#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CSMD2	114784	hgsc.bcm.edu	37	1	34291374	34291374	+	Splice_Site	SNP	G	G	T			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr1:34291374G>T	ENST00000373381.4	-	7	1211	c.1035C>A	c.(1033-1035)gtC>gtA	p.V345V		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	305	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TTTGCTTCTTGACTAGAGAGG	0.517																																					p.V305V		Atlas-SNP	.											.	CSMD2	946	.	0			c.C915A						.						96.0	72.0	80.0					1																	34291374		2203	4300	6503	SO:0001630	splice_region_variant	114784	exon7			CTTCTTGACTAGA	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.1034-1C>A	chr1.hg19:g.34291374G>T		33.0	0.0		46.0	19.0	NM_052896	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Silent	SNP	ENST00000373381.4	hg19																																																																																				.	.		0.517	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896	Silent
REG4	83998	hgsc.bcm.edu	37	1	120345731	120345731	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr1:120345731T>C	ENST00000354219.1	-	4	564	c.125A>G	c.(124-126)tAt>tGt	p.Y42C	REG4_ENST00000256585.5_Missense_Mutation_p.Y42C|REG4_ENST00000530654.1_Missense_Mutation_p.Y42C|REG4_ENST00000369401.4_Missense_Mutation_p.Y42C	NM_001159352.1	NP_001152824.1	Q9BYZ8	REG4_HUMAN	regenerating islet-derived family, member 4	42	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					cytoplasm (GO:0005737)|extracellular region (GO:0005576)	heparin binding (GO:0008201)|mannan binding (GO:2001065)			central_nervous_system(1)|large_intestine(1)|lung(8)|ovary(2)|prostate(1)|skin(2)	15	all_cancers(5;4.81e-10)|all_epithelial(5;7.98e-11)|Melanoma(3;1.93e-05)|Breast(55;0.218)|all_neural(166;0.219)	all_lung(203;8.1e-07)|Lung NSC(69;5.89e-06)|all_epithelial(167;0.000959)		Lung(183;0.011)|LUSC - Lung squamous cell carcinoma(189;0.0588)		GAAGTAACCATAGCAATTGGA	0.473																																					p.Y42C		Atlas-SNP	.											.	REG4	36	.	0			c.A125G						.						73.0	66.0	68.0					1																	120345731		2203	4300	6503	SO:0001583	missense	83998	exon3			TAACCATAGCAAT	AY007243	CCDS906.1, CCDS53354.1	1p13.1-p12	2008-02-05			ENSG00000134193	ENSG00000134193			22977	protein-coding gene	gene with protein product	"""regenerating gene type IV"", "" gastrointestinal secretory protein"""	609846				11311942, 12455032	Standard	NM_032044		Approved	REG-IV, RELP, GISP	uc001eif.3	Q9BYZ8	OTTHUMG00000012175	ENST00000354219.1:c.125A>G	chr1.hg19:g.120345731T>C	ENSP00000346158:p.Tyr42Cys	128.0	0.0		141.0	43.0	NM_001159353	Q8NER6|Q8NER7	Missense_Mutation	SNP	ENST00000354219.1	hg19	CCDS906.1	.	.	.	.	.	.	.	.	.	.	T	13.93	2.384577	0.42308	.	.	ENSG00000134193	ENST00000354219;ENST00000256585;ENST00000369402;ENST00000530654;ENST00000369401	T;T;T;T	0.42513	1.64;1.64;0.97;0.97	5.08	5.08	0.68730	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (2);	0.096438	0.45361	D	0.000376	T	0.69169	0.3081	H	0.97051	3.93	0.39594	D	0.969624	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.79736	-0.1678	10	0.87932	D	0	-17.0463	11.2157	0.48825	0.0:0.0:0.0:1.0	.	42;42	Q9BYZ8-2;Q9BYZ8	.;REG4_HUMAN	C	42	ENSP00000346158:Y42C;ENSP00000256585:Y42C;ENSP00000437135:Y42C;ENSP00000358409:Y42C	ENSP00000256585:Y42C	Y	-	2	0	REG4	120147254	0.930000	0.31532	0.994000	0.49952	0.156000	0.22039	1.373000	0.34272	2.145000	0.66743	0.529000	0.55759	TAT	.	.		0.473	REG4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033675.1	NM_032044	
DISP1	84976	hgsc.bcm.edu	37	1	223177664	223177664	+	Missense_Mutation	SNP	C	C	A			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr1:223177664C>A	ENST00000284476.6	+	8	3089	c.2925C>A	c.(2923-2925)gaC>gaA	p.D975E		NM_032890.3	NP_116279.2	Q96F81	DISP1_HUMAN	dispatched homolog 1 (Drosophila)	975					determination of left/right symmetry (GO:0007368)|diaphragm development (GO:0060539)|dorsal/ventral pattern formation (GO:0009953)|embryonic pattern specification (GO:0009880)|patched ligand maturation (GO:0007225)|peptide transport (GO:0015833)|protein homotrimerization (GO:0070207)|regulation of protein secretion (GO:0050708)|smoothened signaling pathway (GO:0007224)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)|peptide transporter activity (GO:0015197)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(20)|lung(25)|prostate(4)|skin(1)|stomach(1)|urinary_tract(5)	69				GBM - Glioblastoma multiforme(131;0.102)		AGTTCTATGACCTCCAGGATA	0.498																																					p.D975E		Atlas-SNP	.											.	DISP1	145	.	0			c.C2925A						.						77.0	65.0	69.0					1																	223177664		2203	4300	6503	SO:0001583	missense	84976	exon10			CTATGACCTCCAG	AK056569	CCDS1536.1	1q42.12	2008-02-05			ENSG00000154309	ENSG00000154309			19711	protein-coding gene	gene with protein product		607502				10619433	Standard	NM_032890		Approved	DISPA, MGC13130, DKFZP434I0428, MGC16796	uc001hnu.2	Q96F81	OTTHUMG00000037893	ENST00000284476.6:c.2925C>A	chr1.hg19:g.223177664C>A	ENSP00000284476:p.Asp975Glu	76.0	0.0		142.0	12.0	NM_032890	Q8N7C2|Q96I92|Q9H698|Q9H8H9|Q9UFA2	Missense_Mutation	SNP	ENST00000284476.6	hg19	CCDS1536.1	.	.	.	.	.	.	.	.	.	.	C	16.91	3.252200	0.59212	.	.	ENSG00000154309	ENST00000284476	D	0.91068	-2.78	5.58	4.47	0.54385	.	0.000000	0.85682	D	0.000000	D	0.88058	0.6335	N	0.12887	0.27	0.51012	D	0.999906	P	0.49696	0.927	P	0.58620	0.842	D	0.86197	0.1616	10	0.27082	T	0.32	-48.6543	14.3147	0.66440	0.0:0.8739:0.0:0.1261	.	975	Q96F81	DISP1_HUMAN	E	975	ENSP00000284476:D975E	ENSP00000284476:D975E	D	+	3	2	DISP1	221244287	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.521000	0.45563	2.639000	0.89480	0.491000	0.48974	GAC	.	.		0.498	DISP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092512.1	NM_032890	
TUBA3E	112714	hgsc.bcm.edu	37	2	130951447	130951447	+	Missense_Mutation	SNP	A	A	G			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr2:130951447A>G	ENST00000312988.7	-	4	1068	c.968T>C	c.(967-969)gTg>gCg	p.V323A		NM_207312.2	NP_997195	Q6PEY2	TBA3E_HUMAN	tubulin, alpha 3e	323					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			endometrium(4)|kidney(7)|large_intestine(6)|lung(9)|skin(2)	28	Colorectal(110;0.1)					TTTGGGGACCACGTCCCCCCT	0.552																																					p.V323A		Atlas-SNP	.											.	TUBA3E	73	.	0			c.T968C						.						154.0	133.0	140.0					2																	130951447		2203	4300	6503	SO:0001583	missense	112714	exon4			GGGACCACGTCCC	BC057811	CCDS2158.1	2q21.1	2007-03-16			ENSG00000152086	ENSG00000152086		"""Tubulins"""	20765	protein-coding gene	gene with protein product							Standard	NM_207312		Approved		uc002tqv.3	Q6PEY2	OTTHUMG00000131626	ENST00000312988.7:c.968T>C	chr2.hg19:g.130951447A>G	ENSP00000318197:p.Val323Ala	92.0	0.0		128.0	32.0	NM_207312		Missense_Mutation	SNP	ENST00000312988.7	hg19	CCDS2158.1	.	.	.	.	.	.	.	.	.	.	a	13.77	2.334877	0.41297	.	.	ENSG00000152086	ENST00000312988	D	0.86030	-2.06	2.96	2.96	0.34315	Tubulin/FtsZ, 2-layer sandwich domain (3);Tubulin/FtsZ, C-terminal (1);	0.000000	0.44902	U	0.000418	D	0.94565	0.8249	H	0.98295	4.195	0.45528	D	0.998487	D	0.89917	1.0	D	0.97110	1.0	D	0.94373	0.7597	10	0.87932	D	0	.	9.3032	0.37858	1.0:0.0:0.0:0.0	.	323	Q6PEY2	TBA3E_HUMAN	A	323	ENSP00000318197:V323A	ENSP00000318197:V323A	V	-	2	0	TUBA3E	130667917	1.000000	0.71417	0.993000	0.49108	0.718000	0.41266	7.867000	0.87062	1.363000	0.46019	0.374000	0.22700	GTG	.	.		0.552	TUBA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254519.1	NM_207312	
DNAH7	56171	hgsc.bcm.edu	37	2	196825326	196825326	+	Missense_Mutation	SNP	C	C	A	rs374382600		TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr2:196825326C>A	ENST00000312428.6	-	18	2649	c.2549G>T	c.(2548-2550)cGc>cTc	p.R850L		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	850	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						GTGCCTGGGGCGCAAACCAGG	0.453																																					p.R850L		Atlas-SNP	.											.	DNAH7	512	.	0			c.G2549T						.						123.0	125.0	125.0					2																	196825326		1936	4131	6067	SO:0001583	missense	56171	exon18			CTGGGGCGCAAAC	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.2549G>T	chr2.hg19:g.196825326C>A	ENSP00000311273:p.Arg850Leu	89.0	0.0		111.0	33.0	NM_018897	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	ENST00000312428.6	hg19	CCDS42794.1	.	.	.	.	.	.	.	.	.	.	C	15.60	2.882636	0.51908	.	.	ENSG00000118997	ENST00000312428	T	0.62941	-0.01	5.74	3.93	0.45458	Dynein heavy chain, domain-2 (1);	0.125121	0.53938	D	0.000044	T	0.73860	0.3641	M	0.87758	2.905	0.80722	D	1	P	0.52316	0.952	P	0.56700	0.804	T	0.75811	-0.3186	10	0.59425	D	0.04	.	6.4969	0.22148	0.0:0.6773:0.1768:0.1459	.	850	Q8WXX0	DYH7_HUMAN	L	850	ENSP00000311273:R850L	ENSP00000311273:R850L	R	-	2	0	DNAH7	196533571	0.943000	0.32029	1.000000	0.80357	0.961000	0.63080	2.036000	0.41165	1.417000	0.47077	-0.172000	0.13284	CGC	.	.		0.453	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897	
EPHA4	2043	hgsc.bcm.edu	37	2	222365844	222365844	+	Missense_Mutation	SNP	G	G	C			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr2:222365844G>C	ENST00000281821.2	-	4	913	c.872C>G	c.(871-873)gCc>gGc	p.A291G	EPHA4_ENST00000409938.1_Missense_Mutation_p.A291G|EPHA4_ENST00000392071.4_Missense_Mutation_p.A240G|EPHA4_ENST00000409854.1_Missense_Mutation_p.A291G	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4	291	Cys-rich.				adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		TGGGCACTTGGCACAGGTGGC	0.507																																					p.A291G		Atlas-SNP	.											.	EPHA4	263	.	0			c.C872G						.						91.0	82.0	85.0					2																	222365844		2203	4300	6503	SO:0001583	missense	2043	exon4			CACTTGGCACAGG	L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.872C>G	chr2.hg19:g.222365844G>C	ENSP00000281821:p.Ala291Gly	69.0	0.0		104.0	6.0	NM_004438	A8K2P1|B2R601|B7Z6Q8|Q2M380	Missense_Mutation	SNP	ENST00000281821.2	hg19	CCDS2447.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.59|15.59	2.880025|2.880025	0.51801|0.51801	.|.	.|.	ENSG00000116106|ENSG00000116106	ENST00000281821;ENST00000409854;ENST00000409938;ENST00000392071|ENST00000441679	T;T;T;T|.	0.50001|.	0.76;0.76;0.76;0.76|.	6.07|6.07	6.07|6.07	0.98685|0.98685	.|.	0.103168|.	0.64402|.	D|.	0.000003|.	T|T	0.59197|0.59197	0.2176|0.2176	N|N	0.26130|0.26130	0.795|0.795	0.46499|0.46499	D|D	0.999074|0.999074	B|.	0.02656|.	0.0|.	B|.	0.04013|.	0.001|.	T|T	0.49899|0.49899	-0.8890|-0.8890	10|5	0.30078|.	T|.	0.28|.	.|.	20.6439|20.6439	0.99570|0.99570	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	291|.	P54764|.	EPHA4_HUMAN|.	G|A	291;291;291;240|28	ENSP00000281821:A291G;ENSP00000386276:A291G;ENSP00000386829:A291G;ENSP00000375923:A240G|.	ENSP00000281821:A291G|.	A|P	-|-	2|1	0|0	EPHA4|EPHA4	222074088|222074088	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.655000|7.655000	0.83696|0.83696	2.884000|2.884000	0.98904|0.98904	0.655000|0.655000	0.94253|0.94253	GCC|CCA	.	.		0.507	EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256836.3		
COL4A3	1285	hgsc.bcm.edu	37	2	228147228	228147228	+	Missense_Mutation	SNP	C	C	T	rs368342782		TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr2:228147228C>T	ENST00000396578.3	+	32	2798	c.2636C>T	c.(2635-2637)cCg>cTg	p.P879L	AC097662.2_ENST00000439598.2_RNA|AC097662.2_ENST00000396588.2_RNA|AC097662.2_ENST00000433324.1_RNA	NM_000091.4	NP_000082.2	Q01955	CO4A3_HUMAN	collagen, type IV, alpha 3 (Goodpasture antigen)	879	Triple-helical region.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|blood circulation (GO:0008015)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|collagen catabolic process (GO:0030574)|endothelial cell apoptotic process (GO:0072577)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|sensory perception of sound (GO:0007605)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metalloendopeptidase inhibitor activity (GO:0008191)|structural molecule activity (GO:0005198)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)		CCAGGAAATCCGGGAATTTTA	0.428													C|||	1	0.000199681	0.0	0.0	5008	,	,		3728	0.0		0.0	False		,,,				2504	0.001				p.P879L		Atlas-SNP	.											.	COL4A3	293	.	0			c.C2636T						.	C	LEU/PRO	1,3727		0,1,1863	129.0	126.0	127.0		2636	4.0	0.8	2		127	0,8186		0,0,4093	no	missense	COL4A3	NM_000091.4	98	0,1,5956	TT,TC,CC		0.0,0.0268,0.0084	probably-damaging	879/1671	228147228	1,11913	1864	4093	5957	SO:0001583	missense	1285	exon32			GAAATCCGGGAAT		CCDS42829.1	2q36-q37	2014-09-17			ENSG00000169031	ENSG00000169031		"""Collagens"""	2204	protein-coding gene	gene with protein product	"""tumstatin"""	120070				1737849	Standard	NM_000091		Approved		uc002vom.2	Q01955	OTTHUMG00000149891	ENST00000396578.3:c.2636C>T	chr2.hg19:g.228147228C>T	ENSP00000379823:p.Pro879Leu	171.0	0.0		191.0	58.0	NM_000091	Q53QQ1|Q53R14|Q53RW8|Q9BQT2|Q9NYC4|Q9UDJ9|Q9UDK9|Q9UDL0|Q9UDL1	Missense_Mutation	SNP	ENST00000396578.3	hg19	CCDS42829.1	.	.	.	.	.	.	.	.	.	.	C	11.60	1.687028	0.29962	2.68E-4	0.0	ENSG00000169031	ENST00000396578;ENST00000328380;ENST00000335583;ENST00000396574;ENST00000315699	D	0.96685	-4.09	5.93	4.01	0.46588	.	0.208090	0.34178	N	0.004188	D	0.97359	0.9136	M	0.83953	2.67	0.58432	D	0.999999	D;D;D;D	0.69078	0.996;0.996;0.996;0.997	P;P;P;P	0.58077	0.742;0.797;0.742;0.832	D	0.97583	1.0112	10	0.72032	D	0.01	.	12.3675	0.55236	0.3057:0.6943:0.0:0.0	.	879;879;879;879	Q01955-5;Q01955-4;Q01955-2;Q01955	.;.;.;CO4A3_HUMAN	L	879	ENSP00000379823:P879L	ENSP00000323334:P879L	P	+	2	0	COL4A3	227855472	0.845000	0.29573	0.755000	0.31263	0.142000	0.21351	1.575000	0.36493	1.491000	0.48482	0.655000	0.94253	CCG	.	.		0.428	COL4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331409.2	NM_000091	
DIS3L2	129563	hgsc.bcm.edu	37	2	233001275	233001275	+	Missense_Mutation	SNP	G	G	T			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr2:233001275G>T	ENST00000409307.1	+	7	796	c.796G>T	c.(796-798)Gcc>Tcc	p.A266S	DIS3L2_ENST00000360410.4_Silent_p.T285T|DIS3L2_ENST00000325385.7_Missense_Mutation_p.A266S|DIS3L2_ENST00000273009.6_Missense_Mutation_p.A266S					DIS3 like 3'-5' exoribonuclease 2											breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(18)|ovary(1)|prostate(2)|urinary_tract(1)	40		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)		TAGGAAATACGCCCTGTTTTC	0.468																																					p.A266S		Atlas-SNP	.											.	DIS3L2	77	.	0			c.G796T						.						190.0	177.0	181.0					2																	233001275		1890	4124	6014	SO:0001583	missense	129563	exon8			AAATACGCCCTGT	BC026166	CCDS42834.1, CCDS58752.1, CCDS58753.1	2q37.1	2014-09-17	2014-03-05		ENSG00000144535	ENSG00000144535			28648	protein-coding gene	gene with protein product		614184	"""family with sequence similarity 6, member A"", ""DIS3 mitotic control homolog (S. cerevisiae)-like 2"""	FAM6A		22306653, 23503588	Standard	NM_152383		Approved	FLJ36974, MGC42174	uc010fxz.3	Q8IYB7	OTTHUMG00000153385	ENST00000409307.1:c.796G>T	chr2.hg19:g.233001275G>T	ENSP00000386799:p.Ala266Ser	143.0	0.0		168.0	60.0	NM_152383		Missense_Mutation	SNP	ENST00000409307.1	hg19	CCDS42834.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.829740	0.91036	.	.	ENSG00000144535	ENST00000273009;ENST00000542873;ENST00000325385;ENST00000431466;ENST00000409307	T;T;T	0.28069	1.63;1.84;1.84	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.43322	0.1242	M	0.69185	2.1	0.80722	D	1	P	0.39071	0.658	B	0.43082	0.407	T	0.12016	-1.0564	10	0.40728	T	0.16	-20.8641	20.6525	0.99598	0.0:0.0:1.0:0.0	.	266	Q8IYB7	DI3L2_HUMAN	S	266	ENSP00000273009:A266S;ENSP00000315569:A266S;ENSP00000386799:A266S	ENSP00000273009:A266S	A	+	1	0	DIS3L2	232709519	1.000000	0.71417	0.987000	0.45799	0.946000	0.59487	8.025000	0.88777	2.890000	0.99128	0.585000	0.79938	GCC	.	.		0.468	DIS3L2-015	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330988.1	NM_152383	
OR6B2	389090	hgsc.bcm.edu	37	2	240969050	240969050	+	Missense_Mutation	SNP	T	T	A			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr2:240969050T>A	ENST00000402971.2	-	1	856	c.797A>T	c.(796-798)gAt>gTt	p.D266V		NM_001005853.1	NP_001005853.1	Q6IFH4	OR6B2_HUMAN	olfactory receptor, family 6, subfamily B, member 2	266						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(4)|lung(9)|prostate(1)	15		all_epithelial(40;1.64e-11)|Breast(86;0.000327)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.229)|Melanoma(123;0.238)		Epithelial(121;3.4e-29)|all cancers(36;2.08e-27)|OV - Ovarian serous cystadenocarcinoma(60;4.63e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.56e-05)|Lung(119;0.00344)|LUSC - Lung squamous cell carcinoma(224;0.0148)		GCTCTGGGAATCAATGGCTTG	0.507																																					p.D266V		Atlas-SNP	.											.	OR6B2	30	.	0			c.A797T						.						85.0	87.0	87.0					2																	240969050		1991	4157	6148	SO:0001583	missense	389090	exon1			TGGGAATCAATGG		CCDS46559.1	2q37.3	2012-08-09	2004-10-07	2004-10-07	ENSG00000182083	ENSG00000182083		"""GPCR / Class A : Olfactory receptors"""	15041	protein-coding gene	gene with protein product			"""olfactory receptor, family 6, subfamily B, member 2 pseudogene"""	OR6B2P			Standard	XM_005247004		Approved		uc010zoc.2	Q6IFH4	OTTHUMG00000152400	ENST00000402971.2:c.797A>T	chr2.hg19:g.240969050T>A	ENSP00000384563:p.Asp266Val	260.0	0.0		315.0	118.0	NM_001005853	B2RPR3|Q8NGW0	Missense_Mutation	SNP	ENST00000402971.2	hg19	CCDS46559.1	.	.	.	.	.	.	.	.	.	.	T	6.453	0.451703	0.12223	.	.	ENSG00000182083	ENST00000402971	T	0.00130	8.69	4.36	0.181	0.15073	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47852	D	0.000204	T	0.00144	0.0004	L	0.35854	1.095	0.09310	N	0.99999	P	0.39940	0.696	B	0.41374	0.355	T	0.43245	-0.9403	10	0.46703	T	0.11	.	11.9582	0.52993	0.0:0.0:0.641:0.359	.	266	Q6IFH4	OR6B2_HUMAN	V	266	ENSP00000384563:D266V	ENSP00000384563:D266V	D	-	2	0	OR6B2	240617723	0.001000	0.12720	0.010000	0.14722	0.662000	0.39071	0.880000	0.28159	-0.051000	0.13334	0.482000	0.46254	GAT	.	.		0.507	OR6B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326079.1	NM_001005853	
KBTBD12	166348	hgsc.bcm.edu	37	3	127642185	127642185	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr3:127642185T>C	ENST00000405109.1	+	2	748	c.281T>C	c.(280-282)tTg>tCg	p.L94S	KBTBD12_ENST00000343941.4_5'Flank|KBTBD12_ENST00000405256.1_Missense_Mutation_p.L94S|KBTBD12_ENST00000407609.3_Intron			Q3ZCT8	KBTBC_HUMAN	kelch repeat and BTB (POZ) domain containing 12	94	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.									endometrium(1)|large_intestine(6)|lung(5)|ovary(1)	13						AATGCAGCTTTGGAGATCAAT	0.383																																					p.L94S		Atlas-SNP	.											.	KBTBD12	41	.	0			c.T281C						.						77.0	73.0	74.0					3																	127642185		1925	4131	6056	SO:0001583	missense	166348	exon1			CAGCTTTGGAGAT		CCDS33848.2	3q21.3	2013-01-08	2009-10-01	2009-10-01	ENSG00000187715	ENSG00000187715		"""BTB/POZ domain containing"""	25731	protein-coding gene	gene with protein product			"""kelch domain containing 6"""	KLHDC6			Standard	NM_207335		Approved	FLJ46299	uc010hsr.3	Q3ZCT8	OTTHUMG00000150508	ENST00000405109.1:c.281T>C	chr3.hg19:g.127642185T>C	ENSP00000385957:p.Leu94Ser	130.0	0.0		176.0	54.0	NM_207335	B5MCC6|Q6ZRK1	Missense_Mutation	SNP	ENST00000405109.1	hg19	CCDS33848.2	.	.	.	.	.	.	.	.	.	.	T	18.58	3.655215	0.67472	.	.	ENSG00000187715	ENST00000405109;ENST00000405256	T;T	0.71934	-0.61;-0.61	5.75	5.75	0.90469	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	.	.	.	.	D	0.85813	0.5784	M	0.84773	2.715	0.47949	D	0.99955	D	0.89917	1.0	D	0.91635	0.999	D	0.88140	0.2844	9	0.87932	D	0	.	16.0656	0.80867	0.0:0.0:0.0:1.0	.	94	Q3ZCT8	KBTBC_HUMAN	S	94	ENSP00000385957:L94S;ENSP00000385879:L94S	ENSP00000385957:L94S	L	+	2	0	KBTBD12	129124875	1.000000	0.71417	0.711000	0.30485	0.729000	0.41735	7.698000	0.84413	2.203000	0.70933	0.377000	0.23210	TTG	.	.		0.383	KBTBD12-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318682.1	NM_207335	
DNAJC13	23317	hgsc.bcm.edu	37	3	132241675	132241675	+	Nonsense_Mutation	SNP	C	C	T			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr3:132241675C>T	ENST00000260818.6	+	49	5925	c.5677C>T	c.(5677-5679)Cga>Tga	p.R1893*		NM_015268.3	NP_056083.3	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	1893					osteoblast differentiation (GO:0001649)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|urinary_tract(1)	34						CGTATAGGTTCGAATTACGTT	0.323																																					p.R1893X		Atlas-SNP	.											.	DNAJC13	253	.	0			c.C5677T						.						48.0	48.0	48.0					3																	132241675		2203	4299	6502	SO:0001587	stop_gained	23317	exon49			TAGGTTCGAATTA	AB014578	CCDS33857.1	3q22.1	2011-09-02			ENSG00000138246	ENSG00000138246		"""Heat shock proteins / DNAJ (HSP40)"""	30343	protein-coding gene	gene with protein product		614334				12438707	Standard	NM_015268		Approved	RME8, KIAA0678	uc003eor.3	O75165	OTTHUMG00000159674	ENST00000260818.6:c.5677C>T	chr3.hg19:g.132241675C>T	ENSP00000260818:p.Arg1893*	184.0	0.0		247.0	49.0	NM_015268	Q3L0T1|Q6PI82|Q6UJ77|Q6ZSW1|Q6ZUT5|Q86XG3|Q96DC1|Q9BWK9	Nonsense_Mutation	SNP	ENST00000260818.6	hg19	CCDS33857.1	.	.	.	.	.	.	.	.	.	.	C	47	13.197359	0.99726	.	.	ENSG00000138246	ENST00000260818;ENST00000538066	.	.	.	6.08	4.12	0.48240	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.459	0.27283	0.3342:0.58:0.0:0.0858	.	.	.	.	X	1893;540	.	ENSP00000260818:R1893X	R	+	1	2	DNAJC13	133724365	1.000000	0.71417	1.000000	0.80357	0.576000	0.36127	3.821000	0.55700	1.562000	0.49601	0.655000	0.94253	CGA	.	.		0.323	DNAJC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356807.2	NM_015268	
STX18	53407	hgsc.bcm.edu	37	4	4421847	4421847	+	Missense_Mutation	SNP	T	T	A			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr4:4421847T>A	ENST00000306200.2	-	11	985	c.922A>T	c.(922-924)Aac>Tac	p.N308Y	STX18_ENST00000505286.1_Intron	NM_016930.2	NP_058626.1	Q9P2W9	STX18_HUMAN	syntaxin 18	308				N -> D (in Ref. 2; AAS47513). {ECO:0000305}.	ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	5				UCEC - Uterine corpus endometrioid carcinoma (64;0.0534)		CCAGCGTTGTTTTTAATGGCC	0.567																																					p.N308Y		Atlas-SNP	.											.	STX18	16	.	0			c.A922T						.						71.0	62.0	65.0					4																	4421847		2203	4300	6503	SO:0001583	missense	53407	exon11			CGTTGTTTTTAAT	AB028741	CCDS3377.1	4p16.3-p16.2	2013-09-23			ENSG00000168818	ENSG00000168818			15942	protein-coding gene	gene with protein product		606046				10788491	Standard	NM_016930		Approved	Ufe1	uc003gic.3	Q9P2W9	OTTHUMG00000090331	ENST00000306200.2:c.922A>T	chr4.hg19:g.4421847T>A	ENSP00000305810:p.Asn308Tyr	50.0	0.0		64.0	22.0	NM_016930	Q596L3|Q5TZP5	Missense_Mutation	SNP	ENST00000306200.2	hg19	CCDS3377.1	.	.	.	.	.	.	.	.	.	.	T	26.0	4.690896	0.88735	.	.	ENSG00000168818	ENST00000306200	T	0.24538	1.85	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.40670	0.1126	L	0.47716	1.5	0.80722	D	1	D	0.59357	0.985	P	0.58620	0.842	T	0.25222	-1.0138	10	0.72032	D	0.01	-0.4683	15.4307	0.75092	0.0:0.0:0.0:1.0	.	308	Q9P2W9	STX18_HUMAN	Y	308	ENSP00000305810:N308Y	ENSP00000305810:N308Y	N	-	1	0	STX18	4472748	1.000000	0.71417	0.985000	0.45067	0.976000	0.68499	7.329000	0.79170	2.044000	0.60594	0.459000	0.35465	AAC	.	.		0.567	STX18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206696.1		
PPEF2	5470	hgsc.bcm.edu	37	4	76797690	76797690	+	Missense_Mutation	SNP	G	G	A			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr4:76797690G>A	ENST00000286719.7	-	11	1426	c.1070C>T	c.(1069-1071)tCg>tTg	p.S357L		NM_006239.2	NP_006230.2	O14830	PPE2_HUMAN	protein phosphatase, EF-hand calcium binding domain 2	357	Catalytic.				detection of stimulus involved in sensory perception (GO:0050906)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|protein dephosphorylation (GO:0006470)|regulation of JUN kinase activity (GO:0043506)|regulation of MAP kinase activity (GO:0043405)|visual perception (GO:0007601)	cilium (GO:0005929)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|Hsp70 protein binding (GO:0030544)|Hsp90 protein binding (GO:0051879)|iron ion binding (GO:0005506)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	50			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			CCGAAGGGGCGAAGAGGGAAG	0.617																																					p.S357L	NSCLC(105;1359 1603 15961 44567 47947)	Atlas-SNP	.											.	PPEF2	108	.	0			c.C1070T						.						65.0	66.0	66.0					4																	76797690		2203	4300	6503	SO:0001583	missense	5470	exon11			AGGGGCGAAGAGG	AF023456	CCDS34013.1	4q21.1	2013-01-10			ENSG00000156194	ENSG00000156194		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9244	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, beta isozyme"""	602256				9326663, 12051765	Standard	NM_006239		Approved	PPP7CB	uc003hix.3	O14830	OTTHUMG00000160915	ENST00000286719.7:c.1070C>T	chr4.hg19:g.76797690G>A	ENSP00000286719:p.Ser357Leu	90.0	0.0		128.0	48.0	NM_006239	O14831	Missense_Mutation	SNP	ENST00000286719.7	hg19	CCDS34013.1	.	.	.	.	.	.	.	.	.	.	G	13.35	2.210553	0.39102	.	.	ENSG00000156194	ENST00000286719;ENST00000337500	T	0.40476	1.03	4.7	3.84	0.44239	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (1);Metallophosphoesterase domain (1);	1.386770	0.04471	N	0.376022	T	0.45736	0.1357	L	0.27053	0.805	0.09310	N	1	D;D	0.63880	0.98;0.993	B;P	0.52189	0.383;0.692	T	0.44907	-0.9297	10	0.33940	T	0.23	-0.8082	12.6384	0.56696	0.0:0.168:0.832:0.0	.	357;357	O14830-2;O14830	.;PPE2_HUMAN	L	357	ENSP00000286719:S357L	ENSP00000286719:S357L	S	-	2	0	PPEF2	77016714	0.010000	0.17322	0.005000	0.12908	0.003000	0.03518	1.484000	0.35508	0.966000	0.38159	0.491000	0.48974	TCG	.	.		0.617	PPEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362929.1	NM_006239	
DSPP	1834	hgsc.bcm.edu	37	4	88536436	88536436	+	Silent	SNP	C	C	T			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr4:88536436C>T	ENST00000282478.7	+	4	2655	c.2622C>T	c.(2620-2622)agC>agT	p.S874S	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.S874S			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	874	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gtgacagcagcaacagcagtg	0.502																																					p.S874S		Atlas-SNP	.											.	DSPP	174	.	0			c.C2622T						.						70.0	85.0	79.0					4																	88536436		1641	2936	4577	SO:0001819	synonymous_variant	1834	exon5			CAGCAGCAACAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.2622C>T	chr4.hg19:g.88536436C>T		206.0	0.0		312.0	29.0	NM_014208	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	hg19	CCDS43248.1																																																																																			.	.		0.502	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
DSPP	1834	hgsc.bcm.edu	37	4	88537513	88537513	+	Missense_Mutation	SNP	A	A	C	rs112275895		TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr4:88537513A>C	ENST00000282478.7	+	4	3732	c.3699A>C	c.(3697-3699)gaA>gaC	p.E1233D	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Missense_Mutation_p.E1233D			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1233	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		acagcaatgaaagcagcgaca	0.547																																					p.E1233D		Atlas-SNP	.											.	DSPP	174	.	0			c.A3699C						.																																			SO:0001583	missense	1834	exon5			CAATGAAAGCAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3699A>C	chr4.hg19:g.88537513A>C	ENSP00000282478:p.Glu1233Asp	270.0	0.0		396.0	40.0	NM_014208	A8MUI0|O95815	Missense_Mutation	SNP	ENST00000282478.7	hg19	CCDS43248.1	.	.	.	.	.	.	.	.	.	.	A	0.010	-1.785366	0.00628	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.88741	-2.42;-2.42	2.61	-5.21	0.02815	.	.	.	.	.	T	0.57213	0.2038	N	0.01048	-1.04	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.57347	-0.7827	9	0.02654	T	1	.	0.7125	0.00926	0.2623:0.1881:0.1298:0.4197	.	1233	Q9NZW4	DSPP_HUMAN	D	1233	ENSP00000382213:E1233D;ENSP00000282478:E1233D	ENSP00000282478:E1233D	E	+	3	2	DSPP	88756537	0.003000	0.15002	0.000000	0.03702	0.000000	0.00434	-2.769000	0.00780	-2.252000	0.00699	-3.496000	0.00033	GAA	.	A|0.500;C|0.500		0.547	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
PCDH18	54510	hgsc.bcm.edu	37	4	138452550	138452550	+	Silent	SNP	T	T	A			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr4:138452550T>A	ENST00000344876.4	-	1	1079	c.693A>T	c.(691-693)atA>atT	p.I231I	PCDH18_ENST00000511115.1_Intron|PCDH18_ENST00000507846.1_Silent_p.I11I|PCDH18_ENST00000510305.1_Intron|PCDH18_ENST00000412923.2_Silent_p.I231I	NM_019035.3	NP_061908.1	Q9HCL0	PCD18_HUMAN	protocadherin 18	231	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(27)|lung(21)|ovary(2)|pancreas(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86	all_hematologic(180;0.24)					TTATTTTTAGTATGGATGAGC	0.458																																					p.I231I		Atlas-SNP	.											.	PCDH18	229	.	0			c.A693T						.						77.0	77.0	77.0					4																	138452550		2203	4300	6503	SO:0001819	synonymous_variant	54510	exon1			TTTTAGTATGGAT	AL137471	CCDS34064.1, CCDS75193.1	4q28.3	2010-01-26			ENSG00000189184	ENSG00000189184		"""Cadherins / Protocadherins : Non-clustered"""	14268	protein-coding gene	gene with protein product		608287				10835267, 11549318	Standard	XM_005263070		Approved	KIAA1562, PCDH68L	uc003ihe.4	Q9HCL0	OTTHUMG00000161348	ENST00000344876.4:c.693A>T	chr4.hg19:g.138452550T>A		47.0	0.0		82.0	30.0	NM_019035	A8K7K3|B7ZKT1|Q52LS2	Silent	SNP	ENST00000344876.4	hg19	CCDS34064.1																																																																																			.	.		0.458	PCDH18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364614.1	NM_019035	
ADAMTS12	81792	hgsc.bcm.edu	37	5	33534965	33534965	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr5:33534965T>C	ENST00000504830.1	-	23	4914	c.4579A>G	c.(4579-4581)Aac>Gac	p.N1527D	ADAMTS12_ENST00000352040.3_Missense_Mutation_p.N1442D	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	1527	TSP type-1 8. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						GCCTGCTGGTTGCATTTTTTG	0.468										HNSCC(64;0.19)																											p.N1527D		Atlas-SNP	.											.	ADAMTS12	464	.	0			c.A4579G						.						149.0	140.0	143.0					5																	33534965		2203	4300	6503	SO:0001583	missense	81792	exon23			GCTGGTTGCATTT	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.4579A>G	chr5.hg19:g.33534965T>C	ENSP00000422554:p.Asn1527Asp	62.0	0.0		112.0	40.0	NM_030955	A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	ENST00000504830.1	hg19	CCDS34140.1	.	.	.	.	.	.	.	.	.	.	T	15.08	2.726111	0.48833	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.52983	0.64;0.64	5.13	3.96	0.45880	.	0.248692	0.45867	D	0.000339	T	0.51432	0.1674	M	0.82923	2.615	0.80722	D	1	P;P	0.42078	0.728;0.77	B;P	0.45377	0.346;0.478	T	0.49615	-0.8921	10	0.15952	T	0.53	.	7.9855	0.30210	0.0:0.094:0.0:0.906	.	1442;1527	P58397-3;P58397	.;ATS12_HUMAN	D	1527;1442	ENSP00000422554:N1527D;ENSP00000344847:N1442D	ENSP00000344847:N1442D	N	-	1	0	ADAMTS12	33570722	1.000000	0.71417	0.999000	0.59377	0.932000	0.56968	1.279000	0.33191	0.896000	0.36366	0.460000	0.39030	AAC	.	.		0.468	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955	
MAP3K1	4214	hgsc.bcm.edu	37	5	56161727	56161727	+	Missense_Mutation	SNP	C	C	G			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr5:56161727C>G	ENST00000399503.3	+	6	1224	c.1224C>G	c.(1222-1224)atC>atG	p.I408M		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	408					activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		GTAACACCATCCAGAAGTTTG	0.373																																					p.I408M		Atlas-SNP	.											.	MAP3K1	355	.	0			c.C1224G						.						121.0	118.0	119.0					5																	56161727		1900	4122	6022	SO:0001583	missense	4214	exon6			CACCATCCAGAAG	U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.1224C>G	chr5.hg19:g.56161727C>G	ENSP00000382423:p.Ile408Met	130.0	0.0		195.0	58.0	NM_005921		Missense_Mutation	SNP	ENST00000399503.3	hg19	CCDS43318.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.719616	0.89205	.	.	ENSG00000095015	ENST00000399503	T	0.68903	-0.36	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.76083	0.3938	L	0.34521	1.04	0.80722	D	1	D	0.71674	0.998	D	0.78314	0.991	T	0.77376	-0.2611	10	0.66056	D	0.02	.	19.8765	0.96875	0.0:1.0:0.0:0.0	.	408	Q13233	M3K1_HUMAN	M	408	ENSP00000382423:I408M	ENSP00000382423:I408M	I	+	3	3	MAP3K1	56197484	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.066000	0.64351	2.695000	0.91970	0.650000	0.86243	ATC	.	.		0.373	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000132309.2	XM_042066	
ZSWIM6	57688	hgsc.bcm.edu	37	5	60817140	60817140	+	Nonsense_Mutation	SNP	A	A	T			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr5:60817140A>T	ENST00000252744.5	+	5	1384	c.1384A>T	c.(1384-1386)Aag>Tag	p.K462*		NM_020928.1	NP_065979.1	Q9HCJ5	ZSWM6_HUMAN	zinc finger, SWIM-type containing 6	462					neuron projection morphogenesis (GO:0048812)|regulation of neuron migration (GO:2001222)		zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)	8						GTTGGAGCAAAAGGCCAGTTG	0.378																																					p.K462X		Atlas-SNP	.											.	ZSWIM6	51	.	0			c.A1384T						.						99.0	80.0	86.0					5																	60817140		692	1591	2283	SO:0001587	stop_gained	57688	exon5			GAGCAAAAGGCCA	BC039438	CCDS47215.1	5q12.1	2011-03-17			ENSG00000130449	ENSG00000130449		"""Zinc fingers, SWIM-type"""	29316	protein-coding gene	gene with protein product		615951				10997877, 16427614	Standard	NM_020928		Approved	KIAA1577	uc003jsr.3	Q9HCJ5	OTTHUMG00000162388	ENST00000252744.5:c.1384A>T	chr5.hg19:g.60817140A>T	ENSP00000252744:p.Lys462*	139.0	0.0		213.0	39.0	NM_020928		Nonsense_Mutation	SNP	ENST00000252744.5	hg19	CCDS47215.1	.	.	.	.	.	.	.	.	.	.	A	37	6.145134	0.97324	.	.	ENSG00000130449	ENST00000252744	.	.	.	5.31	5.31	0.75309	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.4484	15.2785	0.73760	1.0:0.0:0.0:0.0	.	.	.	.	X	462	.	ENSP00000252744:K462X	K	+	1	0	ZSWIM6	60852897	1.000000	0.71417	0.999000	0.59377	0.980000	0.70556	8.932000	0.92897	2.019000	0.59389	0.533000	0.62120	AAG	.	.		0.378	ZSWIM6-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368710.1	NM_020928	
ZSWIM6	57688	hgsc.bcm.edu	37	5	60817151	60817151	+	Nonsense_Mutation	SNP	G	G	A			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr5:60817151G>A	ENST00000252744.5	+	5	1395	c.1395G>A	c.(1393-1395)tgG>tgA	p.W465*		NM_020928.1	NP_065979.1	Q9HCJ5	ZSWM6_HUMAN	zinc finger, SWIM-type containing 6	465					neuron projection morphogenesis (GO:0048812)|regulation of neuron migration (GO:2001222)		zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)	8						AGGCCAGTTGGCTAAAACAGC	0.408																																					p.W465X		Atlas-SNP	.											.	ZSWIM6	51	.	0			c.G1395A						.						103.0	84.0	90.0					5																	60817151		692	1591	2283	SO:0001587	stop_gained	57688	exon5			CAGTTGGCTAAAA	BC039438	CCDS47215.1	5q12.1	2011-03-17			ENSG00000130449	ENSG00000130449		"""Zinc fingers, SWIM-type"""	29316	protein-coding gene	gene with protein product		615951				10997877, 16427614	Standard	NM_020928		Approved	KIAA1577	uc003jsr.3	Q9HCJ5	OTTHUMG00000162388	ENST00000252744.5:c.1395G>A	chr5.hg19:g.60817151G>A	ENSP00000252744:p.Trp465*	134.0	0.0		217.0	41.0	NM_020928		Nonsense_Mutation	SNP	ENST00000252744.5	hg19	CCDS47215.1	.	.	.	.	.	.	.	.	.	.	G	36	5.970839	0.97156	.	.	ENSG00000130449	ENST00000252744	.	.	.	5.31	5.31	0.75309	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.4014	18.9908	0.92791	0.0:0.0:1.0:0.0	.	.	.	.	X	465	.	ENSP00000252744:W465X	W	+	3	0	ZSWIM6	60852908	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.444000	0.97578	2.494000	0.84150	0.655000	0.94253	TGG	.	.		0.408	ZSWIM6-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368710.1	NM_020928	
CCNB1	891	hgsc.bcm.edu	37	5	68471253	68471253	+	Silent	SNP	A	A	G			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr5:68471253A>G	ENST00000256442.5	+	7	1225	c.972A>G	c.(970-972)aaA>aaG	p.K324K	snoU13_ENST00000459230.1_RNA	NM_031966.3	NP_114172.1	P14635	CCNB1_HUMAN	cyclin B1	324					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cellular response to fatty acid (GO:0071398)|cellular response to hypoxia (GO:0071456)|cellular response to iron(III) ion (GO:0071283)|cellular response to organic cyclic compound (GO:0071407)|digestive tract development (GO:0048565)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle checkpoint (GO:0071174)|mitotic spindle stabilization (GO:0043148)|negative regulation of gene expression (GO:0010629)|negative regulation of protein phosphorylation (GO:0001933)|oocyte maturation (GO:0001556)|positive regulation of attachment of spindle microtubules to kinetochore (GO:0051987)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of histone phosphorylation (GO:0033129)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of chromosome condensation (GO:0060623)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to DDT (GO:0046680)|response to drug (GO:0042493)|response to mechanical stimulus (GO:0009612)|spermatogenesis (GO:0007283)|tissue regeneration (GO:0042246)|ventricular cardiac muscle cell development (GO:0055015)	centrosome (GO:0005813)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	kinase activity (GO:0016301)|patched binding (GO:0005113)|protein kinase binding (GO:0019901)			large_intestine(2)|lung(5)|skin(1)	8		Lung NSC(167;5.51e-05)|Prostate(74;0.00634)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.24e-56)|Epithelial(20;1.12e-52)|all cancers(19;2.63e-48)|Lung(70;0.0177)		CTTTGGCCAAATACCTGATGG	0.403																																					p.K324K		Atlas-SNP	.											.	CCNB1	36	.	0			c.A972G						.						175.0	162.0	166.0					5																	68471253		2203	4300	6503	SO:0001819	synonymous_variant	891	exon7			GGCCAAATACCTG	U22364	CCDS3997.1	5q12	2008-07-18			ENSG00000134057	ENSG00000134057			1579	protein-coding gene	gene with protein product	"""G2/mitotic-specific cyclin B1"""	123836		CCNB		1386342	Standard	NM_031966		Approved		uc003jvm.3	P14635	OTTHUMG00000097817	ENST00000256442.5:c.972A>G	chr5.hg19:g.68471253A>G		123.0	0.0		167.0	51.0	NM_031966	A8K066|Q5TZP9	Silent	SNP	ENST00000256442.5	hg19	CCDS3997.1																																																																																			.	.		0.403	CCNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215084.1	NM_031966	
GPR98	84059	hgsc.bcm.edu	37	5	90078941	90078941	+	Splice_Site	SNP	T	T	A			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr5:90078941T>A	ENST00000405460.2	+	66	13328	c.13232T>A	c.(13231-13233)gTg>gAg	p.V4411E	GPR98_ENST00000425867.2_Splice_Site_p.V72E	NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	4411	Calx-beta 30. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		CCCATTACAGTGGAGGAAGAT	0.428																																					p.V4411E		Atlas-SNP	.											.	GPR98	605	.	0			c.T13232A						.						176.0	169.0	171.0					5																	90078941		2008	4182	6190	SO:0001630	splice_region_variant	84059	exon66			TTACAGTGGAGGA	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.13232-1T>A	chr5.hg19:g.90078941T>A		108.0	0.0		127.0	35.0	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	hg19	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	T	27.7	4.855748	0.91355	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000425867	T;T	0.39056	1.1;1.1	6.17	6.17	0.99709	Na-Ca exchanger/integrin-beta4 (2);	0.000000	0.85682	D	0.000000	T	0.73560	0.3602	M	0.92784	3.345	0.47862	D	0.999538	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.99;0.999	T	0.80238	-0.1465	9	.	.	.	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	72;4411;72	E7EML1;Q8WXG9;Q8WXG9-2	.;GPR98_HUMAN;.	E	4411;4411;72	ENSP00000384582:V4411E;ENSP00000392618:V72E	.	V	+	2	0	GPR98	90114697	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	6.044000	0.71012	2.371000	0.80710	0.533000	0.62120	GTG	.	.		0.428	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	Missense_Mutation
PCDHGB6	56100	hgsc.bcm.edu	37	5	140787904	140787904	+	Silent	SNP	G	G	T			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr5:140787904G>T	ENST00000520790.1	+	1	135	c.135G>T	c.(133-135)tcG>tcT	p.S45S	PCDHGA7_ENST00000518325.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB3_ENST00000576222.1_Intron	NM_018926.2|NM_032100.1	NP_061749.1|NP_115271.1	Q9Y5F9	PCDGI_HUMAN	protocadherin gamma subfamily B, 6	45	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)	48			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCAAGGGCTCGGTGGTGGGGA	0.617																																					p.S45S		Atlas-SNP	.											.	PCDHGB6	120	.	0			c.G135T						.						48.0	53.0	51.0					5																	140787904		1953	4138	6091	SO:0001819	synonymous_variant	56100	exon1			GGGCTCGGTGGTG	AF152522	CCDS54929.1, CCDS75342.1	5q31	2010-01-26				ENSG00000253305		"""Cadherins / Protocadherins : Clustered"""	8713	other	protocadherin		606303				10380929	Standard	NM_018926		Approved	PCDH-GAMMA-B6		Q9Y5F9		ENST00000520790.1:c.135G>T	chr5.hg19:g.140787904G>T		108.0	0.0		146.0	18.0	NM_032100	Q9Y5C5	Silent	SNP	ENST00000520790.1	hg19	CCDS54929.1																																																																																			.	.		0.617	PCDHGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374746.1	NM_018926	
PCDHGB6	56100	hgsc.bcm.edu	37	5	140789789	140789789	+	Missense_Mutation	SNP	G	G	T			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr5:140789789G>T	ENST00000520790.1	+	1	2020	c.2020G>T	c.(2020-2022)Gac>Tac	p.D674Y	PCDHGA7_ENST00000518325.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA10_ENST00000398610.2_5'Flank|PCDHGA3_ENST00000253812.6_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB3_ENST00000576222.1_Intron	NM_018926.2|NM_032100.1	NP_061749.1|NP_115271.1	Q9Y5F9	PCDGI_HUMAN	protocadherin gamma subfamily B, 6	674	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)	48			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GATACTGCCAGACCTCAGCGA	0.607																																					p.D674Y		Atlas-SNP	.											.	PCDHGB6	120	.	0			c.G2020T						.						91.0	99.0	96.0					5																	140789789		2120	4241	6361	SO:0001583	missense	56100	exon1			CTGCCAGACCTCA	AF152522	CCDS54929.1, CCDS75342.1	5q31	2010-01-26				ENSG00000253305		"""Cadherins / Protocadherins : Clustered"""	8713	other	protocadherin		606303				10380929	Standard	NM_018926		Approved	PCDH-GAMMA-B6		Q9Y5F9		ENST00000520790.1:c.2020G>T	chr5.hg19:g.140789789G>T	ENSP00000428603:p.Asp674Tyr	63.0	0.0		107.0	37.0	NM_032100	Q9Y5C5	Missense_Mutation	SNP	ENST00000520790.1	hg19	CCDS54929.1	.	.	.	.	.	.	.	.	.	.	g	16.84	3.234620	0.58886	.	.	ENSG00000253305	ENST00000520790	T	0.52754	0.65	5.18	4.31	0.51392	Cadherin (1);	.	.	.	.	T	0.72890	0.3517	M	0.88377	2.95	0.21652	N	0.999604	D;D	0.89917	0.996;1.0	D;D	0.76071	0.957;0.987	T	0.66756	-0.5843	9	0.87932	D	0	.	13.6668	0.62401	0.0744:0.0:0.9256:0.0	.	674;674	Q9Y5F9;Q9Y5F9-2	PCDGI_HUMAN;.	Y	674	ENSP00000428603:D674Y	ENSP00000428603:D674Y	D	+	1	0	PCDHGB6	140769973	1.000000	0.71417	0.173000	0.22940	0.008000	0.06430	7.290000	0.78711	1.187000	0.43000	0.563000	0.77884	GAC	.	.		0.607	PCDHGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374746.1	NM_018926	
SLC34A1	6569	hgsc.bcm.edu	37	5	176821180	176821180	+	Missense_Mutation	SNP	G	G	T			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr5:176821180G>T	ENST00000324417.5	+	10	1249	c.1158G>T	c.(1156-1158)caG>caT	p.Q386H	SLC34A1_ENST00000513614.1_Intron	NM_003052.4	NP_003043.3	Q06495	NPT2A_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 1	386					arsenate ion transmembrane transport (GO:1901684)|bone remodeling (GO:0046849)|cellular response to metal ion (GO:0071248)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to staurosporine (GO:0072734)|dentinogenesis (GO:0097187)|gentamycin metabolic process (GO:1901128)|glycoprotein metabolic process (GO:0009100)|indole metabolic process (GO:0042431)|ion transport (GO:0006811)|kidney development (GO:0001822)|ossification (GO:0001503)|phosphate ion homeostasis (GO:0055062)|phosphate ion transport (GO:0006817)|positive regulation of membrane potential (GO:0045838)|positive regulation of phosphate transmembrane transport (GO:2000187)|positive regulation of sodium-dependent phosphate transport (GO:2000120)|protein homooligomerization (GO:0051260)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to growth hormone (GO:0060416)|response to lead ion (GO:0010288)|response to magnesium ion (GO:0032026)|response to mercury ion (GO:0046689)|response to potassium ion (GO:0035864)|response to thyroid hormone (GO:0097066)|response to vitamin A (GO:0033189)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|tricarboxylic acid metabolic process (GO:0072350)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|membrane-bounded vesicle (GO:0031988)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|symporter activity (GO:0015293)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AGGTCATCCAGAAGGTCATCA	0.582																																					p.Q386H		Atlas-SNP	.											.	SLC34A1	73	.	0			c.G1158T						.						134.0	126.0	129.0					5																	176821180		2203	4300	6503	SO:0001583	missense	6569	exon10			CATCCAGAAGGTC	L13258	CCDS4418.1, CCDS54953.1	5q35.3	2013-07-17	2013-07-17		ENSG00000131183	ENSG00000131183		"""Solute carriers"""	11019	protein-coding gene	gene with protein product	"""sodium/phosphate co-transporter"", ""solute carrier family 17 (sodium phosphate), member 2"", ""Na+-phosphate cotransporter type II"""	182309	"""solute carrier family 34 (sodium phosphate), member 1"""	NPT2, SLC17A2		8327470, 8693007	Standard	NM_003052		Approved	NAPI-3, NPTIIa, SLC11	uc003mgk.4	Q06495	OTTHUMG00000130857	ENST00000324417.5:c.1158G>T	chr5.hg19:g.176821180G>T	ENSP00000321424:p.Gln386His	96.0	0.0		139.0	48.0	NM_003052	B4DPE3	Missense_Mutation	SNP	ENST00000324417.5	hg19	CCDS4418.1	.	.	.	.	.	.	.	.	.	.	G	13.89	2.371960	0.42003	.	.	ENSG00000131183	ENST00000324417	D	0.86097	-2.07	5.34	5.34	0.76211	.	0.314463	0.31061	N	0.008329	T	0.76097	0.3940	N	0.11000	0.08	0.39156	D	0.962321	B	0.06786	0.001	B	0.18561	0.022	T	0.73357	-0.4008	10	0.87932	D	0	-31.5828	18.6545	0.91445	0.0:0.0:1.0:0.0	.	386	Q06495	NPT2A_HUMAN	H	386	ENSP00000321424:Q386H	ENSP00000321424:Q386H	Q	+	3	2	SLC34A1	176753786	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	3.720000	0.54933	2.495000	0.84180	0.462000	0.41574	CAG	.	.		0.582	SLC34A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253431.1	NM_003052	
MOG	4340	hgsc.bcm.edu	37	6	29641190	29641190	+	IGR	SNP	C	C	T			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr6:29641190C>T	ENST00000376917.3	+	0	2160				ZFP57_ENST00000376881.3_Missense_Mutation_p.C213Y|ZFP57_ENST00000488757.1_Missense_Mutation_p.C233Y|ZFP57_ENST00000376883.1_Missense_Mutation_p.C213Y	NM_002433.4|NM_206809.3	NP_002424.3|NP_996532.2	Q16653	MOG_HUMAN	myelin oligodendrocyte glycoprotein						cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|positive regulation of MyD88-dependent toll-like receptor signaling pathway (GO:0034126)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)|skin(2)	19						ACAGAGCGTGCAACAGAAGGG	0.557																																					p.C233Y		Atlas-SNP	.											.	ZFP57	80	.	0			c.G698A						.						77.0	87.0	84.0					6																	29641190		1375	2614	3989	SO:0001628	intergenic_variant	346171	exon4			AGCGTGCAACAGA		CCDS4667.1, CCDS34366.1, CCDS34367.1, CCDS34368.1, CCDS34369.1, CCDS34370.1, CCDS47394.1, CCDS47395.1, CCDS47395.2, CCDS54977.1	6p22.1	2014-01-16			ENSG00000204655	ENSG00000204655		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	7197	protein-coding gene	gene with protein product		159465					Standard	NM_002433		Approved	BTN6, BTNL11	uc003nne.3	Q16653	OTTHUMG00000031099		chr6.hg19:g.29641190C>T		98.0	0.0		117.0	35.0	NM_001109809	A6NDR4|A6NNJ9|A8MY31|B0UZR9|E9PGF0|F8W9D5|O00713|O00714|O00715|Q13054|Q13055|Q14855|Q29ZN8|Q56UY0|Q5JNX7|Q5JNY1|Q5JNY2|Q5JNY4|Q5SSB5|Q5SSB6|Q5STL9|Q5STM0|Q5STM1|Q5STM2|Q5STM5|Q5SUK5|Q5SUK7|Q5SUK8|Q5SUK9|Q5SUL0|Q5SUL1|Q8IYG5|Q92891|Q92892|Q92893|Q92894|Q92895|Q93053|Q96KU9|Q96KV0|Q96KV1|Q99605	Missense_Mutation	SNP	ENST00000376917.3	hg19	CCDS34370.1	.	.	.	.	.	.	.	.	.	.	C	14.70	2.614850	0.46631	.	.	ENSG00000204644	ENST00000488757;ENST00000376881;ENST00000376883	D;D;D	0.85088	-1.94;-1.94;-1.94	4.51	3.63	0.41609	.	0.000000	0.50627	D	0.000104	D	0.93103	0.7804	H	0.97186	3.955	0.45415	D	0.998392	D;D	0.69078	0.997;0.997	D;D	0.67725	0.953;0.953	D	0.93621	0.6948	10	0.87932	D	0	-18.7952	10.3332	0.43835	0.0:0.9:0.0:0.1	.	233;213	Q9NU63-3;Q9NU63-2	.;.	Y	233;213;213	ENSP00000418259:C233Y;ENSP00000366078:C213Y;ENSP00000366080:C213Y	ENSP00000366078:C213Y	C	-	2	0	ZFP57	29749169	1.000000	0.71417	0.108000	0.21378	0.170000	0.22686	5.515000	0.67049	2.498000	0.84270	0.558000	0.71614	TGC	.	.		0.557	MOG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076160.3	NM_002433	
DXO	1797	hgsc.bcm.edu	37	6	31938745	31938745	+	Missense_Mutation	SNP	G	G	A	rs558849573	byFrequency	TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr6:31938745G>A	ENST00000375349.3	-	3	947	c.536C>T	c.(535-537)cCg>cTg	p.P179L	DXO_ENST00000478221.1_5'UTR|DXO_ENST00000337523.5_Missense_Mutation_p.P179L|STK19_ENST00000375333.2_5'Flank|STK19_ENST00000375331.2_5'Flank|DXO_ENST00000375356.3_Missense_Mutation_p.P179L			O77932	DXO_HUMAN	decapping exoribonuclease	179					metabolic process (GO:0008152)|mRNA catabolic process (GO:0006402)|nuclear mRNA surveillance (GO:0071028)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|RNA destabilization (GO:0050779)	nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|magnesium ion binding (GO:0000287)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|RNA pyrophosphohydrolase activity (GO:0034353)										CCGGAGGAGCGGTGGCCGAGC	0.597													G|||	2	0.000399361	0.0	0.0029	5008	,	,		15226	0.0		0.0	False		,,,				2504	0.0				p.P179L		Atlas-SNP	.											.	DOM3Z	20	.	0			c.C536T						.						78.0	92.0	87.0					6																	31938745		1509	2707	4216	SO:0001583	missense	1797	exon3			AGGAGCGGTGGCC	AF059252	CCDS4732.1	6p21.3	2013-09-11	2013-09-11	2013-09-11	ENSG00000204348	ENSG00000204348			2992	protein-coding gene	gene with protein product		605996	"""DOM-3 (C. elegans) homolog Z"", ""dom-3 homolog Z (C. elegans)"""	DOM3Z		9799600, 23523372	Standard	NM_005510		Approved		uc003nyp.1	O77932	OTTHUMG00000031272	ENST00000375349.3:c.536C>T	chr6.hg19:g.31938745G>A	ENSP00000364498:p.Pro179Leu	36.0	0.0		60.0	23.0	NM_005510	A2CER3|B0UZ80|O15004|O78127|O78128|Q5ST60|Q6IPZ2|Q9NPK4	Missense_Mutation	SNP	ENST00000375349.3	hg19	CCDS4732.1	.	.	.	.	.	.	.	.	.	.	G	10.36	1.329086	0.24167	.	.	ENSG00000204348	ENST00000337523;ENST00000375349;ENST00000375356	T;T;T	0.19938	2.11;2.11;2.11	5.23	3.45	0.39498	.	0.191692	0.44902	D	0.000414	T	0.05640	0.0148	L	0.49455	1.56	0.09310	N	0.999994	B;B	0.28971	0.229;0.039	B;B	0.12156	0.007;0.003	T	0.21484	-1.0244	10	0.38643	T	0.18	-14.8551	4.2437	0.10662	0.1756:0.0:0.5376:0.2867	.	179;179	F8WC68;O77932	.;DOM3Z_HUMAN	L	179	ENSP00000337759:P179L;ENSP00000364498:P179L;ENSP00000364505:P179L	ENSP00000337759:P179L	P	-	2	0	DOM3Z	32046724	0.995000	0.38212	0.977000	0.42913	0.705000	0.40729	2.827000	0.48112	1.201000	0.43203	-0.254000	0.11334	CCG	.	.		0.597	DXO-006	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076592.3		
EEF1A1	1915	hgsc.bcm.edu	37	6	74229110	74229110	+	Missense_Mutation	SNP	C	C	T			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr6:74229110C>T	ENST00000316292.9	-	2	1265	c.274G>A	c.(274-276)Gcc>Acc	p.A92T	EEF1A1_ENST00000331523.2_Missense_Mutation_p.A92T|EEF1A1_ENST00000309268.6_Missense_Mutation_p.A92T|EEF1A1_ENST00000491404.1_5'UTR	NM_001402.5	NP_001393.1	P68104	EF1A1_HUMAN	eukaryotic translation elongation factor 1 alpha 1	92	G3. {ECO:0000250}.|tr-type G.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation elongation factor activity (GO:0003746)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(6)|prostate(2)|skin(3)	18						TGTCCTGGGGCATCAATGATA	0.408											OREG0003890	type=REGULATORY REGION|Gene=LOC477388|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.A92T		Atlas-SNP	.											.	EEF1A1	56	.	0			c.G274A						.						95.0	107.0	103.0					6																	74229110		2203	4298	6501	SO:0001583	missense	1915	exon3			CTGGGGCATCAAT	BC019669	CCDS4980.1	6q14.1	2010-06-30	2004-11-19		ENSG00000156508	ENSG00000156508			3189	protein-coding gene	gene with protein product		130590	"""leukocyte receptor cluster (LRC) member 7"""	EF1A, EEF1A, LENG7		8812466, 10941842	Standard	NM_001402		Approved	EE1A1	uc003phj.3	P68104	OTTHUMG00000015031	ENST00000316292.9:c.274G>A	chr6.hg19:g.74229110C>T	ENSP00000339063:p.Ala92Thr	39.0	0.0	1151	76.0	29.0	NM_001402	P04719|P04720|Q6IQ15	Missense_Mutation	SNP	ENST00000316292.9	hg19	CCDS4980.1	.	.	.	.	.	.	.	.	.	.	C	13.98	2.398406	0.42512	.	.	ENSG00000156508	ENST00000316292;ENST00000358190;ENST00000309268;ENST00000331523;ENST00000391977;ENST00000356303;ENST00000455918	T;T;T;T;T	0.27557	1.66;1.66;1.66;1.66;1.66	3.93	3.93	0.45458	Protein synthesis factor, GTP-binding (4);	0.000000	0.64402	U	0.000001	T	0.19087	0.0458	L	0.33137	0.985	0.80722	D	1	B;B;B;P	0.36378	0.162;0.162;0.162;0.55	B;B;B;B	0.40534	0.158;0.158;0.158;0.332	T	0.14448	-1.0472	10	0.87932	D	0	.	16.5844	0.84724	0.0:1.0:0.0:0.0	.	92;92;92;92	P68104;Q53HR5;Q6IPS9;Q5VTE0	EF1A1_HUMAN;.;.;EF1A3_HUMAN	T	92	ENSP00000339063:A92T;ENSP00000339053:A92T;ENSP00000330054:A92T;ENSP00000348651:A92T;ENSP00000392366:A92T	ENSP00000339053:A92T	A	-	1	0	EEF1A1	74285831	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.344000	0.79328	2.202000	0.70862	0.549000	0.68633	GCC	.	.		0.408	EEF1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041210.2	NM_001402	
SLC2A12	154091	hgsc.bcm.edu	37	6	134350236	134350236	+	Missense_Mutation	SNP	G	G	C			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr6:134350236G>C	ENST00000275230.5	-	2	882	c.727C>G	c.(727-729)Ctc>Gtc	p.L243V		NM_145176.2	NP_660159.1	Q8TD20	GTR12_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 12	243					glucose transport (GO:0015758)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			NS(1)|breast(1)|large_intestine(6)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	17	Breast(56;0.214)|Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.0101)|GBM - Glioblastoma multiforme(68;0.0123)		GTATCTGAGAGTGCTCTTAAC	0.438																																					p.L243V	Melanoma(122;1663 1672 14489 35294 41228)	Atlas-SNP	.											.	SLC2A12	43	.	0			c.C727G						.						74.0	74.0	74.0					6																	134350236		2203	4300	6503	SO:0001583	missense	154091	exon2			CTGAGAGTGCTCT	AL035699	CCDS5169.1	6q23.2	2013-05-22			ENSG00000146411	ENSG00000146411		"""Solute carriers"""	18067	protein-coding gene	gene with protein product		610372				11780753, 11832379	Standard	XM_006715349		Approved	GLUT12, GLUT8	uc003qem.1	Q8TD20	OTTHUMG00000015611	ENST00000275230.5:c.727C>G	chr6.hg19:g.134350236G>C	ENSP00000275230:p.Leu243Val	134.0	0.0		152.0	45.0	NM_145176	B3KV17|Q7Z6U3|Q96MR8	Missense_Mutation	SNP	ENST00000275230.5	hg19	CCDS5169.1	.	.	.	.	.	.	.	.	.	.	G	1.976	-0.435356	0.04669	.	.	ENSG00000146411	ENST00000275230	T	0.73363	-0.74	5.4	-2.89	0.05665	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	1.030380	0.07605	N	0.924261	T	0.20047	0.0482	N	0.01824	-0.7	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.10823	-1.0613	10	0.25751	T	0.34	-5.1749	5.8477	0.18675	0.0:0.2874:0.2507:0.4619	.	243	Q8TD20	GTR12_HUMAN	V	243	ENSP00000275230:L243V	ENSP00000275230:L243V	L	-	1	0	SLC2A12	134391929	0.003000	0.15002	0.012000	0.15200	0.490000	0.33462	-0.009000	0.12765	-0.505000	0.06568	-0.518000	0.04402	CTC	.	.		0.438	SLC2A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042302.1		
GPR126	57211	hgsc.bcm.edu	37	6	142738477	142738477	+	Missense_Mutation	SNP	A	A	T			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr6:142738477A>T	ENST00000230173.6	+	21	3482	c.3006A>T	c.(3004-3006)gaA>gaT	p.E1002D	GPR126_ENST00000367608.2_Missense_Mutation_p.E974D|GPR126_ENST00000296932.8_Missense_Mutation_p.E974D|GPR126_ENST00000367609.3_Missense_Mutation_p.E1002D	NM_020455.5	NP_065188	Q86SQ4	GP126_HUMAN	G protein-coupled receptor 126	1002					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(12)|lung(10)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36	Breast(32;0.176)			OV - Ovarian serous cystadenocarcinoma(155;9.33e-06)|GBM - Glioblastoma multiforme(68;0.00121)		ATGGAAAAGAAAGTTATGGGA	0.348																																					p.E1002D		Atlas-SNP	.											.	GPR126	192	.	0			c.A3006T						.						106.0	96.0	99.0					6																	142738477		1825	4085	5910	SO:0001583	missense	57211	exon21			AAAAGAAAGTTAT	AK027843	CCDS47489.1, CCDS47490.1, CCDS47491.1, CCDS55064.1	6q23.1-q24.3	2014-08-08			ENSG00000112414	ENSG00000112414		"""-"", ""GPCR / Class B : Orphans"""	13841	protein-coding gene	gene with protein product		612243				12565841	Standard	NM_001032395		Approved	FLJ14937	uc010khe.3	Q86SQ4	OTTHUMG00000015709	ENST00000230173.6:c.3006A>T	chr6.hg19:g.142738477A>T	ENSP00000230173:p.Glu1002Asp	171.0	0.0		227.0	71.0	NM_198569	Q5TGN7|Q6DHZ4|Q6F3F5|Q6F3F6|Q6F3F7|Q6F3F8|Q6MZU7|Q8IXA4|Q8NC14|Q96JW0	Missense_Mutation	SNP	ENST00000230173.6	hg19	CCDS47490.1	.	.	.	.	.	.	.	.	.	.	A	4.276	0.050297	0.08243	.	.	ENSG00000112414	ENST00000230173;ENST00000367608;ENST00000296932;ENST00000367609	T;T;T;T	0.37058	1.22;1.22;1.22;1.22	5.28	0.167	0.15006	GPCR, family 2-like (1);	0.673685	0.14623	N	0.308272	T	0.03651	0.0104	N	0.04275	-0.24	0.09310	N	1	B;B;B;B;B	0.10296	0.001;0.002;0.002;0.002;0.003	B;B;B;B;B	0.16289	0.008;0.005;0.005;0.009;0.015	T	0.42378	-0.9455	10	0.16896	T	0.51	.	2.6723	0.05070	0.3838:0.127:0.366:0.1232	.	62;974;1002;974;1002	B4DSK4;Q86SQ4-4;Q86SQ4-3;Q86SQ4-2;Q86SQ4	.;.;.;.;GP126_HUMAN	D	1002;974;974;1002	ENSP00000230173:E1002D;ENSP00000356580:E974D;ENSP00000296932:E974D;ENSP00000356581:E1002D	ENSP00000230173:E1002D	E	+	3	2	GPR126	142780170	0.000000	0.05858	0.270000	0.24601	0.289000	0.27227	-0.598000	0.05706	-0.095000	0.12351	-0.297000	0.09499	GAA	.	.		0.348	GPR126-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000042487.2		
TTYH3	80727	hgsc.bcm.edu	37	7	2689555	2689555	+	Silent	SNP	C	C	T			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr7:2689555C>T	ENST00000258796.7	+	7	1009	c.804C>T	c.(802-804)agC>agT	p.S268S	TTYH3_ENST00000403167.1_Silent_p.S97S|TTYH3_ENST00000477439.1_3'UTR|TTYH3_ENST00000407643.1_Silent_p.S236S	NM_025250.2	NP_079526.1	Q9C0H2	TTYH3_HUMAN	tweety family member 3	268					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)|intracellular calcium activated chloride channel activity (GO:0005229)			kidney(1)|large_intestine(3)|lung(9)|prostate(2)|upper_aerodigestive_tract(2)	17		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;2.04e-14)		AGGGCTCCAGCGACTTCTGTG	0.627																																					p.S268S		Atlas-SNP	.											.	TTYH3	36	.	0			c.C804T						.						96.0	84.0	88.0					7																	2689555		2203	4300	6503	SO:0001819	synonymous_variant	80727	exon7			CTCCAGCGACTTC		CCDS34588.1	7p22	2013-09-02	2013-09-02		ENSG00000136295	ENSG00000136295			22222	protein-coding gene	gene with protein product		608919	"""tweety homolog 3 (Drosophila)"""				Standard	NM_025250		Approved	KIAA1691	uc003smp.3	Q9C0H2	OTTHUMG00000152050	ENST00000258796.7:c.804C>T	chr7.hg19:g.2689555C>T		59.0	0.0		95.0	7.0	NM_025250	A4D201|B7WP98|Q6L749|Q6ZVG3|Q8TEG6	Silent	SNP	ENST00000258796.7	hg19	CCDS34588.1																																																																																			.	.		0.627	TTYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325082.2	XM_166523	
CACNA2D1	781	hgsc.bcm.edu	37	7	81689806	81689806	+	Silent	SNP	G	G	T			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr7:81689806G>T	ENST00000356253.5	-	10	1072	c.817C>A	c.(817-819)Cga>Aga	p.R273R	CACNA2D1_ENST00000423588.1_Silent_p.R273R|CACNA2D1_ENST00000356860.3_Silent_p.R273R			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1	273	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	ACAGATGTTCGGATCAGTTTA	0.348																																					p.R273R		Atlas-SNP	.											.	CACNA2D1	191	.	0			c.C817A						.						135.0	117.0	123.0					7																	81689806		2203	4300	6503	SO:0001819	synonymous_variant	781	exon10			ATGTTCGGATCAG	M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.817C>A	chr7.hg19:g.81689806G>T		72.0	0.0		108.0	38.0	NM_000722	Q17R45|Q9UD80|Q9UD81|Q9UD82	Silent	SNP	ENST00000356253.5	hg19																																																																																				.	.		0.348	CACNA2D1-201	KNOWN	basic	protein_coding	protein_coding			
SARAF	51669	hgsc.bcm.edu	37	8	29927547	29927547	+	Missense_Mutation	SNP	G	G	C			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr8:29927547G>C	ENST00000256255.6	-	3	568	c.311C>G	c.(310-312)gCa>gGa	p.A104G	TMEM66_ENST00000536273.1_5'UTR|TMEM66_ENST00000545648.1_5'UTR	NM_016127.4	NP_057211.4	Q96BY9	SARAF_HUMAN		104					calcium ion transport (GO:0006816)|regulation of store-operated calcium entry (GO:2001256)	integral component of endoplasmic reticulum membrane (GO:0030176)				endometrium(2)|large_intestine(1)|lung(11)	14				KIRC - Kidney renal clear cell carcinoma(542;0.0993)|Kidney(114;0.119)		AAATTTGTATGCAATATCTAA	0.358																																					p.A104G		Atlas-SNP	.											.	TMEM66	23	.	0			c.C311G						.						149.0	163.0	158.0					8																	29927547		2203	4300	6503	SO:0001583	missense	51669	exon3			TTGTATGCAATAT																												ENST00000256255.6:c.311C>G	chr8.hg19:g.29927547G>C	ENSP00000256255:p.Ala104Gly	31.0	0.0		39.0	15.0	NM_016127	B3KQQ4|B7Z9J1|D3DSU7|H9MHJ8|H9MHJ9|Q53HE8|Q9UNZ3|Q9Y683	Missense_Mutation	SNP	ENST00000256255.6	hg19	CCDS6074.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.51|11.51	1.660157|1.660157	0.29515|0.29515	.|.	.|.	ENSG00000133872|ENSG00000133872	ENST00000256255;ENST00000541035;ENST00000523127;ENST00000522794;ENST00000523761|ENST00000521265	T;T;T;T|.	0.45668|.	0.89;0.89;0.89;0.89|.	5.72|5.72	5.72|5.72	0.89469|0.89469	.|.	0.373490|.	0.30830|.	N|.	0.008781|.	T|T	0.71651|0.71651	0.3365|0.3365	L|L	0.56769|0.56769	1.78|1.78	0.80722|0.80722	D|D	1|1	D;D|.	0.67145|.	0.996;0.996|.	D;D|.	0.65573|.	0.936;0.936|.	T|T	0.68413|0.68413	-0.5415|-0.5415	10|5	0.37606|.	T|.	0.19|.	-23.8231|-23.8231	17.3623|17.3623	0.87354|0.87354	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	104;104|.	B3KQQ4;Q96BY9|.	.;TMM66_HUMAN|.	G|D	104;68;2;68;95|104	ENSP00000256255:A104G;ENSP00000428323:A2G;ENSP00000429630:A68G;ENSP00000428832:A95G|.	ENSP00000256255:A104G|.	A|H	-|-	2|1	0|0	TMEM66|TMEM66	30047089|30047089	0.998000|0.998000	0.40836|0.40836	0.308000|0.308000	0.25141|0.25141	0.398000|0.398000	0.30690|0.30690	5.082000|5.082000	0.64450|0.64450	2.715000|2.715000	0.92844|0.92844	0.585000|0.585000	0.79938|0.79938	GCA|CAT	.	.		0.358	TMEM66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257254.4		
LYN	4067	hgsc.bcm.edu	37	8	56866505	56866505	+	Missense_Mutation	SNP	A	A	G			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr8:56866505A>G	ENST00000519728.1	+	8	1048	c.752A>G	c.(751-753)aAa>aGa	p.K251R	LYN_ENST00000520220.2_Missense_Mutation_p.K230R	NM_002350.3	NP_002341.1	P07948	LYN_HUMAN	LYN proto-oncogene, Src family tyrosine kinase	251	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to extracellular stimulus (GO:0031668)|cellular response to heat (GO:0034605)|cellular response to retinoic acid (GO:0071300)|cytokine secretion (GO:0050663)|dendritic cell differentiation (GO:0097028)|erythrocyte differentiation (GO:0030218)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|Fc receptor mediated stimulatory signaling pathway (GO:0002431)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|histamine secretion by mast cell (GO:0002553)|immune response-regulating cell surface receptor signaling pathway (GO:0002768)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|leukocyte migration (GO:0050900)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of immune response (GO:0050777)|negative regulation of intracellular signal transduction (GO:1902532)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of mast cell proliferation (GO:0070667)|negative regulation of myeloid leukocyte differentiation (GO:0002762)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|neuron projection development (GO:0031175)|oligodendrocyte development (GO:0014003)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of Fc receptor mediated stimulatory signaling pathway (GO:0060369)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of mast cell proliferation (GO:0070668)|positive regulation of neuron projection development (GO:0010976)|positive regulation of oligodendrocyte progenitor proliferation (GO:0070447)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of stress-activated protein kinase signaling cascade (GO:0070304)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of B cell apoptotic process (GO:0002902)|regulation of B cell receptor signaling pathway (GO:0050855)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cytokine production (GO:0001817)|regulation of cytokine secretion (GO:0050707)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of erythrocyte differentiation (GO:0045646)|regulation of inflammatory response (GO:0050727)|regulation of mast cell activation (GO:0033003)|regulation of mast cell degranulation (GO:0043304)|regulation of monocyte chemotaxis (GO:0090025)|regulation of platelet aggregation (GO:0090330)|regulation of protein phosphorylation (GO:0001932)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|response to amino acid (GO:0043200)|response to axon injury (GO:0048678)|response to carbohydrate (GO:0009743)|response to drug (GO:0042493)|response to hormone (GO:0009725)|response to insulin (GO:0032868)|response to organic cyclic compound (GO:0014070)|response to sterol depletion (GO:0006991)|response to toxic substance (GO:0009636)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|T cell costimulation (GO:0031295)|tolerance induction to self antigen (GO:0002513)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integrin alpha2-beta1 complex (GO:0034666)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|mitochondrial crista (GO:0030061)|mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|glycosphingolipid binding (GO:0043208)|ion channel binding (GO:0044325)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	22		all_lung(136;0.0555)|Lung NSC(129;0.0726)|all_epithelial(80;0.0772)	Epithelial(17;0.000834)|all cancers(17;0.00598)		Bosutinib(DB06616)|Ponatinib(DB08901)	AAGTTGGTGAAAAGGCTTGGC	0.527																																					p.K251R		Atlas-SNP	.											.	LYN	54	.	0			c.A752G						.						108.0	106.0	107.0					8																	56866505		2203	4300	6503	SO:0001583	missense	4067	exon8			TGGTGAAAAGGCT	M16038	CCDS6162.1, CCDS47859.1	8q13	2014-06-25	2014-06-25		ENSG00000254087	ENSG00000254087		"""SH2 domain containing"""	6735	protein-coding gene	gene with protein product		165120	"""v-yes-1 Yamaguchi sarcoma viral related oncogene homolog"""			3561390	Standard	NM_002350		Approved	JTK8	uc003xsk.4	P07948	OTTHUMG00000044345	ENST00000519728.1:c.752A>G	chr8.hg19:g.56866505A>G	ENSP00000428924:p.Lys251Arg	131.0	0.0		200.0	63.0	NM_002350	A0AVQ5	Missense_Mutation	SNP	ENST00000519728.1	hg19	CCDS6162.1	.	.	.	.	.	.	.	.	.	.	A	9.355	1.066606	0.20067	.	.	ENSG00000254087	ENST00000519728;ENST00000520220	T;T	0.11495	2.77;2.77	5.08	5.08	0.68730	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);SH2 motif (1);Protein kinase, catalytic domain (1);	0.041699	0.85682	D	0.000000	T	0.05593	0.0147	N	0.05199	-0.095	0.80722	D	1	B;B	0.12630	0.006;0.002	B;B	0.20577	0.03;0.02	T	0.22730	-1.0208	10	0.07030	T	0.85	.	15.1358	0.72566	1.0:0.0:0.0:0.0	.	321;251	Q6NUK7;P07948	.;LYN_HUMAN	R	251;230	ENSP00000428924:K251R;ENSP00000428424:K230R	ENSP00000428924:K251R	K	+	2	0	LYN	57029059	1.000000	0.71417	0.961000	0.40146	0.414000	0.31173	7.363000	0.79516	2.049000	0.60858	0.528000	0.53228	AAA	.	.		0.527	LYN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378155.1	NM_002350	
PKHD1L1	93035	hgsc.bcm.edu	37	8	110509162	110509162	+	Missense_Mutation	SNP	G	G	C	rs562593738		TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr8:110509162G>C	ENST00000378402.5	+	64	10446	c.10342G>C	c.(10342-10344)Gtg>Ctg	p.V3448L		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	3448					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			GTTTAATCCTGTGGAAAAGTG	0.363										HNSCC(38;0.096)																											p.V3448L		Atlas-SNP	.											.	PKHD1L1	522	.	0			c.G10342C						.						147.0	139.0	141.0					8																	110509162		1814	4078	5892	SO:0001583	missense	93035	exon64			AATCCTGTGGAAA	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.10342G>C	chr8.hg19:g.110509162G>C	ENSP00000367655:p.Val3448Leu	82.0	0.0		115.0	37.0	NM_177531	Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	hg19	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	G	10.55	1.381104	0.24944	.	.	ENSG00000205038	ENST00000378402;ENST00000526472	T;T	0.80214	-1.35;-1.35	5.64	-7.4	0.01397	Pectin lyase fold/virulence factor (1);	1.157390	0.06179	N	0.679125	T	0.64994	0.2649	L	0.43152	1.355	0.09310	N	1	B	0.06786	0.001	B	0.11329	0.006	T	0.47736	-0.9094	10	0.26408	T	0.33	.	1.9622	0.03388	0.1516:0.2546:0.3643:0.2295	.	3448	Q86WI1	PKHL1_HUMAN	L	3448;376	ENSP00000367655:V3448L;ENSP00000437376:V376L	ENSP00000367655:V3448L	V	+	1	0	PKHD1L1	110578338	0.002000	0.14202	0.000000	0.03702	0.211000	0.24417	-0.063000	0.11655	-1.258000	0.02471	-0.806000	0.03193	GTG	.	.		0.363	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
KANK1	23189	hgsc.bcm.edu	37	9	730216	730216	+	Missense_Mutation	SNP	T	T	A			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr9:730216T>A	ENST00000382303.1	+	8	3516	c.2864T>A	c.(2863-2865)cTg>cAg	p.L955Q	KANK1_ENST00000382293.3_Missense_Mutation_p.L797Q|KANK1_ENST00000489369.1_3'UTR|KANK1_ENST00000382297.2_Missense_Mutation_p.L955Q	NM_001256876.1	NP_001243805.1	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1	955					negative regulation of actin filament polymerization (GO:0030837)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lamellipodium morphogenesis (GO:2000393)|negative regulation of neuron projection development (GO:0010977)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of wound healing (GO:0090303)|regulation of establishment of cell polarity (GO:2000114)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	beta-catenin binding (GO:0008013)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|stomach(4)|upper_aerodigestive_tract(1)	43		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		CCAGTGAACCTGACAGACGAC	0.532																																					p.L955Q		Atlas-SNP	.											.	KANK1	231	.	0			c.T2864A						.						74.0	63.0	67.0					9																	730216		2203	4300	6503	SO:0001583	missense	23189	exon8			TGAACCTGACAGA	AL833161	CCDS6441.1, CCDS34976.1	9p24.3	2013-01-10	2008-01-29	2008-01-29	ENSG00000107104	ENSG00000107104		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	19309	protein-coding gene	gene with protein product		607704	"""ankyrin repeat domain 15"""	ANKRD15		12133830, 17996375, 19554261	Standard	NM_015158		Approved	KIAA0172, KANK	uc003zgn.2	Q14678	OTTHUMG00000019434	ENST00000382303.1:c.2864T>A	chr9.hg19:g.730216T>A	ENSP00000371740:p.Leu955Gln	77.0	0.0		132.0	52.0	NM_001256876	A2A2W8|D3DRH3|Q5W0W0|Q8IY65|Q8WX74	Missense_Mutation	SNP	ENST00000382303.1	hg19	CCDS34976.1	.	.	.	.	.	.	.	.	.	.	T	9.970	1.225126	0.22457	.	.	ENSG00000107104	ENST00000382303;ENST00000354485;ENST00000382297;ENST00000382293	T;T;T	0.18960	2.18;2.18;2.18	5.91	4.71	0.59529	.	0.163209	0.29280	N	0.012607	T	0.14141	0.0342	L	0.31664	0.95	0.80722	D	1	P;B	0.38617	0.64;0.067	B;B	0.32465	0.146;0.011	T	0.03818	-1.1001	10	0.52906	T	0.07	-0.2898	10.8049	0.46512	0.1408:0.0:0.0:0.8592	.	955;955	Q5W0W1;Q14678	.;KANK1_HUMAN	Q	955;955;955;797	ENSP00000371740:L955Q;ENSP00000371734:L955Q;ENSP00000371730:L797Q	ENSP00000346479:L955Q	L	+	2	0	KANK1	720216	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	2.295000	0.43576	2.266000	0.75297	0.533000	0.62120	CTG	.	.		0.532	KANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051484.2	NM_015158	
RANBP6	26953	hgsc.bcm.edu	37	9	6015125	6015125	+	Missense_Mutation	SNP	G	G	T	rs149927185		TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr9:6015125G>T	ENST00000259569.5	-	1	493	c.483C>A	c.(481-483)caC>caA	p.H161Q	RANBP6_ENST00000485372.1_Intron	NM_001243202.1|NM_001243203.1|NM_012416.3	NP_001230131.1|NP_001230132.1|NP_036548.1	O60518	RNBP6_HUMAN	RAN binding protein 6	161					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(5)|large_intestine(8)|lung(9)|ovary(7)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)		GCCAGAAAACGTGAAGTGCAA	0.433																																					p.H161Q		Atlas-SNP	.											.	RANBP6	127	.	0			c.C483A						.						57.0	56.0	56.0					9																	6015125		2203	4300	6503	SO:0001583	missense	26953	exon1			GAAAACGTGAAGT	AF039023	CCDS6467.1	9p24.1	2008-03-26			ENSG00000137040	ENSG00000137040			9851	protein-coding gene	gene with protein product							Standard	NM_001243202		Approved		uc003zjr.3	O60518	OTTHUMG00000019512	ENST00000259569.5:c.483C>A	chr9.hg19:g.6015125G>T	ENSP00000259569:p.His161Gln	90.0	0.0		128.0	38.0	NM_012416	Q5T7X4|Q7Z3V2|Q96E78	Missense_Mutation	SNP	ENST00000259569.5	hg19	CCDS6467.1	.	.	.	.	.	.	.	.	.	.	G	6.613	0.481597	0.12581	.	.	ENSG00000137040	ENST00000259569	T	0.66995	-0.24	4.51	-0.395	0.12431	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.44519	0.1297	N	0.25890	0.77	0.50313	D	0.99986	B	0.33919	0.432	B	0.28465	0.09	T	0.12708	-1.0537	10	0.29301	T	0.29	-6.4829	8.7868	0.34825	0.4187:0.0:0.5813:0.0	.	161	O60518	RNBP6_HUMAN	Q	161	ENSP00000259569:H161Q	ENSP00000259569:H161Q	H	-	3	2	RANBP6	6005125	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	1.025000	0.30090	-0.068000	0.12953	0.561000	0.74099	CAC	.	G|1.000;A|0.000		0.433	RANBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051650.1	NM_012416	
KIAA1958	158405	hgsc.bcm.edu	37	9	115337345	115337345	+	Nonsense_Mutation	SNP	C	C	T			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr9:115337345C>T	ENST00000337530.6	+	2	1281	c.985C>T	c.(985-987)Cag>Tag	p.Q329*	KIAA1958_ENST00000374244.3_Nonsense_Mutation_p.Q329*|KIAA1958_ENST00000536272.1_Nonsense_Mutation_p.Q329*	NM_133465.2	NP_597722.1	Q8N8K9	K1958_HUMAN	KIAA1958	329										endometrium(1)|large_intestine(9)|lung(10)|prostate(2)|skin(3)	25						GTCTGCCCTGCAGCTGCCTGG	0.552																																					p.Q329X		Atlas-SNP	.											.	KIAA1958	52	.	0			c.C985T						.						226.0	213.0	217.0					9																	115337345		2203	4300	6503	SO:0001587	stop_gained	158405	exon2			GCCCTGCAGCTGC	AB075838	CCDS35108.1, CCDS69642.1	9q33.1	2009-09-22			ENSG00000165185	ENSG00000165185			23427	protein-coding gene	gene with protein product							Standard	NM_001287038		Approved	FLJ39294	uc004bgf.1	Q8N8K9	OTTHUMG00000020508	ENST00000337530.6:c.985C>T	chr9.hg19:g.115337345C>T	ENSP00000336940:p.Gln329*	42.0	0.0		55.0	16.0	NM_133465	B7ZKW6|Q2M336|Q5T252|Q8TF43|Q96N02	Nonsense_Mutation	SNP	ENST00000337530.6	hg19	CCDS35108.1	.	.	.	.	.	.	.	.	.	.	C	36	5.657210	0.96724	.	.	ENSG00000165185	ENST00000337530;ENST00000374244;ENST00000536272	.	.	.	5.92	5.92	0.95590	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	-14.168	20.3214	0.98679	0.0:1.0:0.0:0.0	.	.	.	.	X	329	.	ENSP00000336940:Q329X	Q	+	1	0	KIAA1958	114377166	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.786000	0.69006	2.804000	0.96469	0.655000	0.94253	CAG	.	.		0.552	KIAA1958-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053690.1	NM_133465	
RGS3	5998	hgsc.bcm.edu	37	9	116303703	116303703	+	Intron	SNP	G	G	T			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr9:116303703G>T	ENST00000374140.2	+	20	2246				RGS3_ENST00000462143.1_Intron|RGS3_ENST00000350696.5_Intron|RGS3_ENST00000394646.3_Intron|RGS3_ENST00000317613.6_Missense_Mutation_p.G602V|RGS3_ENST00000343817.5_Intron|RGS3_ENST00000374136.1_Missense_Mutation_p.G340V	NM_001282923.1|NM_144488.4	NP_001269852.1|NP_652759.3	P49796	RGS3_HUMAN	regulator of G-protein signaling 3						inactivation of MAPK activity (GO:0000188)|positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			cervix(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	48						ACTCTGATTGGCTGAGCAAAC	0.552																																					p.G602V		Atlas-SNP	.											.	RGS3	251	.	0			c.G1805T						.						156.0	164.0	162.0					9																	116303703		2203	4300	6503	SO:0001627	intron_variant	5998	exon18			TGATTGGCTGAGC	AF006610	CCDS6797.1, CCDS6798.1, CCDS35113.1, CCDS35114.1, CCDS43869.1, CCDS65111.1	9q32	2008-02-05	2007-08-14		ENSG00000138835	ENSG00000138835		"""Regulators of G-protein signaling"""	9999	protein-coding gene	gene with protein product		602189	"""regulator of G-protein signalling 3"""			8602223, 11034339	Standard	NM_001276260		Approved	C2PA, FLJ20370, PDZ-RGS3	uc004bhq.4	P49796	OTTHUMG00000021048	ENST00000374140.2:c.2037+4505G>T	chr9.hg19:g.116303703G>T		75.0	0.0		120.0	41.0	NM_017790	A6NHA0|A8K0V1|B3KUB2|Q5VXB8|Q5VXC1|Q5VZ05|Q5VZ06|Q6ZRM5|Q8IUQ1|Q8NC47|Q8NFN4|Q8NFN5|Q8NFN6|Q8TD59|Q8TD68|Q8WV02|Q8WXA0	Missense_Mutation	SNP	ENST00000374140.2	hg19	CCDS43869.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.604822	0.87157	.	.	ENSG00000138835	ENST00000317613;ENST00000374136	T	0.40476	1.03	5.5	5.5	0.81552	.	.	.	.	.	T	0.55146	0.1902	L	0.36672	1.1	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.56980	-0.7889	9	0.87932	D	0	.	14.887	0.70575	0.0:0.0:1.0:0.0	.	340;602	Q5VXC0;P49796-5	.;.	V	602;340	ENSP00000312844:G602V	ENSP00000312844:G602V	G	+	2	0	RGS3	115343524	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.540000	0.53611	2.578000	0.87016	0.650000	0.86243	GGC	.	.		0.552	RGS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055561.3	NM_017790	
COL5A1	1289	hgsc.bcm.edu	37	9	137688730	137688730	+	Missense_Mutation	SNP	G	G	A			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr9:137688730G>A	ENST00000371817.3	+	36	3295	c.2881G>A	c.(2881-2883)Gga>Aga	p.G961R		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	961	Triple-helical region.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		AGGATTTCCTGGACCAAAGGG	0.592																																					p.G961R		Atlas-SNP	.											.	COL5A1	323	.	0			c.G2881A						.						66.0	76.0	72.0					9																	137688730		2203	4300	6503	SO:0001583	missense	1289	exon36			TTTCCTGGACCAA	D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.2881G>A	chr9.hg19:g.137688730G>A	ENSP00000360882:p.Gly961Arg	94.0	0.0		122.0	35.0	NM_000093	Q15094|Q5SUX4	Missense_Mutation	SNP	ENST00000371817.3	hg19	CCDS6982.1	.	.	.	.	.	.	.	.	.	.	g	18.48	3.633692	0.67130	.	.	ENSG00000130635	ENST00000371817	D	0.99186	-5.53	4.72	4.72	0.59763	.	0.000000	0.85682	U	0.000000	D	0.99582	0.9849	H	0.97707	4.06	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97641	1.0148	10	0.87932	D	0	.	17.6509	0.88163	0.0:0.0:1.0:0.0	.	961	P20908	CO5A1_HUMAN	R	961	ENSP00000360882:G961R	ENSP00000360882:G961R	G	+	1	0	COL5A1	136828551	1.000000	0.71417	0.998000	0.56505	0.845000	0.48019	9.493000	0.97960	2.149000	0.67028	0.443000	0.29094	GGA	.	.		0.592	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2	NM_000093	
MYO3A	53904	hgsc.bcm.edu	37	10	26462696	26462696	+	Missense_Mutation	SNP	C	C	A			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr10:26462696C>A	ENST00000265944.5	+	30	3669	c.3503C>A	c.(3502-3504)aCt>aAt	p.T1168N	MYO3A_ENST00000543632.1_Intron	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	1168					ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						AAGACTTCCACTTTCAAACCT	0.368																																					p.T1168N		Atlas-SNP	.											.	MYO3A	371	.	0			c.C3503A						.						56.0	55.0	56.0					10																	26462696		2203	4300	6503	SO:0001583	missense	53904	exon30			CTTCCACTTTCAA	AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.3503C>A	chr10.hg19:g.26462696C>A	ENSP00000265944:p.Thr1168Asn	177.0	0.0		222.0	75.0	NM_017433	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	ENST00000265944.5	hg19	CCDS7148.1	.	.	.	.	.	.	.	.	.	.	C	4.130	0.022448	0.08006	.	.	ENSG00000095777	ENST00000265944	T	0.76709	-1.04	5.42	1.2	0.21068	.	1.502560	0.02945	N	0.140997	T	0.62962	0.2471	L	0.27053	0.805	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40308	-0.9570	10	0.17832	T	0.49	.	2.5718	0.04797	0.1145:0.4507:0.2172:0.2176	.	1168	Q8NEV4	MYO3A_HUMAN	N	1168	ENSP00000265944:T1168N	ENSP00000265944:T1168N	T	+	2	0	MYO3A	26502702	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	0.582000	0.23834	0.334000	0.23590	0.655000	0.94253	ACT	.	.		0.368	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	NM_017433	
LRRC20	55222	hgsc.bcm.edu	37	10	72061218	72061218	+	Silent	SNP	G	G	A			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr10:72061218G>A	ENST00000355790.4	-	5	924	c.447C>T	c.(445-447)atC>atT	p.I149I	LRRC20_ENST00000373224.1_Silent_p.I149I|LRRC20_ENST00000395010.1_Silent_p.I93I|LRRC20_ENST00000358141.2_Silent_p.I99I|LRRC20_ENST00000395011.1_Silent_p.I99I	NM_001278212.1|NM_001278214.1|NM_207119.1	NP_001265141.1|NP_001265143.1|NP_997002.1	Q8TCA0	LRC20_HUMAN	leucine rich repeat containing 20	149										endometrium(2)|large_intestine(4)|lung(2)|urinary_tract(1)	9						AGCGGAGGTTGATGCTGCGCA	0.602																																					p.I149I		Atlas-SNP	.											.	LRRC20	19	.	0			c.C447T						.						125.0	120.0	122.0					10																	72061218		2203	4300	6503	SO:0001819	synonymous_variant	55222	exon5			GAGGTTGATGCTG	BC024001	CCDS7300.1, CCDS7301.1, CCDS7302.1, CCDS73145.1	10q22.2	2004-04-15			ENSG00000172731	ENSG00000172731			23421	protein-coding gene	gene with protein product							Standard	NM_207119		Approved	FLJ10751, FLJ10844	uc031pvr.1	Q8TCA0	OTTHUMG00000018407	ENST00000355790.4:c.447C>T	chr10.hg19:g.72061218G>A		45.0	0.0		61.0	17.0	NM_207119	Q5T6D4|Q5T6D6|Q9NVA6|Q9NVG3	Silent	SNP	ENST00000355790.4	hg19	CCDS7302.1																																																																																			.	.		0.602	LRRC20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048510.1	NM_018239	
SORCS1	114815	hgsc.bcm.edu	37	10	108339004	108339004	+	Intron	SNP	A	A	G			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr10:108339004A>G	ENST00000263054.6	-	25	3379				SORCS1_ENST00000369698.1_Missense_Mutation_p.I661T|SORCS1_ENST00000344440.6_Missense_Mutation_p.I1126T	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1						neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		AATCCCCGGGATCTTCCTAAA	0.463																																					p.I1126T		Atlas-SNP	.											.	SORCS1	534	.	0			c.T3377C						.						136.0	131.0	132.0					10																	108339004		2203	4300	6503	SO:0001627	intron_variant	114815	exon26			CCCGGGATCTTCC	AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.3371+122T>C	chr10.hg19:g.108339004A>G		56.0	0.0		77.0	6.0	NM_001206572	A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	ENST00000263054.6	hg19	CCDS7559.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.47|16.47	3.132160|3.132160	0.56828|0.56828	.|.	.|.	ENSG00000108018|ENSG00000108018	ENST00000369698;ENST00000344440|ENST00000452214	T;T|.	0.25749|.	1.78;2.35|.	5.68|5.68	5.68|5.68	0.88126|0.88126	.|.	0.418903|.	0.24720|.	N|.	0.036157|.	T|T	0.68403|0.68403	0.2997|0.2997	L|L	0.50333|0.50333	1.59|1.59	0.49798|0.49798	D|D	0.999827|0.999827	D;D|.	0.71674|.	0.998;0.973|.	D;P|.	0.72982|.	0.979;0.885|.	T|T	0.66097|0.66097	-0.6008|-0.6008	9|5	.|.	.|.	.|.	-4.822|-4.822	15.9315|15.9315	0.79663|0.79663	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	1126;1126|.	Q8WY21-3;Q8WY21-2|.	.;.|.	T|P	661;1126|141	ENSP00000358712:I661T;ENSP00000345964:I1126T|.	.|.	I|S	-|-	2|1	0|0	SORCS1|SORCS1	108328994|108328994	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.979000|0.979000	0.70002|0.70002	8.962000|8.962000	0.93254|0.93254	2.176000|2.176000	0.68965|0.68965	0.455000|0.455000	0.32223|0.32223	ATC|TCC	.	.		0.463	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	NM_052918	
OR5L1	219437	hgsc.bcm.edu	37	11	55579715	55579715	+	Missense_Mutation	SNP	T	T	G			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr11:55579715T>G	ENST00000333973.2	+	1	862	c.773T>G	c.(772-774)aTt>aGt	p.I258S		NM_001004738.1	NP_001004738.1	Q8NGL2	OR5L1_HUMAN	olfactory receptor, family 5, subfamily L, member 1	258						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(4)|liver(4)|lung(36)|ovary(2)|pancreas(1)|prostate(5)|skin(9)|stomach(4)|upper_aerodigestive_tract(3)	78		all_epithelial(135;0.208)				GTCCTTTCCATTTATTGCAGG	0.512																																					p.I258S		Atlas-SNP	.											.	OR5L1	145	.	0			c.T773G						.						121.0	104.0	110.0					11																	55579715		2200	4296	6496	SO:0001583	missense	219437	exon1			TTTCCATTTATTG	AB065780	CCDS31509.1	11q11	2012-08-09			ENSG00000186117	ENSG00000186117		"""GPCR / Class A : Olfactory receptors"""	8350	protein-coding gene	gene with protein product							Standard	NM_001004738		Approved	OST262	uc001nhw.1	Q8NGL2	OTTHUMG00000166810	ENST00000333973.2:c.773T>G	chr11.hg19:g.55579715T>G	ENSP00000335529:p.Ile258Ser	70.0	0.0		112.0	33.0	NM_001004738	B2RNK6|Q6IFD0	Missense_Mutation	SNP	ENST00000333973.2	hg19	CCDS31509.1	.	.	.	.	.	.	.	.	.	.	t	9.996	1.232216	0.22626	.	.	ENSG00000186117	ENST00000333973	T	0.00145	8.67	4.12	2.96	0.34315	GPCR, rhodopsin-like superfamily (1);	0.509225	0.18083	N	0.152222	T	0.00178	0.0005	L	0.54965	1.715	0.09310	N	1	B	0.15473	0.013	B	0.23018	0.043	T	0.33854	-0.9852	10	0.62326	D	0.03	-12.5116	7.1659	0.25689	0.0:0.1959:0.0:0.8041	.	258	Q8NGL2	OR5L1_HUMAN	S	258	ENSP00000335529:I258S	ENSP00000335529:I258S	I	+	2	0	OR5L1	55336291	0.000000	0.05858	0.001000	0.08648	0.090000	0.18270	0.264000	0.18497	0.472000	0.27344	0.352000	0.21897	ATT	.	.		0.512	OR5L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391514.1	NM_001004738	
HEPHL1	341208	hgsc.bcm.edu	37	11	93836112	93836112	+	Missense_Mutation	SNP	A	A	G			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr11:93836112A>G	ENST00000315765.9	+	15	2616	c.2608A>G	c.(2608-2610)Aaa>Gaa	p.K870E		NM_001098672.1	NP_001092142.1	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1	870	Plastocyanin-like 5.				copper ion transport (GO:0006825)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	61		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				GAATATCCCTAAAAGATCCGG	0.338																																					p.K870E		Atlas-SNP	.											.	HEPHL1	144	.	0			c.A2608G						.						72.0	68.0	70.0					11																	93836112		1796	4056	5852	SO:0001583	missense	341208	exon15			ATCCCTAAAAGAT	BX641008	CCDS44710.1	11q21	2008-02-05			ENSG00000181333	ENSG00000181333			30477	protein-coding gene	gene with protein product							Standard	NM_001098672		Approved	DKFZp686F22190	uc001pep.2	Q6MZM0	OTTHUMG00000167751	ENST00000315765.9:c.2608A>G	chr11.hg19:g.93836112A>G	ENSP00000313699:p.Lys870Glu	68.0	0.0		86.0	32.0	NM_001098672	Q3C1W7	Missense_Mutation	SNP	ENST00000315765.9	hg19	CCDS44710.1	.	.	.	.	.	.	.	.	.	.	A	1.891	-0.455586	0.04540	.	.	ENSG00000181333	ENST00000315765	D	0.97850	-4.57	5.16	4.04	0.47022	Cupredoxin (2);Multicopper oxidase, type 3 (1);	0.155825	0.64402	D	0.000020	D	0.88466	0.6444	N	0.02854	-0.475	0.31325	N	0.685564	B	0.15930	0.015	B	0.19946	0.027	T	0.81254	-0.1016	10	0.02654	T	1	-16.266	4.0378	0.09737	0.5707:0.1749:0.2544:0.0	.	870	Q6MZM0	HPHL1_HUMAN	E	870	ENSP00000313699:K870E	ENSP00000313699:K870E	K	+	1	0	HEPHL1	93475760	0.993000	0.37304	0.997000	0.53966	0.839000	0.47603	2.238000	0.43070	0.816000	0.34421	-0.256000	0.11100	AAA	.	.		0.338	HEPHL1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396103.2	XM_291947	
ZNF202	7753	hgsc.bcm.edu	37	11	123599920	123599920	+	Missense_Mutation	SNP	C	C	A			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr11:123599920C>A	ENST00000529691.1	-	4	835	c.616G>T	c.(616-618)Gtc>Ttc	p.V206F	ZNF202_ENST00000336139.4_Missense_Mutation_p.V206F|ZNF202_ENST00000530393.1_Missense_Mutation_p.V206F			O95125	ZN202_HUMAN	zinc finger protein 202	206					lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.03)		GGCACTGGGACCTCTATGAAG	0.517																																					p.V206F		Atlas-SNP	.											.	ZNF202	72	.	0			c.G616T						.						58.0	55.0	56.0					11																	123599920		2202	4299	6501	SO:0001583	missense	7753	exon6			CTGGGACCTCTAT	AF027219	CCDS8443.1	11q23.3	2013-01-09				ENSG00000166261		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12994	protein-coding gene	gene with protein product		603430				9790754	Standard	XM_005271659		Approved	ZKSCAN10, ZSCAN42	uc001pzd.1	O95125		ENST00000529691.1:c.616G>T	chr11.hg19:g.123599920C>A	ENSP00000433881:p.Val206Phe	30.0	0.0		47.0	21.0	NM_003455	B0LPH9|Q4JG21|Q9H1B9|Q9NSM4	Missense_Mutation	SNP	ENST00000529691.1	hg19	CCDS8443.1	.	.	.	.	.	.	.	.	.	.	C	12.23	1.874620	0.33069	.	.	ENSG00000166261	ENST00000336139;ENST00000530393;ENST00000529691	T;T;T	0.06371	3.31;3.31;3.31	5.32	1.07	0.20283	.	0.637749	0.12998	N	0.421874	T	0.04588	0.0125	L	0.29908	0.895	0.24721	N	0.993142	B	0.25719	0.132	B	0.21917	0.037	T	0.44314	-0.9336	10	0.15066	T	0.55	-2.8232	9.0697	0.36484	0.1507:0.364:0.4853:0.0	.	206	O95125	ZN202_HUMAN	F	206	ENSP00000337724:V206F;ENSP00000432504:V206F;ENSP00000433881:V206F	ENSP00000337724:V206F	V	-	1	0	ZNF202	123105130	0.069000	0.21087	0.516000	0.27786	0.639000	0.38242	0.012000	0.13287	0.597000	0.29811	-0.312000	0.09012	GTC	.	.		0.517	ZNF202-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387419.1	NM_003455	
PRMT8	56341	hgsc.bcm.edu	37	12	3692299	3692299	+	Missense_Mutation	SNP	G	G	A			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr12:3692299G>A	ENST00000382622.3	+	8	1294	c.904G>A	c.(904-906)Gac>Aac	p.D302N	PRMT8_ENST00000452611.2_Missense_Mutation_p.D293N|PRMT8_ENST00000261252.4_3'UTR	NM_019854.4	NP_062828.3	Q9NR22	ANM8_HUMAN	protein arginine methyltransferase 8	302	SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				histone arginine methylation (GO:0034969)|histone H4-R3 methylation (GO:0043985)|histone methylation (GO:0016571)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|regulation of protein binding (GO:0043393)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	histone methyltransferase activity (H4-R3 specific) (GO:0044020)|histone-arginine N-methyltransferase activity (GO:0008469)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|protein-arginine omega-N monomethyltransferase activity (GO:0035241)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(9)|lung(14)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)	37			OV - Ovarian serous cystadenocarcinoma(31;0.0109)|COAD - Colon adenocarcinoma(12;0.0264)			ACAGCGCAACGACTACGTCCA	0.483																																					p.D302N		Atlas-SNP	.											.	PRMT8	97	.	0			c.G904A						.						119.0	94.0	102.0					12																	3692299		2203	4300	6503	SO:0001583	missense	56341	exon8			CGCAACGACTACG	AF263539	CCDS8521.2, CCDS58200.1	12p13.3	2006-03-03	2006-02-16	2006-02-16	ENSG00000111218	ENSG00000111218		"""Protein arginine methyltransferases"""	5188	protein-coding gene	gene with protein product		610086	"""HMT1 hnRNP methyltransferase-like 3 (S. cerevisiae)"", ""HMT1 hnRNP methyltransferase-like 4 (S. cerevisiae)"""	HRMT1L3, HRMT1L4		16051612	Standard	NM_019854		Approved		uc001qmf.4	Q9NR22	OTTHUMG00000128493	ENST00000382622.3:c.904G>A	chr12.hg19:g.3692299G>A	ENSP00000372067:p.Asp302Asn	69.0	0.0		108.0	40.0	NM_019854	B2RDP0|Q8TBJ8	Missense_Mutation	SNP	ENST00000382622.3	hg19	CCDS8521.2	.	.	.	.	.	.	.	.	.	.	G	20.9	4.062770	0.76187	.	.	ENSG00000111218	ENST00000452611;ENST00000382622	D;D	0.84660	-1.88;-1.88	5.55	5.55	0.83447	.	0.134229	0.64402	D	0.000003	D	0.93854	0.8034	M	0.93241	3.395	0.80722	D	1	D;D	0.76494	0.999;0.997	P;P	0.62649	0.905;0.841	D	0.95141	0.8264	10	0.87932	D	0	.	17.0578	0.86539	0.0:0.0:1.0:0.0	.	293;302	Q9NR22-2;Q9NR22	.;ANM8_HUMAN	N	293;302	ENSP00000414507:D293N;ENSP00000372067:D302N	ENSP00000372067:D302N	D	+	1	0	PRMT8	3562560	1.000000	0.71417	0.992000	0.48379	0.322000	0.28314	9.869000	0.99810	2.625000	0.88918	0.650000	0.86243	GAC	.	.		0.483	PRMT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250297.2	NM_019854	
BHLHE41	79365	hgsc.bcm.edu	37	12	26275865	26275865	+	Missense_Mutation	SNP	C	C	T			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr12:26275865C>T	ENST00000242728.4	-	5	930	c.583G>A	c.(583-585)Gcc>Acc	p.A195T	RP11-283G6.3_ENST00000545819.1_RNA|RP11-283G6.3_ENST00000535914.1_RNA	NM_030762.2	NP_110389.1	Q9C0J9	BHE41_HUMAN	basic helix-loop-helix family, member e41	195					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|circadian regulation of gene expression (GO:0032922)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ morphogenesis (GO:0009887)	nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|histone deacetylase binding (GO:0042826)|MRF binding (GO:0043426)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|transcription corepressor activity (GO:0003714)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(1)	5						GACCCGGCGGCCGAGGGAGCG	0.711																																					p.A195T		Atlas-SNP	.											.	BHLHE41	20	.	0			c.G583A						.						6.0	9.0	8.0					12																	26275865		2055	4080	6135	SO:0001583	missense	79365	exon5			CGGCGGCCGAGGG	AB044088	CCDS8706.1	12p12.1	2011-12-05	2009-01-12	2009-01-12	ENSG00000123095	ENSG00000123095		"""Basic helix-loop-helix proteins"""	16617	protein-coding gene	gene with protein product	"""differentially expressed in chondrocytes 2"", ""Enhancer-of-split and hairy-related protein 1"""	606200	"""basic helix-loop-helix domain containing, class B, 3"""	BHLHB3		11162494, 18557763	Standard	NM_030762		Approved	DEC2, SHARP-1, SHARP1, bHLHe41	uc001rhb.3	Q9C0J9	OTTHUMG00000169174	ENST00000242728.4:c.583G>A	chr12.hg19:g.26275865C>T	ENSP00000242728:p.Ala195Thr	121.0	0.0		161.0	50.0	NM_030762	A2I2N8	Missense_Mutation	SNP	ENST00000242728.4	hg19	CCDS8706.1	.	.	.	.	.	.	.	.	.	.	C	4.963	0.178855	0.09443	.	.	ENSG00000123095	ENST00000242728;ENST00000540731	T	0.55588	0.51	2.74	0.376	0.16193	.	1.818110	0.03319	U	0.191646	T	0.27798	0.0684	N	0.08118	0	0.58432	D	0.999999	B	0.26935	0.164	B	0.22753	0.041	T	0.39187	-0.9626	10	0.19590	T	0.45	-6.3677	1.5786	0.02629	0.1967:0.4512:0.1958:0.1562	.	195	Q9C0J9	BHE41_HUMAN	T	195	ENSP00000242728:A195T	ENSP00000242728:A195T	A	-	1	0	BHLHE41	26167132	0.812000	0.29077	0.046000	0.18839	0.407000	0.30961	1.368000	0.34216	0.235000	0.21160	0.313000	0.20887	GCC	.	.		0.711	BHLHE41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402714.1	NM_030762	
CCDC53	51019	hgsc.bcm.edu	37	12	102455087	102455087	+	Missense_Mutation	SNP	A	A	G			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr12:102455087A>G	ENST00000240079.6	-	2	250	c.89T>C	c.(88-90)cTa>cCa	p.L30P	RP11-554E23.4_ENST00000552707.1_RNA|CCDC53_ENST00000539515.1_5'UTR|CCDC53_ENST00000545679.1_Missense_Mutation_p.L30P	NM_016053.2	NP_057137.1	Q9Y3C0	CCD53_HUMAN	coiled-coil domain containing 53	30						actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|WASH complex (GO:0071203)				endometrium(1)|kidney(1)|large_intestine(1)|lung(1)	4						AAATTGGTTTAGAAAAGCCAC	0.433																																					p.L30P		Atlas-SNP	.											.	CCDC53	14	.	0			c.T89C						.						114.0	103.0	106.0					12																	102455087		1924	4129	6053	SO:0001583	missense	51019	exon2			TGGTTTAGAAAAG	AF151874	CCDS44959.1, CCDS73512.1	12q23.3	2014-05-09			ENSG00000120860	ENSG00000120860			24256	protein-coding gene	gene with protein product						10810093, 20498093	Standard	XM_005268939		Approved	CGI-116	uc010svw.2	Q9Y3C0	OTTHUMG00000168187	ENST00000240079.6:c.89T>C	chr12.hg19:g.102455087A>G	ENSP00000240079:p.Leu30Pro	119.0	0.0		155.0	59.0	NM_016053	B2RC74|Q53FF0|Q6IAI4|Q96QK0	Missense_Mutation	SNP	ENST00000240079.6	hg19	CCDS44959.1	.	.	.	.	.	.	.	.	.	.	A	29.0	4.970400	0.92919	.	.	ENSG00000120860	ENST00000240079;ENST00000545679	.	.	.	5.93	5.93	0.95920	.	0.062101	0.64402	D	0.000004	T	0.80523	0.4639	M	0.81802	2.56	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.78314	0.975;0.991	T	0.83172	-0.0093	9	0.87932	D	0	-8.1961	16.3943	0.83563	1.0:0.0:0.0:0.0	.	30;30	F5GZ97;Q9Y3C0	.;CCD53_HUMAN	P	30	.	ENSP00000240079:L30P	L	-	2	0	CCDC53	100979217	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.673000	0.91186	2.281000	0.76405	0.533000	0.62120	CTA	.	.		0.433	CCDC53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398685.1	NM_016053	
C12orf76	400073	hgsc.bcm.edu	37	12	110496826	110496826	+	Missense_Mutation	SNP	A	A	T			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr12:110496826A>T	ENST00000309050.5	-	3	522	c.158T>A	c.(157-159)aTt>aAt	p.I53N	C12orf76_ENST00000548936.1_Intron|C12orf76_ENST00000548191.1_Intron	NM_207435.1	NP_997318.1	Q8N812	CL076_HUMAN	chromosome 12 open reading frame 76	53										endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	6						tgtggtatgaatgaagcgaga	0.463																																					p.I53N		Atlas-SNP	.											.	C12orf76	10	.	0			c.T158A						.						111.0	94.0	100.0					12																	110496826		1327	2309	3636	SO:0001583	missense	400073	exon3			GTATGAATGAAGC	BC041968	CCDS9141.1	12q24.11	2012-08-16			ENSG00000174456	ENSG00000174456			33790	protein-coding gene	gene with protein product							Standard	NM_207435		Approved	FLJ40142	uc001tqe.2	Q8N812	OTTHUMG00000169315	ENST00000309050.5:c.158T>A	chr12.hg19:g.110496826A>T	ENSP00000308368:p.Ile53Asn	153.0	0.0		213.0	65.0	NM_207435		Missense_Mutation	SNP	ENST00000309050.5	hg19	CCDS9141.1	.	.	.	.	.	.	.	.	.	.	A	6.471	0.455129	0.12283	.	.	ENSG00000174456	ENST00000309050	.	.	.	1.07	1.07	0.20283	.	.	.	.	.	T	0.11153	0.0272	N	0.14661	0.345	0.09310	N	1	D	0.53885	0.963	B	0.36534	0.227	T	0.17410	-1.0370	8	0.87932	D	0	.	4.3477	0.11141	1.0:0.0:0.0:0.0	.	53	Q8N812	CL076_HUMAN	N	53	.	ENSP00000308368:I53N	I	-	2	0	C12orf76	108981209	0.002000	0.14202	0.001000	0.08648	0.024000	0.10985	1.518000	0.35877	0.713000	0.32060	0.260000	0.18958	ATT	.	.		0.463	C12orf76-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403439.2	NM_207435	
PTPN11	5781	hgsc.bcm.edu	37	12	112915714	112915714	+	Silent	SNP	C	C	A			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr12:112915714C>A	ENST00000351677.2	+	9	1185	c.987C>A	c.(985-987)gcC>gcA	p.A329A	PTPN11_ENST00000392597.1_Silent_p.A329A	NM_002834.3	NP_002825.3	Q06124	PTN11_HUMAN	protein tyrosine phosphatase, non-receptor type 11	329	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				abortive mitotic cell cycle (GO:0033277)|activation of MAPK activity (GO:0000187)|atrioventricular canal development (GO:0036302)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage checkpoint (GO:0000077)|ephrin receptor signaling pathway (GO:0048013)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|genitalia development (GO:0048806)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|hormone metabolic process (GO:0042445)|hormone-mediated signaling pathway (GO:0009755)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte migration (GO:0050900)|megakaryocyte development (GO:0035855)|multicellular organismal reproductive process (GO:0048609)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cortisol secretion (GO:0051463)|negative regulation of growth hormone secretion (GO:0060125)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ growth (GO:0035265)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of hormone secretion (GO:0046887)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of multicellular organism growth (GO:0040014)|regulation of protein export from nucleus (GO:0046825)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|T cell costimulation (GO:0031295)|triglyceride metabolic process (GO:0006641)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	insulin receptor binding (GO:0005158)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(406)|kidney(2)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(3)|stomach(3)	451						GTTACATTGCCACACAAGGCT	0.413			Mis		"""JMML, AML, MDS"""		Noonan Syndrome		Noonan syndrome																												p.A329A		Atlas-SNP	.		Dom	yes		12	12q24.1	5781	"""protein tyrosine phosphatase, non-receptor type 11"""	yes	L	.	PTPN11	623	.	0			c.C987A						.						62.0	55.0	57.0					12																	112915714		2203	4300	6503	SO:0001819	synonymous_variant	5781	exon9	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	CATTGCCACACAA	D13540	CCDS9163.1, CCDS58280.1	12q24.1	2014-09-17	2008-07-31		ENSG00000179295	ENSG00000179295		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"", ""SH2 domain containing"""	9644	protein-coding gene	gene with protein product		176876	"""Noonan syndrome 1"""	NS1		7894486, 1280823	Standard	NM_080601		Approved	BPTP3, SH-PTP2, SHP-2, PTP2C, SHP2	uc001ttx.3	Q06124	OTTHUMG00000134334	ENST00000351677.2:c.987C>A	chr12.hg19:g.112915714C>A		165.0	0.0		198.0	78.0	NM_080601	A8K1D9|Q96HD7	Silent	SNP	ENST00000351677.2	hg19	CCDS9163.1																																																																																			.	.		0.413	PTPN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259496.2		
BRCA2	675	hgsc.bcm.edu	37	13	32936724	32936724	+	Missense_Mutation	SNP	T	T	A	rs397507942		TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr13:32936724T>A	ENST00000380152.3	+	17	8103	c.7870T>A	c.(7870-7872)Tat>Aat	p.Y2624N	BRCA2_ENST00000544455.1_Missense_Mutation_p.Y2624N			P51587	BRCA2_HUMAN	breast cancer 2, early onset	2624					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		TTATAATCACTATAGATGGAT	0.378			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											p.Y2624N	Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	Atlas-SNP	.	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	.	BRCA2	812	.	0			c.T7870A						.						102.0	102.0	102.0					13																	32936724		2203	4300	6503	SO:0001583	missense	675	exon17	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	AATCACTATAGAT	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.7870T>A	chr13.hg19:g.32936724T>A	ENSP00000369497:p.Tyr2624Asn	117.0	0.0		182.0	35.0	NM_000059	O00183|O15008|Q13879|Q5TBJ7	Missense_Mutation	SNP	ENST00000380152.3	hg19	CCDS9344.1	.	.	.	.	.	.	.	.	.	.	T	26.7	4.761987	0.89932	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	D;D	0.89415	-2.51;-2.51	5.66	5.66	0.87406	DNA recombination/repair protein BRCA2, helical domain (2);	0.000000	0.85682	D	0.000000	D	0.95306	0.8477	M	0.89095	3.005	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96037	0.9021	10	0.87932	D	0	.	16.1819	0.81915	0.0:0.0:0.0:1.0	.	2624	P51587	BRCA2_HUMAN	N	2624	ENSP00000369497:Y2624N;ENSP00000439902:Y2624N	ENSP00000369497:Y2624N	Y	+	1	0	BRCA2	31834724	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.978000	0.88095	2.279000	0.76181	0.533000	0.62120	TAT	.	.		0.378	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2	NM_000059	
TPP2	7174	hgsc.bcm.edu	37	13	103268744	103268744	+	Splice_Site	SNP	A	A	T			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr13:103268744A>T	ENST00000376065.4	+	4	426		c.e4-1		TPP2_ENST00000376052.3_Splice_Site	NM_003291.2	NP_003282.2	P29144	TPP2_HUMAN	tripeptidyl peptidase II						antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|tripeptidyl-peptidase activity (GO:0008240)			breast(2)|endometrium(5)|kidney(2)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	52	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					CTGTCTTTGCAGAAAGAACGG	0.413																																					.		Atlas-SNP	.											.	TPP2	124	.	0			c.391-2A>T						.						77.0	85.0	83.0					13																	103268744		2203	4300	6503	SO:0001630	splice_region_variant	7174	exon4			CTTTGCAGAAAGA	M55169	CCDS9502.1	13q32-q33	2008-02-05			ENSG00000134900	ENSG00000134900	3.4.14.10		12016	protein-coding gene	gene with protein product		190470				1670990	Standard	NM_003291		Approved		uc001vpi.4	P29144	OTTHUMG00000017305	ENST00000376065.4:c.391-1A>T	chr13.hg19:g.103268744A>T		77.0	0.0		133.0	57.0	NM_003291	Q5VZU8	Splice_Site	SNP	ENST00000376065.4	hg19	CCDS9502.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.972224	0.74246	.	.	ENSG00000134900	ENST00000376065;ENST00000376052	.	.	.	5.54	5.54	0.83059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9801	0.80102	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TPP2	102066745	1.000000	0.71417	1.000000	0.80357	0.773000	0.43773	8.883000	0.92426	2.230000	0.72887	0.528000	0.53228	.	.	.		0.413	TPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045683.2		Intron
FAM155A	728215	hgsc.bcm.edu	37	13	107822876	107822876	+	Missense_Mutation	SNP	G	G	T			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr13:107822876G>T	ENST00000375915.2	-	3	1484	c.1346C>A	c.(1345-1347)aCg>aAg	p.T449K		NM_001080396.2	NP_001073865.1	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A	449						integral component of membrane (GO:0016021)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						TTCTTCCAGCGTGTTGATGCC	0.517																																					p.T449K		Atlas-SNP	.											.	FAM155A	82	.	0			c.C1346A						.						119.0	102.0	108.0					13																	107822876		2203	4300	6503	SO:0001583	missense	728215	exon3			TCCAGCGTGTTGA	L10374	CCDS32006.1	13q33.3	2008-04-15			ENSG00000204442	ENSG00000204442			33877	protein-coding gene	gene with protein product							Standard	NM_001080396		Approved		uc001vql.3	B1AL88	OTTHUMG00000017326	ENST00000375915.2:c.1346C>A	chr13.hg19:g.107822876G>T	ENSP00000365080:p.Thr449Lys	26.0	0.0		43.0	13.0	NM_001080396	B2RUV1|B7Z334	Missense_Mutation	SNP	ENST00000375915.2	hg19	CCDS32006.1	.	.	.	.	.	.	.	.	.	.	G	12.67	2.007445	0.35415	.	.	ENSG00000204442	ENST00000375915	T	0.12465	2.68	5.55	5.55	0.83447	.	0.564912	0.19081	N	0.123254	T	0.10337	0.0253	N	0.14661	0.345	0.34797	D	0.73633	B	0.27416	0.178	B	0.31946	0.138	T	0.18935	-1.0321	10	0.49607	T	0.09	.	12.0487	0.53495	0.0782:0.0:0.9218:0.0	.	449	B1AL88	F155A_HUMAN	K	449	ENSP00000365080:T449K	ENSP00000365080:T449K	T	-	2	0	FAM155A	106620877	1.000000	0.71417	0.291000	0.24904	0.206000	0.24218	5.929000	0.70096	2.638000	0.89438	0.638000	0.83543	ACG	.	.		0.517	FAM155A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045736.2	NM_001080396	
ING1	3621	hgsc.bcm.edu	37	13	111367802	111367802	+	Silent	SNP	G	G	T			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr13:111367802G>T	ENST00000375774.3	+	1	474	c.12G>T	c.(10-12)gtG>gtT	p.V4V	CARS2_ENST00000535398.1_5'Flank|ING1_ENST00000375775.3_Intron|ING1_ENST00000464141.1_3'UTR|ING1_ENST00000338450.7_Intron|ING1_ENST00000333219.7_Intron	NM_005537.4	NP_005528.3	Q9UK53	ING1_HUMAN	inhibitor of growth family, member 1	4					cell cycle (GO:0007049)|chromatin modification (GO:0016568)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell death (GO:0010941)	nucleus (GO:0005634)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(6)|lung(1)|ovary(1)	12	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.188)			TGTCCTTCGTGGAATGTCCTT	0.527																																					p.V4V		Atlas-SNP	.											.	ING1	106	.	0			c.G12T						.						113.0	108.0	110.0					13																	111367802		2203	4300	6503	SO:0001819	synonymous_variant	3621	exon1			CTTCGTGGAATGT		CCDS9515.1, CCDS9516.1, CCDS9517.1, CCDS9518.1	13q34	2013-01-28			ENSG00000153487	ENSG00000153487		"""Zinc fingers, PHD-type"""	6062	protein-coding gene	gene with protein product	"""inhibitor of growth 1"", ""tumor suppressor ING1"", ""growth inhibitor ING1"", ""growth inhibitory protein ING1"""	601566				8944021, 9186514	Standard	NM_198219		Approved	p33ING1, p33ING1b, p24ING1c, p33, p47, p47ING1a	uc001vri.3	Q9UK53	OTTHUMG00000017346	ENST00000375774.3:c.12G>T	chr13.hg19:g.111367802G>T		56.0	0.0		73.0	26.0	NM_001267728	O00532|O43658|Q53ZR3|Q5T9G8|Q5T9G9|Q5T9H0|Q5T9H1|Q9H007|Q9HD98|Q9HD99|Q9NS83|Q9P0U6|Q9UBC6|Q9UIJ1|Q9UIJ2|Q9UIJ3|Q9UIJ4|Q9UK52	Silent	SNP	ENST00000375774.3	hg19	CCDS9517.1																																																																																			.	.		0.527	ING1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045770.2	NM_005537	
RTN1	6252	hgsc.bcm.edu	37	14	60212764	60212764	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr14:60212764T>C	ENST00000267484.5	-	2	1012	c.677A>G	c.(676-678)gAc>gGc	p.D226G		NM_021136.2	NP_066959.1	Q16799	RTN1_HUMAN	reticulon 1	226					neuron differentiation (GO:0030182)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)				central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(30)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		GATGTCAGTGTCTTTATTCTT	0.433																																					p.D226G		Atlas-SNP	.											.	RTN1	139	.	0			c.A677G						.						228.0	225.0	226.0					14																	60212764		2203	4300	6503	SO:0001583	missense	6252	exon2			TCAGTGTCTTTAT	L10333	CCDS9740.1, CCDS9741.1	14q21-q22	2008-08-29			ENSG00000139970	ENSG00000139970			10467	protein-coding gene	gene with protein product		600865	"""neuroendocrine-specific protein"""	NSP		8275708	Standard	NM_206852		Approved		uc001xen.1	Q16799	OTTHUMG00000028947	ENST00000267484.5:c.677A>G	chr14.hg19:g.60212764T>C	ENSP00000267484:p.Asp226Gly	143.0	0.0		163.0	51.0	NM_021136	Q16800|Q16801|Q5BKZ4|Q9BQ59	Missense_Mutation	SNP	ENST00000267484.5	hg19	CCDS9740.1	.	.	.	.	.	.	.	.	.	.	T	9.821	1.185836	0.21870	.	.	ENSG00000139970	ENST00000267484;ENST00000433623	T	0.23147	1.92	5.48	3.15	0.36227	.	0.541566	0.18398	N	0.142433	T	0.19846	0.0477	L	0.50919	1.6	0.09310	N	1	B	0.16166	0.016	B	0.10450	0.005	T	0.26503	-1.0101	10	0.12766	T	0.61	.	8.2271	0.31575	0.0:0.2581:0.0:0.7419	.	226	Q16799	RTN1_HUMAN	G	226;152	ENSP00000267484:D226G	ENSP00000267484:D226G	D	-	2	0	RTN1	59282517	0.001000	0.12720	0.989000	0.46669	0.818000	0.46254	0.233000	0.17911	0.920000	0.36970	0.455000	0.32223	GAC	.	.		0.433	RTN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000072278.2		
NRDE2	55051	hgsc.bcm.edu	37	14	90756941	90756941	+	Missense_Mutation	SNP	T	T	A			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr14:90756941T>A	ENST00000354366.3	-	10	2085	c.1853A>T	c.(1852-1854)gAt>gTt	p.D618V	NRDE2_ENST00000357904.3_Missense_Mutation_p.D387V	NM_017970.3	NP_060440.2	Q9H7Z3	NRDE2_HUMAN	NRDE-2, necessary for RNA interference, domain containing	618																	CCCAATATCATCAAACAACAC	0.423																																					p.D618V		Atlas-SNP	.											.	.	.	.	0			c.A1853T						.						74.0	76.0	75.0					14																	90756941		2203	4300	6503	SO:0001583	missense	55051	exon10			ATATCATCAAACA	AK000870	CCDS9890.1	14q32.11	2012-12-14	2012-09-25	2012-09-25	ENSG00000119720	ENSG00000119720			20186	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 102"""	C14orf102			Standard	NM_017970		Approved	FLJ14051	uc001xyi.2	Q9H7Z3	OTTHUMG00000171020	ENST00000354366.3:c.1853A>T	chr14.hg19:g.90756941T>A	ENSP00000346335:p.Asp618Val	141.0	0.0		186.0	66.0	NM_017970	B4DH71|Q4G0A7|Q9NWH6	Missense_Mutation	SNP	ENST00000354366.3	hg19	CCDS9890.1	.	.	.	.	.	.	.	.	.	.	T	24.0	4.482300	0.84747	.	.	ENSG00000119720	ENST00000354366;ENST00000357904;ENST00000554464	T;T	0.33654	1.4;1.4	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.63780	0.2540	M	0.82056	2.57	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.68281	-0.5450	10	0.72032	D	0.01	-26.717	16.3322	0.83039	0.0:0.0:0.0:1.0	.	618	Q9H7Z3	CN102_HUMAN	V	618;387;197	ENSP00000346335:D618V;ENSP00000350579:D387V	ENSP00000346335:D618V	D	-	2	0	C14orf102	89826694	1.000000	0.71417	1.000000	0.80357	0.826000	0.46750	7.211000	0.77933	2.251000	0.74343	0.528000	0.53228	GAT	.	.		0.423	NRDE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411264.1	NM_017970	
DPP8	54878	hgsc.bcm.edu	37	15	65746732	65746732	+	Nonsense_Mutation	SNP	G	G	A			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr15:65746732G>A	ENST00000341861.5	-	17	3768	c.2188C>T	c.(2188-2190)Cag>Tag	p.Q730*	DPP8_ENST00000559233.1_Nonsense_Mutation_p.Q730*|DPP8_ENST00000358939.4_Intron|DPP8_ENST00000560048.2_5'UTR|DPP8_ENST00000321118.7_Nonsense_Mutation_p.Q681*|DPP8_ENST00000321147.6_Intron|DPP8_ENST00000300141.6_Nonsense_Mutation_p.Q714*|DPP8_ENST00000339244.5_Nonsense_Mutation_p.Q557*	NM_197960.2	NP_932064.1	Q6V1X1	DPP8_HUMAN	dipeptidyl-peptidase 8	730					immune response (GO:0006955)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(2)|endometrium(3)|large_intestine(11)|lung(11)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						CCTTCCACCTGATCGTCAATT	0.408																																					p.Q730X		Atlas-SNP	.											.	DPP8	78	.	0			c.C2188T						.						110.0	97.0	102.0					15																	65746732		2201	4299	6500	SO:0001587	stop_gained	54878	exon18			CCACCTGATCGTC	AF221634	CCDS10207.1, CCDS10208.1, CCDS10209.1, CCDS10210.1	15q22	2008-07-18	2006-01-12		ENSG00000074603	ENSG00000074603			16490	protein-coding gene	gene with protein product	"""dipeptidyl peptidase VIII"", ""dipeptidyl peptidase IV-related protein-1"", ""prolyl dipeptidase DPP8"""	606819	"""dipeptidylpeptidase 8"""			11012666	Standard	XM_005254500		Approved	DP8, DPRP1, MSTP141, FLJ14920, FLJ20283, MGC26191	uc002aox.3	Q6V1X1	OTTHUMG00000133150	ENST00000341861.5:c.2188C>T	chr15.hg19:g.65746732G>A	ENSP00000339208:p.Gln730*	95.0	0.0		103.0	32.0	NM_197960	Q7Z4C8|Q7Z4D3|Q7Z4E1|Q8IWG7|Q8NEM5|Q96JX1|Q9HBM2|Q9HBM3|Q9HBM4|Q9HBM5|Q9NXF4	Nonsense_Mutation	SNP	ENST00000341861.5	hg19	CCDS10207.1	.	.	.	.	.	.	.	.	.	.	G	35	5.448426	0.96205	.	.	ENSG00000074603	ENST00000341861;ENST00000300141;ENST00000321118;ENST00000339244	.	.	.	5.27	5.27	0.74061	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-41.6308	18.9065	0.92464	0.0:0.0:1.0:0.0	.	.	.	.	X	730;714;681;557	.	ENSP00000300141:Q714X	Q	-	1	0	DPP8	63533785	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	9.869000	0.99810	2.436000	0.82500	0.655000	0.94253	CAG	.	.		0.408	DPP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256847.1	NM_017743	
LOXL1	4016	hgsc.bcm.edu	37	15	74235244	74235244	+	Silent	SNP	T	T	C			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr15:74235244T>C	ENST00000261921.7	+	2	1478	c.1152T>C	c.(1150-1152)taT>taC	p.Y384Y		NM_005576.2	NP_005567.2	Q08397	LOXL1_HUMAN	lysyl oxidase-like 1	384	Lysyl-oxidase like.				extracellular matrix organization (GO:0030198)|oxidation-reduction process (GO:0055114)|protein deamination (GO:0018277)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	copper ion binding (GO:0005507)|oxidoreductase activity, acting on the CH-NH2 group of donors, oxygen as acceptor (GO:0016641)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10						CATCCACTTATGTGCAGAGAG	0.577																																					p.Y384Y		Atlas-SNP	.											.	LOXL1	25	.	0			c.T1152C						.						227.0	207.0	214.0					15																	74235244		2198	4297	6495	SO:0001819	synonymous_variant	4016	exon2			CACTTATGTGCAG	L21186	CCDS10253.1	15q24-q25	2008-07-18			ENSG00000129038	ENSG00000129038			6665	protein-coding gene	gene with protein product		153456				7689553	Standard	NM_005576		Approved	LOXL, LOL	uc002awc.1	Q08397	OTTHUMG00000137595	ENST00000261921.7:c.1152T>C	chr15.hg19:g.74235244T>C		67.0	0.0		98.0	33.0	NM_005576	Q6NUL3|Q96BW7	Silent	SNP	ENST00000261921.7	hg19	CCDS10253.1																																																																																			.	.		0.577	LOXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268995.2	NM_005576	
IL16	3603	hgsc.bcm.edu	37	15	81598333	81598333	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr15:81598333T>C	ENST00000302987.4	+	16	3505	c.3505T>C	c.(3505-3507)Tct>Cct	p.S1169P	IL16_ENST00000394660.2_Missense_Mutation_p.S1169P|RP11-761I4.4_ENST00000607019.1_RNA|IL16_ENST00000394652.2_Missense_Mutation_p.S468P			Q14005	IL16_HUMAN	interleukin 16	1169	Interaction with PPP1R12A, PPP1R12B and PPP1R12C.|PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				immune response (GO:0006955)|induction of positive chemotaxis (GO:0050930)|leukocyte chemotaxis (GO:0030595)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(3)|skin(3)|stomach(1)|urinary_tract(1)	57						CAACGGCAAGTCTCTCAAGGG	0.552																																					p.S1169P		Atlas-SNP	.											.	IL16	254	.	0			c.T3505C						.						167.0	170.0	169.0					15																	81598333		2203	4300	6503	SO:0001583	missense	3603	exon17			GGCAAGTCTCTCA	U82972	CCDS10317.1, CCDS42069.1, CCDS53966.1	15q26.3	2011-07-14	2011-07-14		ENSG00000172349	ENSG00000172349		"""Interleukins and interleukin receptors"""	5980	protein-coding gene	gene with protein product	"""prointerleukin 16"", ""lymphocyte chemoattractant factor"""	603035	"""interleukin 16 (lymphocyte chemoattractant factor)"""			9144227	Standard	NM_004513		Approved	LCF, IL-16, prIL-16, HsT19289, FLJ42735, FLJ16806	uc021ssh.1	Q14005	OTTHUMG00000144186	ENST00000302987.4:c.3505T>C	chr15.hg19:g.81598333T>C	ENSP00000302935:p.Ser1169Pro	81.0	0.0		114.0	41.0	NM_001172128	A6NM20|A8MU65|B5TY35|B9EGR6|H3BVH5|Q16435|Q6VVE6|Q6ZMQ7|Q9UP18	Missense_Mutation	SNP	ENST00000302987.4	hg19	CCDS42069.1	.	.	.	.	.	.	.	.	.	.	T	13.55	2.270556	0.40194	.	.	ENSG00000172349	ENST00000394660;ENST00000355368;ENST00000302987;ENST00000329842;ENST00000394653;ENST00000394652;ENST00000394656	T;T;T	0.27256	1.68;1.68;1.68	4.64	4.64	0.57946	PDZ/DHR/GLGF (4);	0.000000	0.46145	D	0.000312	T	0.47783	0.1464	M	0.64170	1.965	0.47037	D	0.999298	D;D;D;D;D;D	0.76494	0.998;0.998;0.999;0.998;0.996;0.979	D;D;D;D;D;D	0.87578	0.998;0.991;0.99;0.997;0.994;0.968	T	0.48681	-0.9014	10	0.59425	D	0.04	.	14.225	0.65853	0.0:0.0:0.0:1.0	.	1001;662;706;559;1169;1169	F8W7Z5;Q6ZTT5;B7Z8M3;B3KY62;Q14005;Q14005-2	.;.;.;.;IL16_HUMAN;.	P	1169;1001;1169;706;559;468;468	ENSP00000378155:S1169P;ENSP00000302935:S1169P;ENSP00000378147:S468P	ENSP00000302935:S1169P	S	+	1	0	IL16	79385388	1.000000	0.71417	0.995000	0.50966	0.009000	0.06853	2.603000	0.46266	1.933000	0.56026	0.533000	0.62120	TCT	.	.		0.552	IL16-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000303952.1	NM_172217	
GRIN2A	2903	hgsc.bcm.edu	37	16	9892293	9892293	+	Missense_Mutation	SNP	C	C	T			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr16:9892293C>T	ENST00000396573.2	-	12	2506	c.2197G>A	c.(2197-2199)Gca>Aca	p.A733T	GRIN2A_ENST00000404927.2_Missense_Mutation_p.A733T|GRIN2A_ENST00000330684.3_Missense_Mutation_p.A733T|GRIN2A_ENST00000535259.1_Missense_Mutation_p.A576T|GRIN2A_ENST00000396575.2_Missense_Mutation_p.A733T|GRIN2A_ENST00000562109.1_Missense_Mutation_p.A733T	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	733					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TTCAAGACTGCGGCATCGTAG	0.562																																					p.A733T		Atlas-SNP	.											.	GRIN2A	366	.	0			c.G2197A						.						92.0	75.0	80.0					16																	9892293		2197	4300	6497	SO:0001583	missense	2903	exon12			AGACTGCGGCATC		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.2197G>A	chr16.hg19:g.9892293C>T	ENSP00000379818:p.Ala733Thr	84.0	0.0		131.0	26.0	NM_000833	O00669|Q17RZ6	Missense_Mutation	SNP	ENST00000396573.2	hg19	CCDS10539.1	.	.	.	.	.	.	.	.	.	.	C	17.91	3.504573	0.64410	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000535259;ENST00000330684;ENST00000396575	T;T;T;T;T	0.27104	1.69;1.69;1.69;1.69;1.69	5.18	5.18	0.71444	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.104112	0.64402	D	0.000004	T	0.39937	0.1097	L	0.31294	0.92	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	P;D;D	0.87578	0.9;0.967;0.998	T	0.10064	-1.0646	9	.	.	.	.	17.6555	0.88176	0.0:1.0:0.0:0.0	.	576;733;733	F5GZ52;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	T	733;733;576;733;733	ENSP00000379818:A733T;ENSP00000385872:A733T;ENSP00000441572:A576T;ENSP00000332549:A733T;ENSP00000379820:A733T	.	A	-	1	0	GRIN2A	9799794	1.000000	0.71417	0.079000	0.20413	0.019000	0.09904	7.681000	0.84073	2.412000	0.81896	0.557000	0.71058	GCA	.	.		0.562	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3		
SPN	6693	hgsc.bcm.edu	37	16	29675057	29675057	+	Missense_Mutation	SNP	C	C	T			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr16:29675057C>T	ENST00000360121.3	+	2	100	c.8C>T	c.(7-9)aCg>aTg	p.T3M	SPN_ENST00000395389.2_Missense_Mutation_p.T3M	NM_001030288.2|NM_003123.4	NP_001025459.1|NP_003114.1	O75398	DEAF1_HUMAN	sialophorin	0	Ala-rich.				anatomical structure morphogenesis (GO:0009653)|embryonic skeletal system development (GO:0048706)|germ cell development (GO:0007281)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)|stomach(1)	15						GAAATGGCCACGCTTCTCCTT	0.632																																					p.T3M		Atlas-SNP	.											SPN,NS,carcinoma,0,1	SPN	44	.	0			c.C8T						.						118.0	129.0	125.0					16																	29675057		2197	4300	6497	SO:0001583	missense	6693	exon2			TGGCCACGCTTCT	J04536	CCDS10650.1	16p11.2	2008-07-31	2008-07-31		ENSG00000197471	ENSG00000197471		"""CD molecules"""	11249	protein-coding gene	gene with protein product	"""leukosialin"""	182160	"""sialophorin (gpL115, leukosialin, CD43)"""			2784859, 2521952	Standard	NM_001030288		Approved	LSN, CD43, GPL115	uc002dtm.4	P16150	OTTHUMG00000097765	ENST00000360121.3:c.8C>T	chr16.hg19:g.29675057C>T	ENSP00000353238:p.Thr3Met	62.0	0.0		67.0	23.0	NM_001030288	A8K1F8|A8K5R8|C7T5V5|O15152|O75399|O75510|O75511|O75512|O75513|Q9UET1	Missense_Mutation	SNP	ENST00000360121.3	hg19	CCDS10650.1	.	.	.	.	.	.	.	.	.	.	.	9.054	0.992699	0.18966	.	.	ENSG00000197471	ENST00000395389;ENST00000436527;ENST00000360121	T;T;T	0.31769	1.48;1.48;1.48	4.51	1.1	0.20463	.	2.276340	0.02812	N	0.124479	T	0.17874	0.0429	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.22208	-1.0223	10	0.51188	T	0.08	1.0E-4	5.7104	0.17931	0.0:0.3389:0.0:0.6611	.	3	P16150	LEUK_HUMAN	M	3	ENSP00000378787:T3M;ENSP00000412907:T3M;ENSP00000353238:T3M	ENSP00000353238:T3M	T	+	2	0	SPN	29582558	0.001000	0.12720	0.096000	0.21009	0.007000	0.05969	0.333000	0.19768	0.335000	0.23614	-0.340000	0.08031	ACG	.	.		0.632	SPN-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215001.2		
MTSS1L	92154	hgsc.bcm.edu	37	16	70698645	70698645	+	Missense_Mutation	SNP	C	C	A			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr16:70698645C>A	ENST00000338779.6	-	14	1601	c.1327G>T	c.(1327-1329)Gcc>Tcc	p.A443S	FLJ00418_ENST00000597002.1_5'UTR	NM_138383.2	NP_612392.1	Q765P7	MTSSL_HUMAN	metastasis suppressor 1-like	443					filopodium assembly (GO:0046847)|signal transduction (GO:0007165)					breast(1)|central_nervous_system(2)|endometrium(1)|liver(1)|lung(1)|skin(1)	7						TCACTGGCGGCGGGGGACACC	0.672																																					p.A443S		Atlas-SNP	.											.	MTSS1L	22	.	0			c.G1327T						.						28.0	26.0	26.0					16																	70698645		2198	4298	6496	SO:0001583	missense	92154	exon14			TGGCGGCGGGGGA		CCDS32476.1	16q22.1	2008-12-16				ENSG00000132613			25094	protein-coding gene	gene with protein product	"""actin-bundling protein with BAIAP2 homology"""					12477932	Standard	XM_006721335		Approved	ABBA-1, LOC92154	uc002ezj.3	Q765P7		ENST00000338779.6:c.1327G>T	chr16.hg19:g.70698645C>A	ENSP00000341171:p.Ala443Ser	105.0	0.0		108.0	19.0	NM_138383	A6NJI7|Q9BUA8	Missense_Mutation	SNP	ENST00000338779.6	hg19	CCDS32476.1	.	.	.	.	.	.	.	.	.	.	C	13.35	2.212109	0.39102	.	.	ENSG00000132613	ENST00000338779	T	0.36340	1.26	4.89	3.94	0.45596	.	0.245478	0.40469	N	0.001085	T	0.36110	0.0955	M	0.63428	1.95	0.40467	D	0.980309	P	0.39940	0.696	B	0.41917	0.37	T	0.14952	-1.0454	10	0.11794	T	0.64	-16.434	12.6675	0.56849	0.0:0.9182:0.0:0.0818	.	443	Q765P7	MTSSL_HUMAN	S	443	ENSP00000341171:A443S	ENSP00000341171:A443S	A	-	1	0	MTSS1L	69256146	1.000000	0.71417	0.090000	0.20809	0.117000	0.20001	6.039000	0.70972	1.044000	0.40200	0.462000	0.41574	GCC	.	.		0.672	MTSS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434927.3	NM_138383	
OR1E2	8388	hgsc.bcm.edu	37	17	3336671	3336671	+	Silent	SNP	C	C	T			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr17:3336671C>T	ENST00000248384.1	-	1	464	c.465G>A	c.(463-465)gcG>gcA	p.A155A		NM_003554.1	NP_003545.1	P47887	OR1E2_HUMAN	olfactory receptor, family 1, subfamily E, member 2	155					sensory perception of chemical stimulus (GO:0007606)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)|receptor activity (GO:0004872)			endometrium(3)|large_intestine(3)|lung(3)	9						CCCAGGACAGCGCCACCACGG	0.547											OREG0006785	type=TRANSCRIPTION FACTOR BINDING SITE|Gene=OR1E2|TFbs=REST|Dataset=NRSF/REST ChIPSeq sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																									p.A155A		Atlas-SNP	.											.	OR1E2	25	.	0			c.G465A						.						81.0	72.0	75.0					17																	3336671		2203	4300	6503	SO:0001819	synonymous_variant	8388	exon1			GGACAGCGCCACC	U04686	CCDS11026.1	17p13.3	2012-08-09			ENSG00000127780	ENSG00000127780		"""GPCR / Class A : Olfactory receptors"""	8190	protein-coding gene	gene with protein product				OR1E4		8004088, 9500546	Standard	NM_003554		Approved	OR17-93, OR17-135	uc010vre.2	P47887	OTTHUMG00000090651	ENST00000248384.1:c.465G>A	chr17.hg19:g.3336671C>T		164.0	0.0	610	207.0	31.0	NM_003554	O43877|O95632|Q0VAD5|Q0VAD6|Q9UL13	Silent	SNP	ENST00000248384.1	hg19	CCDS11026.1																																																																																			.	.		0.547	OR1E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207311.1		
TBX4	9496	hgsc.bcm.edu	37	17	59557244	59557244	+	Silent	SNP	C	C	A			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr17:59557244C>A	ENST00000240335.1	+	6	750	c.705C>A	c.(703-705)atC>atA	p.I235I	TBX4_ENST00000393853.4_Silent_p.I235I|TBX4_ENST00000589449.1_3'UTR	NM_018488.2	NP_060958.2	P57082	TBX4_HUMAN	T-box 4	235					angiogenesis (GO:0001525)|embryonic limb morphogenesis (GO:0030326)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|morphogenesis of an epithelium (GO:0002009)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(15)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						CCCCACAGATCACCCAGCTGA	0.517																																					p.I235I		Atlas-SNP	.											.	TBX4	69	.	0			c.C705A						.						104.0	96.0	99.0					17																	59557244		2203	4300	6503	SO:0001819	synonymous_variant	9496	exon6			ACAGATCACCCAG	AF188703	CCDS11629.1	17q21-q22	2005-10-11				ENSG00000121075		"""T-boxes"""	11603	protein-coding gene	gene with protein product		601719				10945475	Standard	NM_018488		Approved		uc002izi.3	P57082		ENST00000240335.1:c.705C>A	chr17.hg19:g.59557244C>A		108.0	0.0		170.0	19.0	NM_018488	A5PKU7|B2RMT1|B7ZLV3	Silent	SNP	ENST00000240335.1	hg19	CCDS11629.1																																																																																			.	.		0.517	TBX4-002	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000449649.1	NM_018488	
SERPINB8	5271	hgsc.bcm.edu	37	18	61654510	61654510	+	Nonstop_Mutation	SNP	T	T	C			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr18:61654510T>C	ENST00000397985.2	+	7	1379	c.1123T>C	c.(1123-1125)Taa>Caa	p.*375Q	SERPINB8_ENST00000542677.1_Nonstop_Mutation_p.*193Q|SERPINB8_ENST00000493661.1_Intron|SERPINB8_ENST00000353706.2_Nonstop_Mutation_p.*375Q	NM_001276490.1	NP_001263419.1	P50452	SPB8_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 8	0					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|kidney(1)|large_intestine(4)|lung(9)|skin(1)	17		Esophageal squamous(42;0.129)				CTCTTCTCCGTAAAGAGGAGC	0.458																																					p.X375Q		Atlas-SNP	.											.	SERPINB8	42	.	0			c.T1123C						.						78.0	80.0	79.0					18																	61654510		2203	4300	6503	SO:0001578	stop_lost	5271	exon7			TCTCCGTAAAGAG	L40377	CCDS11991.1, CCDS42442.1, CCDS62460.1	18q22.1	2014-02-18	2005-08-18		ENSG00000166401	ENSG00000166401		"""Serine (or cysteine) peptidase inhibitors"""	8952	protein-coding gene	gene with protein product	"""cytoplasmic antiproteinase 2"""	601697	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 8"""	PI8		8530382, 9268635, 24172014	Standard	NM_198833		Approved	CAP2	uc002lju.3	P50452	OTTHUMG00000060596	ENST00000397985.2:c.1123T>C	chr18.hg19:g.61654510T>C	ENSP00000381072:p.*375Glnext*19	58.0	0.0		83.0	4.0	NM_198833	B4DTW2|Q7Z2V6|Q8N178	Missense_Mutation	SNP	ENST00000397985.2	hg19	CCDS11991.1	.	.	.	.	.	.	.	.	.	.	T	11.69	1.714724	0.30413	.	.	ENSG00000166401	ENST00000397985;ENST00000353706;ENST00000542677	.	.	.	5.25	5.25	0.73442	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5025	0.67732	0.0:0.0:0.0:1.0	.	.	.	.	Q	375;375;193	.	.	X	+	1	0	SERPINB8	59805490	0.003000	0.15002	0.003000	0.11579	0.042000	0.13812	1.386000	0.34419	2.200000	0.70718	0.460000	0.39030	TAA	.	.		0.458	SERPINB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134014.1	NM_001031848	
AP1M1	8907	hgsc.bcm.edu	37	19	16314322	16314322	+	Missense_Mutation	SNP	A	A	G			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr19:16314322A>G	ENST00000291439.3	+	2	544	c.95A>G	c.(94-96)cAc>cGc	p.H32R	AP1M1_ENST00000429941.2_Missense_Mutation_p.H32R|AP1M1_ENST00000541844.1_Intron|AP1M1_ENST00000444449.2_Missense_Mutation_p.H32R|AP1M1_ENST00000590756.1_Intron	NM_032493.3	NP_115882.1	Q9BXS5	AP1M1_HUMAN	adaptor-related protein complex 1, mu 1 subunit	32					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|endosome to melanosome transport (GO:0035646)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|trans-Golgi network membrane (GO:0032588)				breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|ovary(3)|prostate(2)	21						GAGGTGGAGCACTTCATGCCC	0.562																																					p.H32R		Atlas-SNP	.											.	AP1M1	48	.	0			c.A95G						.						102.0	86.0	91.0					19																	16314322		2203	4300	6503	SO:0001583	missense	8907	exon2			TGGAGCACTTCAT		CCDS12342.1, CCDS46008.1	19p13.12	2008-05-23							13667	protein-coding gene	gene with protein product		603535				9653655, 17988225	Standard	NM_032493		Approved	AP47, CLAPM2	uc002ndv.2	Q9BXS5		ENST00000291439.3:c.95A>G	chr19.hg19:g.16314322A>G	ENSP00000291439:p.His32Arg	74.0	0.0		97.0	29.0	NM_001130524	Q4TTY5	Missense_Mutation	SNP	ENST00000291439.3	hg19	CCDS12342.1	.	.	.	.	.	.	.	.	.	.	A	10.30	1.312322	0.23908	.	.	ENSG00000072958	ENST00000444449;ENST00000291439;ENST00000429941	T;T;T	0.61980	0.65;0.65;0.06	4.59	4.59	0.56863	Longin-like (1);AP complex, mu/sigma subunit (1);	0.000000	0.85682	D	0.000000	T	0.41511	0.1162	N	0.12443	0.215	0.80722	D	1	B;B;B	0.06786	0.0;0.001;0.001	B;B;B	0.09377	0.0;0.004;0.004	T	0.26677	-1.0096	10	0.14656	T	0.56	-40.567	13.1508	0.59488	1.0:0.0:0.0:0.0	.	32;32;32	E7ENJ6;Q4TTY5;Q9BXS5	.;.;AP1M1_HUMAN	R	32	ENSP00000388996:H32R;ENSP00000291439:H32R;ENSP00000411498:H32R	ENSP00000291439:H32R	H	+	2	0	AP1M1	16175322	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.993000	0.76245	1.715000	0.51383	0.533000	0.62120	CAC	.	.		0.562	AP1M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460492.1	NM_032493	
ZNF737	100129842	hgsc.bcm.edu	37	19	20728081	20728081	+	Missense_Mutation	SNP	C	C	T			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr19:20728081C>T	ENST00000427401.4	-	4	1022	c.928G>A	c.(928-930)Gag>Aag	p.E310K		NM_001159293.1	NP_001152765.1	O75373	ZN737_HUMAN	zinc finger protein 737	310					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|kidney(1)|lung(7)|ovary(1)|stomach(1)|urinary_tract(1)	13						TAGGGTTTCTCTCCGCTATGA	0.413																																					p.E310K		Atlas-SNP	.											.	ZNF737	50	.	0			c.G928A						.						40.0	39.0	39.0					19																	20728081		692	1591	2283	SO:0001583	missense	100129842	exon4			GTTTCTCTCCGCT	BC015765	CCDS54238.1	19p12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	32468	protein-coding gene	gene with protein product		603984					Standard	NM_001159293		Approved	ZNF102	uc002npa.3	O75373		ENST00000427401.4:c.928G>A	chr19.hg19:g.20728081C>T	ENSP00000395733:p.Glu310Lys	87.0	0.0		119.0	6.0	NM_001159293	C9JHM3	Missense_Mutation	SNP	ENST00000427401.4	hg19	CCDS54238.1	.	.	.	.	.	.	.	.	.	.	-	15.35	2.806492	0.50421	.	.	ENSG00000237440	ENST00000427401	T	0.24350	1.86	0.801	0.801	0.18679	.	.	.	.	.	T	0.32285	0.0824	L	0.53671	1.685	0.29096	N	0.881784	D	0.55605	0.972	P	0.53360	0.724	T	0.19516	-1.0303	9	0.59425	D	0.04	.	6.955	0.24565	0.0:1.0:0.0:0.0	.	310	C9JHM3	.	K	310	ENSP00000395733:E310K	ENSP00000395733:E310K	E	-	1	0	ZNF737	20519921	0.828000	0.29307	0.061000	0.19648	0.061000	0.15899	3.485000	0.53208	0.170000	0.19704	0.173000	0.16961	GAG	.	.		0.413	ZNF737-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447844.2	NM_145289	
EGLN2	112398	hgsc.bcm.edu	37	19	41307313	41307313	+	Missense_Mutation	SNP	G	G	T			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr19:41307313G>T	ENST00000593726.1	+	1	1864	c.836G>T	c.(835-837)cGc>cTc	p.R279L	RAB4B-EGLN2_ENST00000594136.1_3'UTR|EGLN2_ENST00000594140.1_5'Flank|EGLN2_ENST00000406058.2_Missense_Mutation_p.R279L|CTC-490E21.12_ENST00000601627.1_Missense_Mutation_p.A38S|EGLN2_ENST00000303961.4_Missense_Mutation_p.R279L			Q96KS0	EGLN2_HUMAN	egl-9 family hypoxia-inducible factor 2	279	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.				cell redox homeostasis (GO:0045454)|cellular response to hypoxia (GO:0071456)|intracellular estrogen receptor signaling pathway (GO:0030520)|peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)|positive regulation of protein catabolic process (GO:0045732)|regulation of cell growth (GO:0001558)|regulation of neuron apoptotic process (GO:0043523)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|response to hypoxia (GO:0001666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ferrous iron binding (GO:0008198)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|oxygen sensor activity (GO:0019826)|peptidyl-proline 4-dioxygenase activity (GO:0031545)			breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	10			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Vitamin C(DB00126)	ATCAACGGGCGCACCAAGGTA	0.612																																					p.R279L		Atlas-SNP	.											.	EGLN2	31	.	0			c.G836T						.						37.0	39.0	38.0					19																	41307313		2190	4280	6470	SO:0001583	missense	112398	exon2			ACGGGCGCACCAA	AJ310544	CCDS12567.1	19q13.2	2013-08-21	2013-08-21		ENSG00000269858	ENSG00000269858			14660	protein-coding gene	gene with protein product	"""HIF prolyl hydroxylase 1"""	606424	"""EGL nine (C.elegans) homolog 2"", ""egl nine homolog 2 (C. elegans)"""				Standard	NM_080732		Approved	PHD1, HIFPH1	uc002oph.3	Q96KS0		ENST00000593726.1:c.836G>T	chr19.hg19:g.41307313G>T	ENSP00000469686:p.Arg279Leu	36.0	0.0		60.0	15.0	NM_053046	A8K5S0|Q8WWY4|Q9BV14	Missense_Mutation	SNP	ENST00000593726.1	hg19	CCDS12567.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.834998	0.91117	.	.	ENSG00000171570	ENST00000303961;ENST00000406058	D;D	0.87650	-2.28;-2.28	4.25	4.25	0.50352	Oxoglutarate/iron-dependent oxygenase (1);Prolyl 4-hydroxylase, alpha subunit (1);	0.000000	0.85682	D	0.000000	D	0.95101	0.8413	H	0.94964	3.605	0.80722	D	1	D	0.76494	0.999	D	0.76575	0.988	D	0.96268	0.9196	10	0.66056	D	0.02	-15.4074	15.9613	0.79933	0.0:0.0:1.0:0.0	.	279	Q96KS0	EGLN2_HUMAN	L	279	ENSP00000307080:R279L;ENSP00000385253:R279L	ENSP00000307080:R279L	R	+	2	0	EGLN2	45999153	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.488000	0.97947	2.368000	0.80403	0.655000	0.94253	CGC	.	.		0.612	EGLN2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463218.1		
ZNF415	55786	hgsc.bcm.edu	37	19	53612770	53612770	+	Silent	SNP	T	T	C			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr19:53612770T>C	ENST00000500065.4	-	4	861	c.528A>G	c.(526-528)tcA>tcG	p.S176S	ZNF415_ENST00000448501.1_Silent_p.S224S|ZNF415_ENST00000597748.1_3'UTR|ZNF415_ENST00000455735.2_Silent_p.S224S|ZNF415_ENST00000440291.1_Silent_p.S163S|ZNF415_ENST00000243643.4_Silent_p.S176S|ZNF415_ENST00000421033.1_Silent_p.S188S|ZNF415_ENST00000597503.1_3'UTR|ZNF415_ENST00000594011.1_3'UTR|ZNF415_ENST00000595193.1_3'UTR|ZNF415_ENST00000601493.1_5'UTR	NM_001136038.2	NP_001129510.2	Q09FC8	ZN415_HUMAN	zinc finger protein 415	224					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(3)|large_intestine(8)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31				GBM - Glioblastoma multiforme(134;0.0191)		TTTGGGGTGGTGAAACTGAGG	0.378																																					p.S176S		Atlas-SNP	.											.	ZNF415	68	.	0			c.A528G						.						111.0	107.0	109.0					19																	53612770		2203	4300	6503	SO:0001819	synonymous_variant	55786	exon4			GGGTGGTGAAACT	AK002053	CCDS12860.1, CCDS54313.1	19q13.42	2014-03-18			ENSG00000170954	ENSG00000170954		"""Zinc fingers, C2H2-type"", ""-"""	20636	protein-coding gene	gene with protein product						14702039	Standard	NM_001136038		Approved		uc002qaw.3	Q09FC8	OTTHUMG00000182865	ENST00000500065.4:c.528A>G	chr19.hg19:g.53612770T>C		114.0	0.0		155.0	29.0	NM_018355	F5H287|Q09FC7|Q09FC9|Q09FD0|Q6NSZ2|Q6P3S0|Q9NUR2	Silent	SNP	ENST00000500065.4	hg19	CCDS54313.1																																																																																			.	.		0.378	ZNF415-025	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464043.1	NM_018355	
RRBP1	6238	hgsc.bcm.edu	37	20	17596112	17596112	+	Silent	SNP	T	T	C			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr20:17596112T>C	ENST00000377813.1	-	23	4317	c.4014A>G	c.(4012-4014)ctA>ctG	p.L1338L	RRBP1_ENST00000470422.1_5'UTR|RRBP1_ENST00000246043.4_Silent_p.L1338L|RRBP1_ENST00000455029.2_Silent_p.L679L|RRBP1_ENST00000360807.4_Silent_p.L905L|RRBP1_ENST00000377807.2_Silent_p.L905L			Q9P2E9	RRBP1_HUMAN	ribosome binding protein 1	1338					osteoblast differentiation (GO:0001649)|protein transport (GO:0015031)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(6)	28						CTGAAGACTCTAGGGGGCCGG	0.627																																					p.L905L		Atlas-SNP	.											.	RRBP1	157	.	0			c.A2715G						.						45.0	47.0	47.0					20																	17596112		2203	4300	6503	SO:0001819	synonymous_variant	6238	exon23			AGACTCTAGGGGG	AB037819	CCDS13128.1	20p12	2012-12-07	2012-12-07		ENSG00000125844	ENSG00000125844			10448	protein-coding gene	gene with protein product		601418	"""ribosome binding protein 1 (dog 180kD homolog)"", ""ribosome binding protein 1 homolog 180kDa (dog)"""			8812507	Standard	NM_001042576		Approved	ES/130, hES	uc002wpw.1	Q9P2E9	OTTHUMG00000031945	ENST00000377813.1:c.4014A>G	chr20.hg19:g.17596112T>C		30.0	0.0		39.0	18.0	NM_004587	A2A2S6|A6NCN6|O75300|O75301|Q5W165|Q96SB2|Q9BWP1|Q9H476	Silent	SNP	ENST00000377813.1	hg19																																																																																				.	.		0.627	RRBP1-002	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000078125.1	NM_001042576	
ABHD16B	140701	hgsc.bcm.edu	37	20	62493842	62493842	+	Missense_Mutation	SNP	C	C	T			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr20:62493842C>T	ENST00000369916.3	+	1	1277	c.949C>T	c.(949-951)Ctc>Ttc	p.L317F	TPD52L2_ENST00000346249.4_5'Flank|TPD52L2_ENST00000351424.4_5'Flank|C20ORF135_ENST00000601296.1_5'Flank|TPD52L2_ENST00000358548.4_5'Flank|TPD52L2_ENST00000348257.5_5'Flank|TPD52L2_ENST00000369927.4_5'Flank|TPD52L2_ENST00000217121.5_5'Flank|TPD52L2_ENST00000352482.4_5'Flank	NM_080622.3	NP_542189.1	Q9H3Z7	ABHGB_HUMAN	abhydrolase domain containing 16B	317							hydrolase activity (GO:0016787)			endometrium(2)|kidney(1)|lung(3)	6						GGTGCTGCTGCTCCGACGCAC	0.692																																					p.L317F		Atlas-SNP	.											.	ABHD16B	22	.	0			c.C949T						.						10.0	11.0	11.0					20																	62493842		2180	4267	6447	SO:0001583	missense	140701	exon1			CTGCTGCTCCGAC		CCDS13539.1	20q13.33	2013-01-17	2010-12-09	2010-12-09	ENSG00000183260	ENSG00000183260		"""Abhydrolase domain containing"""	16128	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 135"""	C20orf135			Standard	NM_080622		Approved	dJ591C20.1	uc002ygx.1	Q9H3Z7	OTTHUMG00000033010	ENST00000369916.3:c.949C>T	chr20.hg19:g.62493842C>T	ENSP00000358932:p.Leu317Phe	43.0	0.0		73.0	28.0	NM_080622		Missense_Mutation	SNP	ENST00000369916.3	hg19	CCDS13539.1	.	.	.	.	.	.	.	.	.	.	C	11.90	1.775764	0.31411	.	.	ENSG00000183260	ENST00000369916	T	0.38077	1.16	5.04	4.03	0.46877	.	0.215659	0.36268	N	0.002691	T	0.26521	0.0648	N	0.12182	0.205	0.39436	D	0.967165	B	0.33964	0.434	B	0.43018	0.405	T	0.15723	-1.0427	10	0.51188	T	0.08	-3.851	9.0601	0.36429	0.2775:0.7225:0.0:0.0	.	317	Q9H3Z7	ABHGB_HUMAN	F	317	ENSP00000358932:L317F	ENSP00000358932:L317F	L	+	1	0	ABHD16B	61964286	1.000000	0.71417	0.981000	0.43875	0.114000	0.19823	4.018000	0.57174	2.341000	0.79615	0.591000	0.81541	CTC	.	.		0.692	ABHD16B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080254.1		
BPIFC	254240	hgsc.bcm.edu	37	22	32827371	32827371	+	Silent	SNP	A	A	G	rs370427363		TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr22:32827371A>G	ENST00000397452.1	-	12	1290	c.1180T>C	c.(1180-1182)Ttg>Ctg	p.L394L	BPIFC_ENST00000534972.1_Silent_p.L118L|BPIFC_ENST00000300399.3_Silent_p.L394L|BPIFC_ENST00000432451.2_Silent_p.L151L			Q8NFQ6	BPIFC_HUMAN	BPI fold containing family C	394						extracellular region (GO:0005576)	lipopolysaccharide binding (GO:0001530)|phospholipid binding (GO:0005543)										CTTTGTCCCAAAATAACCAGG	0.393																																					p.L394L		Atlas-SNP	.											.	.	.	.	0			c.T1180C						.	A		1,4405	2.1+/-5.4	0,1,2202	77.0	62.0	67.0		1180	1.6	0.8	22		67	0,8600		0,0,4300	no	coding-synonymous	BPIFC	NM_174932.2		0,1,6502	GG,GA,AA		0.0,0.0227,0.0077		394/508	32827371	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	254240	exon11			GTCCCAAAATAAC	AF465766	CCDS13906.1	22q12.3	2011-08-04	2011-08-01	2011-08-01	ENSG00000184459	ENSG00000184459		"""BPI fold containing"""	16503	protein-coding gene	gene with protein product		614109	"""bactericidal/permeability-increasing protein-like 2"""	BPIL2			Standard	NM_174932		Approved	dJ149A16.7	uc003amn.2	Q8NFQ6	OTTHUMG00000058273	ENST00000397452.1:c.1180T>C	chr22.hg19:g.32827371A>G		234.0	0.0		301.0	93.0	NM_174932	A2RRF1	Silent	SNP	ENST00000397452.1	hg19	CCDS13906.1																																																																																			.	.		0.393	BPIFC-010	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129029.2	NM_174932	
ZC3H7B	23264	hgsc.bcm.edu	37	22	41751769	41751769	+	Missense_Mutation	SNP	A	A	G			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr22:41751769A>G	ENST00000352645.4	+	19	2434	c.2177A>G	c.(2176-2178)aAg>aGg	p.K726R	ZC3H7B_ENST00000351589.4_Missense_Mutation_p.K726R	NM_017590.4	NP_060060.3	Q9UGR2	Z3H7B_HUMAN	zinc finger CCCH-type containing 7B	742					viral process (GO:0016032)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	38						AGCTGGACCAAGGAGCGGCGG	0.592																																					p.K726R		Atlas-SNP	.											.	ZC3H7B	82	.	0			c.A2177G						.						43.0	42.0	42.0					22																	41751769		2202	4300	6502	SO:0001583	missense	23264	exon19			GGACCAAGGAGCG		CCDS14013.1	22q13.2	2013-01-10		2005-08-09	ENSG00000100403	ENSG00000100403		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30869	protein-coding gene	gene with protein product						10470851, 11230166	Standard	NM_017590		Approved	RoXaN, FLJ13787, DKFZp434K0920, KIAA1031	uc003azw.4	Q9UGR2	OTTHUMG00000150969	ENST00000352645.4:c.2177A>G	chr22.hg19:g.41751769A>G	ENSP00000345793:p.Lys726Arg	80.0	0.0		116.0	44.0	NM_017590	A7YY88|B2RCA4|Q5TFX9|Q8TBT9|Q9H8B6|Q9UGQ9|Q9UGR0|Q9UGR1|Q9UK03|Q9UPW9	Missense_Mutation	SNP	ENST00000352645.4	hg19	CCDS14013.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.034038	0.75504	.	.	ENSG00000100403	ENST00000352645;ENST00000351589	T;T	0.15017	2.46;2.46	5.14	5.14	0.70334	.	0.050485	0.85682	N	0.000000	T	0.22551	0.0544	L	0.54323	1.7	0.52099	D	0.999941	B	0.20459	0.045	B	0.31869	0.137	T	0.02893	-1.1097	10	0.38643	T	0.18	-12.5875	15.0062	0.71513	1.0:0.0:0.0:0.0	.	726	Q9UGR2-2	.	R	726	ENSP00000345793:K726R;ENSP00000263243:K726R	ENSP00000263243:K726R	K	+	2	0	ZC3H7B	40081715	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.930000	0.92872	1.948000	0.56530	0.454000	0.30748	AAG	.	.		0.592	ZC3H7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320696.1	NM_017590	
CASK	8573	hgsc.bcm.edu	37	X	41379791	41379791	+	Missense_Mutation	SNP	T	T	A			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chrX:41379791T>A	ENST00000378163.1	-	27	3137	c.2663A>T	c.(2662-2664)cAc>cTc	p.H888L	CASK_ENST00000421587.2_Missense_Mutation_p.H859L|CASK_ENST00000442742.2_Missense_Mutation_p.H860L|CASK-AS1_ENST00000451126.1_RNA|CASK_ENST00000318588.9_Missense_Mutation_p.H883L|CASK_ENST00000378166.4_Missense_Mutation_p.H883L|CASK_ENST00000378158.1_Missense_Mutation_p.H871L|CASK_ENST00000361962.4_Missense_Mutation_p.H871L			O14936	CSKP_HUMAN	calcium/calmodulin-dependent serine protein kinase (MAGUK family)	888	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				calcium ion import (GO:0070509)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of wound healing (GO:0061045)|nucleotide phosphorylation (GO:0046939)|positive regulation of calcium ion import (GO:0090280)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	actin cytoskeleton (GO:0015629)|basement membrane (GO:0005604)|basolateral plasma membrane (GO:0016323)|cell-cell junction (GO:0005911)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nuclear lamina (GO:0005652)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(5)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|ovary(3)|prostate(1)|stomach(1)	32						ATCGAAGTAGTGTGCATATGT	0.473																																					p.H883L	NSCLC(42;104 1086 3090 27189 35040)	Atlas-SNP	.											.	CASK	93	.	0			c.A2648T						.						157.0	127.0	137.0					X																	41379791		2203	4300	6503	SO:0001583	missense	8573	exon27			AAGTAGTGTGCAT	AF035582	CCDS14257.1, CCDS48094.1, CCDS48095.1	Xp11.4	2010-02-09			ENSG00000147044	ENSG00000147044			1497	protein-coding gene	gene with protein product		300172	"""trinucleotide repeat containing 8"""	TNRC8		9722958	Standard	NM_003688		Approved	LIN2, CAGH39, FGS4	uc004dfl.4	O14936	OTTHUMG00000021378	ENST00000378163.1:c.2663A>T	chrX.hg19:g.41379791T>A	ENSP00000367405:p.His888Leu	50.0	0.0		87.0	36.0	NM_003688	A6NES1|B7ZKY0|O43215|Q17RI4|Q59HA0|Q5VT16|Q5VT17|Q5VT18|Q5VT19|Q66T42|Q9BYH6|Q9NYB2|Q9NYB3	Missense_Mutation	SNP	ENST00000378163.1	hg19		.	.	.	.	.	.	.	.	.	.	T	16.59	3.165180	0.57476	.	.	ENSG00000147044	ENST00000421587;ENST00000318588;ENST00000361962;ENST00000378163;ENST00000378179;ENST00000378168;ENST00000378158;ENST00000378166;ENST00000442742	T;T;T;T;T;T;T;T;T	0.18810	2.19;2.19;2.19;2.19;2.19;2.19;2.19;2.19;2.19	5.52	5.52	0.82312	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (2);	0.000000	0.64402	D	0.000012	T	0.53498	0.1800	M	0.88450	2.955	0.80722	D	1	D;P;D;D;D	0.89917	1.0;0.812;0.999;1.0;0.999	D;P;D;D;D	0.91635	0.997;0.642;0.982;0.999;0.99	T	0.63301	-0.6668	10	0.87932	D	0	.	14.885	0.70560	0.0:0.0:0.0:1.0	.	859;860;883;888;480	O14936-3;O14936-4;O14936-2;O14936;Q5JS72	.;.;.;CSKP_HUMAN;.	L	859;883;871;888;480;343;871;883;860	ENSP00000400526:H859L;ENSP00000322727:H883L;ENSP00000354641:H871L;ENSP00000367405:H888L;ENSP00000367421:H480L;ENSP00000367410:H343L;ENSP00000367400:H871L;ENSP00000367408:H883L;ENSP00000398007:H860L	ENSP00000322727:H883L	H	-	2	0	CASK	41264735	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.655000	0.83696	1.965000	0.57142	0.486000	0.48141	CAC	.	.		0.473	CASK-007	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000056285.1	NM_003688	
HUWE1	10075	hgsc.bcm.edu	37	X	53574709	53574709	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chrX:53574709T>C	ENST00000342160.3	-	67	11018	c.10561A>G	c.(10561-10563)Acg>Gcg	p.T3521A	HUWE1_ENST00000262854.6_Missense_Mutation_p.T3521A|HUWE1_ENST00000474288.1_5'UTR			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	3521	Thr-rich.				base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						GAAATAGCCGTGGCAGCAACC	0.582																																					p.T3521A		Atlas-SNP	.											.	HUWE1	724	.	0			c.A10561G						.						93.0	71.0	79.0					X																	53574709		2203	4300	6503	SO:0001583	missense	10075	exon68			TAGCCGTGGCAGC	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.10561A>G	chrX.hg19:g.53574709T>C	ENSP00000340648:p.Thr3521Ala	139.0	0.0		174.0	32.0	NM_031407	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	hg19	CCDS35301.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	-|-	8.369|8.369	0.834950|0.834950	0.16820|0.16820	.|.	.|.	ENSG00000086758|ENSG00000086758	ENST00000427052;ENST00000426907|ENST00000342160;ENST00000262854	.|T;T	.|0.34859	.|1.34;1.34	5.09|5.09	1.22|1.22	0.21188|0.21188	.|.	.|1.238120	.|0.05397	.|N	.|0.540001	T|T	0.11239|0.11239	0.0274|0.0274	N|N	0.01352|0.01352	-0.895|-0.895	0.29085|0.29085	N|N	0.882461|0.882461	.|B;B	.|0.06786	.|0.0;0.001	.|B;B	.|0.06405	.|0.0;0.002	T|T	0.35674|0.35674	-0.9779|-0.9779	5|10	.|0.06236	.|T	.|0.91	.|.	4.0809|4.0809	0.09925|0.09925	0.1583:0.1865:0.0:0.6552|0.1583:0.1865:0.0:0.6552	.|.	.|3521;3505	.|Q7Z6Z7;Q7Z6Z7-2	.|HUWE1_HUMAN;.	R|A	2554;358|3521	.|ENSP00000340648:T3521A;ENSP00000262854:T3521A	.|ENSP00000262854:T3521A	H|T	-|-	2|1	0|0	HUWE1|HUWE1	53591434|53591434	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.952000|0.952000	0.60782|0.60782	1.143000|1.143000	0.31553|0.31553	0.216000|0.216000	0.20781|0.20781	0.409000|0.409000	0.27619|0.27619	CAC|ACG	.	.		0.582	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119	
IRS4	8471	hgsc.bcm.edu	37	X	107978082	107978082	+	Missense_Mutation	SNP	C	C	T			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chrX:107978082C>T	ENST00000372129.2	-	1	1569	c.1493G>A	c.(1492-1494)gGc>gAc	p.G498D	RP6-24A23.3_ENST00000608811.1_RNA|RP6-24A23.6_ENST00000563887.1_5'Flank|RP6-24A23.3_ENST00000436013.1_RNA	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	498					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						TGAGCCCCGGCCATTTCCTGA	0.582																																					p.G498D		Atlas-SNP	.											.	IRS4	253	.	0			c.G1493A						.						124.0	117.0	119.0					X																	107978082		2203	4300	6503	SO:0001583	missense	8471	exon1			CCCCGGCCATTTC	AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.1493G>A	chrX.hg19:g.107978082C>T	ENSP00000361202:p.Gly498Asp	121.0	0.0		151.0	58.0	NM_003604		Missense_Mutation	SNP	ENST00000372129.2	hg19	CCDS14544.1	.	.	.	.	.	.	.	.	.	.	C	11.88	1.769312	0.31320	.	.	ENSG00000133124	ENST00000372129	T	0.37752	1.18	3.93	3.93	0.45458	.	0.144833	0.45867	D	0.000328	T	0.24044	0.0582	L	0.32530	0.975	0.37325	D	0.909708	P	0.38473	0.633	B	0.32805	0.153	T	0.20405	-1.0276	10	0.42905	T	0.14	-14.2995	10.427	0.44385	0.0:1.0:0.0:0.0	.	498	O14654	IRS4_HUMAN	D	498	ENSP00000361202:G498D	ENSP00000361202:G498D	G	-	2	0	IRS4	107864738	1.000000	0.71417	1.000000	0.80357	0.836000	0.47400	2.468000	0.45102	2.219000	0.72066	0.596000	0.82720	GGC	.	.		0.582	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1	NM_003604	
GPR112	139378	hgsc.bcm.edu	37	X	135429239	135429239	+	Missense_Mutation	SNP	A	A	G			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chrX:135429239A>G	ENST00000394143.1	+	6	3665	c.3374A>G	c.(3373-3375)gAg>gGg	p.E1125G	GPR112_ENST00000287534.4_Missense_Mutation_p.E1062G|GPR112_ENST00000394141.1_Missense_Mutation_p.E920G|GPR112_ENST00000412101.1_Missense_Mutation_p.E920G|GPR112_ENST00000370652.1_Missense_Mutation_p.E1125G	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	1125					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					GCTAAGGCTGAGACCACCCTT	0.493																																					p.E1125G		Atlas-SNP	.											.	GPR112	459	.	0			c.A3374G						.						153.0	119.0	130.0					X																	135429239		2203	4300	6503	SO:0001583	missense	139378	exon6			AGGCTGAGACCAC	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.3374A>G	chrX.hg19:g.135429239A>G	ENSP00000377699:p.Glu1125Gly	144.0	0.0		181.0	52.0	NM_153834	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	hg19	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	A	10.73	1.431287	0.25813	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.29397	1.6;1.6;1.57;1.71;1.57	2.7	1.38	0.22167	.	.	.	.	.	T	0.18215	0.0437	N	0.24115	0.695	0.09310	N	1	P;B;B	0.40834	0.73;0.187;0.118	B;B;B	0.38755	0.281;0.073;0.033	T	0.11397	-1.0589	9	0.54805	T	0.06	.	4.5943	0.12322	0.6987:0.0:0.0:0.3013	.	1062;920;1125	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	G	1125;1125;920;1062;920	ENSP00000377699:E1125G;ENSP00000359686:E1125G;ENSP00000416526:E920G;ENSP00000287534:E1062G;ENSP00000377697:E920G	ENSP00000287534:E1062G	E	+	2	0	GPR112	135256905	0.000000	0.05858	0.017000	0.16124	0.062000	0.15995	-0.050000	0.11904	0.109000	0.17891	0.356000	0.21956	GAG	.	.		0.493	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1		
DKC1	1736	hgsc.bcm.edu	37	X	153991251	153991251	+	Missense_Mutation	SNP	C	C	T			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chrX:153991251C>T	ENST00000369550.5	+	1	221	c.11C>T	c.(10-12)gCg>gTg	p.A4V		NM_001142463.1|NM_001363.3	NP_001135935.1|NP_001354.1	O60832	DKC1_HUMAN	dyskeratosis congenita 1, dyskerin	4	Nucleolar localization.				cell proliferation (GO:0008283)|pseudouridine synthesis (GO:0001522)|RNA processing (GO:0006396)|rRNA processing (GO:0006364)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)|telomerase activity (GO:0003720)			breast(2)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)|prostate(1)	15	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					ATGGCGGATGCGGAAGGTAAG	0.726									Congenital Dyskeratosis																												p.A4V		Atlas-SNP	.											.	DKC1	41	.	0			c.C11T						.						41.0	34.0	36.0					X																	153991251		2161	4222	6383	SO:0001583	missense	1736	exon1	Familial Cancer Database	Zinsser-Engman-Cole syndrome, Dyskeratosis Congenita	CGGATGCGGAAGG	AJ224481	CCDS14761.1, CCDS76062.1	Xq28	2014-09-17			ENSG00000130826	ENSG00000130826			2890	protein-coding gene	gene with protein product		300126		DKC		9590285, 9888995	Standard	NM_001142463		Approved	XAP101, dyskerin, NAP57, NOLA4	uc004fmm.3	O60832	OTTHUMG00000024242	ENST00000369550.5:c.11C>T	chrX.hg19:g.153991251C>T	ENSP00000358563:p.Ala4Val	273.0	0.0		362.0	127.0	NM_001363	F5BSB3|O43845|Q96G67|Q9Y505	Missense_Mutation	SNP	ENST00000369550.5	hg19	CCDS14761.1	.	.	.	.	.	.	.	.	.	.	C	11.05	1.523512	0.27299	.	.	ENSG00000130826	ENST00000369550;ENST00000413910	D;D	0.97480	-4.31;-4.4	3.74	-1.84	0.07809	.	.	.	.	.	D	0.87908	0.6296	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.78521	-0.2172	9	0.20046	T	0.44	.	0.2288	0.00177	0.3336:0.2607:0.1617:0.2439	.	4;4	A8MUT5;O60832	.;DKC1_HUMAN	V	4	ENSP00000358563:A4V;ENSP00000400542:A4V	ENSP00000358563:A4V	A	+	2	0	DKC1	153644445	0.482000	0.25948	0.053000	0.19242	0.425000	0.31504	0.189000	0.17037	-0.594000	0.05836	-0.233000	0.12211	GCG	.	.		0.726	DKC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061180.5	NM_001363	
PGBD5	79605	hgsc.bcm.edu	37	1	230492769	230492770	+	Frame_Shift_Ins	INS	-	-	T			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr1:230492769_230492770insT	ENST00000525115.1	-	2	445_446	c.422_423insA	c.(421-423)aagfs	p.K141fs	PGBD5_ENST00000321327.2_Frame_Shift_Ins_p.K240fs|PGBD5_ENST00000391860.1_Frame_Shift_Ins_p.K95fs			Q8N414	PGBD5_HUMAN	piggyBac transposable element derived 5	141						integral component of membrane (GO:0016021)				biliary_tract(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(2)|skin(1)	33	Breast(184;0.0397)	Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;0.201)		ACTTGAGGATCTTCTCGAAGCG	0.624																																					p.K210fs		Atlas-INDEL	.											.	PGBD5	73	.	0			c.630_631insA						.																																			SO:0001589	frameshift_variant	79605	exon2			.	AK021475		1q42.13	2008-02-05			ENSG00000177614	ENSG00000177614			19405	protein-coding gene	gene with protein product							Standard	NM_001258311		Approved	DKFZp761A0620, FLJ11413	uc031psq.1	Q8N414	OTTHUMG00000037759	ENST00000525115.1:c.423dupA	chr1.hg19:g.230492771_230492771dupT	ENSP00000431404:p.Lys141fs	92.0	0.0		156.0	70.0	NM_001258311	A0PJF3|B9EK58|Q5SR37|Q6PJN2	Frame_Shift_Ins	INS	ENST00000525115.1	hg19																																																																																				.	.		0.624	PGBD5-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000382617.1	NM_024554	
XIRP2	129446	hgsc.bcm.edu	37	2	168102782	168102782	+	Frame_Shift_Del	DEL	A	A	-			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr2:168102782delA	ENST00000409195.1	+	9	4969	c.4880delA	c.(4879-4881)gaafs	p.E1629fs	XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000295237.9_Frame_Shift_Del_p.E1629fs|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409273.1_Frame_Shift_Del_p.E1407fs|XIRP2_ENST00000409605.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	1454					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						TTGATTAGTGAAGAAGAGAAG	0.328																																					p.E1627fs		Atlas-INDEL	.											.	XIRP2	914	.	0			c.4879delG						.						44.0	41.0	42.0					2																	168102782		1820	4067	5887	SO:0001589	frameshift_variant	129446	exon9			.	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.4880delA	chr2.hg19:g.168102782delA	ENSP00000386840:p.Glu1629fs	229.0	0.0		312.0	126.0	NM_152381	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Frame_Shift_Del	DEL	ENST00000409195.1	hg19	CCDS42769.1																																																																																			.	.		0.328	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381	
ACVR2A	92	hgsc.bcm.edu	37	2	148684717	148684722	+	In_Frame_Del	DEL	TGGATG	TGGATG	-			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	TGGATG	TGGATG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr2:148684717_148684722delTGGATG	ENST00000241416.7	+	11	2052_2057	c.1416_1421delTGGATG	c.(1414-1422)gctggatgt>gct	p.GC473del	ACVR2A_ENST00000495775.1_3'UTR|ACVR2A_ENST00000404590.1_In_Frame_Del_p.GC473del|ACVR2A_ENST00000535787.1_In_Frame_Del_p.GC365del	NM_001278579.1|NM_001278580.1|NM_001616.3	NP_001265508.1|NP_001265509.1|NP_001607.1	P27037	AVR2A_HUMAN	activin A receptor, type IIA	473	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|determination of left/right symmetry (GO:0007368)|embryonic skeletal system development (GO:0048706)|gastrulation with mouth forming second (GO:0001702)|mesoderm development (GO:0007498)|penile erection (GO:0043084)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|regulation of BMP signaling pathway (GO:0030510)|regulation of nitric-oxide synthase activity (GO:0050999)|Sertoli cell proliferation (GO:0060011)|sperm ejaculation (GO:0042713)|spermatogenesis (GO:0007283)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|coreceptor activity (GO:0015026)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)	p.G473fs*3(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(5)|large_intestine(14)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(8)	45				BRCA - Breast invasive adenocarcinoma(221;0.0969)		GGTTATCAGCTGGATGTGTAGGTGAA	0.413																																					p.472_474del		Atlas-INDEL	.											.	ACVR2A	125	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.1415_1420del						.																																			SO:0001651	inframe_deletion	92	exon11			.		CCDS33301.1, CCDS63030.1	2q22.2-q23.3	2008-02-05	2005-05-10	2005-05-10	ENSG00000121989	ENSG00000121989			173	protein-coding gene	gene with protein product		102581	"""activin A receptor, type II"""	ACVR2		1314589, 10702675	Standard	NM_001278579		Approved	ACTRII	uc002twh.3	P27037	OTTHUMG00000150603	ENST00000241416.7:c.1416_1421delTGGATG	chr2.hg19:g.148684717_148684722delTGGATG	ENSP00000241416:p.Gly473_Cys474del	122.0	0.0		146.0	48.0	NM_001616	B2RAB8|B4DWQ2|D3DP85|Q53TH4|Q6NWV2|Q92474	In_Frame_Del	DEL	ENST00000241416.7	hg19	CCDS33301.1																																																																																			.	.		0.413	ACVR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319051.1	NM_001616	
ITIH4	3700	hgsc.bcm.edu	37	3	52855127	52855128	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	AA	AA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr3:52855127_52855128delAA	ENST00000266041.4	-	12	1654_1655	c.1558_1559delTT	c.(1558-1560)ttcfs	p.F520fs	ITIH4_ENST00000467462.1_5'UTR|ITIH4_ENST00000485816.1_Frame_Shift_Del_p.F520fs|ITIH4_ENST00000406595.1_Frame_Shift_Del_p.F520fs|ITIH4_ENST00000346281.5_Frame_Shift_Del_p.F520fs|ITIH4_ENST00000434759.3_Frame_Shift_Del_p.F432fs|RP5-966M1.6_ENST00000468472.1_3'UTR|ITIH4-AS1_ENST00000478366.1_RNA	NM_002218.4	NP_002209.2	Q14624	ITIH4_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 4	520					acute-phase response (GO:0006953)|hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)|response to cytokine (GO:0034097)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		CTCCGTTTGGAAAGTGATGTTC	0.564											OREG0015616	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.520_520del		Atlas-INDEL	.											.	ITIH4	74	.	0			c.1559_1560del						.																																			SO:0001589	frameshift_variant	3700	exon12			.	D38535	CCDS2865.1, CCDS54596.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055955	ENSG00000055955			6169	protein-coding gene	gene with protein product	"""plasma Kallikrein-sensitive glycoprotein"""	600564	"""inter-alpha (globulin) inhibitor H4 (plasma Kallikrein-sensitive glycoprotein)"""	ITIHL1		9480842, 7805892	Standard	NM_002218		Approved	IHRP, H4P	uc003dfz.3	Q14624	OTTHUMG00000159023	ENST00000266041.4:c.1558_1559delTT	chr3.hg19:g.52855127_52855128delAA	ENSP00000266041:p.Phe520fs	48.0	0.0	988	74.0	22.0	NM_002218	B7Z545|E9PGN5|Q15135|Q9P190|Q9UQ54	Frame_Shift_Del	DEL	ENST00000266041.4	hg19	CCDS2865.1																																																																																			.	.		0.564	ITIH4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317715.1	NM_002218	
RIBC1	158787	hgsc.bcm.edu	37	X	53455601	53455616	+	Intron	DEL	AGAGACCTGAGGCCTA	AGAGACCTGAGGCCTA	-			TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	AGAGACCTGAGGCCTA	AGAGACCTGAGGCCTA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chrX:53455601_53455616delAGAGACCTGAGGCCTA	ENST00000375327.3	+	5	697				RIBC1_ENST00000457095.1_Stop_Codon_Del|RIBC1_ENST00000414955.2_Intron|RIBC1_ENST00000490702.1_Intron	NM_001031745.2	NP_001026915.1	Q8N443	RIBC1_HUMAN	RIB43A domain with coiled-coils 1											lung(2)	2						CTCCAGACTCAGAGACCTGAGGCCTAGTGGGGATCT	0.537																																					p.190_193del		Atlas-INDEL	.											.	RIBC1	20	.	0			c.569_817del						.																																			SO:0001627	intron_variant	158787	exon5			.	AK057345	CCDS14353.1, CCDS35299.1, CCDS59168.1	Xp11.23	2006-04-12			ENSG00000158423	ENSG00000158423			26537	protein-coding gene	gene with protein product							Standard	NM_144968		Approved	FLJ32783	uc004dsk.4	Q8N443	OTTHUMG00000021615	ENST00000375327.3:c.544+26AGAGACCTGAGGCCTA>-	chrX.hg19:g.53455601_53455616delAGAGACCTGAGGCCTA		278.0	0.0		350.0	80.0	NM_144968	B4E297|E9PDU2|Q5H931|Q96A80	Frame_Shift_Del	DEL	ENST00000375327.3	hg19	CCDS35299.1																																																																																			.	.		0.537	RIBC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056762.1	NM_144968	
UMPS	7372	hgsc.bcm.edu	37	3	124456869	124456886	+	In_Frame_Del	DEL	TCTATCTGCTGATGTTTC	TCTATCTGCTGATGTTTC	-	rs200421426		TCGA-ZP-A9CY-01A-11D-A382-10	TCGA-ZP-A9CY-10B-01D-A385-10	TCTATCTGCTGATGTTTC	TCTATCTGCTGATGTTTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3a74a213-3d11-481d-80af-c56a90e932ad	e224c0c8-8493-4ce1-855b-34fc11453c98	g.chr3:124456869_124456886delTCTATCTGCTGATGTTTC	ENST00000232607.2	+	3	871_888	c.765_782delTCTATCTGCTGATGTTTC	c.(763-783)tgtctatctgctgatgtttca>tga	p.255_261CLSADVS>*	UMPS_ENST00000538242.1_In_Frame_Del_p.77_83CLSADVS>*|UMPS_ENST00000413078.2_In_Frame_Del_p.77_83CLSADVS>*|UMPS_ENST00000498715.1_3'UTR|UMPS_ENST00000536109.1_In_Frame_Del_p.163_169CLSADVS>*	NM_000373.3	NP_000364.1	P11172	UMPS_HUMAN	uridine monophosphate synthetase	255	OMPdecase.				'de novo' pyrimidine nucleobase biosynthetic process (GO:0006207)|'de novo' UMP biosynthetic process (GO:0044205)|cellular response to drug (GO:0035690)|female pregnancy (GO:0007565)|lactation (GO:0007595)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside biosynthetic process (GO:0046134)|small molecule metabolic process (GO:0044281)|UMP biosynthetic process (GO:0006222)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	orotate phosphoribosyltransferase activity (GO:0004588)|orotidine-5'-phosphate decarboxylase activity (GO:0004590)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16				GBM - Glioblastoma multiforme(114;0.146)	Fluorouracil(DB00544)	CCAATCTGTGTCTATCTGCTGATGTTTCACTGGCCAGA	0.472																																					p.255_261del		Atlas-INDEL	.											.	UMPS	43	.	0			c.764_781del						.																																			SO:0001651	inframe_deletion	7372	exon3			.		CCDS3029.1	3q13	2008-02-04	2008-02-04		ENSG00000114491	ENSG00000114491	2.4.2.10, 4.1.1.23		12563	protein-coding gene	gene with protein product	"""orotate phosphoribosyl transferase and orotidine-5'-decarboxylase"""	613891				2767686	Standard	NM_000373		Approved		uc003ehl.4	P11172	OTTHUMG00000159431	ENST00000232607.2:c.765_782delTCTATCTGCTGATGTTTC	chr3.hg19:g.124456869_124456886delTCTATCTGCTGATGTTTC	ENSP00000232607:p.Cys255_Ser261delins*	96.0	0.0		129.0	27.0	NM_000373	B5LY68|B5LY72|O00758|O00759|O00760|Q16862|Q9H3Q2|Q9UG49	In_Frame_Del	DEL	ENST00000232607.2	hg19	CCDS3029.1																																																																																			.	.		0.472	UMPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355271.1	NM_000373	
