133.1, CCDS64057.1	4q28.2	2009-06-09	2009-06-09	2009-06-09	ENSG00000138709	ENSG00000138709		"""La ribonucleoprotein domain containing"""	24704	protein-coding gene	gene with protein product			"""La ribonucleoprotein domain family, member 2"""	LARP2		12045101	Standard	NM_018078		Approved	FLJ10378, DKFZp434K245, DKFZp686E0316	uc003iga.3	Q659C4	OTTHUMG00000133343	ENST00000326639.6:c.769C>T	chr4.hg19:g.129019441C>T	ENSP00000321997:p.Gln257*	40.0	0.0		72.0	14.0	NM_032239	Q2YDB6|Q4W599|Q4W5B2|Q659A0|Q6P5X2|Q7Z3F7|Q86VK7|Q8N6F4|Q8N7H4|Q8NAF2|Q9H5E7|Q9NW12	Nonsense_Mutation	SNP	ENST00000326639.6	hg19	CCDS3738.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	37|37	6.180200|6.180200	0.97352|0.97352	.|.	.|.	ENSG00000138709|ENSG00000138709	ENST00000326639;ENST00000512292;ENST00000508819;ENST00000394288;ENST00000432347;ENST00000264584;ENST00000441387;ENST00000427266|ENST00000507377	.|.	.|.	.|.	5.27|5.27	5.27|5.27	0.74061|0.74061	.|.	0.114305|.	0.64402|.	D|.	0.000015|.	.|T	.|0.64148	.|0.2572	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.61252	.|-0.7100	.|4	0.20046|.	T|.	0.44|.	.|.	12.0742|12.0742	0.53634|0.53634	0.0:0.9213:0.0:0.0787|0.0:0.9213:0.0:0.0787	.|.	.|.	.|.	.|.	X|L	257;257;210;257;257;210;257;257|225	.|.	ENSP00000264584:Q210X|.	Q|S	+|+	1|2	0|0	LARP1B|LARP1B	129238891|129238891	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	5.535000|5.535000	0.67173|0.67173	2.732000|2.732000	0.93576|0.93576	0.650000|0.650000	0.86243|0.86243	CAG|TCA	.	.		0.378	LARP1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257173.2	NM_018078	
ZNF827	152485	hgsc.bcm.edu	37	4	146823924	146823924	+	Missense_Mutation	SNP	C	C	A	rs139372039		TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr4:146823924C>A	ENST00000508784.1	-	2	714	c.487G>T	c.(487-489)Gcc>Tcc	p.A163S	ZNF827_ENST00000379448.4_Missense_Mutation_p.A163S|ZNF827_ENST00000513320.1_Intron			Q17R98	ZN827_HUMAN	zinc finger protein 827	163					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48	all_hematologic(180;0.151)					AGCTGCTGGGCGTGGTGGGAA	0.537																																					p.A163S		Atlas-SNP	.											.	ZNF827	102	.	0			c.G487T						.						77.0	68.0	71.0					4																	146823924		2203	4300	6503	SO:0001583	missense	152485	exon2			GCTGGGCGTGGTG	AK091130	CCDS34072.1	4q31.22	2013-01-08			ENSG00000151612	ENSG00000151612		"""Zinc fingers, C2H2-type"""	27193	protein-coding gene	gene with protein product						12477932	Standard	NM_178835		Approved		uc003ikm.3	Q17R98	OTTHUMG00000161362	ENST00000508784.1:c.487G>T	chr4.hg19:g.146823924C>A	ENSP00000421863:p.Ala163Ser	45.0	0.0		57.0	28.0	NM_178835	B7ZL52|Q7Z4S7|Q8N279	Missense_Mutation	SNP	ENST00000508784.1	hg19		.	.	.	.	.	.	.	.	.	.	C	18.39	3.613722	0.66672	.	.	ENSG00000151612	ENST00000508784;ENST00000379448;ENST00000281318	T;T	0.16597	2.33;2.38	5.84	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.21631	0.0521	L	0.27053	0.805	0.46078	D	0.998851	P;P	0.46621	0.811;0.881	P;P	0.50934	0.452;0.654	T	0.01734	-1.1285	10	0.87932	D	0	-22.6858	14.9737	0.71254	0.0:0.9316:0.0:0.0684	.	163;163	Q17R98;Q17R98-2	ZN827_HUMAN;.	S	163;163;162	ENSP00000421863:A163S;ENSP00000368761:A163S	ENSP00000281318:A162S	A	-	1	0	ZNF827	147043374	1.000000	0.71417	0.991000	0.47740	0.734000	0.41952	7.416000	0.80143	1.483000	0.48342	-0.258000	0.10820	GCC	.	C|1.000;T|0.000		0.537	ZNF827-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000364654.2	NM_178835	
TENM3	55714	hgsc.bcm.edu	37	4	183721246	183721246	+	Silent	SNP	C	C	T			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr4:183721246C>T	ENST00000511685.1	+	28	7965	c.7842C>T	c.(7840-7842)gaC>gaT	p.D2614D	TENM3_ENST00000406950.2_Silent_p.D2614D			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	2614					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										TGACCCTGGACGAGGAGAAGG	0.746																																					p.D2614D		Atlas-SNP	.											.	.	.	.	0			c.C7842T						.						12.0	14.0	13.0					4																	183721246		2130	4235	6365	SO:0001819	synonymous_variant	55714	exon27			CCTGGACGAGGAG	AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.7842C>T	chr4.hg19:g.183721246C>T		51.0	0.0		95.0	35.0	NM_001080477	Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Silent	SNP	ENST00000511685.1	hg19	CCDS47165.1																																																																																			.	.		0.746	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361734.1		
GCNT4	51301	hgsc.bcm.edu	37	5	74325466	74325466	+	Missense_Mutation	SNP	T	T	G			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr5:74325466T>G	ENST00000322348.4	-	1	1258	c.397A>C	c.(397-399)Ata>Cta	p.I133L		NM_016591.2	NP_057675.1	Q9P109	GCNT4_HUMAN	glucosaminyl (N-acetyl) transferase 4, core 2	133					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|homeostasis of number of cells (GO:0048872)|inter-male aggressive behavior (GO:0002121)|kidney morphogenesis (GO:0060993)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|thyroid hormone metabolic process (GO:0042403)|tissue morphogenesis (GO:0048729)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity (GO:0003829)|N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(2)|skin(1)|stomach(2)	19		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;8.44e-57)		GAATAGGCTATTGGGAAGCTT	0.393																																					p.I133L		Atlas-SNP	.											.	GCNT4	46	.	0			c.A397C						.						134.0	129.0	131.0					5																	74325466		2203	4300	6503	SO:0001583	missense	51301	exon1			AGGCTATTGGGAA	AF132035	CCDS4026.1	5q12	2013-02-25	2010-03-16		ENSG00000176928	ENSG00000176928	2.4.1.102	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	17973	protein-coding gene	gene with protein product	"""core 2 beta-1,6-N-acetylglucosaminyltransferase 3"", ""beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase 4"""		"""glucosaminyl (N-acetyl) transferase 4, core 2 (beta-1,6-N-acetylglucosaminyltransferase)"""			10753916	Standard	NM_016591		Approved	C2GNT3	uc003kdn.3	Q9P109	OTTHUMG00000131272	ENST00000322348.4:c.397A>C	chr5.hg19:g.74325466T>G	ENSP00000317027:p.Ile133Leu	55.0	0.0		90.0	6.0	NM_016591		Missense_Mutation	SNP	ENST00000322348.4	hg19	CCDS4026.1	.	.	.	.	.	.	.	.	.	.	.	10.05	1.244533	0.22796	.	.	ENSG00000176928	ENST00000322348	T	0.12147	2.71	6.17	3.71	0.42584	.	0.100808	0.64402	D	0.000003	T	0.05914	0.0154	N	0.16066	0.365	0.32426	N	0.548674	B	0.10296	0.003	B	0.14023	0.01	T	0.33599	-0.9862	10	0.07030	T	0.85	-16.0138	4.9956	0.14237	0.1163:0.0633:0.1217:0.6987	.	133	Q9P109	GCNT4_HUMAN	L	133	ENSP00000317027:I133L	ENSP00000317027:I133L	I	-	1	0	GCNT4	74361222	0.315000	0.24571	0.702000	0.30337	0.952000	0.60782	0.539000	0.23175	0.524000	0.28502	-0.313000	0.08912	ATA	.	.		0.393	GCNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254040.1	NM_016591	
CHD1	1105	hgsc.bcm.edu	37	5	98192416	98192416	+	Nonsense_Mutation	SNP	T	T	A			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr5:98192416T>A	ENST00000284049.3	-	35	4950	c.4801A>T	c.(4801-4803)Aga>Tga	p.R1601*		NM_001270.2	NP_001261.2	O14646	CHD1_HUMAN	chromodomain helicase DNA binding protein 1	1601					chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|methylated histone binding (GO:0035064)			NS(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(2)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	49		all_cancers(142;5.36e-08)|all_epithelial(76;6.97e-11)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|all_lung(232;0.00119)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0717)	Epirubicin(DB00445)	TGTTTCTCTCTGTCACTGTAA	0.294																																					p.R1601X		Atlas-SNP	.											.	CHD1	137	.	0			c.A4801T						.						67.0	66.0	66.0					5																	98192416		2202	4299	6501	SO:0001587	stop_gained	1105	exon35			TCTCTCTGTCACT	AF006513	CCDS34204.1	5q15-q21	2008-07-18			ENSG00000153922	ENSG00000153922			1915	protein-coding gene	gene with protein product		602118				8460153, 9326634	Standard	XM_005271866		Approved		uc003knf.3	O14646	OTTHUMG00000162744	ENST00000284049.3:c.4801A>T	chr5.hg19:g.98192416T>A	ENSP00000284049:p.Arg1601*	78.0	0.0		110.0	43.0	NM_001270	Q17RZ3	Nonsense_Mutation	SNP	ENST00000284049.3	hg19	CCDS34204.1	.	.	.	.	.	.	.	.	.	.	T	43	10.137175	0.99344	.	.	ENSG00000153922	ENST00000422663;ENST00000284049	.	.	.	5.7	3.18	0.36537	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.4484	0.55664	0.0:0.0:0.2537:0.7463	.	.	.	.	X	191;1601	.	ENSP00000284049:R1601X	R	-	1	2	CHD1	98220316	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	2.786000	0.47790	0.375000	0.24679	0.533000	0.62120	AGA	.	.		0.294	CHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370295.1	NM_001270	
TENM2	57451	hgsc.bcm.edu	37	5	167525124	167525124	+	Missense_Mutation	SNP	G	G	C			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr5:167525124G>C	ENST00000518659.1	+	9	1844	c.1805G>C	c.(1804-1806)tGt>tCt	p.C602S	TENM2_ENST00000520394.1_Missense_Mutation_p.C370S|CTB-178M22.1_ENST00000517408.1_RNA|TENM2_ENST00000545108.1_Missense_Mutation_p.C602S|TENM2_ENST00000519204.1_Missense_Mutation_p.C481S|TENM2_ENST00000403607.2_Missense_Mutation_p.C435S	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	602	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.|EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										GGAGCAGACTGTGCTAAAGGT	0.517																																					p.C602S		Atlas-SNP	.											.	.	.	.	0			c.G1805C						.						127.0	125.0	126.0					5																	167525124		2042	4189	6231	SO:0001583	missense	57451	exon9			CAGACTGTGCTAA	AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.1805G>C	chr5.hg19:g.167525124G>C	ENSP00000429430:p.Cys602Ser	77.0	0.0		140.0	33.0	NM_001122679	Q9ULU2	Missense_Mutation	SNP	ENST00000518659.1	hg19		.	.	.	.	.	.	.	.	.	.	G	17.09	3.301418	0.60195	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	T;T;T;T;T	0.20200	2.09;2.09;2.09;2.09;2.09	5.11	5.11	0.69529	EGF, extracellular (1);Epidermal growth factor-like (1);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	0.046763	0.85682	D	0.000000	T	0.68522	0.3010	H	0.99368	4.535	0.80722	D	1	D;D;D	0.89917	1.0;0.984;1.0	D;D;D	0.91635	0.997;0.974;0.999	D	0.84155	0.0425	10	0.87932	D	0	.	18.9359	0.92584	0.0:0.0:1.0:0.0	.	602;370;481	Q9NT68;F8VNQ3;G3V106	TEN2_HUMAN;.;.	S	602;602;481;370;435	ENSP00000429430:C602S;ENSP00000438635:C602S;ENSP00000428964:C481S;ENSP00000427874:C370S;ENSP00000384905:C435S	ENSP00000384905:C435S	C	+	2	0	ODZ2	167457702	1.000000	0.71417	0.997000	0.53966	0.075000	0.17131	9.420000	0.97426	2.538000	0.85594	0.650000	0.86243	TGT	.	.		0.517	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679	
TNXB	7148	hgsc.bcm.edu	37	6	32047000	32047000	+	Silent	SNP	G	G	A			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr6:32047000G>A	ENST00000375244.3	-	11	4386	c.4185C>T	c.(4183-4185)ccC>ccT	p.P1395P	TNXB_ENST00000375247.2_Silent_p.P1395P|RNA5SP206_ENST00000516703.1_RNA			P22105	TENX_HUMAN	tenascin XB	1482	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						AGCTGCCCTGGGGGACGGTCC	0.677																																					p.P1395P		Atlas-SNP	.											.	TNXB	553	.	0			c.C4185T						.						117.0	129.0	125.0					6																	32047000		1260	2540	3800	SO:0001819	synonymous_variant	7148	exon11			GCCCTGGGGGACG	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.4185C>T	chr6.hg19:g.32047000G>A		62.0	0.0		77.0	11.0	NM_019105	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Silent	SNP	ENST00000375244.3	hg19																																																																																				.	.		0.677	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	NM_019105	
PACSIN1	29993	hgsc.bcm.edu	37	6	34494117	34494117	+	Missense_Mutation	SNP	C	C	A			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr6:34494117C>A	ENST00000538621.1	+	2	280	c.35C>A	c.(34-36)cCa>cAa	p.P12Q	PACSIN1_ENST00000374043.2_5'UTR|PACSIN1_ENST00000486120.1_3'UTR|PACSIN1_ENST00000244458.2_Missense_Mutation_p.P12Q	NM_001199583.2	NP_001186512.1	Q9BY11	PACN1_HUMAN	protein kinase C and casein kinase substrate in neurons 1	12	F-BAR domain.				actin filament organization (GO:0007015)|establishment of protein localization to plasma membrane (GO:0090002)|membrane tubulation (GO:0097320)|neuron projection morphogenesis (GO:0048812)|positive regulation of dendrite development (GO:1900006)|protein localization to membrane (GO:0072657)|synaptic vesicle endocytosis (GO:0048488)	axon terminus (GO:0043679)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|synapse (GO:0045202)	phospholipid binding (GO:0005543)			endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)	13						TCACTGGCGCCAGAGGAGACC	0.627																																					p.P12Q		Atlas-SNP	.											.	PACSIN1	42	.	0			c.C35A						.						55.0	51.0	53.0					6																	34494117		2203	4300	6503	SO:0001583	missense	29993	exon2			TGGCGCCAGAGGA	AB037800	CCDS4793.1	6p21.3	2008-02-05			ENSG00000124507	ENSG00000124507			8570	protein-coding gene	gene with protein product	"""syndapin I"""	606512				11179684	Standard	NM_020804		Approved	SDPI	uc003ojp.4	Q9BY11	OTTHUMG00000014547	ENST00000538621.1:c.35C>A	chr6.hg19:g.34494117C>A	ENSP00000439639:p.Pro12Gln	37.0	0.0		73.0	40.0	NM_020804	Q9P2G8	Missense_Mutation	SNP	ENST00000538621.1	hg19	CCDS4793.1	.	.	.	.	.	.	.	.	.	.	C	11.35	1.612398	0.28712	.	.	ENSG00000124507	ENST00000244458;ENST00000436831;ENST00000538621	T;T	0.48522	0.81;0.81	5.09	4.09	0.47781	.	0.906697	0.09497	N	0.794108	T	0.10723	0.0262	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.17440	-1.0369	10	0.13470	T	0.59	-2.7758	9.8093	0.40812	0.0:0.8616:0.0:0.1384	.	12	Q9BY11	PACN1_HUMAN	Q	12	ENSP00000244458:P12Q;ENSP00000439639:P12Q	ENSP00000244458:P12Q	P	+	2	0	PACSIN1	34602095	0.001000	0.12720	0.996000	0.52242	0.994000	0.84299	1.023000	0.30065	2.372000	0.80975	0.561000	0.74099	CCA	.	.		0.627	PACSIN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040236.1		
DNAH8	1769	hgsc.bcm.edu	37	6	38743590	38743590	+	Missense_Mutation	SNP	G	G	A			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr6:38743590G>A	ENST00000359357.3	+	11	1428	c.1174G>A	c.(1174-1176)Gga>Aga	p.G392R	DNAH8_ENST00000441566.1_Missense_Mutation_p.G392R|DNAH8_ENST00000449981.2_Missense_Mutation_p.G609R			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	392					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						TACCATAGAAGGAATAGATAT	0.294																																					p.G609R		Atlas-SNP	.											.	DNAH8	1239	.	0			c.G1825A						.						49.0	56.0	54.0					6																	38743590		2196	4285	6481	SO:0001583	missense	1769	exon13			ATAGAAGGAATAG	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.1174G>A	chr6.hg19:g.38743590G>A	ENSP00000352312:p.Gly392Arg	374.0	0.0		493.0	181.0	NM_001206927	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	hg19		.	.	.	.	.	.	.	.	.	.	G	24.5	4.536989	0.85812	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.57436	0.4;0.4;0.4	5.8	5.8	0.92144	Dynein heavy chain, domain-1 (1);	0.000000	0.85682	D	0.000000	T	0.70996	0.3288	M	0.80332	2.49	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.74028	-0.3796	10	0.87932	D	0	.	17.8277	0.88671	0.0:0.0:1.0:0.0	.	392	Q96JB1	DYH8_HUMAN	R	597;597;392;392	ENSP00000333363:G597R;ENSP00000352312:G392R;ENSP00000402294:G392R	ENSP00000333363:G597R	G	+	1	0	DNAH8	38851568	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.641000	0.83368	2.758000	0.94735	0.643000	0.83706	GGA	.	.		0.294	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
FILIP1	27145	hgsc.bcm.edu	37	6	76072567	76072567	+	Missense_Mutation	SNP	A	A	G			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr6:76072567A>G	ENST00000237172.7	-	3	673	c.343T>C	c.(343-345)Tac>Cac	p.Y115H	RP11-415D17.3_ENST00000609544.1_RNA|RP11-415D17.3_ENST00000588761.1_RNA|RP11-415D17.3_ENST00000440220.1_RNA|RP11-415D17.3_ENST00000419709.1_RNA|RP11-415D17.3_ENST00000415457.2_RNA|FILIP1_ENST00000393004.2_Missense_Mutation_p.Y115H|RP11-415D17.3_ENST00000591821.2_RNA|FILIP1_ENST00000370020.1_Missense_Mutation_p.Y16H	NM_015687.2	NP_056502.1	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	115										breast(3)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)	80						GCAGACCCGTAATGAGCCTCC	0.507																																					p.Y115H		Atlas-SNP	.											.	FILIP1	173	.	0			c.T343C						.						130.0	130.0	130.0					6																	76072567		2203	4300	6503	SO:0001583	missense	27145	exon3			ACCCGTAATGAGC	AB033101	CCDS4984.1, CCDS75480.1	6q14.1	2008-02-05			ENSG00000118407	ENSG00000118407			21015	protein-coding gene	gene with protein product		607307				10574462	Standard	XM_005248713		Approved	FILIP, KIAA1275	uc003pia.3	Q7Z7B0	OTTHUMG00000015056	ENST00000237172.7:c.343T>C	chr6.hg19:g.76072567A>G	ENSP00000237172:p.Tyr115His	69.0	0.0		63.0	33.0	NM_015687	B2RMU6|Q5VUL6|Q86TC3|Q8N8B9|Q96SK6|Q9NVI8|Q9ULE5	Missense_Mutation	SNP	ENST00000237172.7	hg19	CCDS4984.1	.	.	.	.	.	.	.	.	.	.	A	32	5.134986	0.94517	.	.	ENSG00000118407	ENST00000393004;ENST00000237172;ENST00000370020	T;T;T	0.67345	-0.26;-0.26;-0.26	5.99	5.99	0.97316	Cortactin-binding protein-2, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.82171	0.4979	M	0.88570	2.965	0.80722	D	1	D;D;D	0.89917	1.0;0.984;0.981	D;D;P	0.91635	0.999;0.927;0.881	D	0.85222	0.1027	10	0.59425	D	0.04	-14.6073	16.4943	0.84223	1.0:0.0:0.0:0.0	.	115;115;115	A8K2G7;Q7Z7B0;Q7Z7B0-2	.;FLIP1_HUMAN;.	H	115;115;16	ENSP00000376728:Y115H;ENSP00000237172:Y115H;ENSP00000359037:Y16H	ENSP00000237172:Y115H	Y	-	1	0	FILIP1	76129287	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	9.339000	0.96797	2.291000	0.77112	0.533000	0.62120	TAC	.	.		0.507	FILIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041263.1	XM_029179	
BVES	11149	hgsc.bcm.edu	37	6	105564646	105564646	+	Missense_Mutation	SNP	A	A	C			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr6:105564646A>C	ENST00000314641.5	-	6	962	c.746T>G	c.(745-747)tTt>tGt	p.F249C	BVES_ENST00000336775.5_Missense_Mutation_p.F249C|BVES_ENST00000446408.2_Missense_Mutation_p.F249C	NM_001199563.1	NP_001186492.1	Q8NE79	POPD1_HUMAN	blood vessel epicardial substance	249					epithelial cell-cell adhesion (GO:0090136)|hematopoietic progenitor cell differentiation (GO:0002244)|muscle organ development (GO:0007517)|positive regulation of locomotion (GO:0040017)|positive regulation of receptor recycling (GO:0001921)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|regulation of Rac GTPase activity (GO:0032314)|sinoatrial node cell development (GO:0060931)|substrate adhesion-dependent cell spreading (GO:0034446)|vesicle-mediated transport (GO:0016192)	integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	cAMP binding (GO:0030552)|structural molecule activity (GO:0005198)			NS(2)|large_intestine(6)|lung(9)|prostate(2)|skin(1)|urinary_tract(1)	21		all_cancers(87;2.83e-05)|Acute lymphoblastic leukemia(125;1.95e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0101)|Colorectal(196;0.204)|Lung NSC(302;0.238)				AAGATACCTAAAGATTTCATA	0.323																																					p.F249C		Atlas-SNP	.											.	BVES	33	.	0			c.T746G						.						74.0	69.0	71.0					6																	105564646		2202	4295	6497	SO:0001583	missense	11149	exon6			TACCTAAAGATTT	AF124512	CCDS5051.1	6q21	2008-11-25			ENSG00000112276	ENSG00000112276			1152	protein-coding gene	gene with protein product	"""popeye domain containing 1"""	604577				10441744, 10882522	Standard	NM_147147		Approved	HBVES, POP1, POPDC1	uc003pqx.3	Q8NE79	OTTHUMG00000015291	ENST00000314641.5:c.746T>G	chr6.hg19:g.105564646A>C	ENSP00000313172:p.Phe249Cys	97.0	0.0		108.0	40.0	NM_001199563	A8K1R4|E1P5D8|Q5T550|Q5T551|Q8IWC6|Q9HBV0|Q9UNG6	Missense_Mutation	SNP	ENST00000314641.5	hg19	CCDS5051.1	.	.	.	.	.	.	.	.	.	.	A	22.7	4.321008	0.81580	.	.	ENSG00000112276	ENST00000314641;ENST00000336775;ENST00000446408	T;T;T	0.52754	0.65;0.65;0.65	5.55	5.55	0.83447	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);	0.000000	0.85682	D	0.000000	T	0.65291	0.2677	M	0.81682	2.555	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.71484	-0.4579	10	0.87932	D	0	-18.5597	15.9824	0.80121	1.0:0.0:0.0:0.0	.	249	Q8NE79	POPD1_HUMAN	C	249	ENSP00000313172:F249C;ENSP00000337259:F249C;ENSP00000397310:F249C	ENSP00000313172:F249C	F	-	2	0	BVES	105671339	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.287000	0.95975	2.234000	0.73211	0.528000	0.53228	TTT	.	.		0.323	BVES-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406075.1	NM_147147	
CITED2	10370	hgsc.bcm.edu	37	6	139694788	139694788	+	Missense_Mutation	SNP	G	G	T			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr6:139694788G>T	ENST00000367651.2	-	2	509	c.294C>A	c.(292-294)ttC>ttA	p.F98L	CITED2_ENST00000537332.1_Missense_Mutation_p.F98L|CITED2_ENST00000536159.1_Missense_Mutation_p.F98L	NM_006079.4	NP_006070.2	Q99967	CITE2_HUMAN	Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2	98					adrenal cortex formation (GO:0035802)|bone morphogenesis (GO:0060349)|cardiac neural crest cell development involved in heart development (GO:0061308)|cell aging (GO:0007569)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|cranial nerve morphogenesis (GO:0021602)|decidualization (GO:0046697)|determination of left/right symmetry (GO:0007368)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|endocardial cushion development (GO:0003197)|erythrocyte development (GO:0048821)|granulocyte differentiation (GO:0030851)|heart development (GO:0007507)|heart looping (GO:0001947)|hematopoietic progenitor cell differentiation (GO:0002244)|left/right axis specification (GO:0070986)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell migration (GO:0030336)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900164)|outflow tract morphogenesis (GO:0003151)|peripheral nervous system development (GO:0007422)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of gene expression (GO:0010628)|positive regulation of male gonad development (GO:2000020)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|pulmonary artery morphogenesis (GO:0061156)|regulation of organ formation (GO:0003156)|regulation of RNA biosynthetic process (GO:2001141)|response to estrogen (GO:0043627)|response to fluid shear stress (GO:0034405)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|sex determination (GO:0007530)|skeletal muscle cell differentiation (GO:0035914)|spleen development (GO:0048536)|thymus development (GO:0048538)|transforming growth factor beta receptor signaling pathway (GO:0007179)|trophectodermal cell differentiation (GO:0001829)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|LBD domain binding (GO:0050693)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			large_intestine(1)|lung(4)	5	Breast(32;0.226)			GBM - Glioblastoma multiforme(68;0.000171)|OV - Ovarian serous cystadenocarcinoma(155;0.00134)		GGGGACCCATGAACTGGGAGT	0.667																																					p.F103L	NSCLC(98;1219 1550 33720 43229 49330)	Atlas-SNP	.											.	CITED2	16	.	0			c.C309A						.						41.0	47.0	45.0					6																	139694788		2191	4287	6478	SO:0001583	missense	10370	exon2			ACCCATGAACTGG	U65093	CCDS5195.1, CCDS75530.1	6q23.3	2008-08-29			ENSG00000164442	ENSG00000164442			1987	protein-coding gene	gene with protein product		602937				8901575, 10552932	Standard	NM_006079		Approved	MRG1	uc021zfz.2	Q99967	OTTHUMG00000015691	ENST00000367651.2:c.294C>A	chr6.hg19:g.139694788G>T	ENSP00000356623:p.Phe98Leu	38.0	0.0		57.0	21.0	NM_001168389	O95426|Q5VTF4	Missense_Mutation	SNP	ENST00000367651.2	hg19	CCDS5195.1	.	.	.	.	.	.	.	.	.	.	G	12.93	2.086869	0.36855	.	.	ENSG00000164442	ENST00000367651;ENST00000536159;ENST00000537332;ENST00000392312	T;T;T	0.73681	-0.77;-0.77;-0.77	5.28	5.28	0.74379	.	0.000000	0.64402	D	0.000001	T	0.56016	0.1957	L	0.50333	1.59	0.52099	D	0.99994	B	0.34349	0.45	B	0.34138	0.176	T	0.58679	-0.7594	9	.	.	.	-2.7	12.2935	0.54831	0.0778:0.0:0.9222:0.0	.	98	Q99967	CITE2_HUMAN	L	98	ENSP00000356623:F98L;ENSP00000442831:F98L;ENSP00000444198:F98L	.	F	-	3	2	CITED2	139736481	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	2.724000	0.47285	2.488000	0.83962	0.462000	0.41574	TTC	.	.		0.667	CITED2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042463.1		
GRM1	2911	hgsc.bcm.edu	37	6	146755516	146755516	+	Missense_Mutation	SNP	G	G	T			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr6:146755516G>T	ENST00000282753.1	+	8	3404	c.3169G>T	c.(3169-3171)Ggt>Tgt	p.G1057C	GRM1_ENST00000361719.2_Missense_Mutation_p.G1057C|GRM1_ENST00000355289.4_3'UTR|GRM1_ENST00000492807.2_3'UTR|GRM1_ENST00000507907.1_3'UTR|GRM1_ENST00000392299.2_3'UTR			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	1057					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		AGGCCCCGGTGGTCCCGGGAA	0.667																																					p.G1057C		Atlas-SNP	.											.	GRM1	419	.	0			c.G3169T						.						19.0	24.0	22.0					6																	146755516		2194	4283	6477	SO:0001583	missense	2911	exon9			CCCGGTGGTCCCG	U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.3169G>T	chr6.hg19:g.146755516G>T	ENSP00000282753:p.Gly1057Cys	120.0	0.0		134.0	61.0	NM_000838	B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Missense_Mutation	SNP	ENST00000282753.1	hg19	CCDS5209.1	.	.	.	.	.	.	.	.	.	.	G	15.75	2.924433	0.52653	.	.	ENSG00000152822	ENST00000361719;ENST00000282753	D;D	0.88277	-2.36;-2.36	5.5	4.62	0.57501	.	0.995451	0.08147	N	0.990731	T	0.76371	0.3978	L	0.29908	0.895	0.80722	D	1	P	0.39576	0.679	B	0.38500	0.275	T	0.71517	-0.4569	10	0.54805	T	0.06	.	9.4856	0.38928	0.0994:0.0:0.9005:0.0	.	1057	Q13255	GRM1_HUMAN	C	1057	ENSP00000354896:G1057C;ENSP00000282753:G1057C	ENSP00000282753:G1057C	G	+	1	0	GRM1	146797209	0.944000	0.32072	0.218000	0.23776	0.764000	0.43329	1.439000	0.35013	1.318000	0.45170	0.456000	0.33151	GGT	.	.		0.667	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042574.1	NM_000838	
MICALL2	79778	hgsc.bcm.edu	37	7	1484708	1484708	+	Missense_Mutation	SNP	T	T	A			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr7:1484708T>A	ENST00000297508.7	-	6	1173	c.998A>T	c.(997-999)gAg>gTg	p.E333V	MICALL2_ENST00000405088.4_Missense_Mutation_p.E121V	NM_182924.3	NP_891554.1	Q8IY33	MILK2_HUMAN	MICAL-like 2	333	Mediates targeting to the cell plasma membrane. {ECO:0000250}.|Necessary and sufficient for interaction with actinins. {ECO:0000250}.				actin cytoskeleton reorganization (GO:0031532)|actin filament polymerization (GO:0030041)|endocytic recycling (GO:0032456)|neuron projection development (GO:0031175)|substrate adhesion-dependent cell spreading (GO:0034446)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|stress fiber (GO:0001725)|tight junction (GO:0005923)	actin filament binding (GO:0051015)|filamin binding (GO:0031005)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|lung(8)|ovary(2)|skin(2)	19		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;6.01e-15)		GACTTTCCCCTCCGTGGGAGT	0.711																																					p.E333V		Atlas-SNP	.											.	MICALL2	63	.	0			c.A998T						.						9.0	9.0	9.0					7																	1484708		2027	4079	6106	SO:0001583	missense	79778	exon6			TTCCCCTCCGTGG	BC037988	CCDS5324.1	7p22.3	2006-11-24			ENSG00000164877	ENSG00000164877			29672	protein-coding gene	gene with protein product	"""junctional Rab13-binding protein"""					12110185, 16525024	Standard	NM_182924		Approved	MGC46023, FLJ23471, MICAL-L2, JRAB	uc003skj.4	Q8IY33	OTTHUMG00000119021	ENST00000297508.7:c.998A>T	chr7.hg19:g.1484708T>A	ENSP00000297508:p.Glu333Val	44.0	0.0		57.0	23.0	NM_182924	D3YTD2|Q7RTP4|Q7Z655|Q8TEQ4|Q9H5F9	Missense_Mutation	SNP	ENST00000297508.7	hg19	CCDS5324.1	.	.	.	.	.	.	.	.	.	.	T	9.563	1.118944	0.20877	.	.	ENSG00000164877	ENST00000405088;ENST00000297508	T;T	0.69685	2.48;-0.42	3.28	-1.31	0.09230	.	1.676740	0.04204	N	0.330530	T	0.42449	0.1203	N	0.19112	0.55	0.09310	N	1	P	0.38978	0.652	B	0.26693	0.072	T	0.25187	-1.0139	10	0.29301	T	0.29	.	4.5177	0.11943	0.0:0.555:0.2139:0.2311	.	333	Q8IY33	MILK2_HUMAN	V	121;333	ENSP00000385928:E121V;ENSP00000297508:E333V	ENSP00000297508:E333V	E	-	2	0	MICALL2	1451234	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.745000	0.04834	-0.453000	0.07076	-0.451000	0.05528	GAG	.	.		0.711	MICALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239223.2	NM_182924	
SDK1	221935	hgsc.bcm.edu	37	7	4150329	4150329	+	Missense_Mutation	SNP	C	C	T			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr7:4150329C>T	ENST00000404826.2	+	23	3498	c.3359C>T	c.(3358-3360)aCc>aTc	p.T1120I	SDK1_ENST00000389531.3_Missense_Mutation_p.T1120I	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	1120	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		GAGTGGGTCACCCTCTATGAA	0.552																																					p.T1120I		Atlas-SNP	.											.	SDK1	361	.	0			c.C3359T						.						172.0	136.0	148.0					7																	4150329		2203	4300	6503	SO:0001583	missense	221935	exon23			GGGTCACCCTCTA	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.3359C>T	chr7.hg19:g.4150329C>T	ENSP00000385899:p.Thr1120Ile	51.0	0.0		63.0	19.0	NM_152744	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	hg19	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	C	9.811	1.183059	0.21870	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.58652	0.32;0.32	5.51	0.358	0.16084	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.697831	0.14119	N	0.340183	T	0.44829	0.1312	L	0.31752	0.955	0.09310	N	1	B;B	0.14012	0.009;0.008	B;B	0.12156	0.005;0.007	T	0.26815	-1.0092	10	0.35671	T	0.21	.	14.3466	0.66668	0.0:0.5558:0.2759:0.1682	.	1120;1120	F8W6X9;Q7Z5N4	.;SDK1_HUMAN	I	1120	ENSP00000385899:T1120I;ENSP00000374182:T1120I	ENSP00000374182:T1120I	T	+	2	0	SDK1	4116855	0.002000	0.14202	0.270000	0.24601	0.967000	0.64934	0.329000	0.19698	-0.238000	0.09724	-0.176000	0.13171	ACC	.	.		0.552	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744	
IGFBP3	3486	hgsc.bcm.edu	37	7	45954471	45954471	+	Missense_Mutation	SNP	T	T	C	rs45490491		TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr7:45954471T>C	ENST00000275521.6	-	4	957	c.824A>G	c.(823-825)tAc>tGc	p.Y275C	IGFBP3_ENST00000465642.1_5'Flank|IGFBP3_ENST00000381083.4_Missense_Mutation_p.Y281C|IGFBP3_ENST00000381086.5_Missense_Mutation_p.Y178C	NM_000598.4|NM_001013398.1	NP_000589.2|NP_001013416.1	P17936	IBP3_HUMAN	insulin-like growth factor binding protein 3	275	Thyroglobulin type-1. {ECO:0000255|PROSITE-ProRule:PRU00500}.				apoptotic process (GO:0006915)|cellular protein metabolic process (GO:0044267)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of signal transduction (GO:0009968)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|osteoblast differentiation (GO:0001649)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of myoblast differentiation (GO:0045663)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of glucose metabolic process (GO:0010906)|type B pancreatic cell proliferation (GO:0044342)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|insulin-like growth factor binding protein complex (GO:0016942)|nucleus (GO:0005634)	insulin-like growth factor binding (GO:0005520)|insulin-like growth factor I binding (GO:0031994)|metal ion binding (GO:0046872)|protein tyrosine phosphatase activator activity (GO:0008160)			large_intestine(6)|lung(7)|pancreas(1)|prostate(3)	17					Mecasermin(DB01277)	CTTGGTGGTGTAGCCTGGGAG	0.597																																					p.Y281C		Atlas-SNP	.											.	IGFBP3	40	.	0			c.A842G						.						77.0	63.0	68.0					7																	45954471		2203	4300	6503	SO:0001583	missense	3486	exon4			GTGGTGTAGCCTG		CCDS5505.1, CCDS34632.1	7p12.3	2014-09-17			ENSG00000146674	ENSG00000146674			5472	protein-coding gene	gene with protein product	"""growth hormone-dependent binding protein"", ""acid stable subunit of the 140 K IGF complex"", ""binding protein 53"", ""binding protein 29"", ""IGF-binding protein 3"""	146732				1695633	Standard	NM_000598		Approved	IBP3, BP-53	uc003tnr.3	P17936	OTTHUMG00000023769	ENST00000275521.6:c.824A>G	chr7.hg19:g.45954471T>C	ENSP00000275521:p.Tyr275Cys	62.0	0.0		83.0	30.0	NM_001013398	A4D2F5|D3DVM0|Q2V509|Q6P1M6|Q9UCL4	Missense_Mutation	SNP	ENST00000275521.6	hg19	CCDS5505.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.00|14.00	2.403640|2.403640	0.42613|0.42613	.|.	.|.	ENSG00000146674|ENSG00000146674	ENST00000428530|ENST00000545032;ENST00000275521;ENST00000381086;ENST00000438491;ENST00000442142;ENST00000381083;ENST00000433047	.|T;T;T	.|0.63255	.|-0.03;-0.03;-0.03	5.29|5.29	-0.433|-0.433	0.12287|0.12287	.|Thyroglobulin type-1 (5);	.|0.343146	.|0.31660	.|N	.|0.007273	T|T	0.66577|0.66577	0.2803|0.2803	L|L	0.54323|0.54323	1.7|1.7	0.24740|0.24740	N|N	0.993049|0.993049	.|D;D;D	.|0.71674	.|0.998;0.998;0.996	.|D;D;D	.|0.70227	.|0.954;0.968;0.956	T|T	0.57423|0.57423	-0.7814|-0.7814	5|10	.|0.45353	.|T	.|0.12	-15.1114|-15.1114	5.7833|5.7833	0.18318|0.18318	0.4564:0.0:0.1376:0.406|0.4564:0.0:0.1376:0.406	.|.	.|178;275;260	.|B3KWK7;P17936;B4DN53	.|.;IBP3_HUMAN;.	A|C	127|252;275;178;261;173;281;247	.|ENSP00000275521:Y275C;ENSP00000370476:Y178C;ENSP00000370473:Y281C	.|ENSP00000275521:Y275C	T|Y	-|-	1|2	0|0	IGFBP3|IGFBP3	45920996|45920996	0.945000|0.945000	0.32115|0.32115	0.044000|0.044000	0.18714|0.18714	0.631000|0.631000	0.37964|0.37964	1.263000|1.263000	0.33004|0.33004	-0.330000|-0.330000	0.08514|0.08514	0.533000|0.533000	0.62120|0.62120	ACA|TAC	.	.		0.597	IGFBP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251356.3	NM_001013398	
PCMTD1	115294	hgsc.bcm.edu	37	8	52733033	52733033	+	Missense_Mutation	SNP	T	T	G			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr8:52733033T>G	ENST00000360540.5	-	7	1358	c.952A>C	c.(952-954)Aaa>Caa	p.K318Q	PCMTD1_ENST00000522514.1_Missense_Mutation_p.K318Q|PCMTD1_ENST00000519559.1_5'UTR|PCMTD1_ENST00000544451.1_Missense_Mutation_p.K242Q	NM_052937.2	NP_443169.2	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1	318						cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)			NS(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(17)|prostate(2)|skin(8)|soft_tissue(1)	37		Lung NSC(129;0.0795)|all_lung(136;0.144)				TTGTGAtctttttcctcctct	0.388																																					p.K318Q		Atlas-SNP	.											.	PCMTD1	73	.	0			c.A952C						.						108.0	89.0	95.0					8																	52733033		2203	4300	6503	SO:0001583	missense	115294	exon6			GATCTTTTTCCTC		CCDS6148.1, CCDS69480.1	8q11.23	2010-08-05			ENSG00000168300	ENSG00000168300			30483	protein-coding gene	gene with protein product							Standard	XM_005251146		Approved	FLJ10883	uc003xqx.4	Q96MG8	OTTHUMG00000164246	ENST00000360540.5:c.952A>C	chr8.hg19:g.52733033T>G	ENSP00000353739:p.Lys318Gln	64.0	0.0		107.0	9.0	NM_052937	Q96FK9	Missense_Mutation	SNP	ENST00000360540.5	hg19	CCDS6148.1	.	.	.	.	.	.	.	.	.	.	T	12.81	2.050034	0.36181	.	.	ENSG00000168300	ENST00000360540;ENST00000544451;ENST00000522514	T;T;T	0.47528	1.47;0.84;1.47	5.97	4.79	0.61399	.	0.648513	0.16477	N	0.212690	T	0.32315	0.0825	N	0.14661	0.345	0.43512	D	0.99577	P;P;B	0.39282	0.666;0.493;0.048	B;B;B	0.37508	0.252;0.116;0.012	T	0.05683	-1.0870	10	0.34782	T	0.22	-20.6325	13.5036	0.61471	0.0:0.0:0.1301:0.8699	.	188;242;318	B4E2B4;F5H1M8;Q96MG8	.;.;PCMD1_HUMAN	Q	318;242;318	ENSP00000353739:K318Q;ENSP00000444026:K242Q;ENSP00000428099:K318Q	ENSP00000353739:K318Q	K	-	1	0	PCMTD1	52895586	1.000000	0.71417	0.719000	0.30619	0.281000	0.26958	4.310000	0.59141	1.041000	0.40125	0.533000	0.62120	AAA	.	.		0.388	PCMTD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377909.2	NM_052937	
PREX2	80243	hgsc.bcm.edu	37	8	69104690	69104690	+	Missense_Mutation	SNP	T	T	C			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr8:69104690T>C	ENST00000288368.4	+	37	4811	c.4534T>C	c.(4534-4536)Tca>Cca	p.S1512P		NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	1512					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						TGGACTGCTGTCAGTTTCCTC	0.562																																					p.S1512P		Atlas-SNP	.											.	PREX2	614	.	0			c.T4534C						.						69.0	56.0	61.0					8																	69104690		2203	4300	6503	SO:0001583	missense	80243	exon37			CTGCTGTCAGTTT	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.4534T>C	chr8.hg19:g.69104690T>C	ENSP00000288368:p.Ser1512Pro	38.0	0.0		65.0	11.0	NM_024870	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	ENST00000288368.4	hg19	CCDS6201.1	.	.	.	.	.	.	.	.	.	.	T	5.499	0.277037	0.10403	.	.	ENSG00000046889	ENST00000288368	T	0.59083	0.29	4.89	4.89	0.63831	.	0.080287	0.52532	D	0.000069	T	0.42810	0.1219	N	0.17082	0.46	0.52501	D	0.999954	B	0.02656	0.0	B	0.06405	0.002	T	0.30707	-0.9969	10	0.44086	T	0.13	.	14.8053	0.69948	0.0:0.0:0.0:1.0	.	1512	Q70Z35	PREX2_HUMAN	P	1512	ENSP00000288368:S1512P	ENSP00000288368:S1512P	S	+	1	0	PREX2	69267244	1.000000	0.71417	0.993000	0.49108	0.918000	0.54935	3.477000	0.53151	1.965000	0.57142	0.383000	0.25322	TCA	.	.		0.562	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170	
JPH1	56704	hgsc.bcm.edu	37	8	75227529	75227529	+	Missense_Mutation	SNP	G	G	A			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr8:75227529G>A	ENST00000342232.4	-	2	746	c.706C>T	c.(706-708)Cgc>Tgc	p.R236C		NM_020647.2	NP_065698.1	Q9HDC5	JPH1_HUMAN	junctophilin 1	236	Ser-rich.				calcium ion transport into cytosol (GO:0060402)|muscle organ development (GO:0007517)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	24	Breast(64;0.00576)		BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.0728)|all cancers(69;0.176)			ACAGAGCTGCGCTTGCTCGAG	0.562																																					p.R236C		Atlas-SNP	.											.	JPH1	77	.	0			c.C706T						.						72.0	76.0	74.0					8																	75227529		2203	4300	6503	SO:0001583	missense	56704	exon2			AGCTGCGCTTGCT	AB042634	CCDS6217.1	8q21	2008-07-03			ENSG00000104369	ENSG00000104369			14201	protein-coding gene	gene with protein product		605266				10891348, 10949023	Standard	XM_005251273		Approved	JP-1	uc003yae.3	Q9HDC5	OTTHUMG00000164524	ENST00000342232.4:c.706C>T	chr8.hg19:g.75227529G>A	ENSP00000344488:p.Arg236Cys	107.0	0.0		147.0	17.0	NM_020647	B2RTZ0	Missense_Mutation	SNP	ENST00000342232.4	hg19	CCDS6217.1	.	.	.	.	.	.	.	.	.	.	G	17.56	3.421215	0.62622	.	.	ENSG00000104369	ENST00000342232	T	0.61392	0.11	4.89	4.01	0.46588	.	0.051769	0.85682	D	0.000000	T	0.68979	0.3060	M	0.72118	2.19	0.80722	D	1	D	0.76494	0.999	P	0.56088	0.791	T	0.73341	-0.4013	10	0.56958	D	0.05	.	14.6516	0.68800	0.0:0.0:0.8535:0.1465	.	236	Q9HDC5	JPH1_HUMAN	C	236	ENSP00000344488:R236C	ENSP00000344488:R236C	R	-	1	0	JPH1	75390084	1.000000	0.71417	1.000000	0.80357	0.787000	0.44495	3.462000	0.53042	1.247000	0.43917	-0.182000	0.12963	CGC	.	.		0.562	JPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379102.1		
CDKN2A	1029	hgsc.bcm.edu	37	9	21971209	21971209	+	Splice_Site	SNP	T	T	A			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr9:21971209T>A	ENST00000304494.5	-	2	421		c.e2-2		CDKN2A_ENST00000479692.2_Splice_Site|CDKN2A_ENST00000361570.3_Splice_Site|CDKN2A_ENST00000497750.1_Splice_Site|CDKN2A_ENST00000494262.1_Splice_Site|CDKN2A_ENST00000578845.2_5'UTR|CDKN2A_ENST00000446177.1_Splice_Site|CDKN2A_ENST00000498124.1_Splice_Site|CDKN2A_ENST00000579755.1_Splice_Site|CDKN2A_ENST00000579122.1_Splice_Site|CDKN2A_ENST00000530628.2_Splice_Site|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000498628.2_Splice_Site	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A						cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.?(23)|p.0(1)|p.V28_V51del(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		CATCATGACCTGCCAGAGAGA	0.667		17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																											.		Atlas-SNP	.											CDKN2A_ENST00000498124,bladder,carcinoma,0,17	CDKN2A	4810	.	1340	Whole gene deletion(1316)|Unknown(23)|Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(277)|skin(168)|central_nervous_system(163)|lung(146)|urinary_tract(91)|bone(74)|soft_tissue(57)|upper_aerodigestive_tract(52)|pleura(51)|oesophagus(49)|ovary(34)|kidney(30)|breast(30)|pancreas(29)|thyroid(13)|NS(12)|biliary_tract(12)|stomach(12)|autonomic_ganglia(7)|meninges(7)|large_intestine(6)|liver(6)|salivary_gland(4)|thymus(4)|vulva(2)|endometrium(2)|prostate(2)	c.151-2A>T	GRCh37	CS014762	CDKN2A	S		.						8.0	9.0	8.0					9																	21971209		2066	4135	6201	SO:0001630	splice_region_variant	1029	exon3			ATGACCTGCCAGA	L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.151-2A>T	chr9.hg19:g.21971209T>A		37.0	0.0		43.0	16.0	NM_001195132	A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Splice_Site	SNP	ENST00000304494.5	hg19	CCDS6510.1	.	.	.	.	.	.	.	.	.	.	T	15.20	2.762210	0.49468	.	.	ENSG00000147889	ENST00000361570;ENST00000304494;ENST00000530628;ENST00000446177	.	.	.	5.74	5.74	0.90152	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.022	0.71637	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	CDKN2A	21961209	1.000000	0.71417	0.993000	0.49108	0.550000	0.35303	7.014000	0.76380	2.181000	0.69327	0.454000	0.30748	.	.	.		0.667	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000051915.1	NM_000077	Intron
AGTPBP1	23287	hgsc.bcm.edu	37	9	88162138	88162138	+	Silent	SNP	T	T	C			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr9:88162138T>C	ENST00000357081.3	-	26	3711	c.3567A>G	c.(3565-3567)gcA>gcG	p.A1189A	AGTPBP1_ENST00000376109.3_Silent_p.A1201A|AGTPBP1_ENST00000337006.4_3'UTR|AGTPBP1_ENST00000376083.3_Silent_p.A1149A|AGTPBP1_ENST00000432218.1_Missense_Mutation_p.Q638R			Q9UPW5	CBPC1_HUMAN	ATP/GTP binding protein 1	1189					adult walking behavior (GO:0007628)|C-terminal protein deglutamylation (GO:0035609)|cerebellar Purkinje cell differentiation (GO:0021702)|eye photoreceptor cell differentiation (GO:0001754)|mitochondrion organization (GO:0007005)|neuromuscular process (GO:0050905)|neurotransmitter metabolic process (GO:0042133)|olfactory bulb development (GO:0021772)|protein side chain deglutamylation (GO:0035610)|retina development in camera-type eye (GO:0060041)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(12)|ovary(5)|skin(2)|urinary_tract(3)	44						CATTACTTTCTGCACTGTAAT	0.383																																					p.A1149A		Atlas-SNP	.											.	AGTPBP1	128	.	0			c.A3447G						.						157.0	142.0	147.0					9																	88162138		2203	4300	6503	SO:0001819	synonymous_variant	23287	exon26			ACTTTCTGCACTG	AB028958	CCDS6672.1, CCDS75854.1	9q21.33	2014-06-23			ENSG00000135049	ENSG00000135049			17258	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 1"", ""tubulinyl-Tyr carboxypeptidase"", ""carboxypeptidase-tubulin"", ""tyrosine carboxypeptidase"", ""soluble carboxypeptidase"""	606830				11083920	Standard	NM_015239		Approved	KIAA1035, Nna1, CCP1	uc010mqc.3	Q9UPW5	OTTHUMG00000020124	ENST00000357081.3:c.3567A>G	chr9.hg19:g.88162138T>C		86.0	0.0		98.0	42.0	NM_015239	B4DIT6|B4DRZ8|Q5VV80|Q63HM7|Q658P5|Q6P9D6|Q9H8U6|Q9H9W8|Q9NVK1	Silent	SNP	ENST00000357081.3	hg19		.	.	.	.	.	.	.	.	.	.	T	14.72	2.619031	0.46736	.	.	ENSG00000135049	ENST00000432218	T	0.42900	0.96	5.89	4.74	0.60224	.	.	.	.	.	T	0.58538	0.2129	.	.	.	0.80722	D	1	D	0.63046	0.992	P	0.57009	0.811	T	0.63484	-0.6627	8	0.87932	D	0	-24.3728	13.251	0.60052	0.0:0.0:0.1326:0.8674	.	638	B4DHX2	.	R	638	ENSP00000402804:Q638R	ENSP00000402804:Q638R	Q	-	2	0	AGTPBP1	87351958	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.705000	0.47127	1.027000	0.39758	0.459000	0.35465	CAG	.	.		0.383	AGTPBP1-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000052893.1	NM_015239	
ABCA2	20	hgsc.bcm.edu	37	9	139910208	139910208	+	Missense_Mutation	SNP	T	T	C			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr9:139910208T>C	ENST00000371605.3	-	22	3577	c.3430A>G	c.(3430-3432)Atc>Gtc	p.I1144V	ABCA2_ENST00000492260.1_5'Flank|ABCA2_ENST00000341511.6_Missense_Mutation_p.I1145V|ABCA2_ENST00000265662.5_Missense_Mutation_p.I1145V			Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 2	1144	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				ATP catabolic process (GO:0006200)|cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|regulation of intracellular cholesterol transport (GO:0032383)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|nucleotide binding (GO:0000166)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|liver(1)|lung(25)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	41	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		TCCAGGATGATGGCGCGAGAG	0.657																																					p.I1175V		Atlas-SNP	.											.	ABCA2	113	.	0			c.A3523G						.						28.0	34.0	32.0					9																	139910208		2169	4266	6435	SO:0001583	missense	20	exon23			GGATGATGGCGCG	U18235	CCDS43909.1	9q34	2012-03-14			ENSG00000107331	ENSG00000107331		"""ATP binding cassette transporters / subfamily A"""	32	protein-coding gene	gene with protein product		600047		ABC2		8088782	Standard	NM_212533		Approved		uc022bpy.1	Q9BZC7	OTTHUMG00000020958	ENST00000371605.3:c.3430A>G	chr9.hg19:g.139910208T>C	ENSP00000360666:p.Ile1144Val	61.0	0.0		95.0	38.0	NM_212533	A6NED5|Q5SPY5|Q5W9G5|Q76MW7|Q9HC28	Missense_Mutation	SNP	ENST00000371605.3	hg19		.	.	.	.	.	.	.	.	.	.	T	0.050	-1.252815	0.01469	.	.	ENSG00000107331	ENST00000265662;ENST00000371605;ENST00000355090;ENST00000341511	D;D;D	0.93712	-3.27;-3.27;-3.27	4.2	3.05	0.35203	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.139902	0.46442	N	0.000285	T	0.81574	0.4851	N	0.13272	0.32	0.29949	N	0.820374	B;B	0.10296	0.003;0.003	B;B	0.14023	0.01;0.007	T	0.67632	-0.5621	10	0.02654	T	1	.	5.5655	0.17168	0.0:0.3972:0.0:0.6028	.	1144;1175	Q9BZC7;E7ETC3	ABCA2_HUMAN;.	V	1145;1144;1175;1145	ENSP00000265662:I1145V;ENSP00000360666:I1144V;ENSP00000344155:I1145V	ENSP00000265662:I1145V	I	-	1	0	ABCA2	139030029	1.000000	0.71417	0.996000	0.52242	0.247000	0.25773	3.841000	0.55850	0.499000	0.27970	0.260000	0.18958	ATC	.	.		0.657	ABCA2-202	KNOWN	basic	protein_coding	protein_coding		NM_001606	
ASCC1	51008	hgsc.bcm.edu	37	10	73857193	73857193	+	3'UTR	SNP	A	A	T			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr10:73857193A>T	ENST00000342444.4	-	0	1355				ASCC1_ENST00000317126.4_Missense_Mutation_p.Y325N|ASCC1_ENST00000394919.1_Missense_Mutation_p.Y325N|ASCC1_ENST00000317168.6_Missense_Mutation_p.Y325N|ASCC1_ENST00000545550.1_Missense_Mutation_p.Y347N	NM_001198799.2	NP_001185728.1	Q8N9N2	ASCC1_HUMAN	activating signal cointegrator 1 complex subunit 1						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|transcription factor complex (GO:0005667)	catalytic activity (GO:0003824)|RNA binding (GO:0003723)			endometrium(1)|kidney(1)|large_intestine(1)|liver(1)|lung(2)|skin(1)	7						GAGCCAAAGTAGAAGTTCTCA	0.353																																					p.Y325N		Atlas-SNP	.											.	ASCC1	18	.	0			c.T973A						.						67.0	66.0	67.0					10																	73857193		2203	4300	6503	SO:0001624	3_prime_UTR_variant	51008	exon10			CAAAGTAGAAGTT	AY013290	CCDS31219.1, CCDS55713.1	10q22.1	2012-09-20			ENSG00000138303	ENSG00000138303			24268	protein-coding gene	gene with protein product		614215				10810093, 12077347	Standard	NM_001198799		Approved	CGI-18, ASC1p50, Em:AC022392.3	uc001jst.2	Q8N9N2	OTTHUMG00000018434	ENST00000342444.4:c.*51T>A	chr10.hg19:g.73857193A>T		107.0	0.0		171.0	14.0	NM_001198798	Q5SW06|Q5SW07|Q96EI8|Q9Y307	Missense_Mutation	SNP	ENST00000342444.4	hg19	CCDS55713.1	.	.	.	.	.	.	.	.	.	.	A	10.54	1.378864	0.24944	.	.	ENSG00000138303	ENST00000394919;ENST00000317168;ENST00000373101;ENST00000317126;ENST00000545550	T;T;T;T	0.61980	0.06;0.06;0.06;0.06	5.47	2.99	0.34606	.	.	.	.	.	T	0.42381	0.1200	L	0.31926	0.97	0.80722	D	1	B	0.15141	0.012	B	0.10450	0.005	T	0.25882	-1.0119	9	0.13470	T	0.59	.	4.2651	0.10759	0.6767:0.0:0.1477:0.1756	.	347	F5H874	.	N	325;325;325;325;347	ENSP00000378377:Y325N;ENSP00000320810:Y325N;ENSP00000320461:Y325N;ENSP00000442121:Y347N	ENSP00000320461:Y325N	Y	-	1	0	ASCC1	73527199	0.969000	0.33509	1.000000	0.80357	0.882000	0.50991	0.699000	0.25586	2.074000	0.62210	0.402000	0.26972	TAC	.	.		0.353	ASCC1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048573.2	NM_015947	
ATRNL1	26033	hgsc.bcm.edu	37	10	117154258	117154258	+	Nonsense_Mutation	SNP	C	C	T			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr10:117154258C>T	ENST00000355044.3	+	20	3391	c.3265C>T	c.(3265-3267)Caa>Taa	p.Q1089*	ATRNL1_ENST00000303745.7_5'UTR|ATRNL1_ENST00000423111.2_Nonsense_Mutation_p.Q140*	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	1089	Laminin EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00460}.				G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		TGACCAATGCCAATTGTAAGT	0.333																																					p.Q1089X		Atlas-SNP	.											ATRNL1,NS,lymphoid_neoplasm,0,1	ATRNL1	219	.	0			c.C3265T						.						110.0	103.0	105.0					10																	117154258		2203	4299	6502	SO:0001587	stop_gained	26033	exon20			CAATGCCAATTGT	AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.3265C>T	chr10.hg19:g.117154258C>T	ENSP00000347152:p.Gln1089*	93.0	0.0		87.0	31.0	NM_207303	O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Nonsense_Mutation	SNP	ENST00000355044.3	hg19	CCDS7592.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.3|25.3	4.627380|4.627380	0.87560|0.87560	.|.	.|.	ENSG00000107518|ENSG00000107518	ENST00000526373|ENST00000355044;ENST00000423111	.|.	.|.	.|.	5.61|5.61	5.61|5.61	0.85477|0.85477	.|.	.|0.110458	.|0.64402	.|D	.|0.000004	T|.	0.74772|.	0.3760|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.76759|.	-0.2841|.	4|.	.|0.66056	.|D	.|0.02	-14.7681|-14.7681	15.1377|15.1377	0.72583|0.72583	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	L|X	172|1089;140	.|.	.|ENSP00000347152:Q1089X	P|Q	+|+	2|1	0|0	ATRNL1|ATRNL1	117144248|117144248	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.790000|0.790000	0.44656|0.44656	6.050000|6.050000	0.71063|0.71063	2.640000|2.640000	0.89533|0.89533	0.655000|0.655000	0.94253|0.94253	CCA|CAA	.	.		0.333	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050507.3	XM_049349	
USH1C	10083	hgsc.bcm.edu	37	11	17542918	17542918	+	Missense_Mutation	SNP	C	C	T			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr11:17542918C>T	ENST00000318024.4	-	13	1168	c.1060G>A	c.(1060-1062)Gag>Aag	p.E354K	USH1C_ENST00000527020.1_Missense_Mutation_p.E335K|USH1C_ENST00000005226.7_Missense_Mutation_p.E354K|USH1C_ENST00000527720.1_Missense_Mutation_p.E323K	NM_005709.3	NP_005700.2	Q9Y6N9	USH1C_HUMAN	Usher syndrome 1C (autosomal recessive, severe)	354					auditory receptor cell differentiation (GO:0042491)|equilibrioception (GO:0050957)|G2/M transition of mitotic cell cycle (GO:0000086)|inner ear morphogenesis (GO:0042472)|parallel actin filament bundle assembly (GO:0030046)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	spectrin binding (GO:0030507)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	48						CGGTATCTCTCATTTTCCTCT	0.498																																					p.E354K		Atlas-SNP	.											USH1C_ENST00000318024,colon,carcinoma,0,2	USH1C	157	.	0			c.G1060A						.						315.0	256.0	276.0					11																	17542918		2200	4293	6493	SO:0001583	missense	10083	exon13			ATCTCTCATTTTC	AB006955	CCDS7825.1, CCDS31438.1, CCDS73265.1	11p14.3	2013-06-19	2004-05-19		ENSG00000006611	ENSG00000006611			12597	protein-coding gene	gene with protein product	"""harmonin"""	605242	"""deafness, autosomal recessive 18"""	DFNB18		10973247, 12107438	Standard	NM_005709		Approved	PDZ73, harmonin, NY-CO-37, NY-CO-38, PDZ-73, AIE-75, PDZD7C	uc001mne.3	Q9Y6N9	OTTHUMG00000166323	ENST00000318024.4:c.1060G>A	chr11.hg19:g.17542918C>T	ENSP00000317018:p.Glu354Lys	85.0	0.0		99.0	23.0	NM_005709	A8K423|Q7RTU8|Q96B29|Q9UM04|Q9UM17|Q9UPC3	Missense_Mutation	SNP	ENST00000318024.4	hg19	CCDS31438.1	.	.	.	.	.	.	.	.	.	.	C	32	5.117405	0.94385	.	.	ENSG00000006611	ENST00000318024;ENST00000527720;ENST00000527020;ENST00000005226	T;T;T;T	0.65178	1.71;1.7;1.8;-0.14	5.72	5.72	0.89469	.	0.048412	0.85682	D	0.000000	T	0.64148	0.2572	L	0.34521	1.04	0.58432	D	0.999997	D;P;D	0.62365	0.971;0.952;0.991	P;P;P	0.53102	0.654;0.452;0.718	T	0.59553	-0.7433	10	0.29301	T	0.29	.	18.651	0.91430	0.0:1.0:0.0:0.0	.	335;354;354	Q9Y6N9-4;Q9Y6N9;Q7RTU8	.;USH1C_HUMAN;.	K	354;323;335;354	ENSP00000317018:E354K;ENSP00000432944:E323K;ENSP00000436934:E335K;ENSP00000005226:E354K	ENSP00000005226:E354K	E	-	1	0	USH1C	17499494	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.118000	0.71583	2.703000	0.92315	0.650000	0.86243	GAG	.	.		0.498	USH1C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000389146.1	NM_005709	
PRMT3	10196	hgsc.bcm.edu	37	11	20473685	20473685	+	Missense_Mutation	SNP	C	C	T			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr11:20473685C>T	ENST00000331079.6	+	11	1220	c.1003C>T	c.(1003-1005)Ctt>Ttt	p.L335F	PRMT3_ENST00000437750.2_Missense_Mutation_p.L273F	NM_001145167.1|NM_005788.3	NP_001138639.1|NP_005779	O60678	ANM3_HUMAN	protein arginine methyltransferase 3	335	SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				histone arginine methylation (GO:0034969)|negative regulation of protein ubiquitination (GO:0031397)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|ribosome (GO:0005840)	histone-arginine N-methyltransferase activity (GO:0008469)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|modified amino acid binding (GO:0072341)|protein-arginine N-methyltransferase activity (GO:0016274)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)			endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|prostate(1)	17						GGGCTATTTTCTTCTGTTTGA	0.333																																					p.L335F		Atlas-SNP	.											.	PRMT3	50	.	0			c.C1003T						.						154.0	147.0	150.0					11																	20473685		2203	4300	6503	SO:0001583	missense	10196	exon11			TATTTTCTTCTGT	AF059531	CCDS7853.1, CCDS44554.1	11p15.1	2008-02-05	2006-02-16	2006-02-16	ENSG00000185238	ENSG00000185238		"""Protein arginine methyltransferases"""	30163	protein-coding gene	gene with protein product		603190	"""HMT1 hnRNP methyltransferase-like 3 (S. cerevisiae)"""	HRMT1L3		9642256	Standard	NM_005788		Approved		uc001mqb.3	O60678	OTTHUMG00000166022	ENST00000331079.6:c.1003C>T	chr11.hg19:g.20473685C>T	ENSP00000331879:p.Leu335Phe	73.0	0.0		91.0	36.0	NM_005788	B4DUC7	Missense_Mutation	SNP	ENST00000331079.6	hg19	CCDS7853.1	.	.	.	.	.	.	.	.	.	.	C	16.98	3.270695	0.59540	.	.	ENSG00000185238	ENST00000331079;ENST00000541255;ENST00000437750	T;T	0.27402	1.67;1.67	5.69	4.78	0.61160	.	0.057109	0.64402	N	0.000002	T	0.49983	0.1589	L	0.49126	1.545	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.52668	-0.8545	10	0.87932	D	0	-18.8309	14.6779	0.68996	0.0:0.9295:0.0:0.0705	.	273;335	O60678-2;O60678	.;ANM3_HUMAN	F	335;335;273	ENSP00000331879:L335F;ENSP00000397766:L273F	ENSP00000331879:L335F	L	+	1	0	PRMT3	20430261	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	3.249000	0.51437	1.418000	0.47098	-0.139000	0.14373	CTT	.	.		0.333	PRMT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387489.1	NM_005788	
OR4S2	219431	hgsc.bcm.edu	37	11	55418847	55418847	+	Silent	SNP	C	C	A			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr11:55418847C>A	ENST00000312422.2	+	1	468	c.468C>A	c.(466-468)atC>atA	p.I156I		NM_001004059.2	NP_001004059.2	Q8NH73	OR4S2_HUMAN	olfactory receptor, family 4, subfamily S, member 2	156						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(4)|lung(28)|ovary(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_epithelial(135;0.0748)				ACTCCATTATCCAAGTGGCTC	0.433																																					p.I156I		Atlas-SNP	.											.	OR4S2	89	.	0			c.C468A						.						217.0	172.0	188.0					11																	55418847		2181	4040	6221	SO:0001819	synonymous_variant	219431	exon1			CATTATCCAAGTG	BK004390	CCDS31505.1	11q11	2012-08-09	2002-11-13	2002-11-15	ENSG00000174982	ENSG00000174982		"""GPCR / Class A : Olfactory receptors"""	15183	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily S, member 2 pseudogene"""	OR4S2P			Standard	NM_001004059		Approved	OST725	uc001nhs.1	Q8NH73	OTTHUMG00000166799	ENST00000312422.2:c.468C>A	chr11.hg19:g.55418847C>A		152.0	0.0		176.0	79.0	NM_001004059	Q6IF72	Silent	SNP	ENST00000312422.2	hg19	CCDS31505.1																																																																																			.	.		0.433	OR4S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391503.1	NM_001004059	
AHNAK	79026	hgsc.bcm.edu	37	11	62292058	62292058	+	Silent	SNP	T	T	C			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr11:62292058T>C	ENST00000378024.4	-	5	10105	c.9831A>G	c.(9829-9831)aaA>aaG	p.K3277K	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	3277					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				GTTTTGGACCTTTTAATTTGG	0.413																																					p.K3277K		Atlas-SNP	.											.	AHNAK	532	.	0			c.A9831G						.						136.0	126.0	130.0					11																	62292058		2202	4299	6501	SO:0001819	synonymous_variant	79026	exon5			TGGACCTTTTAAT	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.9831A>G	chr11.hg19:g.62292058T>C		67.0	0.0		92.0	43.0	NM_001620	A1A586	Silent	SNP	ENST00000378024.4	hg19	CCDS31584.1																																																																																			.	.		0.413	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
Unknown	0	hgsc.bcm.edu	37	11	89819558	89819558	+	IGR	SNP	G	G	T			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr11:89819558G>T								TRIM49C (13000 upstream) : SNORD56 (32000 downstream)																							AGATGAAACAGAAATATATTC	0.443																																					p.Q147H		Atlas-SNP	.											.	.	.	.	0			c.G441T						.						29.0	21.0	23.0					11																	89819558		675	1510	2185	SO:0001628	intergenic_variant	642623	exon1			GAAACAGAAATAT																													chr11.hg19:g.89819558G>T		172.0	0.0		236.0	39.0	NM_001143975		Missense_Mutation	SNP		hg19																																																																																				.	.	0	0.443								
DYNC2H1	79659	hgsc.bcm.edu	37	11	103039593	103039593	+	Missense_Mutation	SNP	G	G	T			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr11:103039593G>T	ENST00000375735.2	+	32	5016	c.4872G>T	c.(4870-4872)tgG>tgT	p.W1624C	DYNC2H1_ENST00000398093.3_Missense_Mutation_p.W1624C|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	1624	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		CTGAAGACTGGGCTTGGAAAA	0.328																																					p.W1624C		Atlas-SNP	.											.	DYNC2H1	246	.	0			c.G4872T						.						96.0	93.0	94.0					11																	103039593		1826	4082	5908	SO:0001583	missense	79659	exon32			AGACTGGGCTTGG	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.4872G>T	chr11.hg19:g.103039593G>T	ENSP00000364887:p.Trp1624Cys	95.0	0.0		114.0	12.0	NM_001377	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	ENST00000375735.2	hg19	CCDS53701.1	.	.	.	.	.	.	.	.	.	.	G	18.12	3.554110	0.65425	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.28454	1.61;1.61	6.05	5.13	0.70059	.	0.000000	0.33938	U	0.004402	T	0.65491	0.2696	M	0.91561	3.22	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.75836	-0.3177	10	0.87932	D	0	.	17.3526	0.87328	0.0:0.1251:0.8749:0.0	.	1624;1624	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	C	1624	ENSP00000364887:W1624C;ENSP00000381167:W1624C	ENSP00000364887:W1624C	W	+	3	0	DYNC2H1	102544803	1.000000	0.71417	1.000000	0.80357	0.766000	0.43426	9.471000	0.97696	1.539000	0.49286	0.650000	0.86243	TGG	.	.		0.328	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652	
OR8B4	283162	hgsc.bcm.edu	37	11	124294728	124294728	+	Missense_Mutation	SNP	G	G	C			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr11:124294728G>C	ENST00000356130.3	-	1	61	c.40C>G	c.(40-42)Ctt>Gtt	p.L14V		NM_001005196.1	NP_001005196.1	Q96RC9	OR8B4_HUMAN	olfactory receptor, family 8, subfamily B, member 4	14						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(7)|lung(15)|ovary(1)|skin(6)|stomach(1)|urinary_tract(1)	32		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		AATCCCACAAGGATAAACTCA	0.493																																					p.L14V		Atlas-SNP	.											.	OR8B4	60	.	0			c.C40G						.						47.0	45.0	46.0					11																	124294728		2201	4298	6499	SO:0001583	missense	283162	exon1			CCACAAGGATAAA	AB065831	CCDS31710.1	11q24	2012-08-09		2001-06-29	ENSG00000198657	ENSG00000198657		"""GPCR / Class A : Olfactory receptors"""	8473	protein-coding gene	gene with protein product				OR8B4P			Standard	NM_001005196		Approved		uc010sak.2	Q96RC9	OTTHUMG00000165916	ENST00000356130.3:c.40C>G	chr11.hg19:g.124294728G>C	ENSP00000348449:p.Leu14Val	64.0	0.0		68.0	31.0	NM_001005196	B2RNF8|Q6IFQ7	Missense_Mutation	SNP	ENST00000356130.3	hg19	CCDS31710.1	.	.	.	.	.	.	.	.	.	.	g	14.71	2.615266	0.46631	.	.	ENSG00000198657	ENST00000356130	T	0.00563	6.58	4.62	1.74	0.24563	.	0.294190	0.24429	N	0.038611	T	0.02380	0.0073	M	0.94021	3.485	0.31020	N	0.718231	D	0.64830	0.994	P	0.61201	0.885	T	0.02179	-1.1200	10	0.87932	D	0	.	9.8764	0.41207	0.227:0.0:0.773:0.0	.	14	Q96RC9	OR8B4_HUMAN	V	14	ENSP00000348449:L14V	ENSP00000348449:L14V	L	-	1	0	OR8B4	123799938	0.984000	0.35163	0.848000	0.33437	0.812000	0.45895	0.923000	0.28757	0.297000	0.22615	-0.748000	0.03510	CTT	.	.		0.493	OR8B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387055.1	NM_001005196	
GYS2	2998	hgsc.bcm.edu	37	12	21713390	21713390	+	Missense_Mutation	SNP	T	T	C			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr12:21713390T>C	ENST00000261195.2	-	8	1353	c.1099A>G	c.(1099-1101)Att>Gtt	p.I367V		NM_021957.3	NP_068776.2	P54840	GYS2_HUMAN	glycogen synthase 2 (liver)	367					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	cell cortex (GO:0005938)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|ectoplasm (GO:0043265)	glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein homodimerization activity (GO:0042803)			NS(1)|breast(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(14)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						GCAGGCATAATGAAAAACACC	0.373																																					p.I367V	Colon(149;9 1820 3690 10544 50424)	Atlas-SNP	.											.	GYS2	110	.	0			c.A1099G						.						192.0	174.0	180.0					12																	21713390		2203	4300	6503	SO:0001583	missense	2998	exon8			GCATAATGAAAAA		CCDS8690.1	12p12.2-p11.2	2013-02-22			ENSG00000111713	ENSG00000111713	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4707	protein-coding gene	gene with protein product		138571					Standard	NM_021957		Approved		uc001rfb.3	P54840	OTTHUMG00000169135	ENST00000261195.2:c.1099A>G	chr12.hg19:g.21713390T>C	ENSP00000261195:p.Ile367Val	71.0	0.0		87.0	30.0	NM_021957	A0AVD8	Missense_Mutation	SNP	ENST00000261195.2	hg19	CCDS8690.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.178868	0.78564	.	.	ENSG00000111713	ENST00000261195	T	0.69435	-0.4	4.87	4.87	0.63330	.	0.000000	0.85682	D	0.000000	T	0.79885	0.4523	M	0.83852	2.665	0.80722	D	1	P	0.46020	0.871	P	0.56612	0.802	T	0.82125	-0.0612	10	0.51188	T	0.08	-24.7952	14.628	0.68635	0.0:0.0:0.0:1.0	.	367	P54840	GYS2_HUMAN	V	367	ENSP00000261195:I367V	ENSP00000261195:I367V	I	-	1	0	GYS2	21604657	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	7.854000	0.86942	2.046000	0.60703	0.460000	0.39030	ATT	.	.		0.373	GYS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402396.1	NM_021957	
KRT6A	3853	hgsc.bcm.edu	37	12	52886815	52886815	+	Missense_Mutation	SNP	C	C	T			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr12:52886815C>T	ENST00000330722.6	-	1	226	c.158G>A	c.(157-159)gGa>gAa	p.G53E		NM_005554.3	NP_005545.1	P02538	K2C6A_HUMAN	keratin 6A	53	Head.				cell differentiation (GO:0030154)|positive regulation of cell proliferation (GO:0008284)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	39				BRCA - Breast invasive adenocarcinoma(357;0.189)		AAAGCCAGCTCCTCCACATGC	0.662																																					p.G53E		Atlas-SNP	.											.	KRT6A	89	.	0			c.G158A						.						16.0	21.0	20.0					12																	52886815		2029	4038	6067	SO:0001583	missense	3853	exon1			CCAGCTCCTCCAC	BC014152, L42593, L42610	CCDS41786.1	12q13.13	2013-01-16			ENSG00000205420	ENSG00000205420		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6443	protein-coding gene	gene with protein product		148041	"""keratin 6C"", ""keratin 6D"""	KRT6C, KRT6D		1713141, 16831889	Standard	NM_005554		Approved	CK6C, K6C, CK6D, K6D	uc001sam.3	P02538	OTTHUMG00000169597	ENST00000330722.6:c.158G>A	chr12.hg19:g.52886815C>T	ENSP00000369317:p.Gly53Glu	166.0	0.0		194.0	77.0	NM_005554	A4QPC1|P48667|Q08AR4|Q6NT67|Q96CL4	Missense_Mutation	SNP	ENST00000330722.6	hg19	CCDS41786.1	.	.	.	.	.	.	.	.	.	.	C	16.46	3.128182	0.56721	.	.	ENSG00000205420	ENST00000330722	D	0.94966	-3.57	5.24	5.24	0.73138	.	0.000000	0.64402	D	0.000016	D	0.97604	0.9215	M	0.88105	2.93	0.48452	D	0.999656	D	0.89917	1.0	D	0.91635	0.999	D	0.96743	0.9548	10	0.30854	T	0.27	.	19.2638	0.93979	0.0:1.0:0.0:0.0	.	53	P02538	K2C6A_HUMAN	E	53	ENSP00000369317:G53E	ENSP00000369317:G53E	G	-	2	0	KRT6A	51173082	0.144000	0.22641	0.998000	0.56505	0.799000	0.45148	2.143000	0.42187	2.626000	0.88956	0.549000	0.68633	GGA	.	.		0.662	KRT6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404978.2	NM_005554	
TDG	6996	hgsc.bcm.edu	37	12	104379458	104379458	+	Nonsense_Mutation	SNP	G	G	T			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr12:104379458G>T	ENST00000392872.3	+	9	1276	c.1042G>T	c.(1042-1044)Gaa>Taa	p.E348*	TDG_ENST00000544861.1_Nonsense_Mutation_p.E205*|TDG_ENST00000266775.9_Nonsense_Mutation_p.E344*|AC078819.1_ENST00000401157.1_RNA|TDG_ENST00000542036.1_Nonsense_Mutation_p.E144*	NM_003211.4	NP_003202.3	Q13569	TDG_HUMAN	thymine-DNA glycosylase	348					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|chromatin modification (GO:0016568)|depyrimidination (GO:0045008)|DNA demethylation (GO:0080111)|DNA repair (GO:0006281)|embryo development (GO:0009790)|mismatch repair (GO:0006298)|negative regulation of chromatin binding (GO:0035562)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression, epigenetic (GO:0040029)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	damaged DNA binding (GO:0003684)|DNA N-glycosylase activity (GO:0019104)|double-stranded DNA binding (GO:0003690)|mismatched DNA binding (GO:0030983)|protein homodimerization activity (GO:0042803)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|RNA polymerase II transcription cofactor activity (GO:0001104)|structure-specific DNA binding (GO:0043566)			large_intestine(2)|lung(14)|ovary(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24				BRCA - Breast invasive adenocarcinoma(302;0.00114)		TGCTTACGGAGAAAATCCATG	0.433								Base excision repair (BER), DNA glycosylases																													p.E348X		Atlas-SNP	.											.	TDG	43	.	0			c.G1042T						.						181.0	162.0	168.0					12																	104379458		2203	4300	6503	SO:0001587	stop_gained	6996	exon9			TACGGAGAAAATC	U51166	CCDS9095.1	12q24.1	2014-05-14			ENSG00000139372	ENSG00000139372	3.2.2.29		11700	protein-coding gene	gene with protein product	"""G/T mismatch-specific thymine DNA glycosylase"""	601423				8662714, 9299239	Standard	NM_003211		Approved		uc001tkg.3	Q13569	OTTHUMG00000168418	ENST00000392872.3:c.1042G>T	chr12.hg19:g.104379458G>T	ENSP00000376611:p.Glu348*	94.0	0.0		131.0	16.0	NM_003211	Q8IUZ6|Q8IZM3	Nonsense_Mutation	SNP	ENST00000392872.3	hg19	CCDS9095.1	.	.	.	.	.	.	.	.	.	.	G	32	5.155488	0.94686	.	.	ENSG00000139372	ENST00000392872;ENST00000266775;ENST00000544861;ENST00000542036	.	.	.	5.7	5.7	0.88788	.	0.266936	0.41396	D	0.000888	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-9.8938	16.346	0.83133	0.0:0.1406:0.8594:0.0	.	.	.	.	X	348;344;205;144	.	ENSP00000266775:E344X	E	+	1	0	TDG	102903588	1.000000	0.71417	0.013000	0.15412	0.216000	0.24613	6.729000	0.74775	2.692000	0.91855	0.655000	0.94253	GAA	.	.		0.433	TDG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399673.2		
OAS3	4940	hgsc.bcm.edu	37	12	113405240	113405240	+	Missense_Mutation	SNP	T	T	C			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr12:113405240T>C	ENST00000228928.7	+	13	2886	c.2707T>C	c.(2707-2709)Tcc>Ccc	p.S903P	RP1-71H24.1_ENST00000552784.1_RNA	NM_006187.2	NP_006178.2	Q9Y6K5	OAS3_HUMAN	2'-5'-oligoadenylate synthetase 3, 100kDa	903	OAS domain 3.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of viral genome replication (GO:0045071)|nucleobase-containing compound metabolic process (GO:0006139)|regulation of ribonuclease activity (GO:0060700)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	2'-5'-oligoadenylate synthetase activity (GO:0001730)|ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(8)|lung(6)|ovary(1)|skin(2)	27						GGTCTCTGGCTCCAGGCCCAG	0.562																																					p.S903P		Atlas-SNP	.											.	OAS3	63	.	0			c.T2707C						.						40.0	42.0	41.0					12																	113405240		2034	4216	6250	SO:0001583	missense	4940	exon13			TCTGGCTCCAGGC	AF063613	CCDS44981.1	12q24.2	2008-05-02	2002-08-29			ENSG00000111331			8088	protein-coding gene	gene with protein product		603351	"""2'-5'-oligoadenylate synthetase 3 (100 kD)"""			9790745	Standard	NM_006187		Approved		uc001tug.3	Q9Y6K5	OTTHUMG00000169795	ENST00000228928.7:c.2707T>C	chr12.hg19:g.113405240T>C	ENSP00000228928:p.Ser903Pro	83.0	0.0		129.0	57.0	NM_006187	Q2HJ14|Q9H3P5	Missense_Mutation	SNP	ENST00000228928.7	hg19	CCDS44981.1	.	.	.	.	.	.	.	.	.	.	T	12.54	1.968387	0.34754	.	.	ENSG00000111331	ENST00000228928;ENST00000323881	T	0.08720	3.06	4.26	-3.32	0.04973	-oligoadenylate synthetase 1, domain 2/C-terminal (2);-5&apos (2);2&apos (2);	6.218310	0.00926	U	0.002648	T	0.12860	0.0312	M	0.67397	2.05	0.09310	N	1	P	0.52577	0.954	P	0.48952	0.596	T	0.34477	-0.9827	10	0.36615	T	0.2	.	1.1569	0.01797	0.2763:0.0986:0.3433:0.2818	.	903	Q9Y6K5	OAS3_HUMAN	P	903;902	ENSP00000228928:S903P	ENSP00000228928:S903P	S	+	1	0	OAS3	111889623	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.220000	0.09215	-0.290000	0.09025	-0.471000	0.05019	TCC	.	.		0.562	OAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405920.1		
SETD8	387893	hgsc.bcm.edu	37	12	123874057	123874057	+	Missense_Mutation	SNP	G	G	C			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr12:123874057G>C	ENST00000402868.3	+	2	514	c.88G>C	c.(88-90)Gag>Cag	p.E30Q	SETD8_ENST00000330479.4_Missense_Mutation_p.E30Q|SETD8_ENST00000478781.2_Intron			Q9NQR1	SETD8_HUMAN	SET domain containing (lysine methyltransferase) 8	71	Ala-rich.|Poly-Arg.				histone lysine methylation (GO:0034968)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine monomethylation (GO:0018026)|regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043516)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(3)|urinary_tract(1)	13	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.00101)|Epithelial(86;0.00425)		CCCGGGCCCGGAGATGGTGGA	0.811																																					p.E30Q		Atlas-SNP	.											.	SETD8	35	.	0			c.G88C						.						1.0	1.0	1.0					12																	123874057		123	314	437	SO:0001583	missense	387893	exon2			GGCCCGGAGATGG	AY102937	CCDS9247.1	12q24.31	2011-07-01			ENSG00000183955	ENSG00000183955		"""Chromatin-modifying enzymes / K-methyltransferases"""	29489	protein-coding gene	gene with protein product		607240				15933070, 12086618, 12121615	Standard	NM_020382		Approved	SET8, SET07, PR-Set7, KMT5A	uc001uew.3	Q9NQR1	OTTHUMG00000150477	ENST00000402868.3:c.88G>C	chr12.hg19:g.123874057G>C	ENSP00000384629:p.Glu30Gln	0.0	0.0		13.0	7.0	NM_020382	A8K9D0|Q86W83|Q8TD09	Missense_Mutation	SNP	ENST00000402868.3	hg19	CCDS9247.1	.	.	.	.	.	.	.	.	.	.	G	15.51	2.854477	0.51376	.	.	ENSG00000183955	ENST00000402868;ENST00000330479	D;D	0.98666	-5.06;-5.06	1.77	1.77	0.24775	.	130.389000	0.00622	U	0.000447	D	0.94558	0.8247	N	0.14661	0.345	0.21473	N	0.999678	P	0.50710	0.938	B	0.37451	0.25	D	0.93140	0.6540	10	0.17832	T	0.49	-0.2818	6.9164	0.24361	0.0:0.0:1.0:0.0	.	30	Q9NQR1-2	.	Q	30	ENSP00000384629:E30Q;ENSP00000332995:E30Q	ENSP00000332995:E30Q	E	+	1	0	SETD8	122440010	1.000000	0.71417	1.000000	0.80357	0.830000	0.47004	1.377000	0.34317	0.987000	0.38709	0.163000	0.16589	GAG	.	.		0.811	SETD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318263.1	NM_020382	
TMEM132B	114795	hgsc.bcm.edu	37	12	126135432	126135432	+	Missense_Mutation	SNP	C	C	T	rs149523266	byFrequency	TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr12:126135432C>T	ENST00000299308.3	+	7	1840	c.1832C>T	c.(1831-1833)cCg>cTg	p.P611L	TMEM132B_ENST00000535886.1_Missense_Mutation_p.P123L	NM_052907.2	NP_443139.2	Q14DG7	T132B_HUMAN	transmembrane protein 132B	611						integral component of membrane (GO:0016021)				NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(45)|ovary(5)|pancreas(1)|prostate(4)|skin(15)|upper_aerodigestive_tract(3)|urinary_tract(1)	107	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		GTGGAGGAGCCGAAAATCGCT	0.602																																					p.P611L		Atlas-SNP	.											.	TMEM132B	207	.	0			c.C1832T						.						64.0	69.0	68.0					12																	126135432		2077	4205	6282	SO:0001583	missense	114795	exon7			AGGAGCCGAAAAT	AB067493	CCDS41859.1, CCDS66501.1	12q24.31	2006-03-02							29397	protein-coding gene	gene with protein product						11572484	Standard	NM_001286219		Approved	KIAA1906, KIAA1786	uc001uhe.1	Q14DG7		ENST00000299308.3:c.1832C>T	chr12.hg19:g.126135432C>T	ENSP00000299308:p.Pro611Leu	97.0	0.0		132.0	61.0	NM_052907	A2RRG8|Q8NA73|Q96JN9|Q96PY1	Missense_Mutation	SNP	ENST00000299308.3	hg19	CCDS41859.1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.048572	0.93740	.	.	ENSG00000139364	ENST00000299308;ENST00000535886	T;T	0.20738	2.05;2.05	5.14	5.14	0.70334	.	0.192832	0.37012	N	0.002288	T	0.30324	0.0761	M	0.73962	2.25	0.80722	D	1	P	0.46987	0.888	B	0.40565	0.333	T	0.31943	-0.9925	10	0.72032	D	0.01	.	18.6079	0.91273	0.0:1.0:0.0:0.0	.	611	Q14DG7	T132B_HUMAN	L	611;123	ENSP00000299308:P611L;ENSP00000440436:P123L	ENSP00000299308:P611L	P	+	2	0	TMEM132B	124701385	0.970000	0.33590	0.881000	0.34555	0.943000	0.58893	7.562000	0.82300	2.358000	0.79984	0.650000	0.86243	CCG	.	C|0.999;A|0.001		0.602	TMEM132B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400043.1	NM_052907	
DDHD1	80821	hgsc.bcm.edu	37	14	53619420	53619420	+	Missense_Mutation	SNP	C	C	T			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr14:53619420C>T	ENST00000323669.5	-	1	396	c.397G>A	c.(397-399)Ggc>Agc	p.G133S	RP11-547D23.1_ENST00000554235.1_RNA|AL356020.1_ENST00000584587.1_RNA|DDHD1_ENST00000395606.1_Missense_Mutation_p.G133S|DDHD1_ENST00000357758.3_Missense_Mutation_p.G133S	NM_001160148.1	NP_001153620.1	Q8NEL9	DDHD1_HUMAN	DDHD domain containing 1	133					cell death (GO:0008219)|lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)	25	Breast(41;0.037)					GTCGCGCCGCCGCCCCCCGAG	0.741																																					p.G133S		Atlas-SNP	.											.	DDHD1	202	.	0			c.G397A						.						10.0	11.0	11.0					14																	53619420		2171	4228	6399	SO:0001583	missense	80821	exon1			CGCCGCCGCCCCC	AB051492	CCDS9714.1, CCDS53895.1, CCDS53896.1	14q21	2012-11-23			ENSG00000100523	ENSG00000100523			19714	protein-coding gene	gene with protein product	"""phosphatidic acid-preferring phospholipase A1"""	614603	"""spastic paraplegia 28 (autosomal recessive)"""	SPG28		11214970, 20359546	Standard	NM_030637		Approved	KIAA1705, PA-PLA1	uc001xai.3	Q8NEL9	OTTHUMG00000140305	ENST00000323669.5:c.397G>A	chr14.hg19:g.53619420C>T	ENSP00000327104:p.Gly133Ser	89.0	0.0		75.0	4.0	NM_001160147	G5E9D1|Q8WVH3|Q96LL2|Q9C0F8	Missense_Mutation	SNP	ENST00000323669.5	hg19	CCDS53895.1	.	.	.	.	.	.	.	.	.	.	C	13.61	2.289660	0.40494	.	.	ENSG00000100523	ENST00000323669;ENST00000395606;ENST00000357758	.	.	.	3.78	2.88	0.33553	.	0.306105	0.25944	U	0.027297	T	0.37237	0.0996	L	0.29908	0.895	0.29342	N	0.865948	B;D;B	0.89917	0.027;1.0;0.027	B;D;B	0.78314	0.006;0.991;0.006	T	0.21724	-1.0237	9	0.11485	T	0.65	-5.2152	5.4996	0.16821	0.0:0.6251:0.1807:0.1942	.	133;133;133	G5E9D1;Q8NEL9;Q8NEL9-2	.;DDHD1_HUMAN;.	S	133	.	ENSP00000327104:G133S	G	-	1	0	DDHD1	52689170	0.825000	0.29262	0.998000	0.56505	0.632000	0.37999	0.111000	0.15458	0.774000	0.33427	0.462000	0.41574	GGC	.	.		0.741	DDHD1-003	KNOWN	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276901.1		
VSX2	338917	hgsc.bcm.edu	37	14	74727333	74727333	+	Missense_Mutation	SNP	C	C	T			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr14:74727333C>T	ENST00000261980.2	+	5	887	c.797C>T	c.(796-798)tCg>tTg	p.S266L		NM_182894.2	NP_878314.1	P58304	VSX2_HUMAN	visual system homeobox 2	266					cell fate commitment (GO:0045165)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to stimulus (GO:0050896)|retinal bipolar neuron differentiation (GO:0060040)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	7				BRCA - Breast invasive adenocarcinoma(234;0.00154)		GCAGCCGAGTCGGGGAGGAAG	0.597																																					p.S266L		Atlas-SNP	.											.	VSX2	32	.	0			c.C797T						.						11.0	13.0	12.0					14																	74727333		2193	4297	6490	SO:0001583	missense	338917	exon5			CCGAGTCGGGGAG	AC005519	CCDS9827.1	14q24.3	2011-06-20	2007-08-21	2007-08-21		ENSG00000119614		"""Homeoboxes / PRD class"""	1975	protein-coding gene	gene with protein product		142993	"""C elegans ceh-10 homeo domain-containing homolog"", ""ceh-10 homeo domain containing homolog (C. elegans)"", ""ceh-10 homeodomain containing homolog (C. elegans)"""	HOX10, CHX10		1973146	Standard	NM_182894		Approved	RET1	uc001xpq.3	P58304		ENST00000261980.2:c.797C>T	chr14.hg19:g.74727333C>T	ENSP00000261980:p.Ser266Leu	337.0	0.0		384.0	33.0	NM_182894	A1A4X6	Missense_Mutation	SNP	ENST00000261980.2	hg19	CCDS9827.1	.	.	.	.	.	.	.	.	.	.	C	16.15	3.041954	0.55003	.	.	ENSG00000119614	ENST00000261980	D	0.91237	-2.81	4.93	4.93	0.64822	.	0.644709	0.15920	N	0.238169	D	0.82861	0.5129	N	0.21194	0.64	0.35847	D	0.826451	B	0.31413	0.322	B	0.21917	0.037	D	0.83580	0.0117	10	0.31617	T	0.26	.	14.0026	0.64442	0.0:0.8487:0.1513:0.0	.	266	P58304	VSX2_HUMAN	L	266	ENSP00000261980:S266L	ENSP00000261980:S266L	S	+	2	0	VSX2	73797086	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.497000	0.53295	2.550000	0.86006	0.655000	0.94253	TCG	.	.		0.597	VSX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412323.1	NM_182894	
AHNAK2	113146	hgsc.bcm.edu	37	14	105413863	105413863	+	Missense_Mutation	SNP	G	G	A	rs371234619		TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr14:105413863G>A	ENST00000333244.5	-	7	8044	c.7925C>T	c.(7924-7926)aCa>aTa	p.T2642I	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2642						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			ATCTTTGGCTGTCACACCCTT	0.592																																					p.T2642I		Atlas-SNP	.											.	AHNAK2	719	.	0			c.C7925T						.						218.0	237.0	231.0					14																	105413863		1997	4158	6155	SO:0001583	missense	113146	exon7			TTGGCTGTCACAC	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.7925C>T	chr14.hg19:g.105413863G>A	ENSP00000353114:p.Thr2642Ile	110.0	0.0		144.0	16.0	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	hg19	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	c	11.91	1.780972	0.31502	.	.	ENSG00000185567	ENST00000333244	T	0.00902	5.56	3.26	0.711	0.18162	.	.	.	.	.	T	0.01454	0.0047	M	0.67953	2.075	0.09310	N	1	B	0.24258	0.1	B	0.21546	0.035	T	0.39231	-0.9624	9	0.37606	T	0.19	.	8.0014	0.30299	0.0:0.0:0.306:0.694	.	2642	Q8IVF2	AHNK2_HUMAN	I	2642	ENSP00000353114:T2642I	ENSP00000353114:T2642I	T	-	2	0	AHNAK2	104484908	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.128000	0.15810	-0.076000	0.12775	0.306000	0.20318	ACA	.	.		0.592	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
HAUS2	55142	hgsc.bcm.edu	37	15	42858922	42858922	+	Missense_Mutation	SNP	G	G	T			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr15:42858922G>T	ENST00000260372.3	+	6	679	c.616G>T	c.(616-618)Gct>Tct	p.A206S	RP11-265N6.2_ENST00000567089.1_RNA|RP11-265N6.2_ENST00000561902.1_RNA|HAUS2_ENST00000568876.1_Missense_Mutation_p.A175S	NM_018097.2	NP_060567.1	Q9NVX0	HAUS2_HUMAN	HAUS augmin-like complex, subunit 2	206					centrosome organization (GO:0051297)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|HAUS complex (GO:0070652)|microtubule (GO:0005874)|nucleus (GO:0005634)				endometrium(1)|large_intestine(1)|lung(1)	3						CAAAATATTAGCTGAAGAAAG	0.343																																					p.A206S		Atlas-SNP	.											.	HAUS2	12	.	0			c.G616T						.						73.0	72.0	73.0					15																	42858922		2203	4299	6502	SO:0001583	missense	55142	exon6			ATATTAGCTGAAG	AK001322	CCDS10090.1, CCDS45247.1	15q15.1	2014-02-20	2009-04-20	2009-04-20	ENSG00000137814	ENSG00000137814		"""HAUS augmin-like complex subunits"""	25530	protein-coding gene	gene with protein product		613429	"""chromosome 15 open reading frame 25"", ""centrosomal protein 27kDa"""	C15orf25, CEP27		14702039, 14654843, 19427217	Standard	NM_018097		Approved	FLJ10460, HsT17025	uc001zqe.3	Q9NVX0	OTTHUMG00000130678	ENST00000260372.3:c.616G>T	chr15.hg19:g.42858922G>T	ENSP00000260372:p.Ala206Ser	118.0	0.0		142.0	43.0	NM_018097	C9JH36|Q9H9B3	Missense_Mutation	SNP	ENST00000260372.3	hg19	CCDS10090.1	.	.	.	.	.	.	.	.	.	.	G	11.60	1.685533	0.29872	.	.	ENSG00000137814	ENST00000260372;ENST00000391623	T	0.41758	0.99	6.17	-2.41	0.06562	.	0.563980	0.17875	N	0.159059	T	0.23171	0.0560	L	0.35414	1.06	0.22762	N	0.998762	B;B	0.22003	0.013;0.063	B;B	0.17979	0.007;0.02	T	0.08973	-1.0696	10	0.36615	T	0.2	0.0501	3.6903	0.08343	0.3308:0.0:0.2479:0.4214	.	175;206	Q9NVX0-3;Q9NVX0	.;HAUS2_HUMAN	S	206;175	ENSP00000260372:A206S	ENSP00000260372:A206S	A	+	1	0	HAUS2	40646214	0.836000	0.29430	0.916000	0.36221	0.732000	0.41865	-0.308000	0.08156	-0.069000	0.12931	0.655000	0.94253	GCT	.	.		0.343	HAUS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253173.1	NM_018097	
C16orf71	146562	hgsc.bcm.edu	37	16	4787921	4787921	+	Missense_Mutation	SNP	G	G	C			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr16:4787921G>C	ENST00000299320.5	+	3	728	c.250G>C	c.(250-252)Gct>Cct	p.A84P	RP11-127I20.7_ENST00000588099.1_RNA|C16orf71_ENST00000590191.1_Missense_Mutation_p.A84P	NM_139170.2	NP_631909.2	Q8IYS4	CP071_HUMAN	chromosome 16 open reading frame 71	84										breast(1)|central_nervous_system(1)|large_intestine(4)|lung(4)|ovary(1)	11						GGCCTGGGTCGCTGCAGCTGA	0.552																																					p.A84P		Atlas-SNP	.											.	C16orf71	46	.	0			c.G250C						.						72.0	68.0	69.0					16																	4787921		2197	4300	6497	SO:0001583	missense	146562	exon3			TGGGTCGCTGCAG	AF447587	CCDS10521.1	16p13.3	2008-02-05			ENSG00000166246	ENSG00000166246			25081	protein-coding gene	gene with protein product						12477932	Standard	XM_005255144		Approved	FLJ43261, DKFZp686H2240	uc002cxn.3	Q8IYS4	OTTHUMG00000129480	ENST00000299320.5:c.250G>C	chr16.hg19:g.4787921G>C	ENSP00000299320:p.Ala84Pro	105.0	0.0		89.0	35.0	NM_139170	Q8NCV0	Missense_Mutation	SNP	ENST00000299320.5	hg19	CCDS10521.1	.	.	.	.	.	.	.	.	.	.	G	14.57	2.575344	0.45902	.	.	ENSG00000166246	ENST00000299320	T	0.06933	3.24	3.95	-7.9	0.01169	.	1.473130	0.04778	N	0.429214	T	0.07773	0.0195	L	0.43152	1.355	0.09310	N	1	B	0.12013	0.005	B	0.08055	0.003	T	0.25847	-1.0120	10	0.54805	T	0.06	5.5624	9.5592	0.39357	0.1509:0.3931:0.456:0.0	.	84	Q8IYS4	CP071_HUMAN	P	84	ENSP00000299320:A84P	ENSP00000299320:A84P	A	+	1	0	C16orf71	4727922	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.241000	0.02911	-2.751000	0.00374	-1.078000	0.02229	GCT	.	.		0.552	C16orf71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251644.1	NM_139170	
PDZD9	255762	hgsc.bcm.edu	37	16	21995781	21995781	+	Missense_Mutation	SNP	T	T	C			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr16:21995781T>C	ENST00000424898.2	-	4	664	c.602A>G	c.(601-603)gAc>gGc	p.D201G	PDZD9_ENST00000286143.6_Missense_Mutation_p.D139G|PDZD9_ENST00000537222.2_Missense_Mutation_p.D141G			Q8IXQ8	PDZD9_HUMAN	PDZ domain containing 9	201										breast(3)|endometrium(2)|lung(3)|pancreas(1)	9						ACAATTAATGTCTTTTCCTAC	0.443																																					p.D141G		Atlas-SNP	.											.	PDZD9	18	.	0			c.A422G						.						213.0	194.0	200.0					16																	21995781		2198	4300	6498	SO:0001583	missense	255762	exon3			TTAATGTCTTTTC	BC039562	CCDS10602.1, CCDS10602.2	16p12.1	2010-04-14	2010-04-14	2010-04-14	ENSG00000155714	ENSG00000155714			28740	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 65"""	C16orf65		12477932	Standard	NM_173806		Approved	MGC50721	uc021ter.1	Q8IXQ8	OTTHUMG00000131586	ENST00000424898.2:c.602A>G	chr16.hg19:g.21995781T>C	ENSP00000400514:p.Asp201Gly	125.0	0.0		131.0	23.0	NM_173806	F5GWW8	Missense_Mutation	SNP	ENST00000424898.2	hg19		.	.	.	.	.	.	.	.	.	.	T	14.80	2.644166	0.47258	.	.	ENSG00000155714	ENST00000424898;ENST00000537222;ENST00000286143	T	0.59224	0.28	5.43	4.33	0.51752	.	0.289846	0.29587	N	0.011730	T	0.54046	0.1834	M	0.66939	2.045	0.26686	N	0.971445	B	0.15930	0.015	B	0.19946	0.027	T	0.54543	-0.8278	10	0.87932	D	0	-6.1257	8.1798	0.31305	0.0:0.0913:0.0:0.9087	.	139	Q8IXQ8-2	.	G	201;141;139	ENSP00000400514:D201G	ENSP00000286143:D139G	D	-	2	0	PDZD9	21903282	0.562000	0.26586	0.024000	0.17045	0.405000	0.30901	2.176000	0.42500	0.888000	0.36160	0.460000	0.39030	GAC	.	.		0.443	PDZD9-003	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000381652.1	NM_173806	
CES1	1066	hgsc.bcm.edu	37	16	55866943	55866943	+	Missense_Mutation	SNP	C	C	T			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr16:55866943C>T	ENST00000361503.4	-	1	155	c.25G>A	c.(25-27)Gcc>Acc	p.A9T	CES1_ENST00000360526.3_Missense_Mutation_p.A9T|CES1_ENST00000422046.2_Missense_Mutation_p.A9T			P23141	EST1_HUMAN	carboxylesterase 1	9					epithelial cell differentiation (GO:0030855)|metabolic process (GO:0008152)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)	carboxylic ester hydrolase activity (GO:0052689)|methylumbelliferyl-acetate deacetylase activity (GO:0047374)								all cancers(182;0.13)|Epithelial(162;0.137)	Benzocaine(DB01086)|Capecitabine(DB01101)|Ciclesonide(DB01410)|Clopidogrel(DB00758)|Cyclandelate(DB04838)|Dabigatran etexilate(DB06695)|Indomethacin(DB00328)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Mycophenolate mofetil(DB00688)|Oseltamivir(DB00198)|Probucol(DB01599)|Rufinamide(DB06201)|Tamoxifen(DB00675)|Trandolapril(DB00519)	GAGAGAGTGGCCAGGATAAAG	0.592																																					p.A9T	NSCLC(162;1801 2756 42904 52896)	Atlas-SNP	.											.	CES1	78	.	0			c.G25A						.						73.0	62.0	66.0					16																	55866943		2160	4195	6355	SO:0001583	missense	1066	exon1			GAGTGGCCAGGAT	BC012418	CCDS32450.1, CCDS45488.1, CCDS45489.1	16q22.2	2010-10-12	2010-10-12		ENSG00000198848	ENSG00000198848	3.1.1.1	"""Carboxylesterases"""	1863	protein-coding gene	gene with protein product	"""human monocyte/macrophage serine esterase 1"""	114835	"""carboxylesterase 1 (monocyte/macrophage serine esterase 1)"""			2070086, 20931200	Standard	XM_005255774		Approved	HMSE, CES2, HMSE1, SES1, CEH, CES1A1, CES1A2	uc002eil.3	P23141		ENST00000361503.4:c.25G>A	chr16.hg19:g.55866943C>T	ENSP00000355193:p.Ala9Thr	295.0	0.0		344.0	139.0	NM_001025195	A6NIM1|A8K3K8|A8K844|E9PAU8|P82127|Q00015|Q13657|Q14062|Q16737|Q16788|Q549X7|Q549X8|Q86UK2|Q96EE8|Q9UC52|Q9UDG8|Q9UK77|Q9ULY2	Missense_Mutation	SNP	ENST00000361503.4	hg19	CCDS45488.1	.	.	.	.	.	.	.	.	.	.	.	5.505	0.278120	0.10403	.	.	ENSG00000198848	ENST00000360526;ENST00000361503;ENST00000422046	T;T;T	0.68479	-0.33;-0.33;-0.33	3.81	-3.75	0.04372	Carboxylesterase, type B (1);	3.397390	0.01003	N	0.003715	T	0.48714	0.1515	L	0.32530	0.975	0.09310	N	1	B;B;B	0.09022	0.002;0.002;0.001	B;B;B	0.15052	0.012;0.012;0.005	T	0.12941	-1.0528	10	0.14656	T	0.56	.	2.5395	0.04722	0.1406:0.2275:0.4399:0.1919	.	9;9;9	E9PAU8;P23141;P23141-2	.;EST1_HUMAN;.	T	9	ENSP00000353720:A9T;ENSP00000355193:A9T;ENSP00000390492:A9T	ENSP00000353720:A9T	A	-	1	0	CES1	54424444	0.000000	0.05858	0.000000	0.03702	0.104000	0.19210	-1.338000	0.02655	-0.684000	0.05183	0.644000	0.83932	GCC	.	.		0.592	CES1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000433285.1	NM_001266	
LCAT	3931	hgsc.bcm.edu	37	16	67976468	67976468	+	Silent	SNP	G	G	C			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr16:67976468G>C	ENST00000264005.5	-	5	575	c.546C>G	c.(544-546)cgC>cgG	p.R182R	CTC-479C5.17_ENST00000590594.1_lincRNA	NM_000229.1	NP_000220.1	P04180	LCAT_HUMAN	lecithin-cholesterol acyltransferase	182			R -> C. {ECO:0000269|PubMed:8318557, ECO:0000269|PubMed:8432868}.		cholesterol esterification (GO:0034435)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|high-density lipoprotein particle remodeling (GO:0034375)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein metabolic process (GO:0042157)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|regulation of high-density lipoprotein particle assembly (GO:0090107)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|very-low-density lipoprotein particle remodeling (GO:0034372)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)	apolipoprotein A-I binding (GO:0034186)|phosphatidylcholine-sterol O-acyltransferase activity (GO:0004607)			cervix(4)|endometrium(4)|large_intestine(1)|lung(6)|ovary(1)	16		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00418)|Epithelial(162;0.0183)|all cancers(182;0.12)		CTGCGAGCTTGCGGTAGTACT	0.637																																					p.R182R		Atlas-SNP	.											.	LCAT	31	.	0			c.C546G						.						57.0	49.0	52.0					16																	67976468		2198	4300	6498	SO:0001819	synonymous_variant	3931	exon5			GAGCTTGCGGTAG		CCDS10854.1	16q22.1	2012-10-02			ENSG00000213398	ENSG00000213398	2.3.1.43		6522	protein-coding gene	gene with protein product		606967					Standard	NM_000229		Approved		uc002euy.1	P04180	OTTHUMG00000137551	ENST00000264005.5:c.546C>G	chr16.hg19:g.67976468G>C		144.0	0.0		145.0	45.0	NM_000229	Q53XQ3	Silent	SNP	ENST00000264005.5	hg19	CCDS10854.1																																																																																			.	.		0.637	LCAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268885.3		
PRPF8	10594	hgsc.bcm.edu	37	17	1554097	1554097	+	Silent	SNP	C	C	T			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr17:1554097C>T	ENST00000572621.1	-	42	7272	c.7007G>A	c.(7006-7008)tGa>tAa	p.*2336*	PRPF8_ENST00000575116.1_5'Flank|PRPF8_ENST00000304992.6_Silent_p.*2336*|RILP_ENST00000301336.6_5'Flank			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	0					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		GGGAAACGGTCAGGCATACAG	0.602																																					p.X2336X		Atlas-SNP	.											PRPF8,NS,carcinoma,0,1	PRPF8	169	.	0			c.G7007A						.						107.0	88.0	95.0					17																	1554097		2203	4300	6503	SO:0001819	synonymous_variant	10594	exon43			AACGGTCAGGCAT	AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.7007G>A	chr17.hg19:g.1554097C>T		67.0	0.0		49.0	6.0	NM_006445	O14547|O75965	Silent	SNP	ENST00000572621.1	hg19	CCDS11010.1																																																																																			.	.		0.602	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438412.2		
TP53	7157	hgsc.bcm.edu	37	17	7574033	7574033	+	Splice_Site	SNP	T	T	A			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr17:7574033T>A	ENST00000269305.4	-	10	1183	c.994A>T	c.(994-996)Atc>Ttc	p.I332F	TP53_ENST00000359597.4_Intron|TP53_ENST00000445888.2_Splice_Site_p.I332F|TP53_ENST00000420246.2_3'UTR|TP53_ENST00000455263.2_3'UTR|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	332	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.		I -> V (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.I332fs*49(1)|p.?(1)|p.I332V(1)|p.I332fs*5(1)|p.I332fs*13(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CGCCCACGGATCTGCAGCAAC	0.512		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.I332F	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,NS,carcinoma,0,1	TP53	33396	.	13	Whole gene deletion(8)|Deletion - Frameshift(2)|Substitution - Missense(1)|Unknown(1)|Insertion - Frameshift(1)	bone(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|breast(2)|large_intestine(1)|stomach(1)|ovary(1)	c.A994T						.						45.0	37.0	39.0					17																	7574033		2203	4300	6503	SO:0001630	splice_region_variant	7157	exon10	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	CACGGATCTGCAG	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.994-1A>T	chr17.hg19:g.7574033T>A		92.0	0.0		78.0	20.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	T	15.87	2.961350	0.53400	.	.	ENSG00000141510	ENST00000269305;ENST00000445888;ENST00000396473	D;D	0.95885	-3.84;-3.84	5.43	5.43	0.79202	p53, tetramerisation domain (3);	0.119653	0.56097	D	0.000028	D	0.97417	0.9155	M	0.83012	2.62	0.58432	D	0.999991	D	0.63046	0.992	D	0.65874	0.939	D	0.98034	1.0378	10	0.87932	D	0	-36.4786	13.43	0.61049	0.0:0.0:0.0:1.0	.	332	P04637	P53_HUMAN	F	332;332;321	ENSP00000269305:I332F;ENSP00000391478:I332F	ENSP00000269305:I332F	I	-	1	0	TP53	7514758	1.000000	0.71417	1.000000	0.80357	0.150000	0.21749	1.211000	0.32382	2.061000	0.61500	0.459000	0.35465	ATC	.	.		0.512	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Missense_Mutation
TP53	7157	hgsc.bcm.edu	37	17	7577538	7577538	+	Missense_Mutation	SNP	C	C	T	rs11540652		TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr17:7577538C>T	ENST00000269305.4	-	7	932	c.743G>A	c.(742-744)cGg>cAg	p.R248Q	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.R248Q|TP53_ENST00000445888.2_Missense_Mutation_p.R248Q|TP53_ENST00000420246.2_Missense_Mutation_p.R248Q|TP53_ENST00000455263.2_Missense_Mutation_p.R248Q|TP53_ENST00000413465.2_Missense_Mutation_p.R248Q	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	248	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:7682763}.|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs11540652). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:7887414}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1978757, ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248Q(580)|p.R248L(75)|p.R248P(19)|p.R155Q(18)|p.0?(8)|p.?(5)|p.R155L(3)|p.R155P(2)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.M246_P250delMNRRP(2)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*96(1)|p.R248fs*>39(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GATGGGCCTCCGGTTCATGCC	0.572	R248Q(BL41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CA46_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(EM2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HCC1143_BREAST)|R248Q(HCC70_BREAST)|R248Q(HEC1A_ENDOMETRIUM)|R248Q(HS683_CENTRAL_NERVOUS_SYSTEM)|R248Q(HSC4_UPPER_AERODIGESTIVE_TRACT)|R248Q(KASUMI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYSE150_OESOPHAGUS)|R248Q(MOLM6_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NAMALWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NB4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIH211_LUNG)|R248Q(NCIN87_STOMACH)|R248Q(NIHOVCAR3_OVARY)|R248Q(NUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(P12ICHIKAWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PANC0203_PANCREAS)|R248Q(PC14_LUNG)|R248Q(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(RT112_URINARY_TRACT)|R248Q(SEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SF295_CENTRAL_NERVOUS_SYSTEM)|R248Q(SKUT1_SOFT_TISSUE)|R248Q(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SW1463_LARGE_INTESTINE)|R248Q(WSUDLCL2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R248Q	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000545858,NS,adenocarcinoma,0,4	TP53	33396	.	725	Substitution - Missense(698)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(6)|Insertion - Frameshift(3)|Deletion - Frameshift(2)|Complex - compound substitution(1)	large_intestine(138)|breast(83)|haematopoietic_and_lymphoid_tissue(74)|lung(71)|upper_aerodigestive_tract(63)|central_nervous_system(46)|oesophagus(37)|urinary_tract(37)|ovary(36)|stomach(35)|endometrium(23)|skin(18)|prostate(11)|bone(10)|biliary_tract(9)|liver(9)|pancreas(7)|vulva(3)|kidney(3)|cervix(3)|peritoneum(2)|thyroid(2)|soft_tissue(1)|pituitary(1)|adrenal_gland(1)|small_intestine(1)|thymus(1)	c.G743A	GRCh37	CM920675	TP53	M	rs11540652	.	C	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	0,4406		0,0,2203	152.0	112.0	126.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	743,743,743,743,347,347,347	3.7	1.0	17	dbSNP_120	126	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense,missense	TP53	NM_000546.4,NM_001126112.1,NM_001126113.1,NM_001126114.1,NM_001126115.1,NM_001126116.1,NM_001126117.1	43,43,43,43,43,43,43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	248/394,248/394,248/347,248/342,116/262,116/210,116/215	7577538	1,13005	2203	4300	6503	SO:0001583	missense	7157	exon7	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	GGCCTCCGGTTCA	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.743G>A	chr17.hg19:g.7577538C>T	ENSP00000269305:p.Arg248Gln	68.0	0.0		49.0	11.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.822907	0.90873	0.0	1.16E-4	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99864	-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28	4.62	3.65	0.41850	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99840	0.9927	M	0.88640	2.97	0.58432	A	0.999994	D;D;D;D;D;D	0.89917	1.0;0.994;1.0;1.0;1.0;1.0	D;P;D;D;D;D	0.91635	0.996;0.882;0.999;0.995;0.996;0.995	D	0.96819	0.9602	9	0.72032	D	0.01	-9.5643	10.6687	0.45745	0.0:0.9059:0.0:0.0941	rs11540652;rs11540652	248;248;155;248;248;248	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	Q	248;248;248;248;248;248;237;155;116;155	ENSP00000410739:R248Q;ENSP00000352610:R248Q;ENSP00000269305:R248Q;ENSP00000398846:R248Q;ENSP00000391127:R248Q;ENSP00000391478:R248Q;ENSP00000425104:R116Q;ENSP00000423862:R155Q	ENSP00000269305:R248Q	R	-	2	0	TP53	7518263	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	5.884000	0.69729	1.305000	0.44909	0.462000	0.41574	CGG	.	.		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
KRT38	8687	hgsc.bcm.edu	37	17	39594488	39594488	+	Silent	SNP	G	G	A			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr17:39594488G>A	ENST00000246646.3	-	6	1097	c.1098C>T	c.(1096-1098)atC>atT	p.I366I		NM_006771.3	NP_006762.3	O76015	KRT38_HUMAN	keratin 38	366	Coil 2.|Rod.					extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	29		Breast(137;0.000496)				CCACGTTGCTGATGAGGCTCT	0.597																																					p.I366I		Atlas-SNP	.											.	KRT38	63	.	0			c.C1098T						.						68.0	62.0	64.0					17																	39594488		2203	4300	6503	SO:0001819	synonymous_variant	8687	exon6			GTTGCTGATGAGG	Y16794	CCDS11392.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000171360	ENSG00000171360		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6456	protein-coding gene	gene with protein product		604542	"""keratin, hair, acidic, 8"""	KRTHA8		9756910, 16831889	Standard	NM_006771		Approved		uc002hwq.1	O76015	OTTHUMG00000133439	ENST00000246646.3:c.1098C>T	chr17.hg19:g.39594488G>A		49.0	0.0		82.0	29.0	NM_006771	A2RRM5|Q6A164	Silent	SNP	ENST00000246646.3	hg19	CCDS11392.1																																																																																			.	.		0.597	KRT38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257307.2	NM_006771	
SMG8	55181	hgsc.bcm.edu	37	17	57289158	57289158	+	Silent	SNP	A	A	G			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr17:57289158A>G	ENST00000543872.2	+	2	2010	c.1746A>G	c.(1744-1746)tcA>tcG	p.S582S	SMG8_ENST00000300917.5_Silent_p.S582S|CTD-2510F5.6_ENST00000577660.1_Intron|SMG8_ENST00000580498.1_Intron|SMG8_ENST00000578922.1_Silent_p.S582S			Q8ND04	SMG8_HUMAN	SMG8 nonsense mediated mRNA decay factor	582					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of protein kinase activity (GO:0045859)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)				NS(1)|breast(5)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	33						AATTTCACTCATTACCTAAAT	0.358																																					p.S582S		Atlas-SNP	.											.	SMG8	79	.	0			c.A1746G						.						86.0	78.0	81.0					17																	57289158		2203	4300	6503	SO:0001819	synonymous_variant	55181	exon1			TCACTCATTACCT	AL834490	CCDS11615.1	17q23.2	2013-07-02	2013-07-02	2011-06-21					25551	protein-coding gene	gene with protein product		613175	"""chromosome 17 open reading frame 71"", ""smg-8 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf71		19417104	Standard	NM_018149		Approved	FLJ10587, FLJ23205	uc002ixi.3	Q8ND04		ENST00000543872.2:c.1746A>G	chr17.hg19:g.57289158A>G		29.0	0.0		36.0	17.0	NM_018149	Q8N5U5|Q8TDN0|Q9H5P5|Q9NVQ1	Silent	SNP	ENST00000543872.2	hg19	CCDS11615.1																																																																																			.	.		0.358	SMG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445960.2	NM_018149	
CD300E	342510	hgsc.bcm.edu	37	17	72613261	72613261	+	Silent	SNP	G	G	A			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr17:72613261G>A	ENST00000328630.3	-	2	424	c.384C>T	c.(382-384)tcC>tcT	p.S128S	CD300E_ENST00000392619.1_Silent_p.S155S|CD300E_ENST00000426295.2_Silent_p.S169S			Q496F6	CLM2_HUMAN	CD300e molecule	128					innate immune response (GO:0045087)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|kidney(3)|large_intestine(4)|lung(4)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	19						TCTTACCTGGGGAAACATACA	0.542																																					p.S128S		Atlas-SNP	.											.	CD300E	70	.	0			c.C384T						.						91.0	82.0	85.0					17																	72613261		2203	4300	6503	SO:0001819	synonymous_variant	342510	exon2			ACCTGGGGAAACA	BX648376	CCDS11702.1	17q25.1	2013-01-11	2006-03-28	2006-02-22	ENSG00000186407	ENSG00000186407		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	28874	protein-coding gene	gene with protein product		609801	"""CD300 antigen like family member E"", ""CD300e antigen"""	CD300LE		15549731, 15557162	Standard	NM_181449		Approved	IREM2, CLM2	uc002jlb.2	Q496F6	OTTHUMG00000067605	ENST00000328630.3:c.384C>T	chr17.hg19:g.72613261G>A		69.0	0.0		90.0	39.0	NM_181449	B4DNS1|Q7Z7I3	Silent	SNP	ENST00000328630.3	hg19	CCDS11702.1																																																																																			.	.		0.542	CD300E-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_181449	
ITGB4	3691	hgsc.bcm.edu	37	17	73738810	73738810	+	Missense_Mutation	SNP	G	G	T			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr17:73738810G>T	ENST00000200181.3	+	25	3117	c.2930G>T	c.(2929-2931)cGc>cTc	p.R977L	ITGB4_ENST00000339591.3_Missense_Mutation_p.R977L|ITGB4_ENST00000579662.1_Missense_Mutation_p.R977L|ITGB4_ENST00000450894.3_Missense_Mutation_p.R977L|ITGB4_ENST00000449880.2_Missense_Mutation_p.R977L	NM_000213.3	NP_000204.3	P16144	ITB4_HUMAN	integrin, beta 4	977					amelogenesis (GO:0097186)|autophagy (GO:0006914)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell motility (GO:0048870)|cell-matrix adhesion (GO:0007160)|digestive tract development (GO:0048565)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|mesodermal cell differentiation (GO:0048333)|nail development (GO:0035878)|renal system development (GO:0072001)|response to wounding (GO:0009611)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|hemidesmosome (GO:0030056)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor binding (GO:0001664)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(1)|lung(25)|skin(1)|urinary_tract(1)	43	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			CTCGGCCGCCGCCTGGTAAAC	0.647																																					p.R977L		Atlas-SNP	.											.	ITGB4	165	.	0			c.G2930T						.						37.0	33.0	34.0					17																	73738810		2202	4298	6500	SO:0001583	missense	3691	exon25			GCCGCCGCCTGGT		CCDS11727.1, CCDS32736.1, CCDS58599.1	17q25.1	2013-09-19			ENSG00000132470	ENSG00000132470		"""CD molecules"", ""Integrins"", ""Fibronectin type III domain containing"""	6158	protein-coding gene	gene with protein product		147557				2070796	Standard	XM_005257309		Approved	CD104	uc002jpg.3	P16144	OTTHUMG00000179814	ENST00000200181.3:c.2930G>T	chr17.hg19:g.73738810G>T	ENSP00000200181:p.Arg977Leu	28.0	0.0		47.0	16.0	NM_001005731	A0AVL6|O14690|O14691|O15339|O15340|O15341|Q0VF97|Q9UIQ4	Missense_Mutation	SNP	ENST00000200181.3	hg19	CCDS11727.1	.	.	.	.	.	.	.	.	.	.	G	15.09	2.730858	0.48939	.	.	ENSG00000132470	ENST00000200181;ENST00000339591;ENST00000449880	T;T;T	0.75589	-0.95;-0.9;-0.9	5.34	5.34	0.76211	.	0.139500	0.46758	D	0.000270	T	0.74876	0.3774	L	0.27053	0.805	0.48901	D	0.99972	D;D;D	0.60160	0.987;0.977;0.977	P;P;P	0.59487	0.858;0.725;0.725	T	0.77675	-0.2499	10	0.87932	D	0	.	12.4566	0.55708	0.0767:0.0:0.9233:0.0	.	977;977;977	P16144-3;A0AVL6;P16144	.;.;ITB4_HUMAN	L	977	ENSP00000200181:R977L;ENSP00000344079:R977L;ENSP00000400217:R977L	ENSP00000200181:R977L	R	+	2	0	ITGB4	71250405	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	4.803000	0.62546	2.546000	0.85860	0.556000	0.70494	CGC	.	.		0.647	ITGB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000448334.1		
ACAA2	10449	hgsc.bcm.edu	37	18	47329197	47329197	+	Missense_Mutation	SNP	T	T	C			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr18:47329197T>C	ENST00000285093.10	-	2	518	c.43A>G	c.(43-45)Acg>Gcg	p.T15A	ACAA2_ENST00000589432.1_5'UTR|RP11-886H22.1_ENST00000590532.2_3'UTR|ACAA2_ENST00000587994.1_Missense_Mutation_p.T12A	NM_006111.2	NP_006102.2	P42765	THIM_HUMAN	acetyl-CoA acyltransferase 2	15					cellular response to hypoxia (GO:0071456)|cholesterol biosynthetic process (GO:0006695)|fatty acid metabolic process (GO:0006631)|negative regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902109)|negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901029)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	acetyl-CoA C-acyltransferase activity (GO:0003988)|poly(A) RNA binding (GO:0044822)			large_intestine(2)|lung(7)|ovary(1)	10						CCAAAGGGCGTTCGCTTAGCA	0.453																																					p.T15A		Atlas-SNP	.											.	ACAA2	29	.	0			c.A43G						.						104.0	95.0	98.0					18																	47329197		2203	4300	6503	SO:0001583	missense	10449	exon2			AGGGCGTTCGCTT	D16294	CCDS11939.1	18q21	2010-04-30	2010-04-30		ENSG00000167315	ENSG00000167315	2.3.1.16		83	protein-coding gene	gene with protein product	"""mitochondrial 3-oxoacyl-Coenzyme A thiolase"""	604770	"""acetyl-Coenzyme A acyltransferase 2"""			8241273	Standard	NM_006111		Approved	DSAEC	uc002ldw.4	P42765	OTTHUMG00000132667	ENST00000285093.10:c.43A>G	chr18.hg19:g.47329197T>C	ENSP00000285093:p.Thr15Ala	95.0	0.0		179.0	54.0	NM_006111	Q9BUT6	Missense_Mutation	SNP	ENST00000285093.10	hg19	CCDS11939.1	.	.	.	.	.	.	.	.	.	.	T	25.4	4.630287	0.87660	.	.	ENSG00000167315	ENST00000285093	D	0.96300	-3.97	5.64	5.64	0.86602	Thiolase-like, subgroup (1);Thiolase, N-terminal (1);Thiolase-like (1);	0.000000	0.85682	D	0.000000	D	0.98836	0.9607	H	0.97707	4.06	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.99;0.991	D	0.99609	1.0980	10	0.87932	D	0	-23.5008	15.535	0.75996	0.0:0.0:0.0:1.0	.	15;15	B2RB23;P42765	.;THIM_HUMAN	A	15	ENSP00000285093:T15A	ENSP00000285093:T15A	T	-	1	0	ACAA2	45583195	1.000000	0.71417	0.819000	0.32651	0.779000	0.44077	7.911000	0.87458	2.149000	0.67028	0.533000	0.62120	ACG	.	.		0.453	ACAA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255921.2	NM_006111	
VPS4B	9525	hgsc.bcm.edu	37	18	61067937	61067937	+	Splice_Site	SNP	C	C	A			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr18:61067937C>A	ENST00000238497.5	-	6	688		c.e6-1		VPS4B_ENST00000591383.1_Splice_Site	NM_004869.3	NP_004860.2	O75351	VPS4B_HUMAN	vacuolar protein sorting 4 homolog B (S. cerevisiae)						ATP catabolic process (GO:0006200)|cell cycle (GO:0007049)|cell division (GO:0051301)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|intracellular cholesterol transport (GO:0032367)|membrane organization (GO:0061024)|positive regulation of viral release from host cell (GO:1902188)|potassium ion transport (GO:0006813)|protein transport (GO:0015031)|regulation of viral process (GO:0050792)|response to lipid (GO:0033993)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|nucleus (GO:0005634)|vacuolar membrane (GO:0005774)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)			breast(1)|large_intestine(3)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	13						GTTCTCTTGCCTAAAATTTAG	0.378																																					.		Atlas-SNP	.											.	VPS4B	33	.	0			c.485-1G>T						.						64.0	64.0	64.0					18																	61067937		2203	4300	6503	SO:0001630	splice_region_variant	9525	exon7			TCTTGCCTAAAAT	AF038960	CCDS11983.1	18q21.33	2010-04-21	2006-04-04	2002-06-14	ENSG00000119541	ENSG00000119541		"""ATPases / AAA-type"""	10895	protein-coding gene	gene with protein product		609983	"""suppressor of K+ transport defect 1"", ""vacuolar protein sorting 4B (yeast)"""	SKD1		11563910	Standard	XM_006722582		Approved	VPS4-2, SKD1B	uc002lix.3	O75351	OTTHUMG00000132790	ENST00000238497.5:c.485-1G>T	chr18.hg19:g.61067937C>A		85.0	0.0		106.0	32.0	NM_004869	Q69HW4|Q9GZS7	Splice_Site	SNP	ENST00000238497.5	hg19	CCDS11983.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.647207	0.87958	.	.	ENSG00000119541	ENST00000238497	.	.	.	5.8	5.8	0.92144	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.418	0.99029	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	VPS4B	59218917	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	7.692000	0.84203	2.902000	0.99343	0.650000	0.86243	.	.	.		0.378	VPS4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256198.2	NM_004869	Intron
SHD	56961	hgsc.bcm.edu	37	19	4288320	4288320	+	Missense_Mutation	SNP	T	T	G			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr19:4288320T>G	ENST00000543264.2	+	5	2260	c.797T>G	c.(796-798)cTc>cGc	p.L266R	SHD_ENST00000599689.1_Intron	NM_020209.3	NP_064594.3	Q96IW2	SHD_HUMAN	Src homology 2 domain containing transforming protein D	266	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.									breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|stomach(1)	14				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0337)|STAD - Stomach adenocarcinoma(1328;0.18)		CTAGTGCGGCTCAGTGAGACC	0.582																																					p.L266R		Atlas-SNP	.											.	SHD	33	.	0			c.T797G						.						84.0	71.0	75.0					19																	4288320		2203	4300	6503	SO:0001583	missense	56961	exon5			TGCGGCTCAGTGA	BC007206	CCDS12125.1	19p13.3	2013-02-14				ENSG00000105251		"""SH2 domain containing"""	30633	protein-coding gene	gene with protein product		610481				9315092	Standard	NM_020209		Approved		uc002lzw.2	Q96IW2		ENST00000543264.2:c.797T>G	chr19.hg19:g.4288320T>G	ENSP00000446058:p.Leu266Arg	76.0	0.0		109.0	31.0	NM_020209	Q96NC2	Missense_Mutation	SNP	ENST00000543264.2	hg19	CCDS12125.1	.	.	.	.	.	.	.	.	.	.	T	15.90	2.970664	0.53614	.	.	ENSG00000105251	ENST00000543264;ENST00000221852	D	0.88354	-2.37	4.91	3.85	0.44370	SH2 motif (5);	0.314114	0.29609	N	0.011677	T	0.77239	0.4101	N	0.12502	0.225	0.38167	D	0.939229	B	0.12630	0.006	B	0.25759	0.063	T	0.72623	-0.4237	10	0.33141	T	0.24	-20.2727	7.2661	0.26229	0.2933:0.0:0.0:0.7067	.	266	Q96IW2	SHD_HUMAN	R	266;181	ENSP00000446058:L266R	ENSP00000221852:L181R	L	+	2	0	SHD	4239320	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	5.004000	0.63966	2.075000	0.62263	0.454000	0.30748	CTC	.	.		0.582	SHD-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458082.1	NM_020209	
KANK2	25959	hgsc.bcm.edu	37	19	11304443	11304444	+	Missense_Mutation	DNP	GG	GG	CA			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr19:11304443_11304444GG>CA	ENST00000586659.1	-	4	626_627	c.312_313CC>TG	c.(310-315)ggCCgt>ggTGgt	p.R105G	KANK2_ENST00000589894.1_Missense_Mutation_p.R105G|KANK2_ENST00000432929.2_Missense_Mutation_p.R105G|KANK2_ENST00000589359.1_Missense_Mutation_p.R105G|KANK2_ENST00000355150.5_Missense_Mutation_p.R105G			Q63ZY3	KANK2_HUMAN	KN motif and ankyrin repeat domains 2	105					apoptotic process (GO:0006915)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of programmed cell death (GO:0043069)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)				endometrium(2)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						TAGAAGCCACGGCCGCAGTAGG	0.668																																					p.R105G|p.G104G		Atlas-SNP	.											.	KANK2	47	.	0			c.C313G|c.C312T						.																																			SO:0001583	missense	25959	exon2			AGCCACGGCCGCA|GCCACGGCCGCAG	AK000011	CCDS12255.1, CCDS54219.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000197256		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	29300	protein-coding gene	gene with protein product		614610	"""matrix-remodelling associated 3"", ""ankyrin repeat domain 25"""	MXRA3, ANKRD25		10819331, 17996375, 19554261	Standard	NM_015493		Approved	KIAA1518	uc002mqm.3	Q63ZY3		ENST00000586659.1:c.312_313delinsCA	chr19.hg19:g.11304443_11304444delinsCA	ENSP00000465650:p.Arg105Gly	129.0|128.0	0.0		242.0|241.0	34.0|31.0	NM_015493	B0I1P4|Q3KQZ3|Q6GUF5|Q9H8S4|Q9NUP0|Q9P210	Missense_Mutation|Silent	SNP	ENST00000586659.1	hg19	CCDS12255.1																																																																																			.	.		0.668	KANK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000453066.2	NM_015493	
CILP2	148113	hgsc.bcm.edu	37	19	19654688	19654688	+	Missense_Mutation	SNP	G	G	T			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr19:19654688G>T	ENST00000291495.5	+	8	1419	c.1334G>T	c.(1333-1335)aGa>aTa	p.R445I	CILP2_ENST00000586018.1_Missense_Mutation_p.R451I	NM_153221.2	NP_694953.2	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	445						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	32						CGTCTGGAGAGAAGGGAGATT	0.706																																					p.R445I		Atlas-SNP	.											.	CILP2	84	.	0			c.G1334T						.						53.0	50.0	51.0					19																	19654688		2201	4300	6501	SO:0001583	missense	148113	exon8			TGGAGAGAAGGGA	AF542080	CCDS12405.1	19p13.11	2013-01-14				ENSG00000160161		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	24213	protein-coding gene	gene with protein product		612419				12477932	Standard	NM_153221		Approved	MGC45771	uc002nmv.4	Q8IUL8		ENST00000291495.5:c.1334G>T	chr19.hg19:g.19654688G>T	ENSP00000291495:p.Arg445Ile	121.0	0.0		123.0	11.0	NM_153221	Q6NV88|Q8N4A6|Q8WV21	Missense_Mutation	SNP	ENST00000291495.5	hg19	CCDS12405.1	.	.	.	.	.	.	.	.	.	.	G	11.49	1.655304	0.29425	.	.	ENSG00000160161	ENST00000291495	T	0.51574	0.7	4.21	0.489	0.16854	.	0.425372	0.24483	N	0.038137	T	0.22859	0.0552	N	0.08118	0	0.21325	N	0.999725	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.17018	-1.0383	10	0.41790	T	0.15	-2.2175	7.4391	0.27172	0.0:0.4986:0.3418:0.1596	.	445;445	B2RAJ0;Q8IUL8	.;CILP2_HUMAN	I	445	ENSP00000291495:R445I	ENSP00000291495:R445I	R	+	2	0	CILP2	19515688	0.002000	0.14202	0.709000	0.30452	0.612000	0.37316	0.168000	0.16622	0.734000	0.32515	0.423000	0.28283	AGA	.	.		0.706	CILP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459738.3	NM_153221	
ZNF43	7594	hgsc.bcm.edu	37	19	21992333	21992333	+	Missense_Mutation	SNP	G	G	T			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr19:21992333G>T	ENST00000354959.4	-	4	675	c.506C>A	c.(505-507)aCt>aAt	p.T169N	ZNF43_ENST00000595461.1_Missense_Mutation_p.T163N|ZNF43_ENST00000598381.1_Missense_Mutation_p.T163N|ZNF43_ENST00000594012.1_Missense_Mutation_p.T163N	NM_003423.3	NP_003414.2	P17038	ZNF43_HUMAN	zinc finger protein 43	169					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|prostate(3)|stomach(3)|upper_aerodigestive_tract(2)	51		Renal(1328;0.000219)|Hepatocellular(1079;0.121)		GBM - Glioblastoma multiforme(1328;5.97e-05)|STAD - Stomach adenocarcinoma(1328;0.0127)		TTTTTTTTCAGTATGGCTTAT	0.318																																					p.T178N		Atlas-SNP	.											.	ZNF43	152	.	0			c.C533A						.						37.0	37.0	37.0					19																	21992333		2201	4297	6498	SO:0001583	missense	7594	exon4			TTTTCAGTATGGC	X59244	CCDS12413.2, CCDS59367.1, CCDS74321.1	19p13.1-p12	2013-01-08	2006-05-11		ENSG00000198521	ENSG00000198521		"""Zinc fingers, C2H2-type"", ""-"""	13109	protein-coding gene	gene with protein product		603972	"""zinc finger protein 39-like 1 (KOX 27)"", ""zinc finger protein 43 (HTF6)"""	ZNF39L1		1711675	Standard	NM_001256649		Approved	HTF6, KOX27	uc031rka.1	P17038	OTTHUMG00000128543	ENST00000354959.4:c.506C>A	chr19.hg19:g.21992333G>T	ENSP00000347045:p.Thr169Asn	101.0	0.0		123.0	50.0	NM_001256653	A8K5N8|P28160|Q53XQ2|Q5H9T3|Q96DG1	Missense_Mutation	SNP	ENST00000354959.4	hg19	CCDS12413.2	.	.	.	.	.	.	.	.	.	.	G	10.08	1.251617	0.22880	.	.	ENSG00000198521	ENST00000397148;ENST00000354959	T	0.26067	1.76	1.5	-1.72	0.08107	Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.41096	0.1144	M	0.70275	2.135	0.09310	N	1	D	0.63880	0.993	D	0.65140	0.932	T	0.25847	-1.0120	9	0.52906	T	0.07	.	6.7676	0.23576	0.2642:0.0:0.7358:0.0	.	169	P17038	ZNF43_HUMAN	N	168;169	ENSP00000347045:T169N	ENSP00000347045:T169N	T	-	2	0	ZNF43	21784173	0.003000	0.15002	0.000000	0.03702	0.004000	0.04260	0.566000	0.23593	-0.555000	0.06142	-0.350000	0.07774	ACT	.	.		0.318	ZNF43-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250380.2	NM_003423	
ZNF728	388523	hgsc.bcm.edu	37	19	23158365	23158365	+	Missense_Mutation	SNP	A	A	G			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr19:23158365A>G	ENST00000594710.1	-	4	1919	c.1774T>C	c.(1774-1776)Tac>Cac	p.Y592H		NM_001267716.1	NP_001254645.1	P0DKX0	ZN728_HUMAN	zinc finger protein 728	592					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)										TCACATTTGTAGAATTTCTTT	0.368																																					p.Y592H		Atlas-SNP	.											.	.	.	.	0			c.T1774C						.																																			SO:0001583	missense	388523	exon4			ATTTGTAGAATTT	BC128130	CCDS59370.1	19p12	2014-02-14			ENSG00000269067	ENSG00000269067		"""Zinc fingers, C2H2-type"", ""-"""	32463	protein-coding gene	gene with protein product							Standard	NM_001267716		Approved		uc002nqz.2	P0DKX0	OTTHUMG00000183124	ENST00000594710.1:c.1774T>C	chr19.hg19:g.23158365A>G	ENSP00000471593:p.Tyr592His	11.0	0.0		23.0	9.0	NM_001267716		Missense_Mutation	SNP	ENST00000594710.1	hg19	CCDS59370.1																																																																																			.	.		0.368	ZNF728-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465176.1	NM_001267716	
FLT3LG	2323	hgsc.bcm.edu	37	19	49983824	49983824	+	Missense_Mutation	SNP	A	A	T			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr19:49983824A>T	ENST00000594009.1	+	7	755	c.676A>T	c.(676-678)Agt>Tgt	p.S226C	CTD-3148I10.15_ENST00000595815.1_RNA|FLT3LG_ENST00000597551.1_Missense_Mutation_p.S226C|FLT3LG_ENST00000595510.1_Missense_Mutation_p.S144C|FLT3LG_ENST00000596435.1_Missense_Mutation_p.S208C|FLT3LG_ENST00000204637.2_Missense_Mutation_p.S144C|FLT3LG_ENST00000600429.1_Missense_Mutation_p.S226C|CTD-3148I10.9_ENST00000599536.1_Intron	NM_001204503.1	NP_001191432.1	P49771	FLT3L_HUMAN	fms-related tyrosine kinase 3 ligand	226					embryonic hemopoiesis (GO:0035162)|lymphocyte differentiation (GO:0030098)|positive regulation of cell proliferation (GO:0008284)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of protein phosphorylation (GO:0001934)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|intrinsic component of external side of plasma membrane (GO:0031233)|membrane (GO:0016020)	receptor binding (GO:0005102)			large_intestine(2)|lung(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	10		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00154)|GBM - Glioblastoma multiforme(486;0.0246)		CCCCGTCCCCAGTCCCCAGGA	0.657																																					p.S226C		Atlas-SNP	.											.	FLT3LG	22	.	0			c.A676T						.						37.0	34.0	35.0					19																	49983824		2203	4300	6503	SO:0001583	missense	2323	exon7			GTCCCCAGTCCCC	U04806	CCDS12767.1, CCDS62753.1	19q13.3	2014-01-30				ENSG00000090554		"""Endogenous ligands"""	3766	protein-coding gene	gene with protein product		600007				8145851, 7824267	Standard	NM_001204502		Approved		uc010yau.2	P49771		ENST00000594009.1:c.676A>T	chr19.hg19:g.49983824A>T	ENSP00000469613:p.Ser226Cys	84.0	0.0		80.0	34.0	NM_001204503	A0AVC2|B9EGH2|Q05C96	Missense_Mutation	SNP	ENST00000594009.1	hg19	CCDS12767.1	.	.	.	.	.	.	.	.	.	.	A	14.85	2.657994	0.47467	.	.	ENSG00000090554	ENST00000204637	.	.	.	4.22	-5.81	0.02340	.	1.159090	0.06320	N	0.704297	T	0.22666	0.0547	N	0.22421	0.69	0.09310	N	0.999999	B	0.09022	0.002	B	0.04013	0.001	T	0.21177	-1.0253	9	0.51188	T	0.08	-11.0515	2.7293	0.05222	0.2713:0.4365:0.1769:0.1154	.	226	P49771	FLT3L_HUMAN	C	226	.	ENSP00000204637:S226C	S	+	1	0	FLT3LG	54675636	0.000000	0.05858	0.000000	0.03702	0.222000	0.24845	-0.222000	0.09190	-1.196000	0.02676	-0.496000	0.04628	AGT	.	.		0.657	FLT3LG-007	KNOWN	alternative_3_UTR|alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465305.1		
ZNF444	55311	hgsc.bcm.edu	37	19	56669904	56669904	+	Silent	SNP	G	G	A			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr19:56669904G>A	ENST00000337080.3	+	4	706	c.339G>A	c.(337-339)gtG>gtA	p.V113V	ZNF444_ENST00000592171.1_3'UTR|ZNF444_ENST00000592949.1_Silent_p.V113V	NM_001253792.1|NM_018337.3	NP_001240721.1|NP_060807.2	Q8N0Y2	ZN444_HUMAN	zinc finger protein 444	113					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|endometrium(1)|lung(5)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0531)		CAACGAGGGTGCCTCAGGATG	0.597																																					p.V113V		Atlas-SNP	.											.	ZNF444	15	.	0			c.G339A						.						83.0	69.0	74.0					19																	56669904		2203	4300	6503	SO:0001819	synonymous_variant	55311	exon4			GAGGGTGCCTCAG	AB052954	CCDS12939.1, CCDS59426.1	19q13.43	2013-01-09			ENSG00000167685	ENSG00000167685		"""-"", ""Zinc fingers, C2H2-type"""	16052	protein-coding gene	gene with protein product		607874				11978792, 19760602	Standard	NM_001253792		Approved	ZSCAN17, FLJ11137, EZF2	uc002qmm.3	Q8N0Y2		ENST00000337080.3:c.339G>A	chr19.hg19:g.56669904G>A		139.0	0.0		195.0	8.0	NM_001253792	Q8TEQ9|Q8WU35|Q9NUU1	Silent	SNP	ENST00000337080.3	hg19	CCDS12939.1																																																																																			.	.		0.597	ZNF444-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457503.1	NM_018337	
SEC23B	10483	hgsc.bcm.edu	37	20	18491519	18491519	+	Missense_Mutation	SNP	C	C	T	rs121918222		TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr20:18491519C>T	ENST00000336714.3	+	2	472	c.40C>T	c.(40-42)Cgg>Tgg	p.R14W	SEC23B_ENST00000377475.3_Missense_Mutation_p.R14W|SEC23B_ENST00000262544.2_Missense_Mutation_p.R14W|SEC23B_ENST00000377465.1_Missense_Mutation_p.R14W	NM_006363.4|NM_032985.4|NM_032986.3	NP_006354.2|NP_116780.1|NP_116781.1	Q15437	SC23B_HUMAN	Sec23 homolog B (S. cerevisiae)	14			R -> W (in CDAN2; the mutant protein is unstable with less than 5% of protein detectable compared to wild-type). {ECO:0000269|PubMed:19561605, ECO:0000269|PubMed:19621418}.		ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	32						GAATGAAGAACGGGATGGTGT	0.448																																					p.R14W		Atlas-SNP	.											.	SEC23B	70	.	0			c.C40T						.	C	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	155.0	138.0	144.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	40,40,40,40,40	4.1	1.0	20	dbSNP_133	144	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense,missense,missense,missense	SEC23B	NM_001172745.1,NM_001172746.1,NM_006363.4,NM_032985.4,NM_032986.3	101,101,101,101,101	0,3,6500	TT,TC,CC		0.0233,0.0227,0.0231	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	14/768,14/750,14/768,14/768,14/768	18491519	3,13003	2203	4300	6503	SO:0001583	missense	10483	exon2			GAAGAACGGGATG	X97065	CCDS13137.1	20p11.23	2010-02-09	2001-11-28		ENSG00000101310	ENSG00000101310			10702	protein-coding gene	gene with protein product		610512	"""Sec23 (S. cerevisiae) homolog B"", ""congenital dyserythropoietic anemia, type II"""	CDAN2		8898360, 10329445, 19621418	Standard	NM_032985		Approved	CDA-II, CDAII, HEMPAS	uc002wrb.2	Q15437	OTTHUMG00000031976	ENST00000336714.3:c.40C>T	chr20.hg19:g.18491519C>T	ENSP00000338844:p.Arg14Trp	167.0	0.0		302.0	14.0	NM_032985	D3DW33|Q503A9|Q5W183|Q9BS15|Q9BSI2|Q9H1D7	Missense_Mutation	SNP	ENST00000336714.3	hg19	CCDS13137.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.150161	0.78001	2.27E-4	2.33E-4	ENSG00000101310	ENST00000450074;ENST00000336714;ENST00000262544;ENST00000377475;ENST00000377465	D;D;D;D;D	0.83075	-1.68;-1.68;-1.68;-1.68;-1.68	5.08	4.12	0.48240	.	0.060523	0.64402	D	0.000003	D	0.89774	0.6812	M	0.82056	2.57	0.80722	A	1	D;D	0.76494	0.999;0.999	P;P	0.62184	0.899;0.856	D	0.92798	0.6254	9	0.72032	D	0.01	-11.6695	13.9573	0.64157	0.1525:0.8475:0.0:0.0	.	14;14	B4DJW8;Q15437	.;SC23B_HUMAN	W	14	ENSP00000403971:R14W;ENSP00000338844:R14W;ENSP00000262544:R14W;ENSP00000366695:R14W;ENSP00000366685:R14W	ENSP00000262544:R14W	R	+	1	2	SEC23B	18439519	1.000000	0.71417	0.963000	0.40424	0.988000	0.76386	3.052000	0.49893	1.333000	0.45449	0.655000	0.94253	CGG	.	C|1.000;T|0.000		0.448	SEC23B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078184.5		
SOGA1	140710	hgsc.bcm.edu	37	20	35414900	35414900	+	Silent	SNP	G	G	T			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr20:35414900G>T	ENST00000357779.3	-	15	4586	c.4260C>A	c.(4258-4260)ccC>ccA	p.P1420P	SOGA1_ENST00000456801.2_Silent_p.P1261P|SOGA1_ENST00000237536.4_Silent_p.P1658P|SOGA1_ENST00000279034.6_Intron			O94964	SOGA1_HUMAN	suppressor of glucose, autophagy associated 1	1420					insulin receptor signaling pathway (GO:0008286)|negative regulation of gluconeogenesis (GO:0045721)|regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				endometrium(5)|kidney(1)|lung(21)|urinary_tract(1)	28						ACTCGCTGGGGGGGAGTGCCC	0.667																																					p.P1658P		Atlas-SNP	.											.	SOGA1	136	.	0			c.C4974A						.						31.0	37.0	35.0					20																	35414900		692	1591	2283	SO:0001819	synonymous_variant	140710	exon15			GCTGGGGGGGAGT	AK126630	CCDS46598.1, CCDS54459.1	20q11.23	2012-03-01	2012-02-27	2012-02-27	ENSG00000149639	ENSG00000149639			16111	protein-coding gene	gene with protein product	"""suppressor of glucose by autophagy"", ""suppressor of glucose from autophagy"""		"""chromosome 20 open reading frame 117"", ""KIAA0889"""	C20orf117, KIAA0889		20813965	Standard	NM_080627		Approved	dJ132F21.1, FLJ44670, SOGA	uc021wcx.1	O94964	OTTHUMG00000032395	ENST00000357779.3:c.4260C>A	chr20.hg19:g.35414900G>T		28.0	0.0		37.0	13.0	NM_080627	A6NK10|Q14DB2|Q5JW51|Q6ZTG8	Silent	SNP	ENST00000357779.3	hg19																																																																																				.	.		0.667	SOGA1-201	KNOWN	basic	protein_coding	protein_coding		NM_199181	
PSMG1	8624	hgsc.bcm.edu	37	21	40549463	40549463	+	Silent	SNP	T	T	C			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr21:40549463T>C	ENST00000331573.3	-	6	1155	c.690A>G	c.(688-690)gcA>gcG	p.A230A	PSMG1_ENST00000380900.2_Silent_p.A209A	NM_001261824.1|NM_003720.3	NP_001248753.1|NP_003711.1	O95456	PSMG1_HUMAN	proteasome (prosome, macropain) assembly chaperone 1	230					cerebellar granule cell precursor proliferation (GO:0021930)|proteasome assembly (GO:0043248)|proteasome core complex assembly (GO:0080129)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)				autonomic_ganglia(1)|endometrium(2)|large_intestine(1)|lung(1)|skin(1)|urinary_tract(2)	8		Prostate(19;8.44e-08)				AGTACAGAATTGCTGGGATTT	0.323																																					p.A230A		Atlas-SNP	.											.	PSMG1	11	.	0			c.A690G						.						74.0	70.0	71.0					21																	40549463		2202	4300	6502	SO:0001819	synonymous_variant	8624	exon6			CAGAATTGCTGGG	AJ006291	CCDS13660.1, CCDS13661.1	21q22.3	2007-10-23	2007-10-23	2007-10-23	ENSG00000183527	ENSG00000183527			3043	protein-coding gene	gene with protein product		605296	"""Down syndrome critical region gene 2"""	DSCR2		10872820, 17189198	Standard	NM_003720		Approved	c21-LRP, LRPC21, PAC1	uc002yxi.4	O95456	OTTHUMG00000066034	ENST00000331573.3:c.690A>G	chr21.hg19:g.40549463T>C		78.0	0.0		89.0	39.0	NM_003720	B5BUN2|Q6FHA3|Q6FHD3|Q6S713	Silent	SNP	ENST00000331573.3	hg19	CCDS13660.1	.	.	.	.	.	.	.	.	.	.	T	8.043	0.764242	0.15914	.	.	ENSG00000183527	ENST00000440607	.	.	.	5.73	-11.0	0.00169	.	.	.	.	.	T	0.42743	0.1216	.	.	.	0.58432	D	0.999996	.	.	.	.	.	.	T	0.51764	-0.8664	4	.	.	.	-28.1142	6.4678	0.21991	0.1007:0.1621:0.5813:0.156	.	.	.	.	D	87	.	.	N	-	1	0	PSMG1	39471333	0.000000	0.05858	0.000000	0.03702	0.764000	0.43329	-1.316000	0.02710	-1.955000	0.01023	0.455000	0.32223	AAT	.	.		0.323	PSMG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141404.2	NM_003720	
MYO18B	84700	hgsc.bcm.edu	37	22	26298630	26298630	+	Missense_Mutation	SNP	G	G	A			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr22:26298630G>A	ENST00000407587.2	+	30	5046	c.4877G>A	c.(4876-4878)gGt>gAt	p.G1626D	CTA-125H2.2_ENST00000453457.3_RNA|CTA-125H2.2_ENST00000599080.1_RNA|CTA-125H2.2_ENST00000607895.1_RNA|MYO18B_ENST00000536101.1_Missense_Mutation_p.G1625D|CTA-125H2.2_ENST00000609570.1_RNA|CTA-125H2.2_ENST00000609889.1_RNA|CTA-125H2.2_ENST00000595093.1_RNA|CTA-125H2.2_ENST00000608257.1_RNA|CTA-125H2.2_ENST00000597548.1_RNA|CTA-125H2.2_ENST00000609823.1_RNA|CTA-125H2.2_ENST00000609157.1_RNA|CTA-125H2.2_ENST00000597284.1_RNA|CTA-125H2.2_ENST00000600269.1_RNA|CTA-125H2.2_ENST00000608115.1_RNA|CTA-125H2.2_ENST00000609275.1_RNA|MYO18B_ENST00000536204.1_3'UTR|CTA-125H2.2_ENST00000600211.1_RNA|MYO18B_ENST00000335473.7_Missense_Mutation_p.G1625D|CTA-125H2.2_ENST00000594585.1_RNA|CTA-125H2.2_ENST00000599792.1_RNA			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1625	Tail.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						TTTGAGAAGGGTCTCCGTGAG	0.607																																					p.G1625D		Atlas-SNP	.											.	MYO18B	322	.	0			c.G4874A						.						46.0	50.0	49.0					22																	26298630		1997	4176	6173	SO:0001583	missense	84700	exon30			AGAAGGGTCTCCG	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.4877G>A	chr22.hg19:g.26298630G>A	ENSP00000386096:p.Gly1626Asp	78.0	0.0		100.0	11.0	NM_032608	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	hg19		.	.	.	.	.	.	.	.	.	.	G	13.81	2.348380	0.41599	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;D	0.86297	-2.08;-2.08;-2.1	5.11	4.1	0.47936	.	0.453258	0.23660	N	0.045839	T	0.80944	0.4721	L	0.38531	1.155	0.27028	N	0.964313	B;B;D;B	0.56746	0.029;0.314;0.977;0.441	B;B;P;B	0.48030	0.015;0.031;0.564;0.068	T	0.71965	-0.4433	10	0.02654	T	1	.	11.2411	0.48970	0.0894:0.0:0.9106:0.0	.	1138;1625;1626;1625	Q8IUG5-2;Q8IUG5;F5GXR6;F5GYU7	.;MY18B_HUMAN;.;.	D	1625;1625;1626	ENSP00000441229:G1625D;ENSP00000334563:G1625D;ENSP00000386096:G1626D	ENSP00000334563:G1625D	G	+	2	0	MYO18B	24628630	0.984000	0.35163	0.977000	0.42913	0.981000	0.71138	1.960000	0.40422	1.136000	0.42199	0.655000	0.94253	GGT	.	.		0.607	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608	
DMD	1756	hgsc.bcm.edu	37	X	32429887	32429887	+	Silent	SNP	T	T	C			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chrX:32429887T>C	ENST00000357033.4	-	30	4421	c.4215A>G	c.(4213-4215)caA>caG	p.Q1405Q	DMD_ENST00000378677.2_Silent_p.Q1401Q	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1405					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CCTGAGGCATTTGAGCTGCGT	0.413																																					p.Q1405Q		Atlas-SNP	.											.	DMD	2127	.	0			c.A4215G						.						118.0	86.0	97.0					X																	32429887		2202	4300	6502	SO:0001819	synonymous_variant	1756	exon30			AGGCATTTGAGCT	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.4215A>G	chrX.hg19:g.32429887T>C		37.0	0.0		70.0	21.0	NM_004006	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Silent	SNP	ENST00000357033.4	hg19	CCDS14233.1																																																																																			.	.		0.413	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
MAP7D3	79649	hgsc.bcm.edu	37	X	135318419	135318419	+	Silent	SNP	G	G	A			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chrX:135318419G>A	ENST00000316077.9	-	7	940	c.720C>T	c.(718-720)gcC>gcT	p.A240A	MAP7D3_ENST00000370661.1_Silent_p.A205A|MAP7D3_ENST00000370663.5_Silent_p.A222A	NM_024597.3	NP_078873.2	Q8IWC1	MA7D3_HUMAN	MAP7 domain containing 3	240					microtubule cytoskeleton organization (GO:0000226)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(1)	44	Acute lymphoblastic leukemia(192;0.000127)					GCTTCCTTTCGGCTTGTTCTT	0.333																																					p.A240A		Atlas-SNP	.											.	MAP7D3	102	.	0			c.C720T						.						99.0	89.0	92.0					X																	135318419		1824	4070	5894	SO:0001819	synonymous_variant	79649	exon7			CCTTTCGGCTTGT	AL832120	CCDS44004.1, CCDS55508.1, CCDS55509.1	Xq26.3	2014-08-13			ENSG00000129680	ENSG00000129680			25742	protein-coding gene	gene with protein product		300930				24927501	Standard	NM_001173516		Approved	FLJ12649	uc004ezt.3	Q8IWC1	OTTHUMG00000022507	ENST00000316077.9:c.720C>T	chrX.hg19:g.135318419G>A		61.0	0.0		60.0	6.0	NM_024597	A2A2J0|A6NCZ7|A6NHR4|B4DWD2|H7BY77|Q5JXI5|Q5JXI6|Q6P2S1|Q9H9M8	Silent	SNP	ENST00000316077.9	hg19	CCDS44004.1																																																																																			.	.		0.333	MAP7D3-001	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058487.2		
ATP2B3	492	hgsc.bcm.edu	37	X	152815622	152815622	+	Missense_Mutation	SNP	A	A	C			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chrX:152815622A>C	ENST00000349466.2	+	11	2027	c.1701A>C	c.(1699-1701)gaA>gaC	p.E567D	ATP2B3_ENST00000370186.1_Missense_Mutation_p.E553D|ATP2B3_ENST00000370181.2_Missense_Mutation_p.E553D|ATP2B3_ENST00000263519.4_Missense_Mutation_p.E567D|ATP2B3_ENST00000393842.1_Missense_Mutation_p.E553D|ATP2B3_ENST00000359149.3_Missense_Mutation_p.E567D			Q16720	AT2B3_HUMAN	ATPase, Ca++ transporting, plasma membrane 3	567					blood coagulation (GO:0007596)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			NS(2)|breast(5)|endometrium(7)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(3)	50	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					AGATCCCGGAAGACAAGCTTT	0.617																																					p.E567D		Atlas-SNP	.											.	ATP2B3	552	.	0			c.A1701C						.						107.0	76.0	86.0					X																	152815622		2203	4300	6503	SO:0001583	missense	492	exon10			CCCGGAAGACAAG	U60414	CCDS14722.1, CCDS35440.1	Xq28	2014-07-18			ENSG00000067842	ENSG00000067842	3.6.3.8	"""ATPases / P-type"""	816	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 3"", ""cilia and flagella associated protein 39"""	300014	"""spinocerebellar ataxia, X-linked 1"", ""cerebellar ataxia 2 (X-linked)"""	SCAX1, CLA2		8187550, 22912398	Standard	NM_021949		Approved	PMCA3, CFAP39	uc004fht.1	Q16720	OTTHUMG00000024202	ENST00000349466.2:c.1701A>C	chrX.hg19:g.152815622A>C	ENSP00000343886:p.Glu567Asp	69.0	0.0		95.0	83.0	NM_001001344	B7WNR8|B7WNY5|Q12995|Q16858	Missense_Mutation	SNP	ENST00000349466.2	hg19	CCDS35440.1	.	.	.	.	.	.	.	.	.	.	a	20.7	4.032583	0.75504	.	.	ENSG00000067842	ENST00000370186;ENST00000349466;ENST00000393842;ENST00000359149;ENST00000263519;ENST00000370181	D;D;D;D;D;D	0.95980	-3.87;-3.87;-3.87;-3.87;-3.87;-3.87	5.02	1.32	0.21799	ATPase, cation-transporting, domain N (1);Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.111235	0.64402	D	0.000010	D	0.93148	0.7818	L	0.46885	1.475	0.40141	D	0.976836	P;P	0.51351	0.637;0.944	P;P	0.49085	0.515;0.6	D	0.90074	0.4165	10	0.59425	D	0.04	-17.8623	7.2612	0.26203	0.3555:0.0:0.6445:0.0	.	567;567	Q16720;Q16720-2	AT2B3_HUMAN;.	D	553;567;553;567;567;553	ENSP00000359205:E553D;ENSP00000343886:E567D;ENSP00000377425:E553D;ENSP00000352062:E567D;ENSP00000263519:E567D;ENSP00000359200:E553D	ENSP00000263519:E567D	E	+	3	2	ATP2B3	152468816	0.959000	0.32827	0.780000	0.31762	0.876000	0.50452	0.117000	0.15583	0.155000	0.19261	0.480000	0.44947	GAA	.	.		0.617	ATP2B3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060957.1	NM_021949	
GRB14	2888	hgsc.bcm.edu	37	2	165350963	165350964	+	Frame_Shift_Ins	INS	-	-	T			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr2:165350963_165350964insT	ENST00000263915.3	-	13	1991_1992	c.1453_1454insA	c.(1453-1455)atafs	p.I485fs	GRB14_ENST00000543549.1_Frame_Shift_Ins_p.I398fs|GRB14_ENST00000497306.1_Intron	NM_004490.2	NP_004481.2	Q14449	GRB14_HUMAN	growth factor receptor-bound protein 14	485	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				blood coagulation (GO:0007596)|leukocyte migration (GO:0050900)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			breast(3)|endometrium(2)|large_intestine(6)|lung(10)|ovary(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	32						AAAGTGCTTTATTTTTTGTCCA	0.332																																					p.I485fs		Atlas-INDEL	.											.	GRB14	73	.	0			c.1454_1455insA						.																																			SO:0001589	frameshift_variant	2888	exon13			.		CCDS2222.1	2q22-q24	2013-02-14			ENSG00000115290	ENSG00000115290		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4565	protein-coding gene	gene with protein product		601524				8812444	Standard	XM_005246477		Approved		uc002ucl.3	Q14449	OTTHUMG00000132135	ENST00000263915.3:c.1454dupA	chr2.hg19:g.165350969_165350969dupT	ENSP00000263915:p.Ile485fs	209.0	0.0		295.0	51.0	NM_004490	B7Z7F9|Q7Z6I1	Frame_Shift_Ins	INS	ENST00000263915.3	hg19	CCDS2222.1																																																																																			.	.		0.332	GRB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255180.2		
SRSF11	9295	hgsc.bcm.edu	37	1	70716344	70716345	+	Frame_Shift_Ins	INS	-	-	A			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr1:70716344_70716345insA	ENST00000370950.3	+	13	1393_1394	c.1311_1312insA	c.(1312-1314)aaafs	p.K438fs	SRSF11_ENST00000405432.1_Frame_Shift_Ins_p.K438fs|SRSF11_ENST00000370949.1_Frame_Shift_Ins_p.K378fs|SRSF11_ENST00000484162.1_3'UTR|SRSF11_ENST00000370951.1_Frame_Shift_Ins_p.K437fs			Q05519	SRS11_HUMAN	serine/arginine-rich splicing factor 11	438					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			large_intestine(3)|ovary(2)|skin(1)	6						GTGAGAAAGAGAAAAAAGAAGA	0.371																																					p.E437fs		Atlas-INDEL	.											.	SRSF11	68	.	0			c.1311_1312insA						.																																			SO:0001589	frameshift_variant	9295	exon13			.	M74002	CCDS647.1, CCDS53332.1	1p31.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000116754	ENSG00000116754		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10782	protein-coding gene	gene with protein product	"""SR splicing factor 11"""	602010	"""splicing factor, arginine/serine-rich 11"""	SFRS11		1896467, 20516191	Standard	NM_004768		Approved	p54, NET2	uc001des.3	Q05519	OTTHUMG00000009342	ENST00000370950.3:c.1317dupA	chr1.hg19:g.70716350_70716350dupA	ENSP00000359988:p.Lys438fs	181.0	0.0		234.0	89.0	NM_004768	Q5T758|Q8IWE6	Frame_Shift_Ins	INS	ENST00000370950.3	hg19	CCDS647.1																																																																																			.	.		0.371	SRSF11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000025889.1	NM_004768	
LCAT	3931	hgsc.bcm.edu	37	16	67976467	67976468	+	Frame_Shift_Ins	INS	-	-	CC			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr16:67976467_67976468insCC	ENST00000264005.5	-	5	575_576	c.546_547insGG	c.(544-549)cgcaagfs	p.K183fs	CTC-479C5.17_ENST00000590594.1_lincRNA	NM_000229.1	NP_000220.1	P04180	LCAT_HUMAN	lecithin-cholesterol acyltransferase	183					cholesterol esterification (GO:0034435)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|high-density lipoprotein particle remodeling (GO:0034375)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein metabolic process (GO:0042157)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|regulation of high-density lipoprotein particle assembly (GO:0090107)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|very-low-density lipoprotein particle remodeling (GO:0034372)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)	apolipoprotein A-I binding (GO:0034186)|phosphatidylcholine-sterol O-acyltransferase activity (GO:0004607)			cervix(4)|endometrium(4)|large_intestine(1)|lung(6)|ovary(1)	16		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00418)|Epithelial(162;0.0183)|all cancers(182;0.12)		CCTGCGAGCTTGCGGTAGTACT	0.634																																					p.K183fs		Atlas-INDEL	.											.	LCAT	31	.	0			c.547_548insGG						.																																			SO:0001589	frameshift_variant	3931	exon5			.		CCDS10854.1	16q22.1	2012-10-02			ENSG00000213398	ENSG00000213398	2.3.1.43		6522	protein-coding gene	gene with protein product		606967					Standard	NM_000229		Approved		uc002euy.1	P04180	OTTHUMG00000137551	ENST00000264005.5:c.546_547insGG	chr16.hg19:g.67976467_67976468insCC	ENSP00000264005:p.Lys183fs	146.0	0.0		152.0	45.0	NM_000229	Q53XQ3	Frame_Shift_Ins	INS	ENST00000264005.5	hg19	CCDS10854.1																																																																																			.	.		0.634	LCAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268885.3		
CRH	1392	hgsc.bcm.edu	37	8	67089349	67089363	+	In_Frame_Del	DEL	GCAGCAGCAGCTGCT	GCAGCAGCAGCTGCT	-			TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	GCAGCAGCAGCTGCT	GCAGCAGCAGCTGCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr8:67089349_67089363delGCAGCAGCAGCTGCT	ENST00000276571.3	-	2	796_810	c.350_364delAGCAGCTGCTGCTGC	c.(349-366)cagcagctgctgctgcct>cct	p.QQLLL117del		NM_000756.2	NP_000747.1	P06850	CRF_HUMAN	corticotropin releasing hormone	117					adrenal gland development (GO:0030325)|associative learning (GO:0008306)|cellular response to cocaine (GO:0071314)|cellular response to dexamethasone stimulus (GO:0071549)|diterpenoid metabolic process (GO:0016101)|feeding behavior (GO:0007631)|female pregnancy (GO:0007565)|ferulate metabolic process (GO:0033494)|glucocorticoid biosynthetic process (GO:0006704)|hormone-mediated apoptotic signaling pathway (GO:0008628)|hypothalamus development (GO:0021854)|inflammatory response (GO:0006954)|ion homeostasis (GO:0050801)|learning or memory (GO:0007611)|locomotory exploration behavior (GO:0035641)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|lung development (GO:0030324)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell death (GO:0060548)|negative regulation of circadian sleep/wake cycle, REM sleep (GO:0042322)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of gene expression (GO:0010629)|negative regulation of glucagon secretion (GO:0070093)|negative regulation of luteinizing hormone secretion (GO:0033685)|negative regulation of norepinephrine secretion (GO:0010700)|parturition (GO:0007567)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell death (GO:0010942)|positive regulation of cell proliferation (GO:0008284)|positive regulation of circadian sleep/wake cycle, wakefulness (GO:0010841)|positive regulation of corticosterone secretion (GO:2000854)|positive regulation of corticotropin secretion (GO:0051461)|positive regulation of cortisol secretion (GO:0051464)|positive regulation of digestive system process (GO:0060456)|positive regulation of gene expression (GO:0010628)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of protein phosphorylation (GO:0001934)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of serotonin secretion (GO:0014062)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to ether (GO:0045472)|response to immobilization stress (GO:0035902)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, dopaminergic (GO:0001963)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|perikaryon (GO:0043204)|varicosity (GO:0043196)	hormone activity (GO:0005179)|neuropeptide hormone activity (GO:0005184)|receptor binding (GO:0005102)			breast(1)|endometrium(1)|lung(2)|urinary_tract(1)	5		all_cancers(86;2.58e-06)|all_epithelial(80;6.27e-09)|all_lung(136;0.000414)|Lung NSC(129;0.0011)	Epithelial(68;0.0136)|all cancers(69;0.0507)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)		Corticotropin(DB01285)	GAGCGCCGAGGCAGCAGCAGCTGCTGCAGCAACAC	0.726											OREG0018805	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.117_122del		Atlas-INDEL	.											.	CRH	8	.	0			c.351_365del						.																																			SO:0001651	inframe_deletion	1392	exon2			.		CCDS6188.1	8q13	2013-02-25				ENSG00000147571		"""Endogenous ligands"""	2355	protein-coding gene	gene with protein product	"""corticotropin-releasing factor"", ""corticoliberin"""	122560					Standard	NM_000756		Approved	CRF	uc003xvy.2	P06850		ENST00000276571.3:c.350_364delAGCAGCTGCTGCTGC	chr8.hg19:g.67089349_67089363delGCAGCAGCAGCTGCT	ENSP00000276571:p.Gln117_Leu121del	51.0	0.0	1096	54.0	20.0	NM_000756	B3KQS4	In_Frame_Del	DEL	ENST00000276571.3	hg19	CCDS6188.1																																																																																			.	.		0.726	CRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378926.1	NM_000756	
AGA	175	hgsc.bcm.edu	37	4	178355598	178355598	+	Frame_Shift_Del	DEL	G	G	-	rs148052291	byFrequency	TCGA-XR-A8TG-01A-11D-A35Z-10	TCGA-XR-A8TG-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81b78069-7129-494c-9209-e00ecf75cced	110d65ad-5d6c-4db6-beb6-720ee7d7b871	g.chr4:178355598delG	ENST00000264595.2	-	7	871	c.744delC	c.(742-744)gacfs	p.D249fs	AGA_ENST00000506853.1_5'UTR	NM_000027.3|NM_001171988.1	NP_000018.2|NP_001165459.1	P20933	ASPG_HUMAN	aspartylglucosaminidase	249					protein deglycosylation (GO:0006517)|protein maturation (GO:0051604)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	N4-(beta-N-acetylglucosaminyl)-L-asparaginase activity (GO:0003948)|peptidase activity (GO:0008233)	p.D248D(1)		endometrium(1)|kidney(2)|large_intestine(6)|lung(5)|skin(2)	16		all_lung(41;1.27e-09)|Lung NSC(41;1.1e-08)|Breast(14;6.27e-05)|Melanoma(52;0.00102)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Hepatocellular(41;0.148)|all_neural(102;0.164)|Colorectal(36;0.245)		all cancers(43;1.37e-22)|Epithelial(43;3.86e-20)|OV - Ovarian serous cystadenocarcinoma(60;3.8e-11)|Colorectal(24;6.98e-05)|GBM - Glioblastoma multiforme(59;0.000362)|COAD - Colon adenocarcinoma(29;0.000462)|STAD - Stomach adenocarcinoma(60;0.0029)|LUSC - Lung squamous cell carcinoma(193;0.0328)|READ - Rectum adenocarcinoma(43;0.163)		CTGCAGTATCGTCAGCATAGG	0.468																																					p.D249fs		Atlas-INDEL	.											.	AGA	39	.	1	Substitution - coding silent(1)	large_intestine(1)	c.745delG						.						111.0	105.0	107.0					4																	178355598		2203	4300	6503	SO:0001589	frameshift_variant	175	exon7			.	X55330	CCDS3829.1	4q34.3	2014-06-23			ENSG00000038002	ENSG00000038002	3.5.1.26		318	protein-coding gene	gene with protein product	"""glycosylasparaginase"", ""N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase"""	613228					Standard	NM_000027		Approved	ASRG	uc003iuu.2	P20933	OTTHUMG00000160723	ENST00000264595.2:c.744delC	chr4.hg19:g.178355598delG	ENSP00000264595:p.Asp249fs	197.0	0.0		386.0	119.0	NM_000027	B2R7H2|D3DP47|Q4W5Q2|Q6FHN6|Q9UCK6|Q9UCK7|Q9UCK8	Frame_Shift_Del	DEL	ENST00000264595.2	hg19	CCDS3829.1																																																																																			.	.		0.468	AGA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361916.1	NM_000027	
