#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PLEKHO1	51177	hgsc.bcm.edu	37	1	150131451	150131451	+	Silent	SNP	G	G	A			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr1:150131451G>A	ENST00000369124.4	+	6	1241	c.963G>A	c.(961-963)gaG>gaA	p.E321E	PLEKHO1_ENST00000025469.6_Silent_p.E287E|PLEKHO1_ENST00000369126.1_Silent_p.E138E	NM_016274.4	NP_057358.2	Q53GL0	PKHO1_HUMAN	pleckstrin homology domain containing, family O member 1	321	Negative regulator of AP-1 activity.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|skin(2)	22	Lung NSC(24;7.78e-28)|Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			AGACTCAGGAGCTTCTGGCAG	0.642																																					p.E321E		Atlas-SNP	.											.	PLEKHO1	37	.	0			c.G963A						.						46.0	52.0	50.0					1																	150131451		2203	4300	6503	SO:0001819	synonymous_variant	51177	exon6			TCAGGAGCTTCTG	AF073836	CCDS945.1	1q21.2	2013-01-10			ENSG00000023902	ENSG00000023902		"""Pleckstrin homology (PH) domain containing"""	24310	protein-coding gene	gene with protein product		608335				10799509	Standard	NM_016274		Approved	CKIP-1, OC120	uc001ett.3	Q53GL0	OTTHUMG00000012510	ENST00000369124.4:c.963G>A	chr1.hg19:g.150131451G>A		279.0	0.0		313.0	16.0	NM_016274	Q336K5|Q8IZ51|Q9NRV3|Q9UL48	Silent	SNP	ENST00000369124.4	hg19	CCDS945.1																																																																																			.	.		0.642	PLEKHO1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034962.1	NM_016274	
CFAP45	25790	hgsc.bcm.edu	37	1	159847189	159847189	+	Missense_Mutation	SNP	C	C	T			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr1:159847189C>T	ENST00000368099.4	-	9	1172	c.1108G>A	c.(1108-1110)Gca>Aca	p.A370T	CCDC19_ENST00000426543.2_Missense_Mutation_p.A285T|CCDC19_ENST00000476696.1_5'UTR	NM_012337.2	NP_036469.2														endometrium(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	26	all_hematologic(112;0.0597)		BRCA - Breast invasive adenocarcinoma(70;0.151)			CTCAAGCGTGCGATCTCCTTC	0.537																																					p.A370T		Atlas-SNP	.											.	CCDC19	79	.	0			c.G1108A						.						314.0	257.0	276.0					1																	159847189		2203	4300	6503	SO:0001583	missense	25790	exon9			AGCGTGCGATCTC																												ENST00000368099.4:c.1108G>A	chr1.hg19:g.159847189C>T	ENSP00000357079:p.Ala370Thr	146.0	0.0		154.0	33.0	NM_012337		Missense_Mutation	SNP	ENST00000368099.4	hg19	CCDS30914.1	.	.	.	.	.	.	.	.	.	.	c	13.57	2.277087	0.40294	.	.	ENSG00000213085	ENST00000368099;ENST00000426543	T;T	0.11277	2.79;2.79	4.57	0.434	0.16539	.	0.517167	0.20680	N	0.087663	T	0.02807	0.0084	L	0.47716	1.5	0.30694	N	0.750993	B;B	0.13145	0.007;0.007	B;B	0.15870	0.014;0.008	T	0.43540	-0.9385	9	.	.	.	-2.3368	7.9394	0.29950	0.0:0.6248:0.0:0.3752	.	370;370	A8K884;Q9UL16	.;CCD19_HUMAN	T	370;285	ENSP00000357079:A370T;ENSP00000403044:A285T	.	A	-	1	0	CCDC19	158113813	0.011000	0.17503	0.710000	0.30468	0.961000	0.63080	0.102000	0.15272	-0.003000	0.14444	0.586000	0.80456	GCA	.	.		0.537	CCDC19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085979.1		
DNAH6	1768	hgsc.bcm.edu	37	2	85039487	85039487	+	Missense_Mutation	SNP	A	A	G			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr2:85039487A>G	ENST00000237449.6	+	72	11770	c.11762A>G	c.(11761-11763)aAa>aGa	p.K3921R	DNAH6_ENST00000389394.3_Missense_Mutation_p.K3921R			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	3921					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						ACACTCAACAAAGCCATCGCT	0.448																																					p.K3921R		Atlas-SNP	.											.	DNAH6	194	.	0			c.A11762G						.						110.0	102.0	105.0					2																	85039487		692	1591	2283	SO:0001583	missense	1768	exon73			TCAACAAAGCCAT	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.11762A>G	chr2.hg19:g.85039487A>G	ENSP00000237449:p.Lys3921Arg	137.0	0.0		147.0	62.0	NM_001370	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	ENST00000237449.6	hg19	CCDS46348.1	.	.	.	.	.	.	.	.	.	.	A	18.13	3.555032	0.65425	.	.	ENSG00000115423	ENST00000389394;ENST00000237449	T;T	0.08896	3.04;3.04	5.7	4.56	0.56223	Dynein heavy chain (1);	0.000000	0.56097	D	0.000025	T	0.15046	0.0363	L	0.60845	1.875	0.80722	D	1	P	0.44659	0.84	P	0.50754	0.649	T	0.00565	-1.1668	10	0.44086	T	0.13	.	9.1923	0.37207	0.9153:0.0:0.0847:0.0	.	3921	Q9C0G6	DYH6_HUMAN	R	3921	ENSP00000374045:K3921R;ENSP00000237449:K3921R	ENSP00000237449:K3921R	K	+	2	0	DNAH6	84892998	1.000000	0.71417	0.998000	0.56505	0.571000	0.35966	4.794000	0.62482	2.178000	0.69098	0.477000	0.44152	AAA	.	.		0.448	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
GPAT2	150763	hgsc.bcm.edu	37	2	96690055	96690055	+	Missense_Mutation	SNP	C	C	G			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr2:96690055C>G	ENST00000434632.1	-	17	2159	c.1700G>C	c.(1699-1701)aGa>aCa	p.R567T	GPAT2_ENST00000377137.3_Missense_Mutation_p.R567T|FAHD2CP_ENST00000607780.1_RNA|GPAT2_ENST00000453542.1_Missense_Mutation_p.R496T|GPAT2_ENST00000359548.4_Missense_Mutation_p.R567T			Q6NUI2	GPAT2_HUMAN	glycerol-3-phosphate acyltransferase 2, mitochondrial	567					CDP-diacylglycerol biosynthetic process (GO:0016024)|glycerol-3-phosphate metabolic process (GO:0006072)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			NS(1)|breast(1)|cervix(1)|endometrium(4)|large_intestine(1)|lung(5)|skin(3)	16						GGGCGGCACTCTGCCTGCCAG	0.642																																					p.R567T		Atlas-SNP	.											.	GPAT2	46	.	0			c.G1700C						.						9.0	11.0	11.0					2																	96690055		1847	3954	5801	SO:0001583	missense	150763	exon16			GGCACTCTGCCTG	BC042847	CCDS42714.1	2q11.2	2010-05-04			ENSG00000186281	ENSG00000186281			27168	protein-coding gene	gene with protein product	"""cancer/testis antigen 123"""					12477932	Standard	NM_207328		Approved	CT123	uc010yuf.1	Q6NUI2	OTTHUMG00000155208	ENST00000434632.1:c.1700G>C	chr2.hg19:g.96690055C>G	ENSP00000389395:p.Arg567Thr	85.0	0.0		98.0	6.0	NM_207328	Q6P2E4|Q6ZNI3|Q6ZNI5|Q6ZWJ4	Missense_Mutation	SNP	ENST00000434632.1	hg19	CCDS42714.1	.	.	.	.	.	.	.	.	.	.	c	15.88	2.962803	0.53507	.	.	ENSG00000186281	ENST00000359548;ENST00000434632;ENST00000453542;ENST00000377137	T;T;T;T	0.78126	-1.14;-1.14;-0.17;-1.15	5.2	4.32	0.51571	.	0.148103	0.40554	N	0.001071	T	0.81254	0.4784	M	0.65498	2.005	0.27417	N	0.954412	D;P;P;P;D	0.56035	0.974;0.763;0.469;0.554;0.974	P;B;B;B;P	0.53861	0.647;0.288;0.158;0.218;0.736	T	0.75340	-0.3352	10	0.62326	D	0.03	.	9.7275	0.40342	0.0:0.9037:0.0:0.0963	.	496;567;573;567;496	E9PE95;Q6NUI2-3;Q6NUI2-4;Q6NUI2;B4DNZ9	.;.;.;GPAT2_HUMAN;.	T	567;567;496;567	ENSP00000352547:R567T;ENSP00000389395:R567T;ENSP00000393770:R496T;ENSP00000366341:R567T	ENSP00000352547:R567T	R	-	2	0	GPAT2	96053782	0.011000	0.17503	0.987000	0.45799	0.982000	0.71751	1.312000	0.33574	1.197000	0.43143	0.637000	0.83480	AGA	.	.		0.642	GPAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338786.1	NM_207328	
GALNT13	114805	hgsc.bcm.edu	37	2	155295175	155295175	+	Silent	SNP	A	A	G			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr2:155295175A>G	ENST00000392825.3	+	12	2034	c.1467A>G	c.(1465-1467)ggA>ggG	p.G489G	GALNT13_ENST00000409237.1_Silent_p.G489G|AC009227.2_ENST00000434635.1_RNA|GALNT13_ENST00000487047.1_3'UTR	NM_052917.2	NP_443149.2	Q8IUC8	GLT13_HUMAN	polypeptide N-acetylgalactosaminyltransferase 13	489	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|lung(37)|ovary(3)|pancreas(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	65						GACTCAATGGACCTGTAATCA	0.323																																					p.G489G		Atlas-SNP	.											.	GALNT13	170	.	0			c.A1467G						.						128.0	132.0	131.0					2																	155295175		2203	4300	6503	SO:0001819	synonymous_variant	114805	exon12			CAATGGACCTGTA	AB067505	CCDS2199.1	2q24.1	2014-03-13	2014-03-13		ENSG00000144278	ENSG00000144278	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	23242	protein-coding gene	gene with protein product	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13"", ""polypeptide GalNAc transferase 13"""	608369	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13)"""			11572484, 12407114	Standard	XM_005246267		Approved	KIAA1918, GalNAc-T13	uc002tyr.4	Q8IUC8	OTTHUMG00000131917	ENST00000392825.3:c.1467A>G	chr2.hg19:g.155295175A>G		92.0	0.0		87.0	35.0	NM_052917	Q08ER7|Q68VI8|Q6ZWG1|Q96PX0|Q9UIE5	Silent	SNP	ENST00000392825.3	hg19	CCDS2199.1	.	.	.	.	.	.	.	.	.	.	A	10.53	1.377026	0.24857	.	.	ENSG00000144278	ENST00000450838;ENST00000422126	.	.	.	5.55	-1.18	0.09617	.	.	.	.	.	T	0.40040	0.1101	.	.	.	0.80722	D	1	B	0.09022	0.002	B	0.04013	0.001	T	0.25293	-1.0136	7	0.66056	D	0.02	.	2.1258	0.03738	0.2784:0.1605:0.4057:0.1555	.	469	Q8IUC8-2	.	A	75;28	.	ENSP00000391469:T28A	T	+	1	0	GALNT13	155003421	0.472000	0.25870	0.997000	0.53966	0.980000	0.70556	-0.109000	0.10840	-0.142000	0.11354	-0.899000	0.02877	ACC	.	.		0.323	GALNT13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254870.2	NM_052917	
TTN	7273	hgsc.bcm.edu	37	2	179399862	179399862	+	Missense_Mutation	SNP	C	C	T	rs376403708		TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr2:179399862C>T	ENST00000591111.1	-	308	96781	c.96557G>A	c.(96556-96558)cGt>cAt	p.R32186H	TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R24887H|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000415561.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R24954H|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R33827H|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.R24762H|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R31259H			Q8WZ42	TITIN_HUMAN	titin	32186	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AAACTCACCACGCCCAAGATC	0.408													C|||	1	0.000199681	0.0	0.0	5008	,	,		20558	0.0		0.0	False		,,,				2504	0.001				p.R33827H		Atlas-SNP	.											.	TTN	18412	.	0			c.G101480A						.	C	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	0,3806		0,0,1903	117.0	113.0	114.0		74861,74660,93776,74285	4.8	1.0	2		114	1,8237		0,1,4118	no	missense,missense,missense,missense	TTN	NM_133437.3,NM_133432.3,NM_133378.4,NM_003319.4	29,29,29,29	0,1,6021	TT,TC,CC		0.0121,0.0,0.0083	benign,benign,benign,benign	24954/27119,24887/27052,31259/33424,24762/26927	179399862	1,12043	1903	4119	6022	SO:0001583	missense	7273	exon358			TCACCACGCCCAA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.96557G>A	chr2.hg19:g.179399862C>T	ENSP00000465570:p.Arg32186His	62.0	0.0		65.0	22.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	C	15.39	2.819595	0.50633	0.0	1.21E-4	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.66995	-0.24;-0.24;-0.24;-0.24	5.72	4.85	0.62838	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.60907	0.2305	L	0.56199	1.76	0.54753	D	0.999981	B;B;B;B	0.22146	0.065;0.065;0.065;0.065	B;B;B;B	0.17722	0.019;0.019;0.019;0.019	T	0.61222	-0.7106	9	0.87932	D	0	.	10.7451	0.46177	0.0:0.8546:0.0:0.1454	.	24762;24887;24954;32186	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	H	31259;24762;24954;24887;24759	ENSP00000343764:R31259H;ENSP00000434586:R24762H;ENSP00000340554:R24954H;ENSP00000352154:R24887H	ENSP00000340554:R24954H	R	-	2	0	TTN	179108108	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	4.102000	0.57776	1.407000	0.46875	0.557000	0.71058	CGT	.	.		0.408	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
FSIP2	401024	hgsc.bcm.edu	37	2	186672932	186672932	+	Missense_Mutation	SNP	C	C	T			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr2:186672932C>T	ENST00000424728.1	+	17	18899	c.18899C>T	c.(18898-18900)cCt>cTt	p.P6300L	FSIP2_ENST00000343098.5_Missense_Mutation_p.P6389L			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	6300										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						GAATTTCAACCTCAAGTAGAG	0.303																																					p.P6389L		Atlas-SNP	.											.	FSIP2	251	.	0			c.C19166T						.						43.0	41.0	41.0					2																	186672932		1811	4067	5878	SO:0001583	missense	401024	exon17			TTCAACCTCAAGT	AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.18899C>T	chr2.hg19:g.186672932C>T	ENSP00000401306:p.Pro6300Leu	347.0	0.0		326.0	140.0	NM_173651	Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Missense_Mutation	SNP	ENST00000424728.1	hg19		.	.	.	.	.	.	.	.	.	.	C	16.31	3.087744	0.55968	.	.	ENSG00000188738	ENST00000343098;ENST00000424728	T;T	0.51817	0.69;0.69	5.21	3.37	0.38596	.	0.449576	0.19458	N	0.113770	T	0.49541	0.1563	L	0.49126	1.545	0.40431	D	0.979945	.	.	.	.	.	.	T	0.53151	-0.8479	8	0.72032	D	0.01	.	7.3416	0.26640	0.0:0.7386:0.17:0.0913	.	.	.	.	L	6389;6300	ENSP00000344403:P6389L;ENSP00000401306:P6300L	ENSP00000344403:P6389L	P	+	2	0	FSIP2	186381177	0.055000	0.20627	0.997000	0.53966	0.936000	0.57629	0.619000	0.24388	1.417000	0.47077	0.591000	0.81541	CCT	.	.		0.303	FSIP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000332778.3	NM_173651	
DNAH7	56171	hgsc.bcm.edu	37	2	196619175	196619175	+	Missense_Mutation	SNP	A	A	G			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr2:196619175A>G	ENST00000312428.6	-	63	11750	c.11650T>C	c.(11650-11652)Ttc>Ctc	p.F3884L	DNAH7_ENST00000409063.1_Missense_Mutation_p.F367L	NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3884					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						CCGGTCAGGAAGGCTTGTGTG	0.468																																					p.F3884L		Atlas-SNP	.											.	DNAH7	512	.	0			c.T11650C						.						99.0	100.0	100.0					2																	196619175		1919	4118	6037	SO:0001583	missense	56171	exon63			TCAGGAAGGCTTG	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.11650T>C	chr2.hg19:g.196619175A>G	ENSP00000311273:p.Phe3884Leu	138.0	0.0		157.0	65.0	NM_018897	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	ENST00000312428.6	hg19	CCDS42794.1	.	.	.	.	.	.	.	.	.	.	A	32	5.186620	0.94885	.	.	ENSG00000118997	ENST00000312428;ENST00000409063	T;T	0.14266	2.52;2.52	5.55	5.55	0.83447	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.47857	0.1468	M	0.92077	3.27	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.59653	-0.7414	10	0.66056	D	0.02	.	15.517	0.75833	1.0:0.0:0.0:0.0	.	3884	Q8WXX0	DYH7_HUMAN	L	3884;367	ENSP00000311273:F3884L;ENSP00000386912:F367L	ENSP00000311273:F3884L	F	-	1	0	DNAH7	196327420	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	8.747000	0.91610	2.326000	0.78906	0.533000	0.62120	TTC	.	.		0.468	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897	
UNC80	285175	hgsc.bcm.edu	37	2	210698727	210698727	+	Splice_Site	SNP	G	G	T			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr2:210698727G>T	ENST00000439458.1	+	17	2857	c.2777G>T	c.(2776-2778)gGa>gTa	p.G926V	UNC80_ENST00000272845.6_Splice_Site_p.G921V	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	926					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						TCCAAACAGGGACTGTATTGT	0.458																																					p.G926V		Atlas-SNP	.											.	UNC80	280	.	0			c.G2777T						.						96.0	78.0	84.0					2																	210698727		692	1591	2283	SO:0001630	splice_region_variant	285175	exon17			AACAGGGACTGTA	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.2776-1G>T	chr2.hg19:g.210698727G>T		115.0	0.0		115.0	51.0	NM_032504	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	ENST00000439458.1	hg19	CCDS46504.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.517400	0.85495	.	.	ENSG00000144406	ENST00000439458;ENST00000272845	T;T	0.31510	1.49;1.49	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.51517	0.1679	L	0.43152	1.355	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.48198	-0.9056	10	0.72032	D	0.01	-19.4034	20.0706	0.97721	0.0:0.0:1.0:0.0	.	926	Q8N2C7	UNC80_HUMAN	V	926;921	ENSP00000391088:G926V;ENSP00000272845:G921V	ENSP00000272845:G921V	G	+	2	0	UNC80	210406972	1.000000	0.71417	0.991000	0.47740	0.742000	0.42306	9.869000	0.99810	2.744000	0.94065	0.655000	0.94253	GGA	.	.		0.458	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_182587	Missense_Mutation
MFF	56947	hgsc.bcm.edu	37	2	228194472	228194472	+	Missense_Mutation	SNP	G	G	T	rs145010660	byFrequency	TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr2:228194472G>T	ENST00000353339.3	+	3	452	c.11G>T	c.(10-12)gGa>gTa	p.G4V	MFF_ENST00000476924.1_Intron|MFF_ENST00000349901.7_Intron|MFF_ENST00000409565.1_Intron|MFF_ENST00000304593.9_Intron|MFF_ENST00000524634.1_Intron|MFF_ENST00000354503.6_Intron|MFF_ENST00000409616.1_5'UTR|MFF_ENST00000392059.1_Missense_Mutation_p.G4V|MFF_ENST00000337110.7_Intron	NM_001277061.1	NP_001263990.1	Q9GZY8	MFF_HUMAN	mitochondrial fission factor	4					mitochondrial fission (GO:0000266)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial fusion (GO:0008053)|mitochondrion morphogenesis (GO:0070584)|peroxisome fission (GO:0016559)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|protein homooligomerization (GO:0051260)|protein targeting to mitochondrion (GO:0006626)|regulation of mitochondrion organization (GO:0010821)|regulation of peroxisome organization (GO:1900063)|release of cytochrome c from mitochondria (GO:0001836)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|integral component of mitochondrial membrane (GO:0032592)|mitochondrial outer membrane (GO:0005741)|peroxisome (GO:0005777)|synapse (GO:0045202)	protein homodimerization activity (GO:0042803)			breast(3)|endometrium(2)|kidney(3)|large_intestine(7)|lung(4)|stomach(2)	21						ATGAGTAAAGGAACAAGCAGT	0.358																																					p.G4V		Atlas-SNP	.											.	MFF	48	.	0			c.G11T						.						121.0	114.0	117.0					2																	228194472		2203	4300	6503	SO:0001583	missense	56947	exon3			GTAAAGGAACAAG	AF258660	CCDS2465.1, CCDS63139.1, CCDS63140.1, CCDS63141.1, CCDS63142.1, CCDS74662.1	2q36	2008-05-29	2008-05-29	2008-05-29	ENSG00000168958	ENSG00000168958			24858	protein-coding gene	gene with protein product		614785	"""chromosome 2 open reading frame 33"""	C2orf33		18353969	Standard	NM_001277061		Approved	GL004	uc002voy.4	Q9GZY8	OTTHUMG00000133180	ENST00000353339.3:c.11G>T	chr2.hg19:g.228194472G>T	ENSP00000302037:p.Gly4Val	268.0	0.0		283.0	98.0	NM_020194	Q567U1|Q658R6|Q9BVZ1|Q9H690|Q9NRG8	Missense_Mutation	SNP	ENST00000353339.3	hg19	CCDS2465.1	.	.	.	.	.	.	.	.	.	.	G	13.21	2.170092	0.38315	.	.	ENSG00000168958	ENST00000353339;ENST00000436237;ENST00000443428;ENST00000392059	T;T;T;T	0.38077	1.51;1.16;1.48;1.51	5.97	4.15	0.48705	.	0.224259	0.31636	N	0.007317	T	0.17323	0.0416	N	0.08118	0	0.43203	D	0.995053	B	0.17667	0.023	B	0.17722	0.019	T	0.06409	-1.0828	9	.	.	.	-1.3011	8.8122	0.34974	0.0815:0.1512:0.7673:0.0	.	4	Q9GZY8	MFF_HUMAN	V	4	ENSP00000302037:G4V;ENSP00000411386:G4V;ENSP00000391829:G4V;ENSP00000375912:G4V	.	G	+	2	0	MFF	227902716	1.000000	0.71417	0.998000	0.56505	0.959000	0.62525	2.047000	0.41269	0.833000	0.34828	0.650000	0.86243	GGA	.	G|0.999;C|0.001		0.358	MFF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256887.2	NM_020194	
ANKMY1	51281	hgsc.bcm.edu	37	2	241421602	241421602	+	Silent	SNP	C	C	G			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr2:241421602C>G	ENST00000272972.3	-	15	2830	c.2616G>C	c.(2614-2616)ggG>ggC	p.G872G	ANKMY1_ENST00000361678.4_Silent_p.G648G|ANKMY1_ENST00000373318.2_Silent_p.G651G|ANKMY1_ENST00000401804.1_Silent_p.G961G|ANKMY1_ENST00000406958.1_Silent_p.G633G|ANKMY1_ENST00000403283.1_Silent_p.G774G|ANKMY1_ENST00000391987.1_Silent_p.G872G|ANKMY1_ENST00000373320.4_Silent_p.G642G	NM_016552.2	NP_057636.2	Q9P2S6	ANKY1_HUMAN	ankyrin repeat and MYND domain containing 1	872							metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	30		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.03e-30)|all cancers(36;4.78e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.45e-14)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.8e-06)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.01)|Colorectal(34;0.0101)|COAD - Colon adenocarcinoma(134;0.0476)		ACACTTACTGCCCCTGCTCCT	0.617																																					p.G872G		Atlas-SNP	.											.	ANKMY1	112	.	0			c.G2616C						.						106.0	98.0	100.0					2																	241421602		2203	4300	6503	SO:0001819	synonymous_variant	51281	exon15			TTACTGCCCCTGC	AB034636	CCDS2535.1, CCDS2536.1, CCDS63184.1, CCDS63185.1, CCDS74681.1	2q37.3	2013-01-10			ENSG00000144504	ENSG00000144504		"""Zinc fingers, MYND-type"", ""Ankyrin repeat domain containing"""	20987	protein-coding gene	gene with protein product							Standard	XM_005247020		Approved	FLJ20499, ZMYND13	uc002vyz.1	Q9P2S6	OTTHUMG00000133355	ENST00000272972.3:c.2616G>C	chr2.hg19:g.241421602C>G		86.0	0.0		67.0	16.0	NM_016552	B2RB78|Q4ZFV3|Q8IYX5|Q8NDK5|Q9H0V8|Q9NX10	Silent	SNP	ENST00000272972.3	hg19	CCDS2536.1																																																																																			.	.		0.617	ANKMY1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257187.2	NM_017844	
GOLGA4	2803	hgsc.bcm.edu	37	3	37340443	37340443	+	Silent	SNP	T	T	C			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr3:37340443T>C	ENST00000361924.2	+	8	1308	c.934T>C	c.(934-936)Tta>Cta	p.L312L	GOLGA4_ENST00000435830.2_3'UTR|GOLGA4_ENST00000356847.4_Silent_p.L334L|GOLGA4_ENST00000444882.1_Intron	NM_002078.4	NP_002069.2	Q13439	GOGA4_HUMAN	golgin A4	312	Glu-rich.				Golgi to plasma membrane protein transport (GO:0043001)|protein targeting to Golgi (GO:0000042)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	GTPase binding (GO:0051020)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(17)|liver(2)|lung(16)|ovary(4)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						ATGTACACTATTAACTAGTGA	0.353																																					p.L334L		Atlas-SNP	.											.	GOLGA4	173	.	0			c.T1000C						.						111.0	116.0	114.0					3																	37340443		2203	4300	6503	SO:0001819	synonymous_variant	2803	exon9			ACACTATTAACTA	U31906	CCDS2666.1, CCDS54564.1	3p22-p21.3	2010-02-12	2010-02-12		ENSG00000144674	ENSG00000144674			4427	protein-coding gene	gene with protein product	"""golgin 245"""	602509	"""golgi autoantigen, golgin subfamily a, 4"""			8626529	Standard	NM_002078		Approved	GOLG, GCP2, p230, golgin-240	uc003cgw.3	Q13439	OTTHUMG00000130799	ENST00000361924.2:c.934T>C	chr3.hg19:g.37340443T>C		463.0	0.0		449.0	172.0	NM_001172713	F8W8Q7|Q13270|Q13654|Q14436|Q59EW8	Silent	SNP	ENST00000361924.2	hg19	CCDS2666.1																																																																																			.	.		0.353	GOLGA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253339.2	NM_002078	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266107	41266107	+	Missense_Mutation	SNP	T	T	G	rs121913416		TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr3:41266107T>G	ENST00000349496.5	+	3	384	c.104T>G	c.(103-105)aTc>aGc	p.I35S	CTNNB1_ENST00000453024.1_Missense_Mutation_p.I28S|CTNNB1_ENST00000396185.3_Missense_Mutation_p.I35S|CTNNB1_ENST00000396183.3_Missense_Mutation_p.I35S|CTNNB1_ENST00000405570.1_Missense_Mutation_p.I35S	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	35			I -> S (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.A5_A80del(53)|p.I35S(20)|p.I35T(13)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.I35_S37>T(1)|p.A13_R151del(1)|p.D32_H36>D(1)|p.M14_S45del(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.I35_K170del(1)|p.H24_G38del(1)|p.S29_H36del(1)|p.I35_T41del(1)|p.I35N(1)|p.I35_G38del(1)|p.I35K(1)|p.Y30_A97del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.D32fs*9(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.S33_S37del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.GIHS34?(1)|p.A5_I35del(1)|p.D32_H36del(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		GACTCTGGAATCCATTCTGGT	0.493		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.I35S	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,NS,carcinoma,0,1	CTNNB1	4904	.	169	Deletion - In frame(107)|Substitution - Missense(35)|Complex - deletion inframe(17)|Unknown(7)|Deletion - Frameshift(3)	liver(118)|large_intestine(19)|salivary_gland(12)|stomach(7)|soft_tissue(2)|small_intestine(2)|endometrium(2)|skin(2)|adrenal_gland(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|pituitary(1)|kidney(1)	c.T104G						.						95.0	80.0	85.0					3																	41266107		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	CTGGAATCCATTC	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.104T>G	chr3.hg19:g.41266107T>G	ENSP00000344456:p.Ile35Ser	183.0	0.0		126.0	51.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.188620	0.78789	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.51817	0.69;0.69;0.69;0.69;0.69;0.69;0.69;0.69;0.69	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.69548	0.3123	M	0.79614	2.46	0.80722	D	1	D	0.76494	0.999	D	0.71414	0.973	T	0.73949	-0.3821	10	0.87932	D	0	-3.5499	16.0677	0.80897	0.0:0.0:0.0:1.0	.	35	P35222	CTNB1_HUMAN	S	28;35;35;35;35;28;35;35;35	ENSP00000400508:I28S;ENSP00000385604:I35S;ENSP00000412219:I35S;ENSP00000379486:I35S;ENSP00000344456:I35S;ENSP00000411226:I28S;ENSP00000379488:I35S;ENSP00000409302:I35S;ENSP00000401599:I35S	ENSP00000344456:I35S	I	+	2	0	CTNNB1	41241111	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.040000	0.89188	2.201000	0.70794	0.533000	0.62120	ATC	.	.		0.493	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
B4GALT4	8702	hgsc.bcm.edu	37	3	118948707	118948707	+	Silent	SNP	C	C	T			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr3:118948707C>T	ENST00000483209.1	-	3	881	c.240G>A	c.(238-240)gtG>gtA	p.V80V	B4GALT4-AS1_ENST00000470790.1_RNA|B4GALT4_ENST00000359213.3_Silent_p.V80V|B4GALT4_ENST00000460321.1_Intron|B4GALT4_ENST00000393765.2_Silent_p.V80V|B4GALT4_ENST00000471675.1_Silent_p.V33V|B4GALT4_ENST00000467604.1_Silent_p.V80V			O60513	B4GT4_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 4	80					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|membrane lipid metabolic process (GO:0006643)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)|metal ion binding (GO:0046872)|N-acetyllactosamine synthase activity (GO:0003945)			breast(2)|endometrium(1)|large_intestine(1)|lung(6)|skin(2)|stomach(2)	14				GBM - Glioblastoma multiforme(114;0.222)	N-Acetyl-D-glucosamine(DB00141)	GGTAAGGAGACACAGAAGGGC	0.368																																					p.V80V		Atlas-SNP	.											.	B4GALT4	30	.	0			c.G240A						.						136.0	125.0	129.0					3																	118948707		2203	4300	6503	SO:0001819	synonymous_variant	8702	exon4			AGGAGACACAGAA	AF022367	CCDS2986.1	3q13.3	2013-02-19			ENSG00000121578	ENSG00000121578		"""Beta 4-glycosyltransferases"""	927	protein-coding gene	gene with protein product		604015				9597550	Standard	NM_003778		Approved	beta4Gal-T4	uc003eci.3	O60513	OTTHUMG00000159358	ENST00000483209.1:c.240G>A	chr3.hg19:g.118948707C>T		60.0	0.0		50.0	21.0	NM_212543	Q68D68|Q9BSW3|Q9C078	Silent	SNP	ENST00000483209.1	hg19	CCDS2986.1																																																																																			.	.		0.368	B4GALT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354925.2	NM_003778	
HGD	3081	hgsc.bcm.edu	37	3	120389301	120389301	+	Missense_Mutation	SNP	C	C	A			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr3:120389301C>A	ENST00000283871.5	-	4	714	c.255G>T	c.(253-255)tgG>tgT	p.W85C	HGD_ENST00000488183.1_5'UTR	NM_000187.3	NP_000178.2	Q93099	HGD_HUMAN	homogentisate 1,2-dioxygenase	85					cellular nitrogen compound metabolic process (GO:0034641)|L-phenylalanine catabolic process (GO:0006559)|small molecule metabolic process (GO:0044281)|tyrosine catabolic process (GO:0006572)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	homogentisate 1,2-dioxygenase activity (GO:0004411)|metal ion binding (GO:0046872)			cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(2)	25				GBM - Glioblastoma multiforme(114;0.158)		CAACTTCATCCCAGTTGTGAG	0.418																																					p.W85C		Atlas-SNP	.											.	HGD	65	.	0			c.G255T						.						150.0	147.0	148.0					3																	120389301		2203	4296	6499	SO:0001583	missense	3081	exon4			TTCATCCCAGTTG		CCDS3000.1	3q	2010-04-27	2010-04-27		ENSG00000113924	ENSG00000113924	1.13.11.5		4892	protein-coding gene	gene with protein product	"""homogentisate oxidase"""	607474	"""homogentisate 1,2-dioxygenase (homogentisate oxidase)"""	AKU		8188241	Standard	NM_000187		Approved	HGO	uc003edw.3	Q93099	OTTHUMG00000159441	ENST00000283871.5:c.255G>T	chr3.hg19:g.120389301C>A	ENSP00000283871:p.Trp85Cys	123.0	0.0		120.0	50.0	NM_000187	A8K417|B2R8Z0	Missense_Mutation	SNP	ENST00000283871.5	hg19	CCDS3000.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.007814	0.75046	.	.	ENSG00000113924	ENST00000283871;ENST00000476082	D;D	0.98968	-5.28;-5.28	6.06	6.06	0.98353	Cupin, RmlC-type (1);	0.000000	0.85682	D	0.000000	D	0.98807	0.9598	L	0.60904	1.88	0.80722	D	1	D	0.76494	0.999	D	0.72338	0.977	D	0.99218	1.0878	10	0.44086	T	0.13	-12.3701	18.1221	0.89574	0.0:1.0:0.0:0.0	.	85	Q93099	HGD_HUMAN	C	85;44	ENSP00000283871:W85C;ENSP00000419560:W44C	ENSP00000283871:W85C	W	-	3	0	HGD	121871991	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.498000	0.73679	2.871000	0.98454	0.655000	0.94253	TGG	.	.		0.418	HGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355410.1		
POLQ	10721	hgsc.bcm.edu	37	3	121258426	121258426	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr3:121258426T>C	ENST00000264233.5	-	4	613	c.485A>G	c.(484-486)cAg>cGg	p.Q162R		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	162	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		TCCTACTTCCTGAAACAGACT	0.373								DNA polymerases (catalytic subunits)																													p.Q162R	Pancreas(152;907 1925 26081 31236 36904)	Atlas-SNP	.											.	POLQ	273	.	0			c.A485G						.						82.0	79.0	80.0					3																	121258426		2203	4300	6503	SO:0001583	missense	10721	exon4			ACTTCCTGAAACA	AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.485A>G	chr3.hg19:g.121258426T>C	ENSP00000264233:p.Gln162Arg	238.0	0.0		214.0	83.0	NM_199420	O95160|Q6VMB5	Missense_Mutation	SNP	ENST00000264233.5	hg19	CCDS33833.1	.	.	.	.	.	.	.	.	.	.	T	19.88	3.909861	0.72983	.	.	ENSG00000051341	ENST00000264233;ENST00000393672	T	0.15017	2.46	6.06	4.89	0.63831	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.203846	0.52532	D	0.000071	T	0.17831	0.0428	N	0.25144	0.715	0.43550	D	0.99585	B	0.29301	0.241	B	0.40009	0.316	T	0.07158	-1.0787	10	0.52906	T	0.07	.	13.5722	0.61853	0.0:0.0:0.1297:0.8702	.	162	O75417	DPOLQ_HUMAN	R	162;297	ENSP00000264233:Q162R	ENSP00000264233:Q162R	Q	-	2	0	POLQ	122741116	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.932000	0.70121	1.087000	0.41251	0.528000	0.53228	CAG	.	.		0.373	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355097.1	NM_199420	
KCTD8	386617	hgsc.bcm.edu	37	4	44449630	44449630	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr4:44449630T>C	ENST00000360029.3	-	1	1194	c.911A>G	c.(910-912)cAg>cGg	p.Q304R	AC131951.1_ENST00000584757.1_RNA	NM_198353.2	NP_938167.1	Q6ZWB6	KCTD8_HUMAN	potassium channel tetramerization domain containing 8	304					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)				central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(3)|upper_aerodigestive_tract(4)	41						GTCGCGGTACTGGTTGACGAA	0.612										HNSCC(17;0.042)																											p.Q304R		Atlas-SNP	.											.	KCTD8	96	.	0			c.A911G						.						30.0	27.0	28.0					4																	44449630		2203	4299	6502	SO:0001583	missense	386617	exon1			CGGTACTGGTTGA	AK123347	CCDS3467.1	4p13	2013-06-20	2013-06-20		ENSG00000183783	ENSG00000183783			22394	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 8"""				Standard	NM_198353		Approved		uc003gwu.3	Q6ZWB6	OTTHUMG00000099409	ENST00000360029.3:c.911A>G	chr4.hg19:g.44449630T>C	ENSP00000353129:p.Gln304Arg	89.0	0.0		66.0	38.0	NM_198353	A2RU39	Missense_Mutation	SNP	ENST00000360029.3	hg19	CCDS3467.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.12|15.12	2.740103|2.740103	0.49045|0.49045	.|.	.|.	ENSG00000183783|ENSG00000183783	ENST00000360029|ENST00000515268	T|.	0.38560|.	1.13|.	4.2|4.2	4.2|4.2	0.49525|0.49525	.|.	0.076891|.	0.53938|.	D|.	0.000059|.	T|T	0.57932|0.57932	0.2087|0.2087	L|L	0.43152|0.43152	1.355|1.355	0.46798|0.46798	D|D	0.999205|0.999205	B|.	0.20052|.	0.041|.	B|.	0.17098|.	0.017|.	T|T	0.55431|0.55431	-0.8142|-0.8142	10|5	0.45353|.	T|.	0.12|.	.|.	12.6153|12.6153	0.56573|0.56573	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	304|.	Q6ZWB6|.	KCTD8_HUMAN|.	R|G	304|1	ENSP00000353129:Q304R|.	ENSP00000353129:Q304R|.	Q|S	-|-	2|1	0|0	KCTD8|KCTD8	44144387|44144387	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	5.929000|5.929000	0.70096|0.70096	1.769000|1.769000	0.52152|0.52152	0.482000|0.482000	0.46254|0.46254	CAG|AGT	.	.		0.612	KCTD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216868.1		
KIT	3815	hgsc.bcm.edu	37	4	55564533	55564533	+	Missense_Mutation	SNP	C	C	T			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr4:55564533C>T	ENST00000288135.5	+	3	518	c.421C>T	c.(421-423)Cca>Tca	p.P141S		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	141	Ig-like C2-type 2.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TCTCACAGACCCAGAAGTGAC	0.512		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																												p.P141S		Atlas-SNP	.	yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	.	KIT	7396	.	0			c.C421T						.						51.0	50.0	50.0					4																	55564533		2203	4300	6503	SO:0001583	missense	3815	exon3	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	ACAGACCCAGAAG	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.421C>T	chr4.hg19:g.55564533C>T	ENSP00000288135:p.Pro141Ser	136.0	0.0		101.0	31.0	NM_000222	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	ENST00000288135.5	hg19	CCDS3496.1	.	.	.	.	.	.	.	.	.	.	C	17.76	3.469049	0.63625	.	.	ENSG00000157404	ENST00000288135;ENST00000412167;ENST00000536403	D;D	0.84370	-1.84;-1.82	5.63	5.63	0.86233	Immunoglobulin-like fold (1);	0.099447	0.44688	D	0.000423	D	0.92522	0.7625	M	0.78637	2.42	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.93048	0.6463	10	0.87932	D	0	.	17.8639	0.88790	0.0:1.0:0.0:0.0	.	141;141	P10721-2;P10721	.;KIT_HUMAN	S	141	ENSP00000288135:P141S;ENSP00000390987:P141S	ENSP00000288135:P141S	P	+	1	0	KIT	55259290	1.000000	0.71417	0.991000	0.47740	0.273000	0.26683	5.302000	0.65733	2.657000	0.90304	0.561000	0.74099	CCA	.	.		0.512	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250618.1		
SLC4A4	8671	hgsc.bcm.edu	37	4	72205022	72205022	+	Intron	SNP	C	C	T			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr4:72205022C>T	ENST00000264485.5	+	4	370				SLC4A4_ENST00000351898.6_Intron|SLC4A4_ENST00000340595.3_Silent_p.A19A|SLC4A4_ENST00000514331.1_Intron|SLC4A4_ENST00000425175.1_Intron|SLC4A4_ENST00000512686.1_Silent_p.A19A	NM_001098484.2	NP_001091954.1	Q9Y6R1	S4A4_HUMAN	solute carrier family 4 (sodium bicarbonate cotransporter), member 4						bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	58			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		Sodium bicarbonate(DB01390)	GAGGAAGAGCCCGGAGCTCCA	0.498																																					p.A19A		Atlas-SNP	.											.	SLC4A4	269	.	0			c.C57T						.						182.0	208.0	200.0					4																	72205022		2203	4300	6503	SO:0001627	intron_variant	8671	exon1			AAGAGCCCGGAGC	AF007216	CCDS3549.1, CCDS43236.1, CCDS47071.1	4q13.3	2013-07-19	2013-07-19		ENSG00000080493	ENSG00000080493		"""Solute carriers"""	11030	protein-coding gene	gene with protein product		603345	"""solute carrier family 4, sodium bicarbonate cotransporter, member 4"""	SLC4A5		9235899, 9651366	Standard	NM_001098484		Approved	NBC1, HNBC1, NBC2, pNBC, hhNMC	uc010iic.3	Q9Y6R1	OTTHUMG00000129907	ENST00000264485.5:c.254-65C>T	chr4.hg19:g.72205022C>T		179.0	0.0		156.0	60.0	NM_003759	C4B714|O15153|Q8NEJ2|Q9H262|Q9NRZ1|Q9UIC0|Q9UIC1|Q9UP50	Silent	SNP	ENST00000264485.5	hg19	CCDS43236.1																																																																																			.	.		0.498	SLC4A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362090.1	NM_003759	
HHIP	64399	hgsc.bcm.edu	37	4	145580921	145580921	+	Silent	SNP	T	T	C			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr4:145580921T>C	ENST00000296575.3	+	4	1417	c.762T>C	c.(760-762)ctT>ctC	p.L254L	HHIP_ENST00000511314.1_3'UTR|HHIP_ENST00000434550.2_Silent_p.L254L|HHIP-AS1_ENST00000512359.1_RNA	NM_022475.2	NP_071920.1	Q96QV1	HHIP_HUMAN	hedgehog interacting protein	254					carbohydrate metabolic process (GO:0005975)|dorsal/ventral pattern formation (GO:0009953)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|negative regulation of signal transduction (GO:0009968)|negative regulation of smoothened signaling pathway (GO:0045879)|neuroblast proliferation (GO:0007405)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|skeletal system morphogenesis (GO:0048705)|smoothened signaling pathway (GO:0007224)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	hedgehog family protein binding (GO:0097108)|oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	33	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0185)		TGAAGATACTTACCCCTGAAG	0.423																																					p.L254L		Atlas-SNP	.											.	HHIP	100	.	0			c.T762C						.						97.0	106.0	103.0					4																	145580921		2203	4300	6503	SO:0001819	synonymous_variant	64399	exon4			GATACTTACCCCT	AK024645	CCDS3762.1	4q31.21-q31.3	2008-08-29	2001-11-29		ENSG00000164161	ENSG00000164161			14866	protein-coding gene	gene with protein product		606178	"""hedgehog-interacting protein"""			11435703, 11731473	Standard	NM_022475		Approved	HIP, FLJ20992	uc003ijs.2	Q96QV1	OTTHUMG00000161428	ENST00000296575.3:c.762T>C	chr4.hg19:g.145580921T>C		197.0	0.0		167.0	66.0	NM_022475	Q6PK09|Q8NCI7|Q9BXK3|Q9H1J4|Q9H7E7	Silent	SNP	ENST00000296575.3	hg19	CCDS3762.1																																																																																			.	.		0.423	HHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364887.2		
DDX60	55601	hgsc.bcm.edu	37	4	169209405	169209405	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr4:169209405T>C	ENST00000393743.3	-	9	1394	c.1103A>G	c.(1102-1104)aAt>aGt	p.N368S		NM_017631.5	NP_060101.3	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	368					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|urinary_tract(4)	63		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		GTGAATTAAATTCAGATTCCA	0.259																																					p.N368S		Atlas-SNP	.											.	DDX60	304	.	0			c.A1103G						.						46.0	53.0	50.0					4																	169209405		2166	4260	6426	SO:0001583	missense	55601	exon9			ATTAAATTCAGAT	AK001649	CCDS34097.1	4q32.3	2010-02-17			ENSG00000137628	ENSG00000137628			25942	protein-coding gene	gene with protein product		613974				12477932	Standard	NM_017631		Approved	FLJ20035	uc003irp.3	Q8IY21	OTTHUMG00000161350	ENST00000393743.3:c.1103A>G	chr4.hg19:g.169209405T>C	ENSP00000377344:p.Asn368Ser	738.0	1.0		669.0	256.0	NM_017631	Q6PK35|Q9NVE3	Missense_Mutation	SNP	ENST00000393743.3	hg19	CCDS34097.1	.	.	.	.	.	.	.	.	.	.	T	17.68	3.450481	0.63290	.	.	ENSG00000137628	ENST00000393743	T	0.20069	2.1	4.86	4.86	0.63082	.	0.282994	0.29964	N	0.010753	T	0.26593	0.0650	M	0.66939	2.045	0.33731	D	0.618275	P	0.48911	0.917	B	0.43950	0.437	T	0.43294	-0.9400	10	0.25751	T	0.34	.	13.7386	0.62833	0.0:0.0:0.0:1.0	.	368	Q8IY21	DDX60_HUMAN	S	368	ENSP00000377344:N368S	ENSP00000377344:N368S	N	-	2	0	DDX60	169445980	0.995000	0.38212	0.999000	0.59377	0.984000	0.73092	2.990000	0.49401	1.959000	0.56917	0.377000	0.23210	AAT	.	.		0.259	DDX60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364622.1	NM_017631	
BRD9	65980	hgsc.bcm.edu	37	5	892720	892720	+	Splice_Site	SNP	C	C	T			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr5:892720C>T	ENST00000467963.1	-	1	219		c.e1+1		BRD9_ENST00000435709.2_5'Flank|BRD9_ENST00000388890.4_5'Flank|BRD9_ENST00000483173.1_5'Flank|BRD9_ENST00000323510.4_5'Flank|TRIP13_ENST00000166345.3_5'Flank	NM_023924.4	NP_076413.3	Q9H8M2	BRD9_HUMAN	bromodomain containing 9						chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		lysine-acetylated histone binding (GO:0070577)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|pancreas(1)|prostate(3)	29			Epithelial(17;0.00202)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00815)|Lung(60;0.185)			CGCCGCCTCACCCTCGTAGGA	0.761																																					.		Atlas-SNP	.											.	BRD9	113	.	0			c.52+1G>A						.						6.0	8.0	7.0					5																	892720		658	1547	2205	SO:0001630	splice_region_variant	65980	exon2			GCCTCACCCTCGT	AK023503	CCDS34127.1, CCDS34128.1, CCDS34127.2, CCDS34128.2	5p15.33	2008-02-05			ENSG00000028310	ENSG00000028310			25818	protein-coding gene	gene with protein product						12477932	Standard	NM_023924		Approved	FLJ13441	uc003jbq.3	Q9H8M2	OTTHUMG00000159258	ENST00000467963.1:c.52+1G>A	chr5.hg19:g.892720C>T		89.0	0.0		198.0	8.0	NM_023924	A6NFY8|B4DMQ2|B4DR93|Q2XUS1|Q6UWU9|Q8IUS4|Q9H5Q5|Q9H7R9	Splice_Site	SNP	ENST00000467963.1	hg19	CCDS34127.2	.	.	.	.	.	.	.	.	.	.	C	10.38	1.333052	0.24167	.	.	ENSG00000028310	ENST00000467963	.	.	.	3.21	2.3	0.28687	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.0584	0.42259	0.0:0.7918:0.2082:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	BRD9	945720	1.000000	0.71417	0.922000	0.36590	0.954000	0.61252	2.642000	0.46596	0.645000	0.30675	0.591000	0.81541	.	.	.		0.761	BRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354113.1	NM_023924	Intron
TRIP13	9319	hgsc.bcm.edu	37	5	912081	912081	+	Silent	SNP	C	C	T			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr5:912081C>T	ENST00000166345.3	+	10	1346	c.990C>T	c.(988-990)atC>atT	p.I330I		NM_004237.3	NP_004228.1	Q15645	PCH2_HUMAN	thyroid hormone receptor interactor 13	330					double-strand break repair (GO:0006302)|female meiosis I (GO:0007144)|male meiosis I (GO:0007141)|oocyte maturation (GO:0001556)|oogenesis (GO:0048477)|reciprocal meiotic recombination (GO:0007131)|regulation of RNA biosynthetic process (GO:2001141)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)|transcription from RNA polymerase II promoter (GO:0006366)	male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)	ATP binding (GO:0005524)|transcription cofactor activity (GO:0003712)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	18			Epithelial(17;0.00147)|OV - Ovarian serous cystadenocarcinoma(19;0.00271)|all cancers(22;0.00622)|Lung(60;0.165)			TCTTCAAAATCTACCTCTCTT	0.408																																					p.I330I		Atlas-SNP	.											.	TRIP13	41	.	0			c.C990T						.						170.0	148.0	155.0					5																	912081		2203	4300	6503	SO:0001819	synonymous_variant	9319	exon10			CAAAATCTACCTC	L40384	CCDS3858.1	5p15	2010-04-21			ENSG00000071539	ENSG00000071539		"""ATPases / AAA-type"""	12307	protein-coding gene	gene with protein product	"""thyroid receptor interacting protein 13"""	604507				7776974	Standard	NM_004237		Approved	16E1BP	uc003jbr.3	Q15645	OTTHUMG00000090349	ENST00000166345.3:c.990C>T	chr5.hg19:g.912081C>T		99.0	0.0		200.0	25.0	NM_004237	C9K0T3|D3DTC0|O15324	Silent	SNP	ENST00000166345.3	hg19	CCDS3858.1																																																																																			.	.		0.408	TRIP13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206721.2	NM_004237	
TERT	7015	hgsc.bcm.edu	37	5	1294294	1294294	+	Missense_Mutation	SNP	T	T	G			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr5:1294294T>G	ENST00000310581.5	-	2	764	c.707A>C	c.(706-708)aAg>aCg	p.K236T	TERT_ENST00000334602.6_Missense_Mutation_p.K236T|TERT_ENST00000508104.2_Missense_Mutation_p.K236T|TERT_ENST00000296820.5_Missense_Mutation_p.K236T|TERT_ENST00000522877.1_5'Flank	NM_001193376.1|NM_198253.2	NP_001180305.1|NP_937983.2	O14746	TERT_HUMAN	telomerase reverse transcriptase	236	Linker.				DNA strand elongation (GO:0022616)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|replicative senescence (GO:0090399)|telomere formation via telomerase (GO:0032203)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|telomerase holoenzyme complex (GO:0005697)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|telomerase activity (GO:0003720)|telomeric DNA binding (GO:0042162)|telomeric RNA binding (GO:0070034)|telomeric template RNA reverse transcriptase activity (GO:0003721)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|kidney(4)|large_intestine(3)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	41	all_cancers(3;3.17e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.87e-10)		Epithelial(17;0.00105)|all cancers(22;0.00178)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)		Zidovudine(DB00495)	CCTGGGCCTCTTGGGCAACGG	0.751									TERT Mutation-Associated Haematological Disorders;Pulmonary Fibrosis, Idiopathic;Congenital Dyskeratosis																												p.K236T		Atlas-SNP	.											.	TERT	2594	.	0			c.A707C						.						7.0	8.0	8.0					5																	1294294		2142	4134	6276	SO:0001583	missense	7015	exon2	Familial Cancer Database	;Hamman-Rich syndrome, Fibrocystic Pulmonary Dysplasia;Zinsser-Engman-Cole syndrome, Dyskeratosis Congenita	GGCCTCTTGGGCA	AF015950	CCDS3861.2, CCDS54831.1	5p15.33	2014-09-17			ENSG00000164362	ENSG00000164362			11730	protein-coding gene	gene with protein product		187270				9252327	Standard	NM_198253		Approved	TRT, TP2, TCS1, hEST2, EST2	uc003jcb.1	O14746	OTTHUMG00000090357	ENST00000310581.5:c.707A>C	chr5.hg19:g.1294294T>G	ENSP00000309572:p.Lys236Thr	338.0	2.0		743.0	544.0	NM_001193376	O14783|Q2XS35|Q8N6C3|Q8NG38|Q8NG46	Missense_Mutation	SNP	ENST00000310581.5	hg19	CCDS3861.2	.	.	.	.	.	.	.	.	.	.	T	13.41	2.229911	0.39399	.	.	ENSG00000164362	ENST00000310581;ENST00000296820;ENST00000334602;ENST00000508104	D;D;D;D	0.97232	-4.27;-4.3;-4.2;-4.3	3.34	3.34	0.38264	.	0.400740	0.23504	N	0.047464	D	0.95153	0.8429	M	0.66939	2.045	0.35939	D	0.833101	P;P;P	0.40332	0.713;0.59;0.59	B;B;B	0.40410	0.328;0.176;0.176	D	0.95694	0.8743	10	0.66056	D	0.02	-25.129	7.0682	0.25164	0.0:0.0:0.2311:0.7689	.	236;236;236	O14746-3;O14746;Q8NG38	.;TERT_HUMAN;.	T	236	ENSP00000309572:K236T;ENSP00000296820:K236T;ENSP00000334346:K236T;ENSP00000426042:K236T	ENSP00000296820:K236T	K	-	2	0	TERT	1347294	0.014000	0.17966	0.393000	0.26258	0.059000	0.15707	0.559000	0.23485	1.476000	0.48215	0.379000	0.24179	AAG	.	.		0.751	TERT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206729.2		
OSMR	9180	hgsc.bcm.edu	37	5	38921880	38921880	+	Silent	SNP	C	C	T			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr5:38921880C>T	ENST00000274276.3	+	12	2151	c.1749C>T	c.(1747-1749)agC>agT	p.S583S		NM_003999.2	NP_003990.1	Q99650	OSMR_HUMAN	oncostatin M receptor	583	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	oncostatin-M receptor complex (GO:0005900)	growth factor binding (GO:0019838)|oncostatin-M receptor activity (GO:0004924)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(8)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	46	all_lung(31;0.000365)					ATACCACAAGCACAGTCATTA	0.443																																					p.S583S		Atlas-SNP	.											.	OSMR	133	.	0			c.C1749T						.						174.0	160.0	165.0					5																	38921880		2203	4300	6503	SO:0001819	synonymous_variant	9180	exon12			CACAAGCACAGTC	U60805	CCDS3928.1, CCDS54847.1	5p13.2	2013-02-11			ENSG00000145623	ENSG00000145623		"""Fibronectin type III domain containing"""	8507	protein-coding gene	gene with protein product		601743				8999038	Standard	NM_001168355		Approved	OSMRB	uc003jln.2	Q99650	OTTHUMG00000090811	ENST00000274276.3:c.1749C>T	chr5.hg19:g.38921880C>T		175.0	0.0		155.0	75.0	NM_003999	Q6P4E8|Q96QJ6	Silent	SNP	ENST00000274276.3	hg19	CCDS3928.1																																																																																			.	.		0.443	OSMR-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000207609.2	NM_003999	
MRPS30	10884	hgsc.bcm.edu	37	5	44809645	44809645	+	Missense_Mutation	SNP	C	C	T			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr5:44809645C>T	ENST00000507110.1	+	1	619	c.581C>T	c.(580-582)gCc>gTc	p.A194V	RP11-53O19.1_ENST00000508945.1_RNA|RP11-53O19.1_ENST00000508123.1_RNA|RP11-53O19.1_ENST00000514597.1_RNA|RP11-53O19.1_ENST00000503179.1_RNA|RP11-53O19.1_ENST00000503452.1_RNA|RP11-53O19.1_ENST00000505401.1_RNA|RP11-53O19.1_ENST00000505637.1_RNA|RP11-53O19.1_ENST00000505302.1_RNA	NM_016640.3	NP_057724.2	Q9NP92	RT30_HUMAN	mitochondrial ribosomal protein S30	194					apoptotic process (GO:0006915)|translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(2)|lung(11)|prostate(1)	20	Lung NSC(6;8.08e-07)					CACAACCCGGCCCTGGCCGCT	0.642																																					p.A194V		Atlas-SNP	.											.	MRPS30	90	.	0			c.C581T						.						35.0	42.0	39.0					5																	44809645		2182	4272	6454	SO:0001583	missense	10884	exon1			ACCCGGCCCTGGC	AF146192	CCDS3951.1	5q11	2012-09-13		2001-11-09	ENSG00000112996	ENSG00000112996		"""Mitochondrial ribosomal proteins / small subunits"""	8769	protein-coding gene	gene with protein product		611991		PDCD9		10640817, 11279123	Standard	NM_016640		Approved	PAP	uc003joh.3	Q9NP92	OTTHUMG00000096967	ENST00000507110.1:c.581C>T	chr5.hg19:g.44809645C>T	ENSP00000424328:p.Ala194Val	125.0	0.0		120.0	52.0	NM_016640	Q96I91|Q96Q19|Q9H0P8|Q9NSF9|Q9NZ76	Missense_Mutation	SNP	ENST00000507110.1	hg19	CCDS3951.1	.	.	.	.	.	.	.	.	.	.	C	6.515	0.463283	0.12402	.	.	ENSG00000112996	ENST00000507110	T	0.17054	2.3	4.89	-5.07	0.02938	.	1.231740	0.05330	N	0.528128	T	0.04907	0.0132	N	0.00972	-1.085	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.44190	-0.9344	10	0.10377	T	0.69	-0.9645	10.8884	0.46981	0.0:0.167:0.1097:0.7233	.	194	Q9NP92	RT30_HUMAN	V	194	ENSP00000424328:A194V	ENSP00000424328:A194V	A	+	2	0	MRPS30	44845402	0.000000	0.05858	0.003000	0.11579	0.465000	0.32709	-0.950000	0.03889	-0.904000	0.03876	-0.254000	0.11334	GCC	.	.		0.642	MRPS30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214033.2	NM_016640	
GZMK	3003	hgsc.bcm.edu	37	5	54320628	54320628	+	Nonsense_Mutation	SNP	C	C	T			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr5:54320628C>T	ENST00000231009.2	+	2	275	c.205C>T	c.(205-207)Caa>Taa	p.Q69*	CTD-2313F11.1_ENST00000608929.1_RNA|CTD-2313F11.1_ENST00000596137.1_RNA|ESM1_ENST00000598310.1_5'Flank|CTD-2313F11.1_ENST00000595218.1_RNA|CTD-2313F11.1_ENST00000371487.3_RNA|CTD-2313F11.1_ENST00000609699.1_RNA|CTD-2313F11.1_ENST00000607910.1_RNA|CTD-2313F11.1_ENST00000608466.1_RNA|CTD-2313F11.1_ENST00000596909.2_RNA	NM_002104.2	NP_002095.1	P49863	GRAK_HUMAN	granzyme K (granzyme 3; tryptase II)	69	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(4)	15		Lung NSC(810;4.08e-05)|Breast(144;0.0433)|Prostate(74;0.183)				AGCCCACTGCCAATATCGGTG	0.458																																					p.Q69X		Atlas-SNP	.											.	GZMK	39	.	0			c.C205T						.						47.0	49.0	48.0					5																	54320628		2203	4300	6503	SO:0001587	stop_gained	3003	exon2			CACTGCCAATATC	BC035802	CCDS3964.1	5q11.2	2008-05-15	2005-08-17		ENSG00000113088	ENSG00000113088			4711	protein-coding gene	gene with protein product		600784	"""granzyme K (serine protease, granzyme 3; tryptase II)"""			7758581	Standard	NM_002104		Approved	TRYP2, PRSS	uc003jpl.1	P49863	OTTHUMG00000097009	ENST00000231009.2:c.205C>T	chr5.hg19:g.54320628C>T	ENSP00000231009:p.Gln69*	109.0	0.0		86.0	27.0	NM_002104	B2R563	Nonsense_Mutation	SNP	ENST00000231009.2	hg19	CCDS3964.1	.	.	.	.	.	.	.	.	.	.	c	15.41	2.826578	0.50739	.	.	ENSG00000113088	ENST00000231009	.	.	.	4.55	-0.331	0.12679	.	1.286500	0.05059	N	0.479504	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	.	3.4567	0.07518	0.4411:0.2962:0.0:0.2627	.	.	.	.	X	69	.	ENSP00000231009:Q69X	Q	+	1	0	GZMK	54356385	0.001000	0.12720	0.021000	0.16686	0.012000	0.07955	-0.894000	0.04123	-0.079000	0.12707	-0.903000	0.02851	CAA	.	.		0.458	GZMK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214098.1	NM_002104	
ANKHD1	54882	hgsc.bcm.edu	37	5	139908468	139908468	+	Silent	SNP	G	G	A			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr5:139908468G>A	ENST00000360839.2	+	29	6091	c.5937G>A	c.(5935-5937)gtG>gtA	p.V1979V	ANKHD1_ENST00000297183.6_Silent_p.V1979V|ANKHD1-EIF4EBP3_ENST00000532219.1_Silent_p.V1979V|ANKHD1_ENST00000544120.1_Silent_p.V362V|SNORD45_ENST00000363181.1_RNA	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	1979	Ser-rich.					cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTTCTTCTGTGACAAGCACTT	0.493																																					p.V1979V		Atlas-SNP	.											.	ANKHD1	233	.	0			c.G5937A						.						156.0	153.0	154.0					5																	139908468		2203	4300	6503	SO:0001819	synonymous_variant	54882	exon29			TTCTGTGACAAGC	AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.5937G>A	chr5.hg19:g.139908468G>A		49.0	0.0		27.0	22.0	NM_017747	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Silent	SNP	ENST00000360839.2	hg19	CCDS4225.1	.	.	.	.	.	.	.	.	.	.	G	2.662	-0.279626	0.05642	.	.	ENSG00000131503	ENST00000435794;ENST00000432301	.	.	.	5.3	4.43	0.53597	.	.	.	.	.	T	0.69708	0.3141	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68689	-0.5342	4	.	.	.	.	13.8855	0.63706	0.0736:0.0:0.9264:0.0	.	.	.	.	N	470;430	.	.	D	+	1	0	ANKHD1	139888652	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	2.506000	0.45433	1.247000	0.43917	-0.142000	0.14014	GAC	.	.		0.493	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251672.1	NM_017747	
HAVCR1	26762	hgsc.bcm.edu	37	5	156482260	156482260	+	Missense_Mutation	SNP	C	C	T			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr5:156482260C>T	ENST00000339252.3	-	2	863	c.331G>A	c.(331-333)Ggg>Agg	p.G111R	HAVCR1_ENST00000523175.1_Missense_Mutation_p.G111R|HAVCR1_ENST00000522693.1_Missense_Mutation_p.G111R|HAVCR1_ENST00000425854.1_Missense_Mutation_p.G111R|HAVCR1_ENST00000544197.1_Missense_Mutation_p.G111R	NM_012206.2	NP_036338.2	Q96D42	HAVR1_HUMAN	hepatitis A virus cellular receptor 1	0	Ig-like V-type.				viral process (GO:0016032)	integral component of membrane (GO:0016021)	virus receptor activity (GO:0001618)			endometrium(3)|large_intestine(2)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TTGAACCACCCACGGTGCTCA	0.408																																					p.G111R		Atlas-SNP	.											.	HAVCR1	84	.	0			c.G331A						.						91.0	79.0	83.0					5																	156482260		1981	4175	6156	SO:0001583	missense	26762	exon3			ACCACCCACGGTG	AF043724	CCDS43392.1	5q33.2	2014-01-14			ENSG00000113249	ENSG00000113249		"""Immunoglobulin superfamily / V-set domain containing"""	17866	protein-coding gene	gene with protein product	"""T-cell immunoglobulin mucin family member 1"""	606518				9658108, 11725301	Standard	NM_012206		Approved	HAVCR-1, TIM-1, TIM1, HAVCR, TIMD1	uc021ygj.1	Q96D42	OTTHUMG00000163466	ENST00000339252.3:c.331G>A	chr5.hg19:g.156482260C>T	ENSP00000344844:p.Gly111Arg	118.0	0.0		94.0	29.0	NM_001099414	O43656	Missense_Mutation	SNP	ENST00000339252.3	hg19	CCDS43392.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.063285	0.76187	.	.	ENSG00000113249	ENST00000522693;ENST00000523175;ENST00000339252;ENST00000425854;ENST00000544197;ENST00000518745	T;T;T;T;T;T	0.58797	0.31;0.31;0.31;0.31;0.31;0.31	5.78	5.78	0.91487	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.82508	0.5052	M	0.92459	3.31	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.85830	0.1391	10	0.66056	D	0.02	-26.0765	18.7919	0.91976	0.0:1.0:0.0:0.0	.	111;111	F1CME6;Q96D42	.;HAVR1_HUMAN	R	111	ENSP00000428524:G111R;ENSP00000427898:G111R;ENSP00000344844:G111R;ENSP00000403333:G111R;ENSP00000440258:G111R;ENSP00000428422:G111R	ENSP00000344844:G111R	G	-	1	0	HAVCR1	156414838	0.783000	0.28701	0.368000	0.25939	0.345000	0.29048	2.404000	0.44539	2.729000	0.93468	0.650000	0.86243	GGG	.	.		0.408	HAVCR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373698.1		
FAM184A	79632	hgsc.bcm.edu	37	6	119297186	119297186	+	Missense_Mutation	SNP	G	G	A			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr6:119297186G>A	ENST00000338891.7	-	12	2922	c.2479C>T	c.(2479-2481)Cat>Tat	p.H827Y	FAM184A_ENST00000521531.1_Missense_Mutation_p.H827Y|RP11-351A11.1_ENST00000518570.1_RNA|FAM184A_ENST00000368475.4_Missense_Mutation_p.H707Y|FAM184A_ENST00000352896.5_Missense_Mutation_p.H707Y	NM_024581.4	NP_078857.5	Q8NB25	F184A_HUMAN	family with sequence similarity 184, member A	827						extracellular space (GO:0005615)				breast(2)|central_nervous_system(2)|endometrium(2)|kidney(5)|large_intestine(19)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(5)	52						GCATGTTGATGGTTGAGTTCT	0.348																																					p.H827Y		Atlas-SNP	.											.	FAM184A	109	.	0			c.C2479T						.						92.0	84.0	87.0					6																	119297186		1867	4109	5976	SO:0001583	missense	79632	exon12			GTTGATGGTTGAG	BC009055	CCDS43499.1, CCDS43500.1, CCDS75508.1	6q22.31	2008-08-14	2008-08-14	2008-08-14	ENSG00000111879	ENSG00000111879			20991	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 60"""	C6orf60		11230166	Standard	NM_024581		Approved	FLJ13942	uc003pyj.3	Q8NB25	OTTHUMG00000015471	ENST00000338891.7:c.2479C>T	chr6.hg19:g.119297186G>A	ENSP00000342604:p.His827Tyr	46.0	0.0		46.0	15.0	NM_024581	B9DI75|F8W8D6|Q5TBS9|Q7Z323|Q96GY8|Q9H0J8|Q9H851	Missense_Mutation	SNP	ENST00000338891.7	hg19	CCDS43499.1	.	.	.	.	.	.	.	.	.	.	G	17.06	3.292181	0.59976	.	.	ENSG00000111879	ENST00000338891;ENST00000352896;ENST00000368475;ENST00000521531	T;T;T;T	0.27256	2.41;2.35;1.7;1.68	5.21	5.21	0.72293	.	0.105878	0.64402	D	0.000005	T	0.21718	0.0523	M	0.69823	2.125	0.80722	D	1	B;B;B	0.31040	0.305;0.176;0.108	B;B;B	0.33960	0.112;0.09;0.173	T	0.03619	-1.1019	9	.	.	.	-6.4031	18.7445	0.91787	0.0:0.0:1.0:0.0	.	827;707;827	Q8NB25-2;F8W8D6;Q8NB25	.;.;F184A_HUMAN	Y	827;707;707;827	ENSP00000342604:H827Y;ENSP00000326608:H707Y;ENSP00000357460:H707Y;ENSP00000430442:H827Y	.	H	-	1	0	FAM184A	119338885	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	7.163000	0.77524	2.437000	0.82529	0.563000	0.77884	CAT	.	.		0.348	FAM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042009.3	NM_024581	
FUT10	84750	hgsc.bcm.edu	37	8	33318937	33318937	+	Missense_Mutation	SNP	A	A	G			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr8:33318937A>G	ENST00000327671.5	-	2	665	c.34T>C	c.(34-36)Tct>Cct	p.S12P	FUT10_ENST00000524021.1_5'UTR|FUT10_ENST00000518672.1_Intron|FUT10_ENST00000335589.3_5'UTR	NM_032664.3	NP_116053.3	Q6P4F1	FUT10_HUMAN	fucosyltransferase 10 (alpha (1,3) fucosyltransferase)	12					embryo development (GO:0009790)|fertilization (GO:0009566)|fucosylation (GO:0036065)|hemopoiesis (GO:0030097)|L-fucose catabolic process (GO:0042355)|nervous system development (GO:0007399)|protein folding (GO:0006457)|protein glycosylation (GO:0006486)|protein targeting (GO:0006605)|wound healing (GO:0042060)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)			cervix(1)|endometrium(1)|large_intestine(7)|liver(1)|lung(9)|ovary(1)|pancreas(1)|prostate(3)|stomach(3)|upper_aerodigestive_tract(2)	29				KIRC - Kidney renal clear cell carcinoma(67;0.129)|Kidney(114;0.154)		CACAGGCAAGATGCCAAAAGC	0.557																																					p.S12P		Atlas-SNP	.											.	FUT10	62	.	0			c.T34C						.						197.0	140.0	159.0					8																	33318937		2203	4300	6503	SO:0001583	missense	84750	exon2			GGCAAGATGCCAA	AJ512465	CCDS6088.1	8p12	2013-02-26			ENSG00000172728	ENSG00000172728		"""Fucosyltransferases"""	19234	protein-coding gene	gene with protein product							Standard	NM_032664		Approved		uc003xje.3	Q6P4F1	OTTHUMG00000163954	ENST00000327671.5:c.34T>C	chr8.hg19:g.33318937A>G	ENSP00000332757:p.Ser12Pro	57.0	0.0		23.0	15.0	NM_032664	A8KAC8|Q70GG3|Q8IVI6|Q8IVI7|Q8IVJ3|Q8TE43|Q9BSR3	Missense_Mutation	SNP	ENST00000327671.5	hg19	CCDS6088.1	.	.	.	.	.	.	.	.	.	.	A	14.06	2.423874	0.43020	.	.	ENSG00000172728	ENST00000327671;ENST00000380081	T	0.39997	1.05	5.79	4.61	0.57282	.	3.111010	0.00963	N	0.003130	T	0.46889	0.1416	M	0.62723	1.935	0.80722	D	1	B;B;B	0.13145	0.007;0.003;0.004	B;B;B	0.14578	0.006;0.006;0.011	T	0.13388	-1.0511	10	0.33940	T	0.23	.	10.0117	0.41990	0.8302:0.1698:0.0:0.0	.	12;12;12	B4DLS4;Q6P4F1-5;Q6P4F1	.;.;FUT10_HUMAN	P	12	ENSP00000332757:S12P	ENSP00000332757:S12P	S	-	1	0	FUT10	33438479	1.000000	0.71417	0.951000	0.38953	0.951000	0.60555	3.848000	0.55903	1.016000	0.39470	0.524000	0.50904	TCT	.	.		0.557	FUT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376540.1	NM_032664	
RB1CC1	9821	hgsc.bcm.edu	37	8	53573155	53573155	+	Splice_Site	SNP	C	C	T			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr8:53573155C>T	ENST00000025008.5	-	12	2213		c.e12+1		RB1CC1_ENST00000539297.1_Splice_Site|RB1CC1_ENST00000521611.1_Intron|RB1CC1_ENST00000435644.2_Splice_Site	NM_014781.4	NP_055596.3	Q8TDY2	RBCC1_HUMAN	RB1-inducible coiled-coil 1						autophagic vacuole assembly (GO:0000045)|cell cycle (GO:0007049)|heart development (GO:0007507)|JNK cascade (GO:0007254)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell size (GO:0045793)|positive regulation of protein phosphorylation (GO:0001934)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)				NS(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(19)|ovary(8)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	60		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				TAAATACATACACAAAAGGAA	0.333																																					.	GBM(180;1701 2102 13475 42023 52570)	Atlas-SNP	.											.	RB1CC1	163	.	0			c.1689+1G>A						.						40.0	47.0	45.0					8																	53573155		2201	4294	6495	SO:0001630	splice_region_variant	9821	exon13			TACATACACAAAA	AB059622	CCDS34892.1, CCDS47856.1	8q11	2014-06-13				ENSG00000023287			15574	protein-coding gene	gene with protein product	"""200 kDa FAK family kinase-interacting protein"", ""phosphatase 1, regulatory subunit 131"""	606837				11850849, 7724523, 18443221	Standard	NM_014781		Approved	KIAA0203, Cc1, DRAGOU14, FIP200, ATG17, PPP1R131	uc003xre.4	Q8TDY2		ENST00000025008.5:c.1689+1G>A	chr8.hg19:g.53573155C>T		515.0	0.0		294.0	205.0	NM_014781	Q86YR4|Q8WVU9|Q92601	Splice_Site	SNP	ENST00000025008.5	hg19	CCDS34892.1	.	.	.	.	.	.	.	.	.	.	C	18.68	3.676302	0.67928	.	.	ENSG00000023287	ENST00000025008;ENST00000435644;ENST00000539297	.	.	.	5.2	4.31	0.51392	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9447	0.71020	0.0:0.8557:0.1443:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RB1CC1	53735708	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	5.342000	0.65970	1.302000	0.44855	0.460000	0.39030	.	.	.		0.333	RB1CC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378011.1	NM_014781	Intron
FOCAD	54914	hgsc.bcm.edu	37	9	20986401	20986401	+	Missense_Mutation	SNP	G	G	T	rs376770371		TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr9:20986401G>T	ENST00000380249.1	+	42	5207	c.4843G>T	c.(4843-4845)Gtg>Ttg	p.V1615L	FOCAD_ENST00000605086.1_Missense_Mutation_p.V1051L|FOCAD_ENST00000338382.6_Missense_Mutation_p.V1615L	NM_017794.3	NP_060264.3	Q5VW36	FOCAD_HUMAN	focadhesin	1615						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)											TGAGAAAGAGGTGTTGGCCTG	0.517																																					p.V1615L		Atlas-SNP	.											.	.	.	.	0			c.G4843T						.						134.0	100.0	111.0					9																	20986401		2203	4300	6503	SO:0001583	missense	54914	exon42			AAAGAGGTGTTGG	AB058700	CCDS34993.1	9p21	2012-03-23	2012-03-23	2012-03-23	ENSG00000188352	ENSG00000188352			23377	protein-coding gene	gene with protein product		614606	"""KIAA1797"""	KIAA1797		22427331	Standard	XM_006716794		Approved	FLJ20375	uc003zog.1	Q5VW36	OTTHUMG00000066930	ENST00000380249.1:c.4843G>T	chr9.hg19:g.20986401G>T	ENSP00000369599:p.Val1615Leu	47.0	0.0		42.0	15.0	NM_017794	D3DRJ9|Q6ZME1|Q8IZG0|Q96JM8|Q96MS9|Q9BVF3|Q9NX87	Missense_Mutation	SNP	ENST00000380249.1	hg19	CCDS34993.1	.	.	.	.	.	.	.	.	.	.	G	8.894	0.954781	0.18431	.	.	ENSG00000188352	ENST00000380249;ENST00000338382	T;T	0.18657	2.2;2.2	5.72	-5.02	0.02982	.	0.403128	0.27168	N	0.020605	T	0.05960	0.0155	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.21211	-1.0252	10	0.18710	T	0.47	-26.0131	2.003	0.03471	0.3732:0.1014:0.329:0.1964	.	1615	Q5VW36	K1797_HUMAN	L	1615	ENSP00000369599:V1615L;ENSP00000344307:V1615L	ENSP00000344307:V1615L	V	+	1	0	KIAA1797	20976401	0.050000	0.20438	0.000000	0.03702	0.836000	0.47400	-0.031000	0.12287	-1.328000	0.02261	-1.166000	0.01754	GTG	.	.		0.517	FOCAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143442.1	NM_017794	
SVEP1	79987	hgsc.bcm.edu	37	9	113252044	113252044	+	Missense_Mutation	SNP	G	G	T			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr9:113252044G>T	ENST00000401783.2	-	9	2152	c.1816C>A	c.(1816-1818)Cat>Aat	p.H606N	SVEP1_ENST00000302728.8_Missense_Mutation_p.H606N|SVEP1_ENST00000467821.1_5'UTR|SVEP1_ENST00000374469.1_Missense_Mutation_p.H583N|SVEP1_ENST00000374461.1_Missense_Mutation_p.H583N	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	606	HYR 1. {ECO:0000255|PROSITE- ProRule:PRU00113}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						AAAGCTGGATGAACGTGGACT	0.388																																					p.H606N		Atlas-SNP	.											.	SVEP1	326	.	0			c.C1816A						.						160.0	154.0	156.0					9																	113252044		1929	4141	6070	SO:0001583	missense	79987	exon9			CTGGATGAACGTG	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.1816C>A	chr9.hg19:g.113252044G>T	ENSP00000384917:p.His606Asn	121.0	0.0		132.0	39.0	NM_153366	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	hg19	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	G	9.930	1.214531	0.22289	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000302728;ENST00000374461	T;T;T;T	0.21031	2.03;2.03;2.03;2.03	4.85	2.8	0.32819	Hyalin (2);	0.297330	0.34676	N	0.003767	T	0.08403	0.0209	N	0.05124	-0.11	0.25917	N	0.983168	B;B;B	0.27625	0.183;0.116;0.095	B;B;B	0.27887	0.084;0.054;0.032	T	0.27020	-1.0086	10	0.23302	T	0.38	.	5.7906	0.18359	0.1069:0.0:0.4527:0.4404	.	606;606;606	E9PBN8;Q4LDE5;Q4LDE5-2	.;SVEP1_HUMAN;.	N	606;583;606;583	ENSP00000384917:H606N;ENSP00000363593:H583N;ENSP00000304118:H606N;ENSP00000363585:H583N	ENSP00000304118:H606N	H	-	1	0	SVEP1	112291865	1.000000	0.71417	0.757000	0.31301	0.733000	0.41908	3.422000	0.52749	1.045000	0.40225	0.563000	0.77884	CAT	.	.		0.388	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
BRINP1	1620	hgsc.bcm.edu	37	9	121929597	121929597	+	Missense_Mutation	SNP	C	C	T			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr9:121929597C>T	ENST00000265922.3	-	8	2512	c.2051G>A	c.(2050-2052)gGc>gAc	p.G684D	BRINP1_ENST00000482797.1_Intron	NM_014618.2	NP_055433.2	O60477	BRNP1_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 1	684					cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell cycle (GO:0045786)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	cytoplasm (GO:0005737)		p.G684D(1)|p.G684V(1)									ATAGAACTGGCCGCCCTGTGT	0.577																																					p.G684D		Atlas-SNP	.											DBC1,brain,glioma,0,2	DBC1	194	.	2	Substitution - Missense(2)	lung(1)|central_nervous_system(1)	c.G2051A						.						144.0	137.0	139.0					9																	121929597		2203	4300	6503	SO:0001583	missense	1620	exon8			AACTGGCCGCCCT	AF027734	CCDS6822.1	9q32-q33	2013-08-06	2013-08-06	2013-07-31	ENSG00000078725	ENSG00000078725			2687	protein-coding gene	gene with protein product		602865	"""deleted in bladder cancer chromosome region candidate 1"", ""deleted in bladder cancer 1"""	DBCCR1, DBC1		9175739, 10444335, 15193422	Standard	NM_014618		Approved	FAM5A	uc004bkc.2	O60477	OTTHUMG00000021020	ENST00000265922.3:c.2051G>A	chr9.hg19:g.121929597C>T	ENSP00000265922:p.Gly684Asp	151.0	0.0		163.0	8.0	NM_014618	Q6IPV6|Q6P1A0|Q8WU22	Missense_Mutation	SNP	ENST00000265922.3	hg19	CCDS6822.1	.	.	.	.	.	.	.	.	.	.	C	9.952	1.220446	0.22457	.	.	ENSG00000078725	ENST00000373969;ENST00000265922	T	0.13420	2.59	5.73	4.84	0.62591	.	0.158127	0.56097	N	0.000025	T	0.10637	0.0260	N	0.22421	0.69	0.50813	D	0.999896	B	0.06786	0.001	B	0.04013	0.001	T	0.10800	-1.0614	10	0.28530	T	0.3	-25.2604	14.8292	0.70135	0.0:0.9312:0.0:0.0688	.	684	O60477	DBC1_HUMAN	D	684	ENSP00000265922:G684D	ENSP00000265922:G684D	G	-	2	0	DBC1	120969418	0.996000	0.38824	0.997000	0.53966	0.985000	0.73830	2.512000	0.45485	1.577000	0.49804	0.650000	0.86243	GGC	.	.		0.577	BRINP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055440.2	NM_014618	
MEGF9	1955	hgsc.bcm.edu	37	9	123370235	123370235	+	Missense_Mutation	SNP	G	G	C			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr9:123370235G>C	ENST00000373930.3	-	5	1252	c.1141C>G	c.(1141-1143)Ccg>Gcg	p.P381A	MEGF9_ENST00000426959.1_Missense_Mutation_p.P418A	NM_001080497.2	NP_001073966.2	Q9H1U4	MEGF9_HUMAN	multiple EGF-like-domains 9	381	Laminin EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00460}.					integral component of membrane (GO:0016021)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(9)|upper_aerodigestive_tract(1)	16						TTGCAGTTCGGGCCTATGTAA	0.393																																					p.P381A		Atlas-SNP	.											.	MEGF9	33	.	0			c.C1141G						.						134.0	126.0	128.0					9																	123370235		1889	4106	5995	SO:0001583	missense	1955	exon5			AGTTCGGGCCTAT	AB011542	CCDS48010.1, CCDS48010.2	9q32-q33.3	2008-07-21	2006-03-31	2006-03-31	ENSG00000106780	ENSG00000106780			3234	protein-coding gene	gene with protein product		604268	"""EGF-like-domain, multiple 5"""	EGFL5		9693030	Standard	NM_001080497		Approved		uc022bms.1	Q9H1U4	OTTHUMG00000021039	ENST00000373930.3:c.1141C>G	chr9.hg19:g.123370235G>C	ENSP00000363040:p.Pro381Ala	129.0	0.0		131.0	44.0	NM_001080497	B7Z315|O75098	Missense_Mutation	SNP	ENST00000373930.3	hg19	CCDS48010.2	.	.	.	.	.	.	.	.	.	.	G	9.138	1.012992	0.19277	.	.	ENSG00000106780	ENST00000373930;ENST00000426959	T;T	0.61040	0.14;0.14	5.23	1.96	0.26148	.	0.761100	0.11916	N	0.517196	T	0.35770	0.0943	N	0.24115	0.695	0.30392	N	0.780949	P	0.38280	0.625	B	0.34931	0.192	T	0.25606	-1.0127	10	0.13853	T	0.58	3.9453	6.9123	0.24342	0.0838:0.0:0.6122:0.3041	.	418	C9J1K8	.	A	381;418	ENSP00000363040:P381A;ENSP00000392666:P418A	ENSP00000363040:P381A	P	-	1	0	MEGF9	122410056	0.997000	0.39634	0.979000	0.43373	0.804000	0.45430	2.584000	0.46102	0.650000	0.30769	0.557000	0.71058	CCG	.	.		0.393	MEGF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055513.1	NM_001080497	
STRBP	55342	hgsc.bcm.edu	37	9	125920368	125920368	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr9:125920368T>C	ENST00000348403.5	-	11	1397	c.968A>G	c.(967-969)tAc>tGc	p.Y323C	STRBP_ENST00000447404.2_Missense_Mutation_p.Y323C|STRBP_ENST00000360998.3_Missense_Mutation_p.Y309C	NM_018387.4	NP_060857.2	Q96SI9	STRBP_HUMAN	spermatid perinuclear RNA binding protein	323	DZF. {ECO:0000255|PROSITE- ProRule:PRU01040}.				cellular component movement (GO:0006928)|mechanosensory behavior (GO:0007638)|multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(6)|prostate(1)|skin(2)	26						CAGCACTTTGTAAATCTGGCC	0.373																																					p.Y323C		Atlas-SNP	.											.	STRBP	73	.	0			c.A968G						.						115.0	115.0	115.0					9																	125920368		2203	4300	6503	SO:0001583	missense	55342	exon11			ACTTTGTAAATCT	AK002169	CCDS6851.1, CCDS55337.1	9q33.1-q33.3	2008-08-29	2001-11-28		ENSG00000165209	ENSG00000165209			16462	protein-coding gene	gene with protein product		611138	"""spermatid perinuclear RNA-binding protein"", ""interleukin enhancer binding factor 3-like"""	ILF3L			Standard	NM_018387		Approved	FLJ11307, SPNR	uc004bns.3	Q96SI9	OTTHUMG00000020636	ENST00000348403.5:c.968A>G	chr9.hg19:g.125920368T>C	ENSP00000321347:p.Tyr323Cys	85.0	0.0		68.0	21.0	NM_018387	Q32NB9|Q9BUE1|Q9BXG4|Q9H0B4|Q9H7V1|Q9NUK4	Missense_Mutation	SNP	ENST00000348403.5	hg19	CCDS6851.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.225443	0.79576	.	.	ENSG00000165209	ENST00000447404;ENST00000348403;ENST00000360998	T;T;T	0.41758	0.99;0.99;0.99	5.29	5.29	0.74685	DZF (2);	0.061386	0.64402	D	0.000002	T	0.44582	0.1300	L	0.48642	1.525	0.80722	D	1	B	0.29136	0.234	B	0.37451	0.25	T	0.46020	-0.9221	10	0.66056	D	0.02	-9.6521	15.2158	0.73264	0.0:0.0:0.0:1.0	.	323	Q96SI9	STRBP_HUMAN	C	323;323;309	ENSP00000415968:Y323C;ENSP00000321347:Y323C;ENSP00000354271:Y309C	ENSP00000321347:Y323C	Y	-	2	0	STRBP	124960189	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	5.975000	0.70475	1.993000	0.58246	0.460000	0.39030	TAC	.	.		0.373	STRBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053982.1		
TOR1B	27348	hgsc.bcm.edu	37	9	132566402	132566402	+	Missense_Mutation	SNP	G	G	C			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr9:132566402G>C	ENST00000259339.2	+	2	310	c.250G>C	c.(250-252)Gaa>Caa	p.E84Q	TOR1B_ENST00000486372.1_3'UTR	NM_014506.1	NP_055321.1	O14657	TOR1B_HUMAN	torsin family 1, member B (torsin B)	84					ATP catabolic process (GO:0006200)|chaperone mediated protein folding requiring cofactor (GO:0051085)|endoplasmic reticulum organization (GO:0007029)|nuclear membrane organization (GO:0071763)|protein homooligomerization (GO:0051260)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear envelope (GO:0005635)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			endometrium(3)|kidney(1)|large_intestine(1)|lung(7)	12		Ovarian(14;0.0586)				TCTAGCCACGGAAGTGATTTT	0.478																																					p.E84Q		Atlas-SNP	.											.	TOR1B	20	.	0			c.G250C						.						80.0	78.0	79.0					9																	132566402		2203	4300	6503	SO:0001583	missense	27348	exon2			GCCACGGAAGTGA	AF007872	CCDS6929.1	9q34	2008-07-21			ENSG00000136816	ENSG00000136816			11995	protein-coding gene	gene with protein product		608050				9288096, 10644435	Standard	NM_014506		Approved	DQ1, MGC4386	uc004byk.1	O14657	OTTHUMG00000020795	ENST00000259339.2:c.250G>C	chr9.hg19:g.132566402G>C	ENSP00000259339:p.Glu84Gln	97.0	0.0		109.0	45.0	NM_014506		Missense_Mutation	SNP	ENST00000259339.2	hg19	CCDS6929.1	.	.	.	.	.	.	.	.	.	.	G	12.25	1.880702	0.33255	.	.	ENSG00000136816	ENST00000259339;ENST00000437263	T	0.32988	1.43	5.1	4.19	0.49359	.	0.378995	0.31279	N	0.007940	T	0.19005	0.0456	N	0.25957	0.775	0.27298	N	0.957659	B	0.20459	0.045	B	0.25405	0.06	T	0.23976	-1.0173	10	0.12103	T	0.63	.	8.3606	0.32357	0.179:0.0:0.821:0.0	.	84	O14657	TOR1B_HUMAN	Q	84	ENSP00000259339:E84Q	ENSP00000259339:E84Q	E	+	1	0	TOR1B	131606223	0.692000	0.27719	0.986000	0.45419	0.987000	0.75469	1.268000	0.33062	1.132000	0.42129	0.561000	0.74099	GAA	.	.		0.478	TOR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054615.1	NM_014506	
RET	5979	hgsc.bcm.edu	37	10	43609005	43609005	+	Splice_Site	SNP	G	G	A			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr10:43609005G>A	ENST00000355710.3	+	10	1993	c.1761G>A	c.(1759-1761)cgG>cgA	p.R587R	RET_ENST00000340058.5_Splice_Site_p.R587R	NM_020975.4	NP_066124.1	P07949	RET_HUMAN	ret proto-oncogene	587		Breakpoint for translocation to form the TRIM27/RET oncogene.			activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to retinoic acid (GO:0071300)|embryonic epithelial tube formation (GO:0001838)|enteric nervous system development (GO:0048484)|homophilic cell adhesion (GO:0007156)|innervation (GO:0060384)|lymphocyte migration into lymphoid organs (GO:0097021)|MAPK cascade (GO:0000165)|membrane protein proteolysis (GO:0033619)|neural crest cell migration (GO:0001755)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch morphogenesis (GO:0061146)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration (GO:0030335)|positive regulation of cell size (GO:0045793)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior midgut development (GO:0007497)|protein phosphorylation (GO:0006468)|regulation of axonogenesis (GO:0050770)|regulation of cell adhesion (GO:0030155)|response to drug (GO:0042493)|response to pain (GO:0048265)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ureter maturation (GO:0035799)|ureteric bud development (GO:0001657)	endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		CCDC6/RET(4)|KIF5B/RET(79)	NS(2)|adrenal_gland(26)|breast(5)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|lung(27)|ovary(5)|prostate(3)|skin(1)|thyroid(504)|upper_aerodigestive_tract(1)|urinary_tract(1)	607		Ovarian(717;0.0423)			Cabozantinib(DB08875)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	TGCCCTCAGGGGGCAGCATTG	0.652		1	"""T, Mis, N, F"""	"""H4, PRKAR1A, NCOA4, PCM1, GOLGA5, TRIM33, KTN1, TRIM27, HOOK3, KIF5B, CCDC6"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma, NSCLC"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma"""	Hirschsprung disease		Multiple Endocrine Neoplasia, type 2B;Multiple Endocrine Neoplasia, type 2A;Familial Medullary Thyroid Carcinoma																												p.R587R	Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)	Atlas-SNP	.	yes	Dom	yes	Multiple endocrine neoplasia 2A/2B	10	10q11.2	5979	ret proto-oncogene	yes	"""E, O"""	.	RET	916	.	0			c.G1761A						.						16.0	18.0	17.0					10																	43609005		2199	4295	6494	SO:0001630	splice_region_variant	5979	exon10	Familial Cancer Database	MEN2B, Wagenmann-Froboese s.;MEN2A, Sipple disease, incl MEN2C;FMTC	CTCAGGGGGCAGC	BC004257	CCDS7200.1, CCDS53525.1	10q11.2	2014-09-17	2007-02-16		ENSG00000165731	ENSG00000165731		"""Cadherins / Cadherin-related"""	9967	protein-coding gene	gene with protein product	"""cadherin-related family member 16"""	164761	"""multiple endocrine neoplasia and medullary thyroid carcinoma 1"", ""Hirschsprung disease 1"""	HSCR1, MEN2A, MTC1, MEN2B		2687772, 1611909	Standard	NM_020975		Approved	PTC, CDHF12, RET51, CDHR16	uc001jal.3	P07949	OTTHUMG00000018024	ENST00000355710.3:c.1760-1G>A	chr10.hg19:g.43609005G>A		22.0	0.0		35.0	19.0	NM_020630	A8K6Z2|Q15250|Q9BTB0|Q9H4A2	Silent	SNP	ENST00000355710.3	hg19	CCDS7200.1																																																																																			.	.		0.652	RET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047694.2	NM_020975	Silent
TIAL1	7073	hgsc.bcm.edu	37	10	121339462	121339462	+	Silent	SNP	A	A	C			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr10:121339462A>C	ENST00000436547.2	-	6	476	c.432T>G	c.(430-432)tcT>tcG	p.S144S	TIAL1_ENST00000463089.2_5'Flank|TIAL1_ENST00000369093.2_Silent_p.S161S|TIAL1_ENST00000369092.4_Silent_p.S21S	NM_003252.3	NP_003243.1	Q01085	TIAR_HUMAN	TIA1 cytotoxic granule-associated RNA binding protein-like 1	144	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				apoptotic process (GO:0006915)|defense response (GO:0006952)|germ cell development (GO:0007281)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell division (GO:0017145)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(3)|ovary(1)	13		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.00239)|BRCA - Breast invasive adenocarcinoma(275;0.0932)		TGTTATAAAAAGATACAAAAC	0.333																																					p.S161S		Atlas-SNP	.											.	TIAL1	47	.	0			c.T483G						.						63.0	66.0	65.0					10																	121339462		2203	4300	6503	SO:0001819	synonymous_variant	7073	exon6			ATAAAAAGATACA	AL833106	CCDS7613.1, CCDS31295.1	10q	2013-02-12	2001-11-28		ENSG00000151923	ENSG00000151923		"""RNA binding motif (RRM) containing"""	11804	protein-coding gene	gene with protein product		603413	"""TIA1 cytotoxic granule-associated RNA-binding protein-like 1"""			1326761	Standard	XM_005270108		Approved	TIAR	uc001lej.1	Q01085	OTTHUMG00000019156	ENST00000436547.2:c.432T>G	chr10.hg19:g.121339462A>C		144.0	0.0		130.0	40.0	NM_001033925	A8K3T0|A8K4L9	Silent	SNP	ENST00000436547.2	hg19	CCDS7613.1																																																																																			.	.		0.333	TIAL1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050672.2	NM_022333, NM_003252	
SIGIRR	59307	hgsc.bcm.edu	37	11	406869	406869	+	Missense_Mutation	SNP	A	A	T			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr11:406869A>T	ENST00000431843.2	-	8	1159	c.853T>A	c.(853-855)Ttg>Atg	p.L285M	SIGIRR_ENST00000531205.1_Missense_Mutation_p.L285M|SIGIRR_ENST00000332725.3_Missense_Mutation_p.L285M|SIGIRR_ENST00000397632.3_Missense_Mutation_p.L285M|SIGIRR_ENST00000382520.2_Missense_Mutation_p.L285M|SIGIRR_ENST00000529486.1_5'Flank	NM_001135054.1	NP_001128526.1	Q6IA17	SIGIR_HUMAN	single immunoglobulin and toll-interleukin 1 receptor (TIR) domain	285	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				acute-phase response (GO:0006953)|negative regulation of chemokine biosynthetic process (GO:0045079)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				cervix(2)|endometrium(1)|liver(1)|lung(5)|prostate(2)|skin(1)|urinary_tract(1)	13		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CAGAGCAGCAAGGTCACCAGG	0.741																																					p.L285M		Atlas-SNP	.											.	SIGIRR	22	.	0			c.T853A						.						5.0	7.0	6.0					11																	406869		1994	4025	6019	SO:0001583	missense	59307	exon8			GCAGCAAGGTCAC		CCDS31325.1	11p15.5	2013-01-11	2005-10-10					"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30575	protein-coding gene	gene with protein product	"""single immunoglobulin domain IL1R1 related"""	605478				10346978	Standard	NM_021805		Approved	TIR8	uc001lpe.1	Q6IA17		ENST00000431843.2:c.853T>A	chr11.hg19:g.406869A>T	ENSP00000403104:p.Leu285Met	52.0	0.0		54.0	23.0	NM_001135053	Q3KQY2|Q6UXI3|Q9H733	Missense_Mutation	SNP	ENST00000431843.2	hg19	CCDS31325.1	.	.	.	.	.	.	.	.	.	.	a	18.97	3.734864	0.69189	.	.	ENSG00000185187	ENST00000431843;ENST00000397632;ENST00000332725;ENST00000531205;ENST00000382520;ENST00000528209	T;T;T;T;T;T	0.23950	1.88;1.88;1.88;1.88;1.88;1.88	3.42	1.04	0.20106	Toll/interleukin-1 receptor homology (TIR) domain (3);	0.321095	0.27375	N	0.019645	T	0.20088	0.0483	L	0.27053	0.805	0.34564	D	0.712687	P;P	0.48503	0.828;0.911	P;P	0.49752	0.542;0.621	T	0.23154	-1.0196	10	0.40728	T	0.16	.	5.3158	0.15854	0.3932:0.1507:0.456:0.0	.	285;285	C9JFX4;Q6IA17	.;SIGIR_HUMAN	M	285;285;285;285;285;181	ENSP00000403104:L285M;ENSP00000380756:L285M;ENSP00000333656:L285M;ENSP00000433022:L285M;ENSP00000371960:L285M;ENSP00000435135:L181M	ENSP00000333656:L285M	L	-	1	2	SIGIRR	396869	0.136000	0.22515	0.996000	0.52242	0.979000	0.70002	-0.270000	0.08584	0.352000	0.24053	0.397000	0.26171	TTG	.	.		0.741	SIGIRR-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383884.3	NM_021805	
MICAL2	9645	hgsc.bcm.edu	37	11	12281400	12281400	+	Missense_Mutation	SNP	C	C	G			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr11:12281400C>G	ENST00000256194.4	+	26	3578	c.3290C>G	c.(3289-3291)tCt>tGt	p.S1097C	MICAL2_ENST00000342902.5_Missense_Mutation_p.S1076C|RP11-265D17.2_ENST00000527288.1_RNA|MICAL2_ENST00000527546.1_Missense_Mutation_p.S907C|MICAL2_ENST00000537344.1_Missense_Mutation_p.S907C|MICAL2_ENST00000379612.3_Missense_Mutation_p.S871C	NM_001282663.1|NM_014632.2	NP_001269592.1|NP_055447.1	O94851	MICA2_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 2	1097					actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|heart development (GO:0007507)|heart looping (GO:0001947)|oxidation-reduction process (GO:0055114)|positive regulation of transcription via serum response element binding (GO:0010735)|sulfur oxidation (GO:0019417)	nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|NADPH:sulfur oxidoreductase activity (GO:0043914)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	47				Epithelial(150;0.00552)		ACCGAAAGTTCTTGCGCAGTG	0.587																																					p.S1097C		Atlas-SNP	.											.	MICAL2	114	.	0			c.C3290G						.						48.0	49.0	49.0					11																	12281400		2201	4294	6495	SO:0001583	missense	9645	exon26			AAAGTTCTTGCGC	AB018293	CCDS7809.1, CCDS60726.1, CCDS60727.1, CCDS60728.1	11p15.3	2014-08-12	2013-03-26		ENSG00000133816	ENSG00000133816			24693	protein-coding gene	gene with protein product		608881				12110185	Standard	XM_005253249		Approved	KIAA0750	uc001mjz.3	O94851	OTTHUMG00000165744	ENST00000256194.4:c.3290C>G	chr11.hg19:g.12281400C>G	ENSP00000256194:p.Ser1097Cys	258.0	0.0		224.0	76.0	NM_014632	B4DGZ0|B7Z849|D3DQW5|G3XAC8|Q5KTR3|Q5KTR4|Q7Z3A8	Missense_Mutation	SNP	ENST00000256194.4	hg19	CCDS7809.1	.	.	.	.	.	.	.	.	.	.	C	14.24	2.475762	0.44044	.	.	ENSG00000133816	ENST00000537344;ENST00000544073;ENST00000256194;ENST00000527546;ENST00000342902;ENST00000379612	T;T;T;T;T	0.62232	0.04;0.05;0.04;0.05;0.11	5.37	4.45	0.53987	.	1.018760	0.07827	N	0.960726	T	0.66187	0.2764	N	0.19112	0.55	0.26663	N	0.971875	D;D;P;D;D;D	0.69078	0.997;0.996;0.697;0.996;0.983;0.983	P;P;B;P;B;P	0.61592	0.781;0.891;0.338;0.784;0.436;0.533	T	0.60398	-0.7271	10	0.72032	D	0.01	.	13.1459	0.59461	0.0:0.9223:0.0:0.0777	.	440;1076;907;850;871;1097	B4DYS3;G3XAC8;B7Z849;Q5KTR3;Q5KTR4;O94851	.;.;.;.;.;MICA2_HUMAN	C	907;440;1097;907;1076;871	ENSP00000441689:S907C;ENSP00000256194:S1097C;ENSP00000433965:S907C;ENSP00000344894:S1076C;ENSP00000368932:S871C	ENSP00000256194:S1097C	S	+	2	0	MICAL2	12237976	0.993000	0.37304	0.996000	0.52242	0.040000	0.13550	1.488000	0.35551	2.492000	0.84095	0.591000	0.81541	TCT	.	.		0.587	MICAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385993.1	NM_014632	
SIK2	23235	hgsc.bcm.edu	37	11	111592590	111592590	+	Missense_Mutation	SNP	C	C	T			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr11:111592590C>T	ENST00000304987.3	+	13	2154	c.1981C>T	c.(1981-1983)Ctc>Ttc	p.L661F		NM_015191.1	NP_056006.1	Q9H0K1	SIK2_HUMAN	salt-inducible kinase 2	661					insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of insulin receptor signaling pathway (GO:0046626)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	30						CGTCTCCACTCTCCCTGCCAG	0.567																																					p.L661F		Atlas-SNP	.											.	SIK2	89	.	0			c.C1981T						.						72.0	68.0	70.0					11																	111592590		2201	4297	6498	SO:0001583	missense	23235	exon13			TCCACTCTCCCTG	AB018324	CCDS8347.1	11q23.1	2008-12-23	2008-12-23	2008-12-23	ENSG00000170145	ENSG00000170145			21680	protein-coding gene	gene with protein product		608973	"""SNF1-like kinase 2"""	SNF1LK2		15067358	Standard	NM_015191		Approved	KIAA0781, QIK, DKFZp434K1115, LOH11CR1I	uc001plt.3	Q9H0K1	OTTHUMG00000150644	ENST00000304987.3:c.1981C>T	chr11.hg19:g.111592590C>T	ENSP00000305976:p.Leu661Phe	52.0	0.0		45.0	15.0	NM_015191	A8K5B8|B0YJ94|O94878|Q17RV0|Q6AZE2|Q76N03|Q8NCV7|Q96CZ8	Missense_Mutation	SNP	ENST00000304987.3	hg19	CCDS8347.1	.	.	.	.	.	.	.	.	.	.	C	5.131	0.209869	0.09757	.	.	ENSG00000170145	ENST00000304987	T	0.72282	-0.64	5.89	2.53	0.30540	.	0.361014	0.32301	N	0.006285	T	0.39358	0.1075	N	0.04203	-0.255	0.24952	N	0.991789	B	0.02656	0.0	B	0.04013	0.001	T	0.20405	-1.0276	10	0.09084	T	0.74	.	5.7945	0.18379	0.0:0.4523:0.3839:0.1638	.	661	Q9H0K1	SIK2_HUMAN	F	661	ENSP00000305976:L661F	ENSP00000305976:L661F	L	+	1	0	SIK2	111097800	0.999000	0.42202	0.030000	0.17652	0.188000	0.23474	3.828000	0.55753	0.812000	0.34326	-0.302000	0.09304	CTC	.	.		0.567	SIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319352.3	NM_015191	
HMBS	3145	hgsc.bcm.edu	37	11	118963733	118963733	+	Splice_Site	SNP	T	T	C			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr11:118963733T>C	ENST00000278715.3	+	13	1063		c.e13+2		HMBS_ENST00000392841.1_Splice_Site|HMBS_ENST00000537841.1_Splice_Site|HMBS_ENST00000543090.1_Splice_Site|HMBS_ENST00000442944.2_Splice_Site|HMBS_ENST00000542729.1_Splice_Site|HMBS_ENST00000544387.1_Splice_Site	NM_000190.3	NP_000181.2	P08397	HEM3_HUMAN	hydroxymethylbilane synthase						heme biosynthetic process (GO:0006783)|peptidyl-pyrromethane cofactor linkage (GO:0018160)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	hydroxymethylbilane synthase activity (GO:0004418)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|urinary_tract(1)	15	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.72e-05)		CCTGCCCAGGTACCAAAGCTG	0.517																																					.		Atlas-SNP	.											.	HMBS	27	.	0			c.741+2T>C						.						77.0	77.0	77.0					11																	118963733		2200	4295	6495	SO:0001630	splice_region_variant	3145	exon12			CCCAGGTACCAAA	X04808	CCDS8409.1, CCDS41726.1, CCDS58186.1, CCDS58187.1	11q23.3	2013-07-10			ENSG00000256269	ENSG00000256269	2.5.1.61		4982	protein-coding gene	gene with protein product		609806	"""uroporphyrinogen I synthase"", ""porphobilinogen deaminase"", ""porphyria, acute; Chester type"""	PBGD, UPS, PORC		8432552, 17298217	Standard	NM_001258208		Approved		uc001puz.1	P08397	OTTHUMG00000168295	ENST00000278715.3:c.912+2T>C	chr11.hg19:g.118963733T>C		149.0	0.0		135.0	63.0	NM_001258209	A8K2L0|G3V1P4|G5EA58|P08396|Q16012	Splice_Site	SNP	ENST00000278715.3	hg19	CCDS8409.1	.	.	.	.	.	.	.	.	.	.	t	19.14	3.770737	0.69992	.	.	ENSG00000256269;ENSG00000256269;ENSG00000256269;ENSG00000256269;ENSG00000256269;ENSG00000256269;ENSG00000149397	ENST00000278715;ENST00000537841;ENST00000542729;ENST00000544387;ENST00000543090;ENST00000392841;ENST00000442944	.	.	.	4.8	4.8	0.61643	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.1242	0.53907	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	CTD-2589C9.4;HMBS	118468943	1.000000	0.71417	0.991000	0.47740	0.959000	0.62525	6.106000	0.71511	2.132000	0.65825	0.454000	0.30748	.	.	.		0.517	HMBS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399188.1	NM_000190	Intron
CLSTN3	9746	hgsc.bcm.edu	37	12	7293899	7293899	+	Missense_Mutation	SNP	A	A	G			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr12:7293899A>G	ENST00000266546.6	+	9	1835	c.1385A>G	c.(1384-1386)tAt>tGt	p.Y462C	CLSTN3_ENST00000537408.1_Missense_Mutation_p.Y474C	NM_014718.3	NP_055533.2	Q9BQT9	CSTN3_HUMAN	calsyntenin 3	462					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(7)|prostate(1)|skin(1)	33						GTCACACTCTATACCGACGGC	0.577											OREG0021650	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Y462C		Atlas-SNP	.											.	CLSTN3	84	.	0			c.A1385G						.						348.0	256.0	287.0					12																	7293899		2203	4300	6503	SO:0001583	missense	9746	exon9			CACTCTATACCGA	AB018269	CCDS8575.1	12p13.31	2011-07-01			ENSG00000139182	ENSG00000139182		"""Cadherins / Cadherin-related"""	18371	protein-coding gene	gene with protein product	"""cadherin-related family member 14"""	611324				12498782	Standard	NM_014718		Approved	CSTN3, KIAA0726, CDHR14	uc001qsr.3	Q9BQT9	OTTHUMG00000168167	ENST00000266546.6:c.1385A>G	chr12.hg19:g.7293899A>G	ENSP00000266546:p.Tyr462Cys	178.0	0.0	640	155.0	65.0	NM_014718	D3DUT6|O94831|Q2T9J5|Q5UE57	Missense_Mutation	SNP	ENST00000266546.6	hg19	CCDS8575.1	.	.	.	.	.	.	.	.	.	.	A	19.33	3.807145	0.70797	.	.	ENSG00000139182	ENST00000266546;ENST00000537408	D;D	0.88354	-2.37;-2.37	5.38	5.38	0.77491	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.000000	0.85682	D	0.000000	D	0.93112	0.7807	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.93496	0.6840	10	0.87932	D	0	-18.0968	10.5888	0.45298	0.9249:0.0:0.0751:0.0	.	474;462	Q5UE57;Q9BQT9	.;CSTN3_HUMAN	C	462;474	ENSP00000266546:Y462C;ENSP00000440679:Y474C	ENSP00000266546:Y462C	Y	+	2	0	CLSTN3	7185166	1.000000	0.71417	0.702000	0.30337	0.813000	0.45954	8.962000	0.93254	2.033000	0.60031	0.374000	0.22700	TAT	.	.		0.577	CLSTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398560.2	NM_014718	
TRPC4	7223	hgsc.bcm.edu	37	13	38211276	38211276	+	Missense_Mutation	SNP	G	G	T			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr13:38211276G>T	ENST00000379705.3	-	11	3555	c.2698C>A	c.(2698-2700)Ccc>Acc	p.P900T	TRPC4_ENST00000379679.1_Missense_Mutation_p.P727T|TRPC4_ENST00000379681.3_Missense_Mutation_p.P905T|TRPC4_ENST00000447043.1_Missense_Mutation_p.P759T|TRPC4_ENST00000426868.2_3'UTR|TRPC4_ENST00000355779.2_Missense_Mutation_p.P759T|TRPC4_ENST00000358477.2_Missense_Mutation_p.P816T|TRPC4_ENST00000338947.5_Missense_Mutation_p.P727T|TRPC4_ENST00000379673.2_Missense_Mutation_p.P751T			Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel, subfamily C, member 4	900	Binds to ITPR1, ITPR2 and ITPR3.				axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|gamma-aminobutyric acid secretion (GO:0014051)|ion transmembrane transport (GO:0034220)|oligodendrocyte differentiation (GO:0048709)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|calcium channel complex (GO:0034704)|caveola (GO:0005901)|cell surface (GO:0009986)|cortical cytoskeleton (GO:0030863)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(2)|breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(26)|lung(30)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	83				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		CTGAGACCGGGAATGCTCAGG	0.468																																					p.P905T		Atlas-SNP	.											.	TRPC4	389	.	0			c.C2713A						.						117.0	102.0	107.0					13																	38211276		2203	4300	6503	SO:0001583	missense	7223	exon11			GACCGGGAATGCT	U40983	CCDS9365.1, CCDS45035.1, CCDS45036.1, CCDS45038.1, CCDS45039.1	13q13.3	2013-01-10			ENSG00000133107	ENSG00000133107		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12336	protein-coding gene	gene with protein product		603651				8646775, 16382100	Standard	NM_016179		Approved	HTRP4, TRP4	uc010abx.3	Q9UBN4	OTTHUMG00000016752	ENST00000379705.3:c.2698C>A	chr13.hg19:g.38211276G>T	ENSP00000369027:p.Pro900Thr	102.0	0.0		95.0	45.0	NM_003306	B1ALE0|B1ALE1|B1ALE2|Q15721|Q3SWS6|Q96P03|Q96P04|Q96P05|Q9UIB0|Q9UIB1|Q9UIB2	Missense_Mutation	SNP	ENST00000379705.3	hg19	CCDS9365.1	.	.	.	.	.	.	.	.	.	.	G	8.875	0.950159	0.18431	.	.	ENSG00000133107	ENST00000379705;ENST00000379681;ENST00000338947;ENST00000379679;ENST00000355779;ENST00000358477;ENST00000379673;ENST00000447043	T;T;T;T;T;T;T;T	0.70282	-0.08;-0.08;0.12;0.12;0.24;-0.19;-0.47;0.24	5.43	4.54	0.55810	.	0.174545	0.41194	D	0.000932	T	0.65565	0.2703	N	0.08118	0	0.25714	N	0.985445	B;B;D;B;B;B	0.57899	0.004;0.013;0.981;0.152;0.043;0.018	B;B;D;B;B;B	0.70487	0.015;0.022;0.969;0.058;0.079;0.011	T	0.56498	-0.7969	10	0.21540	T	0.41	-20.4477	11.7376	0.51773	0.0:0.1688:0.7113:0.1198	.	759;751;905;727;816;900	Q9UBN4-3;Q9UBN4-4;Q9UBN4-5;Q9UBN4-6;Q9UBN4-2;Q9UBN4	.;.;.;.;.;TRPC4_HUMAN	T	900;905;727;727;759;816;751;759	ENSP00000369027:P900T;ENSP00000369003:P905T;ENSP00000342580:P727T;ENSP00000369001:P727T;ENSP00000348025:P759T;ENSP00000351264:P816T;ENSP00000368995:P751T;ENSP00000414316:P759T	ENSP00000342580:P727T	P	-	1	0	TRPC4	37109276	0.976000	0.34144	0.919000	0.36401	0.508000	0.34012	2.533000	0.45667	2.687000	0.91594	0.655000	0.94253	CCC	.	.		0.468	TRPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044574.2	NM_003306	
ACTC1	70	hgsc.bcm.edu	37	15	35084698	35084698	+	Missense_Mutation	SNP	G	G	T			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr15:35084698G>T	ENST00000290378.4	-	4	1182	c.527C>A	c.(526-528)gCc>gAc	p.A176D	ACTC1_ENST00000557860.1_5'UTR|RP11-814P5.1_ENST00000503496.1_RNA|RP11-814P5.1_ENST00000558707.1_RNA	NM_005159.4	NP_005150.1	P68032	ACTC_HUMAN	actin, alpha, cardiac muscle 1	176					actin filament-based movement (GO:0030048)|actin-myosin filament sliding (GO:0033275)|actomyosin structure organization (GO:0031032)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|heart contraction (GO:0060047)|muscle filament sliding (GO:0030049)|negative regulation of apoptotic process (GO:0043066)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|skeletal muscle thin filament assembly (GO:0030240)	actin filament (GO:0005884)|actomyosin, actin portion (GO:0042643)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|I band (GO:0031674)|membrane (GO:0016020)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|myosin binding (GO:0017022)			central_nervous_system(1)|endometrium(5)|kidney(1)|lung(14)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	31		all_lung(180;2.3e-08)		all cancers(64;5.83e-19)|GBM - Glioblastoma multiforme(113;1.98e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		ACGCATGATGGCATGGGGCAA	0.547																																					p.A176D		Atlas-SNP	.											.	ACTC1	75	.	0			c.C527A						.						154.0	134.0	141.0					15																	35084698		2201	4298	6499	SO:0001583	missense	70	exon4			ATGATGGCATGGG	BC009978	CCDS10041.1	15q14	2014-09-17	2006-08-24	2006-08-24	ENSG00000159251	ENSG00000159251			143	protein-coding gene	gene with protein product		102540	"""actin, alpha, cardiac muscle"""	ACTC		1639426	Standard	NM_005159		Approved	CMD1R	uc001ziu.1	P68032	OTTHUMG00000129675	ENST00000290378.4:c.527C>A	chr15.hg19:g.35084698G>T	ENSP00000290378:p.Ala176Asp	179.0	0.0		179.0	20.0	NM_005159	P04270	Missense_Mutation	SNP	ENST00000290378.4	hg19	CCDS10041.1	.	.	.	.	.	.	.	.	.	.	G	18.23	3.578764	0.65878	.	.	ENSG00000159251	ENST00000290378;ENST00000544062	D	0.97850	-4.57	4.99	4.99	0.66335	.	0.000000	0.52532	U	0.000080	D	0.99155	0.9708	H	0.99074	4.42	0.58432	D	0.999999	P	0.44816	0.844	P	0.52646	0.705	D	0.99066	1.0832	10	0.87932	D	0	.	18.8258	0.92117	0.0:0.0:1.0:0.0	.	176	P68032	ACTC_HUMAN	D	176;141	ENSP00000290378:A176D	ENSP00000290378:A176D	A	-	2	0	ACTC1	32871990	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.657000	0.98554	2.755000	0.94549	0.591000	0.81541	GCC	.	.		0.547	ACTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251876.3	NM_005159	
SPATA5L1	79029	hgsc.bcm.edu	37	15	45694823	45694823	+	Missense_Mutation	SNP	G	G	C			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr15:45694823G>C	ENST00000305560.6	+	1	295	c.196G>C	c.(196-198)Gac>Cac	p.D66H	GATM_ENST00000458245.5_5'Flank|SPATA5L1_ENST00000559860.1_Missense_Mutation_p.D66H	NM_024063.2	NP_076968.2	Q9BVQ7	SPA5L_HUMAN	spermatogenesis associated 5-like 1	66						cytoplasm (GO:0005737)	ATP binding (GO:0005524)			kidney(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	14		Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;7.31e-17)|GBM - Glioblastoma multiforme(94;6.28e-07)		GCCTCGGCGGGACGGAGCGGA	0.741																																					p.D66H		Atlas-SNP	.											.	SPATA5L1	40	.	0			c.G196C						.						4.0	5.0	5.0					15																	45694823		2027	4067	6094	SO:0001583	missense	79029	exon1			CGGCGGGACGGAG	AK023232	CCDS10123.1	15q15.1	2010-04-21			ENSG00000171763	ENSG00000171763		"""ATPases / AAA-type"""	28762	protein-coding gene	gene with protein product						12477932	Standard	NM_024063		Approved	MGC5347, FLJ12286	uc001zve.3	Q9BVQ7	OTTHUMG00000131425	ENST00000305560.6:c.196G>C	chr15.hg19:g.45694823G>C	ENSP00000305494:p.Asp66His	60.0	0.0		64.0	22.0	NM_024063	C9JHR5|Q9H8W7|Q9HA41	Missense_Mutation	SNP	ENST00000305560.6	hg19	CCDS10123.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.530409	0.85706	.	.	ENSG00000171763	ENST00000305560	D	0.94966	-3.57	4.87	2.99	0.34606	.	0.058275	0.64402	D	0.000002	D	0.95931	0.8675	M	0.71581	2.175	0.42303	D	0.992184	D	0.76494	0.999	D	0.66716	0.946	D	0.95171	0.8290	10	0.87932	D	0	-22.7009	9.6755	0.40039	0.1701:0.0:0.8299:0.0	.	66	Q9BVQ7	SPA5L_HUMAN	H	66	ENSP00000305494:D66H	ENSP00000305494:D66H	D	+	1	0	SPATA5L1	43482115	1.000000	0.71417	0.999000	0.59377	0.986000	0.74619	6.712000	0.74681	0.657000	0.30906	0.557000	0.71058	GAC	.	.		0.741	SPATA5L1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000254218.1	NM_024063	
TLN2	83660	hgsc.bcm.edu	37	15	63069030	63069030	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr15:63069030T>C	ENST00000561311.1	+	42	5665	c.5435T>C	c.(5434-5436)aTg>aCg	p.M1812T	TLN2_ENST00000472902.1_Missense_Mutation_p.M205T|TLN2_ENST00000306829.6_Missense_Mutation_p.M1812T			Q9Y4G6	TLN2_HUMAN	talin 2	1812					cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						GATGACATCATGGTGACGCTG	0.562																																					p.M1812T		Atlas-SNP	.											.	TLN2	253	.	0			c.T5435C						.						108.0	87.0	94.0					15																	63069030		2203	4300	6503	SO:0001583	missense	83660	exon40			ACATCATGGTGAC	AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.5435T>C	chr15.hg19:g.63069030T>C	ENSP00000453508:p.Met1812Thr	76.0	0.0		85.0	38.0	NM_015059	A6NLB8	Missense_Mutation	SNP	ENST00000561311.1	hg19	CCDS32261.1	.	.	.	.	.	.	.	.	.	.	T	9.670	1.146443	0.21288	.	.	ENSG00000171914	ENST00000306829	T	0.14640	2.49	5.48	5.48	0.80851	.	0.079544	0.85682	D	0.000000	T	0.08891	0.0220	N	0.16233	0.39	0.48395	D	0.999644	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.16070	-1.0415	10	0.09084	T	0.74	-32.1648	15.2464	0.73509	0.0:0.0:0.0:1.0	.	856;1812	G1UI21;Q9Y4G6	.;TLN2_HUMAN	T	1812	ENSP00000303476:M1812T	ENSP00000303476:M1812T	M	+	2	0	TLN2	60856083	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.215000	0.72206	2.076000	0.62316	0.460000	0.39030	ATG	.	.		0.562	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257878.2		
HCN4	10021	hgsc.bcm.edu	37	15	73660429	73660429	+	Silent	SNP	G	G	A			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr15:73660429G>A	ENST00000261917.3	-	1	1176	c.183C>T	c.(181-183)gcC>gcT	p.A61A		NM_005477.2	NP_005468.1	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 4	61					blood circulation (GO:0008015)|cation transport (GO:0006812)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)	cAMP binding (GO:0030552)|cation channel activity (GO:0005261)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(13)|liver(1)|lung(18)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				COAD - Colon adenocarcinoma(1;0.142)		TGCCACCCGCGGCCGCCGAGG	0.781																																					p.A61A		Atlas-SNP	.											.	HCN4	150	.	0			c.C183T						.						1.0	1.0	1.0					15																	73660429		662	1712	2374	SO:0001819	synonymous_variant	10021	exon1			ACCCGCGGCCGCC	AJ132429	CCDS10248.1	15q24.1	2011-07-05			ENSG00000138622	ENSG00000138622		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	16882	protein-coding gene	gene with protein product		605206				10228147, 10430953, 16382102	Standard	NM_005477		Approved		uc002avp.3	Q9Y3Q4	OTTHUMG00000137563	ENST00000261917.3:c.183C>T	chr15.hg19:g.73660429G>A		377.0	1.0		410.0	180.0	NM_005477	Q9UMQ7	Silent	SNP	ENST00000261917.3	hg19	CCDS10248.1																																																																																			.	.		0.781	HCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268900.2	NM_005477	
XYLT1	64131	hgsc.bcm.edu	37	16	17235129	17235129	+	Missense_Mutation	SNP	C	C	T			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr16:17235129C>T	ENST00000261381.6	-	7	1552	c.1468G>A	c.(1468-1470)Gat>Aat	p.D490N	CTD-2576D5.4_ENST00000567344.1_RNA	NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	490					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						GAACCGCCATCCACGGCAATG	0.567																																					p.D490N		Atlas-SNP	.											.	XYLT1	147	.	0			c.G1468A						.						106.0	108.0	108.0					16																	17235129		2197	4300	6497	SO:0001583	missense	64131	exon7			CGCCATCCACGGC	AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.1468G>A	chr16.hg19:g.17235129C>T	ENSP00000261381:p.Asp490Asn	98.0	0.0		86.0	42.0	NM_022166	Q9H1B6	Missense_Mutation	SNP	ENST00000261381.6	hg19	CCDS10569.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.184988	0.78677	.	.	ENSG00000103489	ENST00000261381	T	0.11604	2.76	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.29976	0.0750	L	0.52126	1.63	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.00060	-1.2164	10	0.40728	T	0.16	-27.5973	19.2967	0.94126	0.0:1.0:0.0:0.0	.	490	Q86Y38	XYLT1_HUMAN	N	490	ENSP00000261381:D490N	ENSP00000261381:D490N	D	-	1	0	XYLT1	17142630	1.000000	0.71417	0.986000	0.45419	0.080000	0.17528	5.972000	0.70448	2.797000	0.96272	0.555000	0.69702	GAT	.	.		0.567	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252241.2	NM_022166	
IRX6	79190	hgsc.bcm.edu	37	16	55362676	55362676	+	Silent	SNP	G	G	A			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr16:55362676G>A	ENST00000290552.7	+	5	2118	c.786G>A	c.(784-786)gaG>gaA	p.E262E	RP11-26L20.3_ENST00000558730.2_RNA	NM_024335.2	NP_077311.2	P78412	IRX6_HUMAN	iroquois homeobox 6	262					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(5)|endometrium(3)|kidney(2)|large_intestine(6)|liver(2)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	33						Tggaggaagaggaggaggagg	0.622																																					p.E262E		Atlas-SNP	.											.	IRX6	66	.	0			c.G786A						.						33.0	38.0	36.0					16																	55362676		2195	4295	6490	SO:0001819	synonymous_variant	79190	exon5			GGAAGAGGAGGAG	AF319966	CCDS32449.1	16q12.2	2011-06-20	2007-07-13	2003-01-10		ENSG00000159387		"""Homeoboxes / TALE class"""	14675	protein-coding gene	gene with protein product		606196	"""iroquois homeobox protein 7"", ""iroquois homeobox protein 6"""	IRX7			Standard	NM_024335		Approved	IRX-3	uc002ehy.3	P78412		ENST00000290552.7:c.786G>A	chr16.hg19:g.55362676G>A		75.0	0.0		87.0	6.0	NM_024335	B2RN06|Q7Z2K0	Silent	SNP	ENST00000290552.7	hg19	CCDS32449.1																																																																																			.	.		0.622	IRX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417445.4	NM_024335	
TIMP2	7077	hgsc.bcm.edu	37	17	76887957	76887957	+	Intron	SNP	G	G	A			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr17:76887957G>A	ENST00000262768.7	-	2	429				DDC8_ENST00000322630.2_Missense_Mutation_p.T210M|TIMP2_ENST00000536189.2_Intron	NM_003255.4	NP_003246.1	P16035	TIMP2_HUMAN	TIMP metallopeptidase inhibitor 2						aging (GO:0007568)|cellular response to organic substance (GO:0071310)|central nervous system development (GO:0007417)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of proteolysis (GO:0045861)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|regulation of Rap protein signal transduction (GO:0032487)|response to cytokine (GO:0034097)|response to drug (GO:0042493)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase inhibitor activity (GO:0008191)			central_nervous_system(2)	2			BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.194)			CATCCGACCCGTGGCTTTTGT	0.607																																					p.T210M		Atlas-SNP	.											.	.	.	.	0			c.C629T						.																																			SO:0001627	intron_variant	0	exon3			CGACCCGTGGCTT		CCDS11758.1	17q25	2008-07-18	2005-08-08		ENSG00000035862	ENSG00000035862			11821	protein-coding gene	gene with protein product		188825	"""tissue inhibitor of metalloproteinase 2"""			1427908	Standard	NM_003255		Approved	CSC-21K	uc002jwf.3	P16035	OTTHUMG00000154517	ENST00000262768.7:c.131-17956C>T	chr17.hg19:g.76887957G>A		96.0	0.0		128.0	37.0	NM_001243540	Q16121|Q93006|Q9UDF7	Missense_Mutation	SNP	ENST00000262768.7	hg19	CCDS11758.1	.	.	.	.	.	.	.	.	.	.	G	4.355	0.065350	0.08388	.	.	ENSG00000178404	ENST00000322630	T	0.25085	1.82	3.57	-6.44	0.01920	.	5.198410	0.00678	N	0.000662	T	0.14184	0.0343	.	.	.	0.09310	N	1	B	0.18461	0.028	B	0.11329	0.006	T	0.10382	-1.0632	9	0.42905	T	0.14	0.133	2.228	0.03989	0.383:0.2425:0.2752:0.0993	.	210	Q96MC4	.	M	210	ENSP00000312767:T210M	ENSP00000312767:T210M	T	-	2	0	AC100788.1	74399552	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.726000	0.04936	-1.889000	0.01112	-2.069000	0.00389	ACG	.	.		0.607	TIMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335662.1	NM_003255	
COLEC12	81035	hgsc.bcm.edu	37	18	334824	334824	+	Silent	SNP	G	G	T			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr18:334824G>T	ENST00000400256.3	-	6	1941	c.1734C>A	c.(1732-1734)ggC>ggA	p.G578G		NM_130386.2	NP_569057	Q5KU26	COL12_HUMAN	collectin sub-family member 12	578	Collagen-like 3.				carbohydrate mediated signaling (GO:0009756)|defense response (GO:0006952)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|protein homooligomerization (GO:0051260)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galactose binding (GO:0005534)|low-density lipoprotein particle binding (GO:0030169)|metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)			cervix(2)|endometrium(3)|kidney(2)|large_intestine(10)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	46		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)				GGCCGGGGGGGCCCTTGGGGC	0.697																																					p.G578G		Atlas-SNP	.											.	COLEC12	121	.	0			c.C1734A						.						18.0	19.0	19.0					18																	334824		2199	4287	6486	SO:0001819	synonymous_variant	81035	exon6			GGGGGGGCCCTTG	AB038518	CCDS32782.1	18p11.32	2013-09-19			ENSG00000158270	ENSG00000158270		"""Collectins"""	16016	protein-coding gene	gene with protein product		607621				11162630	Standard	NM_130386		Approved	SRCL, CL-P1, SCARA4	uc002kkm.3	Q5KU26	OTTHUMG00000178145	ENST00000400256.3:c.1734C>A	chr18.hg19:g.334824G>T		61.0	0.0		62.0	30.0	NM_130386	Q6P9F2|Q8TCR2|Q8WZA4|Q9BY85|Q9BYH7	Silent	SNP	ENST00000400256.3	hg19	CCDS32782.1																																																																																			.	.		0.697	COLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440746.1		
TSHZ3	57616	hgsc.bcm.edu	37	19	31770531	31770531	+	Missense_Mutation	SNP	G	G	C			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr19:31770531G>C	ENST00000240587.4	-	2	495	c.168C>G	c.(166-168)tgC>tgG	p.C56W		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	56					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					GGTAGCTGGGGCAGGCCCTGG	0.592																																					p.C56W		Atlas-SNP	.											.	TSHZ3	549	.	0			c.C168G						.						33.0	35.0	35.0					19																	31770531		1964	4132	6096	SO:0001583	missense	57616	exon2			GCTGGGGCAGGCC	AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.168C>G	chr19.hg19:g.31770531G>C	ENSP00000240587:p.Cys56Trp	49.0	0.0		42.0	12.0	NM_020856	Q9H0G6|Q9P254	Missense_Mutation	SNP	ENST00000240587.4	hg19	CCDS12421.2	.	.	.	.	.	.	.	.	.	.	G	13.06	2.123830	0.37436	.	.	ENSG00000121297	ENST00000240587	T	0.11495	2.77	5.92	2.26	0.28386	.	0.301733	0.26474	U	0.024173	T	0.06645	0.0170	N	0.14661	0.345	0.52099	D	0.999949	P	0.47034	0.889	B	0.43018	0.405	T	0.36089	-0.9762	10	0.51188	T	0.08	-26.241	7.1481	0.25595	0.2178:0.0:0.6577:0.1245	.	56	Q63HK5	TSH3_HUMAN	W	56	ENSP00000240587:C56W	ENSP00000240587:C56W	C	-	3	2	TSHZ3	36462371	1.000000	0.71417	0.995000	0.50966	0.862000	0.49288	0.713000	0.25794	0.847000	0.35167	0.650000	0.86243	TGC	.	.		0.592	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856	
ZNF382	84911	hgsc.bcm.edu	37	19	37117613	37117613	+	Missense_Mutation	SNP	A	A	G			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr19:37117613A>G	ENST00000292928.2	+	5	927	c.814A>G	c.(814-816)Aaa>Gaa	p.K272E	ZNF382_ENST00000439428.1_Missense_Mutation_p.K271E|ZNF382_ENST00000423582.1_Missense_Mutation_p.K223E|ZNF382_ENST00000435416.1_Missense_Mutation_p.K271E|CTD-3234P18.2_ENST00000585467.1_lincRNA	NM_001256838.1|NM_032825.4	NP_001243767.1|NP_116214.2	Q96SR6	ZN382_HUMAN	zinc finger protein 382	272					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	34	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			TGCCTACAACAAATATGGGAA	0.393																																					p.K272E		Atlas-SNP	.											.	ZNF382	87	.	0			c.A814G						.						68.0	70.0	69.0					19																	37117613		2203	4296	6499	SO:0001583	missense	84911	exon5			TACAACAAATATG	AF513816	CCDS33004.1, CCDS58659.1	19q13.13	2013-01-08			ENSG00000161298	ENSG00000161298		"""Zinc fingers, C2H2-type"", ""-"""	17409	protein-coding gene	gene with protein product		609516					Standard	NM_032825		Approved	FLJ14686, KS1	uc010efb.4	Q96SR6	OTTHUMG00000048153	ENST00000292928.2:c.814A>G	chr19.hg19:g.37117613A>G	ENSP00000292928:p.Lys272Glu	91.0	0.0		102.0	42.0	NM_032825	A3KMP6|A8MT55|C9K0V5|Q53ZY8|Q5JPJ2	Missense_Mutation	SNP	ENST00000292928.2	hg19	CCDS33004.1	.	.	.	.	.	.	.	.	.	.	A	3.921	-0.018131	0.07681	.	.	ENSG00000161298	ENST00000423582;ENST00000292928;ENST00000439428;ENST00000435416	T;T;T;T	0.26518	1.73;1.73;1.73;1.73	4.59	3.49	0.39957	.	0.000000	0.42821	D	0.000658	T	0.03915	0.0110	N	0.00205	-1.85	0.20307	N	0.999919	B;B;B	0.24823	0.112;0.112;0.068	B;B;B	0.22880	0.042;0.042;0.019	T	0.43212	-0.9405	10	0.02654	T	1	.	4.3939	0.11353	0.6949:0.2022:0.1028:0.0	.	271;271;272	Q96SR6-2;Q96SR6-3;Q96SR6	.;.;ZN382_HUMAN	E	223;272;271;271	ENSP00000389722:K223E;ENSP00000292928:K272E;ENSP00000407593:K271E;ENSP00000410113:K271E	ENSP00000292928:K272E	K	+	1	0	ZNF382	41809453	0.000000	0.05858	0.996000	0.52242	0.891000	0.51852	0.192000	0.17096	2.065000	0.61736	0.383000	0.25322	AAA	.	.		0.393	ZNF382-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109562.2	NM_032825	
ZNF569	148266	hgsc.bcm.edu	37	19	37904717	37904717	+	Missense_Mutation	SNP	C	C	A			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr19:37904717C>A	ENST00000316950.6	-	6	1400	c.843G>T	c.(841-843)caG>caT	p.Q281H	ZNF569_ENST00000392149.2_Missense_Mutation_p.Q281H|ZNF569_ENST00000392150.2_Missense_Mutation_p.Q122H	NM_152484.2	NP_689697.2	Q5MCW4	ZN569_HUMAN	zinc finger protein 569	281					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|endometrium(4)|large_intestine(16)|lung(11)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	40			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GATTTGATTTCTGGCTGAAGG	0.358																																					p.Q281H		Atlas-SNP	.											.	ZNF569	101	.	0			c.G843T						.						77.0	81.0	80.0					19																	37904717		2203	4300	6503	SO:0001583	missense	148266	exon6			TGATTTCTGGCTG	AL833408	CCDS12503.1	19q13.12	2013-09-20			ENSG00000196437	ENSG00000196437		"""Zinc fingers, C2H2-type"", ""-"""	24737	protein-coding gene	gene with protein product		613904				12477932	Standard	NM_152484		Approved	FLJ32053, ZAP1	uc002ogi.3	Q5MCW4	OTTHUMG00000048172	ENST00000316950.6:c.843G>T	chr19.hg19:g.37904717C>A	ENSP00000325018:p.Gln281His	56.0	0.0		62.0	24.0	NM_152484	A8K1S2|Q15925|Q17RR6|Q96MQ2	Missense_Mutation	SNP	ENST00000316950.6	hg19	CCDS12503.1	.	.	.	.	.	.	.	.	.	.	C	10.02	1.236321	0.22626	.	.	ENSG00000196437	ENST00000316950;ENST00000392150	T;T	0.07327	3.2;3.2	3.97	0.39	0.16275	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.35805	N	0.002963	T	0.08133	0.0203	N	0.05510	-0.035	0.09310	N	1	B;D	0.69078	0.016;0.997	B;D	0.79108	0.024;0.992	T	0.34004	-0.9846	10	0.18276	T	0.48	.	5.9243	0.19101	0.3342:0.5695:0.0:0.0963	.	122;281	Q17RR6;Q5MCW4	.;ZN569_HUMAN	H	281;122	ENSP00000325018:Q281H;ENSP00000375993:Q122H	ENSP00000325018:Q281H	Q	-	3	2	ZNF569	42596557	0.000000	0.05858	0.862000	0.33874	0.991000	0.79684	-1.281000	0.02802	0.073000	0.16731	0.655000	0.94253	CAG	.	.		0.358	ZNF569-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109594.2	NM_152484	
FBXO17	115290	hgsc.bcm.edu	37	19	39437164	39437164	+	Missense_Mutation	SNP	C	C	G	rs546215787		TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr19:39437164C>G	ENST00000292852.4	-	4	846	c.505G>C	c.(505-507)Gtg>Ctg	p.V169L	FBXO17_ENST00000595329.1_Missense_Mutation_p.V169L|SARS2_ENST00000448145.2_Missense_Mutation_p.V4L|CTC-360G5.8_ENST00000599996.1_Missense_Mutation_p.G73A	NM_024907.5	NP_079183.4	Q96EF6	FBX17_HUMAN	F-box protein 17	169	FBA. {ECO:0000255|PROSITE- ProRule:PRU00482}.					SCF ubiquitin ligase complex (GO:0019005)	glycoprotein binding (GO:0001948)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)	7	all_cancers(60;8.37e-07)|all_lung(34;3.71e-07)|Lung NSC(34;4.17e-07)|all_epithelial(25;1.13e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			TCCTGCCACACCCCTTCCATC	0.612																																					p.V178L		Atlas-SNP	.											.	FBXO17	42	.	0			c.G532C						.						83.0	66.0	72.0					19																	39437164		2203	4300	6503	SO:0001583	missense	115290	exon4			GCCACACCCCTTC	AF386743	CCDS12526.1	19q13.2	2010-07-02	2004-06-15	2004-06-16		ENSG00000269190		"""F-boxes /  ""other"""""	18754	protein-coding gene	gene with protein product	"""F-box only protein 26"""	609094	"""F-box only protein 17"""	FBXO26			Standard	NM_148169		Approved	FBG4, FLJ25205, MGC9379, FLJ11798, Fbx17		Q96EF6		ENST00000292852.4:c.505G>C	chr19.hg19:g.39437164C>G	ENSP00000292852:p.Val169Leu	161.0	0.0		140.0	62.0	NM_148169	Q96LQ4	Missense_Mutation	SNP	ENST00000292852.4	hg19	CCDS12526.1	.	.	.	.	.	.	.	.	.	.	C	0.565	-0.843601	0.02671	.	.	ENSG00000104835	ENST00000448145;ENST00000392076;ENST00000292852	T;T	0.23754	1.89;1.89	4.25	-2.18	0.07037	Galactose-binding domain-like (1);F-box associated (FBA) domain (2);	0.321927	0.21695	N	0.070509	T	0.04272	0.0118	N	0.00656	-1.285	.	.	.	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.40175	-0.9577	9	0.02654	T	1	.	4.0976	0.09998	0.0:0.3549:0.3384:0.3066	.	4;169	E7EX87;Q96EF6	.;FBX17_HUMAN	L	4;178;169	ENSP00000399330:V4L;ENSP00000292852:V169L	ENSP00000292852:V169L	V	-	1	0	FBXO17	44129004	0.000000	0.05858	0.357000	0.25798	0.769000	0.43574	-0.882000	0.04174	-0.053000	0.13289	0.455000	0.32223	GTG	.	.		0.612	FBXO17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463273.1	NM_024907	
ZNF223	7766	hgsc.bcm.edu	37	19	44570689	44570689	+	Silent	SNP	A	A	G			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr19:44570689A>G	ENST00000434772.3	+	5	963	c.708A>G	c.(706-708)caA>caG	p.Q236Q	ZNF223_ENST00000591793.1_Silent_p.Q346Q	NM_013361.4	NP_037493.3	Q9UK11	ZN223_HUMAN	zinc finger protein 223	236					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18		Prostate(69;0.0352)				AATGTGAACAATGTGGGAGAG	0.418																																					p.Q236Q		Atlas-SNP	.											.	ZNF223	61	.	0			c.A708G						.						147.0	145.0	146.0					19																	44570689		2203	4300	6503	SO:0001819	synonymous_variant	7766	exon5			TGAACAATGTGGG	AF187989	CCDS12635.1	19q13.2	2013-01-08				ENSG00000178386		"""Zinc fingers, C2H2-type"", ""-"""	13016	protein-coding gene	gene with protein product							Standard	XM_006723365		Approved		uc002oyf.1	Q9UK11		ENST00000434772.3:c.708A>G	chr19.hg19:g.44570689A>G		107.0	0.0		94.0	45.0	NM_013361	Q15736|Q8TBJ3|Q9HCA9	Silent	SNP	ENST00000434772.3	hg19	CCDS12635.1																																																																																			.	.		0.418	ZNF223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460469.2		
ZNF227	7770	hgsc.bcm.edu	37	19	44739935	44739935	+	Nonsense_Mutation	SNP	T	T	G			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr19:44739935T>G	ENST00000313040.7	+	6	1557	c.1352T>G	c.(1351-1353)tTa>tGa	p.L451*	ZNF227_ENST00000589005.1_Nonsense_Mutation_p.L400*|ZNF227_ENST00000391961.2_Nonsense_Mutation_p.L400*	NM_182490.1	NP_872296.1	Q86WZ6	ZN227_HUMAN	zinc finger protein 227	451					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(2)|stomach(1)|urinary_tract(1)	24		Prostate(69;0.0435)				AATTCACCATTAATATGCCAT	0.468																																					p.L451X		Atlas-SNP	.											.	ZNF227	62	.	0			c.T1352G						.						93.0	91.0	92.0					19																	44739935		2203	4300	6503	SO:0001587	stop_gained	7770	exon6			CACCATTAATATG	AK092253	CCDS12636.1, CCDS74388.1	19q13.32	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	13020	protein-coding gene	gene with protein product							Standard	XM_005259232		Approved		uc002oyu.3	Q86WZ6		ENST00000313040.7:c.1352T>G	chr19.hg19:g.44739935T>G	ENSP00000321049:p.Leu451*	101.0	0.0		68.0	24.0	NM_182490	B3KRU7|B7Z5P9	Nonsense_Mutation	SNP	ENST00000313040.7	hg19	CCDS12636.1	.	.	.	.	.	.	.	.	.	.	T	36	5.891761	0.97074	.	.	ENSG00000131115	ENST00000313040;ENST00000328297;ENST00000391961;ENST00000418980;ENST00000377916	.	.	.	4.02	2.96	0.34315	.	.	.	.	.	.	.	.	.	.	.	0.25863	N	0.983792	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.9013	0.13777	0.0:0.1013:0.2011:0.6976	.	.	.	.	X	451;408;400;430;152	.	ENSP00000321049:L451X	L	+	2	0	ZNF227	49431775	0.002000	0.14202	0.005000	0.12908	0.981000	0.71138	1.338000	0.33873	0.673000	0.31224	0.460000	0.39030	TTA	.	.		0.468	ZNF227-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460720.1	NM_182490	
HAS1	3036	hgsc.bcm.edu	37	19	52222514	52222514	+	Missense_Mutation	SNP	C	C	T			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr19:52222514C>T	ENST00000222115.1	-	2	681	c.647G>A	c.(646-648)cGc>cAc	p.R216H	HAS1_ENST00000594621.1_Missense_Mutation_p.R70H|HAS1_ENST00000601714.1_Missense_Mutation_p.R223H|HAS1_ENST00000540069.2_Missense_Mutation_p.R215H	NM_001523.2	NP_001514.2	Q92839	HYAS1_HUMAN	hyaluronan synthase 1	216					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|negative regulation of fibroblast migration (GO:0010764)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronan synthase activity (GO:0050501)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(4)	40		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00102)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		CATGACCTCGCGCTTGCCGCC	0.657																																					p.R216H	NSCLC(132;636 2450 45807 47979)	Atlas-SNP	.											.	HAS1	61	.	0			c.G647A						.						43.0	37.0	39.0					19																	52222514		2202	4298	6500	SO:0001583	missense	3036	exon2			ACCTCGCGCTTGC	U59269	CCDS12838.1, CCDS74436.1	19q13.3-q13.4	2013-02-22			ENSG00000105509	ENSG00000105509	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4818	protein-coding gene	gene with protein product		601463		HAS		9169154	Standard	XM_005258834		Approved		uc002pxo.1	Q92839		ENST00000222115.1:c.647G>A	chr19.hg19:g.52222514C>T	ENSP00000222115:p.Arg216His	56.0	0.0		64.0	27.0	NM_001523	Q14470|Q9NS49	Missense_Mutation	SNP	ENST00000222115.1	hg19	CCDS12838.1	.	.	.	.	.	.	.	.	.	.	.	28.2	4.900084	0.92035	.	.	ENSG00000105509	ENST00000540069;ENST00000222115;ENST00000376737;ENST00000376738	T;T	0.59224	0.28;0.28	3.79	3.79	0.43588	.	0.000000	0.64402	D	0.000001	T	0.79690	0.4489	M	0.91972	3.26	0.58432	D	0.999997	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.84857	0.0817	10	0.87932	D	0	-20.6314	13.4921	0.61402	0.0:1.0:0.0:0.0	.	215;216;215	G3V1S7;Q92839;Q8IYH3	.;HAS1_HUMAN;.	H	215;216;70;70	ENSP00000445021:R215H;ENSP00000222115:R216H	ENSP00000222115:R216H	R	-	2	0	HAS1	56914326	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.424000	0.80242	1.812000	0.52913	0.423000	0.28283	CGC	.	.		0.657	HAS1-005	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466953.1	NM_001523	
ZNF813	126017	hgsc.bcm.edu	37	19	53995222	53995222	+	Missense_Mutation	SNP	A	A	T			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr19:53995222A>T	ENST00000396403.4	+	4	1864	c.1736A>T	c.(1735-1737)tAc>tTc	p.Y579F	ZNF813_ENST00000396421.4_Intron	NM_001004301.3	NP_001004301.2	Q6ZN06	ZN813_HUMAN	zinc finger protein 813	579					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)	1				GBM - Glioblastoma multiforme(134;0.00619)		GAGAAACCTTACAAGTGTAAT	0.373																																					p.Y579F		Atlas-SNP	.											.	ZNF813	81	.	0			c.A1736T						.						41.0	43.0	42.0					19																	53995222		2199	4298	6497	SO:0001583	missense	126017	exon4			AACCTTACAAGTG	AK091460	CCDS46172.1	19q13.41	2013-01-08			ENSG00000198346	ENSG00000198346		"""Zinc fingers, C2H2-type"", ""-"""	33257	protein-coding gene	gene with protein product							Standard	NM_001004301		Approved	FLJ16542	uc002qbu.2	Q6ZN06	OTTHUMG00000158309	ENST00000396403.4:c.1736A>T	chr19.hg19:g.53995222A>T	ENSP00000379684:p.Tyr579Phe	174.0	0.0		144.0	60.0	NM_001004301		Missense_Mutation	SNP	ENST00000396403.4	hg19	CCDS46172.1	.	.	.	.	.	.	.	.	.	.	a	11.10	1.538031	0.27475	.	.	ENSG00000198346	ENST00000396403	T	0.18338	2.22	1.28	-0.352	0.12598	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.15132	0.0365	N	0.13299	0.325	0.09310	N	0.999994	P	0.45768	0.866	P	0.55112	0.769	T	0.21245	-1.0251	9	0.42905	T	0.14	.	5.0799	0.14651	0.3851:0.0:0.0:0.6149	.	579	Q6ZN06	ZN813_HUMAN	F	579	ENSP00000379684:Y579F	ENSP00000379684:Y579F	Y	+	2	0	ZNF813	58687034	0.000000	0.05858	0.147000	0.22382	0.094000	0.18550	-0.643000	0.05421	0.383000	0.24910	0.158000	0.16466	TAC	.	.		0.373	ZNF813-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350638.1	NM_001004301	
PSMG1	8624	hgsc.bcm.edu	37	21	40550541	40550541	+	Missense_Mutation	SNP	C	C	G			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr21:40550541C>G	ENST00000331573.3	-	5	954	c.489G>C	c.(487-489)caG>caC	p.Q163H	PSMG1_ENST00000380900.2_Missense_Mutation_p.Q142H	NM_001261824.1|NM_003720.3	NP_001248753.1|NP_003711.1	O95456	PSMG1_HUMAN	proteasome (prosome, macropain) assembly chaperone 1	163					cerebellar granule cell precursor proliferation (GO:0021930)|proteasome assembly (GO:0043248)|proteasome core complex assembly (GO:0080129)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)				autonomic_ganglia(1)|endometrium(2)|large_intestine(1)|lung(1)|skin(1)|urinary_tract(2)	8		Prostate(19;8.44e-08)				GAATAGTTATCTGCATGTTCT	0.348																																					p.Q163H		Atlas-SNP	.											.	PSMG1	11	.	0			c.G489C						.						88.0	88.0	88.0					21																	40550541		2203	4300	6503	SO:0001583	missense	8624	exon5			AGTTATCTGCATG	AJ006291	CCDS13660.1, CCDS13661.1	21q22.3	2007-10-23	2007-10-23	2007-10-23	ENSG00000183527	ENSG00000183527			3043	protein-coding gene	gene with protein product		605296	"""Down syndrome critical region gene 2"""	DSCR2		10872820, 17189198	Standard	NM_003720		Approved	c21-LRP, LRPC21, PAC1	uc002yxi.4	O95456	OTTHUMG00000066034	ENST00000331573.3:c.489G>C	chr21.hg19:g.40550541C>G	ENSP00000329915:p.Gln163His	131.0	0.0		159.0	72.0	NM_003720	B5BUN2|Q6FHA3|Q6FHD3|Q6S713	Missense_Mutation	SNP	ENST00000331573.3	hg19	CCDS13660.1	.	.	.	.	.	.	.	.	.	.	C	15.22	2.768698	0.49680	.	.	ENSG00000183527	ENST00000331573;ENST00000380900	T;T	0.29917	1.55;1.55	5.5	-0.945	0.10388	.	0.295226	0.37348	N	0.002123	T	0.39384	0.1076	M	0.72479	2.2	0.32517	N	0.536789	P;D	0.54047	0.955;0.964	P;P	0.55785	0.66;0.784	T	0.48958	-0.8988	10	0.59425	D	0.04	-20.6822	6.0761	0.19915	0.1254:0.3692:0.0:0.5055	.	142;163	O95456-2;O95456	.;PSMG1_HUMAN	H	163;142	ENSP00000329915:Q163H;ENSP00000370286:Q142H	ENSP00000329915:Q163H	Q	-	3	2	PSMG1	39472411	0.994000	0.37717	0.213000	0.23690	0.882000	0.50991	0.248000	0.18198	-0.248000	0.09583	-0.251000	0.11542	CAG	.	.		0.348	PSMG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141404.2	NM_003720	
SCUBE1	80274	hgsc.bcm.edu	37	22	43634957	43634957	+	Missense_Mutation	SNP	G	G	A			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr22:43634957G>A	ENST00000360835.4	-	7	857	c.731C>T	c.(730-732)aCg>aTg	p.T244M	Z82214.2_ENST00000419643.1_RNA|SCUBE1_ENST00000290460.7_Missense_Mutation_p.T274M	NM_173050.3	NP_766638.2	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1	244	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|post-embryonic development (GO:0009791)|protein homooligomerization (GO:0051260)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extrinsic component of plasma membrane (GO:0019897)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)	p.T244M(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(4)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		all_neural(38;0.0414)|Ovarian(80;0.07)				GACTGCGCACGTCTCTGGGGA	0.582																																					p.T244M		Atlas-SNP	.											SCUBE1,NS,carcinoma,0,1	SCUBE1	105	.	1	Substitution - Missense(1)	lung(1)	c.C731T						.						48.0	43.0	45.0					22																	43634957		2203	4300	6503	SO:0001583	missense	80274	exon7			GCGCACGTCTCTG		CCDS14048.1	22q13	2008-07-01			ENSG00000159307	ENSG00000159307			13441	protein-coding gene	gene with protein product		611746				11087664	Standard	NM_173050		Approved		uc003bdt.2	Q8IWY4	OTTHUMG00000150679	ENST00000360835.4:c.731C>T	chr22.hg19:g.43634957G>A	ENSP00000354080:p.Thr244Met	153.0	0.0		124.0	44.0	NM_173050	Q5R336	Missense_Mutation	SNP	ENST00000360835.4	hg19	CCDS14048.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.8|25.8	4.671195|4.671195	0.88348|0.88348	.|.	.|.	ENSG00000159307|ENSG00000159307	ENST00000381243|ENST00000360835;ENST00000434132;ENST00000290460	.|D;D	.|0.88741	.|-2.05;-2.42	5.57|5.57	5.57|5.57	0.84162|0.84162	.|Epidermal growth factor-like (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.93360|0.93360	0.7883|0.7883	L|L	0.53249|0.53249	1.67|1.67	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.83275	.|0.97;0.996	D|D	0.93418|0.93418	0.6774|0.6774	6|10	0.87932|0.62326	D|D	0|0.03	.|.	19.1674|19.1674	0.93562|0.93562	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|274;244	.|B1AH90;Q8IWY4	.|.;SCUB1_HUMAN	C|M	37|244;244;274	.|ENSP00000354080:T244M;ENSP00000290460:T274M	ENSP00000370642:R37C|ENSP00000290460:T274M	R|T	-|-	1|2	0|0	SCUBE1|SCUBE1	41964901|41964901	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.644000|0.644000	0.38419|0.38419	7.806000|7.806000	0.86020|0.86020	2.630000|2.630000	0.89119|0.89119	0.655000|0.655000	0.94253|0.94253	CGT|ACG	.	.		0.582	SCUBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319582.3	NM_173050	
FRMPD4	9758	hgsc.bcm.edu	37	X	12632900	12632900	+	Missense_Mutation	SNP	G	G	A			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chrX:12632900G>A	ENST00000380682.1	+	4	828	c.322G>A	c.(322-324)Ggc>Agc	p.G108S	7SK_ENST00000606842.1_RNA	NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	108	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						GTCTCCAGGTGGCCCCTCTGA	0.507																																					p.G108S		Atlas-SNP	.											.	FRMPD4	214	.	0			c.G322A						.						107.0	103.0	104.0					X																	12632900		2203	4300	6503	SO:0001583	missense	9758	exon4			CCAGGTGGCCCCT	AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.322G>A	chrX.hg19:g.12632900G>A	ENSP00000370057:p.Gly108Ser	177.0	0.0		134.0	55.0	NM_014728	A8K0X9|O15032	Missense_Mutation	SNP	ENST00000380682.1	hg19	CCDS35201.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.962069	0.74016	.	.	ENSG00000169933	ENST00000380682;ENST00000429478;ENST00000304087	T	0.29142	1.58	5.4	5.4	0.78164	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.53818	0.1820	L	0.58101	1.795	0.58432	D	0.999999	D;D	0.76494	0.999;0.972	D;P	0.77004	0.989;0.888	T	0.54807	-0.8238	10	0.59425	D	0.04	.	18.3276	0.90259	0.0:0.0:1.0:0.0	.	100;108	B7ZLE1;Q14CM0	.;FRPD4_HUMAN	S	108;99;97	ENSP00000370057:G108S	ENSP00000304583:G97S	G	+	1	0	FRMPD4	12542821	1.000000	0.71417	1.000000	0.80357	0.013000	0.08279	9.221000	0.95188	2.268000	0.75426	0.594000	0.82650	GGC	.	.		0.507	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055771.1	XM_045712	
ATRX	546	hgsc.bcm.edu	37	X	76938720	76938720	+	Silent	SNP	A	A	G			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chrX:76938720A>G	ENST00000373344.5	-	9	2242	c.2028T>C	c.(2026-2028)aaT>aaC	p.N676N	ATRX_ENST00000395603.3_Silent_p.N638N|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	676					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						CTTCATCTGAATTAGATGTTA	0.373			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																														p.N676N		Atlas-SNP	.		Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	.	ATRX	833	.	1	Unknown(1)	bone(1)	c.T2028C						.						134.0	134.0	134.0					X																	76938720		2203	4293	6496	SO:0001819	synonymous_variant	546	exon9			ATCTGAATTAGAT	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.2028T>C	chrX.hg19:g.76938720A>G		82.0	0.0		100.0	37.0	NM_000489	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Silent	SNP	ENST00000373344.5	hg19	CCDS14434.1																																																																																			.	.		0.373	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058860.2	NM_000489	
MT-CO1	4512	hgsc.bcm.edu	37	M	5970	5970	+	Missense_Mutation	SNP	G	G	A			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chrM:5970G>A	ENST00000361624.2	+	1	67	c.67G>A	c.(67-69)Ggc>Agc	p.G23S	MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-CO2_ENST00000361739.1_5'Flank			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	23					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						ACCTATTATTCGGCGCATGAG	0.507																																					p.G23S		Atlas-SNP	.											.	.	.	.	0			c.G67A						.																																			SO:0001583	missense	5742	exon1			TTATTCGGCGCAT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.67G>A	chrM.hg19:g.5970G>A	ENSP00000354499:p.Gly23Ser	67.0	0.0		127.0	10.0	ENST00000361624	Q34770	Missense_Mutation	SNP	ENST00000361624.2	hg19																																																																																				.	.		0.507	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024028	
MT-ND5	4540	hgsc.bcm.edu	37	M	13289	13289	+	Missense_Mutation	SNP	G	G	A			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chrM:13289G>A	ENST00000361567.2	+	1	953	c.953G>A	c.(952-954)gGc>gAc	p.G318D	MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TP_ENST00000387461.2_RNA|MT-TR_ENST00000387439.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	318					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						AGTTACAATCGGCATCAACCA	0.453																																					p.G318D		Atlas-SNP	.											.	.	.	.	0			c.G953A						.																																			SO:0001583	missense	0	exon1			CAATCGGCATCAA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.953G>A	chrM.hg19:g.13289G>A	ENSP00000354813:p.Gly318Asp	55.0	0.0		89.0	32.0	ENST00000361567	Q34773|Q8WCY3	Missense_Mutation	SNP	ENST00000361567.2	hg19																																																																																				.	.		0.453	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
MT-ND6	4541	hgsc.bcm.edu	37	M	14459	14459	+	Missense_Mutation	SNP	G	G	A			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chrM:14459G>A	ENST00000361681.2	-	1	214	c.215C>T	c.(214-216)gCg>gTg	p.A72V	MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TP_ENST00000387461.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA			P03923	NU6M_HUMAN	mitochondrially encoded NADH dehydrogenase 6	72			A -> V (in MT-C1D and LDYT; most severe mutation with no vision recovery). {ECO:0000269|PubMed:20818383, ECO:0000269|PubMed:8016139}.		cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain (GO:0070469)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(10)|kidney(17)|urinary_tract(1)	29						CAATAGCCATCGCTGTAGTAT	0.438																																					p.A72V		Atlas-SNP	.											.	.	.	.	0			c.C215T						.																																			SO:0001583	missense	0	exon1			GCCATCGCTGTAG			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198695	ENSG00000198695	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7462	protein-coding gene	gene with protein product	"""complex I ND6 subunit"", ""NADH-ubiquinone oxidoreductase chain 6"""	516006	"""NADH dehydrogenase 6"""	MTND6			Standard			Approved	NAD6, ND6		P03923		ENST00000361681.2:c.215C>T	chrM.hg19:g.14459G>A	ENSP00000354665:p.Ala72Val	90.0	0.0		170.0	15.0	ENST00000361681	Q34774|Q8HG30	Missense_Mutation	SNP	ENST00000361681.2	hg19																																																																																				.	.		0.438	MT-ND6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024037	
MT-CYB	4519	hgsc.bcm.edu	37	M	15392	15392	+	Missense_Mutation	SNP	G	G	A			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chrM:15392G>A	ENST00000361789.2	+	1	646	c.646G>A	c.(646-648)Gat>Aat	p.D216N	MT-TE_ENST00000387459.1_RNA|MT-ND6_ENST00000361681.2_5'Flank|MT-TT_ENST00000387460.2_RNA|MT-TP_ENST00000387461.2_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	216					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						CCTCCCATTCCGATAAAATCA	0.463											OREG0007583	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																									p.D216N		Atlas-SNP	.											.	.	.	.	0			c.G646A						.																																			SO:0001583	missense	0	exon1			CATTCCGATAAAA			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.646G>A	chrM.hg19:g.15392G>A	ENSP00000354554:p.Asp216Asn	46.0	0.0	585	76.0	16.0	ENST00000361789	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Missense_Mutation	SNP	ENST00000361789.2	hg19																																																																																				.	.		0.463	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024038	
HERC2	8924	hgsc.bcm.edu	37	15	28419719	28419729	+	Frame_Shift_Del	DEL	CGTGCCATTGC	CGTGCCATTGC	-	rs373351931		TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	CGTGCCATTGC	CGTGCCATTGC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr15:28419719_28419729delCGTGCCATTGC	ENST00000261609.7	-	65	9977_9987	c.9869_9879delGCAATGGCACG	c.(9868-9879)ggcaatggcacgfs	p.GNGT3290fs		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TAACCGTGGTCGTGCCATTGCCCTGCTGGCC	0.498																																					p.3290_3294del		Atlas-INDEL	.											.	HERC2	501	.	0			c.9870_9880del						.																																			SO:0001589	frameshift_variant	8924	exon65			.	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.9869_9879delGCAATGGCACG	chr15.hg19:g.28419719_28419729delCGTGCCATTGC	ENSP00000261609:p.Gly3290fs	463.0	0.0		397.0	59.0	NM_004667		Frame_Shift_Del	DEL	ENST00000261609.7	hg19	CCDS10021.1																																																																																			.	.		0.498	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
MIRLET7BHG	400931	hgsc.bcm.edu	37	22	46501636	46501636	+	Frame_Shift_Del	DEL	C	C	-			TCGA-ZP-A9D4-01A-11D-A36X-10	TCGA-ZP-A9D4-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8a6d2530-b2f0-4021-988f-4a0f41cae737	e029bef5-a63c-42bb-9902-0acc5f1bb090	g.chr22:46501636delC	ENST00000381051.2	+	5	608	c.555delC	c.(553-555)ggcfs	p.G185fs	FLJ27365_ENST00000360737.3_Intron																							CCAGGCCAGGCCCGCATCCTC	0.701																																					.		Atlas-INDEL	.											.	.	.	.	0			.						.																																			SO:0001589	frameshift_variant	400931	.			.																												ENST00000381051.2:c.555delC	chr22.hg19:g.46501636delC	ENSP00000370439:p.Gly185fs	66.0	0.0		82.0	37.0	.		RNA	DEL	ENST00000381051.2	hg19																																																																																				.	.		0.701	FLJ27365-003	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000316783.1		
