#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TNFRSF18	8784	hgsc.bcm.edu	37	1	1140775	1140775	+	Silent	SNP	G	G	C			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr1:1140775G>C	ENST00000379268.2	-	2	404	c.285C>G	c.(283-285)ccC>ccG	p.P95P	TNFRSF18_ENST00000379265.5_Silent_p.P95P|TNFRSF18_ENST00000328596.6_Silent_p.P95P|TNFRSF18_ENST00000486728.1_Silent_p.P23P	NM_004195.2|NM_148902.1	NP_004186.1|NP_683700.1	Q9Y5U5	TNR18_HUMAN	tumor necrosis factor receptor superfamily, member 18	95					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|signal transduction (GO:0007165)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	tumor necrosis factor-activated receptor activity (GO:0005031)			lung(1)	1	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;3.73e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.01e-21)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;4.22e-05)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		CCTGGCCTGGGGGACAAGGGT	0.657																																					p.P95P	GBM(157;472 1934 13810 14591 35952)	Atlas-SNP	.											.	TNFRSF18	13	.	0			c.C285G						.						46.0	41.0	43.0					1																	1140775		2200	4292	6492	SO:0001819	synonymous_variant	8784	exon2			GCCTGGGGGACAA	AF125304	CCDS9.1, CCDS10.1, CCDS30552.1	1p36.3	2011-08-11			ENSG00000186891	ENSG00000186891		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11914	protein-coding gene	gene with protein product		603905				9177197, 10037686	Standard	NM_004195		Approved	AITR, GITR, CD357	uc001add.3	Q9Y5U5	OTTHUMG00000001414	ENST00000379268.2:c.285C>G	chr1.hg19:g.1140775G>C		374.0	0.0		323.0	111.0	NM_148902	B1AME1|O95851|Q5U0I4|Q9NYJ9	Silent	SNP	ENST00000379268.2	hg19	CCDS10.1																																																																																			.	.		0.657	TNFRSF18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000004083.2	NM_004195	
ACAP3	116983	hgsc.bcm.edu	37	1	1229084	1229084	+	Missense_Mutation	SNP	G	G	A			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr1:1229084G>A	ENST00000354700.5	-	24	2567	c.2365C>T	c.(2365-2367)Cgt>Tgt	p.R789C	ACAP3_ENST00000353662.3_Missense_Mutation_p.R714C|ACAP3_ENST00000379037.2_5'Flank	NM_030649.2	NP_085152.2	Q96P50	ACAP3_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH domains 3	789					regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			endometrium(3)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	14						CGCGCCAGACGGAGCCTACGG	0.781																																					p.R789C		Atlas-SNP	.											.	ACAP3	87	.	0			c.C2365T						.						3.0	3.0	3.0					1																	1229084		1697	3296	4993	SO:0001583	missense	116983	exon24			CCAGACGGAGCCT	AF411981	CCDS19.2	1p36	2013-01-10	2008-09-22	2008-09-22	ENSG00000131584	ENSG00000131584		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16754	protein-coding gene	gene with protein product			"""centaurin, beta 5"""	CENTB5			Standard	NM_030649		Approved	KIAA1716	uc001aeb.2	Q96P50	OTTHUMG00000002235	ENST00000354700.5:c.2365C>T	chr1.hg19:g.1229084G>A	ENSP00000346733:p.Arg789Cys	16.0	0.0		14.0	9.0	NM_030649	B1AMF5|Q5TA42|Q5TA43|Q86UT3|Q9BSR9|Q9C0E7	Missense_Mutation	SNP	ENST00000354700.5	hg19	CCDS19.2	.	.	.	.	.	.	.	.	.	.	G	19.09	3.759323	0.69763	.	.	ENSG00000131584	ENST00000354700;ENST00000353662	T;T	0.34275	1.37;1.37	4.26	4.26	0.50523	Ankyrin repeat-containing domain (2);	0.136297	0.50627	D	0.000110	T	0.65739	0.2720	M	0.89414	3.03	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.989;0.995	T	0.74808	-0.3539	10	0.87932	D	0	.	15.8335	0.78778	0.0:0.0:1.0:0.0	.	789;714	Q96P50;Q96P50-1	ACAP3_HUMAN;.	C	789;714	ENSP00000346733:R789C;ENSP00000321139:R714C	ENSP00000321139:R714C	R	-	1	0	ACAP3	1218947	1.000000	0.71417	0.988000	0.46212	0.102000	0.19082	3.947000	0.56652	2.195000	0.70347	0.549000	0.68633	CGT	.	.		0.781	ACAP3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006366.2	NM_030649	
STX6	10228	hgsc.bcm.edu	37	1	180991796	180991796	+	Missense_Mutation	SNP	T	T	A			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr1:180991796T>A	ENST00000258301.5	-	1	251	c.14A>T	c.(13-15)gAc>gTc	p.D5V	STX6_ENST00000542060.1_5'UTR	NM_005819.4	NP_005810.1	O43752	STX6_HUMAN	syntaxin 6	5					endosome organization (GO:0007032)|Golgi vesicle transport (GO:0048193)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)|vesicle fusion (GO:0006906)	clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|SNARE complex (GO:0031201)|trans-Golgi network membrane (GO:0032588)	SNAP receptor activity (GO:0005484)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)	10						AAAGAAGGGGTCCTCCATGGA	0.706																																					p.D5V		Atlas-SNP	.											.	STX6	21	.	0			c.A14T						.						26.0	28.0	27.0					1																	180991796		2202	4300	6502	SO:0001583	missense	10228	exon1			AAGGGGTCCTCCA	AJ002078	CCDS1341.1, CCDS65738.1	1q25.3	2008-02-05			ENSG00000135823	ENSG00000135823			11441	protein-coding gene	gene with protein product		603944				10080545	Standard	XM_005244824		Approved		uc021pfr.1	O43752	OTTHUMG00000035179	ENST00000258301.5:c.14A>T	chr1.hg19:g.180991796T>A	ENSP00000258301:p.Asp5Val	177.0	0.0		234.0	48.0	NM_005819	B2R652|B4DR17|Q5VY08|Q6FH83	Missense_Mutation	SNP	ENST00000258301.5	hg19	CCDS1341.1	.	.	.	.	.	.	.	.	.	.	T	15.12	2.739505	0.49045	.	.	ENSG00000135823	ENST00000258301	.	.	.	5.09	3.95	0.45737	t-SNARE (1);Syntaxin 6, N-terminal (1);	0.102848	0.64402	D	0.000004	T	0.81612	0.4859	M	0.93150	3.385	0.45035	D	0.998054	D	0.71674	0.998	D	0.74023	0.982	D	0.86832	0.2011	8	0.87932	D	0	-7.69	8.9399	0.35722	0.0:0.0:0.1883:0.8117	.	5	O43752	STX6_HUMAN	V	5	.	ENSP00000258301:D5V	D	-	2	0	STX6	179258419	1.000000	0.71417	1.000000	0.80357	0.106000	0.19336	3.680000	0.54641	0.763000	0.33175	-0.648000	0.03929	GAC	.	.		0.706	STX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085143.1	NM_005819	
ARPC5	10092	hgsc.bcm.edu	37	1	183602268	183602268	+	Silent	SNP	T	T	C			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr1:183602268T>C	ENST00000359856.6	-	2	231	c.165A>G	c.(163-165)ctA>ctG	p.L55L	RGL1_ENST00000304685.4_5'Flank|ARPC5_ENST00000367534.1_Silent_p.L55L|RGL1_ENST00000536277.1_5'Flank|ARPC5_ENST00000294742.6_Silent_p.L58L|ARPC5_ENST00000462965.1_5'UTR	NM_005717.3	NP_005708.1	O15511	ARPC5_HUMAN	actin related protein 2/3 complex, subunit 5, 16kDa	55					actin cytoskeleton organization (GO:0030036)|Arp2/3 complex-mediated actin nucleation (GO:0034314)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	structural constituent of cytoskeleton (GO:0005200)			cervix(1)|large_intestine(1)|lung(2)	4						GAGCTGCCTGTAGGGCAGCTG	0.463																																					p.L58L	Melanoma(136;1596 1789 3041 4830 41075)	Atlas-SNP	.											.	ARPC5	6	.	0			c.A174G						.						132.0	134.0	133.0					1																	183602268		2203	4300	6503	SO:0001819	synonymous_variant	10092	exon2			TGCCTGTAGGGCA	AF017807	CCDS1357.1, CCDS58050.1	1q	2011-07-06	2002-08-29		ENSG00000162704	ENSG00000162704		"""Actin related protein 2/3 complex subunits"""	708	protein-coding gene	gene with protein product	"""Arp2/3 protein complex subunit p16"""	604227	"""actin related protein 2/3 complex, subunit 5 (16 kD)"""			9359840, 9230079	Standard	NM_005717		Approved	p16-Arc, ARC16, dJ127C7.3	uc021pgb.2	O15511	OTTHUMG00000035326	ENST00000359856.6:c.165A>G	chr1.hg19:g.183602268T>C		121.0	0.0		220.0	39.0	NM_001270439	A6NEC4|Q6PG42	Silent	SNP	ENST00000359856.6	hg19	CCDS1357.1																																																																																			.	.		0.463	ARPC5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000085477.1	NM_005717	
CR1	1378	hgsc.bcm.edu	37	1	207748949	207748949	+	Silent	SNP	C	C	T			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr1:207748949C>T	ENST00000367049.4	+	28	4461	c.4461C>T	c.(4459-4461)ctC>ctT	p.L1487L	CR1_ENST00000367052.1_Silent_p.L1037L|CR1_ENST00000367053.1_Silent_p.L1037L|RP11-78B10.2_ENST00000596003.1_RNA|CR1_ENST00000367051.1_Silent_p.L1037L|RP11-78B10.2_ENST00000597497.1_RNA|CR1_ENST00000400960.2_Silent_p.L1037L	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	1037	Sushi 23. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						GGCACCGACTCATTGGTCACT	0.443																																					p.L1487L		Atlas-SNP	.											.	CR1	354	.	0			c.C4461T						.						329.0	317.0	321.0					1																	207748949		1936	4140	6076	SO:0001819	synonymous_variant	1378	exon28			CCGACTCATTGGT	Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.4461C>T	chr1.hg19:g.207748949C>T		281.0	0.0		474.0	97.0	NM_000651	Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Silent	SNP	ENST00000367049.4	hg19	CCDS44308.1																																																																																			.	.		0.443	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382527.1	NM_000573	
AHCTF1	25909	hgsc.bcm.edu	37	1	247024559	247024559	+	Silent	SNP	A	A	C			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr1:247024559A>C	ENST00000391829.2	-	29	3897	c.3774T>G	c.(3772-3774)ccT>ccG	p.P1258P	AHCTF1_ENST00000470300.1_5'UTR|AHCTF1_ENST00000326225.3_Silent_p.P1267P|AHCTF1_ENST00000366508.1_Silent_p.P1293P			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	1258	Disordered. {ECO:0000250}.|Necessary for nuclear localization. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			CACATTTTTTAGGTGTAGTAA	0.353																																					p.P1267P	Colon(145;197 1800 4745 15099 26333)	Atlas-SNP	.											.	AHCTF1	187	.	0			c.T3801G						.						30.0	29.0	29.0					1																	247024559		2203	4296	6499	SO:0001819	synonymous_variant	25909	exon29			TTTTTTAGGTGTA		CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.3774T>G	chr1.hg19:g.247024559A>C		203.0	0.0		387.0	170.0	NM_015446	A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Silent	SNP	ENST00000391829.2	hg19																																																																																				.	.		0.353	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015446	
FAM179A	165186	hgsc.bcm.edu	37	2	29222198	29222198	+	Missense_Mutation	SNP	G	G	C			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr2:29222198G>C	ENST00000379558.4	+	4	642	c.291G>C	c.(289-291)ttG>ttC	p.L97F	FAM179A_ENST00000403861.2_Missense_Mutation_p.L97F	NM_199280.2	NP_954974.2	Q6ZUX3	F179A_HUMAN	family with sequence similarity 179, member A	97										breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						TCAGGGCCTTGTCTTTGGGGG	0.612																																					p.L97F		Atlas-SNP	.											.	FAM179A	106	.	0			c.G291C						.						36.0	41.0	39.0					2																	29222198		2198	4296	6494	SO:0001583	missense	165186	exon4			GGCCTTGTCTTTG	AK125239, AK125744	CCDS1769.2	2p23.2	2008-10-30			ENSG00000189350	ENSG00000189350			33715	protein-coding gene	gene with protein product						16344560	Standard	NM_199280		Approved	FLJ43249, LOC165186	uc010ezl.3	Q6ZUX3	OTTHUMG00000128432	ENST00000379558.4:c.291G>C	chr2.hg19:g.29222198G>C	ENSP00000368876:p.Leu97Phe	179.0	0.0		133.0	51.0	NM_199280	Q6ZUF5	Missense_Mutation	SNP	ENST00000379558.4	hg19	CCDS1769.2	.	.	.	.	.	.	.	.	.	.	G	16.79	3.221506	0.58560	.	.	ENSG00000189350	ENST00000379558;ENST00000403861	T;T	0.12147	2.9;2.71	5.73	2.87	0.33458	.	.	.	.	.	T	0.19208	0.0461	L	0.29908	0.895	0.09310	N	1	D;D	0.65815	0.995;0.993	D;P	0.66497	0.944;0.797	T	0.09640	-1.0665	8	.	.	.	.	5.2693	0.15617	0.194:0.2144:0.5916:0.0	.	97;97	F8W8E4;Q6ZUX3	.;F179A_HUMAN	F	97	ENSP00000368876:L97F;ENSP00000384699:L97F	.	L	+	3	2	FAM179A	29075702	0.005000	0.15991	0.008000	0.14137	0.095000	0.18619	0.549000	0.23329	0.771000	0.33359	0.478000	0.44815	TTG	.	.		0.612	FAM179A-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317848.4	NM_199280	
SFXN5	94097	hgsc.bcm.edu	37	2	73250320	73250320	+	Silent	SNP	C	C	T			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr2:73250320C>T	ENST00000272433.2	-	4	403	c.273G>A	c.(271-273)aaG>aaA	p.K91K	SFXN5_ENST00000474528.1_5'UTR|SFXN5_ENST00000410065.1_Silent_p.K91K	NM_144579.2	NP_653180.1	Q8TD22	SFXN5_HUMAN	sideroflexin 5	91					iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)|citrate transmembrane transporter activity (GO:0015137)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)	9						GGATTACCTGCTTGATTTTCT	0.463																																					p.K91K		Atlas-SNP	.											.	SFXN5	31	.	0			c.G273A						.						75.0	78.0	77.0					2																	73250320		2203	4300	6503	SO:0001819	synonymous_variant	94097	exon4			TACCTGCTTGATT	AY044437	CCDS1922.1	2p13	2008-05-21			ENSG00000144040	ENSG00000144040		"""Sideroflexins"""	16073	protein-coding gene	gene with protein product		615572				12039050, 12150972	Standard	XM_005264648		Approved	BBG-TCC	uc002siq.3	Q8TD22	OTTHUMG00000129775	ENST00000272433.2:c.273G>A	chr2.hg19:g.73250320C>T		73.0	0.0		39.0	13.0	NM_144579	A8K116|Q494Y3|Q53T29	Silent	SNP	ENST00000272433.2	hg19	CCDS1922.1	.	.	.	.	.	.	.	.	.	.	C	9.185	1.024484	0.19433	.	.	ENSG00000144040	ENST00000411783	.	.	.	5.24	2.34	0.29019	.	.	.	.	.	T	0.54838	0.1883	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44467	-0.9326	4	.	.	.	-23.0405	6.7519	0.23491	0.0:0.7062:0.0:0.2938	.	.	.	.	T	81	.	.	A	-	1	0	SFXN5	73103828	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	1.530000	0.36007	0.297000	0.22615	-0.312000	0.09012	GCA	.	.		0.463	SFXN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251991.1	NM_144579	
CNTNAP5	129684	hgsc.bcm.edu	37	2	125555843	125555843	+	Missense_Mutation	SNP	C	C	T			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr2:125555843C>T	ENST00000431078.1	+	19	3524	c.3160C>T	c.(3160-3162)Ctc>Ttc	p.L1054F		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	1054	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		CAGTCTTTTGCTCTTTATCAA	0.473																																					p.L1054F		Atlas-SNP	.											CNTNAP5,right_upper_lobe,carcinoma,0,1	CNTNAP5	405	.	0			c.C3160T						.						148.0	145.0	146.0					2																	125555843		1970	4152	6122	SO:0001583	missense	129684	exon19			CTTTTGCTCTTTA	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.3160C>T	chr2.hg19:g.125555843C>T	ENSP00000399013:p.Leu1054Phe	123.0	0.0		108.0	27.0	NM_130773	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	ENST00000431078.1	hg19	CCDS46401.1	.	.	.	.	.	.	.	.	.	.	C	16.72	3.201791	0.58234	.	.	ENSG00000155052	ENST00000431078	D	0.85556	-2.0	5.92	3.04	0.35103	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.156540	0.29376	N	0.012333	D	0.85256	0.5655	M	0.81614	2.55	0.54753	D	0.999981	B	0.30482	0.281	B	0.34931	0.192	T	0.82741	-0.0307	10	0.45353	T	0.12	.	11.0798	0.48053	0.0:0.808:0.0:0.192	.	1054	Q8WYK1	CNTP5_HUMAN	F	1054	ENSP00000399013:L1054F	ENSP00000399013:L1054F	L	+	1	0	CNTNAP5	125272313	1.000000	0.71417	0.998000	0.56505	0.972000	0.66771	1.787000	0.38704	0.786000	0.33708	-0.312000	0.09012	CTC	.	.		0.473	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3		
SCN1A	6323	hgsc.bcm.edu	37	2	166852580	166852580	+	Silent	SNP	A	A	G			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr2:166852580A>G	ENST00000303395.4	-	24	4523	c.4524T>C	c.(4522-4524)taT>taC	p.Y1508Y	SCN1A_ENST00000423058.2_Silent_p.Y1508Y|AC010127.3_ENST00000595647.1_RNA|AC010127.3_ENST00000597623.1_RNA|SCN1A_ENST00000375405.3_Silent_p.Y1497Y|SCN1A_ENST00000409050.1_Silent_p.Y1480Y			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	1508					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TCATTGCATTATAGTATTTCT	0.318																																					p.Y1508Y		Atlas-SNP	.											.	SCN1A	641	.	0			c.T4524C						.						130.0	124.0	126.0					2																	166852580		2202	4300	6502	SO:0001819	synonymous_variant	6323	exon24			TGCATTATAGTAT	AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.4524T>C	chr2.hg19:g.166852580A>G		168.0	0.0		156.0	57.0	NM_001165963	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Silent	SNP	ENST00000303395.4	hg19	CCDS54413.1																																																																																			.	.		0.318	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	NM_006920	
FSIP2	401024	hgsc.bcm.edu	37	2	186670241	186670241	+	Missense_Mutation	SNP	C	C	T			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr2:186670241C>T	ENST00000424728.1	+	17	16208	c.16208C>T	c.(16207-16209)tCt>tTt	p.S5403F	FSIP2_ENST00000343098.5_Missense_Mutation_p.S5492F			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	5403										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						GGAGACTGGTCTTCCACCTTC	0.393																																					p.S5492F		Atlas-SNP	.											.	FSIP2	251	.	0			c.C16475T						.						104.0	95.0	98.0					2																	186670241		1850	4087	5937	SO:0001583	missense	401024	exon17			ACTGGTCTTCCAC	AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.16208C>T	chr2.hg19:g.186670241C>T	ENSP00000401306:p.Ser5403Phe	231.0	0.0		238.0	89.0	NM_173651	Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Missense_Mutation	SNP	ENST00000424728.1	hg19		.	.	.	.	.	.	.	.	.	.	C	11.37	1.617792	0.28801	.	.	ENSG00000188738	ENST00000343098;ENST00000424728	T;T	0.44881	0.91;0.91	5.13	2.07	0.26955	.	.	.	.	.	T	0.22742	0.0549	L	0.27053	0.805	0.25818	N	0.984311	.	.	.	.	.	.	T	0.24012	-1.0172	7	0.08179	T	0.78	.	3.9741	0.09467	0.0:0.563:0.2124:0.2246	.	.	.	.	F	5492;5403	ENSP00000344403:S5492F;ENSP00000401306:S5403F	ENSP00000344403:S5492F	S	+	2	0	FSIP2	186378486	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.861000	0.27885	0.720000	0.32209	0.460000	0.39030	TCT	.	.		0.393	FSIP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000332778.3	NM_173651	
PVRL3	25945	hgsc.bcm.edu	37	3	110837591	110837591	+	Silent	SNP	T	T	G			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr3:110837591T>G	ENST00000485303.1	+	3	866	c.591T>G	c.(589-591)acT>acG	p.T197T	PVRL3_ENST00000319792.3_Silent_p.T197T|PVRL3_ENST00000493615.1_Silent_p.T174T	NM_001243286.1|NM_015480.2	NP_001230215.1|NP_056295.1	Q9NQS3	PVRL3_HUMAN	poliovirus receptor-related 3	197	Ig-like C2-type 1.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|fertilization (GO:0009566)|homophilic cell adhesion (GO:0007156)|lens morphogenesis in camera-type eye (GO:0002089)|retina morphogenesis in camera-type eye (GO:0060042)|single organismal cell-cell adhesion (GO:0016337)	apical junction complex (GO:0043296)|cell-cell adherens junction (GO:0005913)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	cell adhesion molecule binding (GO:0050839)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(3)	19						TCGCAGCCACTGGAAAACCCG	0.423																																					p.T197T		Atlas-SNP	.											.	PVRL3	78	.	0			c.T591G						.						60.0	51.0	54.0					3																	110837591		2203	4300	6503	SO:0001819	synonymous_variant	25945	exon3			AGCCACTGGAAAA	AF282874	CCDS2957.1, CCDS58842.1, CCDS58843.1	3q13	2013-01-29			ENSG00000177707	ENSG00000177707		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17664	protein-coding gene	gene with protein product		607147				11024295	Standard	NM_015480		Approved	nectin-3, PPR3, PVRR3, DKFZP566B0846, CDw113, CD113	uc003dxt.2	Q9NQS3	OTTHUMG00000159239	ENST00000485303.1:c.591T>G	chr3.hg19:g.110837591T>G		198.0	0.0		199.0	72.0	NM_001243286	E9PFR0|Q6NVZ3|Q8NC05|Q8WVU4|Q9BVA9|Q9Y412	Silent	SNP	ENST00000485303.1	hg19	CCDS2957.1																																																																																			.	.		0.423	PVRL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354045.1	NM_015480	
FAM200B	285550	hgsc.bcm.edu	37	4	15688697	15688697	+	Missense_Mutation	SNP	G	G	A			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr4:15688697G>A	ENST00000422728.2	+	2	935	c.97G>A	c.(97-99)Gac>Aac	p.D33N	FAM200B_ENST00000504137.1_3'UTR	NM_001145191.1	NP_001138663.1	P0CF97	F200B_HUMAN	family with sequence similarity 200, member B	33							nucleic acid binding (GO:0003676)			endometrium(1)|kidney(1)	2						tgtgaatagtgacaatattga	0.303																																					p.D33N		Atlas-SNP	.											.	FAM200B	56	.	0			c.G97A						.						54.0	49.0	50.0					4																	15688697		692	1587	2279	SO:0001583	missense	285550	exon2			AATAGTGACAATA	BC048993	CCDS47028.1	4p15.32	2014-04-02			ENSG00000237765	ENSG00000237765			27740	protein-coding gene	gene with protein product	"""chromosome 4 open reading frame 53"""						Standard	NM_001145191		Approved	C4orf53	uc003gof.4	P0CF97	OTTHUMG00000160279	ENST00000422728.2:c.97G>A	chr4.hg19:g.15688697G>A	ENSP00000393017:p.Asp33Asn	527.0	1.0		495.0	174.0	NM_001145191		Missense_Mutation	SNP	ENST00000422728.2	hg19	CCDS47028.1	.	.	.	.	.	.	.	.	.	.	G	3.560	-0.089815	0.07053	.	.	ENSG00000237765	ENST00000422728	T	0.13657	2.57	3.5	2.6	0.31112	.	.	.	.	.	T	0.06600	0.0169	N	0.14661	0.345	0.09310	N	1	B	0.18863	0.031	B	0.16722	0.016	T	0.42481	-0.9449	9	0.09590	T	0.72	.	6.2408	0.20789	0.1479:0.0:0.8521:0.0	.	33	P0CF97	F200B_HUMAN	N	33	ENSP00000393017:D33N	ENSP00000393017:D33N	D	+	1	0	FAM200B	15297795	0.004000	0.15560	0.005000	0.12908	0.699000	0.40488	0.972000	0.29409	0.986000	0.38683	0.650000	0.86243	GAC	.	.		0.303	FAM200B-005	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360100.1	NM_001145191	
DSPP	1834	hgsc.bcm.edu	37	4	88537513	88537513	+	Missense_Mutation	SNP	A	A	C	rs112275895		TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr4:88537513A>C	ENST00000282478.7	+	4	3732	c.3699A>C	c.(3697-3699)gaA>gaC	p.E1233D	DSPP_ENST00000399271.1_Missense_Mutation_p.E1233D|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1233	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		acagcaatgaaagcagcgaca	0.547																																					p.E1233D		Atlas-SNP	.											.	DSPP	174	.	0			c.A3699C						.																																			SO:0001583	missense	1834	exon5			CAATGAAAGCAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3699A>C	chr4.hg19:g.88537513A>C	ENSP00000282478:p.Glu1233Asp	347.0	0.0		383.0	39.0	NM_014208	A8MUI0|O95815	Missense_Mutation	SNP	ENST00000282478.7	hg19	CCDS43248.1	.	.	.	.	.	.	.	.	.	.	A	0.010	-1.785366	0.00628	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.88741	-2.42;-2.42	2.61	-5.21	0.02815	.	.	.	.	.	T	0.57213	0.2038	N	0.01048	-1.04	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.57347	-0.7827	9	0.02654	T	1	.	0.7125	0.00926	0.2623:0.1881:0.1298:0.4197	.	1233	Q9NZW4	DSPP_HUMAN	D	1233	ENSP00000382213:E1233D;ENSP00000282478:E1233D	ENSP00000282478:E1233D	E	+	3	2	DSPP	88756537	0.003000	0.15002	0.000000	0.03702	0.000000	0.00434	-2.769000	0.00780	-2.252000	0.00699	-3.496000	0.00033	GAA	.	A|0.500;C|0.500		0.547	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
PITX2	5308	hgsc.bcm.edu	37	4	111543434	111543434	+	Intron	SNP	G	G	T			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr4:111543434G>T	ENST00000354925.2	-	6	1890				PITX2_ENST00000355080.5_Intron|PITX2_ENST00000394598.2_Intron|PITX2_ENST00000394595.3_Intron|PITX2_ENST00000306732.3_Missense_Mutation_p.D61E|PITX2_ENST00000557119.2_Missense_Mutation_p.D61E|PITX2_ENST00000556049.1_5'Flank	NM_001204397.1	NP_001191326.1	Q99697	PITX2_HUMAN	paired-like homeodomain 2						atrial cardiac muscle tissue morphogenesis (GO:0055009)|atrioventricular valve development (GO:0003171)|camera-type eye development (GO:0043010)|cardiac neural crest cell migration involved in outflow tract morphogenesis (GO:0003253)|cell proliferation involved in outflow tract morphogenesis (GO:0061325)|deltoid tuberosity development (GO:0035993)|determination of left/right symmetry (GO:0007368)|embryonic camera-type eye development (GO:0031076)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic hindlimb morphogenesis (GO:0035116)|endodermal digestive tract morphogenesis (GO:0061031)|extraocular skeletal muscle development (GO:0002074)|female gonad development (GO:0008585)|hair cell differentiation (GO:0035315)|hypothalamus cell migration (GO:0021855)|in utero embryonic development (GO:0001701)|iris morphogenesis (GO:0061072)|left lung morphogenesis (GO:0060460)|left/right axis specification (GO:0070986)|male gonad development (GO:0008584)|myoblast fusion (GO:0007520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|odontogenesis (GO:0042476)|odontogenesis of dentin-containing tooth (GO:0042475)|patterning of blood vessels (GO:0001569)|positive regulation of DNA binding (GO:0043388)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prolactin secreting cell differentiation (GO:0060127)|pulmonary myocardium development (GO:0003350)|pulmonary vein morphogenesis (GO:0060577)|regulation of cell migration (GO:0030334)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to hormone (GO:0009725)|response to vitamin A (GO:0033189)|somatotropin secreting cell differentiation (GO:0060126)|spleen development (GO:0048536)|subthalamic nucleus development (GO:0021763)|superior vena cava morphogenesis (GO:0060578)|vascular smooth muscle cell differentiation (GO:0035886)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell development (GO:0055015)|ventricular septum morphogenesis (GO:0060412)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin DNA binding (GO:0031490)|phosphoprotein binding (GO:0051219)|protein homodimerization activity (GO:0042803)|ribonucleoprotein complex binding (GO:0043021)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|endometrium(3)|large_intestine(1)|lung(5)	10		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00222)		GGCTGGAGGTGTCGGAGATGG	0.687																																					p.D61E		Atlas-SNP	.											.	PITX2	73	.	0			c.C183A						.						16.0	17.0	17.0					4																	111543434		2189	4271	6460	SO:0001627	intron_variant	5308	exon1			GGAGGTGTCGGAG	U69961	CCDS3692.1, CCDS3693.1, CCDS3694.1	4q25	2011-06-20	2007-07-12		ENSG00000164093	ENSG00000164093		"""Homeoboxes / PRD class"""	9005	protein-coding gene	gene with protein product		601542	"""paired-like homeodomain transcription factor 2"""	IRID2, IHG2, RIEG, RIEG1, RGS		9539779, 7581385	Standard	NM_000325		Approved	IGDS, RS, Brx1, Otlx2, ARP1	uc021xqr.1	Q99697	OTTHUMG00000132837	ENST00000354925.2:c.185-909C>A	chr4.hg19:g.111543434G>T		205.0	0.0		182.0	79.0	NM_000325	A8K6C6|B2RA02|B3KXS0|O60578|O60579|O60580|Q3KQX9|Q9BY17	Missense_Mutation	SNP	ENST00000354925.2	hg19	CCDS3692.1	.	.	.	.	.	.	.	.	.	.	G	16.25	3.069630	0.55539	.	.	ENSG00000164093	ENST00000306732	D	0.91124	-2.79	5.17	4.32	0.51571	.	0.345833	0.33092	N	0.005290	T	0.79563	0.4467	.	.	.	0.80722	D	1	B	0.13145	0.007	B	0.17979	0.02	T	0.70905	-0.4745	9	0.02654	T	1	.	12.429	0.55563	0.084:0.0:0.916:0.0	.	61	Q99697-2	.	E	61	ENSP00000304169:D61E	ENSP00000304169:D61E	D	-	3	2	PITX2	111762883	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.169000	0.71913	1.138000	0.42230	0.655000	0.94253	GAC	.	.		0.687	PITX2-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256308.2		
RASA1	5921	hgsc.bcm.edu	37	5	86668007	86668007	+	Missense_Mutation	SNP	C	C	G			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr5:86668007C>G	ENST00000274376.6	+	13	2335	c.1771C>G	c.(1771-1773)Cgt>Ggt	p.R591G	RASA1_ENST00000506290.1_Missense_Mutation_p.R425G|RASA1_ENST00000456692.2_Missense_Mutation_p.R414G|RASA1_ENST00000512763.1_Missense_Mutation_p.R424G	NM_002890.2	NP_002881.1	P20936	RASA1_HUMAN	RAS p21 protein activator (GTPase activating protein) 1	591	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				blood vessel morphogenesis (GO:0048514)|embryo development (GO:0009790)|intracellular signal transduction (GO:0035556)|mitotic cytokinesis (GO:0000281)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|regulation of RNA metabolic process (GO:0051252)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|ruffle (GO:0001726)	glycoprotein binding (GO:0001948)|GTPase binding (GO:0051020)|potassium channel inhibitor activity (GO:0019870)|Ras GTPase activator activity (GO:0005099)|receptor binding (GO:0005102)			NS(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(12)|lung(13)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	48		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		TAAACGCCTTCGTCAGGTGAA	0.353																																					p.R591G		Atlas-SNP	.											.	RASA1	213	.	0			c.C1771G						.						85.0	86.0	86.0					5																	86668007		2203	4300	6503	SO:0001583	missense	5921	exon13			CGCCTTCGTCAGG		CCDS34200.1, CCDS47243.1	5q13	2013-02-14			ENSG00000145715	ENSG00000145715		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	9871	protein-coding gene	gene with protein product	"""capillary malformation-arteriovenous malformation"""	139150		RASA		15917201	Standard	NM_022650		Approved	GAP, CM-AVM, p120GAP, p120RASGAP	uc003kiw.3	P20936	OTTHUMG00000162605	ENST00000274376.6:c.1771C>G	chr5.hg19:g.86668007C>G	ENSP00000274376:p.Arg591Gly	148.0	0.0		158.0	48.0	NM_002890	B2R6W3|Q9UDI1	Missense_Mutation	SNP	ENST00000274376.6	hg19	CCDS34200.1	.	.	.	.	.	.	.	.	.	.	C	19.36	3.812121	0.70797	.	.	ENSG00000145715	ENST00000274376;ENST00000534133;ENST00000456692;ENST00000512763;ENST00000506290	D;T;T;T	0.81821	-1.54;-1.44;-1.43;-1.44	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	D	0.89100	0.6619	M	0.71581	2.175	0.80722	D	1	D;D;D;D;D	0.76494	0.993;0.999;0.993;0.996;0.986	P;D;P;D;P	0.67382	0.87;0.951;0.87;0.939;0.775	D	0.89999	0.4113	10	0.87932	D	0	.	19.1952	0.93684	0.0:1.0:0.0:0.0	.	425;424;425;414;591	E9PGC0;B4DTL2;B4DTX4;P20936-2;P20936	.;.;.;.;RASA1_HUMAN	G	591;624;414;424;425	ENSP00000274376:R591G;ENSP00000411221:R414G;ENSP00000422008:R424G;ENSP00000420905:R425G	ENSP00000274376:R591G	R	+	1	0	RASA1	86703763	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.486000	0.53215	2.531000	0.85337	0.650000	0.86243	CGT	.	.		0.353	RASA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369729.1	NM_002890	
RFESD	317671	hgsc.bcm.edu	37	5	94991973	94991973	+	Missense_Mutation	SNP	A	A	T			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr5:94991973A>T	ENST00000311364.4	+	5	1851	c.434A>T	c.(433-435)tAt>tTt	p.Y145F	SPATA9_ENST00000477047.2_Intron|RFESD_ENST00000513950.2_3'UTR|RFESD_ENST00000458310.1_Missense_Mutation_p.Y198F|RFESD_ENST00000380005.4_Missense_Mutation_p.Y198F	NM_173362.3	NP_775498.1	Q8TAC1	RFESD_HUMAN	Rieske (Fe-S) domain containing	145							2 iron, 2 sulfur cluster binding (GO:0051537)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)			autonomic_ganglia(2)|endometrium(1)|large_intestine(1)|lung(1)|urinary_tract(1)	6		all_cancers(142;0.000215)|all_epithelial(76;7.43e-07)|all_lung(232;0.0318)|Lung NSC(167;0.041)|Ovarian(225;0.051)|Colorectal(57;0.162)		all cancers(79;5.94e-17)		TCTGATTTTTATGCCACTGGA	0.308																																					p.Y198F		Atlas-SNP	.											.	RFESD	22	.	0			c.A593T						.						60.0	70.0	66.0					5																	94991973		2203	4300	6503	SO:0001583	missense	317671	exon6			ATTTTTATGCCAC	BC035110	CCDS4075.1, CCDS47248.1	5q15	2010-12-07			ENSG00000175449	ENSG00000175449			29587	protein-coding gene	gene with protein product						12477932	Standard	NM_173362		Approved		uc003klg.3	Q8TAC1	OTTHUMG00000121168	ENST00000311364.4:c.434A>T	chr5.hg19:g.94991973A>T	ENSP00000309229:p.Tyr145Phe	84.0	0.0		71.0	26.0	NM_001131066	J3KPH1	Missense_Mutation	SNP	ENST00000311364.4	hg19	CCDS4075.1	.	.	.	.	.	.	.	.	.	.	A	16.70	3.196803	0.58126	.	.	ENSG00000175449	ENST00000380005;ENST00000311364;ENST00000458310	.	.	.	5.44	5.44	0.79542	.	0.056927	0.64402	D	0.000001	T	0.58090	0.2098	M	0.67517	2.055	0.80722	D	1	B	0.22683	0.073	B	0.18561	0.022	T	0.55302	-0.8162	8	.	.	.	-5.8305	11.212	0.48804	0.8627:0.0:0.0:0.1373	.	145	Q8TAC1	RFESD_HUMAN	F	198;145;198	.	.	Y	+	2	0	RFESD	95017729	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.793000	0.55484	2.070000	0.61991	0.383000	0.25322	TAT	.	.		0.308	RFESD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241654.1	NM_173362	
FTMT	94033	hgsc.bcm.edu	37	5	121187819	121187819	+	Missense_Mutation	SNP	C	C	A			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr5:121187819C>A	ENST00000321339.1	+	1	170	c.161C>A	c.(160-162)tCc>tAc	p.S54Y		NM_177478.1	NP_803431.1	Q8N4E7	FTMT_HUMAN	ferritin mitochondrial	54					cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|positive regulation of cell proliferation (GO:0008284)|positive regulation of lyase activity (GO:0051349)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of transferase activity (GO:0051347)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ferric iron binding (GO:0008199)|ferroxidase activity (GO:0004322)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	33		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;0.000171)|OV - Ovarian serous cystadenocarcinoma(64;0.000188)|all cancers(49;0.0027)		GCAGCCGCCTCCTCCCGGGAC	0.766																																					p.S54Y		Atlas-SNP	.											.	FTMT	71	.	0			c.C161A						.						7.0	9.0	9.0					5																	121187819		2142	4198	6340	SO:0001583	missense	94033	exon1			CCGCCTCCTCCCG	BC034419	CCDS4128.1	5q23.1	2008-02-05			ENSG00000181867	ENSG00000181867			17345	protein-coding gene	gene with protein product		608847				11323407	Standard	NM_177478		Approved	MtF	uc003kss.3	Q8N4E7	OTTHUMG00000128912	ENST00000321339.1:c.161C>A	chr5.hg19:g.121187819C>A	ENSP00000313691:p.Ser54Tyr	43.0	0.0		52.0	21.0	NM_177478		Missense_Mutation	SNP	ENST00000321339.1	hg19	CCDS4128.1	.	.	.	.	.	.	.	.	.	.	C	5.474	0.272473	0.10349	.	.	ENSG00000181867	ENST00000321339	T	0.64991	-0.13	3.23	1.32	0.21799	.	.	.	.	.	T	0.38161	0.1030	L	0.27053	0.805	0.09310	N	1	B	0.30406	0.278	B	0.28385	0.089	T	0.29181	-1.0020	9	0.02654	T	1	.	5.2817	0.15678	0.0:0.5856:0.0:0.4144	.	54	Q8N4E7	FTMT_HUMAN	Y	54	ENSP00000313691:S54Y	ENSP00000313691:S54Y	S	+	2	0	FTMT	121215718	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	0.239000	0.18023	0.337000	0.23665	0.655000	0.94253	TCC	.	.		0.766	FTMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250884.1	NM_177478	
ANKHD1	54882	hgsc.bcm.edu	37	5	139908010	139908010	+	Missense_Mutation	SNP	C	C	T			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr5:139908010C>T	ENST00000360839.2	+	29	5633	c.5479C>T	c.(5479-5481)Ccc>Tcc	p.P1827S	SNORD45_ENST00000363181.1_RNA|ANKHD1_ENST00000297183.6_Missense_Mutation_p.P1827S|ANKHD1-EIF4EBP3_ENST00000532219.1_Missense_Mutation_p.P1827S|ANKHD1_ENST00000544120.1_Missense_Mutation_p.P210S	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	1827						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TACGTTCCAGCCCGCTAATAA	0.438																																					p.P1827S		Atlas-SNP	.											.	ANKHD1	233	.	0			c.C5479T						.						150.0	147.0	148.0					5																	139908010		2203	4300	6503	SO:0001583	missense	54882	exon29			TTCCAGCCCGCTA	AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.5479C>T	chr5.hg19:g.139908010C>T	ENSP00000354085:p.Pro1827Ser	151.0	0.0		143.0	58.0	NM_017747	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Missense_Mutation	SNP	ENST00000360839.2	hg19	CCDS4225.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.75|10.75	1.438920|1.438920	0.25900|0.25900	.|.	.|.	ENSG00000131503|ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000254996	ENST00000435794;ENST00000432301|ENST00000360839;ENST00000297183;ENST00000253810;ENST00000431508;ENST00000536646;ENST00000433049;ENST00000544120;ENST00000532219	.|T;T;T;T;T;T	.|0.63096	.|0.02;-0.02;2.12;2.17;1.77;-0.02	4.99|4.99	3.2|3.2	0.36748|0.36748	.|.	.|0.366825	.|0.28659	.|N	.|0.014565	T|T	0.44891|0.44891	0.1315|0.1315	L|L	0.28274|0.28274	0.84|0.84	0.36827|0.36827	D|D	0.886704|0.886704	.|B;B;B;B;B	.|0.02656	.|0.0;0.0;0.0;0.0;0.0	.|B;B;B;B;B	.|0.04013	.|0.001;0.0;0.001;0.001;0.001	T|T	0.43228|0.43228	-0.9404|-0.9404	5|10	.|0.56958	.|D	.|0.05	.|.	6.5559|6.5559	0.22460|0.22460	0.0:0.5672:0.2815:0.1512|0.0:0.5672:0.2815:0.1512	.|.	.|210;257;1827;1827;1827	.|Q8IWG5;Q9H059;E9PF56;Q8IWZ2;Q8IWZ3	.|.;.;.;.;ANKH1_HUMAN	V|S	317;277|1827;1827;1827;483;262;349;210;1827	.|ENSP00000354085:P1827S;ENSP00000297183:P1827S;ENSP00000393204:P483S;ENSP00000390034:P349S;ENSP00000437687:P210S;ENSP00000432016:P1827S	.|ENSP00000432016:P1827S	A|P	+|+	2|1	0|0	ANKHD1|ANKHD1-EIF4EBP3;ANKHD1	139888194|139888194	0.995000|0.995000	0.38212|0.38212	0.998000|0.998000	0.56505|0.56505	0.914000|0.914000	0.54420|0.54420	0.506000|0.506000	0.22658|0.22658	0.687000|0.687000	0.31509|0.31509	0.655000|0.655000	0.94253|0.94253	GCC|CCC	.	.		0.438	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251672.1	NM_017747	
PCDHGA11	56105	hgsc.bcm.edu	37	5	140801283	140801283	+	Silent	SNP	G	G	A			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr5:140801283G>A	ENST00000398587.2	+	1	522	c.489G>A	c.(487-489)gtG>gtA	p.V163V	PCDHGA8_ENST00000398604.2_Intron|PCDHGA11_ENST00000518882.1_Silent_p.V163V|PCDHGA3_ENST00000253812.6_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron	NM_018914.2|NM_032092.1	NP_061737.1|NP_114481.1	Q9Y5H2	PCDGB_HUMAN	protocadherin gamma subfamily A, 11	163	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(8)|kidney(3)|large_intestine(9)|lung(22)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATCCAGATGTGGGCGTGAACT	0.542																																					p.V163V		Atlas-SNP	.											.	PCDHGA11	128	.	0			c.G489A						.						35.0	37.0	36.0					5																	140801283		1951	4156	6107	SO:0001819	synonymous_variant	56105	exon1			AGATGTGGGCGTG	AF152505	CCDS47294.1, CCDS54930.1, CCDS75345.1	5q31	2010-01-26			ENSG00000253873	ENSG00000253873		"""Cadherins / Protocadherins : Clustered"""	8698	other	protocadherin		606298				10380929	Standard	NM_018914		Approved	PCDH-GAMMA-A11		Q9Y5H2	OTTHUMG00000164055	ENST00000398587.2:c.489G>A	chr5.hg19:g.140801283G>A		125.0	0.0		124.0	35.0	NM_032091	B7ZVY8|Q9Y5D8|Q9Y5D9	Silent	SNP	ENST00000398587.2	hg19	CCDS47294.1																																																																																			.	.		0.542	PCDHGA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376974.1	NM_018914	
GALNT10	55568	hgsc.bcm.edu	37	5	153570579	153570579	+	Silent	SNP	G	G	A			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr5:153570579G>A	ENST00000297107.6	+	1	290	c.153G>A	c.(151-153)gcG>gcA	p.A51A	MFAP3_ENST00000519325.1_Intron|GALNT10_ENST00000377661.2_Silent_p.A51A|GALNT10_ENST00000425427.2_Silent_p.A51A	NM_198321.3	NP_938080.1	Q86SR1	GLT10_HUMAN	polypeptide N-acetylgalactosaminyltransferase 10	51					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(12)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	32	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)|all_hematologic(541;0.21)	Kidney(363;8.21e-05)|KIRC - Kidney renal clear cell carcinoma(527;0.000577)			cgccggcggcgggACAGGTGA	0.697																																					p.A51A		Atlas-SNP	.											.	GALNT10	70	.	0			c.G153A						.						2.0	3.0	3.0					5																	153570579		1372	2906	4278	SO:0001819	synonymous_variant	55568	exon1			GGCGGCGGGACAG	AK023782	CCDS4325.1	5q34	2014-03-13	2014-03-13		ENSG00000164574	ENSG00000164574	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	19873	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 10"""	608043	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (GalNAc-T10)"""			12417297	Standard	NM_198321		Approved	GalNAc-T10	uc003lvh.3	Q86SR1	OTTHUMG00000130145	ENST00000297107.6:c.153G>A	chr5.hg19:g.153570579G>A		54.0	0.0		38.0	11.0	NM_198321	B3KXC9|Q6IN56|Q86VP8|Q8IXJ2|Q8TEJ2|Q96IV2|Q9H8E1|Q9Y4M4	Silent	SNP	ENST00000297107.6	hg19	CCDS4325.1																																																																																			.	.		0.697	GALNT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252453.1	NM_198321	
ERGIC1	57222	hgsc.bcm.edu	37	5	172359459	172359459	+	Missense_Mutation	SNP	A	A	C	rs140909162		TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr5:172359459A>C	ENST00000393784.3	+	8	701	c.562A>C	c.(562-564)Atc>Ctc	p.I188L		NM_001031711.2	NP_001026881.1	Q969X5	ERGI1_HUMAN	endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1	188					ER to Golgi vesicle-mediated transport (GO:0006888)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|skin(2)	9	Renal(175;0.000159)|Lung NSC(126;0.00344)|all_lung(126;0.00594)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CCACGACTACATCCTGAAGAT	0.597											OREG0017050	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.I188L		Atlas-SNP	.											.	ERGIC1	35	.	0			c.A562C						.	A	LEU/ILE	0,4406		0,0,2203	71.0	59.0	63.0		562	4.9	1.0	5	dbSNP_134	63	1,8599	1.2+/-3.3	0,1,4299	no	missense	ERGIC1	NM_001031711.2	5	0,1,6502	CC,CA,AA		0.0116,0.0,0.0077	benign	188/291	172359459	1,13005	2203	4300	6503	SO:0001583	missense	57222	exon8			GACTACATCCTGA	AF267855	CCDS34292.1	5q35.1	2009-11-06			ENSG00000113719	ENSG00000113719			29205	protein-coding gene	gene with protein product						10574461, 15308636	Standard	NM_001031711		Approved	ERGIC32, ERGIC-32, KIAA1181, NET24	uc003mbw.4	Q969X5	OTTHUMG00000130520	ENST00000393784.3:c.562A>C	chr5.hg19:g.172359459A>C	ENSP00000377374:p.Ile188Leu	72.0	0.0	237	65.0	25.0	NM_001031711	Q9H0L0|Q9H2J2|Q9ULN9	Missense_Mutation	SNP	ENST00000393784.3	hg19	CCDS34292.1	.	.	.	.	.	.	.	.	.	.	A	18.22	3.576391	0.65878	0.0	1.16E-4	ENSG00000113719	ENST00000393784	.	.	.	4.9	4.9	0.64082	Domain of unknown function DUF1692 (1);	0.046408	0.85682	D	0.000000	T	0.50667	0.1629	L	0.50919	1.6	0.80722	D	1	B;B	0.28178	0.202;0.201	B;B	0.29942	0.109;0.081	T	0.54241	-0.8323	9	0.62326	D	0.03	-27.4274	8.8988	0.35481	0.9152:0.0:0.0848:0.0	.	133;188	B4E0N6;Q969X5	.;ERGI1_HUMAN	L	188	.	ENSP00000377374:I188L	I	+	1	0	ERGIC1	172292065	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.273000	0.78527	1.844000	0.53588	0.533000	0.62120	ATC	.	A|1.000;C|0.000		0.597	ERGIC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252938.3	NM_020462	
B4GALT7	11285	hgsc.bcm.edu	37	5	177036620	177036620	+	Missense_Mutation	SNP	G	G	A			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr5:177036620G>A	ENST00000029410.5	+	6	1019	c.908G>A	c.(907-909)gGc>gAc	p.G303D	RP11-1277A3.1_ENST00000499900.2_RNA	NM_007255.2	NP_009186.1	Q9UBV7	B4GT7_HUMAN	xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7	303					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|chondroitin sulfate metabolic process (GO:0030204)|extracellular fibril organization (GO:0043206)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|negative regulation of fibroblast proliferation (GO:0048147)|protein N-linked glycosylation (GO:0006487)|proteoglycan metabolic process (GO:0006029)|small molecule metabolic process (GO:0044281)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|galactosyltransferase activity (GO:0008378)|manganese ion binding (GO:0030145)|xylosylprotein 4-beta-galactosyltransferase activity (GO:0046525)			endometrium(2)|large_intestine(1)|lung(1)|pancreas(1)|skin(1)|urinary_tract(1)	7	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTGTCTGTGGGCGGGGCCCCC	0.592																																					p.G303D		Atlas-SNP	.											.	B4GALT7	21	.	0			c.G908A						.						80.0	77.0	78.0					5																	177036620		2203	4300	6503	SO:0001583	missense	11285	exon6			CTGTGGGCGGGGC	AB028600	CCDS4429.1	5q35.1-q35.3	2013-02-19	2012-07-18		ENSG00000027847	ENSG00000027847		"""Beta 4-glycosyltransferases"""	930	protein-coding gene	gene with protein product	"""galactosyltransferase I"""	604327				10438455, 10473568	Standard	NM_007255		Approved	XGALT-1, beta4Gal-T7	uc003mhy.3	Q9UBV7	OTTHUMG00000130851	ENST00000029410.5:c.908G>A	chr5.hg19:g.177036620G>A	ENSP00000029410:p.Gly303Asp	137.0	0.0		127.0	48.0	NM_007255	B3KN39|Q9UHN2	Missense_Mutation	SNP	ENST00000029410.5	hg19	CCDS4429.1	.	.	.	.	.	.	.	.	.	.	.	4.285	0.052114	0.08291	.	.	ENSG00000027847	ENST00000029410;ENST00000541139	T	0.69040	-0.37	5.21	0.886	0.19194	.	0.362657	0.34362	N	0.004032	T	0.47002	0.1422	N	0.21097	0.63	0.39543	D	0.968851	B	0.06786	0.001	B	0.06405	0.002	T	0.47522	-0.9111	10	0.02654	T	1	-14.3041	16.3216	0.82953	0.0:0.4968:0.5032:0.0	.	303	Q9UBV7	B4GT7_HUMAN	D	303;189	ENSP00000029410:G303D	ENSP00000029410:G303D	G	+	2	0	B4GALT7	176969226	0.996000	0.38824	0.979000	0.43373	0.889000	0.51656	2.345000	0.44018	0.228000	0.21019	0.561000	0.74099	GGC	.	.		0.592	B4GALT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253421.1	NM_007255	
HSF2	3298	hgsc.bcm.edu	37	6	122744789	122744789	+	Silent	SNP	A	A	G	rs201391717		TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr6:122744789A>G	ENST00000368455.4	+	10	1326	c.1134A>G	c.(1132-1134)ctA>ctG	p.L378L	HSF2_ENST00000452194.1_Silent_p.L378L	NM_004506.3	NP_004497.1	Q03933	HSF2_HUMAN	heat shock transcription factor 2	378	Hydrophobic repeat HR-C.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to stress (GO:0006950)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II intronic transcription regulatory region sequence-specific DNA binding (GO:0001162)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			large_intestine(4)|lung(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16				OV - Ovarian serous cystadenocarcinoma(136;0.00371)|all cancers(137;0.0299)|GBM - Glioblastoma multiforme(226;0.0586)		AGGCCATGCTATCAGGAAGAC	0.348																																					p.L378L		Atlas-SNP	.											.	HSF2	43	.	0			c.A1134G						.						144.0	130.0	135.0					6																	122744789		2203	4300	6503	SO:0001819	synonymous_variant	3298	exon10			CATGCTATCAGGA	M65217	CCDS5124.1, CCDS47470.1	6q22	2008-08-29			ENSG00000025156	ENSG00000025156			5225	protein-coding gene	gene with protein product		140581				1871106	Standard	NM_004506		Approved		uc003pyu.2	Q03933	OTTHUMG00000016216	ENST00000368455.4:c.1134A>G	chr6.hg19:g.122744789A>G		88.0	0.0		78.0	29.0	NM_004506	B4DGJ4|Q0VAH9|Q2M1K4|Q9H445	Silent	SNP	ENST00000368455.4	hg19	CCDS5124.1																																																																																			.	A|1.000;C|0.000		0.348	HSF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043520.1	NM_004506	
PRKAG2	51422	hgsc.bcm.edu	37	7	151329170	151329170	+	Nonsense_Mutation	SNP	C	C	A	rs397517281		TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr7:151329170C>A	ENST00000287878.4	-	5	1243	c.739G>T	c.(739-741)Gag>Tag	p.E247*	PRKAG2_ENST00000418337.2_Nonsense_Mutation_p.E6*|PRKAG2_ENST00000392801.2_Nonsense_Mutation_p.E203*|PRKAG2_ENST00000433631.2_Nonsense_Mutation_p.E123*|PRKAG2_ENST00000492843.1_Nonsense_Mutation_p.E123*	NM_016203.3	NP_057287.2	Q9UGJ0	AAKG2_HUMAN	protein kinase, AMP-activated, gamma 2 non-catalytic subunit	247					ATP biosynthetic process (GO:0006754)|carnitine shuttle (GO:0006853)|cell cycle arrest (GO:0007050)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|glycogen metabolic process (GO:0005977)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|membrane organization (GO:0061024)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase activity (GO:0045860)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of fatty acid metabolic process (GO:0019217)|regulation of fatty acid oxidation (GO:0046320)|regulation of glucose import (GO:0046324)|regulation of glycolytic process (GO:0006110)|small molecule metabolic process (GO:0044281)|sterol biosynthetic process (GO:0016126)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|ATP binding (GO:0005524)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|phosphorylase kinase regulator activity (GO:0008607)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|upper_aerodigestive_tract(1)	26	all_neural(206;0.187)	all_hematologic(28;0.0605)	OV - Ovarian serous cystadenocarcinoma(82;0.00252)	UCEC - Uterine corpus endometrioid carcinoma (81;0.185)	Acetylsalicylic acid(DB00945)	TCCTCGAACTCCAGCTTCTCC	0.771																																					p.E247X		Atlas-SNP	.											.	PRKAG2	86	.	0			c.G739T						.						7.0	10.0	9.0					7																	151329170		2093	4133	6226	SO:0001587	stop_gained	51422	exon5			CGAACTCCAGCTT	AF087875	CCDS5928.1, CCDS43683.1, CCDS47752.1	7q35-q36	2014-09-17			ENSG00000106617	ENSG00000106617			9386	protein-coding gene	gene with protein product	"""AMPK gamma2"""	602743				8557660, 8621499	Standard	NM_024429		Approved	AAKG, AAKG2, H91620p, WPWS, CMH6	uc003wkk.3	Q9UGJ0	OTTHUMG00000157324	ENST00000287878.4:c.739G>T	chr7.hg19:g.151329170C>A	ENSP00000287878:p.Glu247*	54.0	0.0		47.0	9.0	NM_016203	Q53Y07|Q6NUI0|Q75MP4|Q9NUZ9|Q9UDN8|Q9ULX8	Nonsense_Mutation	SNP	ENST00000287878.4	hg19	CCDS5928.1	.	.	.	.	.	.	.	.	.	.	C	41	8.792104	0.98956	.	.	ENSG00000106617	ENST00000418337;ENST00000287878;ENST00000492843;ENST00000433631;ENST00000392801;ENST00000476632	.	.	.	3.36	3.36	0.38483	.	0.854162	0.10081	U	0.718430	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09843	T	0.71	.	10.2143	0.43160	0.0:1.0:0.0:0.0	.	.	.	.	X	6;247;123;123;203;6	.	ENSP00000287878:E247X	E	-	1	0	PRKAG2	150960103	0.997000	0.39634	0.020000	0.16555	0.136000	0.21042	1.540000	0.36115	1.417000	0.47077	0.467000	0.42956	GAG	.	.		0.771	PRKAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348440.2	NM_016203	
DOCK5	80005	hgsc.bcm.edu	37	8	25240239	25240239	+	Missense_Mutation	SNP	A	A	G			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr8:25240239A>G	ENST00000276440.7	+	40	4120	c.4076A>G	c.(4075-4077)cAg>cGg	p.Q1359R		NM_024940.6	NP_079216.4	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	1359	DHR-2.				positive regulation of GTPase activity (GO:0043547)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(9)|large_intestine(13)|lung(20)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		ATGAGGCCTCAGCCTGAATAC	0.448																																					p.Q1359R	Pancreas(145;34 1887 3271 10937 30165)	Atlas-SNP	.											.	DOCK5	167	.	0			c.A4076G						.						117.0	105.0	109.0					8																	25240239		2203	4300	6503	SO:0001583	missense	80005	exon40			GGCCTCAGCCTGA		CCDS6047.1	8p21.2	2009-04-17			ENSG00000147459	ENSG00000147459			23476	protein-coding gene	gene with protein product						12432077	Standard	NM_024940		Approved	FLJ21034	uc003xeg.3	Q9H7D0	OTTHUMG00000131991	ENST00000276440.7:c.4076A>G	chr8.hg19:g.25240239A>G	ENSP00000276440:p.Gln1359Arg	135.0	0.0		74.0	40.0	NM_024940	B2RNY0|Q5XKD5|Q6AI11|Q6PJS6|Q6ZTS6	Missense_Mutation	SNP	ENST00000276440.7	hg19	CCDS6047.1	.	.	.	.	.	.	.	.	.	.	A	18.23	3.577519	0.65878	.	.	ENSG00000147459	ENST00000276440	T	0.03889	3.77	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.08492	0.0211	L	0.50333	1.59	0.58432	D	0.999996	B;B;B	0.28584	0.216;0.002;0.002	B;B;B	0.32928	0.155;0.005;0.005	T	0.07635	-1.0762	10	0.62326	D	0.03	.	15.9599	0.79923	1.0:0.0:0.0:0.0	.	148;1349;1359	Q6ZP32;D3DSS6;Q9H7D0	.;.;DOCK5_HUMAN	R	1359	ENSP00000276440:Q1359R	ENSP00000276440:Q1359R	Q	+	2	0	DOCK5	25296156	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.339000	0.96797	2.162000	0.67917	0.533000	0.62120	CAG	.	.		0.448	DOCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254955.2	NM_024940	
ZHX1	11244	hgsc.bcm.edu	37	8	124266377	124266377	+	Missense_Mutation	SNP	G	G	C			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr8:124266377G>C	ENST00000522655.1	-	3	2350	c.1810C>G	c.(1810-1812)Caa>Gaa	p.Q604E	ZHX1-C8ORF76_ENST00000357082.4_Intron|ZHX1_ENST00000522595.1_5'Flank|ZHX1_ENST00000395571.3_Missense_Mutation_p.Q604E|ZHX1_ENST00000297857.2_Missense_Mutation_p.Q604E			Q9UKY1	ZHX1_HUMAN	zinc fingers and homeoboxes 1	604					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		STAD - Stomach adenocarcinoma(47;0.00527)			AGTTTGGTTTGTGCCCTTAAC	0.363																																					p.Q604E		Atlas-SNP	.											.	ZHX1	89	.	0			c.C1810G						.						101.0	99.0	100.0					8																	124266377		2203	4300	6503	SO:0001583	missense	11244	exon3			TGGTTTGTGCCCT	AF106862	CCDS6342.1	8q24.13	2012-03-09	2004-01-23		ENSG00000165156	ENSG00000165156		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	12871	protein-coding gene	gene with protein product		604764	"""zinc-fingers and homeoboxes 1"""			10441475	Standard	NM_001017926		Approved		uc003yqe.3	Q9UKY1	OTTHUMG00000165088	ENST00000522655.1:c.1810C>G	chr8.hg19:g.124266377G>C	ENSP00000428821:p.Gln604Glu	91.0	0.0		81.0	31.0	NM_007222	Q8IWD8	Missense_Mutation	SNP	ENST00000522655.1	hg19	CCDS6342.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.637|0.637	-0.815039|-0.815039	0.02776|0.02776	.|.	.|.	ENSG00000165156|ENSG00000165156	ENST00000520474|ENST00000297857;ENST00000395571;ENST00000522655	.|D;D;D	.|0.96073	.|-3.9;-3.9;-3.9	5.3|5.3	5.3|5.3	0.74995|0.74995	.|Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	.|0.178458	.|0.49305	.|D	.|0.000147	D|D	0.88775|0.88775	0.6528|0.6528	.|.	.|.	.|.	0.48975|0.48975	D|D	0.999734|0.999734	.|B	.|0.09022	.|0.002	.|B	.|0.10450	.|0.005	T|T	0.83194|0.83194	-0.0082|-0.0082	4|9	.|0.02654	.|T	.|1	-15.6398|-15.6398	16.0406|16.0406	0.80679|0.80679	0.0:0.1989:0.8011:0.0|0.0:0.1989:0.8011:0.0	.|.	.|604	.|Q9UKY1	.|ZHX1_HUMAN	Q|E	288|604	.|ENSP00000297857:Q604E;ENSP00000378938:Q604E;ENSP00000428821:Q604E	.|ENSP00000297857:Q604E	H|Q	-|-	3|1	2|0	ZHX1|ZHX1	124335558|124335558	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	4.036000|4.036000	0.57304|0.57304	2.763000|2.763000	0.94921|0.94921	0.555000|0.555000	0.69702|0.69702	CAC|CAA	.	.		0.363	ZHX1-003	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000381759.1		
PRUNE2	158471	hgsc.bcm.edu	37	9	79319694	79319694	+	Missense_Mutation	SNP	T	T	G			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr9:79319694T>G	ENST00000376718.3	-	8	7619	c.7496A>C	c.(7495-7497)gAc>gCc	p.D2499A	PRUNE2_ENST00000428286.1_Missense_Mutation_p.D2140A	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	2499					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						TGGTCCTATGTCTCCACCTGC	0.418											OREG0019258	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D2499A		Atlas-SNP	.											.	PRUNE2	331	.	0			c.A7496C						.						72.0	59.0	63.0					9																	79319694		1567	3577	5144	SO:0001583	missense	158471	exon8			CCTATGTCTCCAC	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.7496A>C	chr9.hg19:g.79319694T>G	ENSP00000365908:p.Asp2499Ala	139.0	0.0	1190	75.0	34.0	NM_015225	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	ENST00000376718.3	hg19	CCDS47982.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.77|18.77	3.694587|3.694587	0.68386|0.68386	.|.	.|.	ENSG00000106772|ENSG00000106772	ENST00000376718;ENST00000428286;ENST00000422033|ENST00000426088	T;T|.	0.59502|.	0.26;0.29|.	6.08|6.08	4.95|4.95	0.65309|0.65309	.|.	0.000000|.	0.64402|.	D|.	0.000010|.	T|T	0.65186|0.65186	0.2667|0.2667	M|M	0.64997|0.64997	1.995|1.995	0.80722|0.80722	D|D	1|1	D|.	0.76494|.	0.999|.	D|.	0.65874|.	0.939|.	T|T	0.64330|0.64330	-0.6433|-0.6433	10|5	0.42905|.	T|.	0.14|.	-26.2698|-26.2698	11.6879|11.6879	0.51497|0.51497	0.0:0.0683:0.0:0.9317|0.0:0.0683:0.0:0.9317	.|.	2499|.	Q8WUY3|.	PRUN2_HUMAN|.	A|S	2499;2140;2498|1820	ENSP00000365908:D2499A;ENSP00000397425:D2140A|.	ENSP00000365908:D2499A|.	D|R	-|-	2|3	0|2	PRUNE2|PRUNE2	78509514|78509514	0.982000|0.982000	0.34865|0.34865	0.998000|0.998000	0.56505|0.56505	0.997000|0.997000	0.91878|0.91878	0.657000|0.657000	0.24963|0.24963	2.333000|2.333000	0.79357|0.79357	0.533000|0.533000	0.62120|0.62120	GAC|AGA	.	.		0.418	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818	
SVEP1	79987	hgsc.bcm.edu	37	9	113170387	113170387	+	Missense_Mutation	SNP	C	C	T			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr9:113170387C>T	ENST00000401783.2	-	38	7829	c.7493G>A	c.(7492-7494)tGc>tAc	p.C2498Y	SVEP1_ENST00000297826.5_Missense_Mutation_p.C424Y|SVEP1_ENST00000374469.1_Missense_Mutation_p.C2475Y	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	2498	Sushi 19. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						GGGTTTCAGGCACTCAATGGC	0.473																																					p.C2498Y		Atlas-SNP	.											.	SVEP1	326	.	0			c.G7493A						.						50.0	50.0	50.0					9																	113170387		1922	4125	6047	SO:0001583	missense	79987	exon38			TTCAGGCACTCAA	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.7493G>A	chr9.hg19:g.113170387C>T	ENSP00000384917:p.Cys2498Tyr	78.0	0.0		67.0	36.0	NM_153366	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	hg19	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	C	14.79	2.640702	0.47153	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000297826;ENST00000374463	D;D;D	0.99784	-6.74;-6.74;-6.74	5.85	5.85	0.93711	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	D	0.99904	0.9954	H	0.99130	4.44	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96282	0.9207	10	0.87932	D	0	.	20.1577	0.98120	0.0:1.0:0.0:0.0	.	2498	Q4LDE5	SVEP1_HUMAN	Y	2498;2475;424;170	ENSP00000384917:C2498Y;ENSP00000363593:C2475Y;ENSP00000297826:C424Y	ENSP00000297826:C424Y	C	-	2	0	SVEP1	112210208	1.000000	0.71417	0.994000	0.49952	0.214000	0.24535	7.624000	0.83124	2.767000	0.95098	0.655000	0.94253	TGC	.	.		0.473	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
REXO4	57109	hgsc.bcm.edu	37	9	136272184	136272184	+	Nonsense_Mutation	SNP	G	G	A			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr9:136272184G>A	ENST00000371942.3	-	8	1361	c.1162C>T	c.(1162-1164)Cag>Tag	p.Q388*	REXO4_ENST00000371935.2_Nonsense_Mutation_p.Q216*	NM_020385.2	NP_065118.2	Q9GZR2	REXO4_HUMAN	REX4, RNA exonuclease 4 homolog (S. cerevisiae)	388	Exonuclease.				regulation of transcription, DNA-templated (GO:0006355)	nucleolus (GO:0005730)|nucleus (GO:0005634)	exonuclease activity (GO:0004527)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(4)|lung(7)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	15				OV - Ovarian serous cystadenocarcinoma(145;8.58e-08)|Epithelial(140;9.55e-07)|all cancers(34;1.05e-05)		ATTGCTGCCTGGGCATCCTGA	0.592											OREG0019587	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q388X		Atlas-SNP	.											.	REXO4	27	.	0			c.C1162T						.						153.0	118.0	130.0					9																	136272184		2203	4300	6503	SO:0001587	stop_gained	57109	exon8			CTGCCTGGGCATC	AF273304	CCDS6969.1, CCDS65179.1	9q34	2008-02-05	2005-08-22	2005-08-22	ENSG00000148300	ENSG00000148300			12820	protein-coding gene	gene with protein product		602930	"""Xenopus prevents mitotic catatrophe 2 homolog"", ""XPMC2 prevents mitotic catastrophe 2 homolog (Xenopus laevis)"""	XPMC2H		9325058	Standard	NM_020385		Approved		uc004cdm.3	Q9GZR2	OTTHUMG00000020870	ENST00000371942.3:c.1162C>T	chr9.hg19:g.136272184G>A	ENSP00000361010:p.Gln388*	40.0	0.0	1624	26.0	17.0	NM_020385	B2RAT2|Q5T8S4|Q5T8S5|Q5T8S6|Q9GZW3	Nonsense_Mutation	SNP	ENST00000371942.3	hg19	CCDS6969.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.68|16.68	3.190936|3.190936	0.58017|0.58017	.|.	.|.	ENSG00000148300|ENSG00000148300	ENST00000453165|ENST00000371942;ENST00000371935;ENST00000454825	T|.	0.21932|.	1.98|.	5.27|5.27	5.27|5.27	0.74061|0.74061	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.68577|.	0.3016|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.64495|.	-0.6394|.	6|.	0.66056|0.27785	D|T	0.02|0.31	.|.	16.0348|16.0348	0.80617|0.80617	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	L|X	343|388;216;216	ENSP00000403272:P343L|.	ENSP00000403272:P343L|ENSP00000361003:Q216X	P|Q	-|-	2|1	0|0	REXO4|REXO4	135262005|135262005	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.074000|0.074000	0.17049|0.17049	7.064000|7.064000	0.76721|0.76721	2.451000|2.451000	0.82905|0.82905	0.561000|0.561000	0.74099|0.74099	CCA|CAG	.	.		0.592	REXO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054899.1		
ANK3	288	hgsc.bcm.edu	37	10	61832026	61832026	+	Silent	SNP	C	C	A			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr10:61832026C>A	ENST00000280772.2	-	37	8804	c.8613G>T	c.(8611-8613)tcG>tcT	p.S2871S	ANK3_ENST00000373827.2_Intron|ANK3_ENST00000355288.2_Intron|ANK3_ENST00000503366.1_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	2871					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						CAAGTACATGCGAAAGTTTTT	0.403																																					p.S2871S		Atlas-SNP	.											.	ANK3	703	.	0			c.G8613T						.						82.0	86.0	84.0					10																	61832026		2203	4299	6502	SO:0001819	synonymous_variant	288	exon37			TACATGCGAAAGT	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.8613G>T	chr10.hg19:g.61832026C>A		84.0	0.0		83.0	36.0	NM_020987	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Silent	SNP	ENST00000280772.2	hg19	CCDS7258.1																																																																																			.	.		0.403	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
SLC5A12	159963	hgsc.bcm.edu	37	11	26725171	26725171	+	Missense_Mutation	SNP	A	A	T			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr11:26725171A>T	ENST00000396005.3	-	6	1037	c.728T>A	c.(727-729)gTg>gAg	p.V243E	SLC5A12_ENST00000280467.6_Missense_Mutation_p.V243E	NM_178498.3	NP_848593.2	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/monocarboxylate cotransporter), member 12	243					sodium ion transport (GO:0006814)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)	35						AGTTCCTCCCACTGTGATAGT	0.408																																					p.V243E		Atlas-SNP	.											SLC5A12_ENST00000280467,right_upper_lobe,carcinoma,0,2	SLC5A12	134	.	0			c.T728A						.						129.0	124.0	125.0					11																	26725171		2203	4299	6502	SO:0001583	missense	159963	exon6			CCTCCCACTGTGA	BC049207	CCDS7860.2	11p14.2	2013-07-19	2013-07-19		ENSG00000148942	ENSG00000148942		"""Solute carriers"""	28750	protein-coding gene	gene with protein product		612455	"""solute carrier family 5 (sodium/glucose cotransporter), member 12"""			12477932	Standard	NM_178498		Approved	MGC52019, SMCT2	uc001mra.2	Q1EHB4	OTTHUMG00000150706	ENST00000396005.3:c.728T>A	chr11.hg19:g.26725171A>T	ENSP00000379326:p.Val243Glu	101.0	0.0		90.0	36.0	NM_178498	Q86UC7	Missense_Mutation	SNP	ENST00000396005.3	hg19	CCDS7860.2	.	.	.	.	.	.	.	.	.	.	A	25.8	4.670489	0.88348	.	.	ENSG00000148942	ENST00000396005;ENST00000280467;ENST00000533617	D;D;D	0.88741	-2.42;-2.42;-2.42	5.51	5.51	0.81932	.	0.361911	0.23870	N	0.043760	D	0.94745	0.8304	M	0.87682	2.9	0.23271	N	0.99801	P;D	0.64830	0.676;0.994	P;D	0.65987	0.776;0.94	D	0.89846	0.4006	10	0.87932	D	0	.	15.6015	0.76628	1.0:0.0:0.0:0.0	.	243;243	Q1EHB4-2;Q1EHB4	.;SC5AC_HUMAN	E	243;243;55	ENSP00000379326:V243E;ENSP00000280467:V243E;ENSP00000435053:V55E	ENSP00000280467:V243E	V	-	2	0	SLC5A12	26681747	0.976000	0.34144	0.885000	0.34714	0.965000	0.64279	9.287000	0.95975	2.094000	0.63399	0.477000	0.44152	GTG	.	.		0.408	SLC5A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319681.1	NM_178498	
GRM5	2915	hgsc.bcm.edu	37	11	88242143	88242143	+	Missense_Mutation	SNP	T	T	A			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr11:88242143T>A	ENST00000305447.4	-	9	3405	c.3256A>T	c.(3256-3258)Agc>Tgc	p.S1086C	GRM5-AS1_ENST00000526448.1_RNA|GRM5-AS1_ENST00000531994.1_RNA|GRM5_ENST00000305432.5_Missense_Mutation_p.S1054C|GRM5_ENST00000393297.1_Intron|GRM5_ENST00000455756.2_Missense_Mutation_p.S1054C|GRM5_ENST00000418177.2_Missense_Mutation_p.S1086C	NM_001143831.2	NP_001137303.1	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5	1086					activation of MAPKKK activity (GO:0000185)|cognition (GO:0050890)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|learning (GO:0007612)|locomotory behavior (GO:0007626)|negative regulation of locomotion (GO:0040013)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(1)|breast(5)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(18)|lung(40)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)|Rufinamide(DB06201)	ACGCCGGGGCTGGGGGCCGCG	0.642																																					p.S1086C		Atlas-SNP	.											.	GRM5	414	.	0			c.A3256T						.						12.0	15.0	14.0					11																	88242143		2195	4291	6486	SO:0001583	missense	2915	exon9			CGGGGCTGGGGGC	D28538	CCDS8283.1, CCDS44694.1	11q14.3	2014-06-12			ENSG00000168959	ENSG00000168959		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4597	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 86"""	604102				7908515	Standard	NM_001143831		Approved	MGLUR5, GPRC1E, mGlu5, PPP1R86	uc001pcq.3	P41594	OTTHUMG00000134306	ENST00000305447.4:c.3256A>T	chr11.hg19:g.88242143T>A	ENSP00000306138:p.Ser1086Cys	160.0	0.0		133.0	45.0	NM_001143831	Q6J164	Missense_Mutation	SNP	ENST00000305447.4	hg19	CCDS44694.1	.	.	.	.	.	.	.	.	.	.	T	12.57	1.977921	0.34942	.	.	ENSG00000168959	ENST00000418177;ENST00000455756;ENST00000305432;ENST00000305447	D;D;D;D	0.89123	-2.44;-2.47;-2.47;-2.44	4.72	3.79	0.43588	.	0.455544	0.23125	N	0.051649	T	0.79009	0.4374	N	0.14661	0.345	0.23346	N	0.997869	P;P	0.44946	0.846;0.761	B;B	0.40329	0.326;0.221	T	0.68930	-0.5279	9	.	.	.	.	12.0581	0.53546	0.0:0.9136:0.0:0.0864	.	1054;1086	P41594-2;P41594	.;GRM5_HUMAN	C	1086;1054;1054;1086	ENSP00000402912:S1086C;ENSP00000405690:S1054C;ENSP00000305905:S1054C;ENSP00000306138:S1086C	.	S	-	1	0	GRM5	87881791	0.155000	0.22806	0.171000	0.22900	0.377000	0.30045	0.515000	0.22801	0.928000	0.37168	-0.468000	0.05107	AGC	.	.		0.642	GRM5-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000259226.1	NM_000842	
MFAP5	8076	hgsc.bcm.edu	37	12	8800725	8800725	+	Missense_Mutation	SNP	A	A	T			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr12:8800725A>T	ENST00000359478.2	-	10	671	c.484T>A	c.(484-486)Tgt>Agt	p.C162S	MFAP5_ENST00000433590.2_Missense_Mutation_p.C137S|MFAP5_ENST00000543369.1_Missense_Mutation_p.C140S|MFAP5_ENST00000396549.2_Missense_Mutation_p.C152S|MFAP5_ENST00000540087.1_Missense_Mutation_p.C152S|MFAP5_ENST00000535336.1_Missense_Mutation_p.C98S	NM_003480.2	NP_003471.1	Q13361	MFAP5_HUMAN	microfibrillar associated protein 5	162					extracellular fibril organization (GO:0043206)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|microfibril (GO:0001527)	extracellular matrix structural constituent (GO:0005201)			breast(1)|endometrium(2)|large_intestine(4)|lung(5)|skin(1)	13	Lung SC(5;0.184)					ACATTTTCACAGGGAGGAAGT	0.478																																					p.C162S		Atlas-SNP	.											.	MFAP5	34	.	0			c.T484A						.						89.0	87.0	87.0					12																	8800725		2203	4300	6503	SO:0001583	missense	8076	exon10			TTTCACAGGGAGG	AK124368	CCDS8595.1, CCDS73437.1	12p13.1-p12.3	2004-04-05				ENSG00000197614			29673	protein-coding gene	gene with protein product		601103				9792630, 8557636	Standard	XM_005253485		Approved	MAGP2, MP25	uc001qut.1	Q13361		ENST00000359478.2:c.484T>A	chr12.hg19:g.8800725A>T	ENSP00000352455:p.Cys162Ser	267.0	0.0		286.0	99.0	NM_003480	B0AZL6|D3DUV1|Q7Z490	Missense_Mutation	SNP	ENST00000359478.2	hg19	CCDS8595.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.221392	0.79464	.	.	ENSG00000197614	ENST00000543467;ENST00000359478;ENST00000433590;ENST00000396549;ENST00000543369;ENST00000535336;ENST00000540087	.	.	.	4.79	4.79	0.61399	.	0.068358	0.64402	D	0.000009	T	0.59918	0.2229	L	0.32530	0.975	0.36278	D	0.855596	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.78314	0.991;0.991;0.991	T	0.68895	-0.5288	9	0.87932	D	0	-13.1712	10.894	0.47012	1.0:0.0:0.0:0.0	.	137;162;152	B3KW70;Q13361;Q7Z490	.;MFAP5_HUMAN;.	S	68;162;137;152;140;98;152	.	ENSP00000352455:C162S	C	-	1	0	MFAP5	8691992	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	4.493000	0.60341	2.138000	0.66242	0.460000	0.39030	TGT	.	.		0.478	MFAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400656.2	NM_003480	
UTP20	27340	hgsc.bcm.edu	37	12	101779827	101779827	+	Missense_Mutation	SNP	G	G	C			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr12:101779827G>C	ENST00000261637.4	+	62	8458	c.8284G>C	c.(8284-8286)Gag>Cag	p.E2762Q		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	2762	Nuclear localization signal.				endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						GAGAAAGATAGAGTTCCTGCG	0.373																																					p.E2762Q		Atlas-SNP	.											.	UTP20	222	.	0			c.G8284C						.						127.0	134.0	132.0					12																	101779827		2203	4300	6503	SO:0001583	missense	27340	exon62			AAGATAGAGTTCC	AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.8284G>C	chr12.hg19:g.101779827G>C	ENSP00000261637:p.Glu2762Gln	343.0	0.0		349.0	122.0	NM_014503	Q9H3H4	Missense_Mutation	SNP	ENST00000261637.4	hg19	CCDS9081.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.676759	0.88445	.	.	ENSG00000120800	ENST00000261637	T	0.19806	2.12	5.93	5.05	0.67936	.	0.049132	0.85682	D	0.000000	T	0.36853	0.0982	L	0.51422	1.61	0.52501	D	0.999956	D	0.71674	0.998	D	0.63597	0.916	T	0.05162	-1.0902	10	0.38643	T	0.18	-13.7632	13.4138	0.60958	0.0721:0.0:0.9279:0.0	.	2762	O75691	UTP20_HUMAN	Q	2762	ENSP00000261637:E2762Q	ENSP00000261637:E2762Q	E	+	1	0	UTP20	100303958	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.276000	0.95745	1.527000	0.49086	-0.148000	0.13756	GAG	.	.		0.373	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408242.1	NM_014503	
SYNE2	23224	hgsc.bcm.edu	37	14	64600832	64600832	+	Missense_Mutation	SNP	C	C	A			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr14:64600832C>A	ENST00000344113.4	+	78	14772	c.14560C>A	c.(14560-14562)Ctg>Atg	p.L4854M	ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000555002.1_Missense_Mutation_p.L1488M|SYNE2_ENST00000358025.3_Missense_Mutation_p.L4854M|SYNE2_ENST00000357395.3_Missense_Mutation_p.L1239M|SYNE2_ENST00000394768.2_Missense_Mutation_p.L1239M|SYNE2_ENST00000554584.1_Missense_Mutation_p.L4771M	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	4854					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TGAAAAGGACCTGGAAATTCT	0.373																																					p.L4854M		Atlas-SNP	.											.	SYNE2	577	.	0			c.C14560A						.						138.0	143.0	142.0					14																	64600832		2203	4300	6503	SO:0001583	missense	23224	exon78			AAGGACCTGGAAA	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.14560C>A	chr14.hg19:g.64600832C>A	ENSP00000341781:p.Leu4854Met	143.0	0.0		130.0	54.0	NM_182914	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	hg19	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	C	12.26	1.883853	0.33255	.	.	ENSG00000054654	ENST00000358025;ENST00000357395;ENST00000344113;ENST00000554584;ENST00000261678;ENST00000555002;ENST00000394768	T;T;T;T;T;T	0.70164	-0.43;2.77;-0.46;-0.38;2.78;2.77	5.95	5.05	0.67936	.	0.000000	0.40818	N	0.001003	T	0.78698	0.4324	M	0.76328	2.33	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	T	0.79621	-0.1727	10	0.72032	D	0.01	.	8.6131	0.33815	0.0:0.7946:0.0:0.2054	.	1239;4854;4854	Q8WXH0-7;Q8WXH0;Q8WXH0-2	.;SYNE2_HUMAN;.	M	4854;1239;4854;4771;4771;1488;1239	ENSP00000350719:L4854M;ENSP00000349969:L1239M;ENSP00000341781:L4854M;ENSP00000452570:L4771M;ENSP00000450831:L1488M;ENSP00000378249:L1239M	ENSP00000261678:L4771M	L	+	1	2	SYNE2	63670585	0.940000	0.31905	1.000000	0.80357	0.975000	0.68041	1.399000	0.34566	2.821000	0.97095	0.561000	0.74099	CTG	.	.		0.373	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
NRXN3	9369	hgsc.bcm.edu	37	14	80271457	80271457	+	Silent	SNP	A	A	G			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr14:80271457A>G	ENST00000557594.1	+	5	1865	c.912A>G	c.(910-912)ccA>ccG	p.P304P	NRXN3_ENST00000556003.1_Intron|NRXN3_ENST00000281127.7_Silent_p.P304P|NRXN3_ENST00000335750.5_Silent_p.P936P|NRXN3_ENST00000554719.1_Silent_p.P936P|NRXN3_ENST00000428277.2_Silent_p.P334P	NM_001272020.1	NP_001258949.1	Q9HDB5	NRX3B_HUMAN	neurexin 3	304					adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		ATAAACAGCCAACATCAGATG	0.383																																					p.P936P		Atlas-SNP	.											.	NRXN3	342	.	0			c.A2808G						.						208.0	187.0	194.0					14																	80271457		2203	4300	6503	SO:0001819	synonymous_variant	9369	exon16			ACAGCCAACATCA	AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000557594.1:c.912A>G	chr14.hg19:g.80271457A>G		74.0	0.0		56.0	25.0	NM_004796	A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Silent	SNP	ENST00000557594.1	hg19																																																																																				.	.		0.383	NRXN3-004	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000413790.1	NM_001105250	
PRPF8	10594	hgsc.bcm.edu	37	17	1577803	1577803	+	Missense_Mutation	SNP	C	C	T			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr17:1577803C>T	ENST00000572621.1	-	20	3497	c.3232G>A	c.(3232-3234)Gcc>Acc	p.A1078T	PRPF8_ENST00000304992.6_Missense_Mutation_p.A1078T			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	1078	Reverse transcriptase homology domain.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		GCCTCAGTGGCTATGTCCTGG	0.527																																					p.A1078T		Atlas-SNP	.											.	PRPF8	169	.	0			c.G3232A						.						155.0	149.0	151.0					17																	1577803		2203	4300	6503	SO:0001583	missense	10594	exon21			CAGTGGCTATGTC	AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.3232G>A	chr17.hg19:g.1577803C>T	ENSP00000460348:p.Ala1078Thr	183.0	0.0		177.0	62.0	NM_006445	O14547|O75965	Missense_Mutation	SNP	ENST00000572621.1	hg19	CCDS11010.1	.	.	.	.	.	.	.	.	.	.	C	13.40	2.227054	0.39399	.	.	ENSG00000174231	ENST00000304992	T	0.80033	-1.33	5.25	5.25	0.73442	.	0.104865	0.64402	D	0.000004	T	0.75213	0.3819	L	0.41961	1.31	0.53688	D	0.999974	B	0.06786	0.001	B	0.08055	0.003	T	0.68484	-0.5396	10	0.19147	T	0.46	.	19.0491	0.93036	0.0:1.0:0.0:0.0	.	1078	Q6P2Q9	PRP8_HUMAN	T	1078	ENSP00000304350:A1078T	ENSP00000304350:A1078T	A	-	1	0	PRPF8	1524553	0.998000	0.40836	1.000000	0.80357	0.856000	0.48823	3.858000	0.55979	2.740000	0.93945	0.313000	0.20887	GCC	.	.		0.527	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438412.2		
SLFN11	91607	hgsc.bcm.edu	37	17	33680389	33680389	+	Missense_Mutation	SNP	C	C	T			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr17:33680389C>T	ENST00000394566.1	-	6	2160	c.1888G>A	c.(1888-1890)Gtt>Att	p.V630I	SLFN11_ENST00000308377.4_Missense_Mutation_p.V630I	NM_001104587.1|NM_001104588.1|NM_001104589.1|NM_001104590.1	NP_001098057.1|NP_001098058.1|NP_001098059.1|NP_001098060.1	Q7Z7L1	SLN11_HUMAN	schlafen family member 11	630					defense response to virus (GO:0051607)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|tRNA binding (GO:0000049)			autonomic_ganglia(1)|breast(1)|kidney(3)|large_intestine(14)|lung(17)|ovary(1)|prostate(4)|skin(2)|stomach(5)|upper_aerodigestive_tract(2)	50		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		TTTTCACAAACGTAGAGAATT	0.423																																					p.V630I		Atlas-SNP	.											.	SLFN11	112	.	0			c.G1888A						.						58.0	57.0	57.0					17																	33680389		2202	4297	6499	SO:0001583	missense	91607	exon4			CACAAACGTAGAG	AK074184	CCDS11294.1	17q12	2006-04-05			ENSG00000172716	ENSG00000172716			26633	protein-coding gene	gene with protein product		614953				12477932	Standard	NM_001104587		Approved	FLJ34922	uc010ctr.3	Q7Z7L1	OTTHUMG00000132948	ENST00000394566.1:c.1888G>A	chr17.hg19:g.33680389C>T	ENSP00000378067:p.Val630Ile	563.0	0.0		586.0	123.0	NM_152270	E1P643|Q8N3S8|Q8N762|Q8TEE0	Missense_Mutation	SNP	ENST00000394566.1	hg19	CCDS11294.1	.	.	.	.	.	.	.	.	.	.	c	0.018	-1.481177	0.01027	.	.	ENSG00000172716	ENST00000308377;ENST00000394566	D;D	0.83250	-1.7;-1.7	3.69	-7.39	0.01402	Domain of unknown function DUF2075 (1);	1.014740	0.07917	N	0.975160	T	0.56746	0.2006	N	0.03071	-0.42	0.09310	N	1	B	0.15141	0.012	B	0.17098	0.017	T	0.57791	-0.7750	10	0.02654	T	1	.	14.3428	0.66639	0.0:0.184:0.0:0.816	.	630	Q7Z7L1	SLN11_HUMAN	I	630	ENSP00000312402:V630I;ENSP00000378067:V630I	ENSP00000312402:V630I	V	-	1	0	SLFN11	30704502	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-1.746000	0.01829	-1.872000	0.01136	-0.792000	0.03331	GTT	.	.		0.423	SLFN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256480.1	NM_152270	
SLFN14	342618	hgsc.bcm.edu	37	17	33875988	33875988	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr17:33875988T>C	ENST00000415846.3	-	4	2044	c.2009A>G	c.(2008-2010)aAa>aGa	p.K670R		NM_001129820.1	NP_001123292.1	P0C7P3	SLN14_HUMAN	schlafen family member 14	670							ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(3)	9						ATTGCCATATTTGCTGCAGAA	0.438																																					p.K670R		Atlas-SNP	.											.	SLFN14	43	.	0			c.A2009G						.						222.0	187.0	197.0					17																	33875988		692	1591	2283	SO:0001583	missense	342618	exon4			CCATATTTGCTGC		CCDS45650.1	17q12	2009-09-22				ENSG00000236320			32689	protein-coding gene	gene with protein product		614958				9846487	Standard	NM_001129820		Approved		uc010ctu.1	P0C7P3		ENST00000415846.3:c.2009A>G	chr17.hg19:g.33875988T>C	ENSP00000391101:p.Lys670Arg	105.0	0.0		104.0	41.0	NM_001129820	B2RTW9	Missense_Mutation	SNP	ENST00000415846.3	hg19	CCDS45650.1	.	.	.	.	.	.	.	.	.	.	T	7.889	0.731998	0.15507	.	.	ENSG00000236320	ENST00000415846	T	0.55413	0.52	5.37	1.93	0.25924	.	.	.	.	.	T	0.31544	0.0800	N	0.16478	0.41	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.20706	-1.0267	9	0.49607	T	0.09	.	3.2515	0.06816	0.1713:0.1873:0.0:0.6414	.	670	P0C7P3	SLN14_HUMAN	R	670	ENSP00000391101:K670R	ENSP00000391101:K670R	K	-	2	0	SLFN14	30900101	0.000000	0.05858	0.064000	0.19789	0.419000	0.31324	0.688000	0.25422	0.135000	0.18707	0.528000	0.53228	AAA	.	.		0.438	SLFN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448928.1	NM_001129820	
SMCHD1	23347	hgsc.bcm.edu	37	18	2728559	2728559	+	Missense_Mutation	SNP	A	A	C	rs9961682	byFrequency	TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr18:2728559A>C	ENST00000320876.6	+	23	3216	c.2878A>C	c.(2878-2880)Ata>Cta	p.I960L	SMCHD1_ENST00000261598.8_Missense_Mutation_p.I960L|SMCHD1_ENST00000609587.1_3'UTR|RP11-703M24.5_ENST00000583546.1_RNA	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	960			I -> V (in dbSNP:rs9961682).		chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)			NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						ATCAGACAACATAACAGCACA	0.358																																					p.I960L		Atlas-SNP	.											.	SMCHD1	88	.	0			c.A2878C						.						104.0	100.0	101.0					18																	2728559		1862	4100	5962	SO:0001583	missense	23347	exon23			GACAACATAACAG	AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.2878A>C	chr18.hg19:g.2728559A>C	ENSP00000326603:p.Ile960Leu	157.0	0.0		139.0	51.0	NM_015295	O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Missense_Mutation	SNP	ENST00000320876.6	hg19	CCDS45822.1	.	.	.	.	.	.	.	.	.	.	A	11.32	1.603959	0.28534	.	.	ENSG00000101596	ENST00000320876;ENST00000261598	T;T	0.24538	1.85;1.85	5.84	-3.46	0.04767	.	0.509376	0.22250	N	0.062565	T	0.14743	0.0356	L	0.36672	1.1	0.27499	N	0.952033	B	0.02656	0.0	B	0.04013	0.001	T	0.29119	-1.0022	10	0.17832	T	0.49	-4.6572	9.6361	0.39809	0.3166:0.2087:0.4747:0.0	.	960	A6NHR9	SMHD1_HUMAN	L	960	ENSP00000326603:I960L;ENSP00000261598:I960L	ENSP00000261598:I960L	I	+	1	0	SMCHD1	2718559	0.830000	0.29337	0.936000	0.37596	0.999000	0.98932	-0.076000	0.11412	-0.889000	0.03950	0.528000	0.53228	ATA	.	A|0.969;G|0.031		0.358	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441082.2		
ZSCAN30	100101467	hgsc.bcm.edu	37	18	32833559	32833559	+	Missense_Mutation	SNP	C	C	G			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr18:32833559C>G	ENST00000420878.3	-	5	1795	c.1340G>C	c.(1339-1341)gGa>gCa	p.G447A	ZNF397_ENST00000592264.1_Intron|ZSCAN30_ENST00000333206.5_Missense_Mutation_p.G447A|ZNF397_ENST00000589420.1_Intron|ZNF397_ENST00000355632.4_Intron|ZNF397_ENST00000261333.6_Intron	NM_001166012.1	NP_001159484.1	Q86W11	ZSC30_HUMAN	zinc finger and SCAN domain containing 30	447					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(5)|lung(3)|urinary_tract(1)	9						GAAGGATTTTCCACATTCATT	0.393																																					p.G447A		Atlas-SNP	.											.	ZSCAN30	34	.	0			c.G1340C						.						108.0	100.0	102.0					18																	32833559		1568	3582	5150	SO:0001583	missense	100101467	exon5			GATTTTCCACATT	AY234408	CCDS42427.1, CCDS74207.1	18q12.2	2013-01-08	2010-07-23	2010-07-23	ENSG00000186814	ENSG00000186814		"""-"", ""Zinc fingers, C2H2-type"""	33517	protein-coding gene	gene with protein product			"""zinc finger protein 397 opposite strand"", ""ZNF397 opposite strand"""	ZNF397OS		12801647	Standard	NM_001166012		Approved	ZNF917	uc002kym.3	Q86W11		ENST00000420878.3:c.1340G>C	chr18.hg19:g.32833559C>G	ENSP00000392371:p.Gly447Ala	139.0	0.0		131.0	61.0	NM_001166012	B4E0N0|Q6ZNB3|Q96PN3	Missense_Mutation	SNP	ENST00000420878.3	hg19	CCDS42427.1	.	.	.	.	.	.	.	.	.	.	C	17.45	3.391790	0.62066	.	.	ENSG00000186814	ENST00000420878;ENST00000333206;ENST00000360932	T;T	0.01464	4.86;4.86	4.19	3.32	0.38043	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.35436	N	0.003216	T	0.05868	0.0153	M	0.82056	2.57	0.80722	D	1	D	0.57571	0.98	P	0.51487	0.671	T	0.09862	-1.0655	10	0.87932	D	0	.	10.0114	0.41988	0.0:0.8991:0.0:0.1008	.	447	Q86W11	ZSC30_HUMAN	A	447;447;382	ENSP00000392371:G447A;ENSP00000329738:G447A	ENSP00000329738:G447A	G	-	2	0	ZSCAN30	31087557	0.989000	0.36119	1.000000	0.80357	0.980000	0.70556	2.799000	0.47892	1.107000	0.41642	0.655000	0.94253	GGA	.	.		0.393	ZSCAN30-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442510.1	NM_001112734	
ZNF681	148213	hgsc.bcm.edu	37	19	23938228	23938228	+	Splice_Site	SNP	C	C	A			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr19:23938228C>A	ENST00000402377.3	-	2	270	c.129G>T	c.(127-129)ttG>ttT	p.L43F	ZNF681_ENST00000395385.3_Intron	NM_138286.2	NP_612143.2	Q96N22	ZN681_HUMAN	zinc finger protein 681	43	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(3)	21		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				TATCCTCACCCAAGAAGACCA	0.343																																					p.L43F		Atlas-SNP	.											.	ZNF681	76	.	0			c.G129T						.						101.0	111.0	108.0					19																	23938228		2203	4300	6503	SO:0001630	splice_region_variant	148213	exon2			CTCACCCAAGAAG	AK056088	CCDS12414.2	19p12	2013-01-08			ENSG00000196172	ENSG00000196172		"""Zinc fingers, C2H2-type"", ""-"""	26457	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31526"""						Standard	NM_138286		Approved	FLJ31526	uc002nrk.4	Q96N22	OTTHUMG00000150831	ENST00000402377.3:c.130+1G>T	chr19.hg19:g.23938228C>A		568.0	0.0		539.0	172.0	NM_138286	B3KVF7	Missense_Mutation	SNP	ENST00000402377.3	hg19	CCDS12414.2	.	.	.	.	.	.	.	.	.	.	.	9.460	1.092941	0.20471	.	.	ENSG00000196172	ENST00000402377	T	0.02787	4.16	1.05	1.05	0.20165	Krueppel-associated box (4);	.	.	.	.	T	0.16171	0.0389	M	0.93375	3.41	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.00496	-1.1705	9	0.87932	D	0	.	5.3007	0.15776	0.0:1.0:0.0:0.0	.	43	Q96N22	ZN681_HUMAN	F	43	ENSP00000384000:L43F	ENSP00000384000:L43F	L	-	3	2	ZNF681	23730068	0.685000	0.27652	0.327000	0.25402	0.331000	0.28603	0.108000	0.15396	0.452000	0.26830	0.460000	0.39030	TTG	.	.		0.343	ZNF681-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320248.2	NM_138286	Missense_Mutation
HSPA12B	116835	hgsc.bcm.edu	37	20	3723019	3723019	+	Missense_Mutation	SNP	G	G	C			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr20:3723019G>C	ENST00000254963.2	+	4	375	c.230G>C	c.(229-231)aGc>aCc	p.S77T	HSPA12B_ENST00000542646.1_Intron	NM_001197327.1|NM_052970.4	NP_001184256.1|NP_443202.3	Q96MM6	HS12B_HUMAN	heat shock 70kD protein 12B	77							ATP binding (GO:0005524)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)	14						TATGCTTTCAGCTTTGCCAGT	0.597																																					p.S77T		Atlas-SNP	.											.	HSPA12B	43	.	0			c.G230C						.						62.0	57.0	59.0					20																	3723019		2203	4300	6503	SO:0001583	missense	116835	exon4			CTTTCAGCTTTGC	AK056712	CCDS13061.1	20p13	2011-09-02	2003-04-10	2003-04-10	ENSG00000132622	ENSG00000132622		"""Heat shock proteins / HSP70"""	16193	protein-coding gene	gene with protein product		610702	"""chromosome 20 open reading frame 60"""	C20orf60		12552099	Standard	NM_052970		Approved	dJ1009E24.2	uc002wjd.3	Q96MM6	OTTHUMG00000031755	ENST00000254963.2:c.230G>C	chr20.hg19:g.3723019G>C	ENSP00000254963:p.Ser77Thr	64.0	0.0		60.0	20.0	NM_052970	D3DVX7|Q2TAK3|Q9BR52	Missense_Mutation	SNP	ENST00000254963.2	hg19	CCDS13061.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.815939	0.90790	.	.	ENSG00000132622	ENST00000254963	T	0.03801	3.8	4.73	4.73	0.59995	.	0.000000	0.85682	D	0.000000	T	0.16385	0.0394	M	0.69463	2.115	0.80722	D	1	P;D	0.60575	0.933;0.988	P;P	0.61800	0.728;0.894	T	0.00512	-1.1696	10	0.34782	T	0.22	.	15.5958	0.76578	0.0:0.0:1.0:0.0	.	77;77	B7ZLP2;Q96MM6	.;HS12B_HUMAN	T	77	ENSP00000254963:S77T	ENSP00000254963:S77T	S	+	2	0	HSPA12B	3671019	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.493000	0.97960	2.626000	0.88956	0.655000	0.94253	AGC	.	.		0.597	HSPA12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077756.2	NM_052970	
PREX1	57580	hgsc.bcm.edu	37	20	47262565	47262565	+	Silent	SNP	C	C	T			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr20:47262565C>T	ENST00000371941.3	-	26	3358	c.3336G>A	c.(3334-3336)tcG>tcA	p.S1112S	PREX1_ENST00000396220.1_Silent_p.S1112S	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	1112					actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			AGGACCCACCCGAGGTGGGCT	0.587																																					p.S1112S		Atlas-SNP	.											.	PREX1	441	.	0			c.G3336A						.						68.0	62.0	64.0					20																	47262565		2203	4300	6503	SO:0001819	synonymous_variant	57580	exon26			CCCACCCGAGGTG	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.3336G>A	chr20.hg19:g.47262565C>T		43.0	0.0		35.0	18.0	NM_020820	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Silent	SNP	ENST00000371941.3	hg19	CCDS13410.1																																																																																			.	.		0.587	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	NM_020820	
CLDN5	7122	hgsc.bcm.edu	37	22	19511459	19511459	+	Missense_Mutation	SNP	C	C	T			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr22:19511459C>T	ENST00000406028.1	-	2	1635	c.575G>A	c.(574-576)tGc>tAc	p.C192Y	CLDN5_ENST00000413119.2_Missense_Mutation_p.C192Y|CLDN5_ENST00000403084.1_Missense_Mutation_p.C192Y			O00501	CLD5_HUMAN	claudin 5	107					calcium-independent cell-cell adhesion (GO:0016338)|myelination (GO:0042552)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			liver(1)|lung(2)|prostate(1)	4	Colorectal(54;0.0993)					CGGGGCCACGCAGGTGGTGCA	0.731																																					p.C192Y		Atlas-SNP	.											.	CLDN5	22	.	0			c.G575A						.						7.0	8.0	8.0					22																	19511459		2161	4229	6390	SO:0001583	missense	7122	exon1			GCCACGCAGGTGG	AF000959	CCDS13763.2	22q11.21	2008-08-01	2008-08-01		ENSG00000184113	ENSG00000184113		"""Claudins"""	2047	protein-coding gene	gene with protein product		602101	"""transmembrane protein deleted in velocardiofacial syndrome"""	AWAL, TMVCF		9441748, 9192844	Standard	NM_003277		Approved	CPETRL1, BEC1	uc002zpu.2	O00501	OTTHUMG00000150441	ENST00000406028.1:c.575G>A	chr22.hg19:g.19511459C>T	ENSP00000385477:p.Cys192Tyr	72.0	0.0		81.0	24.0	NM_001130861	B3KS11|Q53XW2|Q8WUW3	Missense_Mutation	SNP	ENST00000406028.1	hg19	CCDS13763.2	.	.	.	.	.	.	.	.	.	.	C	20.7	4.033652	0.75504	.	.	ENSG00000184113	ENST00000406028;ENST00000403084;ENST00000413119	D;D;D	0.89050	-2.46;-2.46;-2.46	4.96	3.91	0.45181	.	0.000000	0.85682	D	0.000000	D	0.94686	0.8286	M	0.92219	3.285	0.80722	D	1	D	0.59767	0.986	D	0.67548	0.952	D	0.94506	0.7714	10	0.87932	D	0	.	9.6628	0.39965	0.0:0.7764:0.1431:0.0805	.	192	D3DX19	.	Y	192	ENSP00000385477:C192Y;ENSP00000384554:C192Y;ENSP00000400612:C192Y	ENSP00000384554:C192Y	C	-	2	0	CLDN5	17891459	1.000000	0.71417	1.000000	0.80357	0.814000	0.46013	4.899000	0.63245	1.049000	0.40321	0.462000	0.41574	TGC	.	.		0.731	CLDN5-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318122.3	NM_003277	
TAB3	257397	hgsc.bcm.edu	37	X	30873586	30873586	+	Missense_Mutation	SNP	T	T	A			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chrX:30873586T>A	ENST00000378933.1	-	3	373	c.196A>T	c.(196-198)Atg>Ttg	p.M66L	TAB3_ENST00000288422.2_Missense_Mutation_p.M66L|TAB3_ENST00000378932.2_Missense_Mutation_p.M66L|TAB3-AS2_ENST00000445240.1_RNA|TAB3_ENST00000378930.3_Missense_Mutation_p.M66L|TAB3_ENST00000378928.1_5'Flank	NM_152787.3	NP_690000.2	Q8N5C8	TAB3_HUMAN	TGF-beta activated kinase 1/MAP3K7 binding protein 3	66					activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|skin(1)	27						TTTCTATTCATCCTATTGTCA	0.433																																					p.M66L	Pancreas(164;1598 1985 29022 43301 49529)	Atlas-SNP	.											.	TAB3	82	.	0			c.A196T						.						61.0	54.0	56.0					X																	30873586		2202	4300	6502	SO:0001583	missense	257397	exon6			TATTCATCCTATT	AY331591	CCDS14226.1	Xp21.2	2010-02-05	2010-02-05	2010-02-05	ENSG00000157625	ENSG00000157625			30681	protein-coding gene	gene with protein product	"""TAK1 binding protein 3"""	300480	"""mitogen-activated protein kinase kinase kinase 7 interacting protein 3"""	MAP3K7IP3		14633987, 14670075	Standard	XM_005274482		Approved		uc004dcj.3	Q8N5C8	OTTHUMG00000021329	ENST00000378933.1:c.196A>T	chrX.hg19:g.30873586T>A	ENSP00000368215:p.Met66Leu	171.0	0.0		161.0	52.0	NM_152787	A6NDD9|Q6VQR0	Missense_Mutation	SNP	ENST00000378933.1	hg19	CCDS14226.1	.	.	.	.	.	.	.	.	.	.	T	2.713	-0.268450	0.05716	.	.	ENSG00000157625	ENST00000378933;ENST00000378930;ENST00000288422;ENST00000378932	T;T;T;T	0.70399	-0.48;-0.48;-0.48;-0.48	5.44	4.27	0.50696	.	0.192203	0.56097	D	0.000029	T	0.47116	0.1428	N	0.11427	0.14	0.30810	N	0.738987	B;B	0.09022	0.002;0.001	B;B	0.04013	0.001;0.0	T	0.42378	-0.9455	10	0.14656	T	0.56	-2.84	10.0701	0.42328	0.0:0.08:0.0:0.92	.	66;66	Q8N5C8-2;Q8N5C8	.;TAB3_HUMAN	L	66	ENSP00000368215:M66L;ENSP00000368212:M66L;ENSP00000288422:M66L;ENSP00000368214:M66L	ENSP00000288422:M66L	M	-	1	0	TAB3	30783507	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.600000	0.46240	1.923000	0.55706	0.486000	0.48141	ATG	.	.		0.433	TAB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056173.1	NM_152787	
STAG2	10735	hgsc.bcm.edu	37	X	123197040	123197040	+	Silent	SNP	T	T	C			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chrX:123197040T>C	ENST00000371160.1	+	19	2096	c.1806T>C	c.(1804-1806)acT>acC	p.T602T	STAG2_ENST00000354548.5_Silent_p.T533T|STAG2_ENST00000371157.3_Silent_p.T602T|STAG2_ENST00000371144.3_Silent_p.T602T|STAG2_ENST00000218089.9_Silent_p.T602T|STAG2_ENST00000371145.3_Silent_p.T602T|STAG2_ENST00000469481.1_Intron	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	602					meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						TATATACCACTGGACGATTAG	0.289																																					p.T602T		Atlas-SNP	.											.	STAG2	309	.	0			c.T1806C						.						58.0	56.0	57.0					X																	123197040		2203	4300	6503	SO:0001819	synonymous_variant	10735	exon19			TACCACTGGACGA	Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.1806T>C	chrX.hg19:g.123197040T>C		370.0	0.0		403.0	127.0	NM_001042749	B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Silent	SNP	ENST00000371160.1	hg19	CCDS14607.1																																																																																			.	.		0.289	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000156159.2	NM_006603	
IFIT3	3437	hgsc.bcm.edu	37	10	91099865	91099865	+	Frame_Shift_Del	DEL	A	A	-			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr10:91099865delA	ENST00000371818.4	+	2	1633	c.1453delA	c.(1453-1455)aacfs	p.N485fs	LIPA_ENST00000371837.1_Intron|IFIT3_ENST00000371811.4_Frame_Shift_Del_p.N485fs|LIPA_ENST00000487618.1_Intron	NM_001549.4	NP_001540.2	O14879	IFIT3_HUMAN	interferon-induced protein with tetratricopeptide repeats 3	485					cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)	identical protein binding (GO:0042802)			breast(1)|central_nervous_system(3)|endometrium(1)|large_intestine(4)|lung(3)|skin(2)|urinary_tract(1)	15						GCTCCTCTCTAACTCAGAGCA	0.547																																					p.S484fs		Atlas-INDEL	.											.	IFIT3	36	.	0			c.1452delT						.						45.0	50.0	48.0					10																	91099865		2203	4300	6503	SO:0001589	frameshift_variant	3437	exon2			.	U52513	CCDS7402.1, CCDS31241.1	10q23.31	2014-05-22	2004-07-16	2004-07-16	ENSG00000119917	ENSG00000119917		"""Tetratricopeptide (TTC) repeat domain containing"""	5411	protein-coding gene	gene with protein product		604650	"""interferon-induced protein with tetratricopeptide repeats 4"""	IFIT4		9828129, 9391139	Standard	NM_001031683		Approved	ISG60, RIG-G, CIG-49, IFI60, GARG-49, IRG2	uc001kgg.3	O14879	OTTHUMG00000018708	ENST00000371818.4:c.1453delA	chr10.hg19:g.91099865delA	ENSP00000360883:p.Asn485fs	81.0	0.0		91.0	33.0	NM_001549	Q99634|Q9BSK7	Frame_Shift_Del	DEL	ENST00000371818.4	hg19	CCDS7402.1																																																																																			.	.		0.547	IFIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049294.1	NM_001549	
ANKRD26	22852	hgsc.bcm.edu	37	10	27313387	27313390	+	Frame_Shift_Del	DEL	TCTT	TCTT	-			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	TCTT	TCTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr10:27313387_27313390delTCTT	ENST00000376087.4	-	28	4236_4239	c.4071_4074delAAGA	c.(4069-4074)gaaagafs	p.ER1357fs	ANKRD26_ENST00000436985.2_Frame_Shift_Del_p.ER1373fs|ANKRD26_ENST00000376070.3_Frame_Shift_Del_p.ER914fs	NM_001256053.1|NM_014915.2	NP_001242982.1|NP_055730.2	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	1356					glucose homeostasis (GO:0042593)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of organ growth (GO:0046621)|regulation of fatty acid metabolic process (GO:0019217)|regulation of feeding behavior (GO:0060259)	actin filament (GO:0005884)|centrosome (GO:0005813)				breast(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|urinary_tract(2)	70						CAGTTATCTCTCTTTCTAATTCAA	0.24																																					p.1358_1359del		Atlas-INDEL	.											.	ANKRD26	179	.	0			c.4072_4075del						.																																			SO:0001589	frameshift_variant	22852	exon28			.	AB028997	CCDS41499.1	10p12.1	2014-09-17			ENSG00000107890	ENSG00000107890		"""Ankyrin repeat domain containing"""	29186	protein-coding gene	gene with protein product		610855	"""thrombocytopenia 2 (autosomal dominant)"""	THC2		10470851, 21211618	Standard	NM_014915		Approved	KIAA1074	uc009xku.1	Q9UPS8	OTTHUMG00000017851	ENST00000376087.4:c.4071_4074delAAGA	chr10.hg19:g.27313387_27313390delTCTT	ENSP00000365255:p.Glu1357fs	295.0	0.0		269.0	103.0	NM_014915	A6NH29|Q2TAZ3|Q6ZR14|Q9H1Q1|Q9NSK9|Q9NTD5|Q9NW69	Frame_Shift_Del	DEL	ENST00000376087.4	hg19	CCDS41499.1																																																																																			.	.		0.240	ANKRD26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047296.1		
CCAR1	55749	hgsc.bcm.edu	37	10	70482318	70482319	+	Frame_Shift_Ins	INS	-	-	A			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr10:70482318_70482319insA	ENST00000265872.6	+	2	176_177	c.57_58insA	c.(58-60)gcafs	p.A20fs	CCAR1_ENST00000535016.1_Frame_Shift_Ins_p.A20fs|CCAR1_ENST00000543719.1_Frame_Shift_Ins_p.A20fs	NM_001282959.1|NM_001282960.1|NM_018237.2	NP_001269888.1|NP_001269889.1|NP_060707.2	Q8IX12	CCAR1_HUMAN	cell division cycle and apoptosis regulator 1	20					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(7)|skin(3)	56						TTACAGCCACTGCAGTATCACA	0.46																																					p.T19fs		Atlas-INDEL	.											.	CCAR1	118	.	0			c.57_58insA						.																																			SO:0001589	frameshift_variant	55749	exon2			.	AY249140	CCDS7282.1, CCDS60547.1	10q22.1	2004-02-19			ENSG00000060339	ENSG00000060339			24236	protein-coding gene	gene with protein product		612569				12816952	Standard	NM_018237		Approved	FLJ10590, CARP-1, CARP1	uc001joo.3	Q8IX12	OTTHUMG00000018361	Exception_encountered	chr10.hg19:g.70482318_70482319insA	ENSP00000265872:p.Ala20fs	69.0	0.0		98.0	34.0	NM_018237	A0JLT7|A1L4P7|A8K9D4|B4DNP8|B4DRK8|Q32NE3|Q5EBM3|Q5VUP6|Q6PIZ0|Q6X935|Q9H8N4|Q9NVA7|Q9NVQ0|Q9NWM6	Frame_Shift_Ins	INS	ENST00000265872.6	hg19	CCDS7282.1																																																																																			.	.		0.460	CCAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048356.2	NM_018237	
NOS3	4846	hgsc.bcm.edu	37	7	150710398	150710405	+	Frame_Shift_Del	DEL	GAACGCCC	GAACGCCC	-	rs141415941		TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	GAACGCCC	GAACGCCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr7:150710398_150710405delGAACGCCC	ENST00000297494.3	+	25	3543_3550	c.3186_3193delGAACGCCC	c.(3184-3195)cagaacgcccagfs	p.QNAQ1062fs	NOS3_ENST00000477227.1_3'UTR|ATG9B_ENST00000444312.1_3'UTR|ATG9B_ENST00000605938.1_3'UTR|ATG9B_ENST00000377974.2_3'UTR|NOS3_ENST00000461406.1_Frame_Shift_Del_p.QNAQ856fs|ATG9B_ENST00000494791.1_5'UTR	NM_000603.4	NP_000594.2	P60323	NANO3_HUMAN	nitric oxide synthase 3 (endothelial cell)	0					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|oogenesis (GO:0048477)|regulation of cell cycle (GO:0051726)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(11)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	50	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		ACGAGGTGCAGAACGCCCAGCAGCGCGG	0.62											OREG0018443	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.1062_1064del		Atlas-INDEL	.											.	NOS3	131	.	0			c.3185_3192del						.																																			SO:0001589	frameshift_variant	4846	exon25			.		CCDS5912.1, CCDS55182.1, CCDS55183.1	7q36	2007-02-15			ENSG00000164867	ENSG00000164867	1.14.13.39		7876	protein-coding gene	gene with protein product	"""endothelial nitric oxide synthase"""	163729				1379542	Standard	NM_000603		Approved	ECNOS, eNOS	uc003wif.3	P29474	OTTHUMG00000158343	ENST00000297494.3:c.3186_3193delGAACGCCC	chr7.hg19:g.150710398_150710405delGAACGCCC	ENSP00000297494:p.Gln1062fs	70.0	0.0	1734	52.0	15.0	NM_000603	Q495E5	Frame_Shift_Del	DEL	ENST00000297494.3	hg19	CCDS5912.1																																																																																			.	.		0.620	NOS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350750.2	NM_000603	
ATP2A2	488	hgsc.bcm.edu	37	12	110782702	110782716	+	In_Frame_Del	DEL	GCTGCTACCGTGGGT	GCTGCTACCGTGGGT	-	rs150843644|rs375275623		TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	GCTGCTACCGTGGGT	GCTGCTACCGTGGGT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr12:110782702_110782716delGCTGCTACCGTGGGT	ENST00000539276.2	+	17	2642_2656	c.2533_2547delGCTGCTACCGTGGGT	c.(2533-2547)gctgctaccgtgggtdel	p.AATVG845del	ATP2A2_ENST00000395494.2_In_Frame_Del_p.AATVG818del|ATP2A2_ENST00000308664.6_In_Frame_Del_p.AATVG845del			P16615	AT2A2_HUMAN	ATPase, Ca++ transporting, cardiac muscle, slow twitch 2	845					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|epidermis development (GO:0008544)|ER-nucleus signaling pathway (GO:0006984)|ion transmembrane transport (GO:0034220)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart rate (GO:0010460)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calcium-transporting ATPase activity involved in regulation of cardiac muscle cell membrane potential (GO:0086039)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|S100 protein binding (GO:0044548)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(10)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	38						TTACGTCGGCGCTGCTACCGTGGGTGCTGCTGCAT	0.563																																					p.844_849del		Atlas-INDEL	.											.	ATP2A2	78	.	0			c.2532_2546del						.																																			SO:0001651	inframe_deletion	488	exon17			.		CCDS9143.1, CCDS9144.1	12q24.11	2012-10-22			ENSG00000174437	ENSG00000174437	3.6.3.8	"""ATPases / P-type"""	812	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 2"", ""calcium pump 2"""	108740		ATP2B, DAR		10080178	Standard	NM_170665		Approved	SERCA2	uc001tqk.4	P16615	OTTHUMG00000169327	ENST00000539276.2:c.2533_2547delGCTGCTACCGTGGGT	chr12.hg19:g.110782702_110782716delGCTGCTACCGTGGGT	ENSP00000440045:p.Ala845_Gly849del	120.0	0.0		82.0	26.0	NM_170665	A6NDN7|B4DF05|P16614|Q86VJ2	In_Frame_Del	DEL	ENST00000539276.2	hg19	CCDS9144.1																																																																																			.	.		0.563	ATP2A2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403539.1	NM_001681	
SUPT20HL2	170067	hgsc.bcm.edu	37	X	24329899	24329900	+	IGR	INS	-	-	AGCAGC			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chrX:24329899_24329900insAGCAGC								AC096509.1 (25105 upstream) : AC004552.1 (37025 downstream)																							ggagcagcagcaggagcaggag	0.609																																					p.A512delinsAAA		Atlas-INDEL	.											.	.	.	.	0			c.1534_1535insGCTGCT						.																																			SO:0001628	intergenic_variant	170067	exon1			.																													chrX.hg19:g.24329894_24329899dupAGCAGC		295.0	0.0		300.0	30.0	NM_001136233		In_Frame_Ins	INS		hg19																																																																																				.	.	0	0.609								
CASS4	57091	hgsc.bcm.edu	37	20	55025670	55025670	+	Frame_Shift_Del	DEL	C	C	-			TCGA-ZP-A9D0-01A-11D-A36X-10	TCGA-ZP-A9D0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b293a3fc-fa50-456a-a8cc-42ede95b381c	67df7979-ba2c-424e-b4f2-bffcd8828c05	g.chr20:55025670delC	ENST00000360314.3	+	5	802	c.577delC	c.(577-579)cagfs	p.Q193fs	CASS4_ENST00000434344.1_Frame_Shift_Del_p.Q193fs|CASS4_ENST00000371336.3_Frame_Shift_Del_p.Q193fs	NM_001164116.1	NP_001157588.1	Q9NQ75	CASS4_HUMAN	Cas scaffolding protein family member 4	193					cell adhesion (GO:0007155)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)			breast(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(4)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	54						AGAGAAGCAGCAGTTATATGA	0.488																																					p.Q192fs		Atlas-INDEL	.											.	CASS4	121	.	0			c.576delG						.						92.0	72.0	78.0					20																	55025670		2203	4300	6503	SO:0001589	frameshift_variant	57091	exon4			.	AJ276678	CCDS33492.1, CCDS54475.1	20q13.31	2011-04-13	2008-04-14	2008-04-15	ENSG00000087589	ENSG00000087589		"""Cas scaffolding proteins"""	15878	protein-coding gene	gene with protein product	"""HEF-like protein"", ""HEF1-Efs-p130Cas-like"""		"""chromosome 20 open reading frame 32"""	C20orf32			Standard	NM_020356		Approved	HEFL, HEPL	uc002xxr.2	Q9NQ75	OTTHUMG00000032788	ENST00000360314.3:c.577delC	chr20.hg19:g.55025670delC	ENSP00000353462:p.Gln193fs	123.0	0.0		108.0	42.0	NM_001164115	E1P5Z8|Q5QPD6|Q96K09|Q9BYL5	Frame_Shift_Del	DEL	ENST00000360314.3	hg19	CCDS33492.1																																																																																			.	.		0.488	CASS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079789.2	NM_020356	
