#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
KAZN	23254	broad.mit.edu	37	1	15420685	15420685	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr1:15420685G>T	ENST00000376030.2	+	9	1526	c.1232G>T	c.(1231-1233)aGc>aTc	p.S411I		NM_201628.2	NP_963922.2	Q674X7	KAZRN_HUMAN	kazrin, periplakin interacting protein	411					keratinization (GO:0031424)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|desmosome (GO:0030057)|nucleus (GO:0005634)		p.S411I(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(6)|ovary(1)|prostate(2)	25						GACTCGGACAGCCAGTGCAGC	0.687																																							uc001avm.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1231-1233)AGC>ATC		kazrin isoform E							32.0	36.0	34.0					1																	15420685		2122	4225	6347	SO:0001583	missense	23254				keratinization	cornified envelope|cytoplasm|desmosome|nucleus		g.chr1:15420685G>T	AY505119	CCDS30604.1, CCDS41267.1, CCDS152.2, CCDS41268.1	1p36.21	2014-02-12	2011-01-31		ENSG00000189337	ENSG00000189337		"""Sterile alpha motif (SAM) domain containing"""	29173	protein-coding gene	gene with protein product						15337775, 18840647	Standard	NM_015209		Approved	KIAA1026, KAZRIN, FLJ43806	uc001avm.4	Q674X7	OTTHUMG00000002042	ENST00000376030.2:c.1232G>T	1.37:g.15420685G>T	ENSP00000365198:p.Ser411Ile						p.S411I	NM_201628	NP_963922	Q674X7	KAZRN_HUMAN			9	1513	+			411					B0QYQ0|B1AK78|Q5TGF1|Q674X4|Q674X6|Q6ZUD1|Q8IYN7|Q8N409|Q9UIL2|Q9UPX4	Missense_Mutation	SNP	ENST00000376030.2	37	c.1232G>T	CCDS152.2	.	.	.	.	.	.	.	.	.	.	G	16.19	3.054525	0.55218	.	.	ENSG00000189337	ENST00000376030	T	0.18960	2.18	4.47	4.47	0.54385	.	0.165540	0.39759	N	0.001268	T	0.11793	0.0287	N	0.19112	0.55	0.80722	D	1	P	0.37015	0.578	B	0.30029	0.11	T	0.16748	-1.0392	10	0.22706	T	0.39	-13.1596	12.9966	0.58650	0.0:0.0:1.0:0.0	.	411	Q674X7	KAZRN_HUMAN	I	411	ENSP00000365198:S411I	ENSP00000365198:S411I	S	+	2	0	KAZN	15293272	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.316000	0.72857	2.210000	0.71456	0.555000	0.69702	AGC		0.687	KAZN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005690.2	NM_001017999		12	18	1	0	6.72482e-11	0.003163	7.81812e-11	12	18				
SPEN	23013	broad.mit.edu	37	1	16261724	16261724	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr1:16261724G>A	ENST00000375759.3	+	11	9193	c.8989G>A	c.(8989-8991)Gaa>Aaa	p.E2997K		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	2997					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)	p.E2997K(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		ACTGCCTACAGAAGTCAACCA	0.592																																							uc001axk.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|breast(3)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15						c.(8989-8991)GAA>AAA		spen homolog, transcriptional regulator							79.0	79.0	79.0					1																	16261724		2203	4300	6503	SO:0001583	missense	23013				interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|Notch signaling pathway	nucleus	nucleotide binding|protein binding|RNA binding	g.chr1:16261724G>A		CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.8989G>A	1.37:g.16261724G>A	ENSP00000364912:p.Glu2997Lys					SPEN_uc010obp.1_Missense_Mutation_p.E2956K	p.E2997K	NM_015001	NP_055816	Q96T58	MINT_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)	11	9193	+		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)	2997					Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	ENST00000375759.3	37	c.8989G>A	CCDS164.1	.	.	.	.	.	.	.	.	.	.	g	10.87	1.472740	0.26423	.	.	ENSG00000065526	ENST00000375759	T	0.08896	3.04	5.58	4.68	0.58851	.	.	.	.	.	T	0.19927	0.0479	M	0.63428	1.95	0.44976	D	0.997996	D	0.55385	0.971	P	0.55011	0.766	T	0.00763	-1.1576	9	0.41790	T	0.15	-10.3039	14.7109	0.69232	0.0696:0.0:0.9304:0.0	.	2997	Q96T58	MINT_HUMAN	K	2997	ENSP00000364912:E2997K	ENSP00000364912:E2997K	E	+	1	0	SPEN	16134311	1.000000	0.71417	0.826000	0.32828	0.126000	0.20510	5.056000	0.64287	1.369000	0.46134	-0.215000	0.12644	GAA		0.592	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	NM_015001		11	48	0	0	0	0.00245	0	11	48				
SYTL1	84958	broad.mit.edu	37	1	27679907	27679907	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr1:27679907G>A	ENST00000543823.1	+	13	1939	c.1477G>A	c.(1477-1479)Gag>Aag	p.E493K	SYTL1_ENST00000318074.5_Missense_Mutation_p.E481K|SYTL1_ENST00000490170.1_3'UTR			Q8IYJ3	SYTL1_HUMAN	synaptotagmin-like 1	493	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)	extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|melanosome (GO:0042470)|plasma membrane (GO:0005886)	neurexin family protein binding (GO:0042043)	p.E493K(1)|p.E481K(1)		NS(1)|large_intestine(4)|lung(5)|ovary(1)|urinary_tract(1)	12		Colorectal(325;0.000147)|all_lung(284;0.000366)|Lung NSC(340;0.000548)|Renal(390;0.00211)|Breast(348;0.0115)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0908)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.5e-28)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.0013)|KIRC - Kidney renal clear cell carcinoma(1967;0.00158)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		GGCTTGTGCCGAGCTCTCCCT	0.657																																							uc001bnw.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1477-1479)GAG>AAG		synaptotagmin-like 1							43.0	39.0	40.0					1																	27679907		2203	4300	6503	SO:0001583	missense	84958				exocytosis|intracellular protein transport	extrinsic to plasma membrane|melanosome|soluble fraction	neurexin binding|Rab GTPase binding	g.chr1:27679907G>A	AK027902	CCDS298.1, CCDS53286.1	1p35.3	2008-02-05			ENSG00000142765	ENSG00000142765			15584	protein-coding gene	gene with protein product		608042				12137562	Standard	NM_032872		Approved	SLP1, JFC1, FLJ14996, exophilin-7	uc001bnw.2	Q8IYJ3	OTTHUMG00000005770	ENST00000543823.1:c.1477G>A	1.37:g.27679907G>A	ENSP00000440704:p.Glu493Lys					SYTL1_uc001bnv.1_Missense_Mutation_p.E481K|SYTL1_uc009vsu.1_Missense_Mutation_p.E428K|SYTL1_uc009vsv.1_Missense_Mutation_p.E493K	p.E493K	NM_032872	NP_116261	Q8IYJ3	SYTL1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.5e-28)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.0013)|KIRC - Kidney renal clear cell carcinoma(1967;0.00158)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)	14	1644	+		Colorectal(325;0.000147)|all_lung(284;0.000366)|Lung NSC(340;0.000548)|Renal(390;0.00211)|Breast(348;0.0115)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0908)|all_neural(195;0.0966)	493			C2 2.		Q5SSC9|Q96BB6|Q96GU6|Q96S89|Q96SI0	Missense_Mutation	SNP	ENST00000543823.1	37	c.1477G>A	CCDS53286.1	.	.	.	.	.	.	.	.	.	.	G	36	5.694778	0.96793	.	.	ENSG00000142765	ENST00000318074;ENST00000543823	T;T	0.75821	-0.97;-0.97	5.46	5.46	0.80206	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.89068	0.6610	M	0.90198	3.095	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.971;1.0	D	0.91054	0.4880	10	0.87932	D	0	-30.778	18.0609	0.89377	0.0:0.0:1.0:0.0	.	493;493;481	A8KAH3;Q8IYJ3;Q8IYJ3-2	.;SYTL1_HUMAN;.	K	481;493	ENSP00000316464:E481K;ENSP00000440704:E493K	ENSP00000316464:E481K	E	+	1	0	SYTL1	27552494	1.000000	0.71417	0.995000	0.50966	0.978000	0.69477	9.803000	0.99136	2.559000	0.86315	0.561000	0.74099	GAG		0.657	SYTL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_032872		7	24	0	0	0	0.00308	0	7	24				
S100PBP	64766	broad.mit.edu	37	1	33292039	33292039	+	Silent	SNP	C	C	G			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr1:33292039C>G	ENST00000373475.5	+	3	593	c.339C>G	c.(337-339)ctC>ctG	p.L113L	S100PBP_ENST00000356689.3_3'UTR|S100PBP_ENST00000373476.1_Silent_p.L113L|S100PBP_ENST00000398243.3_Silent_p.L113L	NM_022753.3	NP_073590.2			S100P binding protein									p.L113L(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|stomach(1)	16		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)				CTCCTGACCTCTTCAAACTAC	0.418																																							uc001bvz.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(337-339)CTC>CTG		S100P binding protein isoform a							52.0	50.0	51.0					1																	33292039		2203	4300	6503	SO:0001819	synonymous_variant	64766					nucleus	calcium-dependent protein binding	g.chr1:33292039C>G	BX647916	CCDS30666.1	1p35.1	2008-02-05			ENSG00000116497	ENSG00000116497			25768	protein-coding gene	gene with protein product	"""S100P binding protein 1"""	611889				12477932	Standard	NM_022753		Approved	FLJ12903, S100PBPR	uc001bwc.4	Q96BU1	OTTHUMG00000003955	ENST00000373475.5:c.339C>G	1.37:g.33292039C>G						S100PBP_uc001bwa.1_Silent_p.L113L|S100PBP_uc001bwb.1_Silent_p.L113L|S100PBP_uc001bwc.2_Silent_p.L113L|S100PBP_uc001bwd.2_RNA	p.L113L	NM_022753	NP_073590	Q96BU1	S1PBP_HUMAN			3	616	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)	113						Silent	SNP	ENST00000373475.5	37	c.339C>G	CCDS30666.1																																																																																				0.418	S100PBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011266.1	NM_022753		37	39	0	0	0	0.006999	0	37	39				
CSMD2	114784	broad.mit.edu	37	1	34180202	34180202	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr1:34180202G>T	ENST00000373381.4	-	21	3567	c.3391C>A	c.(3391-3393)Ctg>Atg	p.L1131M		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1091	CUB 7. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L1091M(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CACCTTGGCAGAGGCGAGCTC	0.602																																							uc001bxn.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|skin(5)|pancreas(1)	12						c.(3271-3273)CTG>ATG		CUB and Sushi multiple domains 2							141.0	160.0	154.0					1																	34180202		2202	4300	6502	SO:0001583	missense	114784					integral to membrane|plasma membrane	protein binding	g.chr1:34180202G>T	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.3391C>A	1.37:g.34180202G>T	ENSP00000362479:p.Leu1131Met					CSMD2_uc001bxm.1_Missense_Mutation_p.L1131M	p.L1091M	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN			21	3300	-		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)	1091			Sushi 6.|Extracellular (Potential).		B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373381.4	37	c.3271C>A		.	.	.	.	.	.	.	.	.	.	G	28.2	4.900810	0.92035	.	.	ENSG00000121904	ENST00000373381	T	0.65916	-0.18	5.85	5.85	0.93711	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000003	T	0.79713	0.4493	M	0.71206	2.165	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.997;0.998	T	0.79923	-0.1598	10	0.62326	D	0.03	.	19.1531	0.93496	0.0:0.0:1.0:0.0	.	1091;1131	Q7Z408;E7EUA6	CSMD2_HUMAN;.	M	1131	ENSP00000362479:L1131M	ENSP00000241312:L1091M	L	-	1	2	CSMD2	33952789	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.753000	0.94483	0.655000	0.94253	CTG		0.602	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896		79	289	1	0	2.93434e-44	0.01441	4.22857e-44	79	289				
GJB4	127534	broad.mit.edu	37	1	35227576	35227576	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr1:35227576C>A	ENST00000339480.1	+	2	1091	c.721C>A	c.(721-723)Cag>Aag	p.Q241K	RP1-34M23.5_ENST00000542839.1_RNA	NM_153212.2	NP_694944.1	Q9NTQ9	CXB4_HUMAN	gap junction protein, beta 4, 30.3kDa	241					cell communication (GO:0007154)|olfactory behavior (GO:0042048)|sensory perception of smell (GO:0007608)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)		p.Q241K(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)|skin(1)	16		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.234)				TGTCCTCTCCCAGGGAGGGCA	0.617																																							uc001bxv.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(721-723)CAG>AAG		gap junction protein, beta 4							45.0	39.0	41.0					1																	35227576		2203	4300	6503	SO:0001583	missense	127534				cell communication	connexon complex|integral to membrane	gap junction channel activity	g.chr1:35227576C>A		CCDS383.1	1p35-p34	2008-05-14	2007-11-06		ENSG00000189433	ENSG00000189433		"""Ion channels / Gap junction proteins (connexins)"""	4286	protein-coding gene	gene with protein product	"""connexin 30.3"""	605425	"""gap junction protein, beta 4 (connexin 30.3)"", ""gap junction protein, beta 4"""				Standard	NM_153212		Approved	CX30.3	uc001bxv.1	Q9NTQ9	OTTHUMG00000004052	ENST00000339480.1:c.721C>A	1.37:g.35227576C>A	ENSP00000345868:p.Gln241Lys					GJB4_uc001bxw.3_Missense_Mutation_p.Q241K	p.Q241K	NM_153212	NP_694944	Q9NTQ9	CXB4_HUMAN			2	1091	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.234)	241			Cytoplasmic (Potential).		B3KQ82	Missense_Mutation	SNP	ENST00000339480.1	37	c.721C>A	CCDS383.1	.	.	.	.	.	.	.	.	.	.	C	13.02	2.111663	0.37242	.	.	ENSG00000189433	ENST00000339480	D	0.97553	-4.43	5.33	1.2	0.21068	.	1.885630	0.02545	N	0.095007	D	0.90676	0.7075	N	0.17082	0.46	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	D	0.84084	0.0386	10	0.02654	T	1	.	1.9261	0.03317	0.1451:0.4942:0.1323:0.2284	.	241	Q9NTQ9	CXB4_HUMAN	K	241	ENSP00000345868:Q241K	ENSP00000345868:Q241K	Q	+	1	0	GJB4	35000163	0.776000	0.28616	0.022000	0.16811	0.593000	0.36681	1.363000	0.34159	0.036000	0.15547	-0.304000	0.09214	CAG		0.617	GJB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011560.1	NM_153212		14	15	1	0	3.45872e-05	0.004007	3.68217e-05	14	15				
ZMYM6	9204	broad.mit.edu	37	1	35477543	35477543	+	Nonsense_Mutation	SNP	G	G	C			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr1:35477543G>C	ENST00000357182.4	-	8	1237	c.1010C>G	c.(1009-1011)tCa>tGa	p.S337*	ZMYM6_ENST00000487874.1_Nonsense_Mutation_p.S337*|ZMYM6_ENST00000493328.1_5'UTR|ZMYM6_ENST00000373340.2_Nonsense_Mutation_p.S337*	NM_007167.3	NP_009098.3	O95789	ZMYM6_HUMAN	zinc finger, MYM-type 6	337					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.S337*(1)		breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(10)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	44		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.13)				AGTTCCATTTGACATGGCTAG	0.398																																							uc001byh.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)	3						c.(1009-1011)TCA>TGA		zinc finger protein 258							156.0	136.0	143.0					1																	35477543		2203	4300	6503	SO:0001587	stop_gained	9204				multicellular organismal development	nucleus	DNA binding|zinc ion binding	g.chr1:35477543G>C	AF055470	CCDS387.2	1p34.2	2014-05-12	2005-09-12	2005-09-12	ENSG00000163867	ENSG00000163867		"""Zinc fingers, MYM type"", ""Zinc fingers, BED-type"""	13050	protein-coding gene	gene with protein product	"""zinc finger, BED-type containing 7"""	613567	"""zinc finger protein 258"", ""zinc finger, MYM-type containing 6"""	ZNF258		10486218, 23533661	Standard	NM_007167		Approved	ZNF198L4, MYM, Buster2, ZBED7	uc001byh.3	O95789	OTTHUMG00000004163	ENST00000357182.4:c.1010C>G	1.37:g.35477543G>C	ENSP00000349708:p.Ser337*					ZMYM6_uc001byf.1_Nonsense_Mutation_p.S337*|ZMYM6_uc010oht.1_Nonsense_Mutation_p.S240*|ZMYM6_uc009vup.2_Nonsense_Mutation_p.S143*|ZMYM6_uc009vuq.1_Nonsense_Mutation_p.S337*|ZMYM6_uc009vur.1_Nonsense_Mutation_p.S143*	p.S337*	NM_007167	NP_009098	O95789	ZMYM6_HUMAN			8	1238	-		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.13)	337					B4DRJ6|Q32Q23|Q4G108|Q5SVZ9|Q5SW00|Q69YL4|Q96IY0|Q9NWF1|Q9P2J4	Nonsense_Mutation	SNP	ENST00000357182.4	37	c.1010C>G	CCDS387.2	.	.	.	.	.	.	.	.	.	.	G	39	7.639863	0.98406	.	.	ENSG00000163867	ENST00000373340;ENST00000357182	.	.	.	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-13.9504	19.1372	0.93433	0.0:0.0:1.0:0.0	.	.	.	.	X	337	.	ENSP00000349708:S337X	S	-	2	0	ZMYM6	35250130	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.596000	0.67570	2.827000	0.97445	0.650000	0.86243	TCA		0.398	ZMYM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011999.1	NM_007167		13	55	0	0	0	0.006122	0	13	55				
MACF1	23499	broad.mit.edu	37	1	39844179	39844179	+	Silent	SNP	A	A	G			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr1:39844179A>G	ENST00000372915.3	+	52	13362	c.13275A>G	c.(13273-13275)ggA>ggG	p.G4425G	MACF1_ENST00000545844.1_Silent_p.G2358G|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000317713.7_Silent_p.G2358G|MACF1_ENST00000564288.1_Silent_p.G4420G|MACF1_ENST00000361689.2_Silent_p.G2358G|MACF1_ENST00000567887.1_Silent_p.G4457G|MACF1_ENST00000289893.4_Silent_p.G2860G			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	4425					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.G2860G(1)|p.G2358G(1)		breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GTGTAAACGGATACCACACCT	0.458																																							uc010oiu.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16						c.(8578-8580)GGA>GGG		microfilament and actin filament cross-linker							265.0	200.0	222.0					1																	39844179		2203	4300	6503	SO:0001819	synonymous_variant	23499				cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding	g.chr1:39844179A>G	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.13275A>G	1.37:g.39844179A>G						MACF1_uc010ois.1_Silent_p.G2358G|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron	p.G2860G	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)		17	8711	+	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	4425					B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Silent	SNP	ENST00000372915.3	37	c.8580A>G																																																																																					0.458	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044		30	54	0	0	0	0.004289	0	30	54				
MYCL	4610	broad.mit.edu	37	1	40363447	40363447	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr1:40363447C>A	ENST00000372816.2	-	2	1139	c.692G>T	c.(691-693)aGg>aTg	p.R231M	RP1-118J21.5_ENST00000418255.1_RNA|MYCL_ENST00000397332.2_Missense_Mutation_p.R261M			P12524	MYCL_HUMAN	v-myc avian myelocytomatosis viral oncogene lung carcinoma derived homolog	231						nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R261M(1)									TTGGGGACCCCTCTCTGAAGC	0.522																																							uc001cer.1		NA								A							small cell lung 		1	Substitution - Missense(1)		lung(1)	lung(1)|liver(1)	2						c.(691-693)AGG>ATG		l-myc-1 proto-oncogene isoform 1							113.0	124.0	120.0					1																	40363447		2203	4300	6503	SO:0001583	missense	4610					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr1:40363447C>A		CCDS30682.1, CCDS44117.1, CCDS44117.2, CCDS53300.1	1p34.3	2013-07-09	2013-07-09	2013-07-09	ENSG00000116990	ENSG00000116990		"""Basic helix-loop-helix proteins"""	7555	protein-coding gene	gene with protein product	"""l-myc protein"", ""myc-related gene from lung cancer"", ""oncogene lmyc"""	164850	"""v-myc avian myelocytomatosis viral oncogene homolog 1, lung carcinoma derived"""	MYCL1		8978772	Standard	NM_001033082		Approved	LMYC, bHLHe38	uc001cer.2	P12524	OTTHUMG00000009243	ENST00000372816.2:c.692G>T	1.37:g.40363447C>A	ENSP00000361903:p.Arg231Met					MYCL1_uc001ces.1_Missense_Mutation_p.R231M	p.R231M	NM_001033082	NP_001028254	P12524	MYCL1_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;1.51e-19)|Epithelial(16;3.36e-18)|all cancers(16;8.43e-17)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)		3	909	-	all_cancers(7;1.73e-14)|all_lung(5;2.77e-17)|all_epithelial(6;6.81e-17)|Lung SC(1;2.85e-13)|Lung NSC(20;7.03e-07)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	231					A2A2C9|B4DJH2|Q14897|Q5QPL0|Q5QPL1|Q9NUE9	Missense_Mutation	SNP	ENST00000372816.2	37	c.692G>T	CCDS30682.1	.	.	.	.	.	.	.	.	.	.	C	7.644	0.681568	0.14907	.	.	ENSG00000116990	ENST00000397332;ENST00000372816	T;T	0.79247	-1.04;-1.25	5.76	-0.0835	0.13694	.	3.190950	0.01462	U	0.015931	T	0.64638	0.2616	N	0.08118	0	0.09310	N	0.999997	P	0.38110	0.618	B	0.43123	0.409	T	0.58912	-0.7552	10	0.72032	D	0.01	-10.2014	4.3331	0.11073	0.0:0.2353:0.3584:0.4062	.	231	P12524	MYCL1_HUMAN	M	261;231	ENSP00000380494:R261M;ENSP00000361903:R231M	ENSP00000361903:R231M	R	-	2	0	MYCL1	40136034	0.001000	0.12720	0.000000	0.03702	0.376000	0.30014	0.107000	0.15375	0.142000	0.18901	-0.122000	0.15005	AGG		0.522	MYCL-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277004.1	NM_001033082		12	210	1	0	1.05317e-09	0.00245	1.2059e-09	12	210				
ZCCHC11	23318	broad.mit.edu	37	1	52901105	52901105	+	Nonsense_Mutation	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr1:52901105G>A	ENST00000371544.3	-	27	4454	c.4192C>T	c.(4192-4194)Caa>Taa	p.Q1398*	ZCCHC11_ENST00000257177.4_Nonsense_Mutation_p.Q1399*	NM_001009881.2|NM_015269.2	NP_001009881.1|NP_056084.1	Q5TAX3	TUT4_HUMAN	zinc finger, CCHC domain containing 11	1398	Gln-rich.				cytokine production (GO:0001816)|miRNA catabolic process (GO:0010587)|miRNA metabolic process (GO:0010586)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|pre-miRNA processing (GO:0031054)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|RNA 3'-end processing (GO:0031123)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)	p.Q1399*(1)		NS(2)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(17)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	58						GCCACCTGTTGAGCATTTACA	0.433																																							uc001ctx.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|skin(1)	3						c.(4192-4194)CAA>TAA		zinc finger, CCHC domain containing 11 isoform							114.0	98.0	103.0					1																	52901105		2203	4300	6503	SO:0001587	stop_gained	23318				miRNA catabolic process|pre-miRNA processing|RNA 3'-end processing|stem cell maintenance	cytoplasm|nucleolus	nucleic acid binding|protein binding|protein binding|RNA uridylyltransferase activity|zinc ion binding	g.chr1:52901105G>A	D83776	CCDS30715.1, CCDS30716.1	1p32.3	2014-03-05			ENSG00000134744	ENSG00000134744		"""Zinc fingers, CCHC domain containing"""	28981	protein-coding gene	gene with protein product	"""TUTase4"""	613692				8724849, 12239557	Standard	NM_015269		Approved	KIAA0191, PAPD3, TUT4	uc001cty.2	Q5TAX3	OTTHUMG00000008200	ENST00000371544.3:c.4192C>T	1.37:g.52901105G>A	ENSP00000360599:p.Gln1398*					ZCCHC11_uc001cty.2_Nonsense_Mutation_p.Q1399*|ZCCHC11_uc001ctz.2_Nonsense_Mutation_p.Q1394*|ZCCHC11_uc001cua.1_Nonsense_Mutation_p.Q316*	p.Q1398*	NM_015269	NP_056084	Q5TAX3	TUT4_HUMAN			27	4426	-			1398			Gln-rich.		A2RRP0|B7Z8J5|D3DQ35|Q12764|Q5TAX2|Q5TAX4|Q86XZ3	Nonsense_Mutation	SNP	ENST00000371544.3	37	c.4192C>T	CCDS30716.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	29.8|29.8	5.039747|5.039747	0.93630|0.93630	.|.	.|.	ENSG00000134744|ENSG00000134744	ENST00000257177;ENST00000371544;ENST00000531722|ENST00000474453	.|.	.|.	.|.	5.1|5.1	5.1|5.1	0.69264|0.69264	.|.	0.220017|.	0.38837|.	N|.	0.001559|.	.|T	.|0.72120	.|0.3421	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.71314	.|-0.4630	.|4	0.44086|.	T|.	0.13|.	.|.	16.3003|16.3003	0.82806|0.82806	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|L	1399;1398;236|243	.|.	ENSP00000257177:Q1399X|.	Q|S	-|-	1|2	0|0	ZCCHC11|ZCCHC11	52673693|52673693	1.000000|1.000000	0.71417|0.71417	0.981000|0.981000	0.43875|0.43875	0.993000|0.993000	0.82548|0.82548	7.587000|7.587000	0.82613|0.82613	2.390000|2.390000	0.81377|0.81377	0.467000|0.467000	0.42956|0.42956	CAA|TCA		0.433	ZCCHC11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022462.1	XM_038288		29	24	0	0	0	0.012213	0	29	24				
PODN	127435	broad.mit.edu	37	1	53535678	53535678	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr1:53535678G>T	ENST00000312553.5	+	2	302	c.295G>T	c.(295-297)Gtg>Ttg	p.V99L	PODN_ENST00000395871.2_Missense_Mutation_p.V99L|PODN_ENST00000371500.3_Missense_Mutation_p.V80L|RP11-334A14.5_ENST00000447867.1_RNA	NM_001199081.1|NM_153703.4	NP_001186010.1|NP_714914.2	Q7Z5L7	PODN_HUMAN	podocan	51					negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)	p.V99L(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(11)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						GGAGGAGCCGGTGCTGGTACT	0.692																																							uc001cuv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(295-297)GTG>TTG		podocan							23.0	30.0	27.0					1																	53535678		2203	4299	6502	SO:0001583	missense	127435				negative regulation of cell migration|negative regulation of cell proliferation	cytoplasm|extracellular space|proteinaceous extracellular matrix	collagen binding	g.chr1:53535678G>T	AY313607	CCDS573.1, CCDS55601.1, CCDS55602.1	1p32.3	2008-02-05			ENSG00000174348	ENSG00000174348		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	23174	protein-coding gene	gene with protein product	"""podocan proteoglycan"""	608661					Standard	NM_153703		Approved	PCAN, PODOCAN, MGC24995, SLRR5A	uc010onr.2	Q7Z5L7	OTTHUMG00000008934	ENST00000312553.5:c.295G>T	1.37:g.53535678G>T	ENSP00000308315:p.Val99Leu					PODN_uc001cuw.2_Missense_Mutation_p.V80L|PODN_uc010onr.1_Missense_Mutation_p.V80L|PODN_uc010ons.1_Missense_Mutation_p.V99L	p.V99L	NM_153703	NP_714914	Q7Z5L7	PODN_HUMAN			2	302	+			51					B4DKN5|B4E373|Q5VVZ2|Q5VVZ3|Q6PIR3|Q6UXL8|Q8N641	Missense_Mutation	SNP	ENST00000312553.5	37	c.295G>T	CCDS573.1	.	.	.	.	.	.	.	.	.	.	G	11.18	1.562836	0.27915	.	.	ENSG00000174348	ENST00000371500;ENST00000395871;ENST00000312553	T;T;T	0.59906	0.98;0.23;1.08	4.22	2.23	0.28157	.	0.519075	0.17816	N	0.161042	T	0.36744	0.0978	N	0.22421	0.69	0.09310	N	1	B;B;B	0.17038	0.002;0.02;0.02	B;B;B	0.15484	0.0;0.013;0.013	T	0.13202	-1.0518	10	0.30854	T	0.27	.	5.2681	0.15611	0.11:0.0:0.6889:0.2011	.	99;80;99	Q7Z5L7-4;Q7Z5L7-2;Q7Z5L7-3	.;.;.	L	80;99;99	ENSP00000360555:V80L;ENSP00000379212:V99L;ENSP00000308315:V99L	ENSP00000308315:V99L	V	+	1	0	PODN	53308266	1.000000	0.71417	0.884000	0.34674	0.189000	0.23516	5.092000	0.64511	0.962000	0.38057	0.491000	0.48974	GTG		0.692	PODN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000024735.1	NM_153703		10	14	1	0	1.76689e-08	0.006214	1.96379e-08	10	14				
GBP6	163351	broad.mit.edu	37	1	89834209	89834209	+	Missense_Mutation	SNP	G	G	C	rs71584945		TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr1:89834209G>C	ENST00000370456.4	+	2	192	c.99G>C	c.(97-99)aaG>aaC	p.K33N	GBP6_ENST00000535065.1_Intron	NM_198460.2	NP_940862.2	Q6ZN66	GBP6_HUMAN	guanylate binding protein family, member 6	33	GTPase domain (Globular). {ECO:0000250}.				cellular response to interferon-gamma (GO:0071346)|defense response to bacterium (GO:0042742)|immune response (GO:0006955)	extracellular vesicular exosome (GO:0070062)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.K33N(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	42		Lung NSC(277;0.0908)		all cancers(265;0.0108)|Epithelial(280;0.0398)		TTCTTGAAAAGATTTCTCAGC	0.473																																							uc001dnf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(97-99)AAG>AAC		guanylate binding protein family, member 6							143.0	137.0	139.0					1																	89834209		2203	4300	6503	SO:0001583	missense	163351						GTP binding|GTPase activity	g.chr1:89834209G>C	BX537949	CCDS723.1	1p22	2008-02-05			ENSG00000183347	ENSG00000183347			25395	protein-coding gene	gene with protein product		612467					Standard	NM_198460		Approved	DKFZp686G0786	uc001dnf.2	Q6ZN66	OTTHUMG00000010123	ENST00000370456.4:c.99G>C	1.37:g.89834209G>C	ENSP00000359485:p.Lys33Asn					GBP6_uc010ost.1_Intron	p.K33N	NM_198460	NP_940862	Q6ZN66	GBP6_HUMAN		all cancers(265;0.0108)|Epithelial(280;0.0398)	2	373	+		Lung NSC(277;0.0908)	33					A2RRM3|Q6ZN86|Q7Z3F0	Missense_Mutation	SNP	ENST00000370456.4	37	c.99G>C	CCDS723.1	.	.	.	.	.	.	.	.	.	.	G	8.968	0.972212	0.18736	.	.	ENSG00000183347	ENST00000544311;ENST00000370456	T	0.61392	0.11	4.46	-0.2	0.13216	Guanylate-binding protein, N-terminal (1);	0.682217	0.14301	N	0.328299	T	0.26774	0.0655	L	0.35414	1.06	0.09310	N	0.999998	B	0.12630	0.006	B	0.20577	0.03	T	0.34153	-0.9840	10	0.33141	T	0.24	-3.5343	15.6553	0.77129	0.0:0.6087:0.3913:0.0	.	33	Q6ZN66	GBP6_HUMAN	N	33	ENSP00000359485:K33N	ENSP00000359485:K33N	K	+	3	2	GBP6	89606797	0.003000	0.15002	0.185000	0.23176	0.168000	0.22595	-0.312000	0.08113	-0.019000	0.14055	-0.479000	0.04858	AAG		0.473	GBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028001.1	NM_198460		45	69	0	0	0	0.01441	0	45	69				
HFM1	164045	broad.mit.edu	37	1	91727809	91727809	+	Silent	SNP	T	T	C			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr1:91727809T>C	ENST00000370425.3	-	38	4325	c.4227A>G	c.(4225-4227)gaA>gaG	p.E1409E	HFM1_ENST00000294696.5_3'UTR|HFM1_ENST00000462405.1_5'UTR|Y_RNA_ENST00000384090.1_RNA|HFM1_ENST00000370424.3_Silent_p.E1088E	NM_001017975.3	NP_001017975.3	A2PYH4	HFM1_HUMAN	HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)	1409					resolution of meiotic recombination intermediates (GO:0000712)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)	p.E1409E(1)		breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(33)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	75		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		TGAAATCAACTTCCTTTTTAC	0.264																																							uc001doa.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(4225-4227)GAA>GAG		HFM1 protein							35.0	33.0	34.0					1																	91727809		1794	4052	5846	SO:0001819	synonymous_variant	164045						ATP binding|ATP-dependent helicase activity|nucleic acid binding	g.chr1:91727809T>C	AB204867	CCDS30769.2	1p22.2	2008-03-26			ENSG00000162669	ENSG00000162669			20193	protein-coding gene	gene with protein product		615684	"""SEC63 domain containing 1"""	SEC63D1		14702039, 17286053	Standard	XM_006710395		Approved	MER3, FLJ39011, FLJ36760	uc001doa.4	A2PYH4	OTTHUMG00000010093	ENST00000370425.3:c.4227A>G	1.37:g.91727809T>C						HFM1_uc009wdb.2_RNA|HFM1_uc010osu.1_Silent_p.E1088E|HFM1_uc001dob.3_Silent_p.E597E	p.E1409E	NM_001017975	NP_001017975	A2PYH4	HFM1_HUMAN		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)	38	4327	-		all_lung(203;0.00961)|Lung NSC(277;0.0351)	1409					B1B0B6|Q8N9Q0	Silent	SNP	ENST00000370425.3	37	c.4227A>G	CCDS30769.2	.	.	.	.	.	.	.	.	.	.	T	3.023	-0.201360	0.06219	.	.	ENSG00000162669	ENST00000430465	.	.	.	4.85	-0.413	0.12363	.	.	.	.	.	T	0.26085	0.0636	.	.	.	0.35444	D	0.795084	.	.	.	.	.	.	T	0.11324	-1.0592	4	.	.	.	.	4.3675	0.11232	0.1554:0.3725:0.0:0.472	.	.	.	.	R	621	.	.	K	-	2	0	HFM1	91500397	0.178000	0.23122	0.883000	0.34634	0.631000	0.37964	0.230000	0.17852	-0.161000	0.10983	-0.388000	0.06559	AAG		0.264	HFM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316716.2	NM_001017975		14	13	0	0	0	0.00245	0	14	13				
HFM1	164045	broad.mit.edu	37	1	91841230	91841230	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr1:91841230C>T	ENST00000370425.3	-	12	1548	c.1450G>A	c.(1450-1452)Gag>Aag	p.E484K	HFM1_ENST00000294696.5_5'UTR|HFM1_ENST00000370424.3_Missense_Mutation_p.E163K	NM_001017975.3	NP_001017975.3	A2PYH4	HFM1_HUMAN	HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)	484					resolution of meiotic recombination intermediates (GO:0000712)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)	p.E484K(1)		breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(33)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	75		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		CTATGGCTCTCATCCATTTTC	0.368																																							uc001doa.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1450-1452)GAG>AAG		HFM1 protein							129.0	122.0	124.0					1																	91841230		1860	4100	5960	SO:0001583	missense	164045						ATP binding|ATP-dependent helicase activity|nucleic acid binding	g.chr1:91841230C>T	AB204867	CCDS30769.2	1p22.2	2008-03-26			ENSG00000162669	ENSG00000162669			20193	protein-coding gene	gene with protein product		615684	"""SEC63 domain containing 1"""	SEC63D1		14702039, 17286053	Standard	XM_006710395		Approved	MER3, FLJ39011, FLJ36760	uc001doa.4	A2PYH4	OTTHUMG00000010093	ENST00000370425.3:c.1450G>A	1.37:g.91841230C>T	ENSP00000359454:p.Glu484Lys					HFM1_uc010osu.1_Missense_Mutation_p.E163K|HFM1_uc010osv.1_Missense_Mutation_p.E168K	p.E484K	NM_001017975	NP_001017975	A2PYH4	HFM1_HUMAN		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)	12	1550	-		all_lung(203;0.00961)|Lung NSC(277;0.0351)	484					B1B0B6|Q8N9Q0	Missense_Mutation	SNP	ENST00000370425.3	37	c.1450G>A	CCDS30769.2	.	.	.	.	.	.	.	.	.	.	C	22.8	4.332726	0.81801	.	.	ENSG00000162669	ENST00000370425;ENST00000370424;ENST00000370421;ENST00000541820	T;D	0.91351	0.17;-2.83	5.4	5.4	0.78164	DEAD-like helicase (1);	0.127854	0.29021	U	0.013398	D	0.90504	0.7025	M	0.89214	3.015	0.47698	D	0.999495	P;P	0.48694	0.914;0.77	B;B	0.43194	0.411;0.357	D	0.89767	0.3951	10	0.22109	T	0.4	.	19.1759	0.93602	0.0:1.0:0.0:0.0	.	163;484	A6NGI5;A2PYH4	.;HFM1_HUMAN	K	484;163;168;517	ENSP00000359454:E484K;ENSP00000359453:E163K	ENSP00000359450:E168K	E	-	1	0	HFM1	91613818	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.762000	0.85270	2.544000	0.85801	0.563000	0.77884	GAG		0.368	HFM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316716.2	NM_001017975		35	143	0	0	0	0.006999	0	35	143				
HSP90B3P	343477	broad.mit.edu	37	1	92109200	92109200	+	IGR	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr1:92109200G>T								CDC7 (117879 upstream) : TGFBR3 (36701 downstream)																							AGTACGGACGGTCTGGCAACA	0.453																																							uc010osx.1		NA																	0					0						c.(1225-1227)CGG>CGT		SubName: Full=cDNA FLJ58812, highly similar to Endoplasmin (Heat shock protein 90kDa beta member 1);																																				SO:0001628	intergenic_variant	343477							g.chr1:92109200G>T																													1.37:g.92109200G>T							p.R409R	NR_003130						3	1227	+									Silent	SNP		37	c.1227G>T																																																																																				0	0.453									15	24	1	0	1.50039e-11	0.012319	1.76599e-11	15	24				
EPS8L3	79574	broad.mit.edu	37	1	110293406	110293406	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr1:110293406C>A	ENST00000361965.4	-	18	1752	c.1646G>T	c.(1645-1647)aGg>aTg	p.R549M	EPS8L3_ENST00000361852.4_Missense_Mutation_p.R519M|EPS8L3_ENST00000369805.3_Missense_Mutation_p.R550M|RP4-735C1.4_ENST00000431955.1_RNA	NM_133181.3	NP_573444.2	Q8TE67	ES8L3_HUMAN	EPS8-like 3	549						cytoplasm (GO:0005737)		p.R550M(1)		breast(1)|endometrium(3)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|upper_aerodigestive_tract(1)	32		all_epithelial(167;1.95e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)		Lung(183;0.0245)|Colorectal(144;0.0365)|all cancers(265;0.103)|Epithelial(280;0.109)|LUSC - Lung squamous cell carcinoma(189;0.137)|COAD - Colon adenocarcinoma(174;0.141)		CCCAAGTGTCCTCACCGTGCT	0.607																																							uc001dyr.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(1645-1647)AGG>ATG		epidermal growth factor receptor pathway							55.0	42.0	47.0					1																	110293406		2203	4300	6503	SO:0001583	missense	79574					cytoplasm	protein binding	g.chr1:110293406C>A	AK025175	CCDS813.1, CCDS814.1, CCDS815.1	1p13.2	2008-02-05			ENSG00000198758	ENSG00000198758			21297	protein-coding gene	gene with protein product		614989				12620401	Standard	NM_139053		Approved	FLJ21522, MGC16817	uc001dyq.2	Q8TE67	OTTHUMG00000011651	ENST00000361965.4:c.1646G>T	1.37:g.110293406C>A	ENSP00000355255:p.Arg549Met					EPS8L3_uc001dys.1_Missense_Mutation_p.R519M|EPS8L3_uc001dyq.1_Missense_Mutation_p.R550M|EPS8L3_uc009wfm.1_Missense_Mutation_p.R486M	p.R549M	NM_133181	NP_573444	Q8TE67	ES8L3_HUMAN		Lung(183;0.0245)|Colorectal(144;0.0365)|all cancers(265;0.103)|Epithelial(280;0.109)|LUSC - Lung squamous cell carcinoma(189;0.137)|COAD - Colon adenocarcinoma(174;0.141)	18	1791	-		all_epithelial(167;1.95e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)	549					A8K833|Q5T8Q6|Q5T8Q7|Q5T8Q8|Q96E47|Q9H719	Missense_Mutation	SNP	ENST00000361965.4	37	c.1646G>T	CCDS814.1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.970273	0.92855	.	.	ENSG00000198758	ENST00000361852;ENST00000369805;ENST00000361965	T;T;T	0.17854	2.25;2.25;2.25	5.55	-1.6	0.08426	.	0.496162	0.22688	N	0.056847	T	0.15089	0.0364	L	0.53249	1.67	0.29840	N	0.829278	D;D;D	0.71674	0.997;0.998;0.974	P;P;P	0.61940	0.896;0.789;0.724	T	0.05599	-1.0875	10	0.59425	D	0.04	-13.5936	10.3688	0.44042	0.0:0.5897:0.0:0.4103	.	519;549;550	Q8TE67-2;Q8TE67;Q8TE67-3	.;ES8L3_HUMAN;.	M	519;550;549	ENSP00000354551:R519M;ENSP00000358820:R550M;ENSP00000355255:R549M	ENSP00000354551:R519M	R	-	2	0	EPS8L3	110094929	0.001000	0.12720	0.567000	0.28434	0.960000	0.62799	-1.202000	0.03023	-0.598000	0.05806	0.491000	0.48974	AGG		0.607	EPS8L3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000032234.1	NM_024526		8	27	1	0	1.76689e-08	0.006214	1.96379e-08	8	27				
SLC6A17	388662	broad.mit.edu	37	1	110709673	110709673	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr1:110709673C>T	ENST00000331565.4	+	2	607	c.122C>T	c.(121-123)gCt>gTt	p.A41V	RP5-1028L10.1_ENST00000430098.1_RNA|RP5-1028L10.1_ENST00000418579.1_RNA|RP5-1028L10.1_ENST00000443008.1_RNA	NM_001010898.2	NP_001010898.1	Q9H1V8	S6A17_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 17	41					alanine transport (GO:0032328)|glycine transport (GO:0015816)|leucine transport (GO:0015820)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synaptic vesicle (GO:0008021)	neurotransmitter:sodium symporter activity (GO:0005328)	p.A41V(1)		breast(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37		all_cancers(81;9.9e-06)|all_epithelial(167;3.24e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0282)|Epithelial(280;0.0372)|all cancers(265;0.0378)|Colorectal(144;0.0438)|LUSC - Lung squamous cell carcinoma(189;0.151)|COAD - Colon adenocarcinoma(174;0.151)		CTGAATGTGGCTGGTGAGGCA	0.612																																							uc009wfq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(121-123)GCT>GTT		solute carrier family 6, member 17							57.0	48.0	51.0					1																	110709673		2203	4300	6503	SO:0001583	missense	388662				alanine transport|glycine transport|leucine transport|proline transport	cell junction|integral to plasma membrane|synaptic vesicle membrane	neurotransmitter:sodium symporter activity	g.chr1:110709673C>T		CCDS30799.1	1p13.2	2013-07-19	2013-07-19		ENSG00000197106	ENSG00000197106		"""Solute carriers"""	31399	protein-coding gene	gene with protein product		610299	"""solute carrier family 6 (neurotransmitter transporter), member 17"", ""solute carrier family 6, member 17"""				Standard	NM_001010898		Approved		uc009wfq.3	Q9H1V8	OTTHUMG00000011761	ENST00000331565.4:c.122C>T	1.37:g.110709673C>T	ENSP00000330199:p.Ala41Val						p.A41V	NM_001010898	NP_001010898	Q9H1V8	S6A17_HUMAN		Lung(183;0.0282)|Epithelial(280;0.0372)|all cancers(265;0.0378)|Colorectal(144;0.0438)|LUSC - Lung squamous cell carcinoma(189;0.151)|COAD - Colon adenocarcinoma(174;0.151)	2	583	+		all_cancers(81;9.9e-06)|all_epithelial(167;3.24e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)	41			Cytoplasmic (Potential).		A6NEA8|A8K1R7|B9EIR5|Q5T5Q9	Missense_Mutation	SNP	ENST00000331565.4	37	c.122C>T	CCDS30799.1	.	.	.	.	.	.	.	.	.	.	C	13.84	2.357873	0.41801	.	.	ENSG00000197106	ENST00000331565;ENST00000450985	T	0.73575	-0.76	4.55	4.55	0.56014	.	0.410117	0.27035	N	0.021247	T	0.46983	0.1421	N	0.22421	0.69	0.30375	N	0.782557	B	0.19935	0.04	B	0.18263	0.021	T	0.33317	-0.9873	10	0.27082	T	0.32	.	17.4881	0.87694	0.0:1.0:0.0:0.0	.	41	Q9H1V8	S6A17_HUMAN	V	41	ENSP00000330199:A41V	ENSP00000330199:A41V	A	+	2	0	SLC6A17	110511196	0.997000	0.39634	0.941000	0.38009	0.830000	0.47004	3.263000	0.51546	2.339000	0.79563	0.563000	0.77884	GCT		0.612	SLC6A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032550.2	XM_371280		8	5	0	0	0	0.013537	0	8	5				
TBX15	6913	broad.mit.edu	37	1	119427674	119427674	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr1:119427674C>A	ENST00000369429.3	-	8	1499	c.1490G>T	c.(1489-1491)gGg>gTg	p.G497V	TBX15_ENST00000207157.3_Missense_Mutation_p.G391V			Q96SF7	TBX15_HUMAN	T-box 15	497					embryonic cranial skeleton morphogenesis (GO:0048701)	Tle3-Aes complex (GO:0070722)	RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.G391V(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(19)|ovary(1)|pancreas(1)|skin(5)	37	all_neural(166;0.117)	all_cancers(81;0.000692)|all_lung(203;3.05e-06)|Lung NSC(69;2.13e-05)|all_epithelial(167;0.000237)		Lung(183;0.044)|LUSC - Lung squamous cell carcinoma(189;0.141)		GTGGCTGCCCCCGAACATGTG	0.557																																							uc001ehl.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|pancreas(1)	2						c.(1171-1173)GGG>GTG		T-box 15							59.0	51.0	54.0					1																	119427674		2203	4300	6503	SO:0001583	missense	6913					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr1:119427674C>A	AK127536	CCDS30816.1	1p11.1	2008-02-05	2004-10-05		ENSG00000092607	ENSG00000092607		"""T-boxes"""	11594	protein-coding gene	gene with protein product		604127	"""T-box 14"""	TBX14		9693034	Standard	XM_005271162		Approved		uc001ehl.1	Q96SF7	OTTHUMG00000012263	ENST00000369429.3:c.1490G>T	1.37:g.119427674C>A	ENSP00000358437:p.Gly497Val					TBX15_uc009whj.1_Missense_Mutation_p.G215V	p.G391V	NM_152380	NP_689593	Q96SF7	TBX15_HUMAN		Lung(183;0.044)|LUSC - Lung squamous cell carcinoma(189;0.141)	8	1487	-	all_neural(166;0.117)	all_cancers(81;0.000692)|all_lung(203;3.05e-06)|Lung NSC(69;2.13e-05)|all_epithelial(167;0.000237)	497					Q08E76|Q5JT54|Q5T9S7	Missense_Mutation	SNP	ENST00000369429.3	37	c.1172G>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.70|15.70	2.911213|2.911213	0.52439|0.52439	.|.	.|.	ENSG00000092607|ENSG00000092607	ENST00000344218;ENST00000207157;ENST00000369429;ENST00000449873|ENST00000393149	D;D;T|.	0.87809|.	-2.3;-2.18;-1.2|.	5.31|5.31	5.31|5.31	0.75309|0.75309	.|.	0.181808|0.181808	0.49916|0.49916	N|D	0.000126|0.000126	T|T	0.50565|0.50565	0.1623|0.1623	N|N	0.22421|0.22421	0.69|0.69	0.80722|0.80722	D|D	1|1	P;P|.	0.44946|.	0.846;0.745|.	B;B|.	0.38056|.	0.25;0.264|.	T|T	0.57201|0.57201	-0.7852|-0.7852	10|7	0.52906|0.72032	T|D	0.07|0.01	.|.	19.1626|19.1626	0.93539|0.93539	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	294;497|.	E9PCG3;Q96SF7|.	.;TBX15_HUMAN|.	V|W	294;391;497;225|223	ENSP00000207157:G391V;ENSP00000358437:G497V;ENSP00000398625:G225V|.	ENSP00000207157:G391V|ENSP00000376856:G223W	G|G	-|-	2|1	0|0	TBX15|TBX15	119229197|119229197	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	4.142000|4.142000	0.58044|0.58044	2.768000|2.768000	0.95171|0.95171	0.561000|0.561000	0.74099|0.74099	GGG|GGG		0.557	TBX15-002	PUTATIVE	not_organism_supported|upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000034351.1	NM_152380		6	28	1	0	2.0095e-06	0.001984	2.1698e-06	6	28				
Unknown	0	broad.mit.edu	37	1	144621558	144621558	+	IGR	SNP	C	C	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr1:144621558C>A								RP11-640M9.2 (15667 upstream) : NBPF9 (190185 downstream)																							AAATTGCACCCCCAGCTGGCA	0.483																																							uc009wig.1		NA																	0					0						c.(889-891)CCC>CAC		hypothetical protein LOC400818																																				SO:0001628	intergenic_variant	400818					cytoplasm		g.chr1:144621558C>A																													1.37:g.144621558C>A						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Missense_Mutation_p.P297H|NBPF9_uc010oxr.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron|NBPF9_uc010oye.1_Missense_Mutation_p.P228H|NBPF9_uc001eli.3_RNA|NBPF9_uc010oyf.1_Missense_Mutation_p.P228H|NBPF9_uc010oyg.1_Missense_Mutation_p.P262H|NBPF9_uc009wii.1_Missense_Mutation_p.P26H	p.P297H	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN			9	966	+			297						Missense_Mutation	SNP		37	c.890C>A																																																																																				0	0.483									13	224	1	0	6.07407e-21	0.007291	7.99331e-21	13	224				
HIST2H2BE	8349	broad.mit.edu	37	1	149858184	149858184	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr1:149858184C>G	ENST00000369155.2	-	1	48	c.7G>C	c.(7-9)Gaa>Caa	p.E3Q	BOLA1_ENST00000369153.2_5'Flank|HIST2H2AC_ENST00000331380.2_5'Flank	NM_003528.2	NP_003519.1	Q16778	H2B2E_HUMAN	histone cluster 2, H2be	3					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.E3Q(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	14	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			TTTGCCGGTTCAGGCATGGTA	0.512																																							uc001etc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(7-9)GAA>CAA		histone cluster 2, H2be							53.0	54.0	54.0					1																	149858184		2203	4300	6503	SO:0001583	missense	8349				defense response to bacterium|nucleosome assembly	nucleosome|nucleus	DNA binding|protein binding	g.chr1:149858184C>G	AY131979	CCDS936.1	1q21.2	2011-01-27	2006-10-11	2003-03-07	ENSG00000184678	ENSG00000184678		"""Histones / Replication-dependent"""	4760	protein-coding gene	gene with protein product		601831	"""H2B histone family, member Q"", ""histone 2, H2be"""	H2B, H2BFQ		1469070, 12408966	Standard	NM_003528		Approved	H2B/q, H2B.1	uc001etc.3	Q16778	OTTHUMG00000012095	ENST00000369155.2:c.7G>C	1.37:g.149858184C>G	ENSP00000358151:p.Glu3Gln					HIST2H2AC_uc001etd.2_5'Flank	p.E3Q	NM_003528	NP_003519	Q16778	H2B2E_HUMAN	STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)		1	49	-	Breast(34;0.0124)|all_hematologic(923;0.127)		3					A3KMC7|A8K110|Q4KMY1|Q5QNX0|Q9UE88	Missense_Mutation	SNP	ENST00000369155.2	37	c.7G>C	CCDS936.1	.	.	.	.	.	.	.	.	.	.	C	19.52	3.843692	0.71488	.	.	ENSG00000184678	ENST00000369155	T	0.18502	2.21	5.99	5.99	0.97316	.	0.000000	0.85682	D	0.000000	T	0.17195	0.0413	M	0.77820	2.39	0.39340	D	0.965561	B	0.21452	0.056	B	0.17433	0.018	T	0.01508	-1.1337	10	0.72032	D	0.01	.	19.1154	0.93336	0.0:1.0:0.0:0.0	.	3	Q16778	H2B2E_HUMAN	Q	3	ENSP00000358151:E3Q	ENSP00000358151:E3Q	E	-	1	0	HIST2H2BE	148124808	1.000000	0.71417	0.994000	0.49952	0.883000	0.51084	7.702000	0.84576	2.857000	0.98124	0.650000	0.86243	GAA		0.512	HIST2H2BE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033455.1	NM_003528		21	81	0	0	0	0.008871	0	21	81				
HRNR	388697	broad.mit.edu	37	1	152187998	152187998	+	Nonsense_Mutation	SNP	G	G	C			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr1:152187998G>C	ENST00000368801.2	-	3	6182	c.6107C>G	c.(6106-6108)tCa>tGa	p.S2036*	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	2036					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.S2036*(1)		autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGACTGACCTGAGCTAGCTCC	0.572																																							uc001ezt.1		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(2)|ovary(1)	3						c.(6106-6108)TCA>TGA		hornerin							166.0	245.0	218.0					1																	152187998		2147	4125	6272	SO:0001587	stop_gained	388697				keratinization		calcium ion binding|protein binding	g.chr1:152187998G>C	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.6107C>G	1.37:g.152187998G>C	ENSP00000357791:p.Ser2036*						p.S2036*	NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	6183	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		2036			22.		Q5DT20|Q5U1F4	Nonsense_Mutation	SNP	ENST00000368801.2	37	c.6107C>G	CCDS30859.1	.	.	.	.	.	.	.	.	.	.	G	44	10.580115	0.99431	.	.	ENSG00000197915	ENST00000368801	.	.	.	4.31	-1.59	0.08453	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	.	0.5273	0.00622	0.2104:0.1591:0.3054:0.3251	.	.	.	.	X	2036	.	ENSP00000357791:S2036X	S	-	2	0	HRNR	150454622	0.008000	0.16893	0.000000	0.03702	0.074000	0.17049	0.945000	0.29056	-0.385000	0.07833	0.603000	0.83216	TCA		0.572	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868		25	654	0	0	0	0.007291	0	25	654				
PBXIP1	57326	broad.mit.edu	37	1	154923837	154923837	+	Missense_Mutation	SNP	G	G	A	rs144138798		TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr1:154923837G>A	ENST00000368463.3	-	5	351	c.280C>T	c.(280-282)Cct>Tct	p.P94S	PBXIP1_ENST00000542459.1_Intron|PBXIP1_ENST00000539880.1_Intron|PBXIP1_ENST00000498553.1_5'UTR|PBXIP1_ENST00000368465.1_Missense_Mutation_p.P65S|PBXIP1_ENST00000368460.3_Missense_Mutation_p.P94S	NM_020524.2	NP_065385.2	Q96AQ6	PBIP1_HUMAN	pre-B-cell leukemia homeobox interacting protein 1	94					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)	cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)	p.P94S(1)		breast(1)|kidney(2)|large_intestine(6)|lung(13)|prostate(1)|urinary_tract(1)	24	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			CCTGGGCCAGGAGGCTCCACA	0.622																																							uc001ffr.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(280-282)CCT>TCT		pre-B-cell leukemia homeobox interacting protein		G	SER/PRO	0,4406		0,0,2203	106.0	100.0	102.0		280	0.0	0.0	1	dbSNP_134	102	2,8598	2.2+/-6.3	0,2,4298	no	missense	PBXIP1	NM_020524.2	74	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	benign	94/732	154923837	2,13004	2203	4300	6503	SO:0001583	missense	57326				cell differentiation|multicellular organismal development|negative regulation of transcription, DNA-dependent	cytosol|microtubule|nucleus	protein binding|transcription corepressor activity	g.chr1:154923837G>A	AF221521	CCDS1074.1	1q22	2008-02-05	2007-01-30		ENSG00000163346	ENSG00000163346			21199	protein-coding gene	gene with protein product			"""pre-B-cell leukemia transcription factor interacting protein 1"""			7505766, 10825160	Standard	NM_020524		Approved	HPIP	uc001ffr.3	Q96AQ6	OTTHUMG00000037369	ENST00000368463.3:c.280C>T	1.37:g.154923837G>A	ENSP00000357448:p.Pro94Ser					PBXIP1_uc001ffs.2_Missense_Mutation_p.P65S|PBXIP1_uc010pep.1_Intron|PBXIP1_uc009woy.1_RNA	p.P94S	NM_020524	NP_065385	Q96AQ6	PBIP1_HUMAN	BRCA - Breast invasive adenocarcinoma(34;0.00034)		5	339	-	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		94					Q5T174|Q5T176|Q9H8X6|Q9HA02|Q9HD85	Missense_Mutation	SNP	ENST00000368463.3	37	c.280C>T	CCDS1074.1	.	.	.	.	.	.	.	.	.	.	G	8.839	0.941782	0.18281	0.0	2.33E-4	ENSG00000163346	ENST00000368465;ENST00000368463;ENST00000351146;ENST00000368460	T;T;T	0.13196	2.61;2.61;2.61	4.29	0.00921	0.14078	.	1.022150	0.07790	N	0.954714	T	0.02455	0.0075	L	0.33485	1.01	0.20196	N	0.999928	B	0.19331	0.035	B	0.17722	0.019	T	0.47623	-0.9103	10	0.22109	T	0.4	-0.4092	3.1158	0.06373	0.3379:0.0:0.4745:0.1876	.	94	Q96AQ6	PBIP1_HUMAN	S	65;94;94;94	ENSP00000357450:P65S;ENSP00000357448:P94S;ENSP00000357445:P94S	ENSP00000295523:P94S	P	-	1	0	PBXIP1	153190461	0.086000	0.21541	0.011000	0.14972	0.006000	0.05464	0.637000	0.24659	-0.144000	0.11314	-0.500000	0.04577	CCT		0.622	PBXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090943.1	NM_020524		30	74	0	0	0	0.010818	0	30	74				
GON4L	54856	broad.mit.edu	37	1	155717651	155717651	+	IGR	SNP	A	A	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr1:155717651A>T	ENST00000368331.1	-	0	7640				MSTO1_ENST00000452804.2_Silent_p.I286I	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)						regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.I286I(1)		NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					GGGGAATAATAACTTGGGGCC	0.542																																							uc010pgn.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(775-777)ATA>ATT		misato																																				SO:0001628	intergenic_variant	100129405							g.chr1:155717651A>T	AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106		1.37:g.155717651A>T						MSTO2P_uc010pgo.1_Silent_p.I286I|MSTO2P_uc010pgp.1_RNA	p.I259I	NM_018116	NP_060586					8	788	+								B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Silent	SNP	ENST00000368331.1	37	c.777A>T																																																																																					0.542	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_032292		59	24	0	0	0	0.01441	0	59	24				
BCAN	63827	broad.mit.edu	37	1	156626175	156626175	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr1:156626175G>T	ENST00000329117.5	+	9	2380	c.2044G>T	c.(2044-2046)Gat>Tat	p.D682Y	RP11-284F21.7_ENST00000448869.1_RNA	NM_021948.4	NP_068767.3	Q96GW7	PGCB_HUMAN	brevican	682	EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00076}.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hippocampus development (GO:0021766)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)	p.D682Y(1)		cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	55	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GGACCTGTGCGATGTTGGTGA	0.612																																							uc001fpp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(2044-2046)GAT>TAT		brevican isoform 1							69.0	64.0	66.0					1																	156626175		2203	4300	6503	SO:0001583	missense	63827				cell adhesion	anchored to membrane|proteinaceous extracellular matrix	hyaluronic acid binding|sugar binding	g.chr1:156626175G>T	BC027971	CCDS1149.1, CCDS1150.1	1q31	2013-05-07			ENSG00000132692	ENSG00000132692		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	23059	protein-coding gene	gene with protein product	"""chondroitin sulfate proteoglycan 7"", ""brevican proteoglycan"""	600347				11054543, 11873941	Standard	NM_021948		Approved	BEHAB, MGC13038, CSPG7	uc001fpp.3	Q96GW7	OTTHUMG00000033322	ENST00000329117.5:c.2044G>T	1.37:g.156626175G>T	ENSP00000331210:p.Asp682Tyr						p.D682Y	NM_021948	NP_068767	Q96GW7	PGCB_HUMAN			9	2380	+	all_hematologic(923;0.088)|Hepatocellular(266;0.158)		682			EGF-like.		D3DVC2|Q5SZ10|Q5T3I5|Q8TBB9|Q9HBK1|Q9HBK4	Missense_Mutation	SNP	ENST00000329117.5	37	c.2044G>T	CCDS1149.1	.	.	.	.	.	.	.	.	.	.	G	18.07	3.540512	0.65085	.	.	ENSG00000132692	ENST00000329117	T	0.17213	2.29	5.42	3.57	0.40892	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.362753	0.25698	N	0.028885	T	0.15696	0.0378	L	0.59912	1.85	0.80722	D	1	D	0.61697	0.99	P	0.52481	0.7	T	0.01172	-1.1429	10	0.66056	D	0.02	-9.4617	10.7693	0.46312	0.1552:0.0:0.8448:0.0	.	682	Q96GW7	PGCB_HUMAN	Y	682	ENSP00000331210:D682Y	ENSP00000331210:D682Y	D	+	1	0	BCAN	154892799	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.147000	0.42226	0.676000	0.31285	-0.258000	0.10820	GAT		0.612	BCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081844.2	NM_021948		46	109	1	0	8.86878e-18	0.01441	1.13941e-17	46	109				
OR10K2	391107	broad.mit.edu	37	1	158389727	158389727	+	Silent	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr1:158389727G>A	ENST00000314902.2	-	1	929	c.930C>T	c.(928-930)tcC>tcT	p.S310S		NM_001004476.1	NP_001004476.1	Q6IF99	O10K2_HUMAN	olfactory receptor, family 10, subfamily K, member 2	310						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S310S(1)		NS(1)|breast(1)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(19)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_hematologic(112;0.0378)					TTTACAACAGGGAAATTGTTC	0.393																																							uc010pii.1		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(1)	1						c.(928-930)TCC>TCT		olfactory receptor, family 10, subfamily K,							42.0	47.0	45.0					1																	158389727		2202	4300	6502	SO:0001819	synonymous_variant	391107				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158389727G>A	AB065642	CCDS30896.1	1q23.1	2012-08-09			ENSG00000180708	ENSG00000180708		"""GPCR / Class A : Olfactory receptors"""	14826	protein-coding gene	gene with protein product							Standard	NM_001004476		Approved		uc010pii.2	Q6IF99	OTTHUMG00000019638	ENST00000314902.2:c.930C>T	1.37:g.158389727G>A							p.S310S	NM_001004476	NP_001004476	Q6IF99	O10K2_HUMAN			1	930	-	all_hematologic(112;0.0378)		310			Cytoplasmic (Potential).			Silent	SNP	ENST00000314902.2	37	c.930C>T	CCDS30896.1																																																																																				0.393	OR10K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051854.1	NM_001004476		23	51	0	0	0	0.00278	0	23	51				
SPTA1	6708	broad.mit.edu	37	1	158618419	158618419	+	Silent	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr1:158618419C>T	ENST00000368147.4	-	26	3774	c.3594G>A	c.(3592-3594)caG>caA	p.Q1198Q		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1198					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.Q1198Q(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TCTTCTCAATCTGCTCCTTCG	0.507																																							uc001fst.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8						c.(3592-3594)CAG>CAA		spectrin, alpha, erythrocytic 1							109.0	107.0	108.0					1																	158618419		1962	4164	6126	SO:0001819	synonymous_variant	6708				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158618419C>T	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.3594G>A	1.37:g.158618419C>T							p.Q1198Q	NM_003126	NP_003117	P02549	SPTA1_HUMAN			26	3793	-	all_hematologic(112;0.0378)		1198			Spectrin 12.		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Silent	SNP	ENST00000368147.4	37	c.3594G>A	CCDS41423.1																																																																																				0.507	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		22	129	0	0	0	0.00278	0	22	129				
B4GALT3	8703	broad.mit.edu	37	1	161141691	161141691	+	Missense_Mutation	SNP	C	C	T	rs111614721	byFrequency	TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr1:161141691C>T	ENST00000319769.5	-	8	1319	c.1097G>A	c.(1096-1098)cGt>cAt	p.R366H	PPOX_ENST00000535223.1_Intron|B4GALT3_ENST00000470882.1_5'UTR|PPOX_ENST00000432542.2_Intron|PPOX_ENST00000495483.1_Intron|B4GALT3_ENST00000367998.1_Missense_Mutation_p.R366H	NM_001199873.1|NM_003779.3	NP_001186802.1|NP_003770.1	O60512	B4GT3_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3	366					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|galactosyltransferase activity (GO:0008378)|metal ion binding (GO:0046872)|N-acetyllactosamine synthase activity (GO:0003945)	p.R366H(1)		cervix(1)|endometrium(5)|large_intestine(6)|lung(6)	18	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)		N-Acetyl-D-glucosamine(DB00141)	CATCTCTTGACGGAAGGCTTG	0.607													C|||	7	0.00139776	0.0045	0.0014	5008	,	,		17177	0.0		0.0	False		,,,				2504	0.0						uc001fyq.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1096-1098)CGT>CAT		UDP-Gal:betaGlcNAc beta 1,4-	N-Acetyl-D-glucosamine(DB00141)	C	HIS/ARG,HIS/ARG,HIS/ARG	25,4381	30.8+/-60.4	0,25,2178	61.0	69.0	66.0		1097,1097,1097	5.3	1.0	1	dbSNP_132	66	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense,missense	B4GALT3	NM_001199873.1,NM_001199874.1,NM_003779.3	29,29,29	0,26,6477	TT,TC,CC		0.0116,0.5674,0.1999	probably-damaging,probably-damaging,probably-damaging	366/394,366/394,366/394	161141691	26,12980	2203	4300	6503	SO:0001583	missense	8703				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity|metal ion binding|N-acetyllactosamine synthase activity	g.chr1:161141691C>T	BC006099	CCDS1222.1	1q21-q23	2013-02-19			ENSG00000158850	ENSG00000158850		"""Beta 4-glycosyltransferases"""	926	protein-coding gene	gene with protein product		604014				9405390, 9597550	Standard	NM_001199873		Approved	beta4Gal-T3	uc001fys.2	O60512	OTTHUMG00000034348	ENST00000319769.5:c.1097G>A	1.37:g.161141691C>T	ENSP00000320965:p.Arg366His					PPOX_uc010pkh.1_Intron|PPOX_uc001fyi.2_Intron|B4GALT3_uc001fyo.1_Missense_Mutation_p.R146H|B4GALT3_uc001fyp.1_RNA|B4GALT3_uc001fyr.1_Missense_Mutation_p.R366H|B4GALT3_uc001fys.1_Missense_Mutation_p.R366H	p.R366H	NM_003779	NP_003770	O60512	B4GT3_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00275)		8	1359	-	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		366			Lumenal (Potential).		D3DVG3|O60910|Q9BPZ4|Q9H8T2	Missense_Mutation	SNP	ENST00000319769.5	37	c.1097G>A	CCDS1222.1	3	0.0013736263736263737	3	0.006097560975609756	0	0.0	0	0.0	0	0.0	C	16.28	3.077763	0.55753	0.005674	1.16E-4	ENSG00000158850	ENST00000319769;ENST00000407555;ENST00000367998;ENST00000367997	T;T	0.54071	0.59;0.59	5.28	5.28	0.74379	.	0.161578	0.42053	D	0.000766	T	0.40067	0.1102	N	0.22421	0.69	0.42130	D	0.991461	D	0.64830	0.994	P	0.49085	0.6	T	0.45205	-0.9277	10	0.87932	D	0	.	17.8577	0.88771	0.0:1.0:0.0:0.0	.	366	O60512	B4GT3_HUMAN	H	366;343;366;366	ENSP00000320965:R366H;ENSP00000356977:R366H	ENSP00000320965:R366H	R	-	2	0	B4GALT3	159408315	0.748000	0.28294	1.000000	0.80357	0.997000	0.91878	0.931000	0.28871	2.746000	0.94184	0.655000	0.94253	CGT		0.607	B4GALT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083054.1	NM_003779		16	128	0	0	0	0.004007	0	16	128				
NUF2	83540	broad.mit.edu	37	1	163317686	163317686	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr1:163317686A>T	ENST00000271452.3	+	12	1361	c.1082A>T	c.(1081-1083)aAg>aTg	p.K361M	NUF2_ENST00000367900.3_Missense_Mutation_p.K361M|NUF2_ENST00000524800.1_Missense_Mutation_p.K314M	NM_145697.2	NP_663735.2	Q9BZD4	NUF2_HUMAN	NUF2, NDC80 kinetochore complex component	361	Interaction with the N-terminus of NDC80.				chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)		p.K361M(2)		breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	all_hematologic(923;0.101)					AAAATAAATAAGAAGCATGAA	0.308																																							uc001gcq.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|skin(1)	4						c.(1081-1083)AAG>ATG		NUF2, NDC80 kinetochore complex component							82.0	79.0	80.0					1																	163317686		2203	4300	6503	SO:0001583	missense	83540				cell division|chromosome segregation|mitotic prometaphase	condensed chromosome kinetochore|cytosol|Ndc80 complex|nucleus	protein binding	g.chr1:163317686A>T	BG354574	CCDS1245.1	1q23.3	2013-07-03	2013-07-03	2006-11-07	ENSG00000143228	ENSG00000143228			14621	protein-coding gene	gene with protein product	"""cancer/testis antigen 106"""	611772	"""cell division cycle associated 1"", ""NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae)"""	CDCA1		11266451, 11685532	Standard	NM_031423		Approved	NUF2R, CT106	uc001gcr.1	Q9BZD4	OTTHUMG00000034275	ENST00000271452.3:c.1082A>T	1.37:g.163317686A>T	ENSP00000271452:p.Lys361Met					NUF2_uc001gcr.1_Missense_Mutation_p.K361M|NUF2_uc009wvc.1_Missense_Mutation_p.K314M	p.K361M	NM_145697	NP_663735	Q9BZD4	NUF2_HUMAN			12	1382	+	all_hematologic(923;0.101)		361			Interaction with the N-terminus of NDC80.		Q8WU69|Q96HJ4|Q96Q78	Missense_Mutation	SNP	ENST00000271452.3	37	c.1082A>T	CCDS1245.1	.	.	.	.	.	.	.	.	.	.	A	15.95	2.983267	0.53827	.	.	ENSG00000143228	ENST00000524800;ENST00000367900;ENST00000271452	T;T;T	0.43294	0.95;1.13;1.13	6.03	3.75	0.43078	.	0.086988	0.85682	D	0.000000	T	0.28863	0.0716	L	0.59436	1.845	0.47862	D	0.999539	P;P	0.43169	0.8;0.8	P;P	0.47206	0.541;0.541	T	0.20371	-1.0277	9	0.66056	D	0.02	-16.3298	7.3141	0.26491	0.7587:0.0:0.2413:0.0	.	314;361	E9PQC4;Q9BZD4	.;NUF2_HUMAN	M	314;361;361	ENSP00000436888:K314M;ENSP00000356875:K361M;ENSP00000271452:K361M	ENSP00000271452:K361M	K	+	2	0	NUF2	161584310	1.000000	0.71417	0.965000	0.40720	0.664000	0.39144	2.702000	0.47102	0.540000	0.28808	0.533000	0.62120	AAG		0.308	NUF2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000082812.1	NM_145697		34	39	0	0	0	0.00623	0	34	39				
EDEM3	80267	broad.mit.edu	37	1	184681006	184681006	+	Silent	SNP	C	C	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr1:184681006C>A	ENST00000318130.8	-	15	1808	c.1542G>T	c.(1540-1542)tcG>tcT	p.S514S	EDEM3_ENST00000367512.3_Silent_p.S471S|EDEM3_ENST00000466392.1_5'Flank	NM_025191.3	NP_079467.3	Q9BZQ6	EDEM3_HUMAN	ER degradation enhancer, mannosidase alpha-like 3	514					cellular protein metabolic process (GO:0044267)|glycoprotein catabolic process (GO:0006516)|post-translational protein modification (GO:0043687)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|response to unfolded protein (GO:0006986)	endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|glycoprotein endo-alpha-1,2-mannosidase activity (GO:0004569)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)	p.S471S(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						CTGTATATTCCGAGGTCTACA	0.343																																							uc010pok.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(1540-1542)TCG>TCT		ER degradation enhancer, mannosidase alpha-like							65.0	61.0	63.0					1																	184681006		2203	4300	6503	SO:0001819	synonymous_variant	80267				post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|response to unfolded protein	endoplasmic reticulum lumen|endoplasmic reticulum membrane	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity|misfolded protein binding	g.chr1:184681006C>A	AF288393	CCDS1363.2	1q25	2008-02-05	2006-03-31	2006-03-31	ENSG00000116406	ENSG00000116406			16787	protein-coding gene	gene with protein product		610214	"""chromosome 1 open reading frame 22"""	C1orf22		15537790, 15579471	Standard	NM_025191		Approved		uc010pok.2	Q9BZQ6	OTTHUMG00000035387	ENST00000318130.8:c.1542G>T	1.37:g.184681006C>A						EDEM3_uc010pol.1_RNA|EDEM3_uc010pom.1_Silent_p.S514S	p.S514S	NM_025191	NP_079467	Q9BZQ6	EDEM3_HUMAN			15	1803	-			514					B2RCH6|B7ZLZ2|Q0VGM5|Q5TEZ0|Q9HCW1|Q9UFV7	Silent	SNP	ENST00000318130.8	37	c.1542G>T	CCDS1363.2																																																																																				0.343	EDEM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085785.3	NM_025191		20	60	1	0	3.8784e-16	0.012319	4.8512e-16	20	60				
F13B	2165	broad.mit.edu	37	1	197021763	197021763	+	Splice_Site	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr1:197021763C>T	ENST00000367412.1	-	9	1599		c.e9+1		F13B_ENST00000490002.1_5'Flank	NM_001994.2	NP_001985.2	P05160	F13B_HUMAN	coagulation factor XIII, B polypeptide						blood coagulation (GO:0007596)	extracellular region (GO:0005576)		p.?(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(5)|liver(1)|lung(40)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	66						TATTATTTTACCTTTTCTAGT	0.313																																							uc001gtt.1		NA																	1	Unknown(1)		lung(1)	upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						c.e9+1		coagulation factor XIII B subunit precursor							61.0	63.0	62.0					1																	197021763		2202	4294	6496	SO:0001630	splice_region_variant	2165				blood coagulation	extracellular region		g.chr1:197021763C>T	M14057	CCDS1388.1	1q31-q32.1	2012-10-02			ENSG00000143278	ENSG00000143278			3534	protein-coding gene	gene with protein product		134580				2339067, 2271707	Standard	NM_001994		Approved	FXIIIB	uc001gtt.1	P05160	OTTHUMG00000036519	ENST00000367412.1:c.1555+1G>A	1.37:g.197021763C>T							p.E519_splice	NM_001994	NP_001985	P05160	F13B_HUMAN			9	1599	-								A8K3E5|Q5VYL5	Splice_Site	SNP	ENST00000367412.1	37	c.1555_splice	CCDS1388.1	.	.	.	.	.	.	.	.	.	.	C	15.91	2.973150	0.53614	.	.	ENSG00000143278	ENST00000367412	.	.	.	5.32	5.32	0.75619	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.9913	0.92793	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	F13B	195288386	1.000000	0.71417	1.000000	0.80357	0.511000	0.34104	5.097000	0.64542	2.484000	0.83849	0.655000	0.94253	.		0.313	F13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088821.2	NM_001994	Intron	13	39	0	0	0	0.013537	0	13	39				
ASPM	259266	broad.mit.edu	37	1	197101454	197101454	+	Silent	SNP	C	C	G	rs565764186		TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr1:197101454C>G	ENST00000367409.4	-	7	2704	c.2448G>C	c.(2446-2448)ctG>ctC	p.L816L	ASPM_ENST00000367408.1_Silent_p.L66L|ASPM_ENST00000294732.7_Silent_p.L816L	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	816					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)		p.L816L(1)		breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						TGTAGGACAACAGCCAATTCA	0.308													C|||	1	0.000199681	0.0008	0.0	5008	,	,		14791	0.0		0.0	False		,,,				2504	0.0						uc001gtu.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|central_nervous_system(2)	6						c.(2446-2448)CTG>CTC		asp (abnormal spindle)-like, microcephaly							68.0	62.0	64.0					1																	197101454		2203	4300	6503	SO:0001819	synonymous_variant	259266				mitosis	cytoplasm|nucleus	calmodulin binding	g.chr1:197101454C>G	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.2448G>C	1.37:g.197101454C>G						ASPM_uc001gtv.2_Silent_p.L816L|ASPM_uc001gtw.3_Intron	p.L816L	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN			7	2705	-			816					Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Silent	SNP	ENST00000367409.4	37	c.2448G>C	CCDS1389.1																																																																																				0.308	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136		26	50	0	0	0	0.00632	0	26	50				
CRB1	23418	broad.mit.edu	37	1	197446916	197446916	+	Silent	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr1:197446916G>A	ENST00000367400.3	+	12	4263	c.4128G>A	c.(4126-4128)caG>caA	p.Q1376Q	CRB1_ENST00000367399.2_Silent_p.Q1264Q|CRB1_ENST00000538660.1_Silent_p.Q840Q|CRB1_ENST00000544212.1_Silent_p.Q857Q|CRB1_ENST00000535699.1_Silent_p.Q1352Q	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	1376					cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Q1376Q(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						GGGCAACTCAGGGAACCTACA	0.517																																							uc001gtz.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|skin(3)|large_intestine(1)	9						c.(4126-4128)CAG>CAA		crumbs homolog 1 precursor							105.0	98.0	100.0					1																	197446916		2203	4300	6503	SO:0001819	synonymous_variant	23418				cell-cell signaling|establishment or maintenance of cell polarity	apical plasma membrane|extracellular region|integral to membrane	calcium ion binding|protein binding	g.chr1:197446916G>A		CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.4128G>A	1.37:g.197446916G>A						CRB1_uc010poz.1_Silent_p.Q1352Q|CRB1_uc010ppa.1_RNA|CRB1_uc009wza.2_Silent_p.Q1264Q|CRB1_uc010ppb.1_Silent_p.Q840Q|CRB1_uc010ppd.1_Silent_p.Q857Q	p.Q1376Q	NM_201253	NP_957705	P82279	CRUM1_HUMAN			12	4263	+			1376			Cytoplasmic (Potential).		A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Silent	SNP	ENST00000367400.3	37	c.4128G>A	CCDS1390.1																																																																																				0.517	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086565.2	NM_201253		100	18	0	0	0	0.01441	0	100	18				
FAM58BP	339521	broad.mit.edu	37	1	200182760	200182760	+	IGR	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr1:200182760C>T								NR5A2 (36208 upstream) : RP11-532L16.3 (101802 downstream)																							gagaggGTGCCGCAGCGCCGG	0.672																																							uc009wzi.1		NA																	0					0						c.(67-69)GCC>GCT		family with sequence similarity 58 member B							34.0	40.0	38.0					1																	200182760		2202	4300	6502	SO:0001628	intergenic_variant	339521				regulation of cyclin-dependent protein kinase activity|regulation of transcription, DNA-dependent		protein kinase binding	g.chr1:200182760C>T																													1.37:g.200182760C>T							p.A23A	NM_001105517	NP_001098987	P0C7Q3	FA58B_HUMAN			1	105	+	Prostate(682;0.19)		23						Silent	SNP		37	c.69C>T																																																																																				0	0.672									9	11	0	0	0	0.010729	0	9	11				
HHAT	55733	broad.mit.edu	37	1	210847693	210847693	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr1:210847693C>T	ENST00000367010.1	+	12	1681	c.1454C>T	c.(1453-1455)gCc>gTc	p.A485V	HHAT_ENST00000537898.1_Missense_Mutation_p.A420V|HHAT_ENST00000413764.2_Missense_Mutation_p.A485V|HHAT_ENST00000261458.3_Missense_Mutation_p.A485V|HHAT_ENST00000367009.1_Missense_Mutation_p.A175V|HHAT_ENST00000545154.1_Missense_Mutation_p.A486V|HHAT_ENST00000541565.1_Missense_Mutation_p.A348V|HHAT_ENST00000308852.6_Missense_Mutation_p.A440V|HHAT_ENST00000545781.1_Missense_Mutation_p.A422V	NM_001170580.1	NP_001164051.1	Q5VTY9	HHAT_HUMAN	hedgehog acyltransferase	485					multicellular organismal development (GO:0007275)|protein palmitoylation (GO:0018345)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)|palmitoyltransferase activity (GO:0016409)	p.A485V(1)		breast(3)|central_nervous_system(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	27				OV - Ovarian serous cystadenocarcinoma(81;0.0136)|all cancers(67;0.161)|KIRC - Kidney renal clear cell carcinoma(1967;0.215)		GTGGGCATTGCCTGGGCCCAG	0.587																																							uc009xcx.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1453-1455)GCC>GTC		hedgehog acyltransferase							117.0	94.0	102.0					1																	210847693		2203	4300	6503	SO:0001583	missense	55733				multicellular organismal development	endoplasmic reticulum membrane|integral to membrane	GTP binding	g.chr1:210847693C>T	AK001586	CCDS1495.1, CCDS53471.1, CCDS53472.1, CCDS53473.1	1q32	2008-02-05			ENSG00000054392	ENSG00000054392			18270	protein-coding gene	gene with protein product		605743				11160356	Standard	NM_001170587		Approved	FLJ10724, MART-2, MART2, Skn, ski, rasp, sit, GUP2	uc009xcx.3	Q5VTY9	OTTHUMG00000036447	ENST00000367010.1:c.1454C>T	1.37:g.210847693C>T	ENSP00000355977:p.Ala485Val					HHAT_uc010psq.1_Missense_Mutation_p.A348V|HHAT_uc001hhz.3_Missense_Mutation_p.A485V|HHAT_uc010psr.1_Missense_Mutation_p.A486V|HHAT_uc010pss.1_Missense_Mutation_p.A440V|HHAT_uc009xcy.2_Missense_Mutation_p.A420V|HHAT_uc010pst.1_Missense_Mutation_p.A422V|HHAT_uc010psu.1_Missense_Mutation_p.A420V|HHAT_uc001hia.3_Missense_Mutation_p.A175V	p.A485V	NM_001122834	NP_001116306	Q5VTY9	HHAT_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0136)|all cancers(67;0.161)|KIRC - Kidney renal clear cell carcinoma(1967;0.215)	12	1620	+			485			Helical; (Potential).		B7Z4D5|B7Z5I1|B7Z868|B7ZA75|D3DT91|F5H444|Q17RZ7|Q4G0K3|Q5CZ95|Q5TGI2|Q9NVH9|Q9Y3N8	Missense_Mutation	SNP	ENST00000367010.1	37	c.1454C>T	CCDS1495.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.118889	0.77323	.	.	ENSG00000054392	ENST00000413764;ENST00000541565;ENST00000545154;ENST00000537898;ENST00000545781;ENST00000261458;ENST00000308852;ENST00000367010;ENST00000367009	T;T;T;T;T;T;T;T;T	0.45668	2.21;0.89;2.16;2.21;2.21;2.21;2.21;2.21;0.89	5.51	5.51	0.81932	.	.	.	.	.	T	0.40297	0.1111	L	0.40543	1.245	0.32494	N	0.539843	P;P;P;P;P	0.52842	0.915;0.949;0.956;0.791;0.915	B;P;B;B;B	0.45881	0.196;0.496;0.444;0.196;0.3	T	0.53837	-0.8382	9	0.59425	D	0.04	.	12.3111	0.54929	0.1687:0.8313:0.0:0.0	.	440;486;348;420;485	B7Z2U8;F5H444;B7Z4D5;B7Z5I1;Q5VTY9	.;.;.;.;HHAT_HUMAN	V	485;348;486;420;422;485;440;485;175	ENSP00000416845:A485V;ENSP00000444995:A348V;ENSP00000438468:A486V;ENSP00000442625:A420V;ENSP00000439229:A422V;ENSP00000261458:A485V;ENSP00000308628:A440V;ENSP00000355977:A485V;ENSP00000355976:A175V	ENSP00000261458:A485V	A	+	2	0	HHAT	208914316	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.667000	0.37471	2.736000	0.93811	0.655000	0.94253	GCC		0.587	HHAT-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088662.1	NM_018194		45	64	0	0	0	0.010771	0	45	64				
USH2A	7399	broad.mit.edu	37	1	215802231	215802231	+	Silent	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr1:215802231G>A	ENST00000307340.3	-	71	15830	c.15444C>T	c.(15442-15444)ctC>ctT	p.L5148L	USH2A_ENST00000366943.2_Silent_p.L5172L|SNORD116_ENST00000365628.1_RNA	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	5148					hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.L5148L(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GAATGTCCATGAGCTGGCTGA	0.542										HNSCC(13;0.011)																													uc001hku.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(15442-15444)CTC>CTT		usherin isoform B							112.0	109.0	110.0					1																	215802231		2203	4300	6503	SO:0001819	synonymous_variant	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:215802231G>A	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.15444C>T	1.37:g.215802231G>A		HNSCC(13;0.011)					p.L5148L	NM_206933	NP_996816	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	71	15831	-			5148			Cytoplasmic (Potential).		Q5VVM9|Q6S362|Q9NS27	Silent	SNP	ENST00000307340.3	37	c.15444C>T	CCDS31025.1																																																																																				0.542	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		41	106	0	0	0	0.01441	0	41	106				
GUK1	2987	broad.mit.edu	37	1	228333279	228333279	+	Silent	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr1:228333279G>A	ENST00000366718.1	+	2	493	c.66G>A	c.(64-66)aaG>aaA	p.K22K	GUK1_ENST00000366723.1_Silent_p.K43K|GUK1_ENST00000470040.1_3'UTR|GUK1_ENST00000366730.1_Silent_p.K22K|GUK1_ENST00000366726.1_Silent_p.K22K|GUK1_ENST00000366721.1_Silent_p.K22K|GUK1_ENST00000312726.4_Silent_p.K22K|GUK1_ENST00000366728.2_Silent_p.K43K|GUK1_ENST00000391865.3_Silent_p.K43K|GUK1_ENST00000366716.1_Silent_p.K22K|GUK1_ENST00000366722.1_Silent_p.K22K	NM_001159391.1	NP_001152863.1	Q16774	KGUA_HUMAN	guanylate kinase 1	22	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				ATP metabolic process (GO:0046034)|dATP metabolic process (GO:0046060)|dGDP biosynthetic process (GO:0006185)|dGMP metabolic process (GO:0046054)|drug metabolic process (GO:0017144)|GDP biosynthetic process (GO:0046711)|GDP-mannose metabolic process (GO:0019673)|glycoprotein transport (GO:0034436)|GMP metabolic process (GO:0046037)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleotide metabolic process (GO:0006163)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)	p.E95K(1)|p.K22K(1)		endometrium(2)|lung(5)|prostate(1)|soft_tissue(1)	9		Prostate(94;0.0405)				CCCTGCTGAAGAGGCTGCTCC	0.637																																							uc001hsh.2		NA																	2	Substitution - Missense(1)|Substitution - coding silent(1)		lung(2)		0						c.(64-66)AAG>AAA		guanylate kinase 1 isoform b							55.0	48.0	51.0					1																	228333279		2203	4300	6503	SO:0001819	synonymous_variant	2987				nucleobase, nucleoside and nucleotide interconversion|purine nucleotide metabolic process	cytosol	ATP binding|guanylate kinase activity	g.chr1:228333279G>A	BC006249	CCDS1568.1, CCDS53481.1, CCDS55689.1	1q32-q41	2012-10-02			ENSG00000143774	ENSG00000143774	2.7.4.8		4693	protein-coding gene	gene with protein product		139270				8647247	Standard	NM_000858		Approved		uc021pkf.1	Q16774	OTTHUMG00000039503	ENST00000366718.1:c.66G>A	1.37:g.228333279G>A						GUK1_uc001hsi.2_Silent_p.K43K|GUK1_uc001hsj.2_5'UTR|GUK1_uc010pvv.1_Silent_p.K22K	p.K22K	NM_000858	NP_000849	Q16774	KGUA_HUMAN			3	369	+		Prostate(94;0.0405)	22			Guanylate kinase-like.		B1ANH1	Silent	SNP	ENST00000366718.1	37	c.66G>A	CCDS1568.1	.	.	.	.	.	.	.	.	.	.	G	18.26	3.585469	0.66105	.	.	ENSG00000143774	ENST00000435153	.	.	.	5.17	3.01	0.34805	.	0.945722	0.08873	N	0.881293	T	0.57888	0.2084	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53578	-0.8419	5	.	.	.	.	8.688	0.34249	0.0949:0.1583:0.7468:0.0	.	.	.	.	K	95	.	.	E	+	1	0	GUK1	226399902	1.000000	0.71417	0.884000	0.34674	0.909000	0.53808	3.535000	0.53575	2.398000	0.81561	0.313000	0.20887	GAG		0.637	GUK1-021	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000095944.1	NM_000858		14	30	0	0	0	0.006122	0	14	30				
SLC35F3	148641	broad.mit.edu	37	1	234454683	234454683	+	Silent	SNP	T	T	C			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr1:234454683T>C	ENST00000366617.3	+	5	1162	c.934T>C	c.(934-936)Tta>Cta	p.L312L	SLC35F3_ENST00000366618.3_Silent_p.L381L			Q8IY50	S35F3_HUMAN	solute carrier family 35, member F3	312					thiamine transport (GO:0015888)	integral component of membrane (GO:0016021)		p.L381L(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|urinary_tract(1)	32	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)			TTCAGTTCTTTTATTGAGTAA	0.438																																							uc001hwa.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(934-936)TTA>CTA		solute carrier family 35, member F3							121.0	119.0	120.0					1																	234454683		2203	4300	6503	SO:0001819	synonymous_variant	148641				transport	integral to membrane		g.chr1:234454683T>C		CCDS1600.1, CCDS73050.1	1q42.3	2013-05-22			ENSG00000183780	ENSG00000183780		"""Solute carriers"""	23616	protein-coding gene	gene with protein product							Standard	XM_005273070		Approved	FLJ37712	uc001hvy.1	Q8IY50	OTTHUMG00000037929	ENST00000366617.3:c.934T>C	1.37:g.234454683T>C						SLC35F3_uc001hvy.1_Silent_p.L381L	p.L312L	NM_173508	NP_775779	Q8IY50	S35F3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00531)		5	1162	+	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	312			Helical; (Potential).		Q5TDD6|Q8N9C9	Silent	SNP	ENST00000366617.3	37	c.934T>C																																																																																					0.438	SLC35F3-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000128322.1	NM_173508		63	172	0	0	0	0.01441	0	63	172				
OR11L1	391189	broad.mit.edu	37	1	248004695	248004695	+	Silent	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr1:248004695G>A	ENST00000355784.2	-	1	559	c.504C>T	c.(502-504)ttC>ttT	p.F168F		NM_001001959.1	NP_001001959.1	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L, member 1	168						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F168F(1)		NS(1)|endometrium(4)|kidney(5)|large_intestine(5)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			TGCGCCCACAGAAGTCCAACC	0.542																																							uc001idn.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|pancreas(1)|skin(1)	3						c.(502-504)TTC>TTT		olfactory receptor, family 11, subfamily L,							90.0	91.0	91.0					1																	248004695		2203	4300	6503	SO:0001819	synonymous_variant	391189				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248004695G>A	AB065646	CCDS31098.1	1q44	2013-09-24			ENSG00000197591	ENSG00000197591		"""GPCR / Class A : Olfactory receptors"""	14998	protein-coding gene	gene with protein product							Standard	NM_001001959		Approved		uc001idn.1	Q8NGX0	OTTHUMG00000040193	ENST00000355784.2:c.504C>T	1.37:g.248004695G>A							p.F168F	NM_001001959	NP_001001959	Q8NGX0	O11L1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0319)		1	504	-	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		168			Extracellular (Potential).			Silent	SNP	ENST00000355784.2	37	c.504C>T	CCDS31098.1																																																																																				0.542	OR11L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096850.1	NM_001001959		69	128	0	0	0	0.01441	0	69	128				
OR2T4	127074	broad.mit.edu	37	1	248525769	248525769	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr1:248525769C>T	ENST00000366475.1	+	1	887	c.887C>T	c.(886-888)tCc>tTc	p.S296F		NM_001004696.1	NP_001004696.1	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T, member 4	296						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S296F(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(2)|lung(47)	56	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CTCCCCAGCTCCTACCACACC	0.517																																							uc001ieh.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(886-888)TCC>TTC		olfactory receptor, family 2, subfamily T,							148.0	145.0	146.0					1																	248525769		2203	4300	6503	SO:0001583	missense	127074				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248525769C>T	BK004464	CCDS31113.1	1q44	2012-08-09			ENSG00000196944	ENSG00000196944		"""GPCR / Class A : Olfactory receptors"""	15016	protein-coding gene	gene with protein product							Standard	NM_001004696		Approved	OR2T4Q	uc001ieh.1	Q8NH00	OTTHUMG00000040453	ENST00000366475.1:c.887C>T	1.37:g.248525769C>T	ENSP00000355431:p.Ser296Phe						p.S296F	NM_001004696	NP_001004696	Q8NH00	OR2T4_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	887	+	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		296			Extracellular (Potential).		Q6IEZ8	Missense_Mutation	SNP	ENST00000366475.1	37	c.887C>T	CCDS31113.1	.	.	.	.	.	.	.	.	.	.	C	13.24	2.178627	0.38511	.	.	ENSG00000196944	ENST00000366475	T	0.00267	8.38	3.0	3.0	0.34707	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46442	D	0.000284	T	0.00356	0.0011	M	0.92367	3.3	0.09310	N	1	P	0.35872	0.525	B	0.44163	0.443	T	0.23226	-1.0194	10	0.72032	D	0.01	.	2.7206	0.05200	0.2647:0.5399:0.0:0.1953	.	296	Q8NH00	OR2T4_HUMAN	F	296	ENSP00000355431:S296F	ENSP00000355431:S296F	S	+	2	0	OR2T4	246592392	0.000000	0.05858	1.000000	0.80357	0.994000	0.84299	0.011000	0.13264	1.498000	0.48600	0.585000	0.79938	TCC		0.517	OR2T4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097349.2	NM_001004696		81	198	0	0	0	0.01441	0	81	198				
FBXO18	84893	broad.mit.edu	37	10	5955790	5955790	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr10:5955790C>T	ENST00000362091.4	+	7	1407	c.1292C>T	c.(1291-1293)tCt>tTt	p.S431F	FBXO18_ENST00000397269.3_5'UTR|FBXO18_ENST00000379999.5_Missense_Mutation_p.S482F	NM_001258453.1|NM_178150.2	NP_001245382.1|NP_835363.1	Q8NFZ0	FBX18_HUMAN	F-box protein, helicase, 18	431					DNA catabolic process, endonucleolytic (GO:0000737)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of protein phosphorylation (GO:0001934)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)	p.S482F(1)		NS(2)|breast(2)|kidney(2)|large_intestine(16)|lung(9)|ovary(2)|prostate(3)|skin(3)|stomach(1)	40						GAGGAGCCATCTGTCTGGCCA	0.423																																							uc001iis.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(1291-1293)TCT>TTT		F-box only protein, helicase, 18 isoform 2							174.0	146.0	156.0					10																	5955790		2203	4300	6503	SO:0001583	missense	84893				DNA repair	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding	g.chr10:5955790C>T	AK095343	CCDS7072.1, CCDS7073.1, CCDS73064.1	10p15.1	2004-08-24	2004-06-15		ENSG00000134452	ENSG00000134452		"""F-boxes /  ""other"""""	13620	protein-coding gene	gene with protein product		607222	"""F-box only protein 18"""			10531037, 11956208	Standard	NM_032807		Approved	FBH1, FLJ14590, Fbx18	uc001iit.4	Q8NFZ0	OTTHUMG00000017609	ENST00000362091.4:c.1292C>T	10.37:g.5955790C>T	ENSP00000355415:p.Ser431Phe					FBXO18_uc001iir.2_Missense_Mutation_p.S357F|FBXO18_uc009xig.2_Missense_Mutation_p.S357F|FBXO18_uc001iit.2_Missense_Mutation_p.S482F	p.S431F	NM_178150	NP_835363	Q8NFZ0	FBX18_HUMAN			7	1387	+			431					Q5JVB0|Q5JVB1|Q7Z4Q6|Q7Z4R0|Q8N1P5|Q8N586|Q96E82|Q96K67|Q96SW7|Q9UFB2	Missense_Mutation	SNP	ENST00000362091.4	37	c.1292C>T	CCDS7072.1	.	.	.	.	.	.	.	.	.	.	C	13.67	2.306482	0.40795	.	.	ENSG00000134452	ENST00000362091;ENST00000544954;ENST00000379999;ENST00000379994	.	.	.	5.63	3.54	0.40534	.	0.480369	0.20896	N	0.083727	T	0.46852	0.1414	L	0.40543	1.245	0.26982	N	0.965335	D;D;D	0.65815	0.995;0.976;0.976	P;P;P	0.58172	0.834;0.656;0.656	T	0.28586	-1.0039	9	0.87932	D	0	-11.2211	9.9673	0.41732	0.1515:0.7017:0.1468:0.0	.	482;431;357	Q8NFZ0-2;Q8NFZ0;Q2TAK1	.;FBX18_HUMAN;.	F	431;168;482;168	.	ENSP00000355415:S431F	S	+	2	0	FBXO18	5995796	0.001000	0.12720	0.397000	0.26308	0.101000	0.19017	1.009000	0.29886	2.652000	0.90054	0.491000	0.48974	TCT		0.423	FBXO18-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046596.1	NM_032807		29	61	0	0	0	0.003755	0	29	61				
OLAH	55301	broad.mit.edu	37	10	15107658	15107658	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr10:15107658G>T	ENST00000378228.3	+	6	732	c.478G>T	c.(478-480)Gga>Tga	p.G160*	OLAH_ENST00000378217.3_Nonsense_Mutation_p.G213*|OLAH_ENST00000485251.1_3'UTR	NM_001039702.2	NP_001034791.1	Q9NV23	SAST_HUMAN	oleoyl-ACP hydrolase	160					fatty acid biosynthetic process (GO:0006633)		myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)	p.G213*(1)		endometrium(2)|large_intestine(1)|lung(14)|stomach(1)	18						TATGGAATTTGGAGGCACCCC	0.413																																							uc001inu.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(478-480)GGA>TGA		oleoyl-ACP hydrolase isoform 2							82.0	77.0	79.0					10																	15107658		2203	4300	6503	SO:0001587	stop_gained	55301				fatty acid biosynthetic process		myristoyl-[acyl-carrier-protein] hydrolase activity|oleoyl-[acyl-carrier-protein] hydrolase activity|palmitoyl-[acyl-carrier-protein] hydrolase activity	g.chr10:15107658G>T	AK001844	CCDS7106.1, CCDS31152.1	10p13	2010-11-23	2006-07-07	2006-07-07	ENSG00000152463	ENSG00000152463	3.1.2.14		25625	protein-coding gene	gene with protein product			"""thioesterase domain containing 1"""	THEDC1			Standard	NM_018324		Approved	FLJ11106, SAST	uc001inu.2	Q9NV23	OTTHUMG00000017724	ENST00000378228.3:c.478G>T	10.37:g.15107658G>T	ENSP00000367473:p.Gly160*					ACBD7_uc010qby.1_Intron|OLAH_uc001int.2_Nonsense_Mutation_p.G213*	p.G160*	NM_001039702	NP_001034791	Q9NV23	SAST_HUMAN			6	732	+			160					Q5VUB6|Q9NUW1	Nonsense_Mutation	SNP	ENST00000378228.3	37	c.478G>T	CCDS31152.1	.	.	.	.	.	.	.	.	.	.	g	24.1	4.491312	0.84962	.	.	ENSG00000152463	ENST00000429028;ENST00000378228;ENST00000378217	.	.	.	5.13	4.23	0.50019	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-19.9768	10.9269	0.47195	0.0887:0.0:0.9113:0.0	.	.	.	.	X	160;160;213	.	ENSP00000367462:G213X	G	+	1	0	OLAH	15147664	0.995000	0.38212	0.826000	0.32828	0.147000	0.21601	2.590000	0.46154	1.289000	0.44618	0.557000	0.71058	GGA		0.413	OLAH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046964.1	NM_018324		34	60	1	0	1.26612e-14	0.003271	1.55294e-14	34	60				
PCDH15	65217	broad.mit.edu	37	10	55700697	55700697	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr10:55700697A>G	ENST00000320301.6	-	24	3555	c.3161T>C	c.(3160-3162)aTg>aCg	p.M1054T	PCDH15_ENST00000361849.3_Missense_Mutation_p.M1054T|PCDH15_ENST00000395433.1_Missense_Mutation_p.M1032T|PCDH15_ENST00000414778.1_Missense_Mutation_p.M1059T|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000437009.1_Missense_Mutation_p.M983T|PCDH15_ENST00000395432.2_Missense_Mutation_p.M1017T|PCDH15_ENST00000395438.1_Missense_Mutation_p.M1054T|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000373965.2_Missense_Mutation_p.M1061T|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000409834.1_Missense_Mutation_p.M665T|PCDH15_ENST00000395430.1_Missense_Mutation_p.M1054T|PCDH15_ENST00000395445.1_Missense_Mutation_p.M1061T	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	1054	Cadherin 10. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)	p.M1054T(2)|p.M1059T(2)		NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				TACACCAACCATGGTCCCTTT	0.363										HNSCC(58;0.16)																													uc001jju.1		NA																	4	Substitution - Missense(4)		lung(4)	pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13						c.(3160-3162)ATG>ACG		protocadherin 15 isoform CD1-4 precursor							101.0	98.0	99.0					10																	55700697		2203	4300	6503	SO:0001583	missense	65217				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding	g.chr10:55700697A>G	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.3161T>C	10.37:g.55700697A>G	ENSP00000322604:p.Met1054Thr	HNSCC(58;0.16)				PCDH15_uc010qhq.1_Missense_Mutation_p.M1059T|PCDH15_uc010qhr.1_Missense_Mutation_p.M1054T|PCDH15_uc010qhs.1_Missense_Mutation_p.M1066T|PCDH15_uc010qht.1_Missense_Mutation_p.M1061T|PCDH15_uc010qhu.1_Missense_Mutation_p.M1054T|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Missense_Mutation_p.M1054T|PCDH15_uc010qhw.1_Missense_Mutation_p.M1017T|PCDH15_uc010qhx.1_Missense_Mutation_p.M983T|PCDH15_uc010qhy.1_Missense_Mutation_p.M1059T|PCDH15_uc010qhz.1_Missense_Mutation_p.M1054T|PCDH15_uc010qia.1_Missense_Mutation_p.M1032T|PCDH15_uc010qib.1_Missense_Mutation_p.M1032T	p.M1054T	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN			24	3556	-		Melanoma(3;0.117)|Lung SC(717;0.238)	1054			Cadherin 10.|Extracellular (Potential).		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000320301.6	37	c.3161T>C	CCDS7248.1	.	.	.	.	.	.	.	.	.	.	A	0.605	-0.827322	0.02734	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000409834;ENST00000395445;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009	T;T;T;T;T;T;T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78	5.37	-3.24	0.05094	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.11836	0.0288	N	0.00268	-1.735	0.09310	N	1	B;B;B;B;B;B;B;B;B;B;B;B;B	0.06786	0.0;0.0;0.0;0.0;0.001;0.0;0.0;0.0;0.001;0.001;0.0;0.0;0.0	B;B;B;B;B;B;B;B;B;B;B;B;B	0.11329	0.004;0.004;0.002;0.001;0.006;0.004;0.004;0.0;0.002;0.001;0.0;0.0;0.001	T	0.36841	-0.9731	9	0.16896	T	0.51	.	7.9084	0.29776	0.3956:0.0:0.4846:0.1198	.	1032;1054;1054;1059;983;1017;1054;1054;1061;1061;1054;1059;1054	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	T	1061;1059;1054;1054;665;1061;1017;1054;1032;1054;1054;1059;983	ENSP00000363076:M1061T;ENSP00000410304:M1059T;ENSP00000378826:M1054T;ENSP00000386693:M665T;ENSP00000378832:M1061T;ENSP00000378820:M1017T;ENSP00000354950:M1054T;ENSP00000378821:M1032T;ENSP00000322604:M1054T;ENSP00000378818:M1054T;ENSP00000412628:M983T	ENSP00000322604:M1054T	M	-	2	0	PCDH15	55370703	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	0.057000	0.14279	-0.459000	0.07013	0.477000	0.44152	ATG		0.363	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056		7	46	0	0	0	0.004482	0	7	46				
BICC1	80114	broad.mit.edu	37	10	60588570	60588570	+	Silent	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr10:60588570C>T	ENST00000373886.3	+	21	2848	c.2844C>T	c.(2842-2844)acC>acT	p.T948T		NM_001080512.1	NP_001073981.1	Q9H694	BICC1_HUMAN	BicC family RNA binding protein 1	948					multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)	cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.T948T(1)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	44						ATGCACGCACCTCTTTCCTGG	0.468																																							uc001jki.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|lung(1)|skin(1)	4						c.(2842-2844)ACC>ACT		bicaudal C homolog 1							106.0	95.0	99.0					10																	60588570		2203	4300	6503	SO:0001819	synonymous_variant	80114				multicellular organismal development		RNA binding	g.chr10:60588570C>T	AK026129	CCDS31206.1	10q21.3	2014-09-17	2014-02-03		ENSG00000122870	ENSG00000122870		"""Sterile alpha motif (SAM) domain containing"""	19351	protein-coding gene	gene with protein product		614295	"""bicaudal C homolog 1 (Drosophila)"""				Standard	XM_005270166		Approved		uc001jki.1	Q9H694	OTTHUMG00000018271	ENST00000373886.3:c.2844C>T	10.37:g.60588570C>T							p.T948T	NM_001080512	NP_001073981	Q9H694	BICC1_HUMAN			21	2844	+			948						Silent	SNP	ENST00000373886.3	37	c.2844C>T	CCDS31206.1																																																																																				0.468	BICC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048150.2	NM_025044		16	48	0	0	0	0.008871	0	16	48				
CDK1	983	broad.mit.edu	37	10	62547906	62547906	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr10:62547906T>A	ENST00000395284.3	+	5	549	c.407T>A	c.(406-408)aTt>aAt	p.I136N	CDK1_ENST00000316629.4_Intron|CDK1_ENST00000448257.2_Missense_Mutation_p.I136N|CDK1_ENST00000373809.2_Intron	NM_001786.4	NP_001777.1	P06493	CDK1_HUMAN	cyclin-dependent kinase 1	136	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cell aging (GO:0007569)|cell migration (GO:0016477)|cellular response to hydrogen peroxide (GO:0070301)|centrosome cycle (GO:0007098)|chromosome condensation (GO:0030261)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell differentiation (GO:0030855)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|MAPK cascade (GO:0000165)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|mitotic G2 DNA damage checkpoint (GO:0007095)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ regeneration (GO:0031100)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of DNA replication (GO:0045740)|positive regulation of gene expression (GO:0010628)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|pronuclear fusion (GO:0007344)|protein complex assembly (GO:0006461)|protein localization to kinetochore (GO:0034501)|Ras protein signal transduction (GO:0007265)|regulation of embryonic development (GO:0045995)|regulation of Schwann cell differentiation (GO:0014038)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to activity (GO:0014823)|response to amine (GO:0014075)|response to axon injury (GO:0048678)|response to cadmium ion (GO:0046686)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to organic cyclic compound (GO:0014070)|response to toxic substance (GO:0009636)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac muscle cell development (GO:0055015)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|midbody (GO:0030496)|mitochondrion (GO:0005739)|mitotic spindle (GO:0072686)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|histone kinase activity (GO:0035173)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)	p.I136N(1)		ovary(1)	1						AATCTCTTGATTGATGACAAA	0.378																																							uc001jld.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(406-408)ATT>AAT		cell division cycle 2 isoform 1							113.0	109.0	110.0					10																	62547906		1817	4082	5899	SO:0001583	missense	983				activation of MAPK activity|activation of MAPKK activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|anti-apoptosis|axon guidance|cell division|epidermal growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway|mitosis|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein localization to kinetochore|Ras protein signal transduction|regulation of transcription involved in G1/S phase of mitotic cell cycle|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|midbody|nucleoplasm|spindle microtubule	ATP binding|cyclin-dependent protein kinase activity|RNA polymerase II carboxy-terminal domain kinase activity	g.chr10:62547906T>A	BC014563	CCDS7260.1, CCDS44408.1	10q21.2	2011-11-08	2009-12-16	2009-12-16	ENSG00000170312	ENSG00000170312		"""Cyclin-dependent kinases"""	1722	protein-coding gene	gene with protein product		116940	"""cell division cycle 2, G1 to S and G2 to M"""	CDC2		3553962, 19884882	Standard	NM_001786		Approved	CDC28A	uc001jld.3	P06493	OTTHUMG00000018290	ENST00000395284.3:c.407T>A	10.37:g.62547906T>A	ENSP00000378699:p.Ile136Asn					CDK1_uc010qii.1_3'UTR|CDK1_uc001jle.2_RNA|CDK1_uc001jlf.2_Missense_Mutation_p.I136N|CDK1_uc001jlg.2_Intron	p.I136N	NM_001786	NP_001777	P06493	CDK1_HUMAN			5	541	+			136			Protein kinase.		A8K7C4|C9J497|O60764	Missense_Mutation	SNP	ENST00000395284.3	37	c.407T>A	CCDS44408.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.103336	0.76983	.	.	ENSG00000170312	ENST00000519078;ENST00000395284;ENST00000448257	T;T	0.70516	-0.49;-0.49	5.8	3.47	0.39725	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.87541	0.6203	H	0.96111	3.77	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.994	D	0.87868	0.2669	10	0.87932	D	0	-8.7234	10.0302	0.42096	0.0:0.1359:0.0:0.8641	.	142;136	Q5H9N4;P06493	.;CDK1_HUMAN	N	136	ENSP00000378699:I136N;ENSP00000397973:I136N	ENSP00000378699:I136N	I	+	2	0	CDK1	62217912	1.000000	0.71417	0.987000	0.45799	0.976000	0.68499	7.794000	0.85869	0.471000	0.27319	0.533000	0.62120	ATT		0.378	CDK1-007	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048211.2	NM_001786		55	54	0	0	0	0.01441	0	55	54				
CTNNA3	29119	broad.mit.edu	37	10	68280485	68280485	+	Missense_Mutation	SNP	G	G	A	rs201810511		TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr10:68280485G>A	ENST00000433211.2	-	11	1595	c.1421C>T	c.(1420-1422)gCg>gTg	p.A474V	CTNNA3_ENST00000373744.4_Missense_Mutation_p.A474V	NM_013266.2	NP_037398.2			catenin (cadherin-associated protein), alpha 3									p.A474V(2)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(1)|lung(50)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	95						GTTTTTGACCGCTTGACTTTT	0.378													A|||	1	0.000199681	0.0	0.0	5008	,	,		11889	0.001		0.0	False		,,,				2504	0.0						uc009xpn.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8						c.(1420-1422)GCG>GTG		catenin, alpha 3		A	VAL/ALA,VAL/ALA	1,4405	826.1+/-416.6	0,1,2202	174.0	148.0	157.0		1421,1421	5.4	1.0	10		157	0,8600		0,0,4300	no	missense,missense	CTNNA3	NM_013266.2,NM_001127384.1	64,64	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign,benign	474/896,474/896	68280485	1,13005	2203	4300	6503	SO:0001583	missense	29119				cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity	g.chr10:68280485G>A	AF091606	CCDS7269.1	10q21	2006-11-24			ENSG00000183230	ENSG00000183230			2511	protein-coding gene	gene with protein product		607667				12596047, 11590244	Standard	XM_005269717		Approved	VR22, MGC26194	uc001jmw.2	Q9UI47	OTTHUMG00000018334	ENST00000433211.2:c.1421C>T	10.37:g.68280485G>A	ENSP00000389714:p.Ala474Val					CTNNA3_uc001jmw.2_Missense_Mutation_p.A474V|CTNNA3_uc001jmx.3_Missense_Mutation_p.A474V	p.A474V	NM_001127384	NP_001120856	Q9UI47	CTNA3_HUMAN			11	1544	-			474						Missense_Mutation	SNP	ENST00000433211.2	37	c.1421C>T	CCDS7269.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	A	8.898	0.955675	0.18507	2.27E-4	0.0	ENSG00000183230	ENST00000433211;ENST00000373744	T;T	0.44881	0.91;0.91	5.43	5.43	0.79202	.	0.000000	0.49916	N	0.000122	T	0.11707	0.0285	N	0.00517	-1.405	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.21690	-1.0238	10	0.02654	T	1	-12.7759	9.9321	0.41528	0.9188:0.0:0.0812:0.0	.	474;474	Q9UI47-2;Q9UI47	.;CTNA3_HUMAN	V	474	ENSP00000389714:A474V;ENSP00000362849:A474V	ENSP00000362849:A474V	A	-	2	0	CTNNA3	67950491	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.173000	0.65010	1.009000	0.39289	-0.269000	0.10298	GCG		0.378	CTNNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048282.2	NM_013266		61	85	0	0	0	0.01441	0	61	85				
SLC29A3	55315	broad.mit.edu	37	10	73121984	73121984	+	Silent	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr10:73121984C>T	ENST00000373189.5	+	6	1099	c.1047C>T	c.(1045-1047)ctC>ctT	p.L349L	SLC29A3_ENST00000469204.1_3'UTR	NM_001174098.1|NM_018344.5	NP_001167569.1|NP_060814.4	Q9BZD2	S29A3_HUMAN	solute carrier family 29 (equilibrative nucleoside transporter), member 3	349					transmembrane transport (GO:0055085)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	nucleoside transmembrane transporter activity (GO:0005337)	p.L349L(1)		endometrium(3)|kidney(2)|large_intestine(3)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	15						TCATCCCCCTCACTACCTTCC	0.582																																					Esophageal Squamous(200;1319 2142 18949 31248 39672)	Esophageal Squamous(200;1319 2142 18949 31248 39672)	uc001jrr.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1045-1047)CTC>CTT		solute carrier family 29 (nucleoside							222.0	210.0	214.0					10																	73121984		2203	4300	6503	SO:0001819	synonymous_variant	55315				nucleobase, nucleoside and nucleotide metabolic process	integral to membrane|late endosome membrane|lysosomal membrane	nucleoside transmembrane transporter activity	g.chr10:73121984C>T	AF326987	CCDS7310.1	10q22.2	2013-07-17	2013-07-17		ENSG00000198246	ENSG00000198246		"""Solute carriers"""	23096	protein-coding gene	gene with protein product		612373	"""solute carrier family 29 (nucleoside transporters), member 3"""			11396612	Standard	NM_018344		Approved	ENT3, FLJ11160	uc001jrr.4	Q9BZD2	OTTHUMG00000018424	ENST00000373189.5:c.1047C>T	10.37:g.73121984C>T						SLC29A3_uc001jrs.3_3'UTR|SLC29A3_uc010qjq.1_Silent_p.L203L|SLC29A3_uc001jrt.3_Silent_p.L143L|SLC29A3_uc001jru.3_Silent_p.L161L	p.L349L	NM_018344	NP_060814	Q9BZD2	S29A3_HUMAN			6	1104	+			349			Helical; (Potential).		B2RB50|B4E2Z9|B7ZA37|Q0VAM9|Q5T465|Q7RTT8|Q8IVZ0|Q9BWI2|Q9NUS9	Silent	SNP	ENST00000373189.5	37	c.1047C>T	CCDS7310.1																																																																																				0.582	SLC29A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048544.1	NM_018344		100	152	0	0	0	0.01441	0	100	152				
CC2D2B	387707	broad.mit.edu	37	10	97769676	97769676	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr10:97769676C>A	ENST00000344386.3	+	3	280	c.116C>A	c.(115-117)tCt>tAt	p.S39Y	CC2D2B_ENST00000371198.2_Missense_Mutation_p.S130Y|ENTPD1-AS1_ENST00000451364.1_RNA|CC2D2B_ENST00000410012.2_Missense_Mutation_p.S39Y|ENTPD1-AS1_ENST00000454638.1_RNA|ENTPD1-AS1_ENST00000416301.1_RNA|RP11-690P14.4_ENST00000475252.2_3'UTR|ENTPD1-AS1_ENST00000452728.1_RNA	NM_001001732.3	NP_001001732.2	Q6DHV5	C2D2B_HUMAN	coiled-coil and C2 domain containing 2B	39								p.S39Y(2)		large_intestine(1)|lung(7)|ovary(1)|urinary_tract(1)	10		Colorectal(252;0.158)		Epithelial(162;7.08e-08)|all cancers(201;2.71e-06)		CTGCAACAATCTGAGGTAAGA	0.398																																							uc001kll.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(115-117)TCT>TAT		coiled-coil and C2 domain containing 2B isoform							131.0	122.0	125.0					10																	97769676		1868	4096	5964	SO:0001583	missense	387707							g.chr10:97769676C>A	BC075861	CCDS41555.1, CCDS53560.1	10q23.33	2008-11-06	2007-10-19	2007-10-19	ENSG00000188649	ENSG00000188649			31666	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 130"""	C10orf130			Standard	NM_001001732		Approved	bA248J23.4	uc010qop.2	Q6DHV5	OTTHUMG00000018820	ENST00000344386.3:c.116C>A	10.37:g.97769676C>A	ENSP00000343747:p.Ser39Tyr					uc001klg.1_Intron|uc001klj.1_Intron|CC2D2B_uc001klk.2_RNA|CC2D2B_uc010qop.1_Missense_Mutation_p.S39Y	p.S39Y	NM_001001732	NP_001001732	Q6DHV5	C2D2B_HUMAN		Epithelial(162;7.08e-08)|all cancers(201;2.71e-06)	3	315	+		Colorectal(252;0.158)	39					A2A3E9|B4DYD4|E9PCC3|Q5VUS0	Missense_Mutation	SNP	ENST00000344386.3	37	c.116C>A	CCDS41555.1	.	.	.	.	.	.	.	.	.	.	C	18.31	3.596285	0.66332	.	.	ENSG00000188649	ENST00000371198;ENST00000424464;ENST00000451649;ENST00000410012;ENST00000344386	D;D;D;T	0.95001	-3.58;-3.58;-1.61;-0.96	5.59	4.68	0.58851	.	.	.	.	.	D	0.93501	0.7926	M	0.68952	2.095	0.23546	N	0.997441	P;P	0.40431	0.717;0.603	B;B	0.43225	0.412;0.206	D	0.86254	0.1651	9	0.27785	T	0.31	.	11.6284	0.51160	0.0:0.9165:0.0:0.0835	.	39;39	E9PCC3;Q6DHV5	.;C2D2B_HUMAN	Y	130;39;39;39;39	ENSP00000360241:S130Y;ENSP00000391834:S39Y;ENSP00000386988:S39Y;ENSP00000343747:S39Y	ENSP00000343747:S39Y	S	+	2	0	CC2D2B	97759666	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.133000	0.50531	1.373000	0.46208	0.644000	0.83932	TCT		0.398	CC2D2B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000049573.3	NM_001001732		18	75	1	0	7.41877e-09	0.012319	8.34337e-09	18	75				
DNMBP	23268	broad.mit.edu	37	10	101646282	101646282	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr10:101646282G>C	ENST00000324109.4	-	13	3484	c.3393C>G	c.(3391-3393)ttC>ttG	p.F1131L	DNMBP_ENST00000342239.3_Missense_Mutation_p.F1155L|DNMBP_ENST00000540316.1_Missense_Mutation_p.F67L|DNMBP_ENST00000543621.1_Missense_Mutation_p.F377L|DNMBP_ENST00000472036.1_5'UTR	NM_015221.2	NP_056036.1	Q6XZF7	DNMBP_HUMAN	dynamin binding protein	1131	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				intracellular signal transduction (GO:0035556)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.F1131L(1)		central_nervous_system(1)|cervix(4)|endometrium(9)|large_intestine(14)|lung(19)|ovary(5)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	61		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)		TACAGTTATAGAAGTCCAGGA	0.517																																							uc001kqj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(1)	6						c.(3391-3393)TTC>TTG		dynamin binding protein							124.0	127.0	126.0					10																	101646282		2203	4300	6503	SO:0001583	missense	23268				intracellular signal transduction|regulation of Rho protein signal transduction	cell junction|cytoskeleton|Golgi stack|synapse	protein binding|Rho guanyl-nucleotide exchange factor activity	g.chr10:101646282G>C	AL833283	CCDS7485.1	10q24.31	2012-07-24			ENSG00000107554	ENSG00000107554		"""Rho guanine nucleotide exchange factors"""	30373	protein-coding gene	gene with protein product	"""scaffold protein TUBA"""	611282				10231032, 14506234	Standard	NM_015221		Approved	KIAA1010, Tuba, ARHGEF36	uc001kqj.2	Q6XZF7	OTTHUMG00000018897	ENST00000324109.4:c.3393C>G	10.37:g.101646282G>C	ENSP00000315659:p.Phe1131Leu					DNMBP_uc010qpl.1_Missense_Mutation_p.F67L|DNMBP_uc001kqg.2_Missense_Mutation_p.F419L|DNMBP_uc001kqh.2_Missense_Mutation_p.F763L	p.F1131L	NM_015221	NP_056036	Q6XZF7	DNMBP_HUMAN		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)	13	3485	-		Colorectal(252;0.234)	1131			BAR.		Q8IVY3|Q9Y2L3	Missense_Mutation	SNP	ENST00000324109.4	37	c.3393C>G	CCDS7485.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.215692	0.79352	.	.	ENSG00000107554	ENST00000342239;ENST00000324109;ENST00000393570;ENST00000543621;ENST00000540316	T;T;T;T	0.60171	0.21;0.21;0.21;0.21	5.82	2.92	0.33932	BAR (3);	0.130110	0.35615	N	0.003082	T	0.64360	0.2591	L	0.49126	1.545	0.39122	D	0.961686	D;D;D	0.71674	0.998;0.962;0.998	D;P;D	0.67231	0.95;0.523;0.95	T	0.64179	-0.6468	10	0.66056	D	0.02	-17.4188	6.5763	0.22569	0.2084:0.1296:0.662:0.0	.	1131;377;1155	Q6XZF7;Q6XZF7-2;Q5SVK8	DNMBP_HUMAN;.;.	L	1155;1131;377;377;67	ENSP00000344914:F1155L;ENSP00000315659:F1131L;ENSP00000443657:F377L;ENSP00000443573:F67L	ENSP00000315659:F1131L	F	-	3	2	DNMBP	101636272	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	3.137000	0.50562	0.359000	0.24239	0.561000	0.74099	TTC		0.517	DNMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049832.2	NM_015221		104	114	0	0	0	0.01441	0	104	114				
PDCD11	22984	broad.mit.edu	37	10	105191887	105191887	+	Splice_Site	SNP	G	G	C			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr10:105191887G>C	ENST00000369797.3	+	22	3464	c.3370G>C	c.(3370-3372)Gag>Cag	p.E1124Q		NM_014976.1	NP_055791.1	Q14690	RRP5_HUMAN	programmed cell death 11	1124					mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)	p.E1124Q(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	64		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		TGCAAACAGTGAGCTGGAGGA	0.473																																							uc001kwy.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(2)|skin(2)|central_nervous_system(1)	7						c.(3370-3372)GAG>CAG		programmed cell death 11							150.0	133.0	139.0					10																	105191887		2203	4300	6503	SO:0001630	splice_region_variant	22984				mRNA processing|rRNA processing	nucleolus	RNA binding|transcription factor binding	g.chr10:105191887G>C	D80007	CCDS31276.1	10q24.32	2010-07-06			ENSG00000148843	ENSG00000148843			13408	protein-coding gene	gene with protein product		612333				10229231	Standard	XM_005269647		Approved	KIAA0185, ALG-4, RRP5	uc001kwy.1	Q14690	OTTHUMG00000018988	ENST00000369797.3:c.3369-1G>C	10.37:g.105191887G>C							p.E1124Q	NM_014976	NP_055791	Q14690	RRP5_HUMAN		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)	22	3457	+		Colorectal(252;0.0747)|Breast(234;0.128)	1124					Q2TA92|Q5W093|Q6P2J3|Q86VQ8|Q9H4P1	Missense_Mutation	SNP	ENST00000369797.3	37	c.3370G>C	CCDS31276.1	.	.	.	.	.	.	.	.	.	.	G	19.87	3.906827	0.72868	.	.	ENSG00000148843	ENST00000369797;ENST00000543503	T	0.10288	2.89	5.4	5.4	0.78164	Nucleic acid-binding, OB-fold-like (1);	0.296390	0.42964	D	0.000622	T	0.10852	0.0265	L	0.29908	0.895	0.45087	D	0.998108	P	0.48998	0.918	B	0.43809	0.432	T	0.22068	-1.0227	10	0.19590	T	0.45	-16.9699	17.1267	0.86716	0.0:0.0:1.0:0.0	.	1124	Q14690	RRP5_HUMAN	Q	1124	ENSP00000358812:E1124Q	ENSP00000358812:E1124Q	E	+	1	0	PDCD11	105181877	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	5.228000	0.65310	2.813000	0.96785	0.561000	0.74099	GAG		0.473	PDCD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050151.1		Missense_Mutation	43	68	0	0	0	0.01441	0	43	68				
SORCS3	22986	broad.mit.edu	37	10	106970956	106970956	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr10:106970956G>T	ENST00000369701.3	+	17	2550	c.2323G>T	c.(2323-2325)Gca>Tca	p.A775S	SORCS3_ENST00000369699.4_Missense_Mutation_p.A61S	NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	775					learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)	p.A775S(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		GTACAATCCAGCATCCCCATC	0.453																																					NSCLC(116;1497 1690 7108 13108 14106)	NSCLC(116;1497 1690 7108 13108 14106)	uc001kyi.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|skin(3)|central_nervous_system(1)	10						c.(2323-2325)GCA>TCA		VPS10 domain receptor protein SORCS 3 precursor							115.0	95.0	102.0					10																	106970956		2203	4300	6503	SO:0001583	missense	22986					integral to membrane	neuropeptide receptor activity	g.chr10:106970956G>T	AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.2323G>T	10.37:g.106970956G>T	ENSP00000358715:p.Ala775Ser					SORCS3_uc010qqz.1_RNA	p.A775S	NM_014978	NP_055793	Q9UPU3	SORC3_HUMAN		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)	17	2550	+		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)	775			Lumenal (Potential).		Q5VXF9|Q9NQJ2	Missense_Mutation	SNP	ENST00000369701.3	37	c.2323G>T	CCDS7558.1	.	.	.	.	.	.	.	.	.	.	G	12.81	2.051042	0.36181	.	.	ENSG00000156395	ENST00000369701;ENST00000393176;ENST00000369699	T;T;T	0.29917	2.55;1.61;1.55	5.93	4.96	0.65561	VPS10 (1);	0.458519	0.24700	N	0.036303	T	0.08088	0.0202	N	0.00661	-1.28	0.33605	D	0.60286	B	0.06786	0.001	B	0.04013	0.001	T	0.28396	-1.0045	9	.	.	.	.	6.8772	0.24153	0.0893:0.0:0.6303:0.2804	.	775	Q9UPU3	SORC3_HUMAN	S	775;136;61	ENSP00000358715:A775S;ENSP00000376876:A136S;ENSP00000358713:A61S	.	A	+	1	0	SORCS3	106960946	0.997000	0.39634	1.000000	0.80357	0.998000	0.95712	2.881000	0.48538	2.826000	0.97356	0.655000	0.94253	GCA		0.453	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050221.1	NM_014978		20	25	1	0	1.28384e-07	0.012319	1.40223e-07	20	25				
ZDHHC6	64429	broad.mit.edu	37	10	114192186	114192186	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr10:114192186G>T	ENST00000369405.3	-	9	1462	c.1039C>A	c.(1039-1041)Cct>Act	p.P347T	ZDHHC6_ENST00000369404.3_Missense_Mutation_p.P343T|ZDHHC6_ENST00000482410.1_5'UTR	NM_022494.1	NP_071939.1	Q9H6R6	ZDHC6_HUMAN	zinc finger, DHHC-type containing 6	347					protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.P347T(1)		endometrium(4)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Colorectal(252;0.198)		Epithelial(162;0.0291)|all cancers(201;0.117)		TGTATTCGAGGCTCTTCGGTG	0.403																																							uc001kzv.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1039-1041)CCT>ACT		zinc finger, DHHC-type containing 6							152.0	153.0	153.0					10																	114192186		2203	4300	6503	SO:0001583	missense	64429					integral to membrane	acyltransferase activity|zinc ion binding	g.chr10:114192186G>T	AK025605	CCDS7574.1	10q26.11	2008-05-02			ENSG00000023041	ENSG00000023041		"""Zinc fingers, DHHC-type"""	19160	protein-coding gene	gene with protein product							Standard	NM_022494		Approved	ZNF376, FLJ21952	uc001kzv.3	Q9H6R6	OTTHUMG00000019062	ENST00000369405.3:c.1039C>A	10.37:g.114192186G>T	ENSP00000358413:p.Pro347Thr					ZDHHC6_uc001kzw.2_Missense_Mutation_p.P343T	p.P347T	NM_022494	NP_071939	Q9H6R6	ZDHC6_HUMAN		Epithelial(162;0.0291)|all cancers(201;0.117)	9	1463	-		Colorectal(252;0.198)	347					D3DRB6|Q53G45|Q96IV7|Q9H605	Missense_Mutation	SNP	ENST00000369405.3	37	c.1039C>A	CCDS7574.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.857227	0.91433	.	.	ENSG00000023041	ENST00000369405;ENST00000369404	T;T	0.13420	2.59;2.59	5.87	5.87	0.94306	Src homology-3 domain (1);Variant SH3 (1);	0.000000	0.85682	D	0.000000	T	0.42877	0.1222	M	0.77820	2.39	0.80722	D	1	D;D	0.89917	1.0;0.981	D;P	0.97110	1.0;0.8	T	0.10683	-1.0619	10	0.56958	D	0.05	0.0278	20.5827	0.99408	0.0:0.0:1.0:0.0	.	343;347	Q9H6R6-2;Q9H6R6	.;ZDHC6_HUMAN	T	347;343	ENSP00000358413:P347T;ENSP00000358412:P343T	ENSP00000358412:P343T	P	-	1	0	ZDHHC6	114182176	1.000000	0.71417	0.996000	0.52242	0.921000	0.55340	9.723000	0.98772	2.941000	0.99782	0.655000	0.94253	CCT		0.403	ZDHHC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050393.1	NM_022494		39	133	1	0	1.03484e-13	0.005524	1.24905e-13	39	133				
NRAP	4892	broad.mit.edu	37	10	115422452	115422452	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr10:115422452C>G	ENST00000359988.3	-	3	485	c.241G>C	c.(241-243)Gag>Cag	p.E81Q	NRAP_ENST00000360478.3_Missense_Mutation_p.E81Q|NRAP_ENST00000369360.3_Missense_Mutation_p.E81Q|NRAP_ENST00000369358.4_Missense_Mutation_p.E81Q	NM_001261463.1|NM_198060.3	NP_001248392.1|NP_932326.2			nebulin-related anchoring protein									p.E81Q(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(18)|lung(39)|ovary(6)|prostate(3)|skin(1)|stomach(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		CTGATGGCCTCTGGAAATGTC	0.363																																							uc001laj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|central_nervous_system(3)|upper_aerodigestive_tract(1)	10						c.(241-243)GAG>CAG		nebulin-related anchoring protein isoform S							133.0	124.0	127.0					10																	115422452		2203	4300	6503	SO:0001583	missense	4892					fascia adherens|muscle tendon junction	actin binding|muscle alpha-actinin binding|zinc ion binding	g.chr10:115422452C>G		CCDS7578.1, CCDS7579.1, CCDS73199.1	10q24-q26	2008-08-01			ENSG00000197893	ENSG00000197893			7988	protein-coding gene	gene with protein product		602873				12789664, 10320340	Standard	NM_006175		Approved		uc001lal.4	Q86VF7	OTTHUMG00000019072	ENST00000359988.3:c.241G>C	10.37:g.115422452C>G	ENSP00000353078:p.Glu81Gln					NRAP_uc001lak.2_Missense_Mutation_p.E81Q|NRAP_uc001lal.3_Missense_Mutation_p.E81Q	p.E81Q	NM_198060	NP_932326	Q86VF7	NRAP_HUMAN		Epithelial(162;0.00392)|all cancers(201;0.00569)	3	405	-		Colorectal(252;0.0233)|Breast(234;0.188)	81			Nebulin 1.			Missense_Mutation	SNP	ENST00000359988.3	37	c.241G>C	CCDS7579.1	.	.	.	.	.	.	.	.	.	.	C	12.05	1.821834	0.32237	.	.	ENSG00000197893	ENST00000369358;ENST00000369360;ENST00000359988;ENST00000360478	T;T;T;T	0.19938	2.29;2.3;2.19;2.11	5.62	5.62	0.85841	.	0.600516	0.18014	N	0.154452	T	0.27313	0.0670	L	0.39898	1.24	0.20196	N	0.999923	B;B;B	0.29508	0.078;0.246;0.159	B;B;B	0.40602	0.135;0.334;0.224	T	0.22068	-1.0227	10	0.16896	T	0.51	.	19.648	0.95790	0.0:1.0:0.0:0.0	.	81;81;81	A0AVL2;Q86VF7-4;Q86VF7	.;.;NRAP_HUMAN	Q	81	ENSP00000358365:E81Q;ENSP00000358367:E81Q;ENSP00000353078:E81Q;ENSP00000353666:E81Q	ENSP00000353078:E81Q	E	-	1	0	NRAP	115412442	0.992000	0.36948	0.022000	0.16811	0.022000	0.10575	5.212000	0.65225	2.822000	0.97130	0.650000	0.86243	GAG		0.363	NRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050425.2	NM_006175		44	76	0	0	0	0.01441	0	44	76				
PNLIPRP1	5407	broad.mit.edu	37	10	118360714	118360714	+	Splice_Site	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr10:118360714G>T	ENST00000528052.1	+	10	1134		c.e10+1		PNLIPRP1_ENST00000534537.1_Splice_Site|PNLIPRP1_ENST00000358834.4_Splice_Site			P54315	LIPR1_HUMAN	pancreatic lipase-related protein 1						lipid metabolic process (GO:0006629)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|triglyceride lipase activity (GO:0004806)	p.?(1)		breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	38				all cancers(201;0.0161)		AATTTCGCTCGTAAGTTGCAC	0.418																																							uc001lco.1		NA																	1	Unknown(1)		lung(1)	ovary(1)|breast(1)	2						c.e10+1		pancreatic lipase-related protein 1 precursor							110.0	90.0	97.0					10																	118360714		2203	4300	6503	SO:0001630	splice_region_variant	5407				lipid metabolic process		calcium ion binding|triglyceride lipase activity	g.chr10:118360714G>T	BC025784	CCDS7595.1	10q26.12	2006-07-04			ENSG00000187021	ENSG00000187021			9156	protein-coding gene	gene with protein product		604422				1379598	Standard	NM_006229		Approved	PLRP1	uc001lco.1	P54315	OTTHUMG00000019109	ENST00000528052.1:c.1063+1G>T	10.37:g.118360714G>T						PNLIPRP1_uc001lcp.2_Splice_Site_p.R355_splice	p.R355_splice	NM_006229	NP_006220	P54315	LIPR1_HUMAN		all cancers(201;0.0161)	10	1081	+								Q68D83|Q68DR6|Q8TAU2|Q9BS82	Splice_Site	SNP	ENST00000528052.1	37	c.1063_splice	CCDS7595.1	.	.	.	.	.	.	.	.	.	.	G	11.03	1.518232	0.27211	.	.	ENSG00000187021	ENST00000358834;ENST00000528052;ENST00000534537	.	.	.	5.25	5.25	0.73442	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.9599	0.89082	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PNLIPRP1	118350704	1.000000	0.71417	0.999000	0.59377	0.069000	0.16628	6.416000	0.73332	2.601000	0.87937	0.591000	0.81541	.		0.418	PNLIPRP1-011	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384633.1	NM_006229	Intron	11	52	1	0	9.31168e-06	0.001855	9.96928e-06	11	52				
RGS10	6001	broad.mit.edu	37	10	121275047	121275047	+	Silent	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr10:121275047G>A	ENST00000369101.3	-	3	376	c.349C>T	c.(349-351)Ctg>Ttg	p.L117L	RGS10_ENST00000392865.1_Silent_p.L111L|RGS10_ENST00000469575.1_Intron|RGS10_ENST00000369103.2_Silent_p.L125L			O43665	RGS10_HUMAN	regulator of G-protein signaling 10	117	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)	p.L125L(1)		breast(2)|large_intestine(1)|lung(3)	6		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.00105)|GBM - Glioblastoma multiforme(135;0.195)		TGGAACATCAGAGGGTGCGGT	0.507																																							uc001lee.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(349-351)CTG>TTG		regulator of G-protein signaling 10 isoform b							177.0	148.0	158.0					10																	121275047		2203	4300	6503	SO:0001819	synonymous_variant	6001				negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|protein binding|signal transducer activity	g.chr10:121275047G>A	AF045229	CCDS31294.1, CCDS41572.1	10q25	2007-08-14	2007-08-14		ENSG00000148908	ENSG00000148908		"""Regulators of G-protein signaling"""	9992	protein-coding gene	gene with protein product		602856	"""regulator of G-protein signalling 10"""			8774883	Standard	NM_002925		Approved		uc001leg.3	O43665	OTTHUMG00000019150	ENST00000369101.3:c.349C>T	10.37:g.121275047G>A						RGS10_uc001lef.2_Silent_p.L111L|RGS10_uc001leg.2_Silent_p.L125L	p.L117L	NM_002925	NP_002916	O43665	RGS10_HUMAN		all cancers(201;0.00105)|GBM - Glioblastoma multiforme(135;0.195)	3	349	-		Lung NSC(174;0.094)|all_lung(145;0.123)	117			RGS.		A8K408|B1AMR8|Q6IAZ6|Q96GN0	Silent	SNP	ENST00000369101.3	37	c.349C>T																																																																																					0.507	RGS10-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050655.1	NM_002925		31	27	0	0	0	0.013726	0	31	27				
BTBD16	118663	broad.mit.edu	37	10	124043431	124043431	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr10:124043431G>T	ENST00000260723.4	+	4	484	c.233G>T	c.(232-234)gGg>gTg	p.G78V	BTBD16_ENST00000368994.2_Missense_Mutation_p.G79V	NM_144587.2	NP_653188.2	Q32M84	BTBDG_HUMAN	BTB (POZ) domain containing 16	78								p.G78V(1)		breast(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(3)|skin(2)|stomach(1)|urinary_tract(1)	15		all_neural(114;0.107)|Lung NSC(174;0.175)|all_lung(145;0.222)|Breast(234;0.238)				ATCCAAAGTGGGGAAGCAGGT	0.398																																							uc001lgc.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(232-234)GGG>GTG		BTB (POZ) domain containing 16							99.0	99.0	99.0					10																	124043431		2203	4300	6503	SO:0001583	missense	118663							g.chr10:124043431G>T	AK058088	CCDS31301.1	10q26.13	2013-01-24	2006-07-04	2006-07-04	ENSG00000138152	ENSG00000138152		"""BTB/POZ domain containing"""	26340	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 87"""	C10orf87			Standard	NM_144587		Approved	FLJ25359, Em:AC061711.1	uc001lgc.1	Q32M84	OTTHUMG00000019182	ENST00000260723.4:c.233G>T	10.37:g.124043431G>T	ENSP00000260723:p.Gly78Val					BTBD16_uc001lgd.1_Missense_Mutation_p.G77V	p.G78V	NM_144587	NP_653188	Q32M84	BTBDG_HUMAN			4	484	+		all_neural(114;0.107)|Lung NSC(174;0.175)|all_lung(145;0.222)|Breast(234;0.238)	78					A6NM63|Q4VXL1|Q96LN0	Missense_Mutation	SNP	ENST00000260723.4	37	c.233G>T	CCDS31301.1	.	.	.	.	.	.	.	.	.	.	G	3.717	-0.058414	0.07317	.	.	ENSG00000138152	ENST00000260723;ENST00000368994	T;T	0.20598	2.06;2.06	3.65	-1.84	0.07809	BTB/POZ fold (2);	1.934510	0.02534	N	0.093883	T	0.25082	0.0609	M	0.62723	1.935	0.09310	N	1	B;B	0.19200	0.034;0.034	B;B	0.21708	0.036;0.036	T	0.32824	-0.9892	10	0.30078	T	0.28	0.057	10.2421	0.43319	0.0876:0.5169:0.3956:0.0	.	79;78	Q32M84-2;Q32M84	.;BTBDG_HUMAN	V	78;79	ENSP00000260723:G78V;ENSP00000357990:G79V	ENSP00000260723:G78V	G	+	2	0	BTBD16	124033421	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	0.046000	0.14035	-0.713000	0.04981	-2.479000	0.00199	GGG		0.398	BTBD16-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000050780.3	NM_144587		19	41	1	0	3.5997e-14	0.014323	4.37271e-14	19	41				
DMBT1	1755	broad.mit.edu	37	10	124395614	124395614	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr10:124395614C>T	ENST00000338354.3	+	50	6375	c.6269C>T	c.(6268-6270)tCt>tTt	p.S2090F	DMBT1_ENST00000359586.6_Missense_Mutation_p.S810F|DMBT1_ENST00000368956.2_Missense_Mutation_p.S1462F|DMBT1_ENST00000330163.4_Missense_Mutation_p.S1462F|DMBT1_ENST00000368955.3_Missense_Mutation_p.S2080F|DMBT1_ENST00000344338.3_Missense_Mutation_p.S2080F|DMBT1_ENST00000368909.3_Missense_Mutation_p.S2090F			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	2090	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)	p.S2090F(2)|p.S2219F(1)		breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				TCCTTCACTTCTTCCTCCAAC	0.522																																					Ovarian(182;93 2026 18125 22222 38972)	Ovarian(182;93 2026 18125 22222 38972)	uc001lgk.1		NA																	3	Substitution - Missense(3)		lung(3)	central_nervous_system(7)	7						c.(6268-6270)TCT>TTT		deleted in malignant brain tumors 1 isoform b							101.0	100.0	100.0					10																	124395614		1999	4159	6158	SO:0001583	missense	1755				epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding	g.chr10:124395614C>T		CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.6269C>T	10.37:g.124395614C>T	ENSP00000342210:p.Ser2090Phe					DMBT1_uc001lgl.1_Missense_Mutation_p.S2080F|DMBT1_uc001lgm.1_Missense_Mutation_p.S1462F|DMBT1_uc009xzz.1_Missense_Mutation_p.S2089F|DMBT1_uc010qtx.1_Missense_Mutation_p.S810F|DMBT1_uc009yab.1_Missense_Mutation_p.S793F|DMBT1_uc009yac.1_Missense_Mutation_p.S384F	p.S2090F	NM_007329	NP_015568	Q9UGM3	DMBT1_HUMAN			50	6375	+		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)	2090			CUB 2.		A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Missense_Mutation	SNP	ENST00000338354.3	37	c.6269C>T		.	.	.	.	.	.	.	.	.	.	C	14.93	2.683295	0.47991	.	.	ENSG00000187908	ENST00000338354;ENST00000368915;ENST00000341278;ENST00000368953;ENST00000339871;ENST00000368942;ENST00000327438;ENST00000344338;ENST00000339712;ENST00000330163;ENST00000368909;ENST00000368955;ENST00000368956;ENST00000344467;ENST00000359586	T;T;T;T;T;T;T	0.40476	1.03;1.03;1.03;1.03;1.03;1.03;1.03	5.39	5.39	0.77823	CUB (5);	0.419184	0.17523	N	0.171191	T	0.75057	0.3798	H	0.94620	3.56	0.45452	D	0.998425	D;P;D;B;D;D;D	0.89917	1.0;0.921;1.0;0.244;1.0;1.0;1.0	D;P;D;B;D;D;D	0.97110	0.999;0.511;0.999;0.041;0.999;0.999;1.0	T	0.80774	-0.1232	10	0.62326	D	0.03	.	17.0654	0.86557	0.0:1.0:0.0:0.0	.	810;2070;1339;2219;1462;2080;2090	F8WEF7;Q9UGM3-5;Q9UGM3-8;Q9UGM3-6;Q9UGM3-2;Q9UGM3-3;Q9UGM3	.;.;.;.;.;.;DMBT1_HUMAN	F	2090;2219;2090;2090;2090;2089;1462;2080;1462;1462;2090;2080;1462;236;810	ENSP00000342210:S2090F;ENSP00000343175:S2080F;ENSP00000327747:S1462F;ENSP00000357905:S2090F;ENSP00000357951:S2080F;ENSP00000357952:S1462F;ENSP00000352593:S810F	ENSP00000331522:S1462F	S	+	2	0	DMBT1	124385604	0.996000	0.38824	0.137000	0.22149	0.024000	0.10985	5.166000	0.64965	2.705000	0.92388	0.558000	0.71614	TCT		0.522	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050792.2	NM_004406		12	40	0	0	0	0.013537	0	12	40				
FANK1	92565	broad.mit.edu	37	10	127697946	127697946	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr10:127697946T>C	ENST00000368693.1	+	11	1081	c.977T>C	c.(976-978)gTa>gCa	p.V326A	FANK1_ENST00000368695.1_Missense_Mutation_p.V320A|FANK1_ENST00000477963.1_3'UTR			Q8TC84	FANK1_HUMAN	fibronectin type III and ankyrin repeat domains 1	326						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.V326A(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(10)|ovary(1)|urinary_tract(1)	21		all_lung(145;0.00752)|Lung NSC(174;0.0115)|Colorectal(57;0.0847)|all_neural(114;0.0936)				ATCTAGAGTGTAGTCTCCTTA	0.403																																							uc001ljh.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(976-978)GTA>GCA		fibronectin type III and ankyrin repeat domains							88.0	91.0	90.0					10																	127697946		2203	4300	6503	SO:0001583	missense	92565					cytoplasm|nucleus		g.chr10:127697946T>C	BC024189	CCDS31309.1	10q26.2	2013-02-11	2005-03-01		ENSG00000203780	ENSG00000203780		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	23527	protein-coding gene	gene with protein product		611640	"""fibronectin type 3 and ankyrin repeat domains 1"""			12477932	Standard	NM_145235		Approved		uc001ljh.4	Q8TC84	OTTHUMG00000019241	ENST00000368693.1:c.977T>C	10.37:g.127697946T>C	ENSP00000357682:p.Val326Ala					FANK1_uc009yan.2_Missense_Mutation_p.V352A|FANK1_uc001lji.2_3'UTR	p.V326A	NM_145235	NP_660278	Q8TC84	FANK1_HUMAN			11	1081	+		all_lung(145;0.00752)|Lung NSC(174;0.0115)|Colorectal(57;0.0847)|all_neural(114;0.0936)	326					Q6UXY9|Q6X7T6	Missense_Mutation	SNP	ENST00000368693.1	37	c.977T>C	CCDS31309.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.14|12.14	1.849734|1.849734	0.32699|0.32699	.|.	.|.	ENSG00000203780|ENSG00000203780	ENST00000368695;ENST00000368693;ENST00000368691;ENST00000368692|ENST00000456942	T;T;T|.	0.55052|.	0.54;0.54;1.94|.	4.98|4.98	4.98|4.98	0.66077|0.66077	Ankyrin repeat-containing domain (3);|.	0.180058|.	0.36519|.	N|.	0.002544|.	T|.	0.52322|.	0.1727|.	L|L	0.27053|0.27053	0.805|0.805	0.80722|0.80722	D|D	1|1	P;P|.	0.48694|.	0.835;0.914|.	B;B|.	0.41271|.	0.352;0.138|.	T|.	0.49312|.	-0.8953|.	10|.	0.02654|.	T|.	1|.	-19.1085|-19.1085	13.795|13.795	0.63166|0.63166	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	352;326|.	Q8TC84-3;Q8TC84|.	.;FANK1_HUMAN|.	A|Q	320;326;263;352|180	ENSP00000357684:V320A;ENSP00000357682:V326A;ENSP00000357680:V263A|.	ENSP00000357680:V263A|.	V|X	+|+	2|1	0|0	FANK1|FANK1	127687936|127687936	0.996000|0.996000	0.38824|0.38824	0.731000|0.731000	0.30826|0.30826	0.059000|0.059000	0.15707|0.15707	5.270000|5.270000	0.65547|0.65547	2.093000|2.093000	0.63338|0.63338	0.460000|0.460000	0.39030|0.39030	GTA|TAG		0.403	FANK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_145235		20	64	0	0	0	0.012319	0	20	64				
FOXI2	399823	broad.mit.edu	37	10	129536807	129536807	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr10:129536807G>A	ENST00000388920.4	+	2	574	c.535G>A	c.(535-537)Gac>Aac	p.D179N		NM_207426.2	NP_997309.2	Q6ZQN5	FOXI2_HUMAN	forkhead box I2	179					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D179N(1)		large_intestine(1)|lung(3)	4		all_epithelial(44;0.0021)|all_lung(145;0.0586)|Lung NSC(174;0.0765)|all_neural(114;0.201)|Glioma(114;0.222)				CTGGACCCTGGACCCCAACTG	0.587																																					Esophageal Squamous(54;1038 1280 2528 31583)	Esophageal Squamous(54;1038 1280 2528 31583)	uc009yas.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(535-537)GAC>AAC		forkhead box I2							39.0	40.0	40.0					10																	129536807		2202	4300	6502	SO:0001583	missense	399823				epidermal cell fate specification|otic placode formation|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding	g.chr10:129536807G>A	AK128865	CCDS7655.2	10q26.2	2008-04-10			ENSG00000186766	ENSG00000186766		"""Forkhead boxes"""	32448	protein-coding gene	gene with protein product							Standard	NM_207426		Approved	FLJ46831	uc009yas.2	Q6ZQN5	OTTHUMG00000019250	ENST00000388920.4:c.535G>A	10.37:g.129536807G>A	ENSP00000373572:p.Asp179Asn					uc009yar.1_5'Flank	p.D179N	NM_207426	NP_997309	Q6ZQN5	FOXI2_HUMAN			2	535	+		all_epithelial(44;0.0021)|all_lung(145;0.0586)|Lung NSC(174;0.0765)|all_neural(114;0.201)|Glioma(114;0.222)	179			Fork-head.			Missense_Mutation	SNP	ENST00000388920.4	37	c.535G>A	CCDS7655.2	.	.	.	.	.	.	.	.	.	.	G	27.5	4.839757	0.91117	.	.	ENSG00000186766	ENST00000388920	D	0.95949	-3.86	4.15	3.21	0.36854	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	0.000000	0.85682	D	0.000000	D	0.96024	0.8705	L	0.48362	1.52	0.58432	D	0.999998	D	0.89917	1.0	D	0.77557	0.99	D	0.95391	0.8481	10	0.62326	D	0.03	.	11.3618	0.49648	0.0:0.1854:0.8146:0.0	.	179	Q6ZQN5	FOXI2_HUMAN	N	179	ENSP00000373572:D179N	ENSP00000373572:D179N	D	+	1	0	FOXI2	129426797	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.512000	0.81728	0.912000	0.36772	0.561000	0.74099	GAC		0.587	FOXI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050984.2	NM_207426		4	7	0	0	0	0.000602	0	4	7				
JAKMIP3	282973	broad.mit.edu	37	10	133958651	133958651	+	Missense_Mutation	SNP	C	C	T	rs374576124		TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr10:133958651C>T	ENST00000298622.4	+	11	1781	c.1643C>T	c.(1642-1644)gCg>gTg	p.A548V	JAKMIP3_ENST00000477275.1_3'UTR	NM_001105521.2	NP_001098991.1	Q5VZ66	JKIP3_HUMAN	Janus kinase and microtubule interacting protein 3	548						Golgi apparatus (GO:0005794)		p.A548V(1)		breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	31		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		AGGGCACAGGCGCGGATAGAG	0.602																																							uc001lkx.3		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(1642-1644)GCG>GTG		Janus kinase and microtubule interacting protein		C	VAL/ALA	1,4399	2.1+/-5.4	0,1,2199	28.0	27.0	27.0		1643	3.5	0.0	10		27	0,8588		0,0,4294	no	missense	JAKMIP3	NM_001105521.2	64	0,1,6493	TT,TC,CC		0.0,0.0227,0.0077	benign	548/845	133958651	1,12987	2200	4294	6494	SO:0001583	missense	282973							g.chr10:133958651C>T	AL832756	CCDS44494.1	10q26.3	2009-04-23	2009-04-23	2008-01-28	ENSG00000188385	ENSG00000188385			23523	protein-coding gene	gene with protein product	"""neuroendocrine long coiled-coil 2"""	611198	"""chromosome 10 open reading frame 39"", ""chromosome 10 open reading frame 14"""	C10orf39, C10orf14		15277531, 17572408	Standard	NM_001105521		Approved	FLJ37857, NECC2, KIAA4091, bA140A10.5	uc001lkx.4	Q5VZ66	OTTHUMG00000150167	ENST00000298622.4:c.1643C>T	10.37:g.133958651C>T	ENSP00000298622:p.Ala548Val					JAKMIP3_uc009yba.1_5'UTR	p.A548V	NM_001105521	NP_001098991				OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)	11	1643	+		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)						A6PW00|Q69YM6|Q6ZT29	Missense_Mutation	SNP	ENST00000298622.4	37	c.1643C>T	CCDS44494.1	.	.	.	.	.	.	.	.	.	.	C	14.98	2.697234	0.48202	2.27E-4	0.0	ENSG00000188385	ENST00000298622	T	0.32272	1.46	4.43	3.49	0.39957	.	0.727333	0.12486	N	0.464668	T	0.29684	0.0741	L	0.59436	1.845	0.24786	N	0.992784	B	0.30824	0.296	B	0.21708	0.036	T	0.09684	-1.0663	10	0.28530	T	0.3	-4.1119	14.0998	0.65046	0.0:0.848:0.152:0.0	.	548	Q5VZ66	JKIP3_HUMAN	V	548	ENSP00000298622:A548V	ENSP00000298622:A548V	A	+	2	0	JAKMIP3	133808641	0.847000	0.29606	0.010000	0.14722	0.017000	0.09413	3.434000	0.52841	1.022000	0.39626	0.478000	0.44815	GCG		0.602	JAKMIP3-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051049.3	NM_194303		6	18	0	0	0	0.004482	0	6	18				
CFAP46	54777	broad.mit.edu	37	10	134628115	134628115	+	Splice_Site	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr10:134628115G>A	ENST00000368586.5	-	53	7351	c.7251C>T	c.(7249-7251)ttC>ttT	p.F2417F	TTC40_ENST00000263170.5_Splice_Site_p.F578F	NM_001200049.2	NP_001186978.2												p.F2417F(1)|p.F578F(1)		breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						GGTCCACGACGACTGGGTCCC	0.662																																							uc010qux.1		NA																	2	Substitution - coding silent(2)		lung(2)		NA						c.(6427-6429)TTC>TTT		Homo sapiens cDNA, FLJ17989.							8.0	11.0	10.0					10																	134628115		2181	4272	6453	SO:0001630	splice_region_variant	0							g.chr10:134628115G>A																												ENST00000368586.5:c.7250-1C>T	10.37:g.134628115G>A							p.F2143F	NM_017609	NP_060079					45	6429	-									Silent	SNP	ENST00000368586.5	37	c.6429C>T	CCDS58101.1																																																																																				0.662	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051095.3		Silent	4	3	0	0	0	0.000602	0	4	3				
ATHL1	80162	broad.mit.edu	37	11	292927	292927	+	Silent	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr11:292927C>T	ENST00000409548.2	+	7	1315	c.1200C>T	c.(1198-1200)gtC>gtT	p.V400V	ATHL1_ENST00000409655.1_Silent_p.V223V|ATHL1_ENST00000409479.1_Silent_p.V400V	NM_025092.4	NP_079368.3	Q32M88	ATHL1_HUMAN	ATH1, acid trehalase-like 1 (yeast)	400					carbohydrate metabolic process (GO:0005975)		hydrolase activity, acting on glycosyl bonds (GO:0016798)	p.V223V(1)|p.V400V(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|liver(1)|lung(7)|prostate(1)|skin(3)	17		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;5.38e-28)|Epithelial(43;3.25e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)		GGGACGTGGTCAGGGCTGTGG	0.642																																							uc010qvu.1		NA																	2	Substitution - coding silent(2)		lung(2)	liver(1)|central_nervous_system(1)|skin(1)	3						c.(1198-1200)GTC>GTT		ATH1, acid trehalase-like 1							104.0	94.0	98.0					11																	292927		2203	4300	6503	SO:0001819	synonymous_variant	80162				carbohydrate metabolic process		hydrolase activity, acting on glycosyl bonds	g.chr11:292927C>T	AK090428	CCDS31322.2	11p15.5	2005-10-27			ENSG00000142102	ENSG00000142102			26210	protein-coding gene	gene with protein product							Standard	NM_025092		Approved	FLJ22635	uc010qvu.2	Q32M88	OTTHUMG00000153218	ENST00000409548.2:c.1200C>T	11.37:g.292927C>T						ATHL1_uc001lor.3_Silent_p.V223V|ATHL1_uc001los.1_Silent_p.V400V|ATHL1_uc001lou.3_5'Flank|ATHL1_uc001lov.3_5'Flank	p.V400V	NM_025092	NP_079368	Q32M88	ATHL1_HUMAN		all cancers(45;5.38e-28)|Epithelial(43;3.25e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)	7	1315	+		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)	400					Q658X8|Q8TEG9|Q9H635	Silent	SNP	ENST00000409548.2	37	c.1200C>T	CCDS31322.2																																																																																				0.642	ATHL1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330164.3	NM_025092		5	38	0	0	0	0.00308	0	5	38				
OR52E4	390081	broad.mit.edu	37	11	5905694	5905694	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr11:5905694C>G	ENST00000316987.2	+	1	194	c.172C>G	c.(172-174)Cac>Gac	p.H58D		NM_001005165.1	NP_001005165.1	Q8NGH9	O52E4_HUMAN	olfactory receptor, family 52, subfamily E, member 4	58						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H58D(1)		autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(7)|liver(2)|lung(13)|ovary(2)|prostate(1)|skin(2)	30		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.24e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACATAGTCTACACCAGCCCAT	0.418																																							uc010qzs.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(172-174)CAC>GAC		olfactory receptor, family 52, subfamily E,							218.0	189.0	199.0					11																	5905694		2201	4296	6497	SO:0001583	missense	390081				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5905694C>G	AB065817	CCDS31401.1	11p15.4	2012-08-09			ENSG00000180974	ENSG00000180974		"""GPCR / Class A : Olfactory receptors"""	15213	protein-coding gene	gene with protein product							Standard	NM_001005165		Approved		uc010qzs.2	Q8NGH9	OTTHUMG00000168804	ENST00000316987.2:c.172C>G	11.37:g.5905694C>G	ENSP00000321426:p.His58Asp					TRIM5_uc001mbq.1_Intron	p.H58D	NM_001005165	NP_001005165	Q8NGH9	O52E4_HUMAN		Epithelial(150;1.24e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	172	+		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)	58			Helical; Name=2; (Potential).		Q6IFG0	Missense_Mutation	SNP	ENST00000316987.2	37	c.172C>G	CCDS31401.1	.	.	.	.	.	.	.	.	.	.	C	13.75	2.331367	0.41297	.	.	ENSG00000180974	ENST00000316987	T	0.15952	2.38	5.04	4.13	0.48395	GPCR, rhodopsin-like superfamily (1);	0.000000	0.52532	D	0.000074	T	0.51753	0.1693	H	0.96333	3.805	0.36589	D	0.873994	D	0.89917	1.0	D	0.91635	0.999	T	0.68640	-0.5355	10	0.87932	D	0	.	9.3425	0.38089	0.0:0.8272:0.0:0.1728	.	58	Q8NGH9	O52E4_HUMAN	D	58	ENSP00000321426:H58D	ENSP00000321426:H58D	H	+	1	0	OR52E4	5862270	0.968000	0.33430	0.987000	0.45799	0.455000	0.32408	2.700000	0.47085	1.345000	0.45676	0.643000	0.83706	CAC		0.418	OR52E4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401146.1	NM_001005165		60	105	0	0	0	0.01441	0	60	105				
OR56A1	120796	broad.mit.edu	37	11	6048374	6048374	+	Silent	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr11:6048374G>T	ENST00000316650.5	-	1	597	c.561C>A	c.(559-561)gcC>gcA	p.A187A		NM_001001917.2	NP_001001917.2	Q8NGH5	O56A1_HUMAN	olfactory receptor, family 56, subfamily A, member 1	187						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A187A(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(22)|ovary(2)	33		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CAGACAAGTTGGCACAGATGC	0.473																																							uc010qzw.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|breast(1)	3						c.(559-561)GCC>GCA		olfactory receptor, family 56, subfamily A,							87.0	85.0	85.0					11																	6048374		2201	4296	6497	SO:0001819	synonymous_variant	120796				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:6048374G>T	AB065821	CCDS31405.1	11p15.4	2012-08-09			ENSG00000180934	ENSG00000180934		"""GPCR / Class A : Olfactory receptors"""	14781	protein-coding gene	gene with protein product							Standard	NM_001001917		Approved		uc010qzw.2	Q8NGH5	OTTHUMG00000165377	ENST00000316650.5:c.561C>A	11.37:g.6048374G>T							p.A187A	NM_001001917	NP_001001917	Q8NGH5	O56A1_HUMAN		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	561	-		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)	187			Extracellular (Potential).		B2RNI2|Q6IFL0	Silent	SNP	ENST00000316650.5	37	c.561C>A	CCDS31405.1																																																																																				0.473	OR56A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383757.1	NM_001001917		47	64	1	0	8.72198e-27	0.01441	1.20205e-26	47	64				
OR2AG2	338755	broad.mit.edu	37	11	6789756	6789756	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr11:6789756C>T	ENST00000338569.2	-	1	530	c.433G>A	c.(433-435)Gtg>Atg	p.V145M		NM_001004490.1	NP_001004490.1	A6NM03	O2AG2_HUMAN	olfactory receptor, family 2, subfamily AG, member 2	145						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V145M(1)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(13)|ovary(1)|skin(5)|stomach(1)|urinary_tract(1)	28		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		GATGTGGCCACCATGATCCAG	0.512																																							uc001meq.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)|central_nervous_system(1)	4						c.(433-435)GTG>ATG		olfactory receptor, family 2, subfamily AG,							105.0	86.0	92.0					11																	6789756		2201	4296	6497	SO:0001583	missense	338755				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:6789756C>T	AB065539	CCDS31413.1	11p15.4	2012-08-09		2004-03-10	ENSG00000188124	ENSG00000188124		"""GPCR / Class A : Olfactory receptors"""	15143	protein-coding gene	gene with protein product				OR2AG2P			Standard	NM_001004490		Approved		uc001meq.1	A6NM03	OTTHUMG00000165868	ENST00000338569.2:c.433G>A	11.37:g.6789756C>T	ENSP00000342697:p.Val145Met						p.V145M	NM_001004490	NP_001004490	A6NM03	O2AG2_HUMAN		Epithelial(150;2.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)	1	433	-		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)	145			Helical; Name=4; (Potential).			Missense_Mutation	SNP	ENST00000338569.2	37	c.433G>A	CCDS31413.1	.	.	.	.	.	.	.	.	.	.	C	11.88	1.771456	0.31320	.	.	ENSG00000188124	ENST00000338569	T	0.39997	1.05	4.47	2.61	0.31194	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44285	D	0.000469	T	0.42698	0.1214	L	0.59436	1.845	0.09310	N	1	P	0.37663	0.604	B	0.43360	0.417	T	0.32241	-0.9914	10	0.52906	T	0.07	.	9.2182	0.37360	0.0:0.8237:0.0:0.1763	.	145	A6NM03	O2AG2_HUMAN	M	145	ENSP00000342697:V145M	ENSP00000342697:V145M	V	-	1	0	OR2AG2	6746332	0.006000	0.16342	0.985000	0.45067	0.898000	0.52572	0.866000	0.27954	0.831000	0.34780	0.655000	0.94253	GTG		0.512	OR2AG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386775.1	NM_001004490		32	39	0	0	0	0.004289	0	32	39				
ZNF214	7761	broad.mit.edu	37	11	7022088	7022088	+	Missense_Mutation	SNP	C	C	T	rs201911443		TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr11:7022088C>T	ENST00000278314.4	-	3	1141	c.826G>A	c.(826-828)Gga>Aga	p.G276R	ZNF214_ENST00000536068.1_Missense_Mutation_p.G276R|ZNF214_ENST00000531083.1_5'Flank	NM_013249.2	NP_037381.2	Q9UL59	ZN214_HUMAN	zinc finger protein 214	276					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.G276R(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				Epithelial(150;3.87e-08)|BRCA - Breast invasive adenocarcinoma(625;0.081)		TCATCACATCCGTACAGCTTC	0.438													C|||	1	0.000199681	0.0	0.0	5008	,	,		19775	0.0		0.0	False		,,,				2504	0.001				Ovarian(22;251 657 736 21522 46864)	Ovarian(22;251 657 736 21522 46864)	uc001mfa.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(826-828)GGA>AGA		zinc finger protein 214							131.0	126.0	128.0					11																	7022088		2200	4295	6495	SO:0001583	missense	7761				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr11:7022088C>T	AF056617	CCDS31418.1	11p15.4	2013-01-08				ENSG00000149050		"""Zinc fingers, C2H2-type"", ""-"""	13006	protein-coding gene	gene with protein product		605015					Standard	NM_013249		Approved		uc001mfa.2	Q9UL59		ENST00000278314.4:c.826G>A	11.37:g.7022088C>T	ENSP00000278314:p.Gly276Arg					ZNF214_uc010ray.1_Missense_Mutation_p.G276R|ZNF214_uc009yfh.1_Missense_Mutation_p.G276R	p.G276R	NM_013249	NP_037381	Q9UL59	ZN214_HUMAN		Epithelial(150;3.87e-08)|BRCA - Breast invasive adenocarcinoma(625;0.081)	3	1129	-			276			C2H2-type 1; degenerate.		B2R8Q1	Missense_Mutation	SNP	ENST00000278314.4	37	c.826G>A	CCDS31418.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	0.040	-1.288939	0.01387	.	.	ENSG00000149050	ENST00000278314;ENST00000536068	T;T	0.14391	2.51;2.51	3.75	0.347	0.16022	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.160165	0.29799	N	0.011177	T	0.04048	0.0113	N	0.02674	-0.535	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.33803	-0.9854	10	0.37606	T	0.19	.	3.7823	0.08686	0.0:0.4272:0.1852:0.3876	.	276	Q9UL59	ZN214_HUMAN	R	276	ENSP00000278314:G276R;ENSP00000445373:G276R	ENSP00000278314:G276R	G	-	1	0	ZNF214	6978664	0.000000	0.05858	0.110000	0.21437	0.767000	0.43475	-3.262000	0.00535	0.083000	0.17047	0.650000	0.86243	GGA		0.438	ZNF214-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385349.1			76	101	0	0	0	0.01441	0	76	101				
QSER1	79832	broad.mit.edu	37	11	32990614	32990614	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr11:32990614G>T	ENST00000399302.2	+	10	5078	c.4743G>T	c.(4741-4743)atG>atT	p.M1581I	QSER1_ENST00000527788.1_Missense_Mutation_p.M1342I	NM_001076786.1	NP_001070254.1	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1	1581								p.M1581I(1)		breast(5)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	48	Breast(20;0.158)					TACCTCATATGAAAAAAATAG	0.274																																							uc001mty.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(2)|skin(1)	6						c.(4741-4743)ATG>ATT		glutamine and serine rich 1							81.0	84.0	83.0					11																	32990614		1801	4051	5852	SO:0001583	missense	79832							g.chr11:32990614G>T	AL834141	CCDS41631.1	11p13	2014-02-12			ENSG00000060749	ENSG00000060749			26154	protein-coding gene	gene with protein product							Standard	XM_006718323		Approved	FLJ21924	uc001mty.3	Q2KHR3		ENST00000399302.2:c.4743G>T	11.37:g.32990614G>T	ENSP00000382241:p.Met1581Ile					QSER1_uc001mtz.1_Missense_Mutation_p.M1342I|QSER1_uc001mua.2_Missense_Mutation_p.M1086I	p.M1581I	NM_001076786	NP_001070254	Q2KHR3	QSER1_HUMAN			10	5010	+	Breast(20;0.158)		1581					Q6ZU30|Q6ZUR5	Missense_Mutation	SNP	ENST00000399302.2	37	c.4743G>T	CCDS41631.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.7|27.7	4.855777|4.855777	0.91355|0.91355	.|.	.|.	ENSG00000060749|ENSG00000060749	ENST00000399302;ENST00000527788|ENST00000524678	T;T|.	0.42900|.	0.96;0.96|.	5.26|5.26	5.26|5.26	0.73747|0.73747	.|.	0.000000|.	0.49916|.	U|.	0.000131|.	T|.	0.74604|.	0.3738|.	M|M	0.65498|0.65498	2.005|2.005	0.80722|0.80722	D|D	1|1	D;D|.	0.76494|.	0.996;0.999|.	D;D|.	0.81914|.	0.986;0.995|.	T|.	0.73366|.	-0.4005|.	10|.	0.56958|.	D|.	0.05|.	.|.	18.8888|18.8888	0.92389|0.92389	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1342;1581|.	Q2KHR3-2;Q2KHR3|.	.;QSER1_HUMAN|.	I|L	1581;1342|602	ENSP00000382241:M1581I;ENSP00000432766:M1342I|.	ENSP00000382241:M1581I|.	M|X	+|+	3|2	0|2	QSER1|QSER1	32947190|32947190	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	8.546000|8.546000	0.90661|0.90661	2.451000|2.451000	0.82905|0.82905	0.650000|0.650000	0.86243|0.86243	ATG|TGA		0.274	QSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388448.1	NM_024774		14	53	1	0	2.94398e-08	0.007413	3.24352e-08	14	53				
ALX4	60529	broad.mit.edu	37	11	44286612	44286612	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr11:44286612G>A	ENST00000329255.3	-	4	1131	c.1028C>T	c.(1027-1029)gCc>gTc	p.A343V		NM_021926.3	NP_068745.2	Q9H161	ALX4_HUMAN	ALX homeobox 4	343					anterior/posterior pattern specification (GO:0009952)|digestive tract development (GO:0048565)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal system morphogenesis (GO:0048704)|hair follicle development (GO:0001942)|muscle organ development (GO:0007517)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of apoptotic process (GO:0042981)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A343V(1)		central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	16						GACGCTGCTGGCCCCAGAGCC	0.692																																							uc001myb.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1027-1029)GCC>GTC		aristaless-like homeobox 4							30.0	30.0	30.0					11																	44286612		2203	4298	6501	SO:0001583	missense	60529				hair follicle development			g.chr11:44286612G>A	AF294629	CCDS31468.1	11p11.2	2011-06-20	2008-11-04		ENSG00000052850	ENSG00000052850		"""Homeoboxes / PRD class"""	450	protein-coding gene	gene with protein product		605420	"""parietal foramina 2"", ""aristaless-like homeobox 4"""	PFM2		11017806, 8644736	Standard	NM_021926		Approved	FPP, PFM, KIAA1788	uc001myb.3	Q9H161	OTTHUMG00000166557	ENST00000329255.3:c.1028C>T	11.37:g.44286612G>A	ENSP00000332744:p.Ala343Val						p.A343V	NM_021926	NP_068745	Q9H161	ALX4_HUMAN			4	1132	-			343					Q96JN7|Q9H198|Q9HAY9	Missense_Mutation	SNP	ENST00000329255.3	37	c.1028C>T	CCDS31468.1	.	.	.	.	.	.	.	.	.	.	G	30	5.053484	0.93793	.	.	ENSG00000052850	ENST00000329255	D	0.91521	-2.86	4.11	4.11	0.48088	.	0.271361	0.26432	N	0.024413	D	0.90266	0.6956	L	0.51422	1.61	0.54753	D	0.999982	P	0.51351	0.944	P	0.48654	0.585	D	0.89622	0.3849	10	0.36615	T	0.2	.	17.6545	0.88174	0.0:0.0:1.0:0.0	.	343	Q9H161	ALX4_HUMAN	V	343	ENSP00000332744:A343V	ENSP00000332744:A343V	A	-	2	0	ALX4	44243188	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.824000	0.92023	2.575000	0.86900	0.561000	0.74099	GCC		0.692	ALX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390399.1			7	23	0	0	0	0.004482	0	7	23				
OR5M9	390162	broad.mit.edu	37	11	56230566	56230566	+	Silent	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr11:56230566G>T	ENST00000279791.1	-	1	311	c.312C>A	c.(310-312)gcC>gcA	p.A104A		NM_001004743.1	NP_001004743.1	Q8NGP3	OR5M9_HUMAN	olfactory receptor, family 5, subfamily M, member 9	104						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A104A(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(4)|urinary_tract(2)	36	Esophageal squamous(21;0.00448)					CGTGGACAACGGCAATGAAAA	0.473																																							uc010rjj.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|ovary(1)|central_nervous_system(1)	4						c.(310-312)GCC>GCA		olfactory receptor, family 5, subfamily M,							127.0	119.0	122.0					11																	56230566		2201	4296	6497	SO:0001819	synonymous_variant	390162				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56230566G>T	AB065747	CCDS31531.1	11q11	2012-08-09			ENSG00000150269	ENSG00000150269		"""GPCR / Class A : Olfactory receptors"""	15294	protein-coding gene	gene with protein product							Standard	NM_001004743		Approved		uc010rjj.2	Q8NGP3	OTTHUMG00000166874	ENST00000279791.1:c.312C>A	11.37:g.56230566G>T							p.A104A	NM_001004743	NP_001004743	Q8NGP3	OR5M9_HUMAN			1	312	-	Esophageal squamous(21;0.00448)		104			Helical; Name=3; (Potential).		Q6IEW5|Q96RB9	Silent	SNP	ENST00000279791.1	37	c.312C>A	CCDS31531.1																																																																																				0.473	OR5M9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391638.1	NM_001004743		43	58	1	0	8.20599e-20	0.011902	1.07244e-19	43	58				
OR5AN1	390195	broad.mit.edu	37	11	59132388	59132388	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr11:59132388G>A	ENST00000313940.2	+	1	504	c.457G>A	c.(457-459)Ggc>Agc	p.G153S		NM_001004729.1	NP_001004729.1	Q8NGI8	O5AN1_HUMAN	olfactory receptor, family 5, subfamily AN, member 1	153						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G153S(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	21						CTACATGACTGGCCTCACTGC	0.468																																							uc010rks.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(457-459)GGC>AGC		olfactory receptor, family 5, subfamily AN,							184.0	162.0	169.0					11																	59132388		2201	4295	6496	SO:0001583	missense	390195				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:59132388G>A	AB065806	CCDS31559.1	11q12.1	2012-08-09			ENSG00000176495	ENSG00000176495		"""GPCR / Class A : Olfactory receptors"""	15255	protein-coding gene	gene with protein product		615702					Standard	NM_001004729		Approved		uc010rks.2	Q8NGI8	OTTHUMG00000167337	ENST00000313940.2:c.457G>A	11.37:g.59132388G>A	ENSP00000320302:p.Gly153Ser						p.G153S	NM_001004729	NP_001004729	Q8NGI8	O5AN1_HUMAN			1	457	+			153			Helical; Name=4; (Potential).		B9EIS2|Q6IEV4	Missense_Mutation	SNP	ENST00000313940.2	37	c.457G>A	CCDS31559.1	.	.	.	.	.	.	.	.	.	.	G	11.37	1.618673	0.28801	.	.	ENSG00000176495	ENST00000313940	T	0.32988	1.43	4.12	3.2	0.36748	GPCR, rhodopsin-like superfamily (1);	0.265699	0.26816	N	0.022350	T	0.45518	0.1346	L	0.55213	1.73	0.09310	N	1	D	0.69078	0.997	D	0.66979	0.948	T	0.20672	-1.0268	10	0.49607	T	0.09	-0.3009	10.7331	0.46109	0.0961:0.0:0.9038:0.0	.	153	Q8NGI8	O5AN1_HUMAN	S	153	ENSP00000320302:G153S	ENSP00000320302:G153S	G	+	1	0	OR5AN1	58888964	0.164000	0.22935	0.028000	0.17463	0.149000	0.21700	1.983000	0.40648	1.057000	0.40506	0.655000	0.94253	GGC		0.468	OR5AN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394231.1	NM_001004729		50	141	0	0	0	0.01441	0	50	141				
CD6	923	broad.mit.edu	37	11	60785317	60785317	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr11:60785317C>T	ENST00000313421.7	+	11	1855	c.1669C>T	c.(1669-1671)Cac>Tac	p.H557Y	CD6_ENST00000452451.2_Missense_Mutation_p.H516Y|CD6_ENST00000344028.5_Missense_Mutation_p.H525Y|CD6_ENST00000352009.5_Missense_Mutation_p.H525Y|CD6_ENST00000346437.4_Missense_Mutation_p.H484Y	NM_006725.4	NP_006716.3	P30203	CD6_HUMAN	CD6 molecule	557					cell adhesion (GO:0007155)	integral component of plasma membrane (GO:0005887)	scavenger receptor activity (GO:0005044)	p.H557Y(2)		endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)	18						CCCTCAGTATCACCCGAGGAG	0.552																																					Pancreas(169;904 2017 4767 38890 42505)	Pancreas(169;904 2017 4767 38890 42505)	uc001nqq.2		NA																	2	Substitution - Missense(2)		lung(2)	pancreas(1)	1						c.(1669-1671)CAC>TAC		CD6 molecule precursor							82.0	82.0	82.0					11																	60785317		2203	4299	6502	SO:0001583	missense	923				cell adhesion	cell surface|integral to plasma membrane	scavenger receptor activity	g.chr11:60785317C>T		CCDS7999.1, CCDS58137.1, CCDS58138.1	11q12.2	2006-03-28	2006-03-28		ENSG00000013725	ENSG00000013725		"""CD molecules"""	1691	protein-coding gene	gene with protein product		186720	"""CD6 antigen"""			9013954	Standard	NM_006725		Approved	Tp120	uc001nqq.3	P30203	OTTHUMG00000167823	ENST00000313421.7:c.1669C>T	11.37:g.60785317C>T	ENSP00000323280:p.His557Tyr					CD6_uc001nqp.2_Missense_Mutation_p.H557Y|CD6_uc001nqr.2_Missense_Mutation_p.H525Y|CD6_uc001nqs.2_RNA|CD6_uc001nqt.2_Missense_Mutation_p.H516Y	p.H557Y	NM_006725	NP_006716	P30203	CD6_HUMAN			11	1892	+			557			Cytoplasmic (Potential).		A4KAD4|A4KAD5|Q9UMF2|Q9Y4K7|Q9Y4K8|Q9Y4K9|Q9Y4L0	Missense_Mutation	SNP	ENST00000313421.7	37	c.1669C>T	CCDS7999.1	.	.	.	.	.	.	.	.	.	.	C	11.76	1.734747	0.30774	.	.	ENSG00000013725	ENST00000344028;ENST00000346437;ENST00000313421;ENST00000452451;ENST00000352009	T;T;T;T;T	0.01918	4.6;4.56;4.69;4.65;4.6	5.31	3.39	0.38822	.	1.228550	0.05812	N	0.614174	T	0.04048	0.0113	L	0.55481	1.735	0.09310	N	1	P;P;B;P	0.44090	0.826;0.826;0.418;0.608	B;B;B;B	0.40825	0.341;0.341;0.157;0.185	T	0.43669	-0.9377	10	0.87932	D	0	.	7.1047	0.25356	0.168:0.742:0.0:0.09	.	516;525;557;557	P30203-5;P30203-4;P30203;Q8N4Q7	.;.;CD6_HUMAN;.	Y	525;484;557;516;525	ENSP00000344108:H525Y;ENSP00000345566:H484Y;ENSP00000323280:H557Y;ENSP00000390676:H516Y;ENSP00000340628:H525Y	ENSP00000323280:H557Y	H	+	1	0	CD6	60541893	0.003000	0.15002	0.001000	0.08648	0.014000	0.08584	1.917000	0.39996	1.223000	0.43536	0.467000	0.42956	CAC		0.552	CD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396449.1	NM_006725		51	59	0	0	0	0.01441	0	51	59				
DPF2	5977	broad.mit.edu	37	11	65113779	65113779	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr11:65113779G>T	ENST00000528416.1	+	9	1099	c.966G>T	c.(964-966)tgG>tgT	p.W322C	DPF2_ENST00000252268.4_Missense_Mutation_p.W336C|DPF2_ENST00000415073.2_Intron	NM_006268.4	NP_006259.1	Q92785	REQU_HUMAN	D4, zinc and double PHD fingers family 2	322					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|zinc ion binding (GO:0008270)	p.W322C(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|prostate(1)	23						CATACCGCTGGCAGTGCATCG	0.547																																							uc001odm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(964-966)TGG>TGT		D4, zinc and double PHD fingers family 2							155.0	115.0	129.0					11																	65113779		2201	4297	6498	SO:0001583	missense	5977				apoptosis|induction of apoptosis by extracellular signals|regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|nucleus	nucleic acid binding|zinc ion binding	g.chr11:65113779G>T	U94585	CCDS8100.1	11q13.1	2014-05-13	2003-10-06	2003-10-08	ENSG00000133884	ENSG00000133884		"""Zinc fingers, PHD-type"""	9964	protein-coding gene	gene with protein product		601671	"""requiem, apoptosis response zinc finger gene"""	REQ		11845289	Standard	NM_006268		Approved	ubi-d4, BAF45d	uc001odm.3	Q92785	OTTHUMG00000165985	ENST00000528416.1:c.966G>T	11.37:g.65113779G>T	ENSP00000436901:p.Trp322Cys					DPF2_uc001odn.2_Missense_Mutation_p.W336C|DPF2_uc010roe.1_Intron	p.W322C	NM_006268	NP_006259	Q92785	REQU_HUMAN			9	978	+			322			PHD-type 1.		A8K7C9|B4DT58	Missense_Mutation	SNP	ENST00000528416.1	37	c.966G>T	CCDS8100.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.740092	0.89573	.	.	ENSG00000133884	ENST00000528416;ENST00000252268	D;D	0.87809	-2.3;-2.3	5.62	5.62	0.85841	Zinc finger, PHD-finger (1);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (2);	0.000000	0.35495	N	0.003172	D	0.95793	0.8631	H	0.96301	3.8	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96875	0.9642	10	0.87932	D	0	-16.2861	17.1512	0.86778	0.0:0.0:1.0:0.0	.	322	Q92785	REQU_HUMAN	C	322;336	ENSP00000436901:W322C;ENSP00000252268:W336C	ENSP00000252268:W336C	W	+	3	0	DPF2	64870355	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.717000	0.98755	2.667000	0.90743	0.561000	0.74099	TGG		0.547	DPF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387293.3	NM_006268		7	42	1	0	0.00448238	0.004482	0.00460385	7	42				
CARNS1	57571	broad.mit.edu	37	11	67191644	67191644	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr11:67191644C>T	ENST00000307823.3	+	9	2508	c.2056C>T	c.(2056-2058)Cgg>Tgg	p.R686W	CARNS1_ENST00000423745.2_Missense_Mutation_p.R686W|CARNS1_ENST00000531040.1_Missense_Mutation_p.R783W|CARNS1_ENST00000445895.2_Missense_Mutation_p.R809W	NM_020811.1	NP_065862.1	A5YM72	CRNS1_HUMAN	carnosine synthase 1	686	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.				ATP catabolic process (GO:0006200)|carnosine biosynthetic process (GO:0035499)		ATP binding (GO:0005524)|ATPase activity (GO:0016887)|carnosine synthase activity (GO:0047730)|metal ion binding (GO:0046872)	p.R809W(1)|p.R244W(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(7)	11						GGCTGGGCCTCGGCTTATCGA	0.607																																							uc009yrp.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(2056-2058)CGG>TGG		ATP-grasp domain containing 1							38.0	41.0	40.0					11																	67191644		2107	4231	6338	SO:0001583	missense	57571				carnosine biosynthetic process		ATP binding|carnosine synthase activity|metal ion binding	g.chr11:67191644C>T		CCDS44658.1, CCDS53667.1	11q13.1	2010-03-25	2010-03-25	2010-03-25	ENSG00000172508	ENSG00000172508			29268	protein-coding gene	gene with protein product		613368	"""ATP-grasp domain containing 1"""	ATPGD1		20097752	Standard	NM_020811		Approved	KIAA1394	uc010rpr.2	A5YM72		ENST00000307823.3:c.2056C>T	11.37:g.67191644C>T	ENSP00000308268:p.Arg686Trp					PPP1CA_uc001okx.1_5'Flank|CARNS1_uc001olc.3_Missense_Mutation_p.R825W	p.R686W	NM_020811	NP_065862	A5YM72	CRNS1_HUMAN			9	2508	+			686			ATP-grasp.		A8K1M3|B4DFC6|E9PK38|F5H427|Q8N467|Q9P2F3	Missense_Mutation	SNP	ENST00000307823.3	37	c.2056C>T	CCDS44658.1	.	.	.	.	.	.	.	.	.	.	C	12.20	1.865480	0.32977	.	.	ENSG00000172508	ENST00000531040;ENST00000307823;ENST00000542831;ENST00000423745;ENST00000445895	T;T;T;T	0.23950	1.88;1.88;1.88;1.88	5.55	2.13	0.27403	ATP-grasp fold (1);ATP-grasp fold, DUF201-type (1);ATP-grasp fold, subdomain 2 (1);	0.236753	0.28354	N	0.015655	T	0.50274	0.1606	M	0.82517	2.595	0.21064	N	0.999796	D;D	0.71674	0.998;0.998	P;P	0.62813	0.907;0.85	T	0.52749	-0.8534	10	0.87932	D	0	-18.834	14.7399	0.69445	0.6486:0.3514:0.0:0.0	.	686;825	A5YM72;A5YM72-3	CRNS1_HUMAN;.	W	783;686;783;686;809	ENSP00000431670:R783W;ENSP00000308268:R686W;ENSP00000401519:R686W;ENSP00000389009:R809W	ENSP00000308268:R686W	R	+	1	2	CARNS1	66948220	0.000000	0.05858	0.458000	0.27068	0.997000	0.91878	-0.496000	0.06436	0.073000	0.16731	0.549000	0.68633	CGG		0.607	CARNS1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395501.1	NM_020811		20	17	0	0	0	0.014323	0	20	17				
TPCN2	219931	broad.mit.edu	37	11	68835056	68835056	+	Missense_Mutation	SNP	C	C	T	rs200218534	byFrequency	TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr11:68835056C>T	ENST00000294309.3	+	8	913	c.812C>T	c.(811-813)aCg>aTg	p.T271M	TPCN2_ENST00000542467.1_Missense_Mutation_p.T271M|TPCN2_ENST00000442692.2_3'UTR	NM_139075.3	NP_620714.2	Q8NHX9	TPC2_HUMAN	two pore segment channel 2	271					calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|release of sequestered calcium ion into cytosol (GO:0051209)|smooth muscle contraction (GO:0006939)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|NAADP-sensitive calcium-release channel activity (GO:0072345)|protein kinase binding (GO:0019901)|voltage-gated calcium channel activity (GO:0005245)	p.T271M(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	32			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			CTGCTGACCACGGCCAACAAC	0.642													c|||	3	0.000599042	0.0015	0.0	5008	,	,		14902	0.0		0.0	False		,,,				2504	0.001						uc001oos.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(811-813)ACG>ATG		two pore segment channel 2							98.0	75.0	83.0					11																	68835056		2200	4294	6494	SO:0001583	missense	219931				cellular calcium ion homeostasis|smooth muscle contraction	endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated calcium channel activity	g.chr11:68835056C>T	AK023366	CCDS8189.1	11q13.1	2011-07-05			ENSG00000162341	ENSG00000162341		"""Voltage-gated ion channels / Two-pore channels"""	20820	protein-coding gene	gene with protein product		612163				16382101	Standard	NM_139075		Approved	TPC2	uc001oos.2	Q8NHX9	OTTHUMG00000167898	ENST00000294309.3:c.812C>T	11.37:g.68835056C>T	ENSP00000294309:p.Thr271Met					TPCN2_uc009ysk.1_Intron|TPCN2_uc001oor.2_Missense_Mutation_p.T186M|TPCN2_uc010rqg.1_Missense_Mutation_p.T271M	p.T271M	NM_139075	NP_620714	Q8NHX9	TPC2_HUMAN	STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)		8	928	+			271					Q9NT82	Missense_Mutation	SNP	ENST00000294309.3	37	c.812C>T	CCDS8189.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	c	19.57	3.852714	0.71719	.	.	ENSG00000162341	ENST00000356782;ENST00000294309;ENST00000535009;ENST00000542467	D;D	0.99239	-5.61;-5.61	4.96	4.96	0.65561	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99504	0.9823	M	0.92738	3.34	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98243	1.0489	10	0.72032	D	0.01	-23.9295	14.0898	0.64982	0.0:1.0:0.0:0.0	.	271;271;186	E7ETX0;Q8NHX9;F5H1G5	.;TPC2_HUMAN;.	M	201;271;186;271	ENSP00000294309:T271M;ENSP00000445551:T271M	ENSP00000294309:T271M	T	+	2	0	TPCN2	68591632	0.998000	0.40836	0.943000	0.38184	0.836000	0.47400	4.958000	0.63660	2.468000	0.83385	0.637000	0.83480	ACG		0.642	TPCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396878.2	NM_139075		43	44	0	0	0	0.010771	0	43	44				
TENM4	26011	broad.mit.edu	37	11	78433860	78433860	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr11:78433860G>T	ENST00000278550.7	-	24	4115	c.3653C>A	c.(3652-3654)cCc>cAc	p.P1218H		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	1218					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)	p.P1218H(2)									GTTGCAGCTGGGGCAGGAGAT	0.582																																							uc001ozl.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|pancreas(2)	4						c.(3652-3654)CCC>CAC		odz, odd Oz/ten-m homolog 4							58.0	63.0	61.0					11																	78433860		2029	4181	6210	SO:0001583	missense	26011				signal transduction	integral to membrane		g.chr11:78433860G>T	AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.3653C>A	11.37:g.78433860G>T	ENSP00000278550:p.Pro1218His						p.P1218H	NM_001098816	NP_001092286	Q6N022	TEN4_HUMAN			24	4116	-			1218			Extracellular (Potential).|NHL 1.		A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	ENST00000278550.7	37	c.3653C>A	CCDS44688.1	.	.	.	.	.	.	.	.	.	.	G	31	5.097781	0.94197	.	.	ENSG00000149256	ENST00000278550	D	0.90069	-2.61	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	D	0.94644	0.8273	M	0.78916	2.43	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.93606	0.6934	9	.	.	.	.	19.8946	0.96949	0.0:0.0:1.0:0.0	.	1218	Q6N022	TEN4_HUMAN	H	1218	ENSP00000278550:P1218H	.	P	-	2	0	ODZ4	78111508	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.657000	0.98554	2.937000	0.99478	0.650000	0.86243	CCC		0.582	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391406.2			14	44	1	0	2.4624e-09	0.008871	2.78582e-09	14	44				
FAT3	120114	broad.mit.edu	37	11	92534618	92534618	+	Silent	SNP	C	C	G			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr11:92534618C>G	ENST00000298047.6	+	9	8456	c.8439C>G	c.(8437-8439)gtC>gtG	p.V2813V	FAT3_ENST00000525166.1_Silent_p.V2663V|FAT3_ENST00000409404.2_Silent_p.V2813V			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2813	Cadherin 25. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V2813V(2)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				ACAAGCCAGTCTTTGAAACTT	0.418										TCGA Ovarian(4;0.039)																													uc001pdj.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(4)|pancreas(1)	5						c.(8437-8439)GTC>GTG		FAT tumor suppressor homolog 3							51.0	52.0	52.0					11																	92534618		1904	4117	6021	SO:0001819	synonymous_variant	120114				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding	g.chr11:92534618C>G	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.8439C>G	11.37:g.92534618C>G		TCGA Ovarian(4;0.039)					p.V2813V	NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN			9	8456	+		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)	2813			Extracellular (Potential).|Cadherin 25.		B5MDB0|Q96AU6	Silent	SNP	ENST00000298047.6	37	c.8439C>G																																																																																					0.418	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781		7	19	0	0	0	0.013537	0	7	19				
NXPE1	120400	broad.mit.edu	37	11	114401171	114401171	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr11:114401171C>G	ENST00000424269.1	-	2	558	c.559G>C	c.(559-561)Gaa>Caa	p.E187Q	NXPE1_ENST00000536312.1_Missense_Mutation_p.E187Q|NXPE1_ENST00000251921.2_Missense_Mutation_p.E45Q|NXPE1_ENST00000536271.1_5'Flank			Q8N323	NXPE1_HUMAN	neurexophilin and PC-esterase domain family, member 1	187						extracellular region (GO:0005576)		p.E45Q(1)									GACGCCCCTTCACTGGGGTGG	0.502																																							uc001ppa.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(133-135)GAA>CAA		hypothetical protein LOC120400							71.0	76.0	74.0					11																	114401171		2201	4296	6497	SO:0001583	missense	120400					extracellular region		g.chr11:114401171C>G	BC029049	CCDS8372.1	11q23.2	2012-06-14	2012-06-11	2012-06-11	ENSG00000095110	ENSG00000095110			28527	protein-coding gene	gene with protein product			"""family with sequence similarity 55, member A"""	FAM55A		12477932	Standard	NM_152315		Approved	MGC34290	uc001ppa.3	Q8N323	OTTHUMG00000168284	ENST00000424269.1:c.559G>C	11.37:g.114401171C>G	ENSP00000411690:p.Glu187Gln					FAM55A_uc010rxd.1_5'UTR|FAM55A_uc001ppb.1_Missense_Mutation_p.E187Q	p.E45Q	NM_152315	NP_689528	Q8N323	FA55A_HUMAN		BRCA - Breast invasive adenocarcinoma(274;3.02e-06)|Epithelial(105;0.000144)|all cancers(92;0.00106)	3	550	-		all_cancers(61;8.53e-16)|all_epithelial(67;1.71e-08)|all_hematologic(158;3.05e-05)|Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0194)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0906)	187					B0YJ13	Missense_Mutation	SNP	ENST00000424269.1	37	c.133G>C		.	.	.	.	.	.	.	.	.	.	C	21.5	4.161721	0.78226	.	.	ENSG00000095110	ENST00000251921;ENST00000424269;ENST00000536312	T;T;T	0.63913	1.88;2.01;-0.07	4.52	4.52	0.55395	.	0.000000	0.56097	D	0.000023	D	0.82669	0.5087	M	0.91872	3.25	0.37555	D	0.918855	D	0.89917	1.0	D	0.87578	0.998	D	0.87778	0.2610	10	0.54805	T	0.06	.	15.5509	0.76152	0.0:1.0:0.0:0.0	.	187	F5H6W7	.	Q	45;187;187	ENSP00000251921:E45Q;ENSP00000411690:E187Q;ENSP00000442984:E187Q	ENSP00000251921:E45Q	E	-	1	0	FAM55A	113906381	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	2.088000	0.41663	2.437000	0.82529	0.655000	0.94253	GAA		0.502	NXPE1-201	KNOWN	basic	protein_coding	protein_coding		NM_152315		30	45	0	0	0	0.003271	0	30	45				
UBE4A	9354	broad.mit.edu	37	11	118250358	118250358	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr11:118250358C>T	ENST00000431736.2	+	11	1862	c.1790C>T	c.(1789-1791)tCc>tTc	p.S597F	UBE4A_ENST00000545354.1_Missense_Mutation_p.S62F|UBE4A_ENST00000252108.3_Missense_Mutation_p.S590F					ubiquitination factor E4A									p.S597F(1)		autonomic_ganglia(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(7)|liver(2)|lung(14)|ovary(3)|prostate(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	56	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		TTGCAGGTGTCCATGGCTGTT	0.473																																							uc001psw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)|breast(1)|kidney(1)	5						c.(1768-1770)TCC>TTC		ubiquitination factor E4A							149.0	123.0	132.0					11																	118250358		2200	4296	6496	SO:0001583	missense	9354				ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding	g.chr11:118250358C>T	D50916	CCDS8396.1, CCDS55790.1	11q23.3	2013-01-28	2011-05-19					"""U-box domain containing"""	12499	protein-coding gene	gene with protein product		603753	"""ubiquitination factor E4A (homologous to yeast UFD2)"", ""ubiquitination factor E4A (UFD2 homolog, yeast)"""			10089879	Standard	NM_004788		Approved	UBOX2, UFD2, KIAA0126, E4	uc001psv.3	Q14139	OTTHUMG00000168100	ENST00000431736.2:c.1790C>T	11.37:g.118250358C>T	ENSP00000387362:p.Ser597Phe					UBE4A_uc001psv.2_Missense_Mutation_p.S597F	p.S590F	NM_004788	NP_004779	Q14139	UBE4A_HUMAN		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)	11	1898	+	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)	590						Missense_Mutation	SNP	ENST00000431736.2	37	c.1769C>T	CCDS8396.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.512459	0.85389	.	.	ENSG00000110344	ENST00000252108;ENST00000431736;ENST00000545354	T;T;T	0.39229	1.09;1.09;1.09	5.38	5.38	0.77491	Ubiquitin conjugation factor E4, core (1);	0.000000	0.85682	D	0.000000	T	0.37892	0.1020	L	0.47716	1.5	0.80722	D	1	B;B	0.29432	0.145;0.244	B;B	0.29077	0.053;0.098	T	0.20438	-1.0275	10	0.09843	T	0.71	-12.7074	19.1102	0.93313	0.0:1.0:0.0:0.0	.	590;597	Q14139;Q14139-2	UBE4A_HUMAN;.	F	590;597;62	ENSP00000252108:S590F;ENSP00000387362:S597F;ENSP00000438918:S62F	ENSP00000252108:S590F	S	+	2	0	UBE4A	117755568	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.487000	0.81328	2.506000	0.84524	0.591000	0.81541	TCC		0.473	UBE4A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398143.1	NM_004788		36	48	0	0	0	0.007835	0	36	48				
OR6T1	219874	broad.mit.edu	37	11	123814374	123814374	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr11:123814374G>T	ENST00000321252.2	-	1	206	c.172C>A	c.(172-174)Cag>Aag	p.Q58K		NM_001005187.1	NP_001005187.1	Q8NGN1	OR6T1_HUMAN	olfactory receptor, family 6, subfamily T, member 1	58						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Q58K(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(18)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		AAGTACATCTGTATGTGCAGG	0.502																																							uc010sab.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(172-174)CAG>AAG		olfactory receptor, family 6, subfamily T,							129.0	120.0	123.0					11																	123814374		2202	4299	6501	SO:0001583	missense	219874				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123814374G>T	AB065759	CCDS31700.1	11q24.1	2012-08-09			ENSG00000181499	ENSG00000181499		"""GPCR / Class A : Olfactory receptors"""	14848	protein-coding gene	gene with protein product							Standard	NM_001005187		Approved		uc010sab.2	Q8NGN1	OTTHUMG00000165962	ENST00000321252.2:c.172C>A	11.37:g.123814374G>T	ENSP00000325203:p.Gln58Lys						p.Q58K	NM_001005187	NP_001005187	Q8NGN1	OR6T1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)	1	172	-		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	58			Helical; Name=2; (Potential).		Q6IFE7	Missense_Mutation	SNP	ENST00000321252.2	37	c.172C>A	CCDS31700.1	.	.	.	.	.	.	.	.	.	.	G	16.92	3.255150	0.59321	.	.	ENSG00000181499	ENST00000321252	T	0.00428	7.44	4.26	4.26	0.50523	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00384	0.0012	L	0.29908	0.895	0.29457	N	0.858031	P	0.42692	0.787	B	0.42188	0.379	T	0.60073	-0.7334	9	0.87932	D	0	-57.724	14.1652	0.65473	0.0:0.0:1.0:0.0	.	58	Q8NGN1	OR6T1_HUMAN	K	58	ENSP00000325203:Q58K	ENSP00000325203:Q58K	Q	-	1	0	OR6T1	123319584	1.000000	0.71417	0.999000	0.59377	0.628000	0.37860	5.389000	0.66255	1.918000	0.55548	0.655000	0.94253	CAG		0.502	OR6T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387264.1	NM_001005187		23	111	1	0	3.28513e-13	0.003954	3.95258e-13	23	111				
VSIG2	23584	broad.mit.edu	37	11	124621476	124621476	+	Splice_Site	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr11:124621476C>T	ENST00000326621.5	-	2	162	c.62G>A	c.(61-63)gGg>gAg	p.G21E	VSIG2_ENST00000403470.1_Splice_Site_p.G21E	NM_014312.3	NP_055127.2	Q96IQ7	VSIG2_HUMAN	V-set and immunoglobulin domain containing 2	21				Missing (in Ref. 1; AAD17522). {ECO:0000305}.		integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)		p.G21E(1)		central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(5)	19	all_hematologic(175;0.215)	Breast(109;0.00663)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0215)		CACGGCCAGCCCTGGGGCCGG	0.667																																							uc001qas.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(1)	4						c.(61-63)GGG>GAG		V-set and immunoglobulin domain containing 2							30.0	29.0	29.0					11																	124621476		2201	4298	6499	SO:0001630	splice_region_variant	23584					integral to plasma membrane|membrane fraction		g.chr11:124621476C>T	AF061022	CCDS8452.1	11q24	2013-01-11			ENSG00000019102	ENSG00000019102		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	17149	protein-coding gene	gene with protein product		606011				9862345	Standard	NM_014312		Approved	CTXL, CTH	uc001qas.3	Q96IQ7	OTTHUMG00000150357	ENST00000326621.5:c.62-1G>A	11.37:g.124621476C>T						VSIG2_uc001qat.2_Missense_Mutation_p.G21E	p.G21E	NM_014312	NP_055127	Q96IQ7	VSIG2_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0215)	2	138	-	all_hematologic(175;0.215)	Breast(109;0.00663)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)	21	Missing (in Ref. 1; AAD17522).				O95791|Q9NX42	Missense_Mutation	SNP	ENST00000326621.5	37	c.62G>A	CCDS8452.1	.	.	.	.	.	.	.	.	.	.	C	15.97	2.989117	0.53934	.	.	ENSG00000019102	ENST00000326621;ENST00000403470	T;T	0.75821	-0.94;-0.97	4.61	4.61	0.57282	.	0.891166	0.09698	N	0.767482	T	0.81059	0.4744	L	0.34521	1.04	0.25677	N	0.985837	D	0.89917	1.0	D	0.87578	0.998	T	0.71576	-0.4551	10	0.56958	D	0.05	.	14.4884	0.67634	0.0:1.0:0.0:0.0	.	21	Q96IQ7	VSIG2_HUMAN	E	21	ENSP00000318684:G21E;ENSP00000385013:G21E	ENSP00000318684:G21E	G	-	2	0	VSIG2	124126686	0.570000	0.26651	0.149000	0.22428	0.111000	0.19643	3.610000	0.54125	2.383000	0.81215	0.650000	0.86243	GGG		0.667	VSIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317785.1	NM_014312	Missense_Mutation	13	38	0	0	0	0.013537	0	13	38				
PRDM10	56980	broad.mit.edu	37	11	129814846	129814846	+	Silent	SNP	C	C	G			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr11:129814846C>G	ENST00000360871.3	-	6	813	c.582G>C	c.(580-582)ccG>ccC	p.P194P	PRDM10_ENST00000526082.1_Silent_p.P108P|PRDM10_ENST00000528746.1_Silent_p.P168P|PRDM10_ENST00000304538.6_Silent_p.P108P|PRDM10_ENST00000423662.2_Silent_p.P108P|PRDM10_ENST00000358825.5_Silent_p.P194P	NM_199437.1	NP_955469.1	Q9NQV6	PRD10_HUMAN	PR domain containing 10	194					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)	p.P194P(1)		breast(2)|endometrium(6)|kidney(3)|large_intestine(14)|lung(15)|pancreas(2)|skin(1)|stomach(3)|urinary_tract(2)	48	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)		GGTTGGGGATCGGGTGCAAGG	0.607																																							uc001qfm.2		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(1)	1						c.(580-582)CCG>CCC		PR domain containing 10 isoform 1							39.0	40.0	39.0					11																	129814846		2201	4297	6498	SO:0001819	synonymous_variant	56980				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr11:129814846C>G	AF275817	CCDS8484.1, CCDS8485.1, CCDS44771.1, CCDS44772.1	11q24.3	2013-01-08			ENSG00000170325	ENSG00000170325		"""Zinc fingers, C2H2-type"""	13995	protein-coding gene	gene with protein product	"""PRDM zinc finger transcription factor"", ""PR-domain family member 7"", ""tristanin"""					12175877	Standard	NM_020228		Approved	KIAA1231, PFM7, MGC131802	uc001qfm.3	Q9NQV6	OTTHUMG00000165762	ENST00000360871.3:c.582G>C	11.37:g.129814846C>G						PRDM10_uc001qfj.2_Silent_p.P108P|PRDM10_uc001qfk.2_Silent_p.P108P|PRDM10_uc001qfl.2_Silent_p.P108P|PRDM10_uc010sbx.1_Silent_p.P108P|PRDM10_uc001qfn.2_Silent_p.P194P|PRDM10_uc009zct.1_Silent_p.P226P	p.P194P	NM_020228	NP_064613	Q9NQV6	PRD10_HUMAN		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)	6	814	-	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)	194					B7ZL71|G3XAE5|J3KP23|Q17R90|Q2KHR4|Q863Z2|Q9NXI4|Q9ULI9	Silent	SNP	ENST00000360871.3	37	c.582G>C	CCDS8484.1																																																																																				0.607	PRDM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386076.1	NM_199437		29	33	0	0	0	0.007291	0	29	33				
NRIP2	83714	broad.mit.edu	37	12	2943997	2943997	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr12:2943997C>G	ENST00000337508.4	-	1	193	c.153G>C	c.(151-153)atG>atC	p.M51I		NM_031474.2	NP_113662.1	Q9BQI9	NRIP2_HUMAN	nuclear receptor interacting protein 2	51					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	aspartic-type endopeptidase activity (GO:0004190)	p.M51I(1)		central_nervous_system(1)|endometrium(2)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			GCTTGGTGCTCATGGCCCCTG	0.677																																							uc001qlc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(151-153)ATG>ATC		nuclear receptor interacting protein 2							92.0	89.0	90.0					12																	2943997		2203	4300	6503	SO:0001583	missense	83714				proteolysis|transcription, DNA-dependent	cytoplasm|nucleus	aspartic-type endopeptidase activity	g.chr12:2943997C>G	AK054740	CCDS8514.1	12p13.33	2008-02-05			ENSG00000053702	ENSG00000053702			23078	protein-coding gene	gene with protein product						11230166	Standard	NM_031474		Approved	DKFZP761G1913	uc001qlc.3	Q9BQI9	OTTHUMG00000130616	ENST00000337508.4:c.153G>C	12.37:g.2943997C>G	ENSP00000337501:p.Met51Ile					NRIP2_uc010sed.1_Missense_Mutation_p.M51I|uc009zdz.1_5'Flank	p.M51I	NM_031474	NP_113662	Q9BQI9	NRIP2_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.000818)		1	225	-			51					A2RRE3|B4DV61	Missense_Mutation	SNP	ENST00000337508.4	37	c.153G>C	CCDS8514.1	.	.	.	.	.	.	.	.	.	.	C	14.42	2.531546	0.45073	.	.	ENSG00000053702	ENST00000337508;ENST00000546074;ENST00000542990;ENST00000542386	.	.	.	4.24	4.24	0.50183	.	2.454860	0.01986	N	0.045161	T	0.41719	0.1171	L	0.34521	1.04	0.29565	N	0.850349	B	0.22003	0.063	B	0.18871	0.023	T	0.22347	-1.0219	9	0.17369	T	0.5	-11.7215	12.0047	0.53252	0.0:1.0:0.0:0.0	.	51	Q9BQI9	NRIP2_HUMAN	I	51;51;1;1	.	ENSP00000337501:M51I	M	-	3	0	NRIP2	2814258	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	1.542000	0.36137	2.201000	0.70794	0.484000	0.47621	ATG		0.677	NRIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253090.4	NM_031474		30	419	0	0	0	0.013726	0	30	419				
PRMT8	56341	broad.mit.edu	37	12	3686040	3686040	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr12:3686040G>T	ENST00000382622.3	+	7	1106	c.716G>T	c.(715-717)tGg>tTg	p.W239L	PRMT8_ENST00000261252.4_3'UTR|PRMT8_ENST00000452611.2_Missense_Mutation_p.W230L	NM_019854.4	NP_062828.3	Q9NR22	ANM8_HUMAN	protein arginine methyltransferase 8	239	SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				histone arginine methylation (GO:0034969)|histone H4-R3 methylation (GO:0043985)|histone methylation (GO:0016571)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|regulation of protein binding (GO:0043393)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	histone methyltransferase activity (H4-R3 specific) (GO:0044020)|histone-arginine N-methyltransferase activity (GO:0008469)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|protein-arginine omega-N monomethyltransferase activity (GO:0035241)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)	p.W239L(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(9)|lung(14)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)	37			OV - Ovarian serous cystadenocarcinoma(31;0.0109)|COAD - Colon adenocarcinoma(12;0.0264)			CCCACAGGGTGGGAGAATGTC	0.592																																							uc001qmf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(1)|skin(1)	5						c.(715-717)TGG>TTG		HMT1 hnRNP methyltransferase-like 4							247.0	227.0	234.0					12																	3686040		2203	4300	6503	SO:0001583	missense	56341				regulation of protein binding	cytoplasm|plasma membrane	histone-arginine N-methyltransferase activity|protein heterodimerization activity|protein homodimerization activity|protein-arginine omega-N asymmetric methyltransferase activity|protein-arginine omega-N monomethyltransferase activity	g.chr12:3686040G>T	AF263539	CCDS8521.2, CCDS58200.1	12p13.3	2006-03-03	2006-02-16	2006-02-16	ENSG00000111218	ENSG00000111218		"""Protein arginine methyltransferases"""	5188	protein-coding gene	gene with protein product		610086	"""HMT1 hnRNP methyltransferase-like 3 (S. cerevisiae)"", ""HMT1 hnRNP methyltransferase-like 4 (S. cerevisiae)"""	HRMT1L3, HRMT1L4		16051612	Standard	NM_019854		Approved		uc001qmf.4	Q9NR22	OTTHUMG00000128493	ENST00000382622.3:c.716G>T	12.37:g.3686040G>T	ENSP00000372067:p.Trp239Leu					PRMT8_uc009zed.2_Missense_Mutation_p.W230L|PRMT8_uc009zee.1_RNA|PRMT8_uc001qmg.2_Missense_Mutation_p.W53L	p.W239L	NM_019854	NP_062828	Q9NR22	ANM8_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.0109)|COAD - Colon adenocarcinoma(12;0.0264)		7	1083	+			239					B2RDP0|Q8TBJ8	Missense_Mutation	SNP	ENST00000382622.3	37	c.716G>T	CCDS8521.2	.	.	.	.	.	.	.	.	.	.	G	26.4	4.735906	0.89482	.	.	ENSG00000111218	ENST00000452611;ENST00000382622	T;T	0.76448	-1.02;-1.02	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	D	0.91178	0.7221	H	0.95884	3.735	0.80722	D	1	D;D	0.69078	0.997;0.99	D;P	0.64237	0.923;0.654	D	0.93900	0.7187	10	0.87932	D	0	.	16.3032	0.82832	0.0:0.0:1.0:0.0	.	230;239	Q9NR22-2;Q9NR22	.;ANM8_HUMAN	L	230;239	ENSP00000414507:W230L;ENSP00000372067:W239L	ENSP00000372067:W239L	W	+	2	0	PRMT8	3556301	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	9.824000	0.99380	2.444000	0.82710	0.655000	0.94253	TGG		0.592	PRMT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250297.2	NM_019854		560	190	1	0	1.33697e-226	0.01441	1.97935e-226	560	190				
IFFO1	25900	broad.mit.edu	37	12	6658970	6658970	+	Silent	SNP	G	G	A	rs138562505		TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr12:6658970G>A	ENST00000396840.2	-	4	1064	c.1023C>T	c.(1021-1023)tgC>tgT	p.C341C	IFFO1_ENST00000356896.4_Silent_p.C341C|IFFO1_ENST00000336604.4_Silent_p.C341C|IFFO1_ENST00000465801.1_Silent_p.C34C|IFFO1_ENST00000436152.2_Silent_p.C34C			Q0D2I5	IFFO1_HUMAN	intermediate filament family orphan 1	341						intermediate filament (GO:0005882)		p.C341C(1)		central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	20						GAGCCACATCGCAGAGCTTGG	0.602																																							uc001qpd.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1021-1023)TGC>TGT		intermediate filament family orphan isoform 2		G	,,	0,4406		0,0,2203	137.0	89.0	105.0		1023,1023,1023	-7.9	0.1	12	dbSNP_134	105	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	IFFO1	NM_001039670.2,NM_001193457.1,NM_080730.4	,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,	341/564,341/572,341/563	6658970	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	25900					intermediate filament		g.chr12:6658970G>A	AF124432	CCDS8550.1, CCDS41741.1, CCDS8550.2, CCDS73425.1	12p13.31	2013-01-16	2008-09-11	2008-09-11	ENSG00000010295	ENSG00000010295		"""Intermediate filament family orphans"""	24970	protein-coding gene	gene with protein product		610495	"""intermediate filament family orphan"""	IFFO		8771189, 3052284	Standard	NM_001193457		Approved	HOM-TES-103	uc010sfe.2	Q0D2I5	OTTHUMG00000141264	ENST00000396840.2:c.1023C>T	12.37:g.6658970G>A						IFFO1_uc001qoy.2_RNA|IFFO1_uc001qpa.1_5'Flank|IFFO1_uc001qpb.1_Silent_p.C18C|IFFO1_uc001qpe.1_RNA|IFFO1_uc010sfe.1_Silent_p.C341C|IFFO1_uc001qpf.1_Silent_p.C341C|IFFO1_uc001qoz.1_5'Flank|IFFO1_uc001qpc.1_Silent_p.C341C|IFFO1_uc001qpg.2_5'Flank	p.C341C	NM_080730	NP_542768	Q0D2I5	IFFO1_HUMAN			4	1057	-			341					Q24JT6|Q7L5J9|Q7Z5X4|Q9BQ46	Silent	SNP	ENST00000396840.2	37	c.1023C>T		.	.	.	.	.	.	.	.	.	.	G	4.714	0.132855	0.09032	0.0	1.16E-4	ENSG00000010295	ENST00000416019	.	.	.	3.95	-7.9	0.01169	.	.	.	.	.	T	0.65059	0.2655	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.71912	-0.4449	4	.	.	.	-11.5573	18.0403	0.89317	0.3571:0.0:0.6429:0.0	.	.	.	.	V	73	.	.	A	-	2	0	IFFO1	6529231	0.000000	0.05858	0.087000	0.20705	0.535000	0.34838	-2.524000	0.00948	-2.457000	0.00539	-0.658000	0.03865	GCG		0.602	IFFO1-008	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000280428.1	NM_080730		71	21	0	0	0	0.01441	0	71	21				
TAS2R13	50838	broad.mit.edu	37	12	11061032	11061032	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr12:11061032C>G	ENST00000390677.2	-	1	1129	c.866G>C	c.(865-867)aGa>aCa	p.R289T	PRR4_ENST00000536668.1_Intron	NM_023920.2	NP_076409.1	Q9NYV9	T2R13_HUMAN	taste receptor, type 2, member 13	289					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|positive regulation of cytokinesis (GO:0032467)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)	p.R289T(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(2)|skin(1)	9						AAAGGCCTGTCTTAACTTAGC	0.418																																							uc001qzg.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)|skin(1)	2						c.(865-867)AGA>ACA		taste receptor, type 2, member 13							100.0	92.0	94.0					12																	11061032		2203	4300	6503	SO:0001583	missense	50838				sensory perception of taste	integral to membrane	taste receptor activity	g.chr12:11061032C>G	AF227137	CCDS8635.1	12p13	2012-08-22			ENSG00000212128	ENSG00000212128		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14919	protein-coding gene	gene with protein product		604792				10761934, 10766242	Standard	NM_023920		Approved	T2R13, TRB3	uc001qzg.1	Q9NYV9		ENST00000390677.2:c.866G>C	12.37:g.11061032C>G	ENSP00000375095:p.Arg289Thr					PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRB4_uc001qzf.1_Intron	p.R289T	NM_023920	NP_076409	Q9NYV9	T2R13_HUMAN			1	1130	-			289			Cytoplasmic (Potential).		Q4G0I5|Q502V8|Q645X2	Missense_Mutation	SNP	ENST00000390677.2	37	c.866G>C	CCDS8635.1	.	.	.	.	.	.	.	.	.	.	C	9.866	1.197656	0.22037	.	.	ENSG00000212128	ENST00000390677	T	0.01051	5.4	2.56	2.56	0.30785	.	0.089217	0.45606	U	0.000360	T	0.02267	0.0070	M	0.79258	2.445	0.09310	N	1	B	0.25719	0.132	B	0.32393	0.145	T	0.23084	-1.0198	10	0.45353	T	0.12	.	8.6377	0.33959	0.0:1.0:0.0:0.0	.	289	Q9NYV9	T2R13_HUMAN	T	289	ENSP00000375095:R289T	ENSP00000375095:R289T	R	-	2	0	TAS2R13	10952299	0.000000	0.05858	0.002000	0.10522	0.055000	0.15305	-0.753000	0.04792	1.414000	0.47017	0.460000	0.39030	AGA		0.418	TAS2R13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400229.1			29	244	0	0	0	0.010818	0	29	244				
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000311936.3_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000556131.1_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1	G12D(HPAC_PANCREAS)|G12V(SW403_LARGE_INTESTINE)|G12D(HPAFII_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(NCIH441_LUNG)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(PK1_PANCREAS)|G12V(KP3_PANCREAS)|G12D(PANC0813_PANCREAS)|G12A(SW1116_LARGE_INTESTINE)|G12D(LS180_LARGE_INTESTINE)|G12V(NCIH727_LUNG)|G12V(PATU8988S_PANCREAS)|G12V(CAPAN2_PANCREAS)|G12D(KP4_PANCREAS)|G12D(LS513_LARGE_INTESTINE)|G12D(SNUC2A_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(COLO668_LUNG)|G12D(COLO678_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12D(PANC0203_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(SW900_LUNG)|G12V(LCLC97TM1_LUNG)|G12V(SW620_LARGE_INTESTINE)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(SH10TC_STOMACH)|G12V(A498_KIDNEY)|G12D(PK59_PANCREAS)|G12D(HEC1A_ENDOMETRIUM)|G12D(PANC0504_PANCREAS)|G12V(SNGM_ENDOMETRIUM)|G12A(RERFLCAD1_LUNG)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12D(ASPC1_PANCREAS)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(RCM1_LARGE_INTESTINE)|G12V(CORL23_LUNG)|G12D(SW1990_PANCREAS)|G12D(HEYA8_OVARY)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12V(HUPT4_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(HEC50B_ENDOMETRIUM)|G12V(YAPC_PANCREAS)|G12V(NCIH2444_LUNG)|G12V(HCC56_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12V(DANG_PANCREAS)|G12V(SHP77_LUNG)|G12D(AGS_STOMACH)|G12D(SKLU1_LUNG)|G12V(QGP1_PANCREAS)|G12D(L33_PANCREAS)|G12V(PANC0327_PANCREAS)|G12D(PANC1_PANCREAS)|G12V(RKN_OVARY)|G12V(PATU8902_PANCREAS)	119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12N(6)|p.G12G(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052						c.(34-36)GGT>GTT		c-K-ras2 protein isoform a precursor							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25398284C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	12.37:g.25398284C>A	ENSP00000256078:p.Gly12Val	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_uc001rgq.1_Missense_Mutation_p.G12V|KRAS_uc001rgr.2_RNA	p.G12V	NM_033360	NP_203524	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		2	216	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		12		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).	GTP.		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	c.35G>T	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		15	15	1	0	1.00905e-13	0.008871	1.22182e-13	15	15				
ITPR2	3709	broad.mit.edu	37	12	26749907	26749907	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr12:26749907C>T	ENST00000381340.3	-	31	4579	c.4163G>A	c.(4162-4164)gGg>gAg	p.G1388E		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	1388					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)	p.G1388E(1)	ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	GACATTTTTCCCCTCTGTGCA	0.532																																							uc001rhg.2		NA																	1	Substitution - Missense(1)		lung(1)	kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14						c.(4162-4164)GGG>GAG		inositol 1,4,5-triphosphate receptor, type 2							103.0	105.0	105.0					12																	26749907		2054	4201	6255	SO:0001583	missense	3709				activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity	g.chr12:26749907C>T	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.4163G>A	12.37:g.26749907C>T	ENSP00000370744:p.Gly1388Glu						p.G1388E	NM_002223	NP_002214	Q14571	ITPR2_HUMAN			31	4580	-	Colorectal(261;0.0847)		1388			Cytoplasmic (Potential).		O94773	Missense_Mutation	SNP	ENST00000381340.3	37	c.4163G>A	CCDS41764.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.823362	0.90873	.	.	ENSG00000123104	ENST00000381340	D	0.95756	-3.8	4.44	4.44	0.53790	.	0.052732	0.85682	D	0.000000	D	0.97551	0.9198	M	0.84326	2.69	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.96823	0.9605	10	0.29301	T	0.29	.	17.6058	0.88037	0.0:1.0:0.0:0.0	.	1388	Q14571	ITPR2_HUMAN	E	1388	ENSP00000370744:G1388E	ENSP00000370744:G1388E	G	-	2	0	ITPR2	26641174	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.596000	0.82721	2.440000	0.82611	0.650000	0.86243	GGG		0.532	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402732.1	NM_002223		178	66	0	0	0	0.01441	0	178	66				
ADAMTS20	80070	broad.mit.edu	37	12	43846211	43846211	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr12:43846211C>A	ENST00000389420.3	-	14	1944	c.1945G>T	c.(1945-1947)Ggc>Tgc	p.G649C	ADAMTS20_ENST00000553158.1_Missense_Mutation_p.G649C	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	649	Cys-rich.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.G649C(2)		breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		TCCTTTGTGCCAACTGTAAAA	0.323																																							uc010skx.1		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19						c.(1945-1947)GGC>TGC		a disintegrin-like and metalloprotease with							69.0	69.0	69.0					12																	43846211		2203	4300	6503	SO:0001583	missense	80070					proteinaceous extracellular matrix	zinc ion binding	g.chr12:43846211C>A	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.1945G>T	12.37:g.43846211C>A	ENSP00000374071:p.Gly649Cys						p.G649C	NM_025003	NP_079279	P59510	ATS20_HUMAN		GBM - Glioblastoma multiforme(48;0.0473)	14	1945	-	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)	649			Cys-rich.		A6NNC9|J3QT00	Missense_Mutation	SNP	ENST00000389420.3	37	c.1945G>T	CCDS31778.2	.	.	.	.	.	.	.	.	.	.	C	6.800	0.516630	0.12944	.	.	ENSG00000173157	ENST00000389420;ENST00000553158;ENST00000389417	T;D	0.86030	2.99;-2.06	4.97	2.07	0.26955	.	0.423664	0.19601	N	0.110384	T	0.81250	0.4783	L	0.52905	1.665	0.58432	D	0.999997	B	0.26577	0.153	B	0.30105	0.111	T	0.73855	-0.3851	10	0.52906	T	0.07	.	10.1208	0.42618	0.2549:0.4565:0.2886:0.0	.	649	P59510	ATS20_HUMAN	C	649	ENSP00000374071:G649C;ENSP00000448341:G649C	ENSP00000374068:G649C	G	-	1	0	ADAMTS20	42132478	0.997000	0.39634	0.169000	0.22859	0.015000	0.08874	0.421000	0.21280	0.059000	0.16252	-1.943000	0.00494	GGC		0.323	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1	NM_025003		16	66	1	0	8.28177e-16	0.007413	1.0325e-15	16	66				
OR10AD1	121275	broad.mit.edu	37	12	48596695	48596695	+	Silent	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr12:48596695G>A	ENST00000310248.2	-	1	475	c.381C>T	c.(379-381)atC>atT	p.I127I		NM_001004134.1	NP_001004134.1	Q8NGE0	O10AD_HUMAN	olfactory receptor, family 10, subfamily AD, member 1	127						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I127I(1)		endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|stomach(1)|urinary_tract(1)	9						GTGGGTAGCAGATAGCAACAT	0.488																																							uc001rrl.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(379-381)ATC>ATT		olfactory receptor, family 10, subfamily AD,							91.0	80.0	84.0					12																	48596695		2203	4300	6503	SO:0001819	synonymous_variant	121275				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr12:48596695G>A		CCDS31787.1	12q13.11	2013-09-24	2002-11-13	2002-11-15	ENSG00000172640	ENSG00000172640		"""GPCR / Class A : Olfactory receptors"""	14819	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily AD, member 1 pseudogene"""	OR10AD1P			Standard	NM_001004134		Approved		uc001rrl.1	Q8NGE0	OTTHUMG00000168027	ENST00000310248.2:c.381C>T	12.37:g.48596695G>A							p.I127I	NM_001004134	NP_001004134	Q8NGE0	O10AD_HUMAN			1	381	-			127			Cytoplasmic (Potential).		B9EGT9|Q6IFA8	Silent	SNP	ENST00000310248.2	37	c.381C>T	CCDS31787.1																																																																																				0.488	OR10AD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397577.1			22	31	0	0	0	0.004656	0	22	31				
GLS2	27165	broad.mit.edu	37	12	56881845	56881845	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr12:56881845G>C	ENST00000311966.4	-	1	336	c.58C>G	c.(58-60)Cga>Gga	p.R20G	GLS2_ENST00000539272.1_Missense_Mutation_p.R20G	NM_013267.2	NP_037399.2	Q9UI32	GLSL_HUMAN	glutaminase 2 (liver, mitochondrial)	20					cellular amino acid biosynthetic process (GO:0008652)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate secretion (GO:0014047)|glutamine metabolic process (GO:0006541)|neurotransmitter secretion (GO:0007269)|reactive oxygen species metabolic process (GO:0072593)|regulation of apoptotic process (GO:0042981)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glutaminase activity (GO:0004359)	p.R20G(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)|urinary_tract(1)	13					L-Glutamine(DB00130)	CAGCCTCCTCGCCCGCAGTGA	0.726																																							uc001slj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(58-60)CGA>GGA		glutaminase 2 precursor	L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)						9.0	11.0	10.0					12																	56881845		2185	4266	6451	SO:0001583	missense	27165				cellular amino acid biosynthetic process|glutamate secretion|glutamine metabolic process|neurotransmitter secretion	mitochondrial matrix	glutaminase activity|protein binding	g.chr12:56881845G>C		CCDS8921.1, CCDS73482.1	12q13	2013-01-10			ENSG00000135423	ENSG00000135423		"""Ankyrin repeat domain containing"""	29570	protein-coding gene	gene with protein product		606365				11130979, 10620514	Standard	NM_013267		Approved	GA, GLS, LGA, hLGA	uc001slj.3	Q9UI32	OTTHUMG00000140379	ENST00000311966.4:c.58C>G	12.37:g.56881845G>C	ENSP00000310447:p.Arg20Gly					GLS2_uc009zos.2_RNA|GLS2_uc001slk.2_5'UTR|GLS2_uc009zot.2_5'UTR|GLS2_uc001sll.2_RNA	p.R20G	NM_013267	NP_037399	Q9UI32	GLSL_HUMAN			1	337	-			20					B7Z8Q9|Q8IX91|Q9NYY2|Q9UI31	Missense_Mutation	SNP	ENST00000311966.4	37	c.58C>G	CCDS8921.1	.	.	.	.	.	.	.	.	.	.	G	12.20	1.867045	0.32977	.	.	ENSG00000135423	ENST00000311966;ENST00000461077;ENST00000539272	T	0.29142	1.58	5.58	1.25	0.21368	.	0.427359	0.19399	N	0.115203	T	0.18923	0.0454	N	0.22421	0.69	0.25860	N	0.983832	B	0.02656	0.0	B	0.01281	0.0	T	0.19160	-1.0314	10	0.72032	D	0.01	-19.1685	8.3851	0.32494	0.0:0.1555:0.4279:0.4166	.	20	Q9UI32	GLSL_HUMAN	G	20	ENSP00000310447:R20G	ENSP00000310447:R20G	R	-	1	2	GLS2	55168112	0.608000	0.26966	0.936000	0.37596	0.692000	0.40212	-0.023000	0.12456	0.337000	0.23665	0.655000	0.94253	CGA		0.726	GLS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277113.1	NM_013267		9	4	0	0	0	0.008291	0	9	4				
ATP5B	506	broad.mit.edu	37	12	57037225	57037225	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr12:57037225C>T	ENST00000262030.3	-	5	804	c.754G>A	c.(754-756)Gaa>Aaa	p.E252K	ATP5B_ENST00000552919.1_Missense_Mutation_p.E252K|ATP5B_ENST00000550162.1_5'Flank|SNORD59A_ENST00000384304.1_RNA	NM_001686.3	NP_001677.2	P06576	ATPB_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide	252					angiogenesis (GO:0001525)|ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular metabolic process (GO:0044237)|generation of precursor metabolites and energy (GO:0006091)|lipid metabolic process (GO:0006629)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|osteoblast differentiation (GO:0001649)|proton transport (GO:0015992)|regulation of intracellular pH (GO:0051453)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial nucleoid (GO:0042645)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase, catalytic core (GO:0005754)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MHC class I protein binding (GO:0042288)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)|transporter activity (GO:0005215)	p.E252K(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						ACACCAGATTCAATCATTTCA	0.428																																							uc001slr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(754-756)GAA>AAA		mitochondrial ATP synthase beta subunit							130.0	119.0	123.0					12																	57037225		2203	4300	6503	SO:0001583	missense	506				angiogenesis|ATP hydrolysis coupled proton transport|regulation of intracellular pH|respiratory electron transport chain	cell surface|mitochondrial nucleoid|mitochondrial proton-transporting ATP synthase, catalytic core|plasma membrane	ATP binding|eukaryotic cell surface binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|hydrogen-exporting ATPase activity, phosphorylative mechanism|MHC class I protein binding|proton-transporting ATPase activity, rotational mechanism	g.chr12:57037225C>T	M27132	CCDS8924.1	12p13.3	2012-10-12			ENSG00000110955	ENSG00000110955	3.6.3.14	"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	830	protein-coding gene	gene with protein product		102910		ATPSB		2687158	Standard	NM_001686		Approved		uc001slr.3	P06576	OTTHUMG00000170291	ENST00000262030.3:c.754G>A	12.37:g.57037225C>T	ENSP00000262030:p.Glu252Lys						p.E252K	NM_001686	NP_001677	P06576	ATPB_HUMAN			5	859	-			252					A8K4X0|Q14283	Missense_Mutation	SNP	ENST00000262030.3	37	c.754G>A	CCDS8924.1	.	.	.	.	.	.	.	.	.	.	C	19.04	3.750112	0.69533	.	.	ENSG00000110955	ENST00000262030;ENST00000552919;ENST00000551020;ENST00000551570;ENST00000553007	D;D;D;D;D	0.82255	-1.59;-1.59;-1.59;-1.59;-1.59	5.89	5.89	0.94794	ATPase, F1/V1/A1 complex, alpha/beta subunit, nucleotide-binding domain (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.88926	0.6570	M	0.80508	2.5	0.80722	D	1	P	0.39624	0.681	P	0.47891	0.56	D	0.89420	0.3709	10	0.87932	D	0	-21.7728	19.0242	0.92926	0.0:1.0:0.0:0.0	.	252	P06576	ATPB_HUMAN	K	252;252;191;45;153	ENSP00000262030:E252K;ENSP00000450297:E252K;ENSP00000446677:E191K;ENSP00000448428:E45K;ENSP00000447571:E153K	ENSP00000262030:E252K	E	-	1	0	ATP5B	55323492	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.688000	0.84153	2.788000	0.95919	0.557000	0.71058	GAA		0.428	ATP5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408380.1	NM_001686		62	147	0	0	0	0.01441	0	62	147				
PRIM1	5557	broad.mit.edu	37	12	57136825	57136825	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr12:57136825C>T	ENST00000338193.6	-	7	730	c.694G>A	c.(694-696)Gat>Aat	p.D232N		NM_000946.2	NP_000937.1	P49642	PRI1_HUMAN	primase, DNA, polypeptide 1 (49kDa)	232					DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	membrane (GO:0016020)|nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)	p.D232N(1)		kidney(1)|lung(6)|prostate(1)	8						TCGAGAATATCTTGATTAACC	0.323																																							uc001smd.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(694-696)GAT>AAT		DNA primase polypeptide 1							56.0	47.0	50.0					12																	57136825		1785	4047	5832	SO:0001583	missense	5557				DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	DNA primase activity|metal ion binding	g.chr12:57136825C>T	BC005266	CCDS44926.1	12q13.3	2007-06-19	2007-06-19			ENSG00000198056			9369	protein-coding gene	gene with protein product		176635				8530050	Standard	NM_000946		Approved		uc001smd.3	P49642	OTTHUMG00000170034	ENST00000338193.6:c.694G>A	12.37:g.57136825C>T	ENSP00000350491:p.Asp232Asn					PRIM1_uc001sme.1_RNA|PRIM1_uc009zoz.1_RNA	p.D232N	NM_000946	NP_000937	P49642	PRI1_HUMAN			7	758	-			232						Missense_Mutation	SNP	ENST00000338193.6	37	c.694G>A	CCDS44926.1	.	.	.	.	.	.	.	.	.	.	C	11.16	1.557459	0.27827	.	.	ENSG00000198056	ENST00000537418;ENST00000338193;ENST00000549549;ENST00000550770	T;T;T	0.44083	0.93;0.93;0.93	4.74	3.84	0.44239	.	0.097447	0.64402	D	0.000002	T	0.33990	0.0882	L	0.46157	1.445	0.58432	D	0.999995	B	0.06786	0.001	B	0.16289	0.015	T	0.11036	-1.0604	10	0.15499	T	0.54	-15.1938	12.4551	0.55700	0.0:0.9147:0.0:0.0853	.	232	P49642	PRI1_HUMAN	N	233;232;20;235	ENSP00000350491:D232N;ENSP00000449806:D20N;ENSP00000450185:D235N	ENSP00000350491:D232N	D	-	1	0	PRIM1	55423092	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	5.351000	0.66022	1.315000	0.45114	0.313000	0.20887	GAT		0.323	PRIM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406956.1	NM_000946		4	6	0	0	0	0.009096	0	4	6				
GLI1	2735	broad.mit.edu	37	12	57863398	57863398	+	Missense_Mutation	SNP	T	T	G			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr12:57863398T>G	ENST00000228682.2	+	11	1584	c.1493T>G	c.(1492-1494)cTt>cGt	p.L498R	GLI1_ENST00000543426.1_Missense_Mutation_p.L370R|GLI1_ENST00000546141.1_Missense_Mutation_p.L457R	NM_005269.2	NP_005260.1	P08151	GLI1_HUMAN	GLI family zinc finger 1	498					cerebellar cortex morphogenesis (GO:0021696)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral pattern formation (GO:0009953)|epidermal cell differentiation (GO:0009913)|lung development (GO:0030324)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|notochord regression (GO:0060032)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|regulation of smoothened signaling pathway (GO:0008589)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|spermatogenesis (GO:0007283)|ventral midline development (GO:0007418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|primary cilium (GO:0072372)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription regulatory region DNA binding (GO:0044212)	p.L498R(1)		NS(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(8)|lung(22)|ovary(6)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69			GBM - Glioblastoma multiforme(3;3.99e-32)			CTTCGCCGCCTTGAGAACCTC	0.602																																					Pancreas(157;841 1936 10503 41495 50368)	Pancreas(157;841 1936 10503 41495 50368)	uc001snx.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(4)|ovary(4)|breast(3)|central_nervous_system(1)|urinary_tract(1)|kidney(1)|pancreas(1)	15						c.(1492-1494)CTT>CGT		GLI family zinc finger 1 isoform 1							89.0	80.0	83.0					12																	57863398		2203	4300	6503	SO:0001583	missense	2735				epidermal cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|osteoblast differentiation|positive regulation of DNA replication|positive regulation of smoothened signaling pathway|positive regulation of transcription from RNA polymerase II promoter	cytosol|nucleus	transcription regulatory region DNA binding|zinc ion binding	g.chr12:57863398T>G		CCDS8940.1, CCDS53806.1, CCDS53807.1	12q13.2-q13.3	2013-01-25	2009-03-05	2005-01-14		ENSG00000111087		"""Zinc fingers, C2H2-type"""	4317	protein-coding gene	gene with protein product		165220	"""glioma-associated oncogene homolog 1 (zinc finger protein)"", ""glioma-associated oncogene family zinc finger 1"""	GLI		2850480	Standard	NM_005269		Approved		uc001snx.3	P08151		ENST00000228682.2:c.1493T>G	12.37:g.57863398T>G	ENSP00000228682:p.Leu498Arg					GLI1_uc009zpq.2_Missense_Mutation_p.L370R	p.L498R	NM_005269	NP_005260	P08151	GLI1_HUMAN	GBM - Glioblastoma multiforme(3;3.99e-32)		11	1571	+			498					D0EUY3|E9PQQ9|F5H6H8|Q8TDN9	Missense_Mutation	SNP	ENST00000228682.2	37	c.1493T>G	CCDS8940.1	.	.	.	.	.	.	.	.	.	.	T	12.88	2.069828	0.36566	.	.	ENSG00000111087	ENST00000543426;ENST00000228682;ENST00000546141;ENST00000528467	T;T;T;T	0.20069	2.2;2.1;2.2;2.2	4.62	3.45	0.39498	.	0.000000	0.47093	D	0.000254	T	0.38799	0.1054	L	0.60067	1.865	0.51233	D	0.99991	D	0.89917	1.0	D	0.78314	0.991	T	0.12142	-1.0559	10	0.66056	D	0.02	.	9.8352	0.40965	0.0:0.0:0.173:0.827	.	498	P08151	GLI1_HUMAN	R	370;498;457;457	ENSP00000437607:L370R;ENSP00000228682:L498R;ENSP00000441006:L457R;ENSP00000434408:L457R	ENSP00000228682:L498R	L	+	2	0	GLI1	56149665	1.000000	0.71417	0.973000	0.42090	0.151000	0.21798	3.997000	0.57016	0.882000	0.36016	-0.316000	0.08728	CTT		0.602	GLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394197.1	NM_005269		19	101	0	0	0	0.01441	0	19	101				
PTPRB	5787	broad.mit.edu	37	12	71016248	71016249	+	Missense_Mutation	DNP	GG	GG	AT			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr12:71016248_71016249GG>AT	ENST00000550358.1	-	3	654_655	c.629_630CC>AT	c.(628-630)cCC>cAT	p.P210H	PTPRB_ENST00000538174.2_5'UTR|PTPRB_ENST00000334414.6_Missense_Mutation_p.P210H|PTPRB_ENST00000551525.1_Missense_Mutation_p.P209H			P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	0	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.P210H(1)		breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			TGTGCAGATTGGGATGCTGCCT	0.49																																							uc001swc.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|skin(1)	3						c.(628-630)CCC>CAT		protein tyrosine phosphatase, receptor type, B																																				SO:0001583	missense	5787				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr12:71016248_71016249GG>AT	X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000550358.1:c.629_630delinsAT	12.37:g.71016248_71016249delinsAT	ENSP00000448058:p.Pro210His					PTPRB_uc001swa.3_Missense_Mutation_p.P210H|PTPRB_uc001swd.3_Missense_Mutation_p.P209H|PTPRB_uc009zrr.1_Missense_Mutation_p.P89H|PTPRB_uc001swe.2_Missense_Mutation_p.P210H	p.P210H	NM_001109754	NP_001103224	P23467	PTPRB_HUMAN	GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)		3	673_674	-	Renal(347;0.236)		Error:Variant_position_missing_in_P23467_after_alignment					B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Missense_Mutation	DNP	ENST00000550358.1	37	c.629_630CC>AT																																																																																					0.490	PTPRB-003	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000404436.1			29	77	0	0	0	0.004672	0	29	77				
LGR5	8549	broad.mit.edu	37	12	71978259	71978259	+	Silent	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr12:71978259C>T	ENST00000266674.5	+	18	2780	c.2469C>T	c.(2467-2469)ttC>ttT	p.F823F	LGR5_ENST00000540815.2_Silent_p.F799F|RP11-186F10.2_ENST00000546601.1_RNA|LGR5_ENST00000536515.1_Silent_p.F751F			O75473	LGR5_HUMAN	leucine-rich repeat containing G protein-coupled receptor 5	823					G-protein coupled receptor signaling pathway (GO:0007186)|inner ear development (GO:0048839)|positive regulation of canonical Wnt signaling pathway (GO:0090263)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)	p.F823F(1)	NUP107/LGR5(2)	endometrium(2)|kidney(3)|large_intestine(2)|lung(24)|ovary(1)|pancreas(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	48						ACATCTTGTTCAATCCTCACT	0.408																																							uc001swl.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(4)|skin(3)|ovary(1)|pancreas(1)	9						c.(2467-2469)TTC>TTT		leucine-rich repeat-containing G protein-coupled							111.0	103.0	105.0					12																	71978259		2203	4300	6503	SO:0001819	synonymous_variant	8549					integral to plasma membrane	protein-hormone receptor activity	g.chr12:71978259C>T	AF062006	CCDS9000.1, CCDS61194.1, CCDS61195.1	12q22-q23	2012-08-21	2011-01-25	2004-11-12				"""GPCR / Class A : Orphans"""	4504	protein-coding gene	gene with protein product		606667	"""G protein-coupled receptor 49"", ""leucine-rich repeat-containing G protein-coupled receptor 5"""	GPR67, GPR49		9642114	Standard	NM_003667		Approved	HG38, FEX	uc001swl.4	O75473	OTTHUMG00000169543	ENST00000266674.5:c.2469C>T	12.37:g.71978259C>T						LGR5_uc001swm.2_Silent_p.F799F|LGR5_uc001swn.1_Intron	p.F823F	NM_003667	NP_003658	O75473	LGR5_HUMAN			18	2517	+			823			Helical; Name=7; (Potential).		D8MCT0|Q4VAM0|Q4VAM2|Q9UP75	Silent	SNP	ENST00000266674.5	37	c.2469C>T	CCDS9000.1																																																																																				0.408	LGR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404744.1	NM_003667		52	103	0	0	0	0.01441	0	52	103				
PPFIA2	8499	broad.mit.edu	37	12	82070623	82070623	+	Splice_Site	SNP	C	C	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr12:82070623C>A	ENST00000549396.1	-	4	410	c.250G>T	c.(250-252)Gat>Tat	p.D84Y	PPFIA2_ENST00000550584.2_Splice_Site_p.D84Y|PPFIA2_ENST00000548586.1_Splice_Site_p.D84Y|PPFIA2_ENST00000333447.7_Intron|PPFIA2_ENST00000552948.1_Splice_Site_p.D84Y|PPFIA2_ENST00000549325.1_Intron	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	84					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)		p.D84Y(1)		NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						GATTCGATATCCTGAAAAGGG	0.418																																							uc001szo.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(2)|pancreas(1)	6						c.(250-252)GAT>TAT		PTPRF interacting protein alpha 2							52.0	54.0	53.0					12																	82070623		1867	4094	5961	SO:0001630	splice_region_variant	8499							g.chr12:82070623C>A	AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.250-1G>T	12.37:g.82070623C>A						PPFIA2_uc010suj.1_RNA|PPFIA2_uc009zsi.1_RNA	p.D84Y	NM_003625	NP_003616	B7Z663	B7Z663_HUMAN			4	411	-			Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Missense_Mutation	SNP	ENST00000549396.1	37	c.250G>T	CCDS55857.1	.	.	.	.	.	.	.	.	.	.	C	17.14	3.313827	0.60414	.	.	ENSG00000139220	ENST00000549396;ENST00000541501;ENST00000548586;ENST00000552948;ENST00000547623	T;T;T;T	0.47177	0.85;0.85;0.85;0.85	5.97	5.97	0.96955	.	0.162622	0.41001	D	0.000969	T	0.60676	0.2287	L	0.39898	1.24	0.80722	D	1	D	0.61697	0.99	D	0.70487	0.969	T	0.60611	-0.7229	10	0.72032	D	0.01	.	15.9389	0.79739	0.0:1.0:0.0:0.0	.	84	O75334	LIPA2_HUMAN	Y	84;95;84;84;84	ENSP00000450337:D84Y;ENSP00000449338:D84Y;ENSP00000447868:D84Y;ENSP00000447918:D84Y	ENSP00000439748:D95Y	D	-	1	0	PPFIA2	80594754	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.549000	0.53681	2.836000	0.97738	0.655000	0.94253	GAT		0.418	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408030.1		Missense_Mutation	12	28	1	0	2.31682e-05	0.003163	2.47345e-05	12	28				
UHRF1BP1L	23074	broad.mit.edu	37	12	100451895	100451895	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr12:100451895G>A	ENST00000279907.7	-	14	3372	c.3160C>T	c.(3160-3162)Cca>Tca	p.P1054S	UHRF1BP1L_ENST00000545232.2_Missense_Mutation_p.P704S	NM_015054.1	NP_055869.1	A0JNW5	UH1BL_HUMAN	UHRF1 binding protein 1-like	1054								p.P1054S(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(21)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	50						GCTGCTTCTGGAAGCAAATCT	0.353																																							uc001tgq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(3160-3162)CCA>TCA		UHRF1 (ICBP90) binding protein 1-like isoform a							76.0	82.0	80.0					12																	100451895		2203	4299	6502	SO:0001583	missense	23074							g.chr12:100451895G>A		CCDS31882.1, CCDS31883.1	12q23.1	2011-04-15	2008-08-15		ENSG00000111647	ENSG00000111647			29102	protein-coding gene	gene with protein product							Standard	XM_005268737		Approved	KIAA0701	uc001tgq.3	A0JNW5	OTTHUMG00000170195	ENST00000279907.7:c.3160C>T	12.37:g.100451895G>A	ENSP00000279907:p.Pro1054Ser					UHRF1BP1L_uc001tgp.2_Missense_Mutation_p.P704S	p.P1054S	NM_015054	NP_055869	A0JNW5	UH1BL_HUMAN			14	3389	-			1054					A0PJE5|O75183|Q8NDL1|Q96C30|Q9BTS5|Q9H0F1	Missense_Mutation	SNP	ENST00000279907.7	37	c.3160C>T	CCDS31882.1	.	.	.	.	.	.	.	.	.	.	G	5.406	0.260154	0.10239	.	.	ENSG00000111647	ENST00000279907;ENST00000545232	T;T	0.08984	3.03;3.03	6.02	-0.185	0.13276	.	1.146260	0.06099	N	0.665109	T	0.05135	0.0137	N	0.24115	0.695	0.41232	D	0.986583	B	0.06786	0.001	B	0.06405	0.002	T	0.36138	-0.9760	10	0.35671	T	0.21	-0.0381	0.2432	0.00195	0.2646:0.2144:0.2787:0.2423	.	1054	A0JNW5	UH1BL_HUMAN	S	1054;704	ENSP00000279907:P1054S;ENSP00000444824:P704S	ENSP00000279907:P1054S	P	-	1	0	UHRF1BP1L	98976026	0.975000	0.34042	0.906000	0.35671	0.780000	0.44128	0.022000	0.13511	-0.309000	0.08779	0.650000	0.86243	CCA		0.353	UHRF1BP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407875.1	NM_001006947		68	106	0	0	0	0.01441	0	68	106				
DEPDC4	120863	broad.mit.edu	37	12	100660779	100660779	+	Nonsense_Mutation	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr12:100660779G>A	ENST00000416321.1	-	1	78	c.76C>T	c.(76-78)Cag>Tag	p.Q26*	SCYL2_ENST00000360820.2_5'Flank	NM_152317.2	NP_689530.1	Q8N2C3	DEPD4_HUMAN	DEP domain containing 4	26					intracellular signal transduction (GO:0035556)			p.Q26*(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(4)|pancreas(1)|urinary_tract(1)	15						AGCTCGTTCTGACTGACAAGT	0.612																																							uc001thi.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(76-78)CAG>TAG		DEP domain containing 4							86.0	92.0	90.0					12																	100660779		2203	4300	6503	SO:0001587	stop_gained	120863				intracellular signal transduction			g.chr12:100660779G>A	AK090824	CCDS9075.1	12q23	2006-03-30				ENSG00000166153			22952	protein-coding gene	gene with protein product						12477932	Standard	XM_005268628		Approved	DEP.4, FLJ33505	uc001thi.3	Q8N2C3		ENST00000416321.1:c.76C>T	12.37:g.100660779G>A	ENSP00000396234:p.Gln26*					SCYL2_uc009ztw.1_5'Flank|SCYL2_uc001thm.1_5'Flank|SCYL2_uc001thn.2_5'Flank|DEPDC4_uc001thh.1_RNA|DEPDC4_uc001thj.1_Nonsense_Mutation_p.Q26*|DEPDC4_uc009ztv.1_Nonsense_Mutation_p.Q26*|DEPDC4_uc001thk.1_5'UTR|DEPDC4_uc001thl.1_RNA	p.Q26*	NM_152317	NP_689530	Q8N2C3	DEPD4_HUMAN			1	79	-			26					Q496C8|Q96BW0	Nonsense_Mutation	SNP	ENST00000416321.1	37	c.76C>T	CCDS9075.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.466636	0.84425	.	.	ENSG00000166153	ENST00000422147;ENST00000378250;ENST00000416321;ENST00000550587;ENST00000549249;ENST00000551642	.	.	.	5.01	5.01	0.66863	.	0.206543	0.41712	U	0.000838	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	.	15.1717	0.72878	0.0:0.0:1.0:0.0	.	.	.	.	X	26;26;26;26;26;19	.	ENSP00000299185:Q26X	Q	-	1	0	DEPDC4	99184910	0.188000	0.23250	0.005000	0.12908	0.029000	0.11900	1.773000	0.38563	2.595000	0.87683	0.655000	0.94253	CAG		0.612	DEPDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408482.1	NM_152317		60	111	0	0	0	0.01441	0	60	111				
UTP20	27340	broad.mit.edu	37	12	101702085	101702085	+	Silent	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr12:101702085G>A	ENST00000261637.4	+	18	2292	c.2118G>A	c.(2116-2118)gtG>gtA	p.V706V		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	706					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)	p.V706V(1)		NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						GACATGATGTGGTACAGACTG	0.388																																							uc001tia.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|breast(2)	4						c.(2116-2118)GTG>GTA		down-regulated in metastasis							120.0	116.0	117.0					12																	101702085		2203	4300	6503	SO:0001819	synonymous_variant	27340				endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|negative regulation of cell proliferation	90S preribosome|cytoplasm|nucleolus|nucleoplasm|preribosome, small subunit precursor|small-subunit processome	protein binding	g.chr12:101702085G>A	AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.2118G>A	12.37:g.101702085G>A							p.V706V	NM_014503	NP_055318	O75691	UTP20_HUMAN			18	2274	+			706					Q9H3H4	Silent	SNP	ENST00000261637.4	37	c.2118G>A	CCDS9081.1																																																																																				0.388	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408242.1	NM_014503		47	100	0	0	0	0.01441	0	47	100				
C12orf42	374470	broad.mit.edu	37	12	103700057	103700057	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr12:103700057A>T	ENST00000378113.2	-	5	551	c.326T>A	c.(325-327)gTc>gAc	p.V109D	C12orf42_ENST00000548048.1_Missense_Mutation_p.V42D|C12orf42_ENST00000548883.1_Missense_Mutation_p.V109D|C12orf42_ENST00000315192.8_Intron|C12orf42_ENST00000548789.1_5'UTR	NM_001099336.1	NP_001092806.1	Q96LP6	CL042_HUMAN	chromosome 12 open reading frame 42	109								p.V109D(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)	22						ACACCTGGGGACTATGTACTG	0.403																																							uc001tjt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(325-327)GTC>GAC		hypothetical protein LOC374470							61.0	62.0	61.0					12																	103700057		1833	4086	5919	SO:0001583	missense	374470							g.chr12:103700057A>T	AK058052	CCDS44963.1	12q23.2	2012-05-30			ENSG00000179088	ENSG00000179088			24729	protein-coding gene	gene with protein product							Standard	NM_001099336		Approved	FLJ25323	uc001tjt.2	Q96LP6	OTTHUMG00000169988	ENST00000378113.2:c.326T>A	12.37:g.103700057A>T	ENSP00000367353:p.Val109Asp					C12orf42_uc001tjs.2_Intron|C12orf42_uc009zuf.1_Missense_Mutation_p.V109D|C12orf42_uc001tju.2_Missense_Mutation_p.V14D	p.V109D	NM_198521	NP_940923	Q96LP6	CL042_HUMAN			5	414	-			109					Q49A64|Q4G0S2	Missense_Mutation	SNP	ENST00000378113.2	37	c.326T>A	CCDS44963.1	.	.	.	.	.	.	.	.	.	.	A	11.71	1.720497	0.30503	.	.	ENSG00000179088	ENST00000548883;ENST00000548048;ENST00000378113;ENST00000552578	T;T;T;T	0.52754	0.65;0.65;0.65;0.65	4.2	1.84	0.25277	.	2.748860	0.01888	N	0.038372	T	0.37183	0.0994	N	0.19112	0.55	0.09310	N	0.999992	P	0.49090	0.919	B	0.42916	0.402	T	0.32188	-0.9916	10	0.87932	D	0	-0.4747	5.9112	0.19029	0.7907:0.0:0.2093:0.0	.	109	Q96LP6	CL042_HUMAN	D	109;42;109;109	ENSP00000447908:V109D;ENSP00000449362:V42D;ENSP00000367353:V109D;ENSP00000447795:V109D	ENSP00000367353:V109D	V	-	2	0	C12orf42	102224187	0.681000	0.27614	0.175000	0.22980	0.075000	0.17131	1.024000	0.30077	0.407000	0.25591	0.449000	0.29647	GTC		0.403	C12orf42-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406754.1	NM_198521		9	25	0	0	0	0.004482	0	9	25				
SLC41A2	84102	broad.mit.edu	37	12	105321916	105321916	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr12:105321916T>A	ENST00000258538.3	-	1	517	c.390A>T	c.(388-390)ttA>ttT	p.L130F		NM_032148.3	NP_115524.3	Q96JW4	S41A2_HUMAN	solute carrier family 41 (magnesium transporter), member 2	130					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)	p.L130F(1)|p.L47F(1)		breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	22						CTTCATCTTGTAACATGGCAG	0.403																																					Esophageal Squamous(195;176 2919 4272 35572)	Esophageal Squamous(195;176 2919 4272 35572)	uc001tla.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|skin(1)	2						c.(388-390)TTA>TTT		solute carrier family 41, member 2							210.0	202.0	205.0					12																	105321916		2203	4300	6503	SO:0001583	missense	84102					integral to membrane|plasma membrane	magnesium ion transmembrane transporter activity	g.chr12:105321916T>A	BC036734	CCDS9100.2	12q24.11	2013-07-17	2013-07-17		ENSG00000136052	ENSG00000136052		"""Solute carriers"""	31045	protein-coding gene	gene with protein product		610802	"""solute carrier family 41, member 2"""				Standard	NM_032148		Approved	DKFZP434K0427	uc001tla.3	Q96JW4	OTTHUMG00000156965	ENST00000258538.3:c.390A>T	12.37:g.105321916T>A	ENSP00000258538:p.Leu130Phe						p.L130F	NM_032148	NP_115524	Q96JW4	S41A2_HUMAN			1	557	-			130			Extracellular.		Q3KP68|Q9H0E5	Missense_Mutation	SNP	ENST00000258538.3	37	c.390A>T	CCDS9100.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.52|19.52	3.842166|3.842166	0.71488|0.71488	.|.	.|.	ENSG00000136052|ENSG00000136052	ENST00000258538;ENST00000415674|ENST00000437220	T;T|.	0.30182|.	1.54;1.54|.	6.13|6.13	-0.556|-0.556	0.11803|0.11803	.|.	0.160682|.	0.42682|.	D|.	0.000677|.	T|T	0.66386|0.66386	0.2784|0.2784	L|L	0.61387|0.61387	1.9|1.9	0.50813|0.50813	D|D	0.999893|0.999893	D|.	0.76494|.	0.999|.	D|.	0.85130|.	0.997|.	T|T	0.62941|0.62941	-0.6747|-0.6747	10|5	0.48119|.	T|.	0.1|.	-9.8038|-9.8038	13.2073|13.2073	0.59805|0.59805	0.0:0.6229:0.0:0.3771|0.0:0.6229:0.0:0.3771	.|.	130|.	Q96JW4|.	S41A2_HUMAN|.	F|F	130|22	ENSP00000258538:L130F;ENSP00000396429:L130F|.	ENSP00000258538:L130F|.	L|Y	-|-	3|2	2|0	SLC41A2|SLC41A2	103846046|103846046	0.387000|0.387000	0.25188|0.25188	0.899000|0.899000	0.35326|0.35326	0.976000|0.976000	0.68499|0.68499	-0.421000|-0.421000	0.07053|0.07053	-0.307000|-0.307000	0.08804|0.08804	0.529000|0.529000	0.55759|0.55759	TTA|TAC		0.403	SLC41A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346850.3	NM_032148		117	176	0	0	0	0.01441	0	117	176				
ISCU	23479	broad.mit.edu	37	12	108959109	108959109	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr12:108959109G>A	ENST00000311893.9	+	3	263	c.241G>A	c.(241-243)Gaa>Aaa	p.E81K	ISCU_ENST00000539593.1_Missense_Mutation_p.E81K|ISCU_ENST00000535729.1_Missense_Mutation_p.E81K|ISCU_ENST00000392807.4_Missense_Mutation_p.E56K|ISCU_ENST00000547005.1_Missense_Mutation_p.E81K|ISCU_ENST00000338291.4_Missense_Mutation_p.E56K|ISCU_ENST00000431221.2_Missense_Mutation_p.E81K	NM_213595.2	NP_998760.1	Q9H1K1	ISCU_HUMAN	iron-sulfur cluster assembly enzyme	81					iron-sulfur cluster assembly (GO:0016226)|nitrogen fixation (GO:0009399)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	iron ion binding (GO:0005506)|iron-sulfur cluster binding (GO:0051536)|protein complex scaffold (GO:0032947)	p.E56K(1)		kidney(2)|large_intestine(2)|lung(4)|prostate(2)|urinary_tract(1)	11						TCAAGTGGATGAAAAGGGGAA	0.493																																							uc010sxc.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(241-243)GAA>AAA		iron-sulfur cluster assembly enzyme isoform							125.0	124.0	124.0					12																	108959109		2203	4300	6503	SO:0001583	missense	23479				iron-sulfur cluster assembly|nitrogen fixation	cytosol|mitochondrion|nucleus	iron ion binding|iron-sulfur cluster binding|protein complex scaffold	g.chr12:108959109G>A	U47101	CCDS9118.1, CCDS44966.1, CCDS73518.1	12q24.1	2013-08-05	2013-08-05	2006-10-24	ENSG00000136003	ENSG00000136003			29882	protein-coding gene	gene with protein product		611911	"""NifU-like N-terminal domain containing"", ""IscU iron-sulfur cluster scaffold homolog (E. coli)"", ""iron-sulfur cluster scaffold homolog (E. coli)"""	NIFUN		8875867, 11060020	Standard	XM_005268760		Approved	ISU2, hnifU, IscU	uc010sxc.2	Q9H1K1	OTTHUMG00000168420	ENST00000311893.9:c.241G>A	12.37:g.108959109G>A	ENSP00000310623:p.Glu81Lys					ISCU_uc010sxa.1_Missense_Mutation_p.E81K|ISCU_uc010sxb.1_Missense_Mutation_p.E81K|ISCU_uc001tnc.3_Missense_Mutation_p.E56K|ISCU_uc009zuy.2_Missense_Mutation_p.E56K|ISCU_uc010sxd.1_Missense_Mutation_p.E81K	p.E81K	NM_213595	NP_998760	Q9H1K1	ISCU_HUMAN			3	346	+			81					Q6P713|Q99617|Q9H1K2	Missense_Mutation	SNP	ENST00000311893.9	37	c.241G>A	CCDS44966.1	.	.	.	.	.	.	.	.	.	.	G	18.43	3.622582	0.66787	.	.	ENSG00000136003	ENST00000535729;ENST00000431221;ENST00000547005;ENST00000311893;ENST00000392807;ENST00000338291;ENST00000539593	T;T;T;T;T;T;T	0.78364	-1.0;-1.0;-1.0;-1.0;-1.17;-1.0;-1.0	5.53	5.53	0.82687	NIF system FeS cluster assembly, NifU, N-terminal (1);	0.423547	0.30085	N	0.010441	T	0.72851	0.3512	L	0.49126	1.545	0.48452	D	0.999655	B;B;B;B;B;B	0.24186	0.099;0.018;0.024;0.081;0.009;0.001	B;B;B;B;B;B	0.28011	0.085;0.067;0.058;0.051;0.02;0.01	T	0.69599	-0.5102	10	0.44086	T	0.13	.	11.6755	0.51427	0.0823:0.0:0.9177:0.0	.	81;81;81;81;56;56	B3KQ30;Q9H1K1;B4DNC9;F5H5N2;B1P7G3;Q9H1K1-2	.;ISCU_HUMAN;.;.;.;.	K	81;81;81;81;56;56;81	ENSP00000445598:E81K;ENSP00000411108:E81K;ENSP00000446606:E81K;ENSP00000310623:E81K;ENSP00000376554:E56K;ENSP00000344584:E56K;ENSP00000443272:E81K	ENSP00000310623:E81K	E	+	1	0	ISCU	107483238	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	4.968000	0.63728	2.603000	0.88011	0.655000	0.94253	GAA		0.493	ISCU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399693.1	NM_014301		22	65	0	0	0	0.009535	0	22	65				
MYO1H	283446	broad.mit.edu	37	12	109853404	109853404	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr12:109853404G>T	ENST00000431443.2	+	14	1558	c.1558G>T	c.(1558-1560)Gag>Tag	p.E520*	MYO1H_ENST00000310903.5_Nonsense_Mutation_p.E510*	NM_001101421.3	NP_001094891.3	Q8N1T3	MYO1H_HUMAN	myosin IH	520	Myosin motor.					myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.E510*(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(17)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	47						CTATGCAGGAGAGGTCACATA	0.552																																							uc010sxn.1		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(1528-1530)GAG>TAG		myosin 1H							45.0	47.0	46.0					12																	109853404		2033	4199	6232	SO:0001587	stop_gained	283446					myosin complex	motor activity	g.chr12:109853404G>T		CCDS53826.1	12q24.11	2011-09-27			ENSG00000174527	ENSG00000174527		"""Myosins / Myosin superfamily : Class I"""	13879	protein-coding gene	gene with protein product		614636					Standard	NM_001101421		Approved	FLJ37587	uc010sxn.1	Q8N1T3	OTTHUMG00000169252	ENST00000431443.2:c.1558G>T	12.37:g.109853404G>T	ENSP00000444076:p.Glu520*						p.E510*	NM_001101421	NP_001094891	Q8N1T3	MYO1H_HUMAN			14	1528	+			Error:Variant_position_missing_in_B4DNW6_after_alignment					F5H3C6	Nonsense_Mutation	SNP	ENST00000431443.2	37	c.1528G>T		.	.	.	.	.	.	.	.	.	.	G	37	6.010466	0.97200	.	.	ENSG00000174527	ENST00000310903;ENST00000431443	.	.	.	5.35	5.35	0.76521	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18276	T	0.48	.	17.609	0.88047	0.0:0.0:1.0:0.0	.	.	.	.	X	510;520	.	ENSP00000439182:E510X	E	+	1	0	MYO1H	108337787	1.000000	0.71417	0.979000	0.43373	0.380000	0.30137	9.031000	0.93731	2.498000	0.84270	0.655000	0.94253	GAG		0.552	MYO1H-201	KNOWN	basic	protein_coding	protein_coding		NM_173597		7	10	1	0	0.00307968	0.00308	0.00318038	7	10				
HECTD4	283450	broad.mit.edu	37	12	112622801	112622801	+	Silent	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr12:112622801G>T	ENST00000430131.2	-	60	9848	c.8703C>A	c.(8701-8703)tcC>tcA	p.S2901S	HECTD4_ENST00000377560.5_Silent_p.S3151S|HECTD4_ENST00000550722.1_Silent_p.S3177S			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	2901	Ser-rich.				glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.S2901S(1)|p.S3151S(1)									TGCCCGACGAGGAGGCCTTTT	0.632																																							uc009zwc.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)|lung(1)	2						c.(8701-8703)TCC>TCA		chromosome 12 open reading frame 51							28.0	31.0	30.0					12																	112622801		2157	4232	6389	SO:0001819	synonymous_variant	283450							g.chr12:112622801G>T	AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.8703C>A	12.37:g.112622801G>T							p.S2901S	NM_001109662	NP_001103132					54	8721	-								L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Silent	SNP	ENST00000430131.2	37	c.8703C>A																																																																																					0.632	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813		4	14	1	0	3.09899e-07	0.004482	3.36537e-07	4	14				
MED13L	23389	broad.mit.edu	37	12	116413452	116413452	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr12:116413452G>A	ENST00000281928.3	-	24	5662	c.5456C>T	c.(5455-5457)gCg>gTg	p.A1819V		NM_015335.4	NP_056150.1	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	1819						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.A1819V(1)		NS(2)|breast(1)|endometrium(9)|kidney(3)|large_intestine(18)|lung(34)|ovary(4)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	85	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		TTTCTGGCTCGCCTCACCAAA	0.522																																							uc001tvw.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(4)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	8						c.(5455-5457)GCG>GTG		mediator complex subunit 13-like							108.0	108.0	108.0					12																	116413452		2203	4300	6503	SO:0001583	missense	23389				regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent			g.chr12:116413452G>A	AB028948	CCDS9177.1	12q24.22	2010-07-29	2007-07-30	2007-07-30	ENSG00000123066	ENSG00000123066			22962	protein-coding gene	gene with protein product		608771	"""thyroid hormone receptor associated protein 2"""	THRAP2			Standard	NM_015335		Approved	KIAA1025, TRAP240L	uc001tvw.3	Q71F56	OTTHUMG00000169404	ENST00000281928.3:c.5456C>T	12.37:g.116413452G>A	ENSP00000281928:p.Ala1819Val						p.A1819V	NM_015335	NP_056150	Q71F56	MD13L_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.0407)	24	5511	-	all_neural(191;0.117)|Medulloblastoma(191;0.163)		1819					A1L469|Q68DN4|Q9H8C0|Q9NSY9|Q9UFD8|Q9UPX5	Missense_Mutation	SNP	ENST00000281928.3	37	c.5456C>T	CCDS9177.1	.	.	.	.	.	.	.	.	.	.	G	32	5.171216	0.94807	.	.	ENSG00000123066	ENST00000281928	D	0.82619	-1.63	5.87	5.87	0.94306	.	0.103852	0.64402	D	0.000002	D	0.88959	0.6579	M	0.70595	2.14	0.54753	D	0.999985	D	0.67145	0.996	P	0.55011	0.766	D	0.88091	0.2813	10	0.51188	T	0.08	.	20.5827	0.99408	0.0:0.0:1.0:0.0	.	1819	Q71F56	MD13L_HUMAN	V	1819	ENSP00000281928:A1819V	ENSP00000281928:A1819V	A	-	2	0	MED13L	114897835	1.000000	0.71417	0.975000	0.42487	0.993000	0.82548	6.001000	0.70685	2.941000	0.99782	0.655000	0.94253	GCG		0.522	MED13L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403879.3			25	54	0	0	0	0.005443	0	25	54				
MLXIP	22877	broad.mit.edu	37	12	122625515	122625515	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr12:122625515C>G	ENST00000319080.7	+	16	2655	c.2523C>G	c.(2521-2523)atC>atG	p.I841M	MLXIP_ENST00000538698.1_Missense_Mutation_p.I448M					MLX interacting protein									p.I841M(1)		NS(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)	20	all_neural(191;0.0837)|Medulloblastoma(191;0.163)	Lung NSC(355;0.0659)		OV - Ovarian serous cystadenocarcinoma(86;0.000599)|Epithelial(86;0.00102)|BRCA - Breast invasive adenocarcinoma(302;0.233)		GCATCATCATCAAGCCGCTGT	0.597																																					Esophageal Squamous(105;787 1493 16200 18566 52466)	Esophageal Squamous(105;787 1493 16200 18566 52466)	uc001ubq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(2521-2523)ATC>ATG		MLX interacting protein							98.0	103.0	102.0					12																	122625515		2138	4263	6401	SO:0001583	missense	22877				regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrial outer membrane|nucleus	DNA binding	g.chr12:122625515C>G	AB020674	CCDS73540.1	12q21.31	2013-05-21				ENSG00000175727		"""Basic helix-loop-helix proteins"""	17055	protein-coding gene	gene with protein product		608090				10048485, 11073985	Standard	XM_006719290		Approved	MONDOA, KIAA0867, MIR, bHLHe36	uc001ubq.3	Q9HAP2		ENST00000319080.7:c.2523C>G	12.37:g.122625515C>G	ENSP00000312834:p.Ile841Met					MLXIP_uc001ubt.2_Missense_Mutation_p.I448M	p.I841M	NM_014938	NP_055753	Q9HAP2	MLXIP_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000599)|Epithelial(86;0.00102)|BRCA - Breast invasive adenocarcinoma(302;0.233)	16	2523	+	all_neural(191;0.0837)|Medulloblastoma(191;0.163)	Lung NSC(355;0.0659)	841			Mediates heterotypic interactions between MLXIP and MLX and is required for cytoplasmic localization.			Missense_Mutation	SNP	ENST00000319080.7	37	c.2523C>G		.	.	.	.	.	.	.	.	.	.	C	11.94	1.788868	0.31685	.	.	ENSG00000175727	ENST00000319080;ENST00000538698	T;T	0.26223	2.41;1.75	5.51	2.63	0.31362	.	0.050739	0.85682	D	0.000000	T	0.30135	0.0755	.	.	.	0.80722	D	1	D	0.57899	0.981	P	0.55161	0.77	T	0.14172	-1.0482	9	0.38643	T	0.18	-17.532	1.2222	0.01926	0.1589:0.431:0.1547:0.2554	.	841	Q9HAP2	MLXIP_HUMAN	M	841;448	ENSP00000312834:I841M;ENSP00000440769:I448M	ENSP00000312834:I841M	I	+	3	3	MLXIP	121191468	0.908000	0.30866	1.000000	0.80357	0.034000	0.12701	0.246000	0.18160	0.270000	0.21984	-1.108000	0.02087	ATC		0.597	MLXIP-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000401718.2	NM_014938		33	41	0	0	0	0.01441	0	33	41				
IL31	386653	broad.mit.edu	37	12	122657100	122657100	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr12:122657100A>T	ENST00000377035.1	-	3	380	c.354T>A	c.(352-354)gaT>gaA	p.D118E		NM_001014336.1	NP_001014358.1	Q6EBC2	IL31_HUMAN	interleukin 31	118					immune system process (GO:0002376)	extracellular space (GO:0005615)		p.D118E(1)		central_nervous_system(2)|kidney(1)|large_intestine(4)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	13	all_neural(191;0.0837)|Medulloblastoma(191;0.163)	Lung NSC(355;6.93e-05)|Breast(359;0.0544)		OV - Ovarian serous cystadenocarcinoma(86;3.27e-29)|Epithelial(86;4.86e-27)|BRCA - Breast invasive adenocarcinoma(302;0.223)		TTTCTGGTGCATCTTGAAATA	0.438																																							uc001ubv.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(352-354)GAT>GAA		interleukin 31 precursor							236.0	201.0	213.0					12																	122657100		2203	4300	6503	SO:0001583	missense	386653					extracellular space	cytokine activity	g.chr12:122657100A>T	AY499343	CCDS31919.1	12q24.31	2011-07-21			ENSG00000204671	ENSG00000204671		"""Interleukins and interleukin receptors"""	19372	protein-coding gene	gene with protein product		609509				15184896	Standard	NM_001014336		Approved	IL-31	uc001ubv.3	Q6EBC2	OTTHUMG00000168916	ENST00000377035.1:c.354T>A	12.37:g.122657100A>T	ENSP00000366234:p.Asp118Glu					LRRC43_uc001ubw.3_Intron|LRRC43_uc009zxl.1_Intron	p.D118E	NM_001014336	NP_001014358	Q6EBC2	IL31_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;3.27e-29)|Epithelial(86;4.86e-27)|BRCA - Breast invasive adenocarcinoma(302;0.223)	3	381	-	all_neural(191;0.0837)|Medulloblastoma(191;0.163)	Lung NSC(355;6.93e-05)|Breast(359;0.0544)	118					A2RUQ1	Missense_Mutation	SNP	ENST00000377035.1	37	c.354T>A	CCDS31919.1	.	.	.	.	.	.	.	.	.	.	A	13.24	2.177431	0.38413	.	.	ENSG00000204671	ENST00000377035	.	.	.	4.18	2.0	0.26442	.	1.844810	0.02806	N	0.123700	T	0.21881	0.0527	N	0.14661	0.345	0.09310	N	1	P	0.41450	0.75	B	0.41917	0.37	T	0.14755	-1.0461	9	0.39692	T	0.17	-4.9431	4.8026	0.13305	0.3657:0.0:0.6343:0.0	.	118	Q6EBC2	IL31_HUMAN	E	118	.	ENSP00000366234:D118E	D	-	3	2	IL31	121223053	0.000000	0.05858	0.000000	0.03702	0.487000	0.33371	-2.383000	0.01063	0.474000	0.27392	0.460000	0.39030	GAT		0.438	IL31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401594.1	NM_001014336		68	115	0	0	0	0.01441	0	68	115				
POLE	5426	broad.mit.edu	37	12	133237666	133237666	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr12:133237666C>G	ENST00000320574.5	-	25	2992	c.2949G>C	c.(2947-2949)aaG>aaC	p.K983N	POLE_ENST00000535270.1_Missense_Mutation_p.K956N	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	983					base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)	p.K983N(2)		NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	ATTGGAAGATCTTAATCAGCT	0.517								DNA polymerases (catalytic subunits)																															uc001uks.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8						c.(2947-2949)AAG>AAC	DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage	DNA-directed DNA polymerase epsilon							182.0	183.0	183.0					12																	133237666		2203	4300	6503	SO:0001583	missense	5426				base-excision repair, gap-filling|DNA synthesis involved in DNA repair|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	chromatin binding|DNA binding|DNA-directed DNA polymerase activity|nucleotide binding|protein binding|zinc ion binding	g.chr12:133237666C>G		CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.2949G>C	12.37:g.133237666C>G	ENSP00000322570:p.Lys983Asn					POLE_uc001ukr.1_5'Flank|POLE_uc010tbq.1_RNA|POLE_uc009zyu.1_Missense_Mutation_p.K956N	p.K983N	NM_006231	NP_006222	Q07864	DPOE1_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	25	2993	-	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)	983					Q13533|Q86VH9	Missense_Mutation	SNP	ENST00000320574.5	37	c.2949G>C	CCDS9278.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.171111	0.78452	.	.	ENSG00000177084	ENST00000320574;ENST00000455752;ENST00000535270;ENST00000539006;ENST00000376577	T;T;T;T	0.23147	1.92;1.92;1.92;1.92	5.27	-4.09	0.03951	DNA-directed DNA polymerase, family B, multifunctional domain (1);	0.000000	0.85682	D	0.000000	T	0.58680	0.2139	H	0.95712	3.71	0.58432	D	0.999993	D;D	0.62365	0.991;0.985	D;D	0.72338	0.961;0.977	T	0.74269	-0.3720	10	0.87932	D	0	.	17.3757	0.87391	0.0:0.8688:0.0:0.1312	.	956;983	F5H1D6;Q07864	.;DPOE1_HUMAN	N	983;994;956;763;918	ENSP00000322570:K983N;ENSP00000406383:K994N;ENSP00000445753:K956N;ENSP00000442519:K763N	ENSP00000322570:K983N	K	-	3	2	POLE	131747739	1.000000	0.71417	0.986000	0.45419	0.992000	0.81027	0.915000	0.28638	-0.679000	0.05217	0.591000	0.81541	AAG		0.517	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397689.2	NM_006231		120	228	0	0	0	0.01441	0	120	228				
DIS3	22894	broad.mit.edu	37	13	73346338	73346338	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr13:73346338C>T	ENST00000377767.4	-	10	1562	c.1462G>A	c.(1462-1464)Gat>Aat	p.D488N	DIS3_ENST00000545453.1_Missense_Mutation_p.D326N|DIS3_ENST00000377780.4_Missense_Mutation_p.D458N	NM_014953.3	NP_055768.3	Q9Y2L1	RRP44_HUMAN	DIS3 exosome endoribonuclease and 3'-5' exoribonuclease	488					CUT catabolic process (GO:0071034)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of GTPase activity (GO:0043547)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|endonuclease activity (GO:0004519)|guanyl-nucleotide exchange factor activity (GO:0005085)|RNA binding (GO:0003723)	p.D488N(4)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(7)|kidney(5)|large_intestine(10)|lung(6)|prostate(2)|skin(1)	35		Breast(118;0.0074)|Acute lymphoblastic leukemia(28;0.0195)		GBM - Glioblastoma multiforme(99;0.000181)		TGTAGAGCATCGTCTATATCA	0.363										Multiple Myeloma(4;0.011)																													uc001vix.3		NA																	4	Substitution - Missense(4)		haematopoietic_and_lymphoid_tissue(3)|lung(1)	central_nervous_system(1)	1						c.(1462-1464)GAT>AAT		DIS3 mitotic control isoform a							114.0	113.0	113.0					13																	73346338		2203	4300	6503	SO:0001583	missense	22894				CUT catabolic process|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|rRNA catabolic process|rRNA processing	cytosol|exosome (RNase complex)|nucleolus|nucleoplasm	3'-5'-exoribonuclease activity|endonuclease activity|guanyl-nucleotide exchange factor activity|protein binding|RNA binding	g.chr13:73346338C>T	AB023225	CCDS9447.1, CCDS45057.1	13q21.32	2014-03-05	2014-03-05	2007-01-12	ENSG00000083520	ENSG00000083520			20604	protein-coding gene	gene with protein product	"""exosome component 11"""	607533	"""KIAA1008"", ""DIS3 mitotic control homolog (S. cerevisiae)"""	KIAA1008		11935316, 9562621	Standard	XM_005266294		Approved	dis3p, RRP44, EXOSC11	uc001vix.4	Q9Y2L1	OTTHUMG00000017070	ENST00000377767.4:c.1462G>A	13.37:g.73346338C>T	ENSP00000366997:p.Asp488Asn	Multiple Myeloma(4;0.011)				DIS3_uc001viy.3_Missense_Mutation_p.D458N|DIS3_uc001viz.2_RNA	p.D488N	NM_014953	NP_055768	Q9Y2L1	RRP44_HUMAN		GBM - Glioblastoma multiforme(99;0.000181)	10	1836	-		Breast(118;0.0074)|Acute lymphoblastic leukemia(28;0.0195)	488					A6NI21|B2RBL2|Q5W0P7|Q5W0P8|Q658Z7|Q7Z481|Q8WWI2|Q9UG36	Missense_Mutation	SNP	ENST00000377767.4	37	c.1462G>A	CCDS9447.1	.	.	.	.	.	.	.	.	.	.	C	34	5.396850	0.96009	.	.	ENSG00000083520	ENST00000377767;ENST00000377780;ENST00000545453	T;T;T	0.65549	-0.16;-0.16;-0.16	5.48	5.48	0.80851	Ribonuclease II/R (2);	0.000000	0.85682	D	0.000000	D	0.89511	0.6736	H	0.99740	4.74	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.93998	0.7273	10	0.87932	D	0	.	19.3194	0.94231	0.0:1.0:0.0:0.0	.	458;488	Q9Y2L1-2;Q9Y2L1	.;RRP44_HUMAN	N	488;458;326	ENSP00000366997:D488N;ENSP00000367011:D458N;ENSP00000440058:D326N	ENSP00000366997:D488N	D	-	1	0	DIS3	72244339	1.000000	0.71417	1.000000	0.80357	0.852000	0.48524	6.008000	0.70739	2.722000	0.93159	0.563000	0.77884	GAT		0.363	DIS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045250.2	NM_014953		15	39	0	0	0	0.004007	0	15	39				
OR11H6	122748	broad.mit.edu	37	14	20692096	20692096	+	Silent	SNP	C	C	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr14:20692096C>A	ENST00000315519.2	+	1	306	c.228C>A	c.(226-228)ccC>ccA	p.P76P		NM_001004480.1	NP_001004480.1	Q8NGC7	O11H6_HUMAN	olfactory receptor, family 11, subfamily H, member 6	76						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P76P(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(13)|ovary(2)|prostate(1)|skin(2)	29	all_cancers(95;0.00108)		Epithelial(56;1.75e-06)|all cancers(55;1.22e-05)	GBM - Glioblastoma multiforme(265;0.0143)		TCCACACACCCATGTACATCC	0.463																																							uc010tlc.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(1)	3						c.(226-228)CCC>CCA		olfactory receptor, family 11, subfamily H,							117.0	105.0	109.0					14																	20692096		2203	4300	6503	SO:0001819	synonymous_variant	122748				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20692096C>A		CCDS32033.1	14q11.2	2013-09-24			ENSG00000176219	ENSG00000176219		"""GPCR / Class A : Olfactory receptors"""	15349	protein-coding gene	gene with protein product							Standard	NM_001004480		Approved		uc010tlc.2	Q8NGC7	OTTHUMG00000170850	ENST00000315519.2:c.228C>A	14.37:g.20692096C>A							p.P76P	NM_001004480	NP_001004480	Q8NGC7	O11H6_HUMAN	Epithelial(56;1.75e-06)|all cancers(55;1.22e-05)	GBM - Glioblastoma multiforme(265;0.0143)	1	228	+	all_cancers(95;0.00108)		76			Helical; Name=2; (Potential).		Q6IF08	Silent	SNP	ENST00000315519.2	37	c.228C>A	CCDS32033.1																																																																																				0.463	OR11H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410676.1			31	101	1	0	6.38683e-12	0.008361	7.5644e-12	31	101				
RNASE12	493901	broad.mit.edu	37	14	21058864	21058864	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr14:21058864T>C	ENST00000556526.1	-	1	118	c.19A>G	c.(19-21)Att>Gtt	p.I7V	RNASE11_ENST00000555841.1_5'Flank|RP11-14J7.6_ENST00000554006.1_RNA|RNASE11_ENST00000553849.1_5'Flank|RP11-14J7.6_ENST00000554529.1_RNA|RNASE11_ENST00000398008.2_5'Flank|RP11-14J7.6_ENST00000556487.1_RNA|RNASE11_ENST00000432835.2_5'Flank|RNASE11_ENST00000555283.1_Missense_Mutation_p.I7V|RNASE11_ENST00000398009.2_5'Flank|RP11-14J7.6_ENST00000553604.1_RNA|RP11-14J7.6_ENST00000554993.1_RNA|RNASE11_ENST00000610205.1_5'Flank	NM_001024822.2	NP_001019993.1	Q5GAN4	RNS12_HUMAN	ribonuclease, RNase A family, 12 (non-active)	7						extracellular region (GO:0005576)	nucleic acid binding (GO:0003676)	p.I7V(1)		kidney(1)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8	all_cancers(95;0.00238)		Epithelial(56;1.85e-06)|all cancers(55;1.46e-05)	GBM - Glioblastoma multiforme(265;0.013)		ACCAAGAAAATTATCACCATT	0.413																																							uc001vxt.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)	2						c.(19-21)ATT>GTT		ribonuclease, RNase A family, 12 (non-active)							129.0	120.0	123.0					14																	21058864		2203	4300	6503	SO:0001583	missense	493901					extracellular region	nucleic acid binding|pancreatic ribonuclease activity	g.chr14:21058864T>C		CCDS32037.1	14q11.1	2012-10-05			ENSG00000258436	ENSG00000258436		"""Ribonucleases, RNase A"""	24211	protein-coding gene	gene with protein product							Standard	NM_001024822		Approved		uc001vxt.3	Q5GAN4	OTTHUMG00000170991	ENST00000556526.1:c.19A>G	14.37:g.21058864T>C	ENSP00000450580:p.Ile7Val					RNASE11_uc010ahv.2_5'Flank|RNASE11_uc010ahx.2_5'Flank|RNASE11_uc010ahw.2_5'Flank|RNASE11_uc001vxs.2_5'Flank|uc001vxu.1_RNA	p.I7V	NM_001024822	NP_001019993	Q5GAN4	RNS12_HUMAN	Epithelial(56;1.85e-06)|all cancers(55;1.46e-05)	GBM - Glioblastoma multiforme(265;0.013)	1	119	-	all_cancers(95;0.00238)		7						Missense_Mutation	SNP	ENST00000556526.1	37	c.19A>G	CCDS32037.1	.	.	.	.	.	.	.	.	.	.	T	9.836	1.189631	0.21954	.	.	ENSG00000258436;ENSG00000206171	ENST00000556526;ENST00000382999	T;T	0.71698	-0.59;-0.59	5.33	-4.31	0.03698	Ribonuclease A, domain (1);	0.883333	0.09858	N	0.746580	T	0.47893	0.1470	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.31392	-0.9945	10	0.42905	T	0.14	-6.5342	8.1307	0.31024	0.0:0.4926:0.1358:0.3716	.	7	Q5GAN4	RNS12_HUMAN	V	7	ENSP00000450580:I7V;ENSP00000372460:I7V	ENSP00000372460:I7V	I	-	1	0	RNASE12;AL163195.1	20128704	0.036000	0.19791	0.009000	0.14445	0.875000	0.50365	-0.122000	0.10627	-0.652000	0.05408	-0.256000	0.11100	ATT		0.413	RNASE12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411107.1			70	65	0	0	0	0.01441	0	70	65				
EDDM3B	64184	broad.mit.edu	37	14	21238647	21238647	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr14:21238647G>T	ENST00000326783.3	+	2	436	c.338G>T	c.(337-339)aGc>aTc	p.S113I		NM_022360.4	NP_071755.1	P56851	EP3B_HUMAN	epididymal protein 3B	113						extracellular region (GO:0005576)		p.S113I(1)		central_nervous_system(1)|kidney(1)|lung(3)|ovary(1)|skin(1)	7						TCCAAAAATAGCTACACAGAG	0.438																																							uc001vyd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(337-339)AGC>ATC		human epididymis-specific 3 beta precursor							79.0	73.0	75.0					14																	21238647		2203	4300	6503	SO:0001583	missense	64184				spermatid development	extracellular region		g.chr14:21238647G>T	X76386	CCDS9557.1	14q11.1	2010-03-19	2010-01-27	2010-01-27	ENSG00000181552	ENSG00000181552			19223	protein-coding gene	gene with protein product		611582	"""family with sequence similarity 12, member B (epididymal)"""	FAM12B		7514008	Standard	NM_022360		Approved	HE3-BETA	uc001vyd.3	P56851	OTTHUMG00000029583	ENST00000326783.3:c.338G>T	14.37:g.21238647G>T	ENSP00000314810:p.Ser113Ile						p.S113I	NM_022360	NP_071755	P56851	EP3B_HUMAN			2	436	+			113					A0PK89	Missense_Mutation	SNP	ENST00000326783.3	37	c.338G>T	CCDS9557.1	.	.	.	.	.	.	.	.	.	.	G	9.910	1.209276	0.22205	.	.	ENSG00000181552	ENST00000326783	T	0.73363	-0.74	3.98	2.09	0.27110	Ribonuclease A, domain (3);	1.689470	0.03140	N	0.166499	T	0.57873	0.2083	N	0.14661	0.345	0.09310	N	1	P	0.40970	0.734	B	0.37508	0.252	T	0.52801	-0.8527	10	0.46703	T	0.11	.	4.4163	0.11457	0.1185:0.0:0.6597:0.2218	.	113	P56851	EP3B_HUMAN	I	113	ENSP00000314810:S113I	ENSP00000314810:S113I	S	+	2	0	EDDM3B	20308487	0.001000	0.12720	0.006000	0.13384	0.365000	0.29674	-0.148000	0.10219	0.315000	0.23110	0.511000	0.50034	AGC		0.438	EDDM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073745.2			49	53	1	0	1.61004e-24	0.01441	2.18711e-24	49	53				
MYH7	4625	broad.mit.edu	37	14	23883231	23883231	+	Silent	SNP	G	G	C			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr14:23883231G>C	ENST00000355349.3	-	38	5802	c.5640C>G	c.(5638-5640)cgC>cgG	p.R1880R	CTD-2201G16.1_ENST00000557368.1_RNA	NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1880					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)	p.R1880R(1)		NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		CCTCGGCCTGGCGCTTGTAGG	0.652																																							uc001wjx.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|skin(1)	4						c.(5638-5640)CGC>CGG		myosin, heavy chain 7, cardiac muscle, beta							81.0	78.0	79.0					14																	23883231		2203	4300	6503	SO:0001819	synonymous_variant	4625				adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr14:23883231G>C	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.5640C>G	14.37:g.23883231G>C							p.R1880R	NM_000257	NP_000248	P12883	MYH7_HUMAN		GBM - Glioblastoma multiforme(265;0.00725)	38	5746	-	all_cancers(95;2.54e-05)		1880			Potential.		A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Silent	SNP	ENST00000355349.3	37	c.5640C>G	CCDS9601.1																																																																																				0.652	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257		13	63	0	0	0	0.012319	0	13	63				
NYNRIN	57523	broad.mit.edu	37	14	24884150	24884150	+	Silent	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr14:24884150G>T	ENST00000382554.3	+	9	3513	c.3195G>T	c.(3193-3195)ctG>ctT	p.L1065L		NM_025081.2	NP_079357.2	Q9P2P1	NYNRI_HUMAN	NYN domain and retroviral integrase containing	1065					DNA integration (GO:0015074)	integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)	p.L1065L(1)		breast(3)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(8)|lung(21)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	56						CTCCCTACCTGGGCATCCCCT	0.637																																							uc001wpf.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(3193-3195)CTG>CTT		hypothetical protein LOC57523							70.0	80.0	77.0					14																	24884150		2037	4188	6225	SO:0001819	synonymous_variant	57523				DNA integration	integral to membrane	DNA binding	g.chr14:24884150G>T	AB037726	CCDS45090.1	14q11.2	2009-10-14	2009-10-14	2009-10-14		ENSG00000205978			20165	protein-coding gene	gene with protein product	"""Cousin of GIN1"""		"""KIAA1305"""	KIAA1305		19561090, 17114934	Standard	NM_025081		Approved	FLJ11811, CGIN1	uc001wpf.4	Q9P2P1		ENST00000382554.3:c.3195G>T	14.37:g.24884150G>T							p.L1065L	NM_025081	NP_079357	Q9P2P1	NYNRI_HUMAN			9	3513	+			1065					Q6P153|Q86TR3|Q9HAC4	Silent	SNP	ENST00000382554.3	37	c.3195G>T	CCDS45090.1																																																																																				0.637	NYNRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412939.1			46	76	1	0	5.13769e-22	0.01441	6.85628e-22	46	76				
GZMB	3002	broad.mit.edu	37	14	25100341	25100341	+	Missense_Mutation	SNP	G	G	A	rs375750638		TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr14:25100341G>A	ENST00000216341.4	-	5	786	c.680C>T	c.(679-681)cCa>cTa	p.P227L	GZMB_ENST00000382540.1_Missense_Mutation_p.P182L|RP11-104E19.1_ENST00000557736.1_RNA|RP11-104E19.1_ENST00000555300.1_RNA|GZMB_ENST00000382542.1_Missense_Mutation_p.P261L|GZMB_ENST00000415355.3_Missense_Mutation_p.P215L			P10144	GRAB_HUMAN	granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1)	227	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				apoptotic process (GO:0006915)|cytolysis (GO:0019835)|intrinsic apoptotic signaling pathway (GO:0097193)|Notch signaling pathway (GO:0007219)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.P227L(1)|p.P261L(1)		endometrium(2)|large_intestine(1)|lung(4)|stomach(4)|urinary_tract(2)	13				GBM - Glioblastoma multiforme(265;0.028)		GCAGGCTCGTGGAGGCATGCC	0.498																																							uc001wps.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(679-681)CCA>CTA		granzyme B precursor							169.0	162.0	164.0					14																	25100341		2203	4300	6503	SO:0001583	missense	3002				activation of pro-apoptotic gene products|cleavage of lamin|cytolysis|induction of apoptosis by intracellular signals	cytosol|immunological synapse|nucleus	protein binding|serine-type endopeptidase activity	g.chr14:25100341G>A	BC030195	CCDS9633.1	14q11.2	2008-08-13			ENSG00000100453	ENSG00000100453			4709	protein-coding gene	gene with protein product	"""fragmentin 2"", ""cytotoxic serine protease B"", ""cathepsin G-like 1"", ""T-cell serine protease 1-3E"""	123910		CTLA1, CSPB		2323780	Standard	NM_004131		Approved	CCPI, CGL-1, CSP-B, CGL1, CTSGL1, HLP, SECT	uc001wps.2	P10144	OTTHUMG00000029369	ENST00000216341.4:c.680C>T	14.37:g.25100341G>A	ENSP00000216341:p.Pro227Leu					GZMB_uc010ama.2_Missense_Mutation_p.P215L|GZMB_uc010amb.2_RNA	p.P227L	NM_004131	NP_004122	P10144	GRAB_HUMAN		GBM - Glioblastoma multiforme(265;0.028)	5	746	-			227			Peptidase S1.		Q8N1D2|Q9UCC1	Missense_Mutation	SNP	ENST00000216341.4	37	c.680C>T	CCDS9633.1	.	.	.	.	.	.	.	.	.	.	g	19.83	3.900325	0.72754	.	.	ENSG00000100453	ENST00000415355;ENST00000216341;ENST00000382542;ENST00000382540;ENST00000382539	T;D;D;T	0.95137	-0.2;-3.62;-3.62;1.05	5.15	5.15	0.70609	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.34025	N	0.004334	D	0.97455	0.9167	M	0.89968	3.075	0.49915	D	0.999831	D;D	0.71674	0.995;0.998	P;D	0.70716	0.897;0.97	D	0.97715	1.0193	10	0.87932	D	0	.	14.31	0.66410	0.0:0.0:1.0:0.0	.	215;227	Q6XGZ4;P10144	.;GRAB_HUMAN	L	215;227;261;182;132	ENSP00000387385:P215L;ENSP00000216341:P227L;ENSP00000371982:P261L;ENSP00000371980:P182L	ENSP00000216341:P227L	P	-	2	0	GZMB	24170181	1.000000	0.71417	0.906000	0.35671	0.020000	0.10135	4.096000	0.57734	2.836000	0.97738	0.655000	0.94253	CCA		0.498	GZMB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276540.3	NM_004131		37	103	0	0	0	0.00623	0	37	103				
CTAGE5	4253	broad.mit.edu	37	14	39769164	39769164	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr14:39769164C>G	ENST00000280083.3	+	9	1083	c.769C>G	c.(769-771)Cta>Gta	p.L257V	CTAGE5_ENST00000341749.3_Missense_Mutation_p.L245V|CTAGE5_ENST00000341502.5_Missense_Mutation_p.L257V|CTAGE5_ENST00000556148.1_Missense_Mutation_p.L182V|CTAGE5_ENST00000348007.3_Missense_Mutation_p.L257V|RP11-407N17.3_ENST00000553728.1_Missense_Mutation_p.L792V|CTAGE5_ENST00000557038.1_Missense_Mutation_p.L177V|RP11-407N17.3_ENST00000603904.1_Missense_Mutation_p.L228V|CTAGE5_ENST00000553352.1_Missense_Mutation_p.L228V|CTAGE5_ENST00000396158.2_Missense_Mutation_p.L262V|CTAGE5_ENST00000396165.4_Missense_Mutation_p.L228V			O15320	CTGE5_HUMAN	CTAGE family, member 5	257					positive regulation of catalytic activity (GO:0043085)	membrane (GO:0016020)	enzyme activator activity (GO:0008047)	p.L257V(1)	CTAGE5/SIP1(2)	breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0475)		AGAACAAGTTCTAAATGATAA	0.338																																							uc001wvg.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(769-771)CTA>GTA		CTAGE family, member 5 isoform 1							155.0	165.0	162.0					14																	39769164		2203	4298	6501	SO:0001583	missense	4253						enzyme activator activity|protein binding	g.chr14:39769164C>G	U94780	CCDS9673.1, CCDS9674.1, CCDS9675.1, CCDS9676.1, CCDS58316.1, CCDS58317.1	14q21.1	2009-09-11	2004-08-24	2004-08-26	ENSG00000150527	ENSG00000150527			7057	protein-coding gene	gene with protein product		602132	"""meningioma expressed antigen 6 (coiled-coil proline-rich)"""	MGEA, MGEA6		9356211, 11149944	Standard	NM_203355		Approved	MEA6, cTAGE-5A, cTAGE-5B, cTAGE-5C, cTAGE-5D, MGEA11	uc001wvi.4	O15320	OTTHUMG00000140258	ENST00000280083.3:c.769C>G	14.37:g.39769164C>G	ENSP00000280083:p.Leu257Val					CTAGE5_uc010tqe.1_Missense_Mutation_p.L219V|CTAGE5_uc001wuz.3_Missense_Mutation_p.L245V|CTAGE5_uc001wuy.3_Missense_Mutation_p.L177V|CTAGE5_uc001wvb.3_Missense_Mutation_p.L228V|CTAGE5_uc001wvc.3_Missense_Mutation_p.L202V|CTAGE5_uc001wva.3_Missense_Mutation_p.L228V|CTAGE5_uc001wve.1_Missense_Mutation_p.L233V|CTAGE5_uc001wvh.3_Missense_Mutation_p.L257V|CTAGE5_uc001wvf.3_Missense_Mutation_p.L182V|CTAGE5_uc001wvi.3_Missense_Mutation_p.L262V|CTAGE5_uc010amz.2_5'UTR|CTAGE5_uc001wvj.3_Missense_Mutation_p.L228V	p.L257V	NM_005930	NP_005921	O15320	CTGE5_HUMAN	LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0475)	9	1105	+	Hepatocellular(127;0.213)		257			Potential.		B3KRA6|B4DQS6|D3DSA6|G3XAC5|O00169|Q6MZN2|Q6P2R8|Q86TF6|Q8IX92|Q8IX93	Missense_Mutation	SNP	ENST00000280083.3	37	c.769C>G	CCDS9674.1	.	.	.	.	.	.	.	.	.	.	C	15.87	2.959301	0.53400	.	.	ENSG00000258941;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527	ENST00000553728;ENST00000341749;ENST00000557038;ENST00000382245;ENST00000396165;ENST00000341502;ENST00000396158;ENST00000280083;ENST00000556148;ENST00000348007;ENST00000553352	T;T;T;T;T;T;T;T;T;T	0.51574	0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7	5.49	-0.129	0.13502	.	0.000000	0.26414	N	0.024519	T	0.54791	0.1880	M	0.88310	2.945	0.26879	N	0.96759	B;B;B;B;B;B	0.30511	0.174;0.282;0.174;0.282;0.174;0.282	B;B;B;B;B;B	0.42882	0.22;0.401;0.401;0.278;0.278;0.22	T	0.53648	-0.8409	9	.	.	.	.	4.2081	0.10498	0.2772:0.4274:0.0:0.2954	.	219;262;257;257;228;245	F8W9E1;O15320-5;O15320-2;O15320;O15320-7;G3XAC5	.;.;.;CTGE5_HUMAN;.;.	V	792;245;177;219;228;257;262;257;182;257;228	ENSP00000452252:L792V;ENSP00000343897:L245V;ENSP00000450869:L177V;ENSP00000379468:L228V;ENSP00000339286:L257V;ENSP00000379462:L262V;ENSP00000280083:L257V;ENSP00000452562:L182V;ENSP00000343912:L257V;ENSP00000450449:L228V	.	L	+	1	2	CTAGE5;RP11-407N17.3	38838915	0.849000	0.29639	0.878000	0.34440	0.935000	0.57460	0.036000	0.13819	0.261000	0.21753	0.650000	0.86243	CTA		0.338	CTAGE5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276771.2	NM_005930		37	45	0	0	0	0.005524	0	37	45				
CTAGE5	4253	broad.mit.edu	37	14	39796151	39796151	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr14:39796151C>T	ENST00000280083.3	+	20	2070	c.1756C>T	c.(1756-1758)Cat>Tat	p.H586Y	CTAGE5_ENST00000341749.3_Missense_Mutation_p.H574Y|CTAGE5_ENST00000341502.5_Missense_Mutation_p.H586Y|CTAGE5_ENST00000556148.1_Missense_Mutation_p.H511Y|CTAGE5_ENST00000348007.3_Missense_Mutation_p.H543Y|RP11-407N17.3_ENST00000553728.1_Missense_Mutation_p.H1121Y|CTAGE5_ENST00000557038.1_Missense_Mutation_p.H506Y|RP11-407N17.3_ENST00000603904.1_Missense_Mutation_p.H557Y|CTAGE5_ENST00000553352.1_Missense_Mutation_p.H557Y|CTAGE5_ENST00000396158.2_Missense_Mutation_p.H591Y|CTAGE5_ENST00000396165.4_Missense_Mutation_p.H557Y			O15320	CTGE5_HUMAN	CTAGE family, member 5	586	Pro-rich.				positive regulation of catalytic activity (GO:0043085)	membrane (GO:0016020)	enzyme activator activity (GO:0008047)	p.H586Y(1)	CTAGE5/SIP1(2)	breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0475)		AACCGATCCTCATAGGGCTCC	0.463																																							uc001wvg.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1756-1758)CAT>TAT		CTAGE family, member 5 isoform 1							112.0	104.0	106.0					14																	39796151		2203	4300	6503	SO:0001583	missense	4253						enzyme activator activity|protein binding	g.chr14:39796151C>T	U94780	CCDS9673.1, CCDS9674.1, CCDS9675.1, CCDS9676.1, CCDS58316.1, CCDS58317.1	14q21.1	2009-09-11	2004-08-24	2004-08-26	ENSG00000150527	ENSG00000150527			7057	protein-coding gene	gene with protein product		602132	"""meningioma expressed antigen 6 (coiled-coil proline-rich)"""	MGEA, MGEA6		9356211, 11149944	Standard	NM_203355		Approved	MEA6, cTAGE-5A, cTAGE-5B, cTAGE-5C, cTAGE-5D, MGEA11	uc001wvi.4	O15320	OTTHUMG00000140258	ENST00000280083.3:c.1756C>T	14.37:g.39796151C>T	ENSP00000280083:p.His586Tyr					CTAGE5_uc010tqe.1_Missense_Mutation_p.H548Y|CTAGE5_uc001wuz.3_Missense_Mutation_p.H574Y|CTAGE5_uc001wuy.3_Missense_Mutation_p.H506Y|CTAGE5_uc001wvb.3_Missense_Mutation_p.H514Y|CTAGE5_uc001wvc.3_Missense_Mutation_p.H488Y|CTAGE5_uc001wva.3_Missense_Mutation_p.H557Y|CTAGE5_uc001wvh.3_Missense_Mutation_p.H543Y|CTAGE5_uc001wvf.3_Missense_Mutation_p.H511Y|CTAGE5_uc001wvi.3_Missense_Mutation_p.H591Y|CTAGE5_uc010amz.2_Missense_Mutation_p.H202Y|CTAGE5_uc001wvj.3_Missense_Mutation_p.H557Y	p.H586Y	NM_005930	NP_005921	O15320	CTGE5_HUMAN	LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0475)	20	2092	+	Hepatocellular(127;0.213)		586			Pro-rich.		B3KRA6|B4DQS6|D3DSA6|G3XAC5|O00169|Q6MZN2|Q6P2R8|Q86TF6|Q8IX92|Q8IX93	Missense_Mutation	SNP	ENST00000280083.3	37	c.1756C>T	CCDS9674.1	.	.	.	.	.	.	.	.	.	.	C	16.50	3.140744	0.56936	.	.	ENSG00000258941;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527	ENST00000553728;ENST00000341749;ENST00000557038;ENST00000382245;ENST00000396165;ENST00000341502;ENST00000396158;ENST00000280083;ENST00000556148;ENST00000348007;ENST00000553352	T;T;T;T;T;T;T;T;T;T	0.71222	2.79;2.64;2.62;2.73;3.07;3.0;3.01;2.62;-0.55;2.73	5.63	5.63	0.86233	.	.	.	.	.	D	0.84960	0.5588	M	0.83852	2.665	0.34552	D	0.71141	D;D;D;D;D;D	0.67145	0.996;0.992;0.983;0.992;0.976;0.976	D;P;P;P;P;P	0.68039	0.955;0.908;0.799;0.908;0.799;0.908	D	0.88999	0.3420	8	.	.	.	.	18.2374	0.89954	0.0:1.0:0.0:0.0	.	548;591;543;586;514;574	F8W9E1;O15320-5;O15320-2;O15320;O15320-7;G3XAC5	.;.;.;CTGE5_HUMAN;.;.	Y	1121;574;506;548;557;586;591;586;511;543;557	ENSP00000452252:H1121Y;ENSP00000343897:H574Y;ENSP00000450869:H506Y;ENSP00000379468:H557Y;ENSP00000339286:H586Y;ENSP00000379462:H591Y;ENSP00000280083:H586Y;ENSP00000452562:H511Y;ENSP00000343912:H543Y;ENSP00000450449:H557Y	.	H	+	1	0	CTAGE5;RP11-407N17.3	38865902	1.000000	0.71417	0.892000	0.35008	0.112000	0.19704	4.924000	0.63418	2.826000	0.97356	0.655000	0.94253	CAT		0.463	CTAGE5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276771.2	NM_005930		39	57	0	0	0	0.00623	0	39	57				
LRFN5	145581	broad.mit.edu	37	14	42356779	42356779	+	Silent	SNP	A	A	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr14:42356779A>T	ENST00000298119.4	+	3	2140	c.951A>T	c.(949-951)gcA>gcT	p.A317A	LRFN5_ENST00000554171.1_Silent_p.A317A|LRFN5_ENST00000554120.1_Silent_p.A317A	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	317	Ig-like.					integral component of membrane (GO:0016021)		p.A317A(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		CTGAGCCTGCAATTCACTGGA	0.468										HNSCC(30;0.082)																													uc001wvm.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|pancreas(2)|central_nervous_system(1)	8						c.(949-951)GCA>GCT		leucine rich repeat and fibronectin type III							118.0	114.0	115.0					14																	42356779		2203	4300	6503	SO:0001819	synonymous_variant	145581					integral to membrane		g.chr14:42356779A>T	AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.951A>T	14.37:g.42356779A>T		HNSCC(30;0.082)				LRFN5_uc010ana.2_Silent_p.A317A	p.A317A	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)	3	2149	+			317			Extracellular (Potential).|Ig-like.		B3KU78|Q86XL2	Silent	SNP	ENST00000298119.4	37	c.951A>T	CCDS9678.1																																																																																				0.468	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276786.1	NM_152447		53	122	0	0	0	0.01441	0	53	122				
TRIM9	114088	broad.mit.edu	37	14	51561379	51561379	+	Silent	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr14:51561379C>T	ENST00000298355.3	-	1	1400	c.279G>A	c.(277-279)caG>caA	p.Q93Q	TRIM9_ENST00000360392.4_Silent_p.Q93Q|TRIM9_ENST00000338969.5_Silent_p.Q93Q	NM_015163.5	NP_055978.4	Q9C026	TRIM9_HUMAN	tripartite motif containing 9	93					negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of SNARE complex assembly (GO:0035544)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|synaptic vesicle (GO:0008021)	ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.Q93Q(2)		breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|liver(1)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_epithelial(31;0.00418)|Breast(41;0.148)					TGGGGGACTTCTGGCACGGGG	0.667																																							uc001wyx.3		NA																	2	Substitution - coding silent(2)		lung(2)	skin(2)|lung(1)	3						c.(277-279)CAG>CAA		tripartite motif protein 9 isoform 1							11.0	16.0	15.0					14																	51561379		2190	4287	6477	SO:0001819	synonymous_variant	114088				proteasomal ubiquitin-dependent protein catabolic process	cell junction|cytoskeleton|dendrite|synaptic vesicle	protein homodimerization activity|ubiquitin-protein ligase activity|zinc ion binding	g.chr14:51561379C>T	AF220036	CCDS9703.1, CCDS45105.1	14q21.3	2013-02-11	2011-01-25		ENSG00000100505	ENSG00000100505		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	16288	protein-coding gene	gene with protein product		606555	"""tripartite motif-containing 9"""			11331580, 11524423	Standard	NM_015163		Approved	SPRING, RNF91	uc001wyx.4	Q9C026	OTTHUMG00000140291	ENST00000298355.3:c.279G>A	14.37:g.51561379C>T						TRIM9_uc001wyy.2_Silent_p.Q93Q|TRIM9_uc001wyz.3_Silent_p.Q93Q	p.Q93Q	NM_015163	NP_055978	Q9C026	TRIM9_HUMAN			1	1044	-	all_epithelial(31;0.00418)|Breast(41;0.148)		93					D3DSB7|D3DSB8|Q92557|Q96D24|Q96NI4|Q9C025|Q9C027	Silent	SNP	ENST00000298355.3	37	c.279G>A	CCDS9703.1																																																																																				0.667	TRIM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276874.1	NM_015163		7	13	0	0	0	0.001984	0	7	13				
TXNDC16	57544	broad.mit.edu	37	14	52936818	52936818	+	Nonsense_Mutation	SNP	T	T	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr14:52936818T>A	ENST00000281741.4	-	16	1926	c.1555A>T	c.(1555-1557)Aaa>Taa	p.K519*	TXNDC16_ENST00000554399.1_Intron	NM_001160047.1|NM_020784.2	NP_001153519.1|NP_065835.2	Q9P2K2	TXD16_HUMAN	thioredoxin domain containing 16	519					cell redox homeostasis (GO:0045454)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)		p.K519*(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|prostate(3)|skin(1)	21	Breast(41;0.0716)					ATGAGGTCTTTATATAATTCC	0.333																																							uc001wzs.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(1555-1557)AAA>TAA		thioredoxin domain containing 16 isoform 1							89.0	91.0	90.0					14																	52936818		2203	4297	6500	SO:0001587	stop_gained	57544				cell redox homeostasis	extracellular region		g.chr14:52936818T>A	AB037765	CCDS32083.1	14q22.1	2007-08-16	2007-08-16	2007-08-16		ENSG00000087301			19965	protein-coding gene	gene with protein product			"""KIAA1344"""	KIAA1344			Standard	NM_020784		Approved		uc001wzs.3	Q9P2K2		ENST00000281741.4:c.1555A>T	14.37:g.52936818T>A	ENSP00000281741:p.Lys519*					TXNDC16_uc010tqu.1_Nonsense_Mutation_p.K514*|TXNDC16_uc010aoe.2_RNA	p.K519*	NM_020784	NP_065835	Q9P2K2	TXD16_HUMAN			16	2004	-	Breast(41;0.0716)		519					A5PKW9|A7E260|A7MD07|B9EH67|Q9H9W7	Nonsense_Mutation	SNP	ENST00000281741.4	37	c.1555A>T	CCDS32083.1	.	.	.	.	.	.	.	.	.	.	T	19.33	3.807556	0.70797	.	.	ENSG00000087301	ENST00000281741	.	.	.	5.2	-0.332	0.12675	.	0.603208	0.17995	N	0.155086	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-31.6371	5.6118	0.17410	0.0:0.1862:0.4416:0.3722	.	.	.	.	X	519	.	ENSP00000281741:K519X	K	-	1	0	TXNDC16	52006568	0.057000	0.20700	0.996000	0.52242	0.773000	0.43773	-0.409000	0.07160	-0.216000	0.10048	-0.472000	0.04984	AAA		0.333	TXNDC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411681.1	XM_051699		32	37	0	0	0	0.003755	0	32	37				
C14orf39	317761	broad.mit.edu	37	14	60938435	60938435	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr14:60938435A>G	ENST00000321731.3	-	6	505	c.346T>C	c.(346-348)Tgt>Cgt	p.C116R		NM_174978.2	NP_777638	Q8N1H7	S6OS1_HUMAN	chromosome 14 open reading frame 39	116					multicellular organismal development (GO:0007275)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)			p.C116R(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(108;0.0448)		TTATACTGACATATATAATCA	0.274																																							uc001xez.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						c.(346-348)TGT>CGT		hypothetical protein LOC317761							60.0	61.0	60.0					14																	60938435		2198	4287	6485	SO:0001583	missense	317761							g.chr14:60938435A>G	AK098187	CCDS9746.1	14q23.1	2012-11-05	2012-11-05	2012-11-05	ENSG00000179008	ENSG00000179008			19849	protein-coding gene	gene with protein product							Standard	NM_174978		Approved	SIX6OS1	uc001xez.4	Q8N1H7	OTTHUMG00000140332	ENST00000321731.3:c.346T>C	14.37:g.60938435A>G	ENSP00000324920:p.Cys116Arg					C14orf39_uc010apo.2_Intron	p.C116R	NM_174978	NP_777638	Q08AQ4	Q08AQ4_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0448)	6	456	-			116					Q08AQ4	Missense_Mutation	SNP	ENST00000321731.3	37	c.346T>C	CCDS9746.1	.	.	.	.	.	.	.	.	.	.	A	1.873	-0.459676	0.04508	.	.	ENSG00000179008	ENST00000321731;ENST00000555476	T;T	0.40756	2.04;1.02	5.61	-0.808	0.10868	.	0.442058	0.23201	N	0.050783	T	0.26376	0.0644	L	0.46157	1.445	0.35441	D	0.794873	B	0.06786	0.001	B	0.08055	0.003	T	0.21008	-1.0258	10	0.12766	T	0.61	-1.8472	5.1267	0.14888	0.5013:0.0:0.157:0.3416	.	116	Q8N1H7	S6OS1_HUMAN	R	116;87	ENSP00000324920:C116R;ENSP00000451665:C87R	ENSP00000324920:C116R	C	-	1	0	C14orf39	60008188	0.625000	0.27111	0.587000	0.28692	0.541000	0.35023	0.698000	0.25571	-0.290000	0.09025	-1.139000	0.01908	TGT		0.274	C14orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276948.1	NM_174978		18	13	0	0	0	0.006122	0	18	13				
SLC39A9	55334	broad.mit.edu	37	14	69908952	69908952	+	Silent	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr14:69908952G>A	ENST00000336643.5	+	3	1050	c.372G>A	c.(370-372)caG>caA	p.Q124Q	SLC39A9_ENST00000031146.4_Intron|SLC39A9_ENST00000557046.1_Silent_p.Q124Q|SLC39A9_ENST00000556605.1_Silent_p.Q124Q|SLC39A9_ENST00000555245.1_3'UTR	NM_018375.4	NP_060845.2	Q9NUM3	S39A9_HUMAN	solute carrier family 39, member 9	124					zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)	metal ion transmembrane transporter activity (GO:0046873)	p.Q124Q(1)		breast(1)|endometrium(2)|large_intestine(4)|lung(4)|prostate(1)|skin(1)|stomach(1)	14				all cancers(60;0.00299)|BRCA - Breast invasive adenocarcinoma(234;0.0145)|OV - Ovarian serous cystadenocarcinoma(108;0.0373)		TGGTGGACCAGATTGGTAACT	0.478																																							uc001xle.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(370-372)CAG>CAA		solute carrier family 39 (zinc transporter),							365.0	310.0	329.0					14																	69908952		2203	4300	6503	SO:0001819	synonymous_variant	55334				zinc ion transport	integral to membrane	metal ion transmembrane transporter activity	g.chr14:69908952G>A		CCDS9795.1, CCDS58327.1, CCDS58328.1	14q24.1	2013-07-17	2013-07-17			ENSG00000029364		"""Solute carriers"""	20182	protein-coding gene	gene with protein product							Standard	NM_018375		Approved	FLJ11274	uc001xle.3	Q9NUM3		ENST00000336643.5:c.372G>A	14.37:g.69908952G>A						SLC39A9_uc010aqx.2_Silent_p.Q124Q|SLC39A9_uc001xlf.3_Silent_p.Q124Q|SLC39A9_uc001xlg.3_RNA	p.Q124Q	NM_018375	NP_060845	Q9NUM3	S39A9_HUMAN		all cancers(60;0.00299)|BRCA - Breast invasive adenocarcinoma(234;0.0145)|OV - Ovarian serous cystadenocarcinoma(108;0.0373)	3	1052	+			124			Helical; (Potential).		G3V5J8|Q53HN3|Q5MJQ0|Q6P2Q1|Q86WY2	Silent	SNP	ENST00000336643.5	37	c.372G>A	CCDS9795.1																																																																																				0.478	SLC39A9-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412446.1	NM_018375		48	223	0	0	0	0.01441	0	48	223				
AREL1	9870	broad.mit.edu	37	14	75142577	75142577	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr14:75142577T>C	ENST00000356357.4	-	8	1420	c.905A>G	c.(904-906)tAt>tGt	p.Y302C	AREL1_ENST00000557401.1_5'UTR	NM_001039479.1	NP_001034568.1	O15033	AREL1_HUMAN	apoptosis resistant E3 ubiquitin protein ligase 1	302					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.Y302C(1)									GGTAGCATTATAAAGATAAGC	0.468																																							uc001xqb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|kidney(1)|central_nervous_system(1)|pancreas(1)	5						c.(904-906)TAT>TGT		hypothetical protein LOC9870							139.0	146.0	144.0					14																	75142577		2052	4206	6258	SO:0001583	missense	9870				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	integral to membrane|intracellular	ubiquitin-protein ligase activity	g.chr14:75142577T>C	AB002315	CCDS41971.1	14q24.2	2013-04-15	2013-04-15	2013-04-15	ENSG00000119682	ENSG00000119682			20363	protein-coding gene	gene with protein product		615380	"""KIAA0317"""	KIAA0317		9205841, 23479728	Standard	XM_006720344		Approved		uc001xqb.3	O15033	OTTHUMG00000154499	ENST00000356357.4:c.905A>G	14.37:g.75142577T>C	ENSP00000348714:p.Tyr302Cys					KIAA0317_uc010tut.1_Missense_Mutation_p.Y141C|KIAA0317_uc001xqc.2_Missense_Mutation_p.Y302C	p.Y302C	NM_001039479	NP_001034568	O15033	K0317_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.00404)	8	1410	-			302					B4E2C7|Q7LDY1|Q8IYY9	Missense_Mutation	SNP	ENST00000356357.4	37	c.905A>G	CCDS41971.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	25.7|25.7	4.665970|4.665970	0.88251|0.88251	.|.	.|.	ENSG00000119682|ENSG00000119682	ENST00000490805|ENST00000356357;ENST00000543377;ENST00000556202	.|T;T	.|0.49720	.|0.77;0.77	5.87|5.87	5.87|5.87	0.94306|0.94306	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.64583|0.64583	0.2611|0.2611	L|L	0.50333|0.50333	1.59|1.59	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;0.99	.|D;P	.|0.83275	.|0.996;0.783	T|T	0.66548|0.66548	-0.5896|-0.5896	5|10	.|0.72032	.|D	.|0.01	.|.	16.2774|16.2774	0.82651|0.82651	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|302;302	.|O15033-2;O15033	.|.;K0317_HUMAN	V|C	50|302;141;141	.|ENSP00000348714:Y302C;ENSP00000452101:Y141C	.|ENSP00000348714:Y302C	I|Y	-|-	1|2	0|0	KIAA0317|KIAA0317	74212330|74212330	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	7.805000|7.805000	0.86005|0.86005	2.247000|2.247000	0.74100|0.74100	0.482000|0.482000	0.46254|0.46254	ATA|TAT		0.468	AREL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335517.2	NM_014821		46	198	0	0	0	0.010771	0	46	198				
TSHR	7253	broad.mit.edu	37	14	81610058	81610058	+	Silent	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr14:81610058C>T	ENST00000541158.2	+	11	1978	c.1656C>T	c.(1654-1656)ctC>ctT	p.L552L	TSHR_ENST00000298171.2_Silent_p.L552L|RP11-114N19.3_ENST00000557775.1_RNA			P16473	TSHR_HUMAN	thyroid stimulating hormone receptor	552					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adult locomotory behavior (GO:0008344)|B cell differentiation (GO:0030183)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of locomotion (GO:0040012)|thyroid-stimulating hormone signaling pathway (GO:0038194)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	thyroid-stimulating hormone receptor activity (GO:0004996)	p.L552L(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(2)|stomach(1)|thyroid(291)|upper_aerodigestive_tract(1)	337				BRCA - Breast invasive adenocarcinoma(234;0.0402)	Thyrotropin Alfa(DB00024)	GCTTCCTTCTCGCCCTGCTTC	0.557			Mis		toxic thyroid adenoma	thyroid  adenoma	Hereditary nonautoimmune hyperthyroidism; subclinical hypothyroidism																																uc001xvd.1		NA	yes	Dom	yes		14	14q31	7253	Mis	thyroid stimulating hormone receptor	yes	Hereditary nonautoimmune hyperthyroidism; subclinical hypothyroidism 	E		thyroid  adenoma	toxic thyroid adenoma		1	Substitution - coding silent(1)		lung(1)	thyroid(289)|ovary(5)|lung(3)|kidney(1)|skin(1)	299						c.(1654-1656)CTC>CTT		thyroid stimulating hormone receptor isoform 1	Thyrotropin Alfa(DB00024)						508.0	352.0	405.0					14																	81610058		2203	4300	6503	SO:0001819	synonymous_variant	7253				cell-cell signaling|positive regulation of cell proliferation	integral to plasma membrane	protein binding|thyroid-stimulating hormone receptor activity	g.chr14:81610058C>T	AY429111	CCDS9872.1, CCDS32131.1, CCDS55935.1	14q24-q31	2014-09-17			ENSG00000165409	ENSG00000165409		"""GPCR / Class A : Gonadotropin and TSH receptors"""	12373	protein-coding gene	gene with protein product		603372				2558651, 2610690	Standard	NM_001018036		Approved	LGR3	uc001xvd.1	P16473		ENST00000541158.2:c.1656C>T	14.37:g.81610058C>T							p.L552L	NM_000369	NP_000360	P16473	TSHR_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.0402)	10	1812	+			552			Helical; Name=4; (Potential).		A0PJU7|F5GYU5|G3V2A9|Q16503|Q8TB90|Q96GT6|Q9P1V4|Q9ULA3|Q9UPH3	Silent	SNP	ENST00000541158.2	37	c.1656C>T	CCDS9872.1																																																																																				0.557	TSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413364.1	NM_000369		29	131	0	0	0	0.008361	0	29	131				
SETD3	84193	broad.mit.edu	37	14	99879343	99879343	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr14:99879343C>A	ENST00000331768.5	-	8	953	c.794G>T	c.(793-795)cGc>cTc	p.R265L	SETD3_ENST00000329331.3_Missense_Mutation_p.R265L|SETD3_ENST00000436070.2_Missense_Mutation_p.R265L	NM_032233.2	NP_115609.2	Q86TU7	SETD3_HUMAN	SET domain containing 3	265	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				histone H3-K36 methylation (GO:0010452)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)|peptidyl-lysine trimethylation (GO:0018023)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)	p.R265L(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|skin(1)	25		all_cancers(154;0.224)|all_epithelial(191;0.0644)|Melanoma(154;0.0866)				CAGGGTCACGCGGGAACCATC	0.473																																							uc001ygc.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(793-795)CGC>CTC		SET domain containing 3 isoform a							148.0	140.0	143.0					14																	99879343		2203	4300	6503	SO:0001583	missense	84193				peptidyl-lysine dimethylation|peptidyl-lysine monomethylation|peptidyl-lysine trimethylation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	histone methyltransferase activity (H3-K36 specific)|transcription coactivator activity	g.chr14:99879343C>A	AK026680	CCDS9951.1, CCDS9952.1	14q32.2	2006-02-15	2006-02-15	2006-02-15	ENSG00000183576	ENSG00000183576			20493	protein-coding gene	gene with protein product		615671	"""chromosome 14 open reading frame 154"""	C14orf154			Standard	NM_032233		Approved	FLJ23027	uc001ygc.3	Q86TU7	OTTHUMG00000028970	ENST00000331768.5:c.794G>T	14.37:g.99879343C>A	ENSP00000327436:p.Arg265Leu					SETD3_uc001ygd.2_Missense_Mutation_p.R265L|SETD3_uc001ygf.2_Missense_Mutation_p.R265L	p.R265L	NM_032233	NP_115609	Q86TU7	SETD3_HUMAN			8	964	-		all_cancers(154;0.224)|all_epithelial(191;0.0644)|Melanoma(154;0.0866)	265			SET.		A0PJU3|A5PLP0|B4DZE8|Q0VAQ2|Q659C0|Q86TU8|Q96GY9|Q9H5U5	Missense_Mutation	SNP	ENST00000331768.5	37	c.794G>T	CCDS9951.1	.	.	.	.	.	.	.	.	.	.	C	13.89	2.370760	0.42003	.	.	ENSG00000183576	ENST00000331768;ENST00000329331;ENST00000436070	T;T;T	0.24151	2.6;1.88;1.87	4.97	4.08	0.47627	SET domain (1);	0.066240	0.64402	D	0.000016	T	0.14270	0.0345	L	0.28192	0.835	0.58432	D	0.999991	B;B;P	0.47677	0.333;0.131;0.899	B;B;B	0.32724	0.052;0.04;0.151	T	0.05209	-1.0899	10	0.28530	T	0.3	-2.7456	12.8357	0.57771	0.0:0.9207:0.0:0.0793	.	265;265;265	Q6NXR6;A0PJU3;Q86TU7	.;.;SETD3_HUMAN	L	265	ENSP00000327436:R265L;ENSP00000327910:R265L;ENSP00000408602:R265L	ENSP00000327910:R265L	R	-	2	0	SETD3	98949096	1.000000	0.71417	0.992000	0.48379	0.959000	0.62525	3.685000	0.54678	1.217000	0.43442	0.650000	0.86243	CGC		0.473	SETD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000072339.3	NM_032233		23	40	1	0	4.26978e-12	0.00333	5.07287e-12	23	40				
AHNAK2	113146	broad.mit.edu	37	14	105411354	105411354	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr14:105411354G>C	ENST00000333244.5	-	7	10553	c.10434C>G	c.(10432-10434)ttC>ttG	p.F3478L	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3478						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.F3478L(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			AGGGCATCTTGAACTTGGGCA	0.627																																							uc010axc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(10432-10434)TTC>TTG		AHNAK nucleoprotein 2							225.0	242.0	237.0					14																	105411354		1980	4149	6129	SO:0001583	missense	113146					nucleus		g.chr14:105411354G>C	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.10434C>G	14.37:g.105411354G>C	ENSP00000353114:p.Phe3478Leu					AHNAK2_uc001ypx.2_Missense_Mutation_p.F3378L	p.F3478L	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)		7	10554	-		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	3478					Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	c.10434C>G	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	g	10.17	1.277304	0.23307	.	.	ENSG00000185567	ENST00000333244	T	0.01933	4.55	4.15	2.99	0.34606	.	0.000000	0.38005	U	0.001856	T	0.03871	0.0109	M	0.82716	2.605	0.27285	N	0.957994	P	0.35155	0.487	B	0.34779	0.189	T	0.21690	-1.0238	10	0.12430	T	0.62	.	9.629	0.39768	0.1918:0.0:0.8082:0.0	.	3478	Q8IVF2	AHNK2_HUMAN	L	3478	ENSP00000353114:F3478L	ENSP00000353114:F3478L	F	-	3	2	AHNAK2	104482399	0.797000	0.28877	1.000000	0.80357	0.159000	0.22180	1.088000	0.30877	1.861000	0.53984	0.313000	0.20887	TTC		0.627	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		139	129	0	0	0	0.01441	0	139	129				
NPAP1	23742	broad.mit.edu	37	15	24922567	24922567	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr15:24922567C>A	ENST00000329468.2	+	1	2027	c.1553C>A	c.(1552-1554)tCt>tAt	p.S518Y		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	518	Pro-rich.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)		p.S518Y(1)									TCCCCAATATCTATGTGTGTG	0.547																																							uc001ywo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8						c.(1552-1554)TCT>TAT		hypothetical protein LOC23742							192.0	200.0	197.0					15																	24922567		2203	4300	6503	SO:0001583	missense	23742				cell differentiation|multicellular organismal development|spermatogenesis			g.chr15:24922567C>A	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.1553C>A	15.37:g.24922567C>A	ENSP00000333735:p.Ser518Tyr						p.S518Y	NM_018958	NP_061831	Q9NZP6	CO002_HUMAN		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)	1	2027	+		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)	518			Pro-rich.			Missense_Mutation	SNP	ENST00000329468.2	37	c.1553C>A	CCDS10015.1	.	.	.	.	.	.	.	.	.	.	.	13.22	2.172074	0.38315	.	.	ENSG00000185823	ENST00000329468	T	0.08370	3.1	2.15	1.19	0.21007	.	1.199650	0.06413	N	0.720953	T	0.11281	0.0275	L	0.38175	1.15	0.09310	N	1	D	0.53462	0.96	P	0.50570	0.644	T	0.29397	-1.0013	10	0.66056	D	0.02	.	4.7964	0.13274	0.0:0.81:0.0:0.19	.	518	Q9NZP6	CO002_HUMAN	Y	518	ENSP00000333735:S518Y	ENSP00000333735:S518Y	S	+	2	0	C15orf2	22473660	0.001000	0.12720	0.002000	0.10522	0.256000	0.26092	1.107000	0.31110	0.456000	0.26937	0.205000	0.17691	TCT		0.547	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958		146	109	1	0	2.909e-70	0.01441	4.2733e-70	146	109				
DLL4	54567	broad.mit.edu	37	15	41222082	41222082	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr15:41222082A>G	ENST00000249749.5	+	2	380	c.104A>G	c.(103-105)cAg>cGg	p.Q35R		NM_019074.3	NP_061947.1	Q9NR61	DLL4_HUMAN	delta-like 4 (Drosophila)	35					angiogenesis (GO:0001525)|blood circulation (GO:0008015)|blood vessel lumenization (GO:0072554)|blood vessel remodeling (GO:0001974)|cardiac atrium morphogenesis (GO:0003209)|cardiac ventricle morphogenesis (GO:0003208)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|dorsal aorta morphogenesis (GO:0035912)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|pericardium morphogenesis (GO:0003344)|positive regulation of neural precursor cell proliferation (GO:2000179)|regulation of neural retina development (GO:0061074)|regulation of neurogenesis (GO:0050767)|signal transduction (GO:0007165)|ventral spinal cord interneuron fate commitment (GO:0060579)|ventricular trabecula myocardium morphogenesis (GO:0003222)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|Notch binding (GO:0005112)	p.Q35R(1)		breast(3)|large_intestine(1)	4		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.07e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.164)		CTGCAGCTGCAGGAGTTCATC	0.687																																							uc001zng.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)	2						c.(103-105)CAG>CGG		delta-like 4 protein precursor							22.0	26.0	25.0					15																	41222082		1947	4135	6082	SO:0001583	missense	54567				blood circulation|cell communication|cell differentiation|Notch receptor processing|Notch signaling pathway	integral to membrane|plasma membrane	calcium ion binding|Notch binding	g.chr15:41222082A>G	AF253468	CCDS45232.1	15q14	2008-07-03	2001-12-03			ENSG00000128917			2910	protein-coding gene	gene with protein product		605185	"""delta-like 4 homolog (Drosophila)"""			10837024	Standard	NM_019074		Approved		uc001zng.2	Q9NR61		ENST00000249749.5:c.104A>G	15.37:g.41222082A>G	ENSP00000249749:p.Gln35Arg						p.Q35R	NM_019074	NP_061947	Q9NR61	DLL4_HUMAN		GBM - Glioblastoma multiforme(113;1.07e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.164)	2	424	+		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)	35			Extracellular (Potential).		Q3KP23|Q9NQT9	Missense_Mutation	SNP	ENST00000249749.5	37	c.104A>G	CCDS45232.1	.	.	.	.	.	.	.	.	.	.	A	14.02	2.410357	0.42715	.	.	ENSG00000128917	ENST00000249749	D	0.97598	-4.45	4.63	-1.93	0.07594	Notch ligand, N-terminal (1);	0.272857	0.40728	N	0.001039	D	0.88548	0.6466	N	0.13235	0.315	0.29434	N	0.85964	B	0.02656	0.0	B	0.06405	0.002	T	0.79344	-0.1842	10	0.14656	T	0.56	.	4.1825	0.10383	0.4872:0.0:0.2759:0.2369	.	35	Q9NR61	DLL4_HUMAN	R	35	ENSP00000249749:Q35R	ENSP00000249749:Q35R	Q	+	2	0	DLL4	39009374	1.000000	0.71417	0.997000	0.53966	0.999000	0.98932	3.270000	0.51600	-0.207000	0.10187	0.533000	0.62120	CAG		0.687	DLL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418859.1			10	5	0	0	0	0.003163	0	10	5				
IGDCC3	9543	broad.mit.edu	37	15	65622919	65622919	+	Silent	SNP	T	T	C			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr15:65622919T>C	ENST00000327987.4	-	10	1973	c.1722A>G	c.(1720-1722)ggA>ggG	p.G574G	IGDCC3_ENST00000559231.1_5'Flank	NM_004884.3	NP_004875.2	Q8IVU1	IGDC3_HUMAN	immunoglobulin superfamily, DCC subclass, member 3	574	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				neuromuscular process controlling balance (GO:0050885)	integral component of plasma membrane (GO:0005887)		p.G574G(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(9)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						AGGAGACGGTTCCAGGCAGCA	0.672																																							uc002aos.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)	3						c.(1720-1722)GGA>GGG		putative neuronal cell adhesion molecule							95.0	96.0	96.0					15																	65622919		2201	4299	6500	SO:0001819	synonymous_variant	9543							g.chr15:65622919T>C	AF063936	CCDS10205.1	15q22.3-q23	2013-02-11	2009-01-08	2009-01-08	ENSG00000174498	ENSG00000174498		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9700	protein-coding gene	gene with protein product		604184	"""putative neuronal cell adhesion molecule"""	PUNC		9922388	Standard	NM_004884		Approved	HsT18880	uc002aos.2	Q8IVU1	OTTHUMG00000133137	ENST00000327987.4:c.1722A>G	15.37:g.65622919T>C						IGDCC3_uc002aor.1_5'Flank	p.G574G	NM_004884	NP_004875	Q8IVU1	IGDC3_HUMAN			10	1974	-			574			Extracellular (Potential).|Fibronectin type-III 2.		O95215	Silent	SNP	ENST00000327987.4	37	c.1722A>G	CCDS10205.1																																																																																				0.672	IGDCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256826.1	NM_004884		37	48	0	0	0	0.01441	0	37	48				
TMED3	23423	broad.mit.edu	37	15	79606204	79606204	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr15:79606204G>T	ENST00000299705.5	+	2	462	c.274G>T	c.(274-276)Gct>Tct	p.A92S	TMED3_ENST00000536821.1_Missense_Mutation_p.A92S|TMED3_ENST00000424155.2_Missense_Mutation_p.A92S	NM_007364.2	NP_031390.1	Q9Y3Q3	TMED3_HUMAN	transmembrane emp24 protein transport domain containing 3	92	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.				protein transport (GO:0015031)	COPI vesicle coat (GO:0030126)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.A92S(1)		large_intestine(3)|lung(4)|ovary(1)|skin(1)	9						CACGTACCGGGCTGAAGTCAA	0.507																																							uc002beu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(274-276)GCT>TCT		transmembrane emp24 domain containing 3							180.0	159.0	166.0					15																	79606204		2196	4293	6489	SO:0001583	missense	23423				protein transport	ER-Golgi intermediate compartment membrane|Golgi apparatus|integral to membrane		g.chr15:79606204G>T	BC022232	CCDS10310.1, CCDS73768.1	15q24-q25	2011-02-09	2005-08-26	2005-01-07	ENSG00000166557	ENSG00000166557			28889	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 22"", ""transmembrane emp24 domain containing 3"""	C15orf22		12975309	Standard	XM_005254263		Approved	p24B	uc002beu.3	Q9Y3Q3	OTTHUMG00000144170	ENST00000299705.5:c.274G>T	15.37:g.79606204G>T	ENSP00000299705:p.Ala92Ser					TMED3_uc010unj.1_Missense_Mutation_p.A92S|TMED3_uc002bev.2_RNA	p.A92S	NM_007364	NP_031390	Q9Y3Q3	TMED3_HUMAN			2	375	+			92			Lumenal (Potential).|GOLD.		A8K069|B4DN05|Q2T9F8	Missense_Mutation	SNP	ENST00000299705.5	37	c.274G>T	CCDS10310.1	.	.	.	.	.	.	.	.	.	.	G	13.01	2.109216	0.37242	.	.	ENSG00000166557	ENST00000299705;ENST00000424155;ENST00000536821;ENST00000543455	T;T;T;T	0.22336	1.96;1.96;1.96;1.96	4.7	3.58	0.41010	GOLD (3);	0.262399	0.37955	N	0.001871	T	0.27205	0.0667	M	0.75264	2.295	0.38434	D	0.946514	P;B	0.36837	0.571;0.02	B;B	0.42163	0.378;0.202	T	0.06698	-1.0812	10	0.33940	T	0.23	-15.9958	8.0534	0.30591	0.1573:0.0:0.8427:0.0	.	92;92	B4DN05;Q9Y3Q3	.;TMED3_HUMAN	S	92	ENSP00000299705:A92S;ENSP00000414983:A92S;ENSP00000446062:A92S;ENSP00000440228:A92S	ENSP00000299705:A92S	A	+	1	0	TMED3	77393259	0.223000	0.23663	0.021000	0.16686	0.457000	0.32468	1.269000	0.33074	0.960000	0.38005	0.655000	0.94253	GCT		0.507	TMED3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291369.1	NM_007364		60	104	1	0	7.82978e-24	0.01441	1.05605e-23	60	104				
EFTUD1	79631	broad.mit.edu	37	15	82456214	82456214	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr15:82456214G>T	ENST00000268206.7	-	16	2030	c.1862C>A	c.(1861-1863)gCt>gAt	p.A621D	EFTUD1_ENST00000359445.3_Missense_Mutation_p.A570D	NM_024580.5	NP_078856.4	Q7Z2Z2	ETUD1_HUMAN	elongation factor Tu GTP binding domain containing 1	621					GTP catabolic process (GO:0006184)|mature ribosome assembly (GO:0042256)		GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ribosome binding (GO:0043022)|translation elongation factor activity (GO:0003746)	p.A621D(1)		cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(14)|ovary(1)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32						TGGTTCAACAGCAACTCTCAC	0.363																																							uc002bgt.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1861-1863)GCT>GAT		elongation factor Tu GTP binding domain							89.0	85.0	86.0					15																	82456214		1891	4121	6012	SO:0001583	missense	79631				mature ribosome assembly		GTP binding|GTPase activity|ribosome binding|translation elongation factor activity	g.chr15:82456214G>T	AK056656	CCDS42070.1, CCDS42071.1	15q25.2	2012-07-04			ENSG00000140598	ENSG00000140598			25789	protein-coding gene	gene with protein product	"""ribosome assembly 1 homolog (yeast)"""					14702039	Standard	NM_024580		Approved	FLJ13119, FAM42A, HsT19294, RIA1	uc002bgt.1	Q7Z2Z2	OTTHUMG00000172573	ENST00000268206.7:c.1862C>A	15.37:g.82456214G>T	ENSP00000268206:p.Ala621Asp					EFTUD1_uc002bgu.1_Missense_Mutation_p.A570D	p.A621D	NM_024580	NP_078856	Q7Z2Z2	ETUD1_HUMAN			16	2031	-			621					A6NKY5|B7Z6I0|Q9H8Z6	Missense_Mutation	SNP	ENST00000268206.7	37	c.1862C>A	CCDS42071.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.856545	0.91355	.	.	ENSG00000140598	ENST00000268206;ENST00000359445	T;T	0.78595	-1.19;-1.19	5.2	5.2	0.72013	Elongation factor G/III/V (1);	0.241656	0.27429	N	0.019405	D	0.91178	0.7221	M	0.92077	3.27	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.978	D	0.93203	0.6593	10	0.87932	D	0	-9.5447	18.7471	0.91797	0.0:0.0:1.0:0.0	.	570;621	Q7Z2Z2-2;Q7Z2Z2	.;ETUD1_HUMAN	D	621;570	ENSP00000268206:A621D;ENSP00000352418:A570D	ENSP00000268206:A621D	A	-	2	0	EFTUD1	80243269	1.000000	0.71417	0.976000	0.42696	0.997000	0.91878	9.123000	0.94387	2.436000	0.82500	0.655000	0.94253	GCT		0.363	EFTUD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419252.1	NM_024580		5	81	1	0	3.59834e-05	0.001168	3.82008e-05	5	81				
ALPK3	57538	broad.mit.edu	37	15	85401093	85401093	+	Missense_Mutation	SNP	G	G	A	rs561031407		TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr15:85401093G>A	ENST00000258888.5	+	6	3897	c.3730G>A	c.(3730-3732)Ggc>Agc	p.G1244S		NM_020778.4	NP_065829.3	Q96L96	ALPK3_HUMAN	alpha-kinase 3	1244					heart development (GO:0007507)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.G1244S(2)		NS(3)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(4)|large_intestine(9)|lung(27)|ovary(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	81			BRCA - Breast invasive adenocarcinoma(143;0.0587)			CCGCCTCACCGGCCTCCTGGA	0.682													G|||	1	0.000199681	0.0	0.0	5008	,	,		16476	0.001		0.0	False		,,,				2504	0.0						uc002ble.2		NA																	2	Substitution - Missense(2)		lung(2)	stomach(3)|ovary(3)|lung(2)|skin(2)|central_nervous_system(1)|breast(1)	12						c.(3730-3732)GGC>AGC		alpha-kinase 3							38.0	26.0	30.0					15																	85401093		2194	4294	6488	SO:0001583	missense	57538				heart development	nucleus	ATP binding|protein serine/threonine kinase activity	g.chr15:85401093G>A	AY044449	CCDS10333.1	15q25.2	2013-01-29			ENSG00000136383	ENSG00000136383		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17574	protein-coding gene	gene with protein product	"""myocyte induction differentiation originator"", ""muscle alpha-kinase"""					10021370	Standard	NM_020778		Approved	MAK, KIAA1330, Midori	uc002ble.3	Q96L96	OTTHUMG00000148667	ENST00000258888.5:c.3730G>A	15.37:g.85401093G>A	ENSP00000258888:p.Gly1244Ser						p.G1244S	NM_020778	NP_065829	Q96L96	ALPK3_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0587)		6	3897	+			1244					Q9P2L6	Missense_Mutation	SNP	ENST00000258888.5	37	c.3730G>A	CCDS10333.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.035991	0.75617	.	.	ENSG00000136383	ENST00000258888	T	0.73258	-0.73	5.21	3.32	0.38043	.	0.543604	0.18096	N	0.151853	T	0.52435	0.1734	L	0.36672	1.1	0.31442	N	0.67188	P	0.50710	0.938	B	0.33890	0.172	T	0.59085	-0.7520	10	0.54805	T	0.06	-12.4321	8.0161	0.30383	0.1897:0.0:0.8103:0.0	.	1244	Q96L96	ALPK3_HUMAN	S	1244	ENSP00000258888:G1244S	ENSP00000258888:G1244S	G	+	1	0	ALPK3	83202097	0.997000	0.39634	0.817000	0.32601	0.902000	0.53008	2.858000	0.48356	0.577000	0.29470	0.563000	0.77884	GGC		0.682	ALPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308997.1	NM_020778		9	25	0	0	0	0.003163	0	9	25				
NTRK3	4916	broad.mit.edu	37	15	88678610	88678610	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr15:88678610C>A	ENST00000360948.2	-	9	1087	c.926G>T	c.(925-927)aGc>aTc	p.S309I	NTRK3_ENST00000557856.1_Missense_Mutation_p.S309I|NTRK3_ENST00000558676.1_Missense_Mutation_p.S309I|NTRK3_ENST00000542733.2_Missense_Mutation_p.S211I|NTRK3_ENST00000317501.3_Missense_Mutation_p.S309I|NTRK3_ENST00000355254.2_Missense_Mutation_p.S309I|NTRK3_ENST00000357724.2_Missense_Mutation_p.S309I|NTRK3_ENST00000394480.2_Missense_Mutation_p.S309I|NTRK3_ENST00000540489.2_Missense_Mutation_p.S309I	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	309	Ig-like C2-type 2.				activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.S309I(3)	ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			CTCCTCCAGGCTCACCACACG	0.592			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																													uc002bme.1		NA		Dom	yes		15	15q25	4916	T	"""neurotrophic tyrosine kinase, receptor, type 3"""			"""E, M"""	ETV6		congenital fibrosarcoma|Secretory breast 	ETV6/NTRK3(234)	3	Substitution - Missense(3)		lung(3)	soft_tissue(85)|kidney(66)|breast(56)|salivary_gland(26)|lung(22)|large_intestine(6)|ovary(6)|stomach(5)|central_nervous_system(3)|pancreas(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	281						c.(925-927)AGC>ATC		neurotrophic tyrosine kinase, receptor, type 3							30.0	32.0	31.0					15																	88678610		2201	4299	6500	SO:0001583	missense	4916				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity	g.chr15:88678610C>A	U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.926G>T	15.37:g.88678610C>A	ENSP00000354207:p.Ser309Ile	TSP Lung(13;0.10)				NTRK3_uc002bmh.2_Missense_Mutation_p.S309I|NTRK3_uc002bmf.1_Missense_Mutation_p.S309I|NTRK3_uc010upl.1_Missense_Mutation_p.S211I|NTRK3_uc010bnh.1_Missense_Mutation_p.S309I|NTRK3_uc002bmg.2_Missense_Mutation_p.S309I	p.S309I	NM_001012338	NP_001012338	Q16288	NTRK3_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.211)		9	1088	-			309			Ig-like C2-type 2.|Extracellular (Potential).		B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Missense_Mutation	SNP	ENST00000360948.2	37	c.926G>T	CCDS32322.1	.	.	.	.	.	.	.	.	.	.	C	9.731	1.162199	0.21538	.	.	ENSG00000140538	ENST00000394480;ENST00000360948;ENST00000357724;ENST00000355254;ENST00000542733;ENST00000540489;ENST00000317501	T;T;T;T;T;T;T	0.74737	-0.87;-0.83;-0.81;-0.87;-0.74;0.03;0.03	5.28	5.28	0.74379	.	0.217044	0.56097	D	0.000037	T	0.58250	0.2109	L	0.34521	1.04	0.32854	D	0.507046	B;B;B;P;B;B	0.42973	0.188;0.047;0.004;0.796;0.098;0.022	B;B;B;B;B;B	0.29267	0.065;0.034;0.028;0.066;0.1;0.028	T	0.69446	-0.5143	10	0.30078	T	0.28	.	14.3439	0.66646	0.0:0.8403:0.1597:0.0	.	211;309;309;309;309;309	B7Z7U4;E9PG56;B7Z4C5;Q96CY4;Q16288-3;Q16288	.;.;.;.;.;NTRK3_HUMAN	I	309;309;309;309;211;309;309	ENSP00000377990:S309I;ENSP00000354207:S309I;ENSP00000350356:S309I;ENSP00000347397:S309I;ENSP00000437773:S211I;ENSP00000444673:S309I;ENSP00000318328:S309I	ENSP00000318328:S309I	S	-	2	0	NTRK3	86479614	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	1.474000	0.35398	2.454000	0.82982	0.563000	0.77884	AGC		0.592	NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding				21	46	1	0	1.96292e-10	0.010504	2.27507e-10	21	46				
ACAN	176	broad.mit.edu	37	15	89386649	89386649	+	Missense_Mutation	SNP	G	G	A	rs373432805		TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr15:89386649G>A	ENST00000561243.1	+	5	821	c.821G>A	c.(820-822)cGg>cAg	p.R274Q	ACAN_ENST00000559004.1_Missense_Mutation_p.R274Q|ACAN_ENST00000439576.2_Missense_Mutation_p.R274Q|ACAN_ENST00000352105.7_Missense_Mutation_p.R274Q|ACAN_ENST00000558207.1_Missense_Mutation_p.R274Q			P16112	PGCA_HUMAN	aggrecan	274	G1-B'.|Link 2. {ECO:0000255|PROSITE- ProRule:PRU00323}.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)	p.R274Q(2)		NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			AATGAGTGCCGGCGGCTGGGT	0.637																																							uc010upo.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|central_nervous_system(1)	3						c.(820-822)CGG>CAG		aggrecan isoform 2 precursor		G	GLN/ARG,GLN/ARG	1,3859		0,1,1929	18.0	21.0	20.0		821,821	4.7	1.0	15		20	0,8282		0,0,4141	no	missense,missense	ACAN	NM_001135.3,NM_013227.3	43,43	0,1,6070	AA,AG,GG		0.0,0.0259,0.0082	possibly-damaging,possibly-damaging	274/2432,274/2531	89386649	1,12141	1930	4141	6071	SO:0001583	missense	176				cell adhesion		hyaluronic acid binding|sugar binding	g.chr15:89386649G>A	M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.821G>A	15.37:g.89386649G>A	ENSP00000453342:p.Arg274Gln					ACAN_uc002bmx.2_Missense_Mutation_p.R274Q|ACAN_uc010upp.1_Missense_Mutation_p.R274Q|ACAN_uc002bna.2_RNA	p.R274Q	NM_013227	NP_037359	E7EX88	E7EX88_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.146)		6	1195	+	Lung NSC(78;0.0392)|all_lung(78;0.077)		274					Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Missense_Mutation	SNP	ENST00000561243.1	37	c.821G>A	CCDS53970.1	.	.	.	.	.	.	.	.	.	.	G	16.51	3.144336	0.57044	2.59E-4	0.0	ENSG00000157766	ENST00000439576;ENST00000352105;ENST00000268134	T;T	0.09163	3.01;3.01	5.56	4.65	0.58169	.	0.000000	0.30068	N	0.010495	T	0.11922	0.0290	N	0.10874	0.06	0.26385	N	0.976664	D;D;P	0.71674	0.998;0.998;0.895	P;P;B	0.61874	0.895;0.895;0.345	T	0.16394	-1.0404	10	0.28530	T	0.3	-9.501	9.0175	0.36179	0.2279:0.0:0.7721:0.0	.	274;274;274	E7ENV9;E7EX88;Q6PID9	.;.;.	Q	274	ENSP00000387356:R274Q;ENSP00000341615:R274Q	ENSP00000268134:R274Q	R	+	2	0	ACAN	87187653	0.997000	0.39634	0.998000	0.56505	0.982000	0.71751	0.630000	0.24553	1.366000	0.46076	0.650000	0.86243	CGG		0.637	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416267.2	NM_001135		3	18	0	0	0	0.000602	0	3	18				
SV2B	9899	broad.mit.edu	37	15	91827441	91827441	+	Silent	SNP	C	C	G			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr15:91827441C>G	ENST00000394232.1	+	11	2168	c.1698C>G	c.(1696-1698)ctC>ctG	p.L566L	SV2B_ENST00000545111.2_Silent_p.L415L|SV2B_ENST00000330276.4_Silent_p.L566L	NM_014848.4	NP_055663.1	Q7L1I2	SV2B_HUMAN	synaptic vesicle glycoprotein 2B	566					neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	transmembrane transporter activity (GO:0022857)	p.L566L(1)		NS(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(17)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	42	Lung NSC(78;0.0987)|all_lung(78;0.172)		BRCA - Breast invasive adenocarcinoma(143;0.0895)			TTGGAAGGCTCAAGATGATTG	0.473																																							uc002bqv.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|central_nervous_system(2)|skin(2)|upper_aerodigestive_tract(1)	8						c.(1696-1698)CTC>CTG		synaptic vesicle protein 2B homolog							87.0	80.0	82.0					15																	91827441		2198	4298	6496	SO:0001819	synonymous_variant	9899				neurotransmitter transport	acrosomal vesicle|cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity	g.chr15:91827441C>G	AB018278	CCDS10370.1, CCDS53972.1	15q26.1	2005-01-10			ENSG00000185518	ENSG00000185518			16874	protein-coding gene	gene with protein product		185861				9872452, 7681585	Standard	NM_014848		Approved	KIAA0735, HsT19680	uc002bqv.3	Q7L1I2	OTTHUMG00000149833	ENST00000394232.1:c.1698C>G	15.37:g.91827441C>G						SV2B_uc010uqv.1_Silent_p.L415L|SV2B_uc002bqu.3_RNA	p.L566L	NM_014848	NP_055663	Q7L1I2	SV2B_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0895)		10	2089	+	Lung NSC(78;0.0987)|all_lung(78;0.172)		566			Helical; (Potential).		B4DH30|C6G489|O94840|Q6IAR8	Silent	SNP	ENST00000394232.1	37	c.1698C>G	CCDS10370.1																																																																																				0.473	SV2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313494.3	NM_014848		41	87	0	0	0	0.00623	0	41	87				
ABCA3	21	broad.mit.edu	37	16	2347904	2347904	+	Nonsense_Mutation	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr16:2347904G>A	ENST00000301732.5	-	16	2615	c.1915C>T	c.(1915-1917)Cag>Tag	p.Q639*	ABCA3_ENST00000382381.3_Nonsense_Mutation_p.Q581*	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	639	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)	p.Q639*(1)		breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	GGGCACTTCTGACGTGACAGG	0.632																																							uc002cpy.1		NA																	1	Substitution - Nonsense(1)		lung(1)	breast(5)|ovary(5)|central_nervous_system(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	16						c.(1915-1917)CAG>TAG		ATP-binding cassette, sub-family A member 3							98.0	92.0	94.0					16																	2347904		2198	4300	6498	SO:0001587	stop_gained	21				response to drug	integral to membrane|lamellar body|membrane fraction|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances	g.chr16:2347904G>A	U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.1915C>T	16.37:g.2347904G>A	ENSP00000301732:p.Gln639*					ABCA3_uc010bsk.1_Nonsense_Mutation_p.Q581*|ABCA3_uc010bsl.1_Nonsense_Mutation_p.Q639*	p.Q639*	NM_001089	NP_001080	Q99758	ABCA3_HUMAN			16	2627	-		Ovarian(90;0.17)	639			ABC transporter 1.		B2RU09|Q54A95|Q6P5P9|Q92473	Nonsense_Mutation	SNP	ENST00000301732.5	37	c.1915C>T	CCDS10466.1	.	.	.	.	.	.	.	.	.	.	G	42	9.768047	0.99259	.	.	ENSG00000167972	ENST00000301732;ENST00000382381	.	.	.	6.08	1.63	0.23807	.	1.098330	0.06600	N	0.753568	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	.	2.5423	0.04729	0.1177:0.1395:0.3122:0.4305	.	.	.	.	X	639;643	.	ENSP00000301732:Q639X	Q	-	1	0	ABCA3	2287905	0.000000	0.05858	0.009000	0.14445	0.002000	0.02628	0.902000	0.28459	0.427000	0.26145	-0.181000	0.13052	CAG		0.632	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250784.2	NM_001089		64	77	0	0	0	0.01441	0	64	77				
RBFOX1	54715	broad.mit.edu	37	16	7703845	7703845	+	Silent	SNP	C	C	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr16:7703845C>A	ENST00000550418.1	+	12	1774	c.786C>A	c.(784-786)acC>acA	p.T262T	RBFOX1_ENST00000355637.4_Silent_p.T282T|RBFOX1_ENST00000547372.1_Silent_p.T305T|RBFOX1_ENST00000535565.2_Silent_p.T219T|RBFOX1_ENST00000436368.2_Silent_p.T282T|RBFOX1_ENST00000553186.1_Silent_p.T235T|RBFOX1_ENST00000340209.4_Silent_p.T267T|RBFOX1_ENST00000547338.1_Silent_p.T262T|RBFOX1_ENST00000552089.1_Silent_p.T279T|RBFOX1_ENST00000422070.4_Silent_p.T305T|RBFOX1_ENST00000311745.5_Silent_p.T282T	NM_018723.3	NP_061193.2	Q9NWB1	RFOX1_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 1	262					mRNA processing (GO:0006397)|neuromuscular process controlling balance (GO:0050885)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	nucleotide binding (GO:0000166)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)	p.T282T(2)|p.T262T(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|lung(17)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)	55						CAGCAGCCACCGCCGCGGCCG	0.706																																					Ovarian(157;934 2567 15163 39509)		uc002cys.2		NA																	3	Substitution - coding silent(3)		lung(3)		0						c.(784-786)ACC>ACA		ataxin 2-binding protein 1 isoform 4							15.0	19.0	18.0					16																	7703845		1725	3657	5382	SO:0001819	synonymous_variant	54715				mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding	g.chr16:7703845C>A	AF107203	CCDS10531.1, CCDS10532.1, CCDS45405.1, CCDS55983.1, CCDS55984.1	16p13.3	2013-02-12			ENSG00000078328	ENSG00000078328		"""RNA binding motif (RRM) containing"""	18222	protein-coding gene	gene with protein product	"""ataxin 2-binding protein 1"", ""hexaribonucleotide binding protein 1"""	605104				10814712, 16260614	Standard	NM_018723		Approved	A2BP1, FOX-1, HRNBP1	uc002cyy.2	Q9NWB1	OTTHUMG00000129551	ENST00000550418.1:c.786C>A	16.37:g.7703845C>A						A2BP1_uc010buf.1_Silent_p.T262T|A2BP1_uc002cyr.1_Silent_p.T261T|A2BP1_uc002cyt.2_Silent_p.T235T|A2BP1_uc010uxz.1_Silent_p.T305T|A2BP1_uc010uya.1_Silent_p.T219T|A2BP1_uc002cyv.1_Silent_p.T262T|A2BP1_uc010uyb.1_Silent_p.T262T|A2BP1_uc002cyw.2_Silent_p.T282T|A2BP1_uc002cyy.2_Silent_p.T282T|A2BP1_uc002cyx.2_Silent_p.T282T|A2BP1_uc010uyc.1_Silent_p.T255T	p.T262T	NM_018723	NP_061193	Q9NWB1	RFOX1_HUMAN		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)	12	1774	+		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)	262					Q7Z7I7|Q8TAE3|Q8TAF2|Q8WYB2|Q9NS20	Silent	SNP	ENST00000550418.1	37	c.786C>A	CCDS55983.1																																																																																				0.706	RBFOX1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409492.2	NM_145891		7	17	1	0	2.32078e-09	0.003163	2.64137e-09	7	17				
USP7	7874	broad.mit.edu	37	16	8993022	8993022	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr16:8993022C>A	ENST00000344836.4	-	23	2685	c.2487G>T	c.(2485-2487)agG>agT	p.R829S	USP7_ENST00000535863.1_Missense_Mutation_p.R730S|USP7_ENST00000381886.4_Missense_Mutation_p.R813S	NM_003470.2	NP_003461.2	Q93009	UBP7_HUMAN	ubiquitin specific peptidase 7 (herpes virus-associated)	829					maintenance of DNA methylation (GO:0010216)|multicellular organismal development (GO:0007275)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|protein deubiquitination (GO:0016579)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|transcription-coupled nucleotide-excision repair (GO:0006283)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|p53 binding (GO:0002039)|protein C-terminus binding (GO:0008022)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.R829S(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(13)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	48						CTGTGTTGAGCCTCTGTGCAA	0.413																																							uc002czl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(2485-2487)AGG>AGT		ubiquitin specific peptidase 7							189.0	156.0	167.0					16																	8993022		2197	4300	6497	SO:0001583	missense	7874				interspecies interaction between organisms|multicellular organismal development|protein deubiquitination|regulation of sequence-specific DNA binding transcription factor activity|ubiquitin-dependent protein catabolic process	cytoplasm|PML body	cysteine-type endopeptidase activity|p53 binding|protein C-terminus binding|transcription factor binding|ubiquitin protein ligase binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr16:8993022C>A	Z72499	CCDS32385.1, CCDS66941.1	16p13.3	2008-04-11	2005-08-08			ENSG00000187555		"""Ubiquitin-specific peptidases"""	12630	protein-coding gene	gene with protein product		602519	"""ubiquitin specific protease 7 (herpes virus-associated)"""	HAUSP		12838346, 9925944	Standard	NM_003470		Approved		uc002czl.2	Q93009		ENST00000344836.4:c.2487G>T	16.37:g.8993022C>A	ENSP00000343535:p.Arg829Ser					USP7_uc010uyk.1_Missense_Mutation_p.R730S|USP7_uc002czj.2_RNA|USP7_uc010uyj.1_Missense_Mutation_p.R730S|USP7_uc002czk.2_Missense_Mutation_p.R813S	p.R829S	NM_003470	NP_003461	Q93009	UBP7_HUMAN			23	2686	-			829					A6NMY8|B7Z815|H0Y3G8	Missense_Mutation	SNP	ENST00000344836.4	37	c.2487G>T	CCDS32385.1	.	.	.	.	.	.	.	.	.	.	C	15.56	2.868755	0.51588	.	.	ENSG00000187555	ENST00000344836;ENST00000381886;ENST00000535863;ENST00000544549	T;T	0.07114	3.22;3.24	6.04	-0.333	0.12671	.	0.000000	0.85682	D	0.000000	T	0.06917	0.0176	L	0.58810	1.83	0.80722	D	1	P;P	0.49635	0.926;0.926	B;B	0.33521	0.165;0.165	T	0.34875	-0.9811	10	0.42905	T	0.14	.	10.6828	0.45823	0.0:0.4451:0.0:0.5549	.	829;813	Q93009;B7Z815	UBP7_HUMAN;.	S	829;837;730;730	ENSP00000343535:R829S;ENSP00000443646:R730S	ENSP00000343535:R829S	R	-	3	2	USP7	8900523	0.999000	0.42202	0.997000	0.53966	0.996000	0.88848	0.609000	0.24238	-0.041000	0.13558	0.561000	0.74099	AGG		0.413	USP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434268.2			30	71	1	0	6.50621e-10	0.013726	7.47229e-10	30	71				
PDILT	204474	broad.mit.edu	37	16	20380967	20380967	+	Silent	SNP	A	A	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr16:20380967A>T	ENST00000302451.4	-	8	1211	c.963T>A	c.(961-963)cgT>cgA	p.R321R		NM_174924.1	NP_777584.1	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis expressed	321					cell migration (GO:0016477)|cell redox homeostasis (GO:0045454)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|spermatid development (GO:0007286)	endoplasmic reticulum (GO:0005783)	protein disulfide isomerase activity (GO:0003756)	p.R321R(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(33)|prostate(3)|skin(1)|urinary_tract(1)	61						ACTTGAAGACACGTCCATTTC	0.463																																							uc002dhc.1		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)	1						c.(961-963)CGT>CGA		protein disulfide isomerase-like, testis							149.0	144.0	146.0					16																	20380967		2203	4300	6503	SO:0001819	synonymous_variant	204474				cell differentiation|cell redox homeostasis|multicellular organismal development|spermatogenesis	endoplasmic reticulum	isomerase activity	g.chr16:20380967A>T		CCDS10584.1	16p12.3	2011-11-10	2009-02-23		ENSG00000169340	ENSG00000169340		"""Protein disulfide isomerases"""	27338	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 7"", ""protein disulfide isomerase-like protein of the testis"""					15475357	Standard	NM_174924		Approved	PDIA7	uc002dhc.1	Q8N807	OTTHUMG00000131487	ENST00000302451.4:c.963T>A	16.37:g.20380967A>T							p.R321R	NM_174924	NP_777584	Q8N807	PDILT_HUMAN			8	1186	-			321					Q8IVQ5	Silent	SNP	ENST00000302451.4	37	c.963T>A	CCDS10584.1																																																																																				0.463	PDILT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254332.1	NM_174924		51	119	0	0	0	0.01441	0	51	119				
ACSM5	54988	broad.mit.edu	37	16	20430688	20430688	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr16:20430688C>A	ENST00000331849.4	+	4	701	c.554C>A	c.(553-555)tCc>tAc	p.S185Y	ACSM5_ENST00000575584.1_Missense_Mutation_p.S185Y	NM_017888.2	NP_060358.2	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	185					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)	p.S185Y(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	51						GAATGCCCCTCCCTCCAGACC	0.582																																							uc002dhe.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(553-555)TCC>TAC		acyl-CoA synthetase medium-chain family member 5							66.0	57.0	60.0					16																	20430688		2203	4300	6503	SO:0001583	missense	54988				fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding	g.chr16:20430688C>A		CCDS10585.1	16p12.3	2007-10-17			ENSG00000183549	ENSG00000183549		"""Acyl-CoA synthetase family"""	26060	protein-coding gene	gene with protein product		614361				17762044	Standard	NM_017888		Approved	FLJ20581	uc002dhe.3	Q6NUN0	OTTHUMG00000131551	ENST00000331849.4:c.554C>A	16.37:g.20430688C>A	ENSP00000327916:p.Ser185Tyr					ACSM5_uc002dhd.1_Missense_Mutation_p.S185Y	p.S185Y	NM_017888	NP_060358	Q6NUN0	ACSM5_HUMAN			4	701	+			185					Q96AV1|Q96CX8|Q9NWV3	Missense_Mutation	SNP	ENST00000331849.4	37	c.554C>A	CCDS10585.1	.	.	.	.	.	.	.	.	.	.	C	17.19	3.325152	0.60634	.	.	ENSG00000183549	ENST00000331849	T	0.42131	0.98	4.65	4.65	0.58169	AMP-dependent synthetase/ligase (1);	0.206543	0.34700	N	0.003747	T	0.46795	0.1411	L	0.55481	1.735	0.31600	N	0.652774	D	0.58620	0.983	P	0.55785	0.784	T	0.54866	-0.8229	10	0.41790	T	0.15	-21.0127	6.1769	0.20449	0.0:0.7723:0.0:0.2277	.	185	Q6NUN0	ACSM5_HUMAN	Y	185	ENSP00000327916:S185Y	ENSP00000327916:S185Y	S	+	2	0	ACSM5	20338189	0.125000	0.22332	1.000000	0.80357	0.877000	0.50540	1.044000	0.30329	2.561000	0.86390	0.650000	0.86243	TCC		0.582	ACSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254413.1	NM_017888		24	59	1	0	0.00047179	0.00333	0.000491232	24	59				
ACSM3	6296	broad.mit.edu	37	16	20788795	20788795	+	Silent	SNP	A	A	G			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr16:20788795A>G	ENST00000289416.5	+	4	1006	c.531A>G	c.(529-531)ttA>ttG	p.L177L	ACSM3_ENST00000440284.2_Silent_p.L177L|ACSM3_ENST00000450120.2_Silent_p.L132L	NM_005622.3	NP_005613.2	Q53FZ2	ACSM3_HUMAN	acyl-CoA synthetase medium-chain family member 3	177					cholesterol homeostasis (GO:0042632)|fatty acid biosynthetic process (GO:0006633)|regulation of blood pressure (GO:0008217)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty acid ligase activity (GO:0015645)|metal ion binding (GO:0046872)	p.L177L(2)		breast(1)|endometrium(5)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)	21						ATGATGTTTTAGCCCCAGCAG	0.453																																							uc002dhr.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(529-531)TTA>TTG		SA hypertension-associated homolog isoform 1							87.0	81.0	83.0					16																	20788795		2201	4300	6501	SO:0001819	synonymous_variant	6296				regulation of blood pressure	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding	g.chr16:20788795A>G	D16350	CCDS10589.1, CCDS45435.1	16p13.11	2006-02-08	2005-09-08	2005-09-08	ENSG00000005187	ENSG00000005187		"""Acyl-CoA synthetase family"""	10522	protein-coding gene	gene with protein product		145505	"""SA (rat hypertension-associated) homolog"", ""SA hypertension-associated homolog (rat)"""	SAH		7843754, 7907320, 11470804	Standard	NM_005622		Approved	SA	uc002dhr.3	Q53FZ2	OTTHUMG00000131552	ENST00000289416.5:c.531A>G	16.37:g.20788795A>G						ACSM3_uc002dhq.2_Silent_p.L177L|ACSM3_uc010vba.1_Silent_p.L169L	p.L177L	NM_005622	NP_005613	Q53FZ2	ACSM3_HUMAN			4	718	+			177					O60363|Q13732|Q15425|Q7KYM6|Q9BUA2	Silent	SNP	ENST00000289416.5	37	c.531A>G	CCDS10589.1																																																																																				0.453	ACSM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254414.2	NM_005622		41	90	0	0	0	0.00874	0	41	90				
SEPT1	1731	broad.mit.edu	37	16	30391340	30391340	+	Silent	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr16:30391340C>T	ENST00000571393.1	-	8	759	c.573G>A	c.(571-573)ttG>ttA	p.L191L	SEPT1_ENST00000605106.1_Silent_p.L196L|SEPT1_ENST00000321367.3_Silent_p.L238L|SEPT1_ENST00000570039.1_5'Flank			Q8WYJ6	SEPT1_HUMAN	septin 1	191	Septin-type G.				cell cycle (GO:0007049)|cell division (GO:0051301)	septin complex (GO:0031105)	GTP binding (GO:0005525)	p.L191L(1)		breast(2)|endometrium(1)|large_intestine(3)|lung(15)|ovary(1)|skin(1)|urinary_tract(1)	24			Colorectal(24;0.193)			CCTCTTCCTTCAACTGATCCC	0.473																																							uc002dxy.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(571-573)TTG>TTA		septin 1							124.0	105.0	111.0					16																	30391340		2197	4300	6497	SO:0001819	synonymous_variant	1731				cell cycle|cell division	microtubule organizing center|septin complex	GTP binding|protein binding	g.chr16:30391340C>T	AF308288	CCDS10678.1, CCDS10678.2, CCDS10678.3	16p11.2	2013-01-21		2001-09-10	ENSG00000180096	ENSG00000180096	3.1.5.1	"""Septins"""	2879	protein-coding gene	gene with protein product		612897		DIFF6		8697812	Standard	NM_052838		Approved	PNUTL3	uc002dxy.4	Q8WYJ6	OTTHUMG00000176984	ENST00000571393.1:c.573G>A	16.37:g.30391340C>T						SEPT1_uc002dxw.2_5'Flank|SEPT1_uc002dxx.2_Silent_p.L16L|SEPT1_uc010veq.1_3'UTR	p.L191L	NM_052838	NP_443070	Q8WYJ6	SEPT1_HUMAN	Colorectal(24;0.193)		8	760	-			191					B4DVE6|Q658T1|Q8NEZ1|Q96EL4|Q9H285	Silent	SNP	ENST00000571393.1	37	c.573G>A																																																																																					0.473	SEPT1-201	KNOWN	basic	protein_coding	protein_coding		NM_052838		43	74	0	0	0	0.011902	0	43	74				
PDP2	57546	broad.mit.edu	37	16	66918316	66918316	+	Silent	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr16:66918316C>T	ENST00000311765.2	+	2	463	c.129C>T	c.(127-129)tcC>tcT	p.S43S	PDP2_ENST00000568720.1_Intron	NM_020786.2	NP_065837.1	Q9P2J9	PDP2_HUMAN	pyruvate dehyrogenase phosphatase catalytic subunit 2	43					cellular metabolic process (GO:0044237)|peptidyl-threonine dephosphorylation (GO:0035970)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	[pyruvate dehydrogenase (lipoamide)] phosphatase activity (GO:0004741)|magnesium-dependent protein serine/threonine phosphatase activity (GO:0004724)|metal ion binding (GO:0046872)	p.S43S(1)		kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|urinary_tract(1)	12		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.088)|Epithelial(162;0.204)		GGCTCTTTTCCCGGGTGCCAC	0.448																																							uc002eqk.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(127-129)TCC>TCT		pyruvate dehydrogenase phosphatase isoenzyme 2							87.0	97.0	94.0					16																	66918316		2200	4300	6500	SO:0001819	synonymous_variant	57546				pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix|protein serine/threonine phosphatase complex	[pyruvate dehydrogenase (lipoamide)] phosphatase activity|metal ion binding	g.chr16:66918316C>T	AB037769	CCDS10822.1	16q22.1	2012-04-17			ENSG00000172840	ENSG00000172840		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	30263	protein-coding gene	gene with protein product	"""protein phosphatase 2C, magnesium-dependent, catalytic subunit 2"""	615499				9651365	Standard	NM_020786		Approved	KIAA1348, PPM2C2	uc002eqk.2	Q9P2J9	OTTHUMG00000137512	ENST00000311765.2:c.129C>T	16.37:g.66918316C>T							p.S43S	NM_020786	NP_065837	Q9P2J9	PDP2_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.088)|Epithelial(162;0.204)	2	291	+		Ovarian(137;0.0563)	43					A8K924	Silent	SNP	ENST00000311765.2	37	c.129C>T	CCDS10822.1																																																																																				0.448	PDP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268831.2	NM_020786		26	184	0	0	0	0.005443	0	26	184				
CTCF	10664	broad.mit.edu	37	16	67645894	67645894	+	Silent	SNP	G	G	C			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr16:67645894G>C	ENST00000264010.4	+	4	1266	c.822G>C	c.(820-822)acG>acC	p.T274T	AC009095.4_ENST00000388909.4_RNA|CTCF_ENST00000401394.1_Intron	NM_006565.3	NP_006556.1	P49711	CTCF_HUMAN	CCCTC-binding factor (zinc finger protein)	274					chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|DNA methylation (GO:0006306)|maintenance of DNA methylation (GO:0010216)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome positioning (GO:0016584)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone acetylation (GO:0035065)|regulation of histone methylation (GO:0031060)|regulation of molecular function, epigenetic (GO:0040030)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin insulator sequence binding (GO:0043035)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.T274T(1)		breast(6)|central_nervous_system(2)|cervix(1)|endometrium(34)|haematopoietic_and_lymphoid_tissue(7)|kidney(3)|large_intestine(9)|liver(1)|lung(11)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	79		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0166)|Epithelial(162;0.0577)		GCAGTTACACGTGTCCACGGC	0.438																																					Colon(175;1200 1966 6945 23069 27405)	Colon(175;1200 1966 6945 23069 27405)	uc002etl.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(820-822)ACG>ACC		CCCTC-binding factor							151.0	125.0	134.0					16																	67645894		2198	4300	6498	SO:0001819	synonymous_variant	10664				chromatin modification|chromosome segregation|negative regulation of transcription, DNA-dependent|nucleosome positioning|positive regulation of transcription, DNA-dependent|regulation of centromeric sister chromatid cohesion|regulation of molecular function, epigenetic	chromosome, centromeric region|condensed chromosome|nucleolus|nucleoplasm	chromatin insulator sequence binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|transcription regulatory region DNA binding|zinc ion binding	g.chr16:67645894G>C	U25435	CCDS10841.1, CCDS54029.1	16q21-q22.3	2013-01-08			ENSG00000102974	ENSG00000102974		"""Zinc fingers, C2H2-type"""	13723	protein-coding gene	gene with protein product	"""11 zinc finger transcriptional repressor"""	604167				8649389, 18550811	Standard	NM_006565		Approved		uc002etl.3	P49711	OTTHUMG00000137539	ENST00000264010.4:c.822G>C	16.37:g.67645894G>C						CTCF_uc010cek.2_Intron	p.T274T	NM_006565	NP_006556	P49711	CTCF_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0166)|Epithelial(162;0.0577)	4	1112	+		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)	274			C2H2-type 1.		B5MC38|Q53XI7|Q59EL8	Silent	SNP	ENST00000264010.4	37	c.822G>C	CCDS10841.1																																																																																				0.438	CTCF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268870.2	NM_006565		10	106	0	0	0	0.010729	0	10	106				
EDC4	23644	broad.mit.edu	37	16	67911274	67911274	+	Silent	SNP	C	C	T	rs368076076		TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr16:67911274C>T	ENST00000358933.5	+	5	845	c.606C>T	c.(604-606)ttC>ttT	p.F202F	AC040162.1_ENST00000408599.1_RNA|EDC4_ENST00000574770.1_3'UTR	NM_014329.4	NP_055144.3	Q6P2E9	EDC4_HUMAN	enhancer of mRNA decapping 4	202					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)		p.F202F(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)		GCAACCTGTTCGTGTGGCGCT	0.587																																							uc002eur.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(2)	4						c.(604-606)TTC>TTT		autoantigen RCD8		C		0,4396		0,0,2198	119.0	117.0	117.0		606	-1.4	1.0	16		117	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	EDC4	NM_014329.3		0,2,6496	TT,TC,CC		0.0233,0.0,0.0154		202/1402	67911274	2,12994	2198	4300	6498	SO:0001819	synonymous_variant	23644				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay	cytoplasmic mRNA processing body|cytosol|nucleus	protein binding	g.chr16:67911274C>T	U17474	CCDS10849.1	16q22.1	2008-02-05			ENSG00000038358	ENSG00000038358			17157	protein-coding gene	gene with protein product		606030				9067524	Standard	NM_014329		Approved	RCD-8, Ge-1, HEDLS	uc002eur.3	Q6P2E9	OTTHUMG00000137543	ENST00000358933.5:c.606C>T	16.37:g.67911274C>T						EDC4_uc010cer.2_5'UTR|EDC4_uc010vkg.1_Silent_p.F134F|EDC4_uc010ces.1_Silent_p.F45F|EDC4_uc002eus.2_5'Flank	p.F202F	NM_014329	NP_055144	Q6P2E9	EDC4_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)	5	772	+		Ovarian(137;0.0563)	202			WD 1.		A6NGM1|A8K4T4|Q13025|Q13826|Q6ZR12|Q7Z6H7	Silent	SNP	ENST00000358933.5	37	c.606C>T	CCDS10849.1																																																																																				0.587	EDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268874.2	NM_014329		59	36	0	0	0	0.01441	0	59	36				
SF3B3	23450	broad.mit.edu	37	16	70573038	70573039	+	Missense_Mutation	DNP	CT	CT	AA	rs199759043		TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	CT	CT	-	-	CT	CT	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr16:70573038_70573039CT>AA	ENST00000302516.5	+	8	1206_1207	c.995_996CT>AA	c.(994-996)aCT>aAA	p.T332K	SNORD111_ENST00000408139.1_RNA	NM_012426.4	NP_036558.3	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3, 130kDa	332					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|protein complex assembly (GO:0006461)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleic acid binding (GO:0003676)	p.T332K(1)		breast(2)|endometrium(8)|kidney(2)|large_intestine(8)|liver(3)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	53		Ovarian(137;0.0694)				TATTTTGATACTGTACCCGTTG	0.421																																							uc002ezf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(994-996)ACT>AAA		splicing factor 3b, subunit 3																																				SO:0001583	missense	23450				protein complex assembly	catalytic step 2 spliceosome|nucleoplasm|small nuclear ribonucleoprotein complex|U12-type spliceosomal complex	nucleic acid binding|protein binding	g.chr16:70573038_70573039CT>AA	AJ001443	CCDS10894.1	16q22	2008-08-01	2002-08-29		ENSG00000189091	ENSG00000189091			10770	protein-coding gene	gene with protein product		605592	"""splicing factor 3b, subunit 3, 130kD"""			10490618	Standard	NM_012426		Approved	SAP130, SF3b130, RSE1, KIAA0017	uc002ezf.3	Q15393	OTTHUMG00000137582	Exception_encountered	16.37:g.70573038_70573039delinsAA	ENSP00000305790:p.Thr332Lys						p.T332K	NM_012426	NP_036558	Q15393	SF3B3_HUMAN			8	1206_1207	+		Ovarian(137;0.0694)	332					Q6NTI8|Q96GC0|Q9BPY2|Q9UFX7|Q9UJ29	Missense_Mutation	DNP	ENST00000302516.5	37	c.995_996CT>AA	CCDS10894.1																																																																																				0.421	SF3B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268972.1	NM_012426		20	166	0	0	0	0.004672	0	20	166				
CHST5	23563	broad.mit.edu	37	16	75563474	75563474	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr16:75563474C>A	ENST00000336257.3	-	3	2203	c.809G>T	c.(808-810)aGc>aTc	p.S270I	RP11-77K12.7_ENST00000460606.1_3'UTR|CHST5_ENST00000541075.1_Missense_Mutation_p.S276I	NM_024533.4	NP_078809.2	Q9GZS9	CHST5_HUMAN	carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5	270					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|N-acetylglucosamine metabolic process (GO:0006044)|protein sulfation (GO:0006477)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)	p.S270I(1)		cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)	24						GCGCACGTGGCTGCGGCACAC	0.716																																							uc002fei.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(808-810)AGC>ATC		carbohydrate (N-acetylglucosamine 6-O)							27.0	33.0	31.0					16																	75563474		2177	4253	6430	SO:0001583	missense	23563				N-acetylglucosamine metabolic process|protein sulfation	integral to membrane|intrinsic to Golgi membrane	N-acetylglucosamine 6-O-sulfotransferase activity	g.chr16:75563474C>A	AF176839	CCDS10919.1	16q23.1	2008-02-05			ENSG00000135702	ENSG00000135702		"""Sulfotransferases, membrane-bound"""	1973	protein-coding gene	gene with protein product		604817				10491328, 11017086	Standard	NM_024533		Approved	I-GLCNAC-6-ST, FLJ22167	uc002fei.3	Q9GZS9	OTTHUMG00000137610	ENST00000336257.3:c.809G>T	16.37:g.75563474C>A	ENSP00000338783:p.Ser270Ile					CHST5_uc002fej.1_Missense_Mutation_p.S276I	p.S270I	NM_024533	NP_078809	Q9GZS9	CHST5_HUMAN			3	2204	-			270			Lumenal (Potential).		B2RV23|Q7LCN3|Q9UBY3	Missense_Mutation	SNP	ENST00000336257.3	37	c.809G>T	CCDS10919.1	.	.	.	.	.	.	.	.	.	.	C	13.33	2.205786	0.39003	.	.	ENSG00000135702	ENST00000336257;ENST00000541075	T;T	0.21191	2.02;2.02	2.84	1.83	0.25207	Sulfotransferase domain (1);	0.043762	0.85682	D	0.000000	T	0.44891	0.1315	M	0.84326	2.69	0.51233	D	0.999915	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.37197	-0.9716	10	0.45353	T	0.12	.	10.3734	0.44068	0.0:0.7977:0.2023:0.0	.	276;270	Q9GZS9-2;Q9GZS9	.;CHST5_HUMAN	I	270;276	ENSP00000338783:S270I;ENSP00000441220:S276I	ENSP00000338783:S270I	S	-	2	0	CHST5	74120975	1.000000	0.71417	0.995000	0.50966	0.056000	0.15407	7.308000	0.78929	0.475000	0.27415	0.313000	0.20887	AGC		0.716	CHST5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269025.2	NM_012126		13	58	1	0	4.93089e-13	0.00245	5.91395e-13	13	58				
ADAMTS18	170692	broad.mit.edu	37	16	77401460	77401460	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr16:77401460C>A	ENST00000282849.5	-	4	1074	c.656G>T	c.(655-657)gGc>gTc	p.G219V	ADAMTS18_ENST00000567121.1_5'UTR	NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	219					eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.G219V(1)|p.G216_G219del(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						CCGGCCAGAGCCGGGGTAGCC	0.547																																							uc002ffc.3		NA																	2	Substitution - Missense(1)|Deletion - In frame(1)	p.G216_G219del(1)	ovary(1)|lung(1)	large_intestine(4)|lung(4)|kidney(4)|skin(3)|breast(1)|ovary(1)|pancreas(1)	18						c.(655-657)GGC>GTC		ADAM metallopeptidase with thrombospondin type 1							78.0	71.0	74.0					16																	77401460		2198	4300	6498	SO:0001583	missense	170692				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr16:77401460C>A	AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.656G>T	16.37:g.77401460C>A	ENSP00000282849:p.Gly219Val					ADAMTS18_uc002ffe.1_5'UTR|ADAMTS18_uc010vni.1_RNA	p.G219V	NM_199355	NP_955387	Q8TE60	ATS18_HUMAN			4	1075	-			219					Q6P4R5|Q6ZWJ9	Missense_Mutation	SNP	ENST00000282849.5	37	c.656G>T	CCDS10926.1	.	.	.	.	.	.	.	.	.	.	C	3.099	-0.185214	0.06340	.	.	ENSG00000140873	ENST00000282849;ENST00000449265	T;T	0.60040	0.22;2.76	4.72	2.75	0.32379	.	0.637046	0.16660	N	0.204803	T	0.41166	0.1147	L	0.39898	1.24	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.20075	-1.0286	10	0.24483	T	0.36	.	3.8648	0.09012	0.0:0.5383:0.1866:0.275	.	219	Q8TE60	ATS18_HUMAN	V	219	ENSP00000282849:G219V;ENSP00000392540:G219V	ENSP00000282849:G219V	G	-	2	0	ADAMTS18	75958961	0.002000	0.14202	0.003000	0.11579	0.622000	0.37654	0.159000	0.16442	0.584000	0.29591	0.555000	0.69702	GGC		0.547	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269037.1			50	40	1	0	5.13769e-22	0.01441	6.85628e-22	50	40				
TP53	7157	broad.mit.edu	37	17	7578403	7578403	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr17:7578403C>T	ENST00000269305.4	-	5	716	c.527G>A	c.(526-528)tGc>tAc	p.C176Y	TP53_ENST00000574684.1_5'UTR|TP53_ENST00000359597.4_Missense_Mutation_p.C176Y|TP53_ENST00000445888.2_Missense_Mutation_p.C176Y|TP53_ENST00000455263.2_Missense_Mutation_p.C176Y|TP53_ENST00000420246.2_Missense_Mutation_p.C176Y|TP53_ENST00000413465.2_Missense_Mutation_p.C176Y	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	176	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:8829627, ECO:0000269|PubMed:9450901}.|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in sporadic cancers; somatic mutation).|CP -> FS (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C176F(129)|p.C176Y(63)|p.C83F(9)|p.C44F(9)|p.C176S(8)|p.0?(8)|p.C176_R181delCPHHER(3)|p.R174fs*24(3)|p.C44Y(3)|p.C83Y(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.C176fs*65(1)|p.C176_P177delCP(1)|p.V173fs*69(1)|p.C176fs*68(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.C176del(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.H178fs*3(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGTGGGGGCAGCGCCTCAC	0.652		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		267	Substitution - Missense(224)|Deletion - Frameshift(18)|Deletion - In frame(13)|Whole gene deletion(8)|Complex - deletion inframe(3)|Insertion - Frameshift(1)	p.C176F(102)|p.C176Y(56)|p.C176S(19)|p.C176W(11)|p.C176R(8)|p.C176fs*71(7)|p.0?(7)|p.C176*(6)|p.C176_R181delCPHHER(3)|p.R174fs*24(3)|p.C176G(3)|p.C176fs*5(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.K164_P219del(1)|p.C176fs*65(1)|p.C176_P177delCP(1)|p.V173fs*69(1)|p.C176fs*68(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.C44Y(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R42fs*24(1)|p.C83Y(1)|p.C176fs*72(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.C176del(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.C176fs*6(1)|p.R174fs*3(1)	lung(42)|large_intestine(38)|upper_aerodigestive_tract(36)|oesophagus(26)|breast(26)|liver(20)|ovary(19)|haematopoietic_and_lymphoid_tissue(13)|stomach(10)|central_nervous_system(9)|bone(9)|urinary_tract(7)|genital_tract(2)|skin(2)|pancreas(2)|prostate(2)|adrenal_gland(1)|vulva(1)|biliary_tract(1)|endometrium(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245						c.(526-528)TGC>TAC	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							49.0	49.0	49.0					17																	7578403		2203	4300	6503	SO:0001583	missense	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7578403C>T	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.527G>A	17.37:g.7578403C>T	ENSP00000269305:p.Cys176Tyr	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_uc002gig.1_Missense_Mutation_p.C176Y|TP53_uc002gih.2_Missense_Mutation_p.C176Y|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.C44Y|TP53_uc010cng.1_Missense_Mutation_p.C44Y|TP53_uc002gii.1_Missense_Mutation_p.C44Y|TP53_uc010cnh.1_Missense_Mutation_p.C176Y|TP53_uc010cni.1_Missense_Mutation_p.C176Y|TP53_uc002gij.2_Missense_Mutation_p.C176Y|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.C83Y|TP53_uc002gio.2_Missense_Mutation_p.C44Y|TP53_uc010vug.1_Missense_Mutation_p.C137Y	p.C176Y	NM_001126112	NP_001119584	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	5	721	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	176		CP -> FS (in a sporadic cancer; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in sporadic cancers; somatic mutation).|C -> F (in sporadic cancers; somatic mutation).	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).	Zinc.	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	c.527G>A	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.497871	0.85069	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99982	-10.62;-10.62;-10.62;-10.62;-10.62;-10.62;-10.62;-10.62	5.59	4.61	0.57282	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.092184	0.85682	D	0.000000	D	0.99981	0.9994	M	0.92923	3.36	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.999;0.996;0.997;0.998;0.998;0.997;0.997	D	0.96187	0.9135	10	0.87932	D	0	-18.1821	13.8336	0.63395	0.1543:0.8457:0.0:0.0	.	137;176;176;83;176;176;176	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	Y	176;176;176;176;176;176;165;83;44;83;44	ENSP00000410739:C176Y;ENSP00000352610:C176Y;ENSP00000269305:C176Y;ENSP00000398846:C176Y;ENSP00000391127:C176Y;ENSP00000391478:C176Y;ENSP00000425104:C44Y;ENSP00000423862:C83Y	ENSP00000269305:C176Y	C	-	2	0	TP53	7519128	1.000000	0.71417	0.999000	0.59377	0.851000	0.48451	7.775000	0.85489	1.472000	0.48140	0.655000	0.94253	TGC		0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		21	16	0	0	0	0.005443	0	21	16				
MYH1	4619	broad.mit.edu	37	17	10419599	10419599	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr17:10419599C>A	ENST00000226207.5	-	4	359	c.265G>T	c.(265-267)Gag>Tag	p.E89*	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	89	Myosin motor.				muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.E89*(1)		NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						GCCATGTCCTCGATCTTGTCA	0.478																																							uc002gmo.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						c.(265-267)GAG>TAG		myosin, heavy chain 1, skeletal muscle, adult							297.0	264.0	275.0					17																	10419599		2203	4300	6503	SO:0001587	stop_gained	4619					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity	g.chr17:10419599C>A		CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.265G>T	17.37:g.10419599C>A	ENSP00000226207:p.Glu89*					uc002gml.1_Intron	p.E89*	NM_005963	NP_005954	P12882	MYH1_HUMAN			4	359	-			89			Myosin head-like.		Q14CA4|Q9Y622	Nonsense_Mutation	SNP	ENST00000226207.5	37	c.265G>T	CCDS11155.1	.	.	.	.	.	.	.	.	.	.	C	37	6.123378	0.97305	.	.	ENSG00000109061	ENST00000226207;ENST00000379814	.	.	.	5.39	5.39	0.77823	.	0.000000	0.43579	U	0.000542	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.3405	0.94339	0.0:1.0:0.0:0.0	.	.	.	.	X	89	.	ENSP00000226207:E89X	E	-	1	0	MYH1	10360324	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.921000	0.70028	2.791000	0.96007	0.655000	0.94253	GAG		0.478	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252725.1	NM_005963		83	78	1	0	1.02218e-41	0.01441	1.45642e-41	83	78				
MYH1	4619	broad.mit.edu	37	17	10419608	10419608	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr17:10419608C>A	ENST00000226207.5	-	4	350	c.256G>T	c.(256-258)Gac>Tac	p.D86Y	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	86	Myosin motor.				muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.D86Y(1)		NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						TCGATCTTGTCATATTTGGGA	0.473																																							uc002gmo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						c.(256-258)GAC>TAC		myosin, heavy chain 1, skeletal muscle, adult							299.0	267.0	278.0					17																	10419608		2203	4300	6503	SO:0001583	missense	4619					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity	g.chr17:10419608C>A		CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.256G>T	17.37:g.10419608C>A	ENSP00000226207:p.Asp86Tyr					uc002gml.1_Intron	p.D86Y	NM_005963	NP_005954	P12882	MYH1_HUMAN			4	350	-			86			Myosin head-like.		Q14CA4|Q9Y622	Missense_Mutation	SNP	ENST00000226207.5	37	c.256G>T	CCDS11155.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.184699	0.78677	.	.	ENSG00000109061	ENST00000226207;ENST00000379814	T	0.72282	-0.64	5.39	5.39	0.77823	Myosin head, motor domain (1);	0.000000	0.45126	U	0.000384	T	0.80204	0.4580	M	0.88842	2.985	0.58432	D	0.999999	B	0.18461	0.028	B	0.32465	0.146	T	0.78417	-0.2212	10	0.52906	T	0.07	.	19.3405	0.94339	0.0:1.0:0.0:0.0	.	86	P12882	MYH1_HUMAN	Y	86	ENSP00000226207:D86Y	ENSP00000226207:D86Y	D	-	1	0	MYH1	10360333	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	5.833000	0.69349	2.791000	0.96007	0.655000	0.94253	GAC		0.473	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252725.1	NM_005963		84	79	1	0	9.07295e-45	0.01441	1.31246e-44	84	79				
DNAH9	1770	broad.mit.edu	37	17	11725838	11725838	+	Silent	SNP	C	C	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr17:11725838C>A	ENST00000262442.4	+	47	9002	c.8934C>A	c.(8932-8934)atC>atA	p.I2978I	DNAH9_ENST00000454412.2_Silent_p.I2978I	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	2978	AAA 4. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.I2978I(1)		NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GCACAGCCATCCACTGGTTCC	0.537																																							uc002gne.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20						c.(8932-8934)ATC>ATA		dynein, axonemal, heavy chain 9 isoform 2							137.0	131.0	133.0					17																	11725838		2203	4300	6503	SO:0001819	synonymous_variant	1770				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr17:11725838C>A	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.8934C>A	17.37:g.11725838C>A						DNAH9_uc010coo.2_Silent_p.I2272I	p.I2978I	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)	47	9002	+		Breast(5;0.0122)|all_epithelial(5;0.131)	2978			AAA 4 (By similarity).		A2VCQ8|O15064|O95494|Q9NQ28	Silent	SNP	ENST00000262442.4	37	c.8934C>A	CCDS11160.1																																																																																				0.537	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372		84	47	1	0	4.82855e-46	0.01441	7.01158e-46	84	47				
ZNF624	57547	broad.mit.edu	37	17	16527059	16527059	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr17:16527059T>C	ENST00000311331.7	-	6	1232	c.1141A>G	c.(1141-1143)Att>Gtt	p.I381V		NM_020787.3	NP_065838.2	Q9P2J8	ZN624_HUMAN	zinc finger protein 624	381					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I381V(1)		breast(4)|endometrium(1)|kidney(1)|large_intestine(8)|lung(9)|ovary(1)|prostate(1)|skin(1)	26				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		CCAGTTTGAATTCTCTGGTGC	0.388																																					NSCLC(186;1023 2134 13330 38202 39800)	NSCLC(186;1023 2134 13330 38202 39800)	uc010cpi.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(1141-1143)ATT>GTT		zinc finger protein 624							85.0	86.0	86.0					17																	16527059		2203	4300	6503	SO:0001583	missense	57547				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr17:16527059T>C	AB037770	CCDS11180.1	17p11.2	2013-01-08			ENSG00000197566	ENSG00000197566		"""Zinc fingers, C2H2-type"", ""-"""	29254	protein-coding gene	gene with protein product						10718198	Standard	NM_020787		Approved	KIAA1349	uc010cpi.2	Q9P2J8	OTTHUMG00000058996	ENST00000311331.7:c.1141A>G	17.37:g.16527059T>C	ENSP00000310472:p.Ile381Val						p.I381V	NM_020787	NP_065838	Q9P2J8	ZN624_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)	6	1224	-			381			C2H2-type 4; degenerate.		Q3SY62|Q3SY63|Q6ZN27	Missense_Mutation	SNP	ENST00000311331.7	37	c.1141A>G	CCDS11180.1	.	.	.	.	.	.	.	.	.	.	T	8.588	0.883925	0.17467	.	.	ENSG00000197566	ENST00000311331	T	0.16324	2.35	2.79	0.459	0.16678	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08582	0.0213	N	0.16098	0.37	0.22240	N	0.99927	B	0.06786	0.001	B	0.08055	0.003	T	0.32079	-0.9920	9	0.44086	T	0.13	.	4.0579	0.09824	0.0:0.126:0.2123:0.6617	.	381	Q9P2J8	ZN624_HUMAN	V	381	ENSP00000310472:I381V	ENSP00000310472:I381V	I	-	1	0	ZNF624	16467784	0.000000	0.05858	0.998000	0.56505	0.976000	0.68499	0.250000	0.18235	0.056000	0.16144	0.460000	0.39030	ATT		0.388	ZNF624-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130512.3	XM_047617		79	45	0	0	0	0.01441	0	79	45				
MYO15A	51168	broad.mit.edu	37	17	18023155	18023155	+	Silent	SNP	G	G	A	rs527681283		TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr17:18023155G>A	ENST00000205890.5	+	2	1379	c.1041G>A	c.(1039-1041)gcG>gcA	p.A347A		NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	347					inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.A347A(1)		breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					ATCCCTATGCGCCGTACGACG	0.597													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15799	0.0		0.0	False		,,,				2504	0.0						uc010vxh.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(4)|ovary(2)|pancreas(1)|breast(1)|central_nervous_system(1)	9						c.(1039-1041)GCG>GCA		myosin XV							75.0	85.0	82.0					17																	18023155		2031	4177	6208	SO:0001819	synonymous_variant	51168				sensory perception of sound	cytoplasm|myosin complex|stereocilium	actin binding|ATP binding|calmodulin binding|motor activity	g.chr17:18023155G>A	AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.1041G>A	17.37:g.18023155G>A							p.A347A	NM_016239	NP_057323	Q9UKN7	MYO15_HUMAN			2	1379	+	all_neural(463;0.228)		347			Myosin head-like.		B4DFC7	Silent	SNP	ENST00000205890.5	37	c.1041G>A	CCDS42271.1																																																																																				0.597	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132048.1	NM_016239		10	74	0	0	0	0.006214	0	10	74				
EPN2	22905	broad.mit.edu	37	17	19232056	19232056	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr17:19232056G>T	ENST00000314728.5	+	8	1664	c.1180G>T	c.(1180-1182)Ggg>Tgg	p.G394W	EPN2_ENST00000395618.3_Missense_Mutation_p.G109W|EPN2_ENST00000347697.2_Missense_Mutation_p.G337W|EPN2_ENST00000395626.1_Missense_Mutation_p.G394W|EPN2_ENST00000571254.1_Missense_Mutation_p.G330W|EPN2_ENST00000575595.1_Missense_Mutation_p.G102W|EPN2_ENST00000395620.2_Missense_Mutation_p.G337W	NM_014964.4	NP_055779.2	O95208	EPN2_HUMAN	epsin 2	394	6 X 3 AA repeats of [DE]-P-W.				embryonic organ development (GO:0048568)|endocytosis (GO:0006897)|in utero embryonic development (GO:0001701)|Notch signaling pathway (GO:0007219)	clathrin coat of endocytic vesicle (GO:0030128)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	lipid binding (GO:0008289)	p.G394W(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	19	all_cancers(12;3.11e-05)|all_epithelial(12;0.00121)|Hepatocellular(7;0.00345)|Breast(13;0.143)					TGACCCATGGGGGGTGCCCAC	0.607																																							uc002gvd.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1180-1182)GGG>TGG		epsin 2 isoform b							57.0	53.0	54.0					17																	19232056		2203	4300	6503	SO:0001583	missense	22905				endocytosis		lipid binding	g.chr17:19232056G>T	AB028988	CCDS11203.1, CCDS11204.1, CCDS42277.1	17p11.2	2012-11-19			ENSG00000072134	ENSG00000072134			18639	protein-coding gene	gene with protein product	"""Eps15 binding protein"""	607263				10567358	Standard	NM_014964		Approved	KIAA1065, EHB21	uc002gvd.4	O95208	OTTHUMG00000178447	ENST00000314728.5:c.1180G>T	17.37:g.19232056G>T	ENSP00000320543:p.Gly394Trp					EPN2_uc010cql.1_Missense_Mutation_p.G103W|EPN2_uc002gve.3_Missense_Mutation_p.G337W|EPN2_uc002gvf.3_Missense_Mutation_p.G109W|EPN2_uc010vyo.1_Missense_Mutation_p.G102W|EPN2_uc010vyp.1_Missense_Mutation_p.G330W|EPN2_uc010vyq.1_Missense_Mutation_p.G331W|EPN2_uc002gvh.1_Missense_Mutation_p.G394W|EPN2_uc002gvj.3_Missense_Mutation_p.G57W	p.G394W	NM_014964	NP_055779	O95208	EPN2_HUMAN			8	1628	+	all_cancers(12;3.11e-05)|all_epithelial(12;0.00121)|Hepatocellular(7;0.00345)|Breast(13;0.143)		394			6 X 3 AA repeats of [DE]-P-W.		A8MTV8|B3KRX8|E9PBC2|O95207|Q52LD0|Q9H7Z2|Q9UPT7	Missense_Mutation	SNP	ENST00000314728.5	37	c.1180G>T	CCDS11203.1	.	.	.	.	.	.	.	.	.	.	G	16.43	3.121657	0.56613	.	.	ENSG00000072134	ENST00000347697;ENST00000395618;ENST00000314728;ENST00000395628;ENST00000395620;ENST00000395626	T;T;T;T;T;T	0.37915	2.15;1.96;2.16;1.19;2.15;1.17	5.14	4.16	0.48862	.	0.521279	0.14840	U	0.295329	T	0.62514	0.2434	M	0.80746	2.51	0.58432	D	0.999999	D;D;D;D;D;D;D	0.89917	0.996;0.986;1.0;1.0;1.0;0.996;0.999	P;P;D;D;D;P;D	0.83275	0.855;0.695;0.996;0.996;0.992;0.855;0.989	T	0.66097	-0.6008	10	0.87932	D	0	-8.9187	14.5474	0.68041	0.0749:0.0:0.9251:0.0	.	337;330;102;109;394;337;394	Q52LD0;B7ZKM5;B7Z3A5;A8MTV8;E9PBC1;E9PBC2;O95208	.;.;.;.;.;.;EPN2_HUMAN	W	337;109;394;337;337;394	ENSP00000261495:G337W;ENSP00000378980:G109W;ENSP00000320543:G394W;ENSP00000378990:G337W;ENSP00000378982:G337W;ENSP00000378988:G394W	ENSP00000320543:G394W	G	+	1	0	EPN2	19172649	1.000000	0.71417	0.978000	0.43139	0.088000	0.18126	6.546000	0.73887	2.546000	0.85860	0.561000	0.74099	GGG		0.607	EPN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000132283.3	NM_014964		18	57	1	0	9.86323e-18	0.003954	1.26289e-17	18	57				
MSL1	339287	broad.mit.edu	37	17	38287837	38287837	+	Splice_Site	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr17:38287837G>A	ENST00000398532.4	+	4	1738	c.1423G>A	c.(1423-1425)Gtt>Att	p.V475I	MSL1_ENST00000578648.1_Intron|MSL1_ENST00000579565.1_Splice_Site_p.V212I	NM_001012241.1	NP_001012241.1	Q68DK7	MSL1_HUMAN	male-specific lethal 1 homolog (Drosophila)	475					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)	MSL complex (GO:0072487)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.V274I(1)		endometrium(1)|kidney(2)|large_intestine(2)|lung(2)	7						AGTCTTGGCTGGTGAGTAGAA	0.493																																							uc002hub.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(820-822)GTT>ATT		hampin							169.0	170.0	170.0					17																	38287837		1934	4131	6065	SO:0001630	splice_region_variant	339287				histone H4-K16 acetylation	MSL complex		g.chr17:38287837G>A		CCDS45670.1	17q21.1	2011-03-21			ENSG00000188895	ENSG00000188895			27905	protein-coding gene	gene with protein product		614801				16227571, 16543150	Standard	NM_001012241		Approved	hMSL1, MSL-1, DKFZp686P24239	uc002hua.4	Q68DK7		ENST00000398532.4:c.1423+1G>A	17.37:g.38287837G>A						MSL1_uc002hua.3_Missense_Mutation_p.V212I|MSL1_uc002hud.2_Missense_Mutation_p.V14I	p.V274I	NM_001012241	NP_001012241	Q68DK7	MSL1_HUMAN			4	839	+			475					Q0VF46|Q69Z03	Missense_Mutation	SNP	ENST00000398532.4	37	c.820G>A		.	.	.	.	.	.	.	.	.	.	G	11.33	1.607878	0.28623	.	.	ENSG00000188895	ENST00000339569;ENST00000398532	T	0.40476	1.03	5.74	5.74	0.90152	.	0.264681	0.40144	N	0.001172	T	0.31231	0.0790	N	0.12831	0.26	0.58432	D	0.999992	.	.	.	.	.	.	T	0.09618	-1.0666	8	0.12430	T	0.62	-24.9049	15.4327	0.75116	0.0:0.0:1.0:0.0	.	.	.	.	I	212;475	ENSP00000381543:V475I	ENSP00000341409:V212I	V	+	1	0	MSL1	35541363	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.489000	0.60309	2.720000	0.93068	0.650000	0.86243	GTT		0.493	MSL1-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000447409.2	NM_001012241	Missense_Mutation	65	161	0	0	0	0.01441	0	65	161				
MPP2	4355	broad.mit.edu	37	17	41958159	41958159	+	Silent	SNP	C	C	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr17:41958159C>A	ENST00000461854.1	-	11	1207	c.1122G>T	c.(1120-1122)cgG>cgT	p.R374R	MPP2_ENST00000523501.1_Silent_p.R339R|MPP2_ENST00000269095.4_Silent_p.R350R|MPP2_ENST00000520305.1_Silent_p.R211R|MPP2_ENST00000377184.3_Silent_p.R367R|MPP2_ENST00000536246.1_Silent_p.R339R|MPP2_ENST00000473246.1_5'Flank|MPP2_ENST00000518766.1_Silent_p.R395R			Q14168	MPP2_HUMAN	membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)	374	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)	p.R350R(1)		breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|liver(1)|lung(4)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)	29		Breast(137;0.00314)		BRCA - Breast invasive adenocarcinoma(366;0.12)		CCAGGGTTTTCCGGCGGAACG	0.612											OREG0024443	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc010wip.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1183-1185)CGG>CGT		palmitoylated membrane protein 2							84.0	78.0	80.0					17																	41958159		2203	4300	6503	SO:0001819	synonymous_variant	4355				signal transduction	cell surface|integral to plasma membrane|membrane fraction	guanylate kinase activity	g.chr17:41958159C>A		CCDS11471.1, CCDS62206.1, CCDS62207.1, CCDS62208.1, CCDS62209.1, CCDS62210.1	17q12-q21	2008-07-18			ENSG00000108852	ENSG00000108852			7220	protein-coding gene	gene with protein product	"""MAGUK p55 subfamily member 2"", ""discs large, homolog 2"""	600723		DLG2		7590743	Standard	NM_001278370		Approved	DKFZp761D0712	uc002ieo.1	Q14168	OTTHUMG00000133840	ENST00000461854.1:c.1122G>T	17.37:g.41958159C>A			OREG0024443	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	905	MPP2_uc002ien.1_Silent_p.R367R|MPP2_uc010wim.1_Silent_p.R339R|MPP2_uc002ieo.1_Silent_p.R350R|MPP2_uc010win.1_Silent_p.R211R|MPP2_uc010wio.1_Silent_p.R339R	p.R395R	NM_005374	NP_005365	Q14168	MPP2_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.12)	10	1242	-		Breast(137;0.00314)	374			Guanylate kinase-like.		B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Silent	SNP	ENST00000461854.1	37	c.1185G>T																																																																																					0.612	MPP2-003	KNOWN	non_canonical_polymorphism|basic	protein_coding	protein_coding	OTTHUMT00000258388.2	NM_005374		41	56	1	0	3.05275e-18	0.013114	3.9623e-18	41	56				
KIF2B	84643	broad.mit.edu	37	17	51901812	51901812	+	Missense_Mutation	SNP	A	A	G	rs139282377		TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr17:51901812A>G	ENST00000268919.4	+	1	1574	c.1418A>G	c.(1417-1419)aAg>aGg	p.K473R		NM_032559.4	NP_115948.4	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	473	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.K473R(1)		NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(15)|lung(58)|ovary(5)|prostate(4)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						GAGATTAACAAGAGTCTTCTA	0.512																																							uc002iua.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(3)	8						c.(1417-1419)AAG>AGG		kinesin family member 2B							47.0	44.0	45.0					17																	51901812		2203	4300	6503	SO:0001583	missense	84643				blood coagulation|cell division|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|microtubule|microtubule organizing center|nucleolus|spindle	ATP binding|microtubule motor activity	g.chr17:51901812A>G	AF333335	CCDS32685.1	17q22	2014-08-12			ENSG00000141200	ENSG00000141200		"""Kinesins"""	29443	protein-coding gene	gene with protein product		615142				11416179	Standard	NM_032559		Approved		uc002iua.2	Q8N4N8	OTTHUMG00000177756	ENST00000268919.4:c.1418A>G	17.37:g.51901812A>G	ENSP00000268919:p.Lys473Arg					uc010wna.1_RNA	p.K473R	NM_032559	NP_115948	Q8N4N8	KIF2B_HUMAN			1	1574	+			473			Kinesin-motor.		Q96MA2|Q9BXG6	Missense_Mutation	SNP	ENST00000268919.4	37	c.1418A>G	CCDS32685.1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.405699	0.83230	.	.	ENSG00000141200	ENST00000268919;ENST00000416491	T	0.76839	-1.05	5.73	5.73	0.89815	Kinesin, motor domain (4);	0.000000	0.46758	D	0.000269	T	0.81442	0.4823	L	0.39467	1.215	0.49687	D	0.999816	P	0.41498	0.752	P	0.55615	0.78	T	0.80544	-0.1335	10	0.41790	T	0.15	.	15.5002	0.75691	1.0:0.0:0.0:0.0	.	473	Q8N4N8	KIF2B_HUMAN	R	473;361	ENSP00000268919:K473R	ENSP00000268919:K473R	K	+	2	0	KIF2B	49256811	1.000000	0.71417	0.999000	0.59377	0.952000	0.60782	7.451000	0.80668	2.302000	0.77476	0.533000	0.62120	AAG		0.512	KIF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438854.1	NM_032559		19	54	0	0	0	0.008871	0	19	54				
PRKCA	5578	broad.mit.edu	37	17	64299089	64299089	+	Silent	SNP	C	C	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr17:64299089C>A	ENST00000413366.3	+	1	146	c.120C>A	c.(118-120)atC>atA	p.I40I	PRKCA_ENST00000583361.1_3'UTR	NM_002737.2	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha	40					activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|chondrocyte differentiation (GO:0002062)|desmosome assembly (GO:0002159)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|histone H3-T6 phosphorylation (GO:0035408)|inactivation of MAPK activity (GO:0000188)|induction of positive chemotaxis (GO:0050930)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|mRNA metabolic process (GO:0016071)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|peptidyl-serine autophosphorylation (GO:0036289)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of dense core granule biogenesis (GO:2000707)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of inflammatory response (GO:0050729)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein phosphorylation (GO:0001934)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|regulation of muscle contraction (GO:0006937)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of the force of heart contraction (GO:0002026)|response to interleukin-1 (GO:0070555)|rhodopsin mediated signaling pathway (GO:0016056)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|enzyme binding (GO:0019899)|histone kinase activity (H3-T6 specific) (GO:0035403)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|zinc ion binding (GO:0008270)	p.I40I(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Ingenol Mebutate(DB05013)|Phosphatidylserine(DB00144)|Tamoxifen(DB00675)|Vitamin E(DB00163)	ACAAATTCATCGCGCGCTTCT	0.657																																							uc002jfp.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(4)|large_intestine(1)|stomach(1)|lung(1)|breast(1)|ovary(1)	9						c.(118-120)ATC>ATA		protein kinase C, alpha	Phosphatidylserine(DB00144)|Vitamin E(DB00163)						116.0	102.0	107.0					17																	64299089		2203	4300	6503	SO:0001819	synonymous_variant	5578				activation of phospholipase C activity|energy reserve metabolic process|induction of apoptosis by extracellular signals|intracellular signal transduction|mRNA metabolic process|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of blood vessel endothelial cell migration|regulation of insulin secretion|response to interleukin-1|synaptic transmission	cytosol|endoplasmic reticulum|membrane fraction|nucleoplasm|plasma membrane	ATP binding|enzyme binding|histone kinase activity (H3-T6 specific)|protein kinase C activity|zinc ion binding	g.chr17:64299089C>A		CCDS11664.1	17q22-q24	2009-07-10				ENSG00000154229	2.7.11.1		9393	protein-coding gene	gene with protein product		176960		PKCA			Standard	NM_002737		Approved		uc002jfp.1	P17252		ENST00000413366.3:c.120C>A	17.37:g.64299089C>A						PRKCA_uc002jfo.1_5'UTR	p.I40I	NM_002737	NP_002728	P17252	KPCA_HUMAN	BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		1	164	+			40			Phorbol-ester/DAG-type 1.		B5BU22|Q15137|Q32M72|Q96RE4	Silent	SNP	ENST00000413366.3	37	c.120C>A	CCDS11664.1																																																																																				0.657	PRKCA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446976.1			38	53	1	0	7.04047e-22	0.005524	9.32986e-22	38	53				
BPTF	2186	broad.mit.edu	37	17	65850144	65850144	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr17:65850144G>T	ENST00000321892.4	+	2	763	c.702G>T	c.(700-702)gaG>gaT	p.E234D	BPTF_ENST00000335221.5_Missense_Mutation_p.E234D|BPTF_ENST00000424123.3_Missense_Mutation_p.E95D|BPTF_ENST00000306378.6_Missense_Mutation_p.E234D			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	234					anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.E234D(2)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			AGTCCTCTGAGGATTTAATGG	0.428																																							uc002jgf.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|skin(2)	4						c.(700-702)GAG>GAT		bromodomain PHD finger transcription factor							126.0	125.0	125.0					17																	65850144		2203	4300	6503	SO:0001583	missense	2186				brain development|chromatin remodeling|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|NURF complex	sequence-specific DNA binding|transcription factor binding|zinc ion binding	g.chr17:65850144G>T	AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.702G>T	17.37:g.65850144G>T	ENSP00000315454:p.Glu234Asp					BPTF_uc002jge.2_Missense_Mutation_p.E234D|BPTF_uc010wqm.1_Missense_Mutation_p.E234D	p.E234D	NM_182641	NP_872579	Q12830	BPTF_HUMAN	BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)		2	763	+	all_cancers(12;6e-11)		234					Q6NX67|Q7Z7D6|Q9UIG2	Missense_Mutation	SNP	ENST00000321892.4	37	c.702G>T		.	.	.	.	.	.	.	.	.	.	G	12.43	1.936025	0.34189	.	.	ENSG00000171634	ENST00000544491;ENST00000306378;ENST00000335221;ENST00000321892;ENST00000544778	T;T;T	0.64260	-0.03;-0.07;-0.09	5.88	4.92	0.64577	.	.	.	.	.	T	0.65821	0.2728	L	0.32530	0.975	0.58432	D	0.999993	D;D;D	0.69078	0.996;0.997;0.996	P;D;D	0.74674	0.708;0.941;0.984	T	0.61267	-0.7097	9	0.20046	T	0.44	-13.3463	10.9314	0.47220	0.1419:0.0:0.8581:0.0	.	234;234;234	Q12830;Q12830-2;Q12830-4	BPTF_HUMAN;.;.	D	139;234;234;234;95	ENSP00000307208:E234D;ENSP00000334351:E234D;ENSP00000315454:E234D	ENSP00000307208:E234D	E	+	3	2	BPTF	63280606	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.001000	0.57046	1.487000	0.48415	0.655000	0.94253	GAG		0.428	BPTF-201	KNOWN	basic	protein_coding	protein_coding		NM_182641, NM_004459		79	140	1	0	1.45978e-39	0.01441	2.07212e-39	79	140				
LAMA3	3909	broad.mit.edu	37	18	21474925	21474925	+	Missense_Mutation	SNP	A	A	C			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr18:21474925A>C	ENST00000313654.9	+	44	5757	c.5516A>C	c.(5515-5517)cAg>cCg	p.Q1839P	LAMA3_ENST00000269217.6_Missense_Mutation_p.Q230P|LAMA3_ENST00000587184.1_Missense_Mutation_p.Q230P|LAMA3_ENST00000399516.3_Missense_Mutation_p.Q1839P|AC010754.1_ENST00000408462.1_RNA	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	1839	Domain II and I.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)	p.Q1839P(1)|p.Q230P(1)		NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					ATGGGCGAGCAGCTCCGCCTG	0.617																																							uc002kuq.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(8)|skin(2)|central_nervous_system(1)	11						c.(5515-5517)CAG>CCG		laminin alpha 3 subunit isoform 1	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						53.0	45.0	48.0					18																	21474925		2203	4300	6503	SO:0001583	missense	3909				cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity	g.chr18:21474925A>C	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.5516A>C	18.37:g.21474925A>C	ENSP00000324532:p.Gln1839Pro					LAMA3_uc002kur.2_Missense_Mutation_p.Q1839P|LAMA3_uc002kus.3_Missense_Mutation_p.Q230P|LAMA3_uc002kut.3_Missense_Mutation_p.Q230P	p.Q1839P	NM_198129	NP_937762	Q16787	LAMA3_HUMAN			44	5602	+	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)		1839			Domain II and I.		B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	ENST00000313654.9	37	c.5516A>C	CCDS42419.1	.	.	.	.	.	.	.	.	.	.	A	18.61	3.661292	0.67700	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000269217	T;T;T	0.18810	2.19;2.2;3.72	5.91	5.91	0.95273	.	.	.	.	.	T	0.16471	0.0396	N	0.08118	0	0.39714	D	0.971373	B;P;P;P	0.41546	0.447;0.507;0.754;0.692	B;B;P;B	0.45506	0.222;0.284;0.483;0.275	T	0.16660	-1.0395	9	0.36615	T	0.2	.	15.3247	0.74150	1.0:0.0:0.0:0.0	.	230;230;1839;1839	Q6VU69;B0YJ33;Q6VU67;Q16787	.;.;.;LAMA3_HUMAN	P	1839;1839;230	ENSP00000324532:Q1839P;ENSP00000382432:Q1839P;ENSP00000269217:Q230P	ENSP00000269217:Q230P	Q	+	2	0	LAMA3	19728923	1.000000	0.71417	0.991000	0.47740	0.985000	0.73830	6.926000	0.75835	2.261000	0.74972	0.533000	0.62120	CAG		0.617	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129		7	11	0	0	0	0.007413	0	7	11				
ASXL3	80816	broad.mit.edu	37	18	31325019	31325019	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr18:31325019C>A	ENST00000269197.5	+	12	5207	c.5207C>A	c.(5206-5208)tCa>tAa	p.S1736*		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	1736					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S1736*(1)		breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						GCAGGGAGCTCAGGCTGTCGT	0.532																																							uc010dmg.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(5206-5208)TCA>TAA		additional sex combs like 3							73.0	75.0	74.0					18																	31325019		2027	4200	6227	SO:0001587	stop_gained	80816				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding	g.chr18:31325019C>A	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.5207C>A	18.37:g.31325019C>A	ENSP00000269197:p.Ser1736*					ASXL3_uc002kxq.2_Nonsense_Mutation_p.S1443*	p.S1736*	NM_030632	NP_085135	Q9C0F0	ASXL3_HUMAN			12	5262	+			1736					Q6ZMX6|Q96MU3|Q9UFC5	Nonsense_Mutation	SNP	ENST00000269197.5	37	c.5207C>A	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	C	39	7.393168	0.98255	.	.	ENSG00000141431	ENST00000269197	.	.	.	5.86	5.86	0.93980	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.1865	0.98220	0.0:1.0:0.0:0.0	.	.	.	.	X	1736	.	ENSP00000269197:S1736X	S	+	2	0	ASXL3	29579017	0.998000	0.40836	0.183000	0.23137	0.040000	0.13550	4.177000	0.58276	2.775000	0.95449	0.655000	0.94253	TCA		0.532	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2			22	18	1	0	1.85244e-09	0.00333	2.11468e-09	22	18				
SETBP1	26040	broad.mit.edu	37	18	42532073	42532073	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr18:42532073T>A	ENST00000282030.5	+	4	3064	c.2768T>A	c.(2767-2769)aTt>aAt	p.I923N		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	923						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.I869N(1)|p.I923N(1)		NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		AAGCATCTCATTGTGGACAAC	0.537									Schinzel-Giedion syndrome																														uc010dni.2		NA																	2	Substitution - Missense(2)		lung(2)	upper_aerodigestive_tract(2)|large_intestine(1)	3						c.(2767-2769)ATT>AAT		SET binding protein 1 isoform a							39.0	39.0	39.0					18																	42532073		2203	4300	6503	SO:0001583	missense	26040	Schinzel-Giedion_syndrome	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome		nucleus	DNA binding	g.chr18:42532073T>A	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.2768T>A	18.37:g.42532073T>A	ENSP00000282030:p.Ile923Asn						p.I923N	NM_015559	NP_056374	Q9Y6X0	SETBP_HUMAN		Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)	4	3064	+			923					A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	ENST00000282030.5	37	c.2768T>A	CCDS11923.2	.	.	.	.	.	.	.	.	.	.	T	10.14	1.269530	0.23221	.	.	ENSG00000152217	ENST00000282030	D	0.89123	-2.47	6.17	6.17	0.99709	.	0.164207	0.52532	D	0.000067	T	0.82051	0.4953	N	0.08118	0	0.36846	D	0.887635	P	0.36315	0.547	B	0.41088	0.347	D	0.84458	0.0592	10	0.33940	T	0.23	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	923	Q9Y6X0	SETBP_HUMAN	N	923	ENSP00000282030:I923N	ENSP00000282030:I923N	I	+	2	0	SETBP1	40786071	1.000000	0.71417	0.963000	0.40424	0.981000	0.71138	5.796000	0.69080	2.371000	0.80710	0.533000	0.62120	ATT		0.537	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255854.4	NM_001130110		19	20	0	0	0	0.012319	0	19	20				
STK11	6794	broad.mit.edu	37	19	1207078	1207078	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr19:1207078G>T	ENST00000326873.7	+	1	1339	c.166G>T	c.(166-168)Ggg>Tgg	p.G56W	STK11_ENST00000585748.1_Intron	NM_000455.4	NP_000446.1	Q15831	STK11_HUMAN	serine/threonine kinase 11	56	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.|Sufficient for interaction with SIRT1.				activation of protein kinase activity (GO:0032147)|anoikis (GO:0043276)|autophagy (GO:0006914)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|energy reserve metabolic process (GO:0006112)|establishment of cell polarity (GO:0030010)|glucose homeostasis (GO:0042593)|Golgi localization (GO:0051645)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of protein kinase B signaling (GO:0051896)|regulation of Wnt signaling pathway (GO:0030111)|response to glucagon (GO:0033762)|response to ionizing radiation (GO:0010212)|response to lipid (GO:0033993)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|T cell receptor signaling pathway (GO:0050852)|TCR signalosome assembly (GO:0036399)|tissue homeostasis (GO:0001894)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|TCR signalosome (GO:0036398)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|p53 binding (GO:0002039)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.0?(20)|p.?(3)|p.G56W(2)|p.G56fs*107(1)|p.G56fs*4(1)		biliary_tract(1)|breast(3)|cervix(35)|gastrointestinal_tract_(site_indeterminate)(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|liver(1)|lung(219)|oesophagus(1)|ovary(4)|pancreas(6)|prostate(2)|skin(15)|small_intestine(1)|stomach(9)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	328		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		GGACCTGCTGGGGGAAGGCTC	0.612		14	"""D, Mis, N, F, S"""		"""NSCLC, pancreatic"""	"""jejunal harmartoma, ovarian, testicular, pancreatic"""			Peutz-Jeghers syndrome	TSP Lung(3;<1E-08)																													uc002lrl.1		14	yes	Rec	yes	Peutz-Jeghers syndrome	19	19p13.3	6794	D|Mis|N|F|S	serine/threonine kinase 11 gene (LKB1)			"""E, M, O"""		jejunal harmartoma|ovarian|testicular|pancreatic	NSCLC|pancreatic		27	Whole gene deletion(20)|Substitution - Missense(2)|Deletion - Frameshift(2)|Unknown(2)|Insertion - Frameshift(1)	p.0?(19)|p.?(3)|p.G56V(1)|p.G56W(1)|p.G56fs*107(1)|p.G56fs*4(1)|p.G52_P179del(1)	cervix(15)|lung(7)|skin(1)|oesophagus(1)|ovary(1)|kidney(1)|pancreas(1)	lung(174)|cervix(35)|skin(15)|large_intestine(12)|pancreas(6)|gastrointestinal_tract_(site_indeterminate)(5)|stomach(4)|ovary(4)|breast(2)|upper_aerodigestive_tract(1)|testis(1)|liver(1)|biliary_tract(1)|small_intestine(1)|urinary_tract(1)|oesophagus(1)|prostate(1)|kidney(1)	266						c.(166-168)GGG>TGG		serine/threonine protein kinase 11							41.0	45.0	44.0					19																	1207078		2084	4198	6282	SO:0001583	missense	6794	Peutz-Jeghers_syndrome	Familial Cancer Database	PJS, Hamartous Intestinal Polyposis	anoikis|cell cycle arrest|energy reserve metabolic process|insulin receptor signaling pathway|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr19:1207078G>T	U63333	CCDS45896.1	19p13.3	2014-09-17	2005-12-13			ENSG00000118046			11389	protein-coding gene	gene with protein product	"""polarization-related protein LKB1"""	602216	"""serine/threonine kinase 11 (Peutz-Jeghers syndrome)"""			9425897	Standard	XM_005259617		Approved	PJS, LKB1	uc002lrl.1	Q15831		ENST00000326873.7:c.166G>T	19.37:g.1207078G>T	ENSP00000324856:p.Gly56Trp	TSP Lung(3;<1E-08)					p.G56W	NM_000455	NP_000446	Q15831	STK11_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)	1	1281	+		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)	56			ATP (By similarity).|Protein kinase.		B2RBX7|E7EW76	Missense_Mutation	SNP	ENST00000326873.7	37	c.166G>T	CCDS45896.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.845776	0.91197	.	.	ENSG00000118046	ENST00000326873;ENST00000405031	D	0.83075	-1.68	3.9	3.9	0.45041	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.95245	0.8458	H	0.99609	4.655	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97421	1.0009	10	0.87932	D	0	-36.2984	14.9008	0.70678	0.0:0.0:1.0:0.0	.	56	Q15831	STK11_HUMAN	W	56	ENSP00000324856:G56W	ENSP00000324856:G56W	G	+	1	0	STK11	1158078	1.000000	0.71417	0.992000	0.48379	0.936000	0.57629	9.527000	0.98044	1.733000	0.51620	0.462000	0.41574	GGG		0.612	STK11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449839.3	NM_000455		17	14	1	0	2.35188e-11	0.006122	2.74266e-11	17	14				
HNRNPM	4670	broad.mit.edu	37	19	8550658	8550658	+	Missense_Mutation	SNP	G	G	T	rs534215217		TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr19:8550658G>T	ENST00000325495.4	+	14	1387	c.1346G>T	c.(1345-1347)cGc>cTc	p.R449L	HNRNPM_ENST00000348943.3_Missense_Mutation_p.R410L	NM_005968.4	NP_005959.2	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M	449	27 X 6 AA repeats of [GEVSTPAN]-[ILMV]- [DE]-[RH]-[MLVI]-[GAV].				alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|RNA binding (GO:0003723)	p.R449L(1)		endometrium(5)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)	25						TCCGTGGAGCGCATGGGCTCC	0.692																																							uc010dwe.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1345-1347)CGC>CTC		heterogeneous nuclear ribonucleoprotein M							59.0	65.0	63.0					19																	8550658		2203	4298	6501	SO:0001583	missense	4670				alternative nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|integral to plasma membrane|nuclear matrix|nucleolus|paraspeckles	nucleotide binding|protein domain specific binding|RNA binding	g.chr19:8550658G>T	L03532	CCDS12203.1, CCDS12204.1	19p13.2	2013-06-12		2008-04-18	ENSG00000099783	ENSG00000099783		"""RNA binding motif (RRM) containing"""	5046	protein-coding gene	gene with protein product	"""CEA receptor"""	160994		NAGR1, HNRPM		8441656, 7558047	Standard	NM_005968		Approved	HTGR1, HNRNPM4, HNRPM4, CEAR	uc010dwe.3	P52272	OTTHUMG00000182383	ENST00000325495.4:c.1346G>T	19.37:g.8550658G>T	ENSP00000325376:p.Arg449Leu					HNRNPM_uc010xke.1_Missense_Mutation_p.R395L|HNRNPM_uc010dwd.2_Missense_Mutation_p.R410L|HNRNPM_uc002mka.2_Missense_Mutation_p.R314L|HNRNPM_uc002mkb.1_5'Flank	p.R449L	NM_005968	NP_005959	P52272	HNRPM_HUMAN			14	1426	+			449			7.|27 X 6 AA repeats of [GEVSTPAN]-[ILMV]- [DE]-[RH]-[MLVI]-[GAV].		Q15584|Q8WZ44|Q96H56|Q9BWL9|Q9Y492	Missense_Mutation	SNP	ENST00000325495.4	37	c.1346G>T	CCDS12203.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.942338	0.73672	.	.	ENSG00000099783	ENST00000325495;ENST00000348943;ENST00000544159;ENST00000539473	T;T	0.19806	2.12;2.46	5.9	5.9	0.94986	.	0.437675	0.29040	N	0.013325	T	0.51227	0.1662	M	0.79805	2.47	0.58432	D	0.999998	B;D;B;B	0.63880	0.418;0.993;0.09;0.116	B;D;B;B	0.71184	0.149;0.972;0.066;0.026	T	0.52049	-0.8627	10	0.87932	D	0	.	18.8342	0.92155	0.0:0.0:1.0:0.0	.	289;449;410;334	Q7KYM9;P52272;P52272-2;Q59ES8	.;HNRPM_HUMAN;.;.	L	449;410;334;6	ENSP00000325376:R449L;ENSP00000325732:R410L	ENSP00000325376:R449L	R	+	2	0	HNRNPM	8456658	1.000000	0.71417	1.000000	0.80357	0.781000	0.44180	9.346000	0.97056	2.793000	0.96121	0.591000	0.81541	CGC		0.692	HNRNPM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460894.1			69	62	1	0	2.72187e-29	0.01441	3.76492e-29	69	62				
MUC16	94025	broad.mit.edu	37	19	9086155	9086155	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr19:9086155G>C	ENST00000397910.4	-	1	5863	c.5660C>G	c.(5659-5661)tCt>tGt	p.S1887C		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	1887	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.S1887C(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTTTCCCATAGACAGGGACTT	0.502																																							uc002mkp.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(5659-5661)TCT>TGT		mucin 16							74.0	70.0	71.0					19																	9086155		1943	4140	6083	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9086155G>C	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.5660C>G	19.37:g.9086155G>C	ENSP00000381008:p.Ser1887Cys						p.S1887C	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN			1	5864	-			1887			Ser-rich.|Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.5660C>G	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	0.355	-0.942709	0.02322	.	.	ENSG00000181143	ENST00000397910	T	0.02737	4.18	0.225	0.225	0.15325	.	.	.	.	.	T	0.04137	0.0115	N	0.08118	0	.	.	.	D	0.67145	0.996	D	0.65773	0.938	T	0.45352	-0.9267	7	0.87932	D	0	.	.	.	.	.	1887	B5ME49	.	C	1887	ENSP00000381008:S1887C	ENSP00000381008:S1887C	S	-	2	0	MUC16	8947155	0.000000	0.05858	0.010000	0.14722	0.010000	0.07245	0.081000	0.14823	0.300000	0.22699	0.305000	0.20034	TCT		0.502	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		22	24	0	0	0	0.012319	0	22	24				
OR7E24	26648	broad.mit.edu	37	19	9361887	9361887	+	Silent	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr19:9361887G>A	ENST00000456448.1	+	1	282	c.168G>A	c.(166-168)acG>acA	p.T56T		NM_001079935.1	NP_001073404.1	Q6IFN5	O7E24_HUMAN	olfactory receptor, family 7, subfamily E, member 24	56						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T56T(1)		endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)	16						ACCTGGTCACGGTGCTGGGGA	0.577																																							uc002mlb.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(166-168)ACG>ACA		olfactory receptor, family 7, subfamily E,							54.0	52.0	53.0					19																	9361887		2203	4300	6503	SO:0001819	synonymous_variant	26648				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr19:9361887G>A	Y10529	CCDS45955.1	19p13.2	2012-08-09	2004-03-04	2004-03-05		ENSG00000237521		"""GPCR / Class A : Olfactory receptors"""	8396	protein-coding gene	gene with protein product			"""olfactory receptor, family 7, subfamily E, member 24 pseudogene"""	OR7E24P		9268701	Standard	NM_001079935		Approved	OR19-8, HSHT2, OR7E24Q	uc002mlb.1	Q6IFN5		ENST00000456448.1:c.168G>A	19.37:g.9361887G>A							p.T56T	NM_001079935	NP_001073404	Q6IFN5	O7E24_HUMAN			1	168	+			56			Helical; Name=1; (Potential).		B9EJD9|Q9UPJ1	Silent	SNP	ENST00000456448.1	37	c.168G>A	CCDS45955.1																																																																																				0.577	OR7E24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449006.1			32	20	0	0	0	0.003755	0	32	20				
KEAP1	9817	broad.mit.edu	37	19	10600419	10600419	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr19:10600419T>C	ENST00000171111.5	-	4	1983	c.1436A>G	c.(1435-1437)gAc>gGc	p.D479G	CTC-429L19.3_ENST00000592671.1_RNA|KEAP1_ENST00000393623.2_Missense_Mutation_p.D479G|KEAP1_ENST00000588024.1_5'Flank	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	479					cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)		p.D479G(1)		breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	GTTTGTCCCGTCAAAGCCCCC	0.582																																							uc002moq.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(12)|breast(3)|ovary(1)|pancreas(1)	17						c.(1435-1437)GAC>GGC		kelch-like ECH-associated protein 1							88.0	71.0	77.0					19																	10600419		2203	4300	6503	SO:0001583	missense	9817				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding	g.chr19:10600419T>C	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.1436A>G	19.37:g.10600419T>C	ENSP00000171111:p.Asp479Gly					KEAP1_uc002mop.1_Missense_Mutation_p.D197G|KEAP1_uc002mor.1_Missense_Mutation_p.D479G	p.D479G	NM_012289	NP_036421	Q14145	KEAP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		4	1592	-			479			Kelch 4.		B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Missense_Mutation	SNP	ENST00000171111.5	37	c.1436A>G	CCDS12239.1	.	.	.	.	.	.	.	.	.	.	T	17.77	3.471772	0.63737	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	T;T	0.69561	-0.41;-0.41	5.79	5.79	0.91817	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	T	0.81465	0.4828	M	0.78637	2.42	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	D	0.83439	0.0042	10	0.62326	D	0.03	.	14.1257	0.65219	0.0:0.0:0.0:1.0	.	479	Q14145	KEAP1_HUMAN	G	479	ENSP00000171111:D479G;ENSP00000377245:D479G	ENSP00000171111:D479G	D	-	2	0	KEAP1	10461419	1.000000	0.71417	0.554000	0.28268	0.134000	0.20937	7.723000	0.84788	2.221000	0.72209	0.456000	0.33151	GAC		0.582	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289		28	30	0	0	0	0.004289	0	28	30				
CLEC17A	388512	broad.mit.edu	37	19	14710915	14710915	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr19:14710915C>T	ENST00000417570.1	+	12	853	c.815C>T	c.(814-816)aCc>aTc	p.T272I	CLEC17A_ENST00000397439.2_Missense_Mutation_p.T255I|CLEC17A_ENST00000547437.1_Missense_Mutation_p.T272I	NM_001204118.1	NP_001191047.1	Q6ZS10	CL17A_HUMAN	C-type lectin domain family 17, member A	272	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					cell surface (GO:0009986)|integral component of membrane (GO:0016021)	fucose binding (GO:0042806)|mannose binding (GO:0005537)|metal ion binding (GO:0046872)	p.T272I(1)									TCCCCAAGCACCAAGTCATGG	0.527																																							uc010dzn.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(814-816)ACC>ATC		SubName: Full=CLEC17A protein;							75.0	72.0	73.0					19																	14710915		1985	4158	6143	SO:0001583	missense	388512					cell surface|integral to membrane	fucose binding|mannose binding|metal ion binding|receptor activity	g.chr19:14710915C>T	AK127809	CCDS46002.1, CCDS46002.2, CCDS56087.1	19p13.12	2009-06-26			ENSG00000187912	ENSG00000187912		"""C-type lectin domain containing"""	34520	protein-coding gene	gene with protein product	"""prolectin"""					19419970	Standard	NM_207390		Approved	FLJ45910	uc010dzn.2	Q6ZS10		ENST00000417570.1:c.815C>T	19.37:g.14710915C>T	ENSP00000393719:p.Thr272Ile					CLEC17A_uc002mzh.1_Missense_Mutation_p.T255I|CLEC17A_uc010xnt.1_RNA|CLEC17A_uc010xnu.1_Intron|CLEC17A_uc010dzo.1_Missense_Mutation_p.T272I	p.T272I			Q6ZS10	CL17A_HUMAN			12	892	+			272			C-type lectin.|Extracellular (Potential).		A8MX68|B2RTX0|B7ZMM4	Missense_Mutation	SNP	ENST00000417570.1	37	c.815C>T	CCDS56087.1	.	.	.	.	.	.	.	.	.	.	C	12.56	1.975966	0.34848	.	.	ENSG00000187912	ENST00000547437;ENST00000397439;ENST00000417570	T;T;T	0.63417	-0.04;-0.04;-0.04	4.67	3.62	0.41486	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.39909	N	0.001230	T	0.67059	0.2853	L	0.35414	1.06	0.25351	N	0.988868	D;D	0.71674	0.998;0.988	D;P	0.80764	0.994;0.863	T	0.58423	-0.7639	10	0.51188	T	0.08	-25.1811	10.7467	0.46185	0.0:0.9046:0.0:0.0954	.	272;272	Q6ZS10-3;Q6ZS10	.;CL17A_HUMAN	I	272;255;272	ENSP00000450065:T272I;ENSP00000380581:T255I;ENSP00000393719:T272I	ENSP00000380581:T255I	T	+	2	0	CLEC17A	14571915	0.605000	0.26941	0.765000	0.31456	0.082000	0.17680	1.331000	0.33793	0.950000	0.37743	0.561000	0.74099	ACC		0.527	CLEC17A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403400.1	NM_207390		28	18	0	0	0	0.012213	0	28	18				
SLC1A6	6511	broad.mit.edu	37	19	15083694	15083694	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr19:15083694A>G	ENST00000221742.3	-	1	36	c.29T>C	c.(28-30)cTg>cCg	p.L10P	SLC1A6_ENST00000598504.1_Missense_Mutation_p.L10P|SLC1A6_ENST00000430939.2_Silent_p.P14P|SLC1A6_ENST00000544886.2_Missense_Mutation_p.L10P|SLC1A6_ENST00000600144.1_Missense_Mutation_p.L10P	NM_005071.1	NP_005062.1	P48664	EAA4_HUMAN	solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6	10					aspartate transport (GO:0015810)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)	p.L10P(1)		breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(8)|liver(1)|lung(12)|ovary(3)|pancreas(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42						GCTCTCCCGCAGGAACAGGCT	0.687																																							uc002naa.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(3)|ovary(2)|skin(1)	6						c.(28-30)CTT>CCT		solute carrier family 1 (high affinity	L-Glutamic Acid(DB00142)						6.0	7.0	7.0					19																	15083694		2100	4127	6227	SO:0001583	missense	6511				synaptic transmission	integral to plasma membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|L-aspartate transmembrane transporter activity|sodium:dicarboxylate symporter activity	g.chr19:15083694A>G		CCDS12321.1, CCDS62578.1	19p13.12	2013-07-15			ENSG00000105143	ENSG00000105143		"""Solute carriers"""	10944	protein-coding gene	gene with protein product		600637				7791878	Standard	NM_005071		Approved	EAAT4	uc002naa.2	P48664	OTTHUMG00000183351	ENST00000221742.3:c.29T>C	19.37:g.15083694A>G	ENSP00000221742:p.Leu10Pro					SLC1A6_uc010dzu.1_Missense_Mutation_p.L10P|SLC1A6_uc010xod.1_Silent_p.P14P|SLC1A6_uc002nab.2_Missense_Mutation_p.L10P|SLC1A6_uc002nac.2_Missense_Mutation_p.L10P|SLC1A6_uc002nad.1_Missense_Mutation_p.L10P	p.L10P	NM_005071	NP_005062	P48664	EAA4_HUMAN			1	37	-			10			Cytoplasmic (Potential).		Q8N753	Missense_Mutation	SNP	ENST00000221742.3	37	c.29T>C	CCDS12321.1	.	.	.	.	.	.	.	.	.	.	A	18.51	3.638701	0.67130	.	.	ENSG00000105143	ENST00000221742;ENST00000544886;ENST00000542610	T;T	0.61040	0.14;0.82	4.41	4.41	0.53225	.	0.731264	0.12206	N	0.489795	T	0.56673	0.2001	N	0.08118	0	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.995	D;D;D	0.83275	0.996;0.996;0.979	T	0.59215	-0.7496	10	0.66056	D	0.02	-12.2133	9.9471	0.41616	1.0:0.0:0.0:0.0	.	10;11;10	Q8N753;Q59GB0;P48664	.;.;EAA4_HUMAN	P	10;10;11	ENSP00000221742:L10P;ENSP00000446175:L10P	ENSP00000221742:L10P	L	-	2	0	SLC1A6	14944694	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	4.323000	0.59221	1.846000	0.53633	0.260000	0.18958	CTG		0.687	SLC1A6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466283.1	NM_005071		2	2	0	0	0	0.009096	0	2	2				
PLVAP	83483	broad.mit.edu	37	19	17476412	17476412	+	Silent	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr19:17476412G>T	ENST00000252590.4	-	3	923	c.862C>A	c.(862-864)Cgg>Agg	p.R288R	CTD-2278I10.1_ENST00000597592.1_RNA	NM_031310.1	NP_112600.1	Q9BX97	PLVAP_HUMAN	plasmalemma vesicle associated protein	288					MAPK cascade (GO:0000165)|positive regulation of cellular extravasation (GO:0002693)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	caveola (GO:0005901)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)		p.R288R(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						CGGAGGCTCCGGGCCAGCTCC	0.657																																							uc002ngk.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(862-864)CGG>AGG		plasmalemma vesicle associated protein							31.0	33.0	32.0					19																	17476412		2203	4300	6503	SO:0001819	synonymous_variant	83483					caveola|integral to membrane|perinuclear region of cytoplasm		g.chr19:17476412G>T	AF326591	CCDS32952.1	19p13.2	2008-07-17				ENSG00000130300			13635	protein-coding gene	gene with protein product	"""fenestrated-endothelial linked structure protein; PV-1 protein"""	607647				11401446	Standard	NM_031310		Approved	gp68, PV-1, PV1, FELS	uc002ngk.1	Q9BX97		ENST00000252590.4:c.862C>A	19.37:g.17476412G>T							p.R288R	NM_031310	NP_112600	Q9BX97	PLVAP_HUMAN			3	912	-			288			Potential.|Extracellular (Potential).		Q86VP0|Q8N8Y0|Q8ND68|Q8TER8|Q9BZD5	Silent	SNP	ENST00000252590.4	37	c.862C>A	CCDS32952.1																																																																																				0.657	PLVAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463655.1	NM_031310		16	16	1	0	2.70639e-06	0.014323	2.91399e-06	16	16				
ZNF85	7639	broad.mit.edu	37	19	21132566	21132566	+	Missense_Mutation	SNP	C	C	A	rs568924406		TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr19:21132566C>A	ENST00000328178.8	+	4	1359	c.1246C>A	c.(1246-1248)Cat>Aat	p.H416N	ZNF85_ENST00000345030.6_Missense_Mutation_p.H383N|ZNF85_ENST00000601023.1_Missense_Mutation_p.H357N	NM_001256173.1|NM_003429.4	NP_001243102.1|NP_003420.2	Q03923	ZNF85_HUMAN	zinc finger protein 85	416					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.H416N(1)		breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)	20						CCTTACTAAACATAAGATAAT	0.313																																							uc002npg.3		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(1246-1248)CAT>AAT		zinc finger protein 85							26.0	28.0	27.0					19																	21132566		2198	4292	6490	SO:0001583	missense	7639					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding	g.chr19:21132566C>A	U35376	CCDS32977.1, CCDS58657.1	19p12	2013-01-08	2006-05-12			ENSG00000105750		"""Zinc fingers, C2H2-type"", ""-"""	13160	protein-coding gene	gene with protein product		603899	"""zinc finger protein 85 (HPF4, HTF1)"""			2505992	Standard	NM_003429		Approved	HPF4, HTF1	uc031rjx.1	Q03923		ENST00000328178.8:c.1246C>A	19.37:g.21132566C>A	ENSP00000329793:p.His416Asn					ZNF85_uc010ecn.2_Missense_Mutation_p.H351N|ZNF85_uc010eco.2_Missense_Mutation_p.H364N|ZNF85_uc002npi.2_Missense_Mutation_p.H357N	p.H416N	NM_003429	NP_003420	Q03923	ZNF85_HUMAN			4	1373	+			416			C2H2-type 10.		B9ZVP4|Q6NVI0	Missense_Mutation	SNP	ENST00000328178.8	37	c.1246C>A	CCDS32977.1	.	.	.	.	.	.	.	.	.	.	.	10.17	1.275343	0.23307	.	.	ENSG00000105750	ENST00000328178;ENST00000345030;ENST00000421385	D;D	0.86865	-2.18;-2.18	1.35	1.35	0.21983	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94755	0.8307	H	0.97023	3.925	0.80722	D	1	D;P;D	0.89917	1.0;0.911;1.0	D;D;D	0.97110	1.0;0.963;1.0	D	0.93954	0.7234	9	0.87932	D	0	.	9.5712	0.39429	0.0:1.0:0.0:0.0	.	383;357;416	Q03923-2;Q49A12;Q03923	.;.;ZNF85_HUMAN	N	416;383;291	ENSP00000329793:H416N;ENSP00000342340:H383N	ENSP00000329793:H416N	H	+	1	0	ZNF85	20924406	0.450000	0.25697	0.005000	0.12908	0.011000	0.07611	2.338000	0.43957	0.681000	0.31386	0.462000	0.41574	CAT		0.313	ZNF85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463430.1	NM_003429		6	21	1	0	1.76689e-08	0.006214	1.96379e-08	6	21				
TSHZ3	57616	broad.mit.edu	37	19	31768902	31768902	+	Silent	SNP	C	C	T	rs201760078		TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr19:31768902C>T	ENST00000240587.4	-	2	2124	c.1797G>A	c.(1795-1797)acG>acA	p.T599T		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	599					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T599T(1)|p.T416T(1)		breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					GCATGGGGGACGTCTGGCTGC	0.552																																							uc002nsy.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(4)|skin(2)|pancreas(1)|lung(1)	8						c.(1795-1797)ACG>ACA		zinc finger protein 537		C		1,4405	2.1+/-5.4	0,1,2202	93.0	101.0	98.0		1797	-4.2	0.9	19		98	0,8600		0,0,4300	no	coding-synonymous	TSHZ3	NM_020856.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		599/1082	31768902	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	57616				negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:31768902C>T	AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.1797G>A	19.37:g.31768902C>T							p.T599T	NM_020856	NP_065907	Q63HK5	TSH3_HUMAN			2	1862	-	Esophageal squamous(110;0.226)		599					Q9H0G6|Q9P254	Silent	SNP	ENST00000240587.4	37	c.1797G>A	CCDS12421.2																																																																																				0.552	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856		69	56	0	0	0	0.01441	0	69	56				
RPS4XP21	126235	broad.mit.edu	37	19	34583634	34583634	+	IGR	SNP	G	G	C			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr19:34583634G>C								RN7SL150P (165104 upstream) : LSM14A (79795 downstream)														p.T205T(1)									TCTCTCTATTGGTGATCACAC	0.448																																							uc002nuz.2		NA																	1	Substitution - coding silent(1)		lung(1)		NA						c.(526-528)ACC>ACG		full-length cDNA clone CS0DE007YF24 of Placenta of Homo sapiens (human).																																				SO:0001628	intergenic_variant	0							g.chr19:34583634G>C																													19.37:g.34583634G>C							p.T176T							1	580	-									Silent	SNP		37	c.528C>G																																																																																				0	0.448									3	4	0	0	0	0.004672	0	3	4				
ZNF780A	284323	broad.mit.edu	37	19	40581599	40581599	+	Missense_Mutation	SNP	T	T	A	rs140183562		TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr19:40581599T>A	ENST00000595687.2	-	6	959	c.750A>T	c.(748-750)gaA>gaT	p.E250D	ZNF780A_ENST00000414720.2_Intron|ZNF780A_ENST00000340963.5_Missense_Mutation_p.E250D|ZNF780A_ENST00000594395.1_Missense_Mutation_p.E251D|AC005614.5_ENST00000595508.1_RNA|ZNF780A_ENST00000450241.2_Missense_Mutation_p.E216D|ZNF780A_ENST00000455521.1_Missense_Mutation_p.E251D	NM_001010880.2	NP_001010880.2	O75290	Z780A_HUMAN	zinc finger protein 780A	250					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E251D(2)|p.E216D(2)		breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|upper_aerodigestive_tract(3)|urinary_tract(1)	31	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					ATTCCTTACATTCAAACAGTT	0.393																																							uc002omy.2		NA																	4	Substitution - Missense(4)		lung(4)		0						c.(748-750)GAA>GAT		zinc finger protein 780A isoform b							142.0	143.0	143.0					19																	40581599		2203	4300	6503	SO:0001583	missense	284323				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:40581599T>A	AK091274	CCDS33026.2, CCDS46078.1, CCDS46079.1	19q13.2	2014-02-12	2006-08-15		ENSG00000197782	ENSG00000197782		"""Zinc fingers, C2H2-type"", ""-"""	27603	protein-coding gene	gene with protein product							Standard	NM_001142577		Approved	ZNF780	uc010xvh.2	O75290	OTTHUMG00000155119	ENST00000595687.2:c.750A>T	19.37:g.40581599T>A	ENSP00000472189:p.Glu250Asp					ZNF780A_uc002omw.3_Intron|ZNF780A_uc002omz.2_Missense_Mutation_p.E250D|ZNF780A_uc010xvh.1_Missense_Mutation_p.E251D	p.E250D	NM_001010880	NP_001010880	O75290	Z780A_HUMAN			6	975	-	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)		250			C2H2-type 4.		E9PB48|Q6ZN87	Missense_Mutation	SNP	ENST00000595687.2	37	c.750A>T	CCDS33026.2	.	.	.	.	.	.	.	.	.	.	T	18.82	3.705654	0.68615	.	.	ENSG00000197782	ENST00000450241;ENST00000455521;ENST00000340963	T;T	0.22134	1.97;1.97	1.73	1.73	0.24493	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.29355	0.0731	L	0.48642	1.525	0.19945	N	0.999941	D;D	0.65815	0.995;0.979	P;P	0.61592	0.891;0.76	T	0.09530	-1.0670	9	0.62326	D	0.03	.	3.4953	0.07653	0.0:0.2221:0.0:0.7779	.	251;250	E9PB48;O75290	.;Z780A_HUMAN	D	250;251;250	ENSP00000400997:E251D;ENSP00000341507:E250D	ENSP00000341507:E250D	E	-	3	2	ZNF780A	45273439	0.000000	0.05858	0.914000	0.36105	0.912000	0.54170	-2.086000	0.01361	0.775000	0.33450	0.254000	0.18369	GAA		0.393	ZNF780A-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000470066.1	NM_001010880		98	73	0	0	0	0.01441	0	98	73				
POU2F2	5452	broad.mit.edu	37	19	42600252	42600252	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr19:42600252G>C	ENST00000526816.2	-	8	660	c.645C>G	c.(643-645)atC>atG	p.I215M	POU2F2_ENST00000529067.1_Missense_Mutation_p.I199M|POU2F2_ENST00000342301.4_Missense_Mutation_p.I215M|POU2F2_ENST00000560558.1_Missense_Mutation_p.I160M|POU2F2_ENST00000389341.5_Missense_Mutation_p.I199M|POU2F2_ENST00000560398.1_Missense_Mutation_p.I221M|POU2F2_ENST00000533720.1_Missense_Mutation_p.I199M|POU2F2_ENST00000529952.1_Missense_Mutation_p.I215M			P09086	PO2F2_HUMAN	POU class 2 homeobox 2	215	POU-specific. {ECO:0000255|PROSITE- ProRule:PRU00530}.				cell maturation (GO:0048469)|humoral immune response (GO:0006959)|immunoglobulin secretion involved in immune response (GO:0002380)|mature B cell differentiation (GO:0002335)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I199M(1)|p.I215M(1)		kidney(1)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Prostate(69;0.059)			Dolutegravir(DB08930)	AGCCCAGCTTGATGCGGCGTT	0.672																																							uc002osp.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|skin(1)	2						c.(643-645)ATC>ATG		POU domain, class 2, transcription factor 2							48.0	42.0	44.0					19																	42600252		2203	4300	6503	SO:0001583	missense	5452				humoral immune response|transcription from RNA polymerase II promoter	cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr19:42600252G>C		CCDS33035.1, CCDS56094.1, CCDS56095.1, CCDS58665.1	19q13.2	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9213	protein-coding gene	gene with protein product		164176	"""POU domain class 2, transcription factor 2"""	OTF2			Standard	NM_001207026		Approved	OCT2	uc002osp.3	P09086		ENST00000526816.2:c.645C>G	19.37:g.42600252G>C	ENSP00000431603:p.Ile215Met					POU2F2_uc002osn.2_Missense_Mutation_p.I199M|POU2F2_uc002oso.2_Translation_Start_Site|POU2F2_uc002osq.2_Missense_Mutation_p.I199M|POU2F2_uc002osr.1_Missense_Mutation_p.I215M	p.I215M	NM_002698	NP_002689	P09086	PO2F2_HUMAN			8	712	-		Prostate(69;0.059)	215			POU-specific.		Q16648|Q7M4M8|Q9BRS4	Missense_Mutation	SNP	ENST00000526816.2	37	c.645C>G	CCDS56095.1	.	.	.	.	.	.	.	.	.	.	G	17.99	3.522999	0.64747	.	.	ENSG00000028277	ENST00000389341;ENST00000342301;ENST00000292077;ENST00000533720;ENST00000526816;ENST00000529067;ENST00000529952	D;D;D;D;D	0.88664	-2.41;-2.41;-2.41;-2.41;-2.41	4.47	3.43	0.39272	POU-specific (4);Lambda repressor-like, DNA-binding (2);POU (1);	0.000000	0.85682	D	0.000000	D	0.92427	0.7596	M	0.72118	2.19	0.58432	D	0.999992	D;D;D	0.71674	0.998;0.998;0.996	D;D;D	0.79108	0.978;0.992;0.962	D	0.91983	0.5596	10	0.87932	D	0	.	8.4839	0.33061	0.1826:0.0:0.8174:0.0	.	199;215;199	P09086-4;P09086;P09086-3	.;PO2F2_HUMAN;.	M	199;215;215;199;214;199;215	ENSP00000373992:I199M;ENSP00000339369:I215M;ENSP00000437221:I199M;ENSP00000437224:I199M;ENSP00000436988:I215M	ENSP00000292077:I215M	I	-	3	3	POU2F2	47292092	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.727000	0.54984	1.238000	0.43771	-0.157000	0.13467	ATC		0.672	POU2F2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387329.3			7	12	0	0	0	0.008291	0	7	12				
ZNF224	7767	broad.mit.edu	37	19	44605073	44605073	+	Silent	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr19:44605073C>T	ENST00000336976.6	+	4	389	c.135C>T	c.(133-135)ctC>ctT	p.L45L	AC084219.3_ENST00000591772.1_RNA	NM_013398.2	NP_037530.2	Q9NZL3	ZN224_HUMAN	zinc finger protein 224	45	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nuclear membrane (GO:0031965)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L45L(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(2)|ovary(2)|prostate(1)|stomach(2)|urinary_tract(1)	19		Prostate(69;0.0435)				GGAACCTGCTCTCAGTGGGTG	0.517																																							uc002oyh.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(133-135)CTC>CTT		zinc finger protein 224							184.0	168.0	174.0					19																	44605073		2203	4300	6503	SO:0001819	synonymous_variant	7767				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	transcriptional repressor complex	DNA binding|protein binding|zinc ion binding	g.chr19:44605073C>T	AF187990	CCDS33046.1	19q13.2	2013-01-08	2004-02-13			ENSG00000267680		"""Zinc fingers, C2H2-type"", ""-"""	13017	protein-coding gene	gene with protein product		194555	"""zinc finger protein 255"", ""zinc finger protein 27"""	ZNF255, ZNF27			Standard	NM_013398		Approved	BMZF-2, KOX22	uc002oyh.2	Q9NZL3		ENST00000336976.6:c.135C>T	19.37:g.44605073C>T							p.L45L	NM_013398	NP_037530	Q9NZL3	ZN224_HUMAN			4	437	+		Prostate(69;0.0435)	45			KRAB.		A6NFW9|P17033|Q86V10|Q8IZC8|Q9UID9|Q9Y2P6	Silent	SNP	ENST00000336976.6	37	c.135C>T	CCDS33046.1																																																																																				0.517	ZNF224-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460477.1	NM_013398		35	117	0	0	0	0.003271	0	35	117				
EML2	24139	broad.mit.edu	37	19	46124826	46124826	+	Missense_Mutation	SNP	C	C	A	rs190064158		TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr19:46124826C>A	ENST00000245925.3	-	10	961	c.911G>T	c.(910-912)cGg>cTg	p.R304L	EML2_ENST00000536630.1_Missense_Mutation_p.R451L|EML2_ENST00000586902.1_5'UTR|EML2_ENST00000587152.1_Missense_Mutation_p.R505L|EML2_ENST00000589876.1_Missense_Mutation_p.R304L	NM_012155.2	NP_036287.1	O95834	EMAL2_HUMAN	echinoderm microtubule associated protein like 2	304	Tandem atypical propeller in EMLs. {ECO:0000250}.				negative regulation of microtubule polymerization (GO:0031115)|regulation of microtubule nucleation (GO:0010968)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	microtubule binding (GO:0008017)|tubulin binding (GO:0015631)	p.R304L(1)		NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(13)|ovary(1)|urinary_tract(1)	31		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)		CGTCCCGTCCCGCAGGGCGCA	0.687																																							uc002pcn.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(910-912)CGG>CTG		echinoderm microtubule associated protein like							46.0	47.0	47.0					19																	46124826		2203	4298	6501	SO:0001583	missense	24139				sensory perception of sound|visual perception	cytoplasm|intracellular membrane-bounded organelle|microtubule|microtubule associated complex	catalytic activity|protein binding	g.chr19:46124826C>A	AF103939	CCDS12670.1, CCDS54280.1, CCDS59399.1	19q13.32	2013-01-10				ENSG00000125746		"""WD repeat domain containing"""	18035	protein-coding gene	gene with protein product	"""echinoderm MT-associated protein (EMAP)-like protein 70"", ""microtubule-associated protein like echinoderm EMAP"""					11694528, 10521658	Standard	NM_012155		Approved	EMAP2, ELP70, EMAP-2	uc010xxm.2	O95834		ENST00000245925.3:c.911G>T	19.37:g.46124826C>A	ENSP00000245925:p.Arg304Leu					EML2_uc002pco.2_RNA|EML2_uc002pcp.2_Missense_Mutation_p.R188L|EML2_uc010xxl.1_Missense_Mutation_p.R451L|EML2_uc010xxm.1_Missense_Mutation_p.R505L|EML2_uc010xxn.1_RNA|EML2_uc010xxo.1_Missense_Mutation_p.R304L|EML2_uc010ekj.2_Missense_Mutation_p.G271W	p.R304L	NM_012155	NP_036287	O95834	EMAL2_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)	10	946	-		Ovarian(192;0.179)|all_neural(266;0.224)	304			WD 5.		B7Z3I2|B7Z3Q9|K7ERL7|Q59EN8|Q8N5A2|Q9UG50	Missense_Mutation	SNP	ENST00000245925.3	37	c.911G>T	CCDS12670.1	.	.	.	.	.	.	.	.	.	.	C	17.74	3.464106	0.63513	.	.	ENSG00000125746	ENST00000536630;ENST00000245925;ENST00000448055;ENST00000399594	T;T;T	0.39997	1.05;1.05;5.02	3.2	3.2	0.36748	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40-repeat-containing domain (1);	0.065950	0.56097	D	0.000024	T	0.61986	0.2391	M	0.79926	2.475	0.39195	D	0.963043	D;D;D;D	0.89917	1.0;0.998;0.984;0.992	D;D;P;D	0.78314	0.991;0.971;0.733;0.916	T	0.65150	-0.6238	10	0.32370	T	0.25	-21.2196	11.8789	0.52562	0.0:1.0:0.0:0.0	.	304;470;451;304	B7Z918;B7Z3Q9;B7Z3I2;O95834	.;.;.;EMAL2_HUMAN	L	451;304;505;462	ENSP00000442365:R451L;ENSP00000245925:R304L;ENSP00000382503:R462L	ENSP00000245925:R304L	R	-	2	0	EML2	50816666	1.000000	0.71417	1.000000	0.80357	0.791000	0.44710	3.372000	0.52387	1.625000	0.50366	0.195000	0.17529	CGG		0.687	EML2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459608.1	NM_012155		9	35	1	0	5.50884e-06	0.013537	5.91459e-06	9	35				
CEACAM18	729767	broad.mit.edu	37	19	51986489	51986489	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr19:51986489G>T	ENST00000396477.4	+	4	913	c.892G>T	c.(892-894)Gtg>Ttg	p.V298L	CEACAM18_ENST00000451626.1_Missense_Mutation_p.V359L	NM_001278392.1	NP_001265321.1	A8MTB9	CEA18_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 18	298	Ig-like C2-type.							p.V298L(1)|p.V359L(1)		breast(1)|endometrium(4)|large_intestine(3)|lung(8)|skin(1)	17		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		CCGATGCACTGTGGAGAACCC	0.562																																							uc002pwv.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(1075-1077)GTG>TTG		carcinoembryonic antigen-related cell adhesion							106.0	106.0	106.0					19																	51986489		2095	4230	6325	SO:0001583	missense	729767					integral to membrane		g.chr19:51986489G>T			19q13.41	2013-01-29				ENSG00000213822		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	31949	protein-coding gene	gene with protein product							Standard	NM_001278392		Approved		uc002pwv.1	A8MTB9		ENST00000396477.4:c.892G>T	19.37:g.51986489G>T	ENSP00000379738:p.Val298Leu						p.V359L	NM_001080405	NP_001073874	A8MTB9	CEA18_HUMAN		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)	5	1075	+		all_neural(266;0.0529)	359			Ig-like C2-type.		C9JN24	Missense_Mutation	SNP	ENST00000396477.4	37	c.1075G>T		.	.	.	.	.	.	.	.	.	.	.	13.29	2.193399	0.38707	.	.	ENSG00000213822	ENST00000451626;ENST00000451086;ENST00000396477	T	0.12672	2.66	2.53	0.221	0.15283	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.18215	0.0437	M	0.72894	2.215	0.09310	N	1	B	0.33549	0.417	B	0.42062	0.374	T	0.31194	-0.9952	9	0.56958	D	0.05	-6.7469	3.421	0.07393	0.1641:0.2744:0.5615:0.0	.	359	A8MTB9	CEA18_HUMAN	L	359;298;298	ENSP00000402203:V359L	ENSP00000379738:V298L	V	+	1	0	CEACAM18	56678301	0.973000	0.33851	0.208000	0.23602	0.056000	0.15407	0.408000	0.21065	0.157000	0.19338	0.456000	0.33151	GTG		0.562	CEACAM18-001	PUTATIVE	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000323114.2			43	36	1	0	1.61004e-24	0.01441	2.18711e-24	43	36				
NBAS	51594	broad.mit.edu	37	2	15519895	15519895	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr2:15519895T>C	ENST00000281513.5	-	30	3446	c.3421A>G	c.(3421-3423)Atg>Gtg	p.M1141V	NBAS_ENST00000441750.1_Missense_Mutation_p.M1021V	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	1141					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)		p.M1141V(1)		NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						CAGTGCATCATCTGTCCAGCC	0.448																																							uc002rcc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|liver(1)|skin(1)	4						c.(3421-3423)ATG>GTG		neuroblastoma-amplified protein							118.0	120.0	120.0					2																	15519895		2203	4300	6503	SO:0001583	missense	51594							g.chr2:15519895T>C	BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.3421A>G	2.37:g.15519895T>C	ENSP00000281513:p.Met1141Val					NBAS_uc010exl.1_Missense_Mutation_p.M213V|NBAS_uc002rcd.1_RNA	p.M1141V	NM_015909	NP_056993	A2RRP1	NBAS_HUMAN			30	3447	-			1141					O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Missense_Mutation	SNP	ENST00000281513.5	37	c.3421A>G	CCDS1685.1	.	.	.	.	.	.	.	.	.	.	T	12.82	2.051689	0.36181	.	.	ENSG00000151779	ENST00000441750;ENST00000281513;ENST00000441755	T;T;T	0.16324	2.35;2.35;2.35	5.89	4.71	0.59529	Secretory pathway Sec39 (1);	0.124465	0.64402	D	0.000001	T	0.18964	0.0455	L	0.45581	1.43	0.41786	D	0.989842	P;P	0.36483	0.502;0.555	B;B	0.37731	0.135;0.257	T	0.01748	-1.1282	10	0.87932	D	0	.	13.1081	0.59259	0.0:0.0:0.134:0.866	.	1021;1141	A2RRP1-2;A2RRP1	.;NBAS_HUMAN	V	1021;1141;188	ENSP00000413201:M1021V;ENSP00000281513:M1141V;ENSP00000396501:M188V	ENSP00000281513:M1141V	M	-	1	0	NBAS	15437346	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.514000	0.35834	1.025000	0.39708	0.460000	0.39030	ATG		0.448	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241638.1	NM_015909		119	118	0	0	0	0.01441	0	119	118				
APOB	338	broad.mit.edu	37	2	21235078	21235078	+	Silent	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr2:21235078G>T	ENST00000233242.1	-	26	4789	c.4662C>A	c.(4660-4662)atC>atA	p.I1554I		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1554					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.I1554I(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TATTTTTAATGATGCCACTTT	0.433																																							uc002red.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27						c.(4660-4662)ATC>ATA		apolipoprotein B precursor	Atorvastatin(DB01076)						104.0	104.0	104.0					2																	21235078		2203	4300	6503	SO:0001819	synonymous_variant	338				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity	g.chr2:21235078G>T	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.4662C>A	2.37:g.21235078G>T							p.I1554I	NM_000384	NP_000375	P04114	APOB_HUMAN			26	4790	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		1554					O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Silent	SNP	ENST00000233242.1	37	c.4662C>A	CCDS1703.1																																																																																				0.433	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1			14	93	1	0	9.16793e-09	0.00499	1.028e-08	14	93				
CRIM1	51232	broad.mit.edu	37	2	36706813	36706813	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr2:36706813G>T	ENST00000280527.2	+	7	1715	c.1348G>T	c.(1348-1350)Ggg>Tgg	p.G450W		NM_016441.2	NP_057525.1	Q9NZV1	CRIM1_HUMAN	cysteine rich transmembrane BMP regulator 1 (chordin-like)	450	VWFC 2. {ECO:0000255|PROSITE- ProRule:PRU00220}.				insulin-like growth factor receptor signaling pathway (GO:0048009)|nervous system development (GO:0007399)|regulation of cell growth (GO:0001558)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	insulin-like growth factor-activated receptor activity (GO:0005010)|PDZ domain binding (GO:0030165)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.G450W(1)		autonomic_ganglia(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(15)|liver(2)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	45		all_hematologic(82;0.131)|Acute lymphoblastic leukemia(82;0.154)				GAAAGTGCCTGGGGAGTGTTG	0.547																																							uc002rpd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(1348-1350)GGG>TGG		cysteine-rich motor neuron 1 precursor							131.0	129.0	129.0					2																	36706813		2203	4300	6503	SO:0001583	missense	51232				nervous system development|regulation of cell growth	extracellular region|integral to membrane|plasma membrane	insulin-like growth factor binding|insulin-like growth factor receptor activity|serine-type endopeptidase inhibitor activity	g.chr2:36706813G>T	AF168681	CCDS1783.1	2p21	2010-06-29	2005-07-25		ENSG00000150938	ENSG00000150938			2359	protein-coding gene	gene with protein product		606189	"""cysteine-rich motor neuron 1"""	S52		10642437	Standard	NM_016441		Approved		uc002rpd.3	Q9NZV1	OTTHUMG00000099419	ENST00000280527.2:c.1348G>T	2.37:g.36706813G>T	ENSP00000280527:p.Gly450Trp						p.G450W	NM_016441	NP_057525	Q9NZV1	CRIM1_HUMAN			7	1387	+		all_hematologic(82;0.131)|Acute lymphoblastic leukemia(82;0.154)	450			VWFC 2.|Extracellular (Potential).		Q2M2G4|Q59GH0|Q7LCQ5|Q9H318	Missense_Mutation	SNP	ENST00000280527.2	37	c.1348G>T	CCDS1783.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.974488	0.92919	.	.	ENSG00000150938	ENST00000280527	T	0.78003	-1.14	5.35	5.35	0.76521	von Willebrand factor, type C (4);	0.000000	0.85682	D	0.000000	D	0.92701	0.7680	H	0.97516	4.02	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94961	0.8108	10	0.87932	D	0	-16.0574	18.423	0.90598	0.0:0.0:1.0:0.0	.	450	Q9NZV1	CRIM1_HUMAN	W	450	ENSP00000280527:G450W	ENSP00000280527:G450W	G	+	1	0	CRIM1	36560317	1.000000	0.71417	0.990000	0.47175	0.976000	0.68499	9.813000	0.99286	2.668000	0.90789	0.655000	0.94253	GGG		0.547	CRIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216878.2	NM_016441		21	88	1	0	6.44725e-10	0.014323	7.44972e-10	21	88				
GALM	130589	broad.mit.edu	37	2	38958889	38958889	+	Silent	SNP	T	T	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr2:38958889T>A	ENST00000272252.5	+	6	1041	c.789T>A	c.(787-789)gcT>gcA	p.A263A	GALM_ENST00000410063.1_Silent_p.A115A	NM_138801.2	NP_620156.1	Q96C23	GALM_HUMAN	galactose mutarotase (aldose 1-epimerase)	263					galactose metabolic process (GO:0006012)|glucose metabolic process (GO:0006006)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	aldose 1-epimerase activity (GO:0004034)|carbohydrate binding (GO:0030246)	p.A263A(1)		NS(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	14		all_hematologic(82;0.248)				TGCATCATGCTGCAAGCGGGC	0.532																																							uc002rqy.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(787-789)GCT>GCA		galactose mutarotase							72.0	75.0	74.0					2																	38958889		2203	4300	6503	SO:0001819	synonymous_variant	130589				hexose metabolic process	cytoplasm	aldose 1-epimerase activity|carbohydrate binding	g.chr2:38958889T>A		CCDS1797.1	2p22.3	2008-02-05			ENSG00000143891	ENSG00000143891			24063	protein-coding gene	gene with protein product	"""aldose 1 epimerase"""	608883				12753898	Standard	NM_138801		Approved		uc002rqy.3	Q96C23	OTTHUMG00000102077	ENST00000272252.5:c.789T>A	2.37:g.38958889T>A							p.A263A	NM_138801	NP_620156	Q96C23	GALM_HUMAN			6	1041	+		all_hematologic(82;0.248)	263					Q53RY1|Q8NIA2|V9HWA8	Silent	SNP	ENST00000272252.5	37	c.789T>A	CCDS1797.1																																																																																				0.532	GALM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219891.2	NM_138801		19	83	0	0	0	0.007413	0	19	83				
CLEC4F	165530	broad.mit.edu	37	2	71043249	71043249	+	Nonsense_Mutation	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr2:71043249G>A	ENST00000272367.2	-	4	1340	c.1264C>T	c.(1264-1266)Cag>Tag	p.Q422*	CLEC4F_ENST00000426626.1_Nonsense_Mutation_p.Q422*	NM_001258027.1|NM_173535.2	NP_001244956.1|NP_775806.2	Q8N1N0	CLC4F_HUMAN	C-type lectin domain family 4, member F	422					endocytosis (GO:0006897)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.Q422*(1)		endometrium(1)|large_intestine(5)|lung(18)|ovary(5)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)	37						CTTAACCTCTGGATCTCGGCA	0.483																																					Colon(107;10 2157 6841 26035)	Colon(107;10 2157 6841 26035)	uc002shf.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(5)	5						c.(1264-1266)CAG>TAG		C-type lectin, superfamily member 13							135.0	121.0	126.0					2																	71043249		2203	4300	6503	SO:0001587	stop_gained	165530				endocytosis	integral to membrane	receptor activity|sugar binding	g.chr2:71043249G>A	AK096429	CCDS1910.1	2p13.3	2008-02-05	2005-02-09	2005-02-11	ENSG00000152672	ENSG00000152672		"""C-type lectin domain containing"""	25357	protein-coding gene	gene with protein product			"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 13"""	CLECSF13		8889548, 1846367	Standard	NM_001258027		Approved	FLJ39110, KCLR	uc002shf.3	Q8N1N0	OTTHUMG00000129713	ENST00000272367.2:c.1264C>T	2.37:g.71043249G>A	ENSP00000272367:p.Gln422*					CLEC4F_uc010yqv.1_Nonsense_Mutation_p.Q422*	p.Q422*	NM_173535	NP_775806	Q8N1N0	CLC4F_HUMAN			4	1341	-			422			Extracellular (Potential).		A4QPA5	Nonsense_Mutation	SNP	ENST00000272367.2	37	c.1264C>T	CCDS1910.1	.	.	.	.	.	.	.	.	.	.	G	18.86	3.714282	0.68730	.	.	ENSG00000152672	ENST00000272367;ENST00000426626	.	.	.	3.79	2.89	0.33648	.	0.581188	0.14434	N	0.319806	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	.	8.5954	0.33712	0.0:0.0:0.771:0.2289	.	.	.	.	X	422	.	ENSP00000272367:Q422X	Q	-	1	0	CLEC4F	70896757	0.958000	0.32768	0.022000	0.16811	0.004000	0.04260	4.044000	0.57361	1.133000	0.42147	0.467000	0.42956	CAG		0.483	CLEC4F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251922.1	NM_173535		39	40	0	0	0	0.004878	0	39	40				
LOXL3	84695	broad.mit.edu	37	2	74763216	74763216	+	Silent	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr2:74763216C>T	ENST00000264094.3	-	7	1226	c.1155G>A	c.(1153-1155)aaG>aaA	p.K385K	LOXL3_ENST00000409986.1_Silent_p.K240K|LOXL3_ENST00000409249.1_Intron|LOXL3_ENST00000393937.2_Silent_p.K240K|LOXL3_ENST00000409549.1_Silent_p.K385K	NM_032603.2	NP_115992.1	P58215	LOXL3_HUMAN	lysyl oxidase-like 3	385	SRCR 3. {ECO:0000255|PROSITE- ProRule:PRU00196}.				epithelial to mesenchymal transition (GO:0001837)|negative regulation of transcription, DNA-templated (GO:0045892)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)|nucleus (GO:0005634)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)	p.K385K(1)		endometrium(7)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30						TGTGGGGGCACTTCCAGAGGG	0.552																																							uc002smp.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1153-1155)AAG>AAA		lysyl oxidase-like 3 precursor							88.0	88.0	88.0					2																	74763216		2203	4300	6503	SO:0001819	synonymous_variant	84695					extracellular space|membrane	copper ion binding|protein-lysine 6-oxidase activity|scavenger receptor activity	g.chr2:74763216C>T	AF282619	CCDS1953.1, CCDS74527.1	2p13	2008-05-23			ENSG00000115318	ENSG00000115318			13869	protein-coding gene	gene with protein product		607163				11386757	Standard	NM_032603		Approved		uc002smp.1	P58215	OTTHUMG00000129953	ENST00000264094.3:c.1155G>A	2.37:g.74763216C>T						LOXL3_uc002smo.1_Silent_p.K24K|LOXL3_uc010ffm.1_Silent_p.K385K|LOXL3_uc002smq.1_Silent_p.K240K|LOXL3_uc010ffn.1_Silent_p.K240K	p.K385K	NM_032603	NP_115992	P58215	LOXL3_HUMAN			7	1227	-			385			SRCR 3.		D6W5J1|Q2EHP2|Q6IPL7|Q96RS1	Silent	SNP	ENST00000264094.3	37	c.1155G>A	CCDS1953.1	.	.	.	.	.	.	.	.	.	.	C	7.138	0.581234	0.13686	.	.	ENSG00000115318	ENST00000420535	.	.	.	5.09	0.00674	0.14068	.	.	.	.	.	T	0.39989	0.1099	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.25847	-1.0120	4	.	.	.	.	0.7356	0.00965	0.1737:0.3402:0.1472:0.3389	.	.	.	.	M	112	.	.	V	-	1	0	LOXL3	74616724	0.462000	0.25791	0.999000	0.59377	0.996000	0.88848	0.394000	0.20834	0.172000	0.19760	0.551000	0.68910	GTG		0.552	LOXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252215.1	NM_032603		69	61	0	0	0	0.01441	0	69	61				
SLC9A2	6549	broad.mit.edu	37	2	103317603	103317603	+	Missense_Mutation	SNP	C	C	G	rs374840608		TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr2:103317603C>G	ENST00000233969.2	+	8	1803	c.1661C>G	c.(1660-1662)tCt>tGt	p.S554C	SLC9A2_ENST00000469286.1_3'UTR	NM_003048.3	NP_003039.2	Q9UBY0	SL9A2_HUMAN	solute carrier family 9, subfamily A (NHE2, cation proton antiporter 2), member 2	554					ion transport (GO:0006811)|protein localization (GO:0008104)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)	p.S554C(1)		breast(5)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42						AGTATTGTATCTTTATATAAA	0.328																																							uc002tca.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(3)|skin(3)|breast(2)	8						c.(1660-1662)TCT>TGT		solute carrier family 9 (sodium/hydrogen							55.0	58.0	57.0					2																	103317603		2203	4300	6503	SO:0001583	missense	6549					integral to membrane|plasma membrane	sodium:hydrogen antiporter activity	g.chr2:103317603C>G		CCDS2062.1	2q11.2	2013-05-22	2012-03-22		ENSG00000115616	ENSG00000115616		"""Solute carriers"""	11072	protein-coding gene	gene with protein product		600530	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 2"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 2"""	NHE2			Standard	NM_003048		Approved		uc002tca.3	Q9UBY0	OTTHUMG00000130778	ENST00000233969.2:c.1661C>G	2.37:g.103317603C>G	ENSP00000233969:p.Ser554Cys						p.S554C	NM_003048	NP_003039	Q9UBY0	SL9A2_HUMAN			8	1803	+			554			Cytoplasmic (Potential).		B2RMS2	Missense_Mutation	SNP	ENST00000233969.2	37	c.1661C>G	CCDS2062.1	.	.	.	.	.	.	.	.	.	.	C	18.48	3.632886	0.67015	.	.	ENSG00000115616	ENST00000233969	T	0.47528	0.84	5.72	5.72	0.89469	.	0.053816	0.85682	D	0.000000	T	0.54983	0.1892	M	0.64997	1.995	0.38664	D	0.952144	D	0.53151	0.958	P	0.50231	0.635	T	0.61535	-0.7043	10	0.62326	D	0.03	.	13.1309	0.59382	0.0:0.9268:0.0:0.0732	.	554	Q9UBY0	SL9A2_HUMAN	C	554	ENSP00000233969:S554C	ENSP00000233969:S554C	S	+	2	0	SLC9A2	102684035	0.999000	0.42202	1.000000	0.80357	0.786000	0.44442	4.603000	0.61105	2.706000	0.92434	0.467000	0.42956	TCT		0.328	SLC9A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253292.2			21	54	0	0	0	0.012319	0	21	54				
EDAR	10913	broad.mit.edu	37	2	109547432	109547432	+	Silent	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr2:109547432G>T	ENST00000258443.2	-	2	469	c.39C>A	c.(37-39)ctC>ctA	p.L13L	EDAR_ENST00000376651.1_Silent_p.L13L|EDAR_ENST00000409271.1_Silent_p.L13L	NM_022336.3	NP_071731.1	Q9UNE0	EDAR_HUMAN	ectodysplasin A receptor	13					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|epidermis development (GO:0008544)|hair follicle development (GO:0001942)|odontogenesis of dentin-containing tooth (GO:0042475)|pigmentation (GO:0043473)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|salivary gland cavitation (GO:0060662)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.L13L(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	16						CCAGGACGGGGAGCCAGGGCG	0.597																																							uc002teq.3		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(37-39)CTC>CTA		ectodysplasin A receptor precursor							92.0	91.0	91.0					2																	109547432		2203	4300	6503	SO:0001819	synonymous_variant	10913				apoptosis|cell differentiation	integral to membrane	protein binding|transmembrane receptor activity	g.chr2:109547432G>T	AF130988	CCDS2081.1	2q13	2013-05-22	2004-08-09		ENSG00000135960	ENSG00000135960		"""Tumor necrosis factor receptor superfamily"""	2895	protein-coding gene	gene with protein product		604095	"""ectodysplasin 1, anhidrotic receptor"""	ED3, DL		10431241, 9375732	Standard	NM_022336		Approved	ED5, EDA3, Edar, ED1R, EDA1R	uc002teq.4	Q9UNE0	OTTHUMG00000130982	ENST00000258443.2:c.39C>A	2.37:g.109547432G>T						EDAR_uc010fjn.2_Silent_p.L13L|EDAR_uc010yws.1_Silent_p.L13L	p.L13L	NM_022336	NP_071731	Q9UNE0	EDAR_HUMAN			2	470	-			13					B2R9H2|B4DLC5|D3DX74|E9PC98|Q52LL5|Q9UND9	Silent	SNP	ENST00000258443.2	37	c.39C>A	CCDS2081.1																																																																																				0.597	EDAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253595.1			19	153	1	0	1.55795e-14	0.012319	1.90471e-14	19	153				
CFAP221	200373	broad.mit.edu	37	2	120387532	120387532	+	Splice_Site	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr2:120387532G>A	ENST00000413369.3	+	17	1818		c.e17+1		PCDP1_ENST00000602047.1_Splice_Site	NM_001271049.1	NP_001257978												p.?(1)				Colorectal(110;0.196)					CAATCTGCAGGTCAGACCTGT	0.338																																							uc002tmb.2		NA																	1	Unknown(1)		lung(1)		0						c.e18+1		primary ciliary dyskinesia protein 1							85.0	82.0	83.0					2																	120387532		2203	4300	6503	SO:0001630	splice_region_variant	200373					cilium	calmodulin binding	g.chr2:120387532G>A																												ENST00000413369.3:c.1731+1G>A	2.37:g.120387532G>A						PCDP1_uc010yyq.1_Splice_Site_p.Q421_splice	p.Q291_splice	NM_001029996	NP_001025167	Q4G0U5	PCDP1_HUMAN			18	1965	+	Colorectal(110;0.196)								Splice_Site	SNP	ENST00000413369.3	37	c.873_splice	CCDS33282.2	.	.	.	.	.	.	.	.	.	.	G	16.16	3.043349	0.55003	.	.	ENSG00000163075	ENST00000295220;ENST00000413369;ENST00000443972;ENST00000413057	.	.	.	4.66	4.66	0.58398	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.2381	0.59982	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	AC069154.2	120104002	1.000000	0.71417	1.000000	0.80357	0.777000	0.43975	4.828000	0.62730	2.567000	0.86603	0.563000	0.77884	.		0.338	PCDP1-006	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464236.1		Intron	24	84	0	0	0	0.00333	0	24	84				
LCT	3938	broad.mit.edu	37	2	136594656	136594656	+	Silent	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr2:136594656G>A	ENST00000264162.2	-	1	94	c.84C>T	c.(82-84)ttC>ttT	p.F28F		NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	28					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)	p.F28F(1)		breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	CGGTGGAAATGAAATTTCTAT	0.468																																							uc002tuu.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13						c.(82-84)TTC>TTT		lactase-phlorizin hydrolase preproprotein							51.0	51.0	51.0					2																	136594656		2203	4300	6503	SO:0001819	synonymous_variant	3938				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity	g.chr2:136594656G>A	X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.84C>T	2.37:g.136594656G>A							p.F28F	NM_002299	NP_002290	P09848	LPH_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.169)	1	95	-			28			Extracellular (Potential).		Q4ZG58	Silent	SNP	ENST00000264162.2	37	c.84C>T	CCDS2178.1																																																																																				0.468	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	NM_002299		8	40	0	0	0	0.004482	0	8	40				
LRP1B	53353	broad.mit.edu	37	2	141110564	141110564	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr2:141110564C>T	ENST00000389484.3	-	76	12579	c.11608G>A	c.(11608-11610)Gac>Aac	p.D3870N		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3870	EGF-like 15. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.D3870N(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		AAATTCTGGTCACACACACAT	0.323										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(11608-11610)GAC>AAC		low density lipoprotein-related protein 1B							173.0	173.0	173.0					2																	141110564		2203	4300	6503	SO:0001583	missense	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141110564C>T	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.11608G>A	2.37:g.141110564C>T	ENSP00000374135:p.Asp3870Asn	TSP Lung(27;0.18)					p.D3870N	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	76	12580	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	3870			Extracellular (Potential).|EGF-like 9.		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	c.11608G>A	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	19.91	3.914109	0.72983	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.89617	-2.54	5.6	4.72	0.59763	Growth factor, receptor (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.204845	0.39020	N	0.001490	D	0.83008	0.5161	N	0.16307	0.4	0.45183	D	0.998191	B	0.31752	0.338	B	0.38803	0.282	T	0.78947	-0.2003	10	0.17832	T	0.49	.	16.8415	0.85971	0.0:0.8712:0.1288:0.0	.	3870	Q9NZR2	LRP1B_HUMAN	N	3870;3808	ENSP00000374135:D3870N	ENSP00000374135:D3870N	D	-	1	0	LRP1B	140827034	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.433000	0.66520	1.487000	0.48415	0.591000	0.81541	GAC		0.323	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		26	157	0	0	0	0.007291	0	26	157				
LRP1B	53353	broad.mit.edu	37	2	141128318	141128318	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr2:141128318C>A	ENST00000389484.3	-	71	11940	c.10969G>T	c.(10969-10971)Gac>Tac	p.D3657Y		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3657	LDL-receptor class A 29. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.D3657Y(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TCCACACAGTCATGAATTCCA	0.408										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(10969-10971)GAC>TAC		low density lipoprotein-related protein 1B							264.0	247.0	253.0					2																	141128318		2203	4300	6503	SO:0001583	missense	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141128318C>A	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.10969G>T	2.37:g.141128318C>A	ENSP00000374135:p.Asp3657Tyr	TSP Lung(27;0.18)					p.D3657Y	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	71	11941	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	3657			Extracellular (Potential).|LDL-receptor class A 29.		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	c.10969G>T	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.606601	0.87157	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.99042	-5.36	5.19	5.19	0.71726	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.85682	U	0.000000	D	0.99579	0.9848	H	0.96889	3.9	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.97814	1.0252	10	0.87932	D	0	.	18.7039	0.91630	0.0:1.0:0.0:0.0	.	3657	Q9NZR2	LRP1B_HUMAN	Y	3657;3595	ENSP00000374135:D3657Y	ENSP00000374135:D3657Y	D	-	1	0	LRP1B	140844788	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.372000	0.79612	2.427000	0.82271	0.491000	0.48974	GAC		0.408	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		60	314	1	0	1.31171e-36	0.01441	1.85499e-36	60	314				
TANC1	85461	broad.mit.edu	37	2	160031569	160031569	+	Missense_Mutation	SNP	G	G	T	rs190179338	byFrequency	TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr2:160031569G>T	ENST00000263635.6	+	12	1846	c.1609G>T	c.(1609-1611)Gcc>Tcc	p.A537S	TANC1_ENST00000454300.1_Missense_Mutation_p.A431S	NM_001145909.1|NM_033394.2	NP_001139381.1|NP_203752.2	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1	537					dendritic spine maintenance (GO:0097062)|myoblast fusion (GO:0007520)|visual learning (GO:0008542)	axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)		p.A537S(2)		breast(3)|central_nervous_system(4)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(25)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	77						TCAGCTGGCCGCCTACAGAGA	0.592																																							uc002uag.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|central_nervous_system(1)	3						c.(1609-1611)GCC>TCC		tetratricopeptide repeat, ankyrin repeat and							127.0	130.0	129.0					2																	160031569		2024	4187	6211	SO:0001583	missense	85461					cell junction|postsynaptic density|postsynaptic membrane	binding	g.chr2:160031569G>T	AB051515	CCDS42766.1	2q24.2	2013-01-11			ENSG00000115183	ENSG00000115183		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29364	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	611397				15673434	Standard	NM_033394		Approved	KIAA1728, ROLSB	uc002uag.3	Q9C0D5	OTTHUMG00000153945	ENST00000263635.6:c.1609G>T	2.37:g.160031569G>T	ENSP00000263635:p.Ala537Ser					TANC1_uc010fol.1_Missense_Mutation_p.A431S|TANC1_uc010zcm.1_Missense_Mutation_p.A529S|TANC1_uc010fom.1_Missense_Mutation_p.A343S|TANC1_uc002uai.1_5'Flank	p.A537S	NM_033394	NP_203752	Q9C0D5	TANC1_HUMAN			12	1883	+			537					C9JD88|Q49AI8	Missense_Mutation	SNP	ENST00000263635.6	37	c.1609G>T	CCDS42766.1	.	.	.	.	.	.	.	.	.	.	G	35	5.472591	0.96274	.	.	ENSG00000115183	ENST00000454300;ENST00000263635	T;T	0.72725	-0.65;-0.68	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	D	0.83547	0.5278	M	0.65975	2.015	0.80722	D	1	D;D;P	0.89917	1.0;1.0;0.785	D;D;P	0.87578	0.995;0.998;0.473	T	0.82394	-0.0479	10	0.44086	T	0.13	.	19.6165	0.95636	0.0:0.0:1.0:0.0	.	529;431;537	B9EK39;Q9C0D5-2;Q9C0D5	.;.;TANC1_HUMAN	S	431;537	ENSP00000396339:A431S;ENSP00000263635:A537S	ENSP00000263635:A537S	A	+	1	0	TANC1	159739815	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.778000	0.75043	2.638000	0.89438	0.655000	0.94253	GCC		0.592	TANC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333135.1			153	120	1	0	2.33112e-60	0.01441	3.41117e-60	153	120				
CSRNP3	80034	broad.mit.edu	37	2	166451720	166451720	+	Missense_Mutation	SNP	A	A	C			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr2:166451720A>C	ENST00000342316.4	+	2	417	c.145A>C	c.(145-147)Acc>Ccc	p.T49P	CSRNP3_ENST00000314499.7_Missense_Mutation_p.T49P|CSRNP3_ENST00000409420.1_Missense_Mutation_p.T81P	NM_024969.3	NP_079245.2	Q8WYN3	CSRN3_HUMAN	cysteine-serine-rich nuclear protein 3	49	Ser-rich.				apoptotic process (GO:0006915)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T49P(1)		breast(2)|cervix(1)|endometrium(1)|large_intestine(9)|lung(15)|ovary(3)|skin(2)	33						TAGTCATTTTACCCGTGAGTA	0.408																																							uc002udf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(1)|skin(1)	5						c.(145-147)ACC>CCC		cysteine-serine-rich nuclear protein 3							138.0	128.0	131.0					2																	166451720		2203	4300	6503	SO:0001583	missense	80034				apoptosis|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr2:166451720A>C	AB063300	CCDS2225.1	2q24.3	2012-04-17	2009-01-07	2009-01-07	ENSG00000178662	ENSG00000178662		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30729	protein-coding gene	gene with protein product	"""TGF beta induced apotosis protein 2"", ""protein phosphatase 1, regulatory subunit 73"""		"""family with sequence similarity 130, member A2"""	FAM130A2		17726538	Standard	NM_024969		Approved	FLJ32093, TAIP-2, PPP1R73	uc002udg.3	Q8WYN3	OTTHUMG00000132145	ENST00000342316.4:c.145A>C	2.37:g.166451720A>C	ENSP00000344042:p.Thr49Pro					CSRNP3_uc002udg.2_Missense_Mutation_p.T49P	p.T49P	NM_024969	NP_079245	Q8WYN3	CSRN3_HUMAN			4	521	+			49			Ser-rich.		B3KPR4|Q53SG0|Q6ZTX3|Q9HAF9	Missense_Mutation	SNP	ENST00000342316.4	37	c.145A>C	CCDS2225.1	.	.	.	.	.	.	.	.	.	.	A	18.45	3.626600	0.66901	.	.	ENSG00000178662	ENST00000421875;ENST00000431452;ENST00000314499;ENST00000409664;ENST00000342316;ENST00000409420	T;T;T;T;T	0.16743	2.32;2.32;2.32;2.32;2.32	5.92	3.71	0.42584	.	0.101955	0.64402	N	0.000003	T	0.20170	0.0485	L	0.61387	1.9	0.45747	D	0.998641	B	0.15141	0.012	B	0.17433	0.018	T	0.02275	-1.1184	10	0.46703	T	0.11	-2.7962	12.7449	0.57276	0.6495:0.3505:0.0:0.0	.	49	Q8WYN3	CSRN3_HUMAN	P	49;56;49;49;49;81	ENSP00000412081:T49P;ENSP00000318258:T49P;ENSP00000386278:T49P;ENSP00000344042:T49P;ENSP00000387195:T81P	ENSP00000318258:T49P	T	+	1	0	CSRNP3	166159966	1.000000	0.71417	0.979000	0.43373	0.938000	0.57974	5.715000	0.68430	0.604000	0.29930	-0.313000	0.08912	ACC		0.408	CSRNP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255191.2	NM_024969		68	70	0	0	0	0.01441	0	68	70				
SCN9A	6335	broad.mit.edu	37	2	167141098	167141098	+	Silent	SNP	C	C	T	rs565711085		TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr2:167141098C>T	ENST00000409435.1	-	11	1838	c.1839G>A	c.(1837-1839)ccG>ccA	p.P613P	SCN9A_ENST00000375387.4_Silent_p.P614P|SCN9A_ENST00000409672.1_Silent_p.P613P|AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000303354.6_Silent_p.P614P			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	613					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)	p.P613P(1)		NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TCCCGTTCACCGGCAGCATTG	0.587													C|||	1	0.000199681	0.0	0.0	5008	,	,		18569	0.0		0.0	False		,,,				2504	0.001						uc010fpl.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(6)|central_nervous_system(5)|skin(2)	13						c.(1837-1839)CCG>CCA		sodium channel, voltage-gated, type IX, alpha	Lamotrigine(DB00555)|Lidocaine(DB00281)						90.0	94.0	93.0					2																	167141098		2175	4283	6458	SO:0001819	synonymous_variant	6335					voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr2:167141098C>T	X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.1839G>A	2.37:g.167141098C>T						uc002udp.2_Intron|SCN9A_uc002udr.1_Silent_p.P484P|SCN9A_uc002uds.1_Silent_p.P484P|SCN9A_uc002udt.1_Silent_p.P484P	p.P613P	NM_002977	NP_002968	Q15858	SCN9A_HUMAN			12	2180	-			613					A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Silent	SNP	ENST00000409435.1	37	c.1839G>A	CCDS46441.1																																																																																				0.587	SCN9A-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333639.1	NM_002977		30	40	0	0	0	0.011902	0	30	40				
XIRP2	129446	broad.mit.edu	37	2	168105626	168105626	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr2:168105626G>A	ENST00000409195.1	+	9	7813	c.7724G>A	c.(7723-7725)aGc>aAc	p.S2575N	XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.S2353N|XIRP2_ENST00000295237.9_Missense_Mutation_p.S2575N	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	2400					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)		p.S2575N(1)		NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						AAAACTCAAAGCCAAAATCAA	0.338																																							uc002udx.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(7)|ovary(6)|pancreas(1)	14						c.(7723-7725)AGC>AAC		xin actin-binding repeat containing 2 isoform 1							95.0	90.0	92.0					2																	168105626		1832	4082	5914	SO:0001583	missense	129446				actin cytoskeleton organization	cell junction	actin binding	g.chr2:168105626G>A	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.7724G>A	2.37:g.168105626G>A	ENSP00000386840:p.Ser2575Asn					XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.S2400N|XIRP2_uc010fpq.2_Missense_Mutation_p.S2353N|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_Intron	p.S2575N	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN			8	7742	+			2400					A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	37	c.7724G>A	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	G	12.00	1.806070	0.31961	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.02606	4.23;4.23;4.23	6.07	-1.5	0.08691	.	0.918926	0.09497	N	0.794183	T	0.02571	0.0078	L	0.43152	1.355	0.09310	N	1	B;B;B	0.11235	0.001;0.002;0.004	B;B;B	0.08055	0.001;0.003;0.003	T	0.46527	-0.9185	10	0.48119	T	0.1	1.2096	1.6013	0.02675	0.2516:0.1097:0.4254:0.2133	.	2400;2400;2353	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	N	2575;2575;2353	ENSP00000386840:S2575N;ENSP00000295237:S2575N;ENSP00000387255:S2353N	ENSP00000295237:S2575N	S	+	2	0	XIRP2	167813872	0.001000	0.12720	0.000000	0.03702	0.268000	0.26511	-0.120000	0.10660	-0.096000	0.12329	0.655000	0.94253	AGC		0.338	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381		28	147	0	0	0	0.007291	0	28	147				
CERS6	253782	broad.mit.edu	37	2	169547564	169547564	+	Silent	SNP	G	G	C			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr2:169547564G>C	ENST00000305747.6	+	5	1073	c.486G>C	c.(484-486)acG>acC	p.T162T	CERS6_ENST00000392687.4_Silent_p.T162T	NM_203463.2	NP_982288.1	Q6ZMG9	CERS6_HUMAN	ceramide synthase 6	162	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)	p.T162T(1)									TGTGGAATACGAGGCATTGCT	0.373																																							uc002ueb.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(484-486)ACG>ACC		longevity assurance homolog 6							148.0	149.0	149.0					2																	169547564		2203	4300	6503	SO:0001819	synonymous_variant	253782					endoplasmic reticulum membrane|integral to membrane|nuclear membrane	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity	g.chr2:169547564G>C	BX393696	CCDS2228.1, CCDS58734.1	2q31	2011-07-11	2011-07-08	2011-07-08	ENSG00000172292	ENSG00000172292		"""Homeoboxes / CERS class"""	23826	protein-coding gene	gene with protein product		615336	"""LAG1 longevity assurance homolog 6 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 6"""	LASS6			Standard	NM_203463		Approved		uc002uec.2	Q6ZMG9	OTTHUMG00000132183	ENST00000305747.6:c.486G>C	2.37:g.169547564G>C						LASS6_uc002uec.1_Silent_p.T162T	p.T162T	NM_203463	NP_982288	Q6ZMG9	CERS6_HUMAN			5	610	+			162			Cytoplasmic (Potential).|TLC.		Q32M63|Q8N617	Silent	SNP	ENST00000305747.6	37	c.486G>C	CCDS2228.1																																																																																				0.373	CERS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255235.2	NM_203463		25	179	0	0	0	0.005443	0	25	179				
LRP2	4036	broad.mit.edu	37	2	170151164	170151164	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr2:170151164G>C	ENST00000263816.3	-	5	769	c.484C>G	c.(484-486)Cag>Gag	p.Q162E	LRP2_ENST00000443831.1_Missense_Mutation_p.Q162E	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	162	LDL-receptor class A 4. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.Q162E(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	TCACACTTCTGACTGGTGTTA	0.393																																							uc002ues.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29						c.(484-486)CAG>GAG		low density lipoprotein-related protein 2	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)						98.0	91.0	93.0					2																	170151164		2203	4300	6503	SO:0001583	missense	4036				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding	g.chr2:170151164G>C		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.484C>G	2.37:g.170151164G>C	ENSP00000263816:p.Gln162Glu					LRP2_uc010zdf.1_Missense_Mutation_p.Q162E	p.Q162E	NM_004525	NP_004516	P98164	LRP2_HUMAN		STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	5	697	-			162			LDL-receptor class A 4.|Extracellular (Potential).		O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	c.484C>G	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	G	17.30	3.355314	0.61293	.	.	ENSG00000081479	ENST00000263816;ENST00000443831	D;D	0.91295	-2.82;-2.82	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	D	0.94676	0.8283	M	0.67625	2.065	0.80722	D	1	D;D	0.63046	0.992;0.989	D;D	0.72338	0.958;0.977	D	0.93967	0.7246	9	.	.	.	.	18.887	0.92383	0.0:0.0:1.0:0.0	.	162;162	E9PC35;P98164	.;LRP2_HUMAN	E	162	ENSP00000263816:Q162E;ENSP00000409813:Q162E	.	Q	-	1	0	LRP2	169859410	1.000000	0.71417	0.577000	0.28562	0.337000	0.28794	7.334000	0.79224	2.550000	0.86006	0.591000	0.81541	CAG		0.393	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525		25	84	0	0	0	0.008361	0	25	84				
CCDC173	129881	broad.mit.edu	37	2	170505760	170505760	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr2:170505760C>T	ENST00000447353.1	-	8	1354	c.1249G>A	c.(1249-1251)Gaa>Aaa	p.E417K		NM_001085447.1	NP_001078916.1	Q0VFZ6	CC173_HUMAN	coiled-coil domain containing 173	417								p.E411K(1)									TTCTCCTTTTCATGTTCCCAG	0.333																																							uc002ufe.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1249-1251)GAA>AAA		hypothetical protein LOC129881							137.0	124.0	128.0					2																	170505760		1823	4094	5917	SO:0001583	missense	129881							g.chr2:170505760C>T	BC015980, BC117445	CCDS46445.1	2q31.1	2012-08-07	2012-08-07	2012-08-07	ENSG00000154479	ENSG00000154479			25064	protein-coding gene	gene with protein product	"""hypothetical LOC129881"""		"""chromosome 2 open reading frame 77"""	C2orf77		12477932	Standard	NM_001085447		Approved	LOC129881	uc002ufe.2	Q0VFZ6	OTTHUMG00000154116	ENST00000447353.1:c.1249G>A	2.37:g.170505760C>T	ENSP00000391504:p.Glu417Lys						p.E417K	NM_001085447	NP_001078916	Q0VFZ6	CB077_HUMAN			8	1343	-			417					Q6PJF6	Missense_Mutation	SNP	ENST00000447353.1	37	c.1249G>A	CCDS46445.1	.	.	.	.	.	.	.	.	.	.	C	19.51	3.841956	0.71488	.	.	ENSG00000154479	ENST00000447353	T	0.14391	2.51	5.28	4.37	0.52481	.	.	.	.	.	T	0.28830	0.0715	M	0.64997	1.995	0.35286	D	0.781771	D	0.57257	0.979	P	0.58266	0.836	T	0.25745	-1.0123	9	0.46703	T	0.11	.	13.5225	0.61576	0.0:0.7088:0.2912:0.0	.	417	Q0VFZ6	CB077_HUMAN	K	417	ENSP00000391504:E417K	ENSP00000391504:E417K	E	-	1	0	C2orf77	170214006	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	2.234000	0.43035	2.473000	0.83533	0.467000	0.42956	GAA		0.333	CCDC173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333954.2	NM_001085447		7	41	0	0	0	0.00308	0	7	41				
COL5A2	1290	broad.mit.edu	37	2	189925458	189925458	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr2:189925458G>C	ENST00000374866.3	-	31	2357	c.2083C>G	c.(2083-2085)Caa>Gaa	p.Q695E		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	695					axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)	p.Q695E(1)		NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			ACACTTACTTGATCACCTGGT	0.373																																							uc002uqk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(2083-2085)CAA>GAA		alpha 2 type V collagen preproprotein							87.0	87.0	87.0					2																	189925458		2203	4300	6503	SO:0001583	missense	1290				axon guidance|collagen fibril organization|eye morphogenesis|skin development	collagen type V	extracellular matrix structural constituent	g.chr2:189925458G>C	Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.2083C>G	2.37:g.189925458G>C	ENSP00000364000:p.Gln695Glu					COL5A2_uc010frx.2_Missense_Mutation_p.Q271E	p.Q695E	NM_000393	NP_000384	P05997	CO5A2_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)		31	2358	-			695					P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Missense_Mutation	SNP	ENST00000374866.3	37	c.2083C>G	CCDS33350.1	.	.	.	.	.	.	.	.	.	.	G	13.44	2.238514	0.39598	.	.	ENSG00000204262	ENST00000374866;ENST00000452536	D	0.93189	-3.18	5.81	5.81	0.92471	.	0.000000	0.45867	D	0.000334	D	0.89591	0.6759	L	0.40543	1.245	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	D	0.84507	0.0620	9	.	.	.	.	15.543	0.76070	0.0:0.1374:0.8626:0.0	.	335;695	Q5PR22;P05997	.;CO5A2_HUMAN	E	695;335	ENSP00000364000:Q695E	.	Q	-	1	0	COL5A2	189633703	1.000000	0.71417	1.000000	0.80357	0.816000	0.46133	3.053000	0.49901	2.751000	0.94390	0.555000	0.69702	CAA		0.373	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313523.1	NM_000393		13	36	0	0	0	0.00245	0	13	36				
MYO1B	4430	broad.mit.edu	37	2	192275861	192275861	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr2:192275861G>C	ENST00000392318.3	+	27	3083	c.2836G>C	c.(2836-2838)Gaa>Caa	p.E946Q	MYO1B_ENST00000304164.4_Missense_Mutation_p.E946Q|MYO1B_ENST00000392316.1_Missense_Mutation_p.E917Q|MYO1B_ENST00000439065.2_Missense_Mutation_p.E191Q|MYO1B_ENST00000339514.4_Missense_Mutation_p.E888Q	NM_001130158.1	NP_001123630.1	O43795	MYO1B_HUMAN	myosin IB	946	Myosin tail. {ECO:0000255}.				actin filament bundle assembly (GO:0051017)|actin filament organization (GO:0007015)|actin filament-based movement (GO:0030048)|metabolic process (GO:0008152)|post-Golgi vesicle-mediated transport (GO:0006892)	actin filament (GO:0005884)|brush border (GO:0005903)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.E888Q(1)|p.E946Q(1)		NS(1)|central_nervous_system(6)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(19)|ovary(1)	55			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)			AGAAGCCAGTGAACTCTTCAA	0.333																																							uc010fsg.2		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(5)|large_intestine(2)|ovary(1)	8						c.(2836-2838)GAA>CAA		myosin IB isoform 1							79.0	89.0	85.0					2																	192275861		2203	4300	6503	SO:0001583	missense	4430					myosin complex	actin binding|ATP binding|calmodulin binding|motor activity	g.chr2:192275861G>C	L29138	CCDS2311.1, CCDS46477.1	2q12-q34	2011-09-27			ENSG00000128641	ENSG00000128641		"""Myosins / Myosin superfamily : Class I"""	7596	protein-coding gene	gene with protein product		606537				8022818, 8449985	Standard	NM_012223		Approved	myr1	uc010fsg.2	O43795	OTTHUMG00000132718	ENST00000392318.3:c.2836G>C	2.37:g.192275861G>C	ENSP00000376132:p.Glu946Gln					MYO1B_uc002usq.2_Missense_Mutation_p.E888Q|MYO1B_uc002usr.2_Missense_Mutation_p.E946Q|MYO1B_uc002usu.2_Missense_Mutation_p.E191Q|MYO1B_uc002usv.2_Missense_Mutation_p.E62Q	p.E946Q	NM_001130158	NP_001123630	O43795	MYO1B_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)		27	3091	+			946					O43794|Q7Z6L5	Missense_Mutation	SNP	ENST00000392318.3	37	c.2836G>C	CCDS46477.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.41|19.41	3.823036|3.823036	0.71028|0.71028	.|.	.|.	ENSG00000128641|ENSG00000128641	ENST00000339514;ENST00000392318;ENST00000304164;ENST00000392316;ENST00000439065|ENST00000427152	T;T;T;T;T|.	0.37584|.	1.19;1.19;1.19;1.19;1.19|.	5.67|5.67	4.73|4.73	0.59995|0.59995	Myosin tail 2 (1);|.	0.051552|.	0.85682|.	D|.	0.000000|.	T|.	0.70833|.	0.3269|.	M|M	0.64080|0.64080	1.96|1.96	0.48830|0.48830	D|D	0.999718|0.999718	D;P;P|.	0.89917|.	1.0;0.94;0.926|.	D;P;P|.	0.87578|.	0.998;0.838;0.693|.	T|.	0.68644|.	-0.5354|.	10|.	0.36615|.	T|.	0.2|.	.|.	14.8041|14.8041	0.69938|0.69938	0.0:0.1434:0.8566:0.0|0.0:0.1434:0.8566:0.0	.|.	191;946;888|.	E7EPB4;O43795;O43795-2|.	.;MYO1B_HUMAN;.|.	Q|S	888;946;946;917;191|24	ENSP00000341903:E888Q;ENSP00000376132:E946Q;ENSP00000306382:E946Q;ENSP00000376130:E917Q;ENSP00000391442:E191Q|.	ENSP00000306382:E946Q|.	E|X	+|+	1|2	0|2	MYO1B|MYO1B	191984106|191984106	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.820000|4.820000	0.62671|0.62671	2.834000|2.834000	0.97654|0.97654	0.650000|0.650000	0.86243|0.86243	GAA|TGA		0.333	MYO1B-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334774.1	NM_012223		12	68	0	0	0	0.001855	0	12	68				
CCDC108	255101	broad.mit.edu	37	2	219892544	219892544	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr2:219892544G>T	ENST00000341552.5	-	13	2122	c.2039C>A	c.(2038-2040)aCc>aAc	p.T680N	CCDC108_ENST00000441968.1_Missense_Mutation_p.T680N|CCDC108_ENST00000453220.1_Missense_Mutation_p.T680N|CCDC108_ENST00000410037.1_Missense_Mutation_p.T615N|CCDC108_ENST00000409865.3_Missense_Mutation_p.T669N	NM_194302.2	NP_919278.2	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108	680						integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)	p.T680N(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(1)|lung(34)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTTGCCCTTGGTGTGGTTCAT	0.627																																							uc002vjl.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4						c.(2038-2040)ACC>AAC		coiled-coil domain containing 108 isoform 1							64.0	59.0	61.0					2																	219892544		2203	4300	6503	SO:0001583	missense	255101					integral to membrane	structural molecule activity	g.chr2:219892544G>T	NM_194302, AL833882, AK127189	CCDS2430.2, CCDS2431.2, CCDS63125.1, CCDS63126.1	2q35	2008-02-05			ENSG00000181378	ENSG00000181378			25325	protein-coding gene	gene with protein product		614270				12477932	Standard	NM_194302		Approved	DKFZp434O0527, MGC35338	uc002vjl.2	Q6ZU64	OTTHUMG00000133013	ENST00000341552.5:c.2039C>A	2.37:g.219892544G>T	ENSP00000340776:p.Thr680Asn					CCDC108_uc010fwa.1_Missense_Mutation_p.T123N|CCDC108_uc010zkp.1_Missense_Mutation_p.T669N|CCDC108_uc010zkq.1_Missense_Mutation_p.T615N	p.T680N	NM_194302	NP_919278	Q6ZU64	CC108_HUMAN		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	13	2123	-		Renal(207;0.0915)	680					A2BDD8|E9PCR1|E9PG25|E9PG72|Q6ZSR8|Q8N0T4|Q8NDJ3	Missense_Mutation	SNP	ENST00000341552.5	37	c.2039C>A	CCDS2430.2	.	.	.	.	.	.	.	.	.	.	G	25.9	4.680934	0.88542	.	.	ENSG00000181378	ENST00000341552;ENST00000441968;ENST00000453220;ENST00000545086;ENST00000409865;ENST00000410037;ENST00000441164	T;T;T;T;T	0.13901	3.03;3.03;3.03;2.55;2.55	5.18	5.18	0.71444	.	0.000000	0.48286	D	0.000198	T	0.39306	0.1073	M	0.72894	2.215	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	T	0.09596	-1.0667	10	0.56958	D	0.05	-44.2236	18.8819	0.92358	0.0:0.0:1.0:0.0	.	669;614;680	E9PG25;B4DYZ8;Q6ZU64	.;.;CC108_HUMAN	N	680;680;680;156;669;615;614	ENSP00000340776:T680N;ENSP00000413377:T680N;ENSP00000409117:T680N;ENSP00000386945:T669N;ENSP00000386258:T615N	ENSP00000340776:T680N	T	-	2	0	CCDC108	219600788	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.600000	0.82769	2.688000	0.91661	0.655000	0.94253	ACC		0.627	CCDC108-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256598.4	NM_194302		19	59	1	0	2.35188e-11	0.006122	2.74266e-11	19	59				
TRIP12	9320	broad.mit.edu	37	2	230675910	230675910	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr2:230675910G>A	ENST00000283943.5	-	13	2031	c.1853C>T	c.(1852-1854)tCa>tTa	p.S618L	TRIP12_ENST00000543084.1_Intron|TRIP12_ENST00000389044.4_Missense_Mutation_p.S666L|TRIP12_ENST00000389045.3_Missense_Mutation_p.S321L	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	618					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)	p.S618L(1)		breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		GCTTTCTACTGACTTTTTATC	0.343																																							uc002vpw.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|lung(2)|breast(1)|central_nervous_system(1)|skin(1)	9						c.(1852-1854)TCA>TTA		thyroid hormone receptor interactor 12							50.0	48.0	49.0					2																	230675910		2203	4300	6503	SO:0001583	missense	9320				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	proteasome complex	thyroid hormone receptor binding|ubiquitin-protein ligase activity	g.chr2:230675910G>A	L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.1853C>T	2.37:g.230675910G>A	ENSP00000283943:p.Ser618Leu					TRIP12_uc002vpx.1_Missense_Mutation_p.S666L|TRIP12_uc002vpy.1_Missense_Mutation_p.S321L|TRIP12_uc010zlz.1_Intron|TRIP12_uc010fxh.1_Missense_Mutation_p.S624L	p.S618L	NM_004238	NP_004229	Q14669	TRIPC_HUMAN		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)	13	1962	-		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)	618					D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Missense_Mutation	SNP	ENST00000283943.5	37	c.1853C>T	CCDS33391.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.289142	0.80914	.	.	ENSG00000153827	ENST00000283943;ENST00000389045;ENST00000389044	T;T;T	0.30182	1.54;1.54;1.54	5.56	5.56	0.83823	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.44435	0.1293	L	0.29908	0.895	0.80722	D	1	D;D;D;D	0.54601	0.967;0.967;0.967;0.967	D;D;D;D	0.63597	0.916;0.916;0.916;0.916	T	0.22034	-1.0228	10	0.44086	T	0.13	.	19.5388	0.95266	0.0:0.0:1.0:0.0	.	624;321;666;618	D4HL82;Q14CF1;Q14CA3;Q14669	.;.;.;TRIPC_HUMAN	L	618;321;666	ENSP00000283943:S618L;ENSP00000373697:S321L;ENSP00000373696:S666L	ENSP00000283943:S618L	S	-	2	0	TRIP12	230384154	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.886000	0.87288	2.622000	0.88805	0.650000	0.86243	TCA		0.343	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331861.3	NM_004238		17	54	0	0	0	0.008871	0	17	54				
NEU4	129807	broad.mit.edu	37	2	242756197	242756197	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr2:242756197G>A	ENST00000391969.2	+	4	1021	c.310G>A	c.(310-312)Gcg>Acg	p.A104T	NEU4_ENST00000325935.6_Missense_Mutation_p.A117T|NEU4_ENST00000404257.1_Missense_Mutation_p.A116T|NEU4_ENST00000405370.1_Missense_Mutation_p.A104T|NEU4_ENST00000407683.1_Missense_Mutation_p.A104T	NM_001167602.1	NP_001161074.1	Q8WWR8	NEUR4_HUMAN	sialidase 4	104					ganglioside catabolic process (GO:0006689)|glycoprotein catabolic process (GO:0006516)|glycosphingolipid metabolic process (GO:0006687)|oligosaccharide catabolic process (GO:0009313)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|organelle inner membrane (GO:0019866)	exo-alpha-(2->3)-sialidase activity (GO:0052794)|exo-alpha-(2->6)-sialidase activity (GO:0052795)|exo-alpha-(2->8)-sialidase activity (GO:0052796)|exo-alpha-sialidase activity (GO:0004308)	p.A116T(1)		breast(1)|lung(10)|prostate(2)|skin(2)	15		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;3.84e-33)|all cancers(36;8.08e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.41e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0825)		CTTCTTCATCGCGGTGCTGGG	0.701																																							uc010fzr.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(310-312)GCG>ACG		sialidase 4							29.0	28.0	28.0					2																	242756197		2202	4298	6500	SO:0001583	missense	129807					lysosomal lumen|organelle inner membrane	exo-alpha-sialidase activity|protein binding	g.chr2:242756197G>A	BC012899	CCDS2553.1, CCDS54441.1, CCDS54442.1	2q37.3	2008-02-05			ENSG00000204099	ENSG00000204099			21328	protein-coding gene	gene with protein product		608527					Standard	NM_001167600		Approved		uc010fzr.3	Q8WWR8	OTTHUMG00000133412	ENST00000391969.2:c.310G>A	2.37:g.242756197G>A	ENSP00000375830:p.Ala104Thr					NEU4_uc002wcl.2_RNA|NEU4_uc002wcm.2_Missense_Mutation_p.A104T|NEU4_uc002wcn.1_Missense_Mutation_p.A116T|NEU4_uc002wco.1_Missense_Mutation_p.A104T|NEU4_uc002wcp.1_Missense_Mutation_p.A116T	p.A104T	NM_080741	NP_542779	Q8WWR8	NEUR4_HUMAN		Epithelial(32;3.84e-33)|all cancers(36;8.08e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.41e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0825)	3	396	+		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)	104					A8K056|J3KNJ5|Q96D64	Missense_Mutation	SNP	ENST00000391969.2	37	c.310G>A	CCDS54442.1	.	.	.	.	.	.	.	.	.	.	G	16.70	3.194605	0.58017	.	.	ENSG00000204099	ENST00000407683;ENST00000405370;ENST00000472793;ENST00000423583;ENST00000404257;ENST00000391969;ENST00000325935;ENST00000420288	D;D;D;D;D;D;D	0.87571	-2.27;-2.27;-2.27;-2.27;-2.27;-2.27;-2.27	4.54	4.54	0.55810	Neuraminidase (2);	0.054656	0.64402	D	0.000001	D	0.88134	0.6355	L	0.53561	1.675	0.44194	D	0.997019	D;D;P	0.69078	0.997;0.996;0.95	P;P;P	0.56960	0.81;0.712;0.464	D	0.85204	0.1017	10	0.21014	T	0.42	-10.5072	11.362	0.49648	0.099:0.0:0.901:0.0	.	116;116;104	A8K211;Q8WWR8-2;Q8WWR8	.;.;NEUR4_HUMAN	T	104;104;114;104;116;104;117;104	ENSP00000385402:A104T;ENSP00000384804:A104T;ENSP00000397860:A104T;ENSP00000385149:A116T;ENSP00000375830:A104T;ENSP00000320318:A117T;ENSP00000388707:A104T	ENSP00000320318:A117T	A	+	1	0	NEU4	242404870	1.000000	0.71417	0.193000	0.23327	0.839000	0.47603	4.564000	0.60830	2.054000	0.61138	0.462000	0.41574	GCG		0.701	NEU4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257270.2	NM_080741		16	16	0	0	0	0.006122	0	16	16				
ISM1	140862	broad.mit.edu	37	20	13280019	13280019	+	Silent	SNP	C	C	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr20:13280019C>A	ENST00000262487.4	+	6	1314	c.1308C>A	c.(1306-1308)gcC>gcA	p.A436A	TASP1_ENST00000539805.1_Intron	NM_080826.1	NP_543016.1	B1AKI9	ISM1_HUMAN	isthmin 1, angiogenesis inhibitor	436	AMOP. {ECO:0000255|PROSITE- ProRule:PRU00347}.					extracellular region (GO:0005576)		p.A436A(1)		NS(1)|autonomic_ganglia(1)|endometrium(1)|large_intestine(8)|lung(5)|urinary_tract(1)	17						ATAACGAGGCCCGGCCTCCCA	0.567																																							uc010gce.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1306-1308)GCC>GCA		isthmin 1 homolog precursor							53.0	60.0	58.0					20																	13280019		2073	4206	6279	SO:0001819	synonymous_variant	140862					extracellular region		g.chr20:13280019C>A	AL133463	CCDS46579.1	20p12.1	2013-05-15	2013-05-15	2008-12-23	ENSG00000101230	ENSG00000101230			16213	protein-coding gene	gene with protein product		615793	"""chromosome 20 open reading frame 82"", ""isthmin 1 homolog (zebrafish)"""	C20orf82			Standard	NM_080826		Approved	bA149I18.1	uc010gce.1	B1AKI9		ENST00000262487.4:c.1308C>A	20.37:g.13280019C>A						TASP1_uc010zri.1_Intron	p.A436A	NM_080826	NP_543016	B1AKI9	ISM1_HUMAN			6	1314	+			436			AMOP.		Q8WVH9	Silent	SNP	ENST00000262487.4	37	c.1308C>A	CCDS46579.1																																																																																				0.567	ISM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078039.2			32	17	1	0	6.50621e-10	0.013726	7.47229e-10	32	17				
NCOA6	23054	broad.mit.edu	37	20	33330706	33330706	+	Silent	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr20:33330706C>T	ENST00000374796.2	-	12	5924	c.3354G>A	c.(3352-3354)ccG>ccA	p.P1118P	NCOA6_ENST00000359003.2_Silent_p.P1118P			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	1118	NCOA1-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.P1118P(1)		NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						AAGGATTCTGCGGGCTCTCCT	0.537																																							uc002xav.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|breast(3)|central_nervous_system(1)	7						c.(3352-3354)CCG>CCA		nuclear receptor coactivator 6							96.0	96.0	96.0					20																	33330706		2203	4300	6503	SO:0001819	synonymous_variant	23054				brain development|cellular lipid metabolic process|DNA recombination|DNA repair|DNA replication|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|heart development|myeloid cell differentiation|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus|transcription initiation from RNA polymerase II promoter	transcription factor complex	chromatin binding|enzyme binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|retinoid X receptor binding|thyroid hormone receptor binding	g.chr20:33330706C>T	AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.3354G>A	20.37:g.33330706C>T						NCOA6_uc002xaw.2_Silent_p.P1118P	p.P1118P	NM_014071	NP_054790	Q14686	NCOA6_HUMAN			12	5925	-			1118			NCOA1-binding region.		A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Silent	SNP	ENST00000374796.2	37	c.3354G>A	CCDS13241.1																																																																																				0.537	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078811.2	NM_014071		51	85	0	0	0	0.01441	0	51	85				
UQCC1	55245	broad.mit.edu	37	20	33891776	33891776	+	Missense_Mutation	SNP	T	T	G			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr20:33891776T>G	ENST00000374385.5	-	10	1039	c.862A>C	c.(862-864)Aag>Cag	p.K288Q	UQCC1_ENST00000397556.3_Missense_Mutation_p.K189Q|UQCC1_ENST00000349714.5_Missense_Mutation_p.K261Q|UQCC1_ENST00000374377.5_Missense_Mutation_p.K176Q|UQCC1_ENST00000374384.2_Missense_Mutation_p.K262Q|UQCC1_ENST00000540457.1_Missense_Mutation_p.K133Q|UQCC1_ENST00000359226.2_Missense_Mutation_p.K208Q|UQCC1_ENST00000407996.2_Missense_Mutation_p.K151Q|UQCC1_ENST00000374380.2_Missense_Mutation_p.K220Q	NM_018244.4	NP_060714.3	Q9NVA1	UQCC1_HUMAN	ubiquinol-cytochrome c reductase complex assembly factor 1	288						cytoplasmic membrane-bounded vesicle (GO:0016023)|mitochondrion (GO:0005739)		p.K288Q(1)									GAATGGGGCTTCAGGATGCTC	0.602											OREG0025888	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002xcd.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(862-864)AAG>CAG		basic FGF-repressed Zic binding protein isoform							123.0	116.0	118.0					20																	33891776		2203	4300	6503	SO:0001583	missense	55245					cytoplasmic membrane-bounded vesicle		g.chr20:33891776T>G	AK001712	CCDS13252.1, CCDS13253.1, CCDS13253.2, CCDS54458.1	20q11.22	2013-09-20	2013-09-20	2013-09-20	ENSG00000101019	ENSG00000101019		"""Mitochondrial respiratory chain complex assembly factors"""	15891	protein-coding gene	gene with protein product	"""Basic FGF-repressed Zic-binding protein"", ""cytochrome B protein synthesis 3 homolog (S. cerevisiae)"""	611797	"""chromosome 20 open reading frame 44"", ""ubiquinol-cytochrome c reductase complex chaperone"""	C20orf44, UQCC			Standard	NM_018244		Approved	FLJ10850, CBP3, BFZB	uc002xcd.3	Q9NVA1	OTTHUMG00000032335	ENST00000374385.5:c.862A>C	20.37:g.33891776T>G	ENSP00000363506:p.Lys288Gln		OREG0025888	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	843	UQCC_uc010zuy.1_Missense_Mutation_p.K189Q|UQCC_uc010zuz.1_Missense_Mutation_p.K133Q|UQCC_uc010zva.1_Missense_Mutation_p.K151Q|UQCC_uc002xce.2_Missense_Mutation_p.K261Q|UQCC_uc002xcg.2_Missense_Mutation_p.K154Q|UQCC_uc010gfb.2_Missense_Mutation_p.K262Q|UQCC_uc010zvb.1_Missense_Mutation_p.K220Q|UQCC_uc002xcf.2_Missense_Mutation_p.K176Q|UQCC_uc002xch.2_RNA|UQCC_uc002xcc.2_Missense_Mutation_p.K101Q	p.K288Q	NM_018244	NP_060714	Q9NVA1	UQCC_HUMAN	BRCA - Breast invasive adenocarcinoma(18;0.00252)		10	929	-			288					B1AKV5|Q0VF37|Q5T348|Q5T351|Q5T353|Q86YU3|Q86YU4|Q96H66|Q9H438|Q9H452|Q9H9K8|Q9H9R5	Missense_Mutation	SNP	ENST00000374385.5	37	c.862A>C	CCDS13252.1	.	.	.	.	.	.	.	.	.	.	T	26.6	4.752845	0.89753	.	.	ENSG00000101019	ENST00000349714;ENST00000359226;ENST00000374384;ENST00000374380;ENST00000374385;ENST00000374377;ENST00000397556;ENST00000407996;ENST00000540457	T;T;T;T;T	0.54675	1.36;1.2;1.04;1.11;0.56	4.99	4.99	0.66335	.	0.204100	0.40818	N	0.001013	T	0.66376	0.2783	L	0.51422	1.61	0.80722	D	1	D;D;D;D;D;D;D;D	0.76494	0.999;0.999;0.999;0.998;0.998;0.999;0.998;0.999	D;D;D;D;D;D;D;D	0.80764	0.939;0.99;0.994;0.953;0.909;0.981;0.925;0.958	T	0.68311	-0.5442	10	0.59425	D	0.04	-18.794	14.3226	0.66496	0.0:0.0:0.0:1.0	.	220;151;262;173;189;261;288;101	B1AKV5;B7Z7J8;B7ZBG3;Q9NVA1-3;B7Z314;B7ZBG4;Q9NVA1;Q7Z3P9	.;.;.;.;.;.;UQCC_HUMAN;.	Q	261;208;262;220;288;176;189;151;133	ENSP00000335364:K261Q;ENSP00000352161:K208Q;ENSP00000363505:K262Q;ENSP00000363506:K288Q;ENSP00000386064:K151Q	ENSP00000335364:K261Q	K	-	1	0	UQCC	33355190	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	7.204000	0.77872	2.239000	0.73571	0.533000	0.62120	AAG		0.602	UQCC1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078866.1	NM_018244		84	121	0	0	0	0.01441	0	84	121				
PLCG1	5335	broad.mit.edu	37	20	39794177	39794177	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr20:39794177G>A	ENST00000373271.1	+	15	2002	c.1597G>A	c.(1597-1599)Gag>Aag	p.E533K	PLCG1_ENST00000244007.3_Missense_Mutation_p.E533K|PLCG1_ENST00000373272.2_Missense_Mutation_p.E533K	NM_182811.1	NP_877963.1	P19174	PLCG1_HUMAN	phospholipase C, gamma 1	533					activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|cell migration (GO:0016477)|cellular response to epidermal growth factor stimulus (GO:0071364)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phospholipid catabolic process (GO:0009395)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cell projection (GO:0042995)|cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|protein kinase binding (GO:0019901)|receptor signaling protein activity (GO:0005057)	p.E533K(1)		breast(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(16)|skin(6)|urinary_tract(2)	46		Myeloproliferative disorder(115;0.00878)				CGAGGATGAGGAGGAGCCCAA	0.577																																							uc002xjp.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|breast(3)|skin(2)	8						c.(1597-1599)GAG>AAG		phospholipase C, gamma 1 isoform b							76.0	67.0	70.0					20																	39794177		2203	4300	6503	SO:0001583	missense	5335				activation of phospholipase C activity|axon guidance|blood coagulation|cellular response to epidermal growth factor stimulus|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|interspecies interaction between organisms|intracellular signal transduction|leukocyte migration|nerve growth factor receptor signaling pathway|phospholipid catabolic process|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of epithelial cell migration|T cell receptor signaling pathway	cytosol|lamellipodium|plasma membrane|ruffle	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|receptor signaling protein activity	g.chr20:39794177G>A	M34667	CCDS13313.1, CCDS13314.1	20q12-q13.1	2013-02-14	2004-01-29		ENSG00000124181	ENSG00000124181	3.1.4.11	"""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"", ""SH2 domain containing"""	9065	protein-coding gene	gene with protein product		172420	"""phospholipase C, gamma 1 (formerly subtype 148)"""	PLC1		2167438, 3254788	Standard	NM_182811		Approved	PLC148, PLC-II, PLCgamma1, NCKAP3	uc002xjo.1	P19174	OTTHUMG00000033082	ENST00000373271.1:c.1597G>A	20.37:g.39794177G>A	ENSP00000362368:p.Glu533Lys					PLCG1_uc002xjo.1_Missense_Mutation_p.E533K|PLCG1_uc010zwe.1_Missense_Mutation_p.E159K|PLCG1_uc010ggf.2_5'Flank	p.E533K	NM_182811	NP_877963	P19174	PLCG1_HUMAN			15	1718	+		Myeloproliferative disorder(115;0.00878)	533					B7ZLY7|B9EGH4|E1P5W4|Q2V575	Missense_Mutation	SNP	ENST00000373271.1	37	c.1597G>A	CCDS13314.1	.	.	.	.	.	.	.	.	.	.	G	34	5.335982	0.95758	.	.	ENSG00000124181	ENST00000244007;ENST00000373271;ENST00000373272	T;T;T	0.67345	-0.26;-0.26;-0.26	5.66	5.66	0.87406	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (1);Pleckstrin homology-type (1);Pleckstrin homology domain (1);	0.000000	0.85682	D	0.000000	T	0.78892	0.4355	M	0.70275	2.135	0.80722	D	1	P;P;P	0.51933	0.589;0.949;0.454	B;P;B	0.55545	0.425;0.778;0.243	T	0.80197	-0.1482	10	0.66056	D	0.02	.	19.7365	0.96208	0.0:0.0:1.0:0.0	.	533;533;533	P19174-2;P19174;A2A284	.;PLCG1_HUMAN;.	K	533	ENSP00000244007:E533K;ENSP00000362368:E533K;ENSP00000362369:E533K	ENSP00000244007:E533K	E	+	1	0	PLCG1	39227591	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.198000	0.72106	2.672000	0.90937	0.655000	0.94253	GAG		0.577	PLCG1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080514.3	NM_182811		14	36	0	0	0	0.003163	0	14	36				
ZNF335	63925	broad.mit.edu	37	20	44578472	44578472	+	Silent	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr20:44578472C>T	ENST00000322927.2	-	24	3736	c.3636G>A	c.(3634-3636)caG>caA	p.Q1212Q	ZNF335_ENST00000426788.1_Silent_p.Q1057Q	NM_022095.3	NP_071378.1	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	1212	Gln-rich.				brain development (GO:0007420)|brain morphogenesis (GO:0048854)|cerebral cortex neuron differentiation (GO:0021895)|histone H3-K4 trimethylation (GO:0080182)|in utero embryonic development (GO:0001701)|neuron projection morphogenesis (GO:0048812)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of neurogenesis (GO:0050769)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription regulatory region DNA binding (GO:0044212)	p.Q1212Q(1)		NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(13)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	51		Myeloproliferative disorder(115;0.0122)				GCTGTACGGTCTGGCCATCTG	0.577																																							uc002xqw.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(3)|ovary(1)	4						c.(3634-3636)CAG>CAA		zinc finger protein 335							163.0	131.0	142.0					20																	44578472		2203	4300	6503	SO:0001819	synonymous_variant	63925				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr20:44578472C>T	AK026157	CCDS13389.1	20q13.12	2011-09-12			ENSG00000198026	ENSG00000198026		"""Zinc fingers, C2H2-type"""	15807	protein-coding gene	gene with protein product	"""NRC-interacting factor 1"""	610827				12215545, 19131338	Standard	NM_022095		Approved	bA465L10.2, NIF-1	uc002xqw.3	Q9H4Z2	OTTHUMG00000032637	ENST00000322927.2:c.3636G>A	20.37:g.44578472C>T						ZNF335_uc002xqv.2_Silent_p.Q324Q|ZNF335_uc010zxk.1_Silent_p.Q1057Q	p.Q1212Q	NM_022095	NP_071378	Q9H4Z2	ZN335_HUMAN			24	3759	-		Myeloproliferative disorder(115;0.0122)	1212			Gln-rich.		B4DLG7|Q548D0|Q9H684	Silent	SNP	ENST00000322927.2	37	c.3636G>A	CCDS13389.1																																																																																				0.577	ZNF335-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079553.1	NM_022095		25	44	0	0	0	0.008361	0	25	44				
NCOA3	8202	broad.mit.edu	37	20	46254147	46254147	+	Silent	SNP	T	T	C			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr20:46254147T>C	ENST00000371998.3	+	5	470	c.279T>C	c.(277-279)gaT>gaC	p.D93D	NCOA3_ENST00000372004.3_Silent_p.D93D|NCOA3_ENST00000371997.3_Silent_p.D93D|NCOA3_ENST00000341724.6_Silent_p.D93D			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	93					androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.D93D(1)		breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						CCAATGATGATGATGTTCAAA	0.368																																							uc002xtk.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|lung(1)|skin(1)	5						c.(277-279)GAT>GAC		nuclear receptor coactivator 3 isoform a							113.0	103.0	106.0					20																	46254147		2203	4300	6503	SO:0001819	synonymous_variant	8202				androgen receptor signaling pathway|cellular lipid metabolic process|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleoplasm	androgen receptor binding|histone acetyltransferase activity|ligand-dependent nuclear receptor binding|protein N-terminus binding|signal transducer activity|thyroid hormone receptor binding	g.chr20:46254147T>C	AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.279T>C	20.37:g.46254147T>C						NCOA3_uc010ght.1_Silent_p.D93D|NCOA3_uc002xtl.2_Silent_p.D93D|NCOA3_uc002xtm.2_Silent_p.D93D|NCOA3_uc002xtn.2_Silent_p.D93D|NCOA3_uc010zyc.1_5'Flank	p.D93D	NM_181659	NP_858045	Q9Y6Q9	NCOA3_HUMAN			5	484	+			93					A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Silent	SNP	ENST00000371998.3	37	c.279T>C	CCDS13407.1																																																																																				0.368	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080405.1	NM_006534		24	75	0	0	0	0.00632	0	24	75				
ZNF831	128611	broad.mit.edu	37	20	57769595	57769595	+	Missense_Mutation	SNP	T	T	G			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr20:57769595T>G	ENST00000371030.2	+	1	3521	c.3521T>G	c.(3520-3522)tTt>tGt	p.F1174C		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	1174							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.F1174C(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					CAAAACCCCTTTCCCTCACTG	0.657																																							uc002yan.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(13)|ovary(1)	14						c.(3520-3522)TTT>TGT		zinc finger protein 831							46.0	54.0	51.0					20																	57769595		2074	4169	6243	SO:0001583	missense	128611					intracellular	nucleic acid binding|zinc ion binding	g.chr20:57769595T>G	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.3521T>G	20.37:g.57769595T>G	ENSP00000360069:p.Phe1174Cys						p.F1174C	NM_178457	NP_848552	Q5JPB2	ZN831_HUMAN			1	3521	+	all_lung(29;0.0085)		1174					Q5TDR4|Q8TCP0	Missense_Mutation	SNP	ENST00000371030.2	37	c.3521T>G	CCDS42894.1	.	.	.	.	.	.	.	.	.	.	T	14.10	2.433560	0.43224	.	.	ENSG00000124203	ENST00000371030	T	0.21031	2.03	5.05	5.05	0.67936	.	0.000000	0.64402	D	0.000004	T	0.41743	0.1172	L	0.54323	1.7	0.36986	D	0.894526	D	0.89917	1.0	D	0.85130	0.997	T	0.50980	-0.8763	10	0.87932	D	0	-23.1183	13.9787	0.64287	0.0:0.0:0.0:1.0	.	1174	Q5JPB2	ZN831_HUMAN	C	1174	ENSP00000360069:F1174C	ENSP00000360069:F1174C	F	+	2	0	ZNF831	57202990	1.000000	0.71417	0.909000	0.35828	0.150000	0.21749	3.643000	0.54374	1.906000	0.55180	0.496000	0.49642	TTT		0.657	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457		24	65	0	0	0	0.005443	0	24	65				
COL20A1	57642	broad.mit.edu	37	20	61929352	61929352	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr20:61929352T>A	ENST00000358894.6	+	3	273	c.173T>A	c.(172-174)gTg>gAg	p.V58E	COL20A1_ENST00000326996.6_Missense_Mutation_p.V58E|COL20A1_ENST00000435874.1_Missense_Mutation_p.V58E|COL20A1_ENST00000422202.1_Missense_Mutation_p.V58E	NM_020882.2	NP_065933.2	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1	58	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)		p.V58E(1)		NS(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(21)|ovary(1)|prostate(3)|urinary_tract(2)	36	all_cancers(38;1.39e-10)					GGCTACCTGGTGCAGGTGAAG	0.652																																							uc011aau.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(172-174)GTG>GAG		collagen, type XX, alpha 1							34.0	44.0	41.0					20																	61929352		2012	4158	6170	SO:0001583	missense	57642				cell adhesion	collagen|extracellular space	structural molecule activity	g.chr20:61929352T>A	BC043183	CCDS46628.1	20q13.33	2014-02-12			ENSG00000101203	ENSG00000101203		"""Collagens"", ""Fibronectin type III domain containing"""	14670	protein-coding gene	gene with protein product						10819331	Standard	NM_020882		Approved	KIAA1510	uc011aau.2	Q9P218	OTTHUMG00000032964	ENST00000358894.6:c.173T>A	20.37:g.61929352T>A	ENSP00000351767:p.Val58Glu						p.V58E	NM_020882	NP_065933	Q9P218	COKA1_HUMAN			3	273	+	all_cancers(38;1.39e-10)		58			Fibronectin type-III 1.		Q4VXQ4|Q6PI59|Q8WUT2|Q96CY9|Q9BQU6|Q9BQU7	Missense_Mutation	SNP	ENST00000358894.6	37	c.173T>A	CCDS46628.1	.	.	.	.	.	.	.	.	.	.	T	15.69	2.907046	0.52333	.	.	ENSG00000101203	ENST00000358894;ENST00000326996;ENST00000435874;ENST00000422202	T;T;T;T	0.69040	-0.37;-0.37;-0.37;-0.37	3.95	3.95	0.45737	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	U	0.000002	T	0.70789	0.3264	L	0.29908	0.895	0.42436	D	0.992692	D	0.76494	0.999	D	0.70487	0.969	T	0.74708	-0.3574	10	0.87932	D	0	.	12.5206	0.56056	0.0:0.0:0.0:1.0	.	58	Q9P218	COKA1_HUMAN	E	58	ENSP00000351767:V58E;ENSP00000323077:V58E;ENSP00000408690:V58E;ENSP00000414753:V58E	ENSP00000323077:V58E	V	+	2	0	COL20A1	61399797	1.000000	0.71417	0.996000	0.52242	0.003000	0.03518	3.330000	0.52068	1.438000	0.47492	0.482000	0.46254	GTG		0.652	COL20A1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000144595.2	NM_020882		7	21	0	0	0	0.006214	0	7	21				
C20orf195	79025	broad.mit.edu	37	20	62187844	62187844	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr20:62187844C>A	ENST00000370098.3	+	2	920	c.828C>A	c.(826-828)aaC>aaA	p.N276K	C20orf195_ENST00000370097.1_Missense_Mutation_p.N276K	NM_024059.2	NP_076964.1	Q9BVV2	CT195_HUMAN	chromosome 20 open reading frame 195	276	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.					extracellular vesicular exosome (GO:0070062)		p.N276K(1)		large_intestine(3)|lung(4)	7	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;9.69e-09)|all cancers(9;5.84e-08)|BRCA - Breast invasive adenocarcinoma(10;3.63e-06)			TGCTGCCCAACCGATCCTATA	0.652																																							uc002yfj.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(826-828)AAC>AAA		hypothetical protein LOC79025							102.0	104.0	103.0					20																	62187844		2203	4299	6502	SO:0001583	missense	79025							g.chr20:62187844C>A		CCDS13526.1	20q13.33	2014-02-12			ENSG00000125531	ENSG00000125531			28764	protein-coding gene	gene with protein product						12477932	Standard	NM_024059		Approved	MGC5356	uc002yfj.3	Q9BVV2	OTTHUMG00000032980	ENST00000370098.3:c.828C>A	20.37:g.62187844C>A	ENSP00000359116:p.Asn276Lys					C20orf195_uc002yfk.2_Missense_Mutation_p.N276K	p.N276K	NM_024059	NP_076964	Q9BVV2	CT195_HUMAN	Epithelial(9;9.69e-09)|all cancers(9;5.84e-08)|BRCA - Breast invasive adenocarcinoma(10;3.63e-06)		2	920	+	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		276						Missense_Mutation	SNP	ENST00000370098.3	37	c.828C>A	CCDS13526.1	.	.	.	.	.	.	.	.	.	.	C	13.96	2.393149	0.42410	.	.	ENSG00000125531	ENST00000370098;ENST00000370097	.	.	.	5.53	3.62	0.41486	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.556447	0.17266	N	0.180597	T	0.34395	0.0896	N	0.24115	0.695	0.32702	N	0.512767	B	0.29037	0.231	B	0.28232	0.087	T	0.44190	-0.9344	9	0.54805	T	0.06	-37.198	11.8075	0.52163	0.0:0.8579:0.0:0.1421	.	276	Q9BVV2	CT195_HUMAN	K	276	.	ENSP00000359115:N276K	N	+	3	2	C20orf195	61658288	1.000000	0.71417	0.994000	0.49952	0.787000	0.44495	2.720000	0.47252	0.722000	0.32252	-0.136000	0.14681	AAC		0.652	C20orf195-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080155.1	NM_024059		39	121	1	0	1.6237e-14	0.013114	1.97872e-14	39	121				
SON	6651	broad.mit.edu	37	21	34918600	34918600	+	Silent	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr21:34918600C>T	ENST00000356577.4	+	2	634	c.159C>T	c.(157-159)gcC>gcT	p.A53A	SON_ENST00000300278.4_Silent_p.A53A|SON_ENST00000290239.6_Silent_p.A53A|SON_ENST00000381692.2_Silent_p.A53A|SON_ENST00000381679.4_Silent_p.A53A	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	53					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.A53A(2)		breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						CTGCCTCTGCCAGGAGTCTAC	0.438																																							uc002yse.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(4)|skin(2)	6						c.(157-159)GCC>GCT		SON DNA-binding protein isoform F							82.0	86.0	85.0					21																	34918600		2203	4300	6503	SO:0001819	synonymous_variant	6651				anti-apoptosis|cytokinesis|mRNA processing|regulation of cell cycle|regulation of RNA splicing|RNA splicing|spindle pole body separation	nuclear speck	DNA binding|double-stranded RNA binding	g.chr21:34918600C>T	AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.159C>T	21.37:g.34918600C>T						SON_uc002ysb.1_Silent_p.A53A|SON_uc002ysc.2_Silent_p.A53A|SON_uc002ysd.2_5'UTR|SON_uc002ysf.1_Silent_p.A53A	p.A53A	NM_138927	NP_620305	P18583	SON_HUMAN			2	208	+			53					D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Silent	SNP	ENST00000356577.4	37	c.159C>T	CCDS13629.1																																																																																				0.438	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2	NM_138927		54	35	0	0	0	0.01441	0	54	35				
DSCAM	1826	broad.mit.edu	37	21	42080523	42080523	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr21:42080523C>A	ENST00000400454.1	-	2	695	c.218G>T	c.(217-219)cGc>cTc	p.R73L		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	73	Ig-like C2-type 1.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.R73L(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				GTGGACGTGGCGGATCCCGGG	0.547																																					Melanoma(134;970 1778 1785 21664 32388)	Melanoma(134;970 1778 1785 21664 32388)	uc002yyq.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11						c.(217-219)CGC>CTC		Down syndrome cell adhesion molecule isoform							92.0	95.0	94.0					21																	42080523		1965	4156	6121	SO:0001583	missense	1826				cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding	g.chr21:42080523C>A	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.218G>T	21.37:g.42080523C>A	ENSP00000383303:p.Arg73Leu					DSCAM_uc002yyr.1_RNA	p.R73L	NM_001389	NP_001380	O60469	DSCAM_HUMAN			2	670	-		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)	73			Extracellular (Potential).|Ig-like C2-type 1.		O60468	Missense_Mutation	SNP	ENST00000400454.1	37	c.218G>T	CCDS42929.1	.	.	.	.	.	.	.	.	.	.	C	28.9	4.958549	0.92726	.	.	ENSG00000171587	ENST00000400454	T	0.37235	1.21	5.1	5.1	0.69264	Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.59169	0.2174	M	0.66560	2.04	0.53688	D	0.999976	D	0.64830	0.994	D	0.76575	0.988	T	0.59757	-0.7394	10	0.52906	T	0.07	.	17.0669	0.86561	0.0:1.0:0.0:0.0	.	73	O60469	DSCAM_HUMAN	L	73	ENSP00000383303:R73L	ENSP00000383303:R73L	R	-	2	0	DSCAM	41002393	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.354000	0.79424	2.547000	0.85894	0.585000	0.79938	CGC		0.547	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389		82	37	1	0	1.92282e-43	0.01441	2.76041e-43	82	37				
COL6A2	1292	broad.mit.edu	37	21	47545874	47545874	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr21:47545874C>G	ENST00000300527.4	+	26	2249	c.2145C>G	c.(2143-2145)atC>atG	p.I715M	COL6A2_ENST00000310645.5_Missense_Mutation_p.I715M|COL6A2_ENST00000357838.4_Missense_Mutation_p.I715M|COL6A2_ENST00000397763.1_Missense_Mutation_p.I715M|COL6A2_ENST00000409416.1_Missense_Mutation_p.I715M	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2	715	Nonhelical region.|VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)		p.I715M(3)		NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		ACCGCCTCATCAAGGAGAGCC	0.632																																							uc002zia.1		NA																	3	Substitution - Missense(3)		lung(3)	central_nervous_system(7)|ovary(1)	8						c.(2143-2145)ATC>ATG		alpha 2 type VI collagen isoform 2C2 precursor							64.0	63.0	63.0					21																	47545874		2202	4300	6502	SO:0001583	missense	1292				axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging	g.chr21:47545874C>G	M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.2145C>G	21.37:g.47545874C>G	ENSP00000300527:p.Ile715Met					COL6A2_uc002zhy.1_Missense_Mutation_p.I715M|COL6A2_uc002zhz.1_Missense_Mutation_p.I715M|COL6A2_uc002zib.1_Missense_Mutation_p.I121M|COL6A2_uc002zic.1_5'Flank	p.I715M	NM_001849	NP_001840	P12110	CO6A2_HUMAN		Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)	26	2227	+	Breast(49;0.245)		715			VWFA 2.|Nonhelical region.		Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Missense_Mutation	SNP	ENST00000300527.4	37	c.2145C>G	CCDS13728.1	.	.	.	.	.	.	.	.	.	.	C	13.78	2.338965	0.41398	.	.	ENSG00000142173	ENST00000300527;ENST00000357838;ENST00000310645;ENST00000409416;ENST00000397763	T;T;T;T;T	0.77877	-1.13;-1.13;-1.13;-1.13;-1.13	4.05	3.08	0.35506	von Willebrand factor, type A (3);	0.000000	0.85682	D	0.000000	D	0.84410	0.5466	M	0.64404	1.975	0.58432	D	0.999995	D;D;D	0.89917	1.0;0.998;0.998	D;D;D	0.91635	0.999;0.974;0.962	D	0.84372	0.0544	10	0.45353	T	0.12	-17.8642	12.2885	0.54805	0.1704:0.8296:0.0:0.0	.	715;715;715	P12110;P12110-2;P12110-3	CO6A2_HUMAN;.;.	M	715	ENSP00000300527:I715M;ENSP00000350497:I715M;ENSP00000312529:I715M;ENSP00000387115:I715M;ENSP00000380870:I715M	ENSP00000300527:I715M	I	+	3	3	COL6A2	46370302	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	2.335000	0.43929	1.808000	0.52836	0.491000	0.48974	ATC		0.632	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206971.1			19	15	0	0	0	0.012319	0	19	15				
CRYBB1	1414	broad.mit.edu	37	22	26995496	26995496	+	Silent	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr22:26995496G>A	ENST00000215939.2	-	6	847	c.717C>T	c.(715-717)ctC>ctT	p.L239L	TPST2_ENST00000403880.1_5'Flank	NM_001887.3	NP_001878.1	P53674	CRBB1_HUMAN	crystallin, beta B1	239	C-terminal arm.				visual perception (GO:0007601)		structural constituent of eye lens (GO:0005212)	p.L239L(1)		breast(1)|endometrium(4)|large_intestine(8)|lung(8)|ovary(1)|prostate(3)|skin(2)|urinary_tract(4)	31						AGGACCCCTCGAGGTGCCACT	0.597																																							uc003acy.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(715-717)CTC>CTT		crystallin, beta B1							71.0	64.0	67.0					22																	26995496		2203	4300	6503	SO:0001819	synonymous_variant	1414				visual perception		structural constituent of eye lens	g.chr22:26995496G>A		CCDS13840.1	22q12.1	2008-06-10			ENSG00000100122	ENSG00000100122			2397	protein-coding gene	gene with protein product		600929				8575764, 12360425	Standard	NM_001887		Approved		uc003acy.1	P53674	OTTHUMG00000150980	ENST00000215939.2:c.717C>T	22.37:g.26995496G>A							p.L239L	NM_001887	NP_001878	P53674	CRBB1_HUMAN			6	787	-			239			C-terminal arm.			Silent	SNP	ENST00000215939.2	37	c.717C>T	CCDS13840.1																																																																																				0.597	CRYBB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320767.1	NM_001887		40	37	0	0	0	0.010771	0	40	37				
DEPDC5	9681	broad.mit.edu	37	22	32302347	32302347	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr22:32302347G>T	ENST00000382112.3	+	42	4719	c.4649G>T	c.(4648-4650)cGc>cTc	p.R1550L	DEPDC5_ENST00000400249.2_Missense_Mutation_p.R1528L|DEPDC5_ENST00000535622.1_Missense_Mutation_p.R1459L|DEPDC5_ENST00000400246.1_Missense_Mutation_p.A1539S|DEPDC5_ENST00000382105.2_3'UTR|DEPDC5_ENST00000266091.3_Missense_Mutation_p.R1537L|DEPDC5_ENST00000539165.1_Missense_Mutation_p.R376L|DEPDC5_ENST00000382111.2_Missense_Mutation_p.A1539S|DEPDC5_ENST00000400248.2_Missense_Mutation_p.R1528L	NM_001136029.2|NM_001242896.1	NP_001129501.1|NP_001229825.1	O75140	DEPD5_HUMAN	DEP domain containing 5	1559					intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)	GTPase activator activity (GO:0005096)	p.R1528L(1)|p.R1459L(1)		breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(24)|ovary(5)|pancreas(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						AAAACATGGCGCTCCAGCGCC	0.582																																							uc003als.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|central_nervous_system(3)|pancreas(1)	8						c.(4582-4584)CGC>CTC		DEP domain containing 5 isoform 1							100.0	106.0	104.0					22																	32302347		2021	4188	6209	SO:0001583	missense	9681				intracellular signal transduction			g.chr22:32302347G>T	AB014545	CCDS43006.1, CCDS43007.1, CCDS46692.1, CCDS56229.1, CCDS74849.1	22q12.3	2013-04-29			ENSG00000100150	ENSG00000100150			18423	protein-coding gene	gene with protein product		614191				23542697, 23542701	Standard	NM_001242896		Approved	KIAA0645, DEP.5	uc011alu.2	O75140	OTTHUMG00000030926	ENST00000382112.3:c.4649G>T	22.37:g.32302347G>T	ENSP00000371546:p.Arg1550Leu					DEPDC5_uc011als.1_Missense_Mutation_p.R1459L|DEPDC5_uc011alu.1_Missense_Mutation_p.R1559L|DEPDC5_uc011alv.1_RNA|DEPDC5_uc003alt.2_Missense_Mutation_p.R1550L|DEPDC5_uc003alu.2_Missense_Mutation_p.R977L|DEPDC5_uc003alv.2_RNA|DEPDC5_uc003alw.2_Missense_Mutation_p.R826L|DEPDC5_uc011alx.1_Missense_Mutation_p.R376L|DEPDC5_uc010gwk.2_Silent_p.A563A|DEPDC5_uc011aly.1_Missense_Mutation_p.R376L	p.R1528L	NM_014662	NP_055477	O75140	DEPD5_HUMAN			42	4725	+			1528					A6H8V6|A8MPX9|B4DH93|B9EGN9|Q5K3V5|Q5THY9|Q5THZ0|Q5THZ1|Q5THZ3|Q68DR1|Q6MZX3|Q6PEZ1|Q9UGV8|Q9UH13	Missense_Mutation	SNP	ENST00000382112.3	37	c.4583G>T	CCDS46692.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	32|32	5.118331|5.118331	0.94385|0.94385	.|.	.|.	ENSG00000100150|ENSG00000100150	ENST00000400246;ENST00000382111|ENST00000535622;ENST00000266091;ENST00000400249;ENST00000382109;ENST00000382112;ENST00000400248;ENST00000539165	T;T|T;T;T;T;T	0.23754|0.41400	1.89;1.89|1.0;1.44;1.44;1.44;1.44	4.97|4.97	4.97|4.97	0.65823|0.65823	.|.	.|0.239499	.|0.32578	.|N	.|0.005901	T|T	0.62974|0.62974	0.2472|0.2472	M|M	0.64404|0.64404	1.975|1.975	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D	.|0.69078	.|0.997;0.995;0.996;0.997;0.993	.|D;D;D;D;D	.|0.79108	.|0.987;0.968;0.992;0.987;0.982	T|T	0.66031|0.66031	-0.6024|-0.6024	7|10	0.87932|0.72032	D|D	0|0.01	.|.	17.6046|17.6046	0.88034|0.88034	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1559;1459;1537;1550;1528	.|B9EGN9;B4DH93;O75140-4;A8MPX9;O75140	.|.;.;.;.;DEPD5_HUMAN	S|L	1539|1459;1537;1528;1459;1550;1528;376	ENSP00000383105:A1539S;ENSP00000371545:A1539S|ENSP00000440210:R1459L;ENSP00000266091:R1537L;ENSP00000383108:R1528L;ENSP00000371546:R1550L;ENSP00000383107:R1528L	ENSP00000371545:A1539S|ENSP00000266091:R1537L	A|R	+|+	1|2	0|0	DEPDC5|DEPDC5	30632347|30632347	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.921000|0.921000	0.55340|0.55340	9.427000|9.427000	0.97472|0.97472	2.491000|2.491000	0.84063|0.84063	0.448000|0.448000	0.29417|0.29417	GCT|CGC		0.582	DEPDC5-006	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129087.1	NM_014662		81	56	1	0	3.46703e-50	0.01441	5.05386e-50	81	56				
SYN3	8224	broad.mit.edu	37	22	33265054	33265054	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr22:33265054C>A	ENST00000358763.2	-	5	762	c.520G>T	c.(520-522)Ggg>Tgg	p.G174W	SYN3_ENST00000332840.5_Missense_Mutation_p.G174W	NM_001135774.1	NP_001129246.1	O14994	SYN3_HUMAN	synapsin III	174	C; actin-binding and synaptic-vesicle binding.				neurotransmitter secretion (GO:0007269)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)	p.G174W(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						TAGTCTTCCCCCAGGGCCATG	0.567																																							uc003amx.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(520-522)GGG>TGG		synapsin III isoform IIIa							76.0	61.0	66.0					22																	33265054		2203	4300	6503	SO:0001583	missense	8224				neurotransmitter secretion	cell junction|synaptic vesicle membrane	ATP binding|ligase activity	g.chr22:33265054C>A	AF046873	CCDS13908.1	22q12.3	2008-05-14			ENSG00000185666	ENSG00000185666			11496	protein-coding gene	gene with protein product		602705				9539796	Standard	NM_003490		Approved		uc003amx.3	O14994	OTTHUMG00000031004	ENST00000358763.2:c.520G>T	22.37:g.33265054C>A	ENSP00000351614:p.Gly174Trp					SYN3_uc003amy.2_Missense_Mutation_p.G174W|SYN3_uc003amz.2_Missense_Mutation_p.G173W	p.G174W	NM_003490	NP_003481	O14994	SYN3_HUMAN			4	679	-			174			C; actin-binding and synaptic-vesicle binding.		B1B1F9	Missense_Mutation	SNP	ENST00000358763.2	37	c.520G>T	CCDS13908.1	.	.	.	.	.	.	.	.	.	.	C	14.90	2.674244	0.47781	.	.	ENSG00000185666	ENST00000358763;ENST00000332840;ENST00000390686	T;T	0.32753	1.44;1.44	5.87	5.87	0.94306	Pre-ATP-grasp fold (1);PreATP-grasp-like fold (1);Synapsin, pre-ATP-grasp domain (1);	0.133324	0.49916	D	0.000131	T	0.51227	0.1662	M	0.71581	2.175	0.40595	D	0.98152	D;P;D	0.58970	0.984;0.946;0.984	P;P;P	0.53861	0.736;0.736;0.736	T	0.52434	-0.8576	10	0.87932	D	0	-0.456	20.5827	0.99408	0.0:1.0:0.0:0.0	.	173;174;174	Q17R54;B1B1F9;O14994	.;.;SYN3_HUMAN	W	174	ENSP00000351614:G174W;ENSP00000330219:G174W	ENSP00000330219:G174W	G	-	1	0	SYN3	31595054	0.998000	0.40836	0.993000	0.49108	0.473000	0.32948	5.992000	0.70609	2.941000	0.99782	0.655000	0.94253	GGG		0.567	SYN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075892.4			15	17	1	0	1.37657e-19	0.012319	1.79285e-19	15	17				
PIM3	415116	broad.mit.edu	37	22	50356707	50356707	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr22:50356707G>A	ENST00000360612.4	+	6	1348	c.913G>A	c.(913-915)Gac>Aac	p.D305N		NM_001001852.3	NP_001001852.2	Q86V86	PIM3_HUMAN	Pim-3 proto-oncogene, serine/threonine kinase	305					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|histone phosphorylation (GO:0016572)|negative regulation of apoptotic process (GO:0043066)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle (GO:0007346)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.D305N(1)					all_cancers(38;5.53e-07)|all_epithelial(38;3.84e-06)|all_lung(38;0.00208)|Breast(42;0.0104)|Lung NSC(38;0.0199)|Ovarian(80;0.0907)|Lung SC(80;0.236)		BRCA - Breast invasive adenocarcinoma(115;0.196)|LUAD - Lung adenocarcinoma(64;0.247)		GGAGAGCTGTGACCTGCGGCT	0.682																																							uc003bjb.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(913-915)GAC>AAC		serine/threonine protein kinase pim-3							18.0	20.0	20.0					22																	50356707		2196	4296	6492	SO:0001583	missense	415116				cell cycle|negative regulation of apoptosis|regulation of mitotic cell cycle		ATP binding|protein binding|protein serine/threonine kinase activity	g.chr22:50356707G>A	BC052239	CCDS33678.1	22q13	2014-06-25	2014-06-25		ENSG00000198355	ENSG00000198355			19310	protein-coding gene	gene with protein product		610580	"""pim-3 oncogene"""			12477932	Standard	NM_001001852		Approved		uc003bjb.3	Q86V86	OTTHUMG00000150290	ENST00000360612.4:c.913G>A	22.37:g.50356707G>A	ENSP00000353824:p.Asp305Asn					PIM3_uc011arj.1_Missense_Mutation_p.D68N	p.D305N	NM_001001852	NP_001001852	Q86V86	PIM3_HUMAN		BRCA - Breast invasive adenocarcinoma(115;0.196)|LUAD - Lung adenocarcinoma(64;0.247)	6	1366	+		all_cancers(38;5.53e-07)|all_epithelial(38;3.84e-06)|all_lung(38;0.00208)|Breast(42;0.0104)|Lung NSC(38;0.0199)|Ovarian(80;0.0907)|Lung SC(80;0.236)	305					A5D8X8|A8K7J0|B1B0P0|Q68BM2	Missense_Mutation	SNP	ENST00000360612.4	37	c.913G>A	CCDS33678.1	.	.	.	.	.	.	.	.	.	.	g	16.86	3.240223	0.58995	.	.	ENSG00000198355	ENST00000360612	T	0.20069	2.1	4.69	4.69	0.59074	Protein kinase-like domain (1);	0.140671	0.46145	U	0.000311	T	0.13415	0.0325	N	0.08118	0	0.40826	D	0.983542	B	0.17268	0.021	B	0.16289	0.015	T	0.08743	-1.0707	10	0.66056	D	0.02	.	16.5917	0.84767	0.0:0.0:1.0:0.0	.	305	Q86V86	PIM3_HUMAN	N	305	ENSP00000353824:D305N	ENSP00000353824:D305N	D	+	1	0	PIM3	48742711	1.000000	0.71417	0.989000	0.46669	0.642000	0.38348	5.935000	0.70145	2.144000	0.66660	0.506000	0.49869	GAC		0.682	PIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317406.1	NM_001001852		8	9	0	0	0	0.004482	0	8	9				
GRM7	2917	broad.mit.edu	37	3	7620469	7620469	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr3:7620469C>G	ENST00000357716.4	+	8	2150	c.1876C>G	c.(1876-1878)Cgg>Ggg	p.R626G	GRM7_ENST00000458641.2_3'UTR|GRM7_ENST00000389336.4_Missense_Mutation_p.R626G|GRM7_ENST00000486284.1_Missense_Mutation_p.R626G|GRM7_ENST00000402647.2_Missense_Mutation_p.R626G|GRM7_ENST00000403881.1_Missense_Mutation_p.R626G	NM_000844.3	NP_000835.1	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7	626					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|adult behavior (GO:0030534)|conditioned taste aversion (GO:0001661)|multicellular organismal response to stress (GO:0033555)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of glutamate secretion (GO:0014050)|regulation of cyclase activity (GO:0031279)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|short-term memory (GO:0007614)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)	adenylate cyclase inhibitor activity (GO:0010855)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|glutamate binding (GO:0016595)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|PDZ domain binding (GO:0030165)|serine binding (GO:0070905)|voltage-gated calcium channel activity (GO:0005245)	p.R626G(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(35)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	76						GGCATCTGGGCGGGAACTCAG	0.502																																							uc003bqm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|lung(3)	7						c.(1876-1878)CGG>GGG		glutamate receptor, metabotropic 7 isoform a	L-Glutamic Acid(DB00142)						126.0	129.0	128.0					3																	7620469		2203	4300	6503	SO:0001583	missense	2917				negative regulation of adenylate cyclase activity|negative regulation of cAMP biosynthetic process|negative regulation of glutamate secretion|sensory perception of smell|sensory perception of sound|synaptic transmission	asymmetric synapse|axon|cell cortex|dendritic shaft|integral to plasma membrane|postsynaptic membrane|presynaptic active zone	adenylate cyclase inhibitor activity|calcium ion binding|glutamate binding|group III metabotropic glutamate receptor activity|PDZ domain binding|serine binding	g.chr3:7620469C>G	U92458	CCDS43042.1	3p26-p25	2014-06-12			ENSG00000196277	ENSG00000196277		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 87"""	604101				8288585, 8840028	Standard	NM_000844		Approved	GLUR7, GPRC1G, mGlu7, MGLUR7, PPP1R87	uc003bql.2	Q14831	OTTHUMG00000125549	ENST00000357716.4:c.1876C>G	3.37:g.7620469C>G	ENSP00000350348:p.Arg626Gly					GRM7_uc011ata.1_RNA|GRM7_uc011atb.1_RNA|GRM7_uc010hcf.2_RNA|GRM7_uc011atc.1_RNA|GRM7_uc010hcg.2_Missense_Mutation_p.R626G|GRM7_uc003bql.2_Missense_Mutation_p.R626G|GRM7_uc003bqn.1_Missense_Mutation_p.R209G|GRM7_uc010hch.1_Missense_Mutation_p.R137G	p.R626G	NM_000844	NP_000835	Q14831	GRM7_HUMAN			8	2150	+			626			Cytoplasmic (Potential).		Q8NFS2|Q8NFS3|Q8NFS4	Missense_Mutation	SNP	ENST00000357716.4	37	c.1876C>G	CCDS43042.1	.	.	.	.	.	.	.	.	.	.	C	12.98	2.101610	0.37048	.	.	ENSG00000196277	ENST00000357716;ENST00000486284;ENST00000389336;ENST00000403881;ENST00000525747;ENST00000402647;ENST00000413492	D;D;D;D;D	0.88586	-2.4;-2.4;-2.4;-2.4;-2.4	5.93	2.85	0.33270	GPCR, family 3, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.95478	0.8531	M	0.93939	3.475	0.41937	D	0.990597	D;D;D;D;D	0.89917	1.0;0.992;0.999;0.994;1.0	D;D;D;D;D	0.97110	0.999;0.979;0.997;0.988;1.0	D	0.96279	0.9205	10	0.87932	D	0	.	13.9731	0.64255	0.5071:0.4928:0.0:0.0	.	626;626;381;626;626	B7ZKK0;Q14831-5;Q59G95;Q14831;Q14831-2	.;.;.;GRM7_HUMAN;.	G	626	ENSP00000350348:R626G;ENSP00000417536:R626G;ENSP00000373987:R626G;ENSP00000385664:R626G;ENSP00000384585:R626G	ENSP00000350348:R626G	R	+	1	2	GRM7	7595469	0.000000	0.05858	0.974000	0.42286	0.539000	0.34962	-0.283000	0.08433	0.811000	0.34303	0.655000	0.94253	CGG		0.502	GRM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246895.3	NM_000844		89	65	0	0	0	0.01441	0	89	65				
OSBPL10	114884	broad.mit.edu	37	3	31871646	31871646	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr3:31871646C>A	ENST00000396556.2	-	4	737	c.615G>T	c.(613-615)caG>caT	p.Q205H	OSBPL10_ENST00000467647.1_5'UTR|OSBPL10_ENST00000438237.2_Intron	NM_017784.4	NP_060254.2	Q9BXB5	OSB10_HUMAN	oxysterol binding protein-like 10	205					lipid transport (GO:0006869)		cholesterol binding (GO:0015485)	p.Q205H(2)		breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	34				STAD - Stomach adenocarcinoma(1;0.00406)		TGAGGTGTCTCTGGCTACAGG	0.567																																							uc003cev.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(613-615)CAG>CAT		oxysterol-binding protein-like protein 10							60.0	59.0	60.0					3																	31871646		2203	4300	6503	SO:0001583	missense	114884				lipid transport		lipid binding	g.chr3:31871646C>A	AF392451	CCDS2651.1, CCDS54559.1	3p23	2013-01-10			ENSG00000144645	ENSG00000144645		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16395	protein-coding gene	gene with protein product		606738					Standard	NM_001174060		Approved		uc021wuu.1	Q9BXB5	OTTHUMG00000130672	ENST00000396556.2:c.615G>T	3.37:g.31871646C>A	ENSP00000379804:p.Gln205His					OSBPL10_uc003ceu.1_5'UTR|OSBPL10_uc011axf.1_Intron	p.Q205H	NM_017784	NP_060254	Q9BXB5	OSB10_HUMAN		STAD - Stomach adenocarcinoma(1;0.00406)	5	996	-			205					B4E212|Q9BTU5	Missense_Mutation	SNP	ENST00000396556.2	37	c.615G>T	CCDS2651.1	.	.	.	.	.	.	.	.	.	.	C	19.76	3.887846	0.72410	.	.	ENSG00000144645	ENST00000396556	T	0.44881	0.91	5.69	4.82	0.62117	.	0.175862	0.51477	D	0.000086	T	0.57344	0.2047	M	0.67397	2.05	0.80722	D	1	D	0.67145	0.996	D	0.63033	0.91	T	0.60469	-0.7257	10	0.66056	D	0.02	-13.875	10.2318	0.43260	0.0:0.7913:0.0:0.2087	.	205	Q9BXB5	OSB10_HUMAN	H	205	ENSP00000379804:Q205H	ENSP00000379804:Q205H	Q	-	3	2	OSBPL10	31846650	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.558000	0.36309	1.415000	0.47037	0.561000	0.74099	CAG		0.567	OSBPL10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253165.2			33	20	1	0	1.51943e-15	0.01441	1.88807e-15	33	20				
MAP4	4134	broad.mit.edu	37	3	47957470	47957470	+	Nonsense_Mutation	SNP	G	G	C			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr3:47957470G>C	ENST00000360240.6	-	7	2365	c.1847C>G	c.(1846-1848)tCa>tGa	p.S616*	MAP4_ENST00000395734.3_Nonsense_Mutation_p.S616*|MAP4_ENST00000426837.2_Nonsense_Mutation_p.S633*|MAP4_ENST00000383737.4_Intron	NM_002375.4	NP_002366.2	P27816	MAP4_HUMAN	microtubule-associated protein 4	616					cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|microtubule sliding (GO:0051012)|mitotic spindle organization (GO:0007052)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|mitotic spindle (GO:0072686)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)	p.S616*(2)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(2)	32				BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)	Docetaxel(DB01248)|Paclitaxel(DB01229)	AGGTGCAGCTGACTGCCCCAC	0.428																																							uc003csb.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(2)|pancreas(1)	3						c.(1846-1848)TCA>TGA		microtubule-associated protein 4 isoform 1							173.0	173.0	173.0					3																	47957470		2203	4300	6503	SO:0001587	stop_gained	4134				negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	protein binding|structural molecule activity	g.chr3:47957470G>C		CCDS33750.1, CCDS46818.1, CCDS46821.1	3p21	2008-07-18			ENSG00000047849	ENSG00000047849			6862	protein-coding gene	gene with protein product		157132				1905296	Standard	NM_002375		Approved		uc003csb.2	P27816	OTTHUMG00000156828	ENST00000360240.6:c.1847C>G	3.37:g.47957470G>C	ENSP00000353375:p.Ser616*					MAP4_uc003csc.3_Nonsense_Mutation_p.S616*|MAP4_uc011bbf.1_Nonsense_Mutation_p.S593*|MAP4_uc003csf.3_Nonsense_Mutation_p.S633*	p.S616*	NM_002375	NP_002366	P27816	MAP4_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)	7	2373	-			616					Q13082|Q59FT2|Q68D74|Q6ZUW9|Q86V26|Q96A76|Q96NS9	Nonsense_Mutation	SNP	ENST00000360240.6	37	c.1847C>G	CCDS33750.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.848022	0.91277	.	.	ENSG00000047849	ENST00000395734;ENST00000426837;ENST00000360240	.	.	.	3.54	3.54	0.40534	.	.	.	.	.	.	.	.	.	.	.	0.35461	D	0.796541	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-3.1089	10.9104	0.47106	0.0:0.0:1.0:0.0	.	.	.	.	X	616;633;616	.	ENSP00000353375:S616X	S	-	2	0	MAP4	47932474	0.051000	0.20477	0.021000	0.16686	0.379000	0.30106	2.068000	0.41471	2.261000	0.74972	0.563000	0.77884	TCA		0.428	MAP4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346085.1	NM_002375		120	54	0	0	0	0.01441	0	120	54				
CELSR3	1951	broad.mit.edu	37	3	48697690	48697690	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr3:48697690A>G	ENST00000164024.4	-	1	2658	c.2378T>C	c.(2377-2379)aTc>aCc	p.I793T	CELSR3_ENST00000544264.1_Missense_Mutation_p.I793T	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	793	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.I793T(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GCCGCCTGTGATCTGGTAGCT	0.592																																							uc003cul.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11						c.(2377-2379)ATC>ACC		cadherin EGF LAG seven-pass G-type receptor 3							97.0	84.0	88.0					3																	48697690		2203	4300	6503	SO:0001583	missense	1951				homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding	g.chr3:48697690A>G	AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.2378T>C	3.37:g.48697690A>G	ENSP00000164024:p.Ile793Thr					CELSR3_uc003cuf.1_Missense_Mutation_p.I863T	p.I793T	NM_001407	NP_001398	Q9NYQ7	CELR3_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)	1	2659	-			793			Extracellular (Potential).|Cadherin 5.		O75092	Missense_Mutation	SNP	ENST00000164024.4	37	c.2378T>C	CCDS2775.1	.	.	.	.	.	.	.	.	.	.	A	18.26	3.584827	0.65992	.	.	ENSG00000008300	ENST00000164024;ENST00000544264	T;T	0.01963	4.53;4.53	5.67	5.67	0.87782	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.26376	0.0644	H	0.98701	4.305	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.995;0.998	T	0.52801	-0.8527	9	0.87932	D	0	.	15.9043	0.79412	1.0:0.0:0.0:0.0	.	793;863	Q9NYQ7;Q5Y190	CELR3_HUMAN;.	T	793	ENSP00000164024:I793T;ENSP00000445694:I793T	ENSP00000164024:I793T	I	-	2	0	CELSR3	48672694	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	2.169000	0.68431	0.459000	0.35465	ATC		0.592	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	NM_001407		10	59	0	0	0	0.010729	0	10	59				
OR5H15	403274	broad.mit.edu	37	3	97887574	97887574	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr3:97887574G>T	ENST00000356526.2	+	1	31	c.31G>T	c.(31-33)Gag>Tag	p.E11*		NM_001005515.1	NP_001005515.1	A6NDH6	O5H15_HUMAN	olfactory receptor, family 5, subfamily H, member 15	11						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E11*(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(20)|ovary(1)|prostate(1)|skin(2)|stomach(1)	35						ATTGCTGACAGAGTTTGTTCT	0.383																																							uc011bgu.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|skin(1)	2						c.(31-33)GAG>TAG		olfactory receptor, family 5, subfamily H,							46.0	50.0	49.0					3																	97887574		2171	4246	6417	SO:0001587	stop_gained	403274				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr3:97887574G>T		CCDS33799.1	3q11.2	2013-09-23			ENSG00000233412	ENSG00000233412		"""GPCR / Class A : Olfactory receptors"""	31287	protein-coding gene	gene with protein product							Standard	NM_001005515		Approved		uc011bgu.2	A6NDH6	OTTHUMG00000160076	ENST00000356526.2:c.31G>T	3.37:g.97887574G>T	ENSP00000373195:p.Glu11*						p.E11*	NM_001005515	NP_001005515	A6NDH6	O5H15_HUMAN			1	31	+			11			Extracellular (Potential).			Nonsense_Mutation	SNP	ENST00000356526.2	37	c.31G>T	CCDS33799.1	.	.	.	.	.	.	.	.	.	.	-	15.45	2.836985	0.50951	.	.	ENSG00000233412	ENST00000356526;ENST00000454529	.	.	.	2.48	1.53	0.23141	.	0.703971	0.12221	N	0.488363	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	8.5997	0.33736	0.0:0.2543:0.7457:0.0	.	.	.	.	X	11	.	ENSP00000373195:E11X	E	+	1	0	OR5H15	99370264	0.002000	0.14202	0.051000	0.19133	0.132000	0.20833	0.511000	0.22739	0.323000	0.23307	0.184000	0.17185	GAG		0.383	OR5H15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359109.1			137	74	1	0	6.2965e-74	0.01441	9.2855e-74	137	74				
CD47	961	broad.mit.edu	37	3	107799048	107799048	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr3:107799048C>G	ENST00000361309.5	-	2	295	c.190G>C	c.(190-192)Gat>Cat	p.D64H	CD47_ENST00000355354.7_Missense_Mutation_p.D64H	NM_001777.3	NP_001768.1	Q08722	CD47_HUMAN	CD47 molecule	64	Ig-like V-type.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|opsonization (GO:0008228)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of inflammatory response (GO:0050729)|positive regulation of phagocytosis (GO:0050766)|positive regulation of T cell activation (GO:0050870)|response to bacterium (GO:0009617)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	thrombospondin receptor activity (GO:0070053)	p.D64H(1)		endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	9			OV - Ovarian serous cystadenocarcinoma(3;0.0191)|Epithelial(53;0.118)			GTGTAAATATCTCTTCCTTTA	0.378																																							uc003dwt.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(190-192)GAT>CAT		CD47 antigen isoform 1 precursor							161.0	142.0	148.0					3																	107799048		1862	4104	5966	SO:0001583	missense	961				blood coagulation|cell adhesion|cell junction assembly|integrin-mediated signaling pathway|leukocyte migration|positive regulation of cell proliferation|positive regulation of cell-cell adhesion|positive regulation of T cell activation	integral to plasma membrane	protein binding|thrombospondin receptor activity	g.chr3:107799048C>G		CCDS43125.1, CCDS43126.1	3q13.1-q13.2	2013-01-11	2006-03-28		ENSG00000196776	ENSG00000196776		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1682	protein-coding gene	gene with protein product	"""antigen identified by monoclonal antibody 1D8"", ""antigenic surface determinant protein OA3"", ""integrin associated protein"", ""Rh-related antigen"", ""leukocyte surface antigen CD47"", ""CD47 glycoprotein"""	601028	"""CD47 antigen (Rh-related antigen, integrin-associated signal transducer)"""	MER6		8294396, 2277087	Standard	XM_005247908		Approved	IAP, OA3	uc003dwt.1	Q08722	OTTHUMG00000044216	ENST00000361309.5:c.190G>C	3.37:g.107799048C>G	ENSP00000355361:p.Asp64His					CD47_uc003dwu.1_Missense_Mutation_p.D64H|CD47_uc003dwv.1_Missense_Mutation_p.D64H|CD47_uc003dww.1_Missense_Mutation_p.D64H	p.D64H	NM_001777	NP_001768	Q08722	CD47_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;0.0191)|Epithelial(53;0.118)		2	370	-			64			Extracellular (Potential).|Ig-like V-type.		A8K198|D3DN59|Q53Y71|Q96A60	Missense_Mutation	SNP	ENST00000361309.5	37	c.190G>C	CCDS43126.1	.	.	.	.	.	.	.	.	.	.	C	5.953	0.359773	0.11296	.	.	ENSG00000196776	ENST00000355354;ENST00000361309	T;T	0.02656	4.21;4.21	6.04	-0.541	0.11858	Immunoglobulin-like (1);CD47 immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.756330	0.12893	N	0.430397	T	0.02494	0.0076	L	0.50333	1.59	0.09310	N	1	P;P;P;P	0.41624	0.713;0.713;0.757;0.757	B;B;B;B	0.40038	0.212;0.212;0.317;0.317	T	0.36986	-0.9725	10	0.14252	T	0.57	.	1.1618	0.01807	0.1685:0.4072:0.2081:0.2161	.	64;64;64;64	Q08722-2;Q08722-3;E9PB22;Q08722	.;.;.;CD47_HUMAN	H	64	ENSP00000347512:D64H;ENSP00000355361:D64H	ENSP00000347512:D64H	D	-	1	0	CD47	109281738	0.000000	0.05858	0.004000	0.12327	0.204000	0.24138	-0.498000	0.06420	-0.420000	0.07427	0.561000	0.74099	GAT		0.378	CD47-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000102793.1	NM_001777		89	41	0	0	0	0.01441	0	89	41				
COL6A6	131873	broad.mit.edu	37	3	130290238	130290238	+	Splice_Site	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr3:130290238G>T	ENST00000358511.6	+	6	3008		c.e6+1		COL6A6_ENST00000453409.2_Splice_Site	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6						cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.?(1)		NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						TCAAAAGTAGGTAAGTTTTGC	0.423																																							uc010htl.2		NA																	1	Unknown(1)		lung(1)	ovary(6)|central_nervous_system(1)|pancreas(1)	8						c.e6+1		collagen type VI alpha 6 precursor							22.0	21.0	21.0					3																	130290238		1711	3873	5584	SO:0001630	splice_region_variant	131873				axon guidance|cell adhesion	collagen		g.chr3:130290238G>T	AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.2977+1G>T	3.37:g.130290238G>T							p.D993_splice	NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN			6	3008	+								A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Splice_Site	SNP	ENST00000358511.6	37	c.2977_splice	CCDS46911.1	.	.	.	.	.	.	.	.	.	.	G	11.67	1.709246	0.30322	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	.	.	.	5.59	4.72	0.59763	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.2815	0.66216	0.0722:0.0:0.9278:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	COL6A6	131772928	1.000000	0.71417	0.998000	0.56505	0.182000	0.23217	8.134000	0.89606	1.376000	0.46267	0.561000	0.74099	.		0.423	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	NM_001102608	Intron	21	12	1	0	1.04121e-07	0.005443	1.14052e-07	21	12				
MME	4311	broad.mit.edu	37	3	154861315	154861315	+	Silent	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr3:154861315G>A	ENST00000460393.1	+	13	1392	c.1272G>A	c.(1270-1272)ggG>ggA	p.G424G	MME_ENST00000462745.1_Silent_p.G424G|MME_ENST00000360490.2_Silent_p.G424G|MME_ENST00000492661.1_Silent_p.G424G|MME_ENST00000493237.1_Silent_p.G424G	NM_000902.3|NM_007287.2	NP_000893.2|NP_009218.2	P08473	NEP_HUMAN	membrane metallo-endopeptidase	424					angiotensin maturation (GO:0002003)|beta-amyloid metabolic process (GO:0050435)|cellular protein metabolic process (GO:0044267)|cellular response to cytokine stimulus (GO:0071345)|cellular response to UV-A (GO:0071492)|cellular response to UV-B (GO:0071493)|creatinine metabolic process (GO:0046449)|kidney development (GO:0001822)|peptide metabolic process (GO:0006518)|proteolysis (GO:0006508)|replicative senescence (GO:0090399)|sensory perception of pain (GO:0019233)	axon (GO:0030424)|brush border (GO:0005903)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|zinc ion binding (GO:0008270)	p.G424G(1)		central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(31)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)|Liraglutide(DB06655)	ATGCTGTGGGGAGGCTTTATG	0.408																																							uc010hvr.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(1270-1272)GGG>GGA		membrane metallo-endopeptidase	Candoxatril(DB00616)						218.0	214.0	216.0					3																	154861315		2203	4300	6503	SO:0001819	synonymous_variant	4311				cell-cell signaling|proteolysis	integral to plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding	g.chr3:154861315G>A		CCDS3172.1	3q25.2	2012-01-31	2007-02-21		ENSG00000196549	ENSG00000196549	3.4.24.11	"""CD molecules"""	7154	protein-coding gene	gene with protein product	"""neutral endopeptidase"", ""enkephalinase"", ""neprilysin"""	120520					Standard	NM_007287		Approved	CALLA, CD10, NEP	uc003fad.1	P08473	OTTHUMG00000158455	ENST00000460393.1:c.1272G>A	3.37:g.154861315G>A						MME_uc003fab.1_Silent_p.G424G|MME_uc003fac.1_Silent_p.G424G|MME_uc003fad.1_Silent_p.G424G|MME_uc003fae.1_Silent_p.G424G	p.G424G	NM_007289	NP_009220	P08473	NEP_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		13	1483	+		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	424			Extracellular (Potential).		A8K6U6|D3DNJ9|Q3MIX4	Silent	SNP	ENST00000460393.1	37	c.1272G>A	CCDS3172.1																																																																																				0.408	MME-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351076.1	NM_000902		41	153	0	0	0	0.011902	0	41	153				
SLITRK3	22865	broad.mit.edu	37	3	164906989	164906989	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr3:164906989C>A	ENST00000475390.1	-	2	2073	c.1630G>T	c.(1630-1632)Gtg>Ttg	p.V544L	SLITRK3_ENST00000241274.3_Missense_Mutation_p.V544L			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	544					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.V544L(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						ACACCAGCCACGGGAAGATAG	0.512										HNSCC(40;0.11)																													uc003fej.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|skin(3)|pancreas(1)	10						c.(1630-1632)GTG>TTG		slit and trk like 3 protein precursor							60.0	61.0	61.0					3																	164906989		2203	4300	6503	SO:0001583	missense	22865					integral to membrane		g.chr3:164906989C>A	AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.1630G>T	3.37:g.164906989C>A	ENSP00000420091:p.Val544Leu	HNSCC(40;0.11)				SLITRK3_uc003fek.2_Missense_Mutation_p.V544L	p.V544L	NM_014926	NP_055741	O94933	SLIK3_HUMAN			2	2074	-			544			Extracellular (Potential).|LRR 12.		Q1RMY6	Missense_Mutation	SNP	ENST00000475390.1	37	c.1630G>T	CCDS3197.1	.	.	.	.	.	.	.	.	.	.	C	15.63	2.889689	0.52014	.	.	ENSG00000121871	ENST00000475390;ENST00000241274	T;T	0.51325	0.71;0.71	5.81	5.81	0.92471	.	0.000000	0.34268	N	0.004106	T	0.51517	0.1679	M	0.71036	2.16	0.53688	D	0.999979	P	0.42620	0.785	B	0.37943	0.261	T	0.57057	-0.7876	10	0.54805	T	0.06	-16.7994	20.0478	0.97616	0.0:1.0:0.0:0.0	.	544	O94933	SLIK3_HUMAN	L	544	ENSP00000420091:V544L;ENSP00000241274:V544L	ENSP00000241274:V544L	V	-	1	0	SLITRK3	166389683	1.000000	0.71417	0.998000	0.56505	0.980000	0.70556	5.984000	0.70548	2.906000	0.99361	0.655000	0.94253	GTG		0.512	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350126.1	NM_014926		45	24	1	0	9.52127e-25	0.01441	1.30273e-24	45	24				
CLDN1	9076	broad.mit.edu	37	3	190027981	190027981	+	Silent	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr3:190027981G>A	ENST00000295522.3	-	3	718	c.450C>T	c.(448-450)gaC>gaT	p.D150D		NM_021101.4	NP_066924.1	O95832	CLD1_HUMAN	claudin 1	150					calcium-independent cell-cell adhesion (GO:0016338)|cell adhesion (GO:0007155)|cell-cell junction organization (GO:0045216)|establishment of skin barrier (GO:0061436)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)	p.D150D(1)		lung(9)	9	all_cancers(143;2.95e-10)|Ovarian(172;0.0512)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.015)		GGGTCATAGGGTCATAGAATT	0.388																																							uc003fsh.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(1)	1						c.(448-450)GAC>GAT		claudin 1							100.0	97.0	98.0					3																	190027981		2203	4300	6503	SO:0001819	synonymous_variant	9076				calcium-independent cell-cell adhesion|interspecies interaction between organisms	integral to plasma membrane|tight junction	identical protein binding|structural molecule activity	g.chr3:190027981G>A	AF101051	CCDS3295.1	3q28-q29	2008-07-18			ENSG00000163347	ENSG00000163347		"""Claudins"""	2032	protein-coding gene	gene with protein product	"""senescence-associated epithelial membrane protein 1"""	603718				10828592, 9892664	Standard	NM_021101		Approved	SEMP1, ILVASC	uc003fsh.3	O95832	OTTHUMG00000156214	ENST00000295522.3:c.450C>T	3.37:g.190027981G>A							p.D150D	NM_021101	NP_066924	O95832	CLD1_HUMAN	Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.015)	3	670	-	all_cancers(143;2.95e-10)|Ovarian(172;0.0512)		150			Extracellular (Potential).			Silent	SNP	ENST00000295522.3	37	c.450C>T	CCDS3295.1																																																																																				0.388	CLDN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343516.2	NM_021101		33	20	0	0	0	0.004878	0	33	20				
TNK2	10188	broad.mit.edu	37	3	195610174	195610174	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr3:195610174C>A	ENST00000333602.6	-	5	1080	c.463G>T	c.(463-465)Gtg>Ttg	p.V155L	TNK2_ENST00000381916.2_Missense_Mutation_p.V218L|TNK2_ENST00000392400.1_Missense_Mutation_p.V155L|TNK2_ENST00000316664.3_Missense_Mutation_p.V155L|TNK2_ENST00000468819.1_5'UTR|TNK2_ENST00000428187.1_Missense_Mutation_p.V187L	NM_005781.4	NP_005772.3	Q07912	ACK1_HUMAN	tyrosine kinase, non-receptor, 2	155	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell surface receptor signaling pathway (GO:0007166)|endocytosis (GO:0006897)|negative regulation of catalytic activity (GO:0043086)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of clathrin-mediated endocytosis (GO:2000369)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|endosome (GO:0005768)|Grb2-EGFR complex (GO:0070436)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|WW domain binding (GO:0050699)	p.V155L(2)|p.V218L(1)		central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(11)|ovary(3)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	29	all_cancers(143;6.48e-09)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;1.46e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.3e-19)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;0.000757)	Adenosine triphosphate(DB00171)	TTCACAGCCACACTCACCTGC	0.607																																							uc003fvu.1		NA																	3	Substitution - Missense(3)		lung(3)	ovary(3)|central_nervous_system(3)|lung(2)|stomach(1)|skin(1)	10						c.(463-465)GTG>TTG		tyrosine kinase, non-receptor, 2 isoform 1	Adenosine triphosphate(DB00171)						81.0	64.0	70.0					3																	195610174		2203	4300	6503	SO:0001583	missense	10188				positive regulation of peptidyl-tyrosine phosphorylation|protein ubiquitination|small GTPase mediated signal transduction	adherens junction|cytoplasmic vesicle membrane|endosome|nucleus	ATP binding|GTPase inhibitor activity|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding	g.chr3:195610174C>A	L13738	CCDS33927.1, CCDS33928.1	3q29	2013-09-02			ENSG00000061938	ENSG00000061938			19297	protein-coding gene	gene with protein product	"""activated Cdc42-associated kinase 1"""	606994				8497321, 14506255	Standard	XM_006713460		Approved	p21cdc42Hs, ACK, ACK1	uc003fvt.1	Q07912	OTTHUMG00000155737	ENST00000333602.6:c.463G>T	3.37:g.195610174C>A	ENSP00000329425:p.Val155Leu					TNK2_uc003fvs.1_Missense_Mutation_p.V187L|TNK2_uc003fvt.1_Missense_Mutation_p.V218L|TNK2_uc010hzw.1_RNA|TNK2_uc003fvv.1_5'UTR|TNK2_uc010hzx.1_Missense_Mutation_p.V169L	p.V155L	NM_005781	NP_005772	Q07912	ACK1_HUMAN	Epithelial(36;3.72e-24)|all cancers(36;1.46e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.3e-19)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;0.000757)	5	1006	-	all_cancers(143;6.48e-09)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	155			Protein kinase.		Q6ZMQ0|Q8N6U7|Q96H59	Missense_Mutation	SNP	ENST00000333602.6	37	c.463G>T	CCDS33928.1	.	.	.	.	.	.	.	.	.	.	C	34	5.392704	0.96009	.	.	ENSG00000061938	ENST00000333602;ENST00000381916;ENST00000428187;ENST00000392400;ENST00000316664	D;D;D;D;D	0.89485	-2.52;-2.52;-2.52;-2.52;-2.52	5.44	5.44	0.79542	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.95252	0.8460	M	0.88775	2.98	0.80722	D	1	B;P;P;D	0.53462	0.424;0.867;0.912;0.96	B;P;P;D	0.66847	0.229;0.703;0.578;0.947	D	0.95831	0.8858	10	0.87932	D	0	.	17.8301	0.88679	0.0:1.0:0.0:0.0	.	155;155;218;187	Q07912-2;Q07912;Q07912-3;C9J1X3	.;ACK1_HUMAN;.;.	L	155;218;187;155;155	ENSP00000329425:V155L;ENSP00000371341:V218L;ENSP00000392546:V187L;ENSP00000376201:V155L;ENSP00000323216:V155L	ENSP00000323216:V155L	V	-	1	0	TNK2	197094571	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.537000	0.82033	2.557000	0.86248	0.655000	0.94253	GTG		0.607	TNK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341437.3	NM_005781		43	12	1	0	9.14704e-12	0.00874	1.07998e-11	43	12				
IDUA	3425	broad.mit.edu	37	4	997367	997367	+	Nonsense_Mutation	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr4:997367C>T	ENST00000247933.4	+	12	1769	c.1681C>T	c.(1681-1683)Caa>Taa	p.Q561*	IDUA_ENST00000453894.1_Nonsense_Mutation_p.Q583*|IDUA_ENST00000514224.1_Nonsense_Mutation_p.Q429*	NM_000203.3	NP_000194.2	P35475	IDUA_HUMAN	iduronidase, alpha-L-	561					carbohydrate metabolic process (GO:0005975)|cell morphogenesis (GO:0000902)|chemical homeostasis (GO:0048878)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate catabolic process (GO:0030209)|disaccharide metabolic process (GO:0005984)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|limb morphogenesis (GO:0035108)|lysosome organization (GO:0007040)|skeletal system morphogenesis (GO:0048705)|small molecule metabolic process (GO:0044281)	coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	L-iduronidase activity (GO:0003940)	p.Q561*(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			GCCCCTGACCCAAGGGCAGCT	0.711																																							uc003gby.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0	GRCh37	CM034103	IDUA	M		c.(1681-1683)CAA>TAA		alpha-L-iduronidase precursor	Laronidase(DB00090)						43.0	46.0	45.0					4																	997367		2201	4299	6500	SO:0001587	stop_gained	3425				disaccharide metabolic process	lysosome	cation binding|L-iduronidase activity	g.chr4:997367C>T	M74715	CCDS3343.1	4p16.3	2012-10-02			ENSG00000127415	ENSG00000127415	3.2.1.76		5391	protein-coding gene	gene with protein product		252800				1832239	Standard	NM_000203		Approved	MPS1	uc003gby.3	P35475	OTTHUMG00000088901	ENST00000247933.4:c.1681C>T	4.37:g.997367C>T	ENSP00000247933:p.Gln561*					IDUA_uc003gbz.2_RNA|IDUA_uc003gca.2_Nonsense_Mutation_p.Q583*	p.Q561*	NM_000203	NP_000194	P35475	IDUA_HUMAN	OV - Ovarian serous cystadenocarcinoma(23;0.0158)		12	1769	+			561					B3KWK6	Nonsense_Mutation	SNP	ENST00000247933.4	37	c.1681C>T	CCDS3343.1	.	.	.	.	.	.	.	.	.	.	C	36	5.867975	0.97043	.	.	ENSG00000127415	ENST00000247933;ENST00000453894;ENST00000514224	.	.	.	4.68	1.64	0.23874	.	0.613450	0.15839	N	0.242131	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.6624	7.1656	0.25689	0.466:0.3879:0.1461:0.0	.	.	.	.	X	561;583;429	.	ENSP00000247933:Q561X	Q	+	1	0	IDUA	987367	0.014000	0.17966	0.260000	0.24451	0.024000	0.10985	0.711000	0.25764	0.568000	0.29311	-0.304000	0.09214	CAA		0.711	IDUA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000201812.1	NM_000203		10	29	0	0	0	0.013537	0	10	29				
SH3TC1	54436	broad.mit.edu	37	4	8220037	8220037	+	Silent	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr4:8220037C>T	ENST00000245105.3	+	8	946	c.879C>T	c.(877-879)gcC>gcT	p.A293A	SH3TC1_ENST00000539824.1_Silent_p.A217A	NM_018986.3	NP_061859	Q8TE82	S3TC1_HUMAN	SH3 domain and tetratricopeptide repeats 1	293								p.A293A(1)		NS(1)|breast(3)|endometrium(4)|kidney(4)|large_intestine(6)|lung(10)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33						TCGACGATGCCATGGGTGGCC	0.577																																					NSCLC(145;2298 2623 35616 37297)	NSCLC(145;2298 2623 35616 37297)	uc003gkv.3		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(2)|pancreas(1)	3						c.(877-879)GCC>GCT		SH3 domain and tetratricopeptide repeats 1							66.0	65.0	65.0					4																	8220037		2203	4300	6503	SO:0001819	synonymous_variant	54436						binding	g.chr4:8220037C>T	AK074093	CCDS3399.1	4p16.1	2013-01-11			ENSG00000125089	ENSG00000125089		"""Tetratricopeptide (TTC) repeat domain containing"""	26009	protein-coding gene	gene with protein product							Standard	NM_018986		Approved	FLJ20356	uc003gkv.4	Q8TE82	OTTHUMG00000160934	ENST00000245105.3:c.879C>T	4.37:g.8220037C>T						SH3TC1_uc003gkw.3_Silent_p.A217A|SH3TC1_uc003gkx.3_RNA	p.A293A	NM_018986	NP_061859	Q8TE82	S3TC1_HUMAN			8	980	+			293					Q4W5G5	Silent	SNP	ENST00000245105.3	37	c.879C>T	CCDS3399.1																																																																																				0.577	SH3TC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206991.2	NM_018986		7	41	0	0	0	0.001984	0	7	41				
SLIT2	9353	broad.mit.edu	37	4	20568941	20568941	+	Nonsense_Mutation	SNP	A	A	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr4:20568941A>T	ENST00000504154.1	+	27	3034	c.2782A>T	c.(2782-2784)Aaa>Taa	p.K928*	SLIT2_ENST00000503837.1_Nonsense_Mutation_p.K924*|SLIT2_ENST00000273739.5_Nonsense_Mutation_p.K932*|SLIT2_ENST00000503823.1_Nonsense_Mutation_p.K920*	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	928	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)	p.K928*(1)		NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						AAATCCGTGTAAAAATGATGG	0.383																																							uc003gpr.1		NA																	1	Substitution - Nonsense(1)		lung(1)	central_nervous_system(4)|skin(4)|ovary(3)	11						c.(2782-2784)AAA>TAA		slit homolog 2 precursor							205.0	198.0	200.0					4																	20568941		2203	4299	6502	SO:0001587	stop_gained	9353				apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding	g.chr4:20568941A>T	AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.2782A>T	4.37:g.20568941A>T	ENSP00000422591:p.Lys928*					SLIT2_uc003gps.1_Nonsense_Mutation_p.K920*	p.K928*	NM_004787	NP_004778	O94813	SLIT2_HUMAN			27	2986	+			928			EGF-like 1.		B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Nonsense_Mutation	SNP	ENST00000504154.1	37	c.2782A>T	CCDS3426.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	42|42	9.769919|9.769919	0.99259|0.99259	.|.	.|.	ENSG00000145147|ENSG00000145147	ENST00000503823;ENST00000504154;ENST00000273739;ENST00000382173;ENST00000503837;ENST00000511508|ENST00000509941	.|.	.|.	.|.	5.67|5.67	5.67|5.67	0.87782|0.87782	.|.	0.088510|.	0.85682|.	D|.	0.000000|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.02654|.	T|.	1|.	.|.	15.9069|15.9069	0.79436|0.79436	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|.	.|.	.|.	X|L	920;928;932;924;924;140|58	.|.	ENSP00000273739:K932X|.	K|X	+|+	1|2	0|2	SLIT2|SLIT2	20178039|20178039	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.997000|0.997000	0.91878|0.91878	3.428000|3.428000	0.52792|0.52792	2.147000|2.147000	0.66899|0.66899	0.533000|0.533000	0.62120|0.62120	AAA|TAA		0.383	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250396.2			101	195	0	0	0	0.01441	0	101	195				
GABRA4	2557	broad.mit.edu	37	4	46981053	46981053	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr4:46981053C>T	ENST00000264318.3	-	3	1250	c.268G>A	c.(268-270)Gaa>Aaa	p.E90K		NM_000809.3|NM_001204266.1|NM_001204267.1	NP_000800.2|NP_001191195.1|NP_001191196.1	P48169	GBRA4_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 4	90					central nervous system development (GO:0007417)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|regulation of response to drug (GO:2001023)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.E90K(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45					Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	CCTACCATTTCAACATCAGAA	0.323																																					Ovarian(6;283 369 8234 12290 33402)	Ovarian(6;283 369 8234 12290 33402)	uc003gxg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)|breast(1)	4						c.(268-270)GAA>AAA		gamma-aminobutyric acid A receptor, alpha 4	Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)						87.0	80.0	82.0					4																	46981053		2203	4298	6501	SO:0001583	missense	2557				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity	g.chr4:46981053C>T		CCDS3473.1	4p12	2012-06-22			ENSG00000109158	ENSG00000109158		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4078	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 4"""	137141				7607683	Standard	NM_000809		Approved		uc021xnz.1	P48169	OTTHUMG00000099431	ENST00000264318.3:c.268G>A	4.37:g.46981053C>T	ENSP00000264318:p.Glu90Lys						p.E90K	NM_000809	NP_000800	P48169	GBRA4_HUMAN			3	407	-			90			Extracellular (Probable).		Q8IYR7	Missense_Mutation	SNP	ENST00000264318.3	37	c.268G>A	CCDS3473.1	.	.	.	.	.	.	.	.	.	.	C	35	5.416912	0.96092	.	.	ENSG00000109158	ENST00000264318	T	0.78595	-1.19	5.11	5.11	0.69529	Neurotransmitter-gated ion-channel ligand-binding (3);	0.103017	0.64402	D	0.000003	T	0.81273	0.4788	N	0.21282	0.65	0.58432	D	0.999999	D	0.89917	1.0	D	0.74348	0.983	D	0.83886	0.0282	10	0.62326	D	0.03	.	17.5299	0.87811	0.0:1.0:0.0:0.0	.	90	P48169	GBRA4_HUMAN	K	90	ENSP00000264318:E90K	ENSP00000264318:E90K	E	-	1	0	GABRA4	46675810	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	7.794000	0.85869	2.364000	0.80123	0.460000	0.39030	GAA		0.323	GABRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216893.1			11	20	0	0	0	0.00245	0	11	20				
C4orf3	401152	broad.mit.edu	37	4	120221638	120221638	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr4:120221638C>T	ENST00000504110.1	-	1	438	c.53G>A	c.(52-54)cGa>cAa	p.R18Q	C4orf3_ENST00000399075.4_Missense_Mutation_p.R151Q	NM_001001701.3	NP_001001701.2	Q8WVX3	CD003_HUMAN	chromosome 4 open reading frame 3	18						integral component of membrane (GO:0016021)		p.R151P(1)|p.R151Q(1)		breast(1)|large_intestine(1)|lung(4)	6						GCTAAAGCCTCGCCGCTCCCG	0.567																																							uc003icv.3		NA																	2	Substitution - Missense(2)		lung(1)|breast(1)		0						c.(52-54)CGA>CAA		hypothetical protein LOC401152							137.0	147.0	144.0					4																	120221638		2009	4155	6164	SO:0001583	missense	401152					integral to membrane		g.chr4:120221638C>T		CCDS43266.1, CCDS54798.1	4q26	2012-02-24			ENSG00000164096	ENSG00000164096			19225	protein-coding gene	gene with protein product	"""HCV F-transactivated protein 1"""						Standard	NM_001001701		Approved		uc021xrf.1	Q8WVX3	OTTHUMG00000161333	ENST00000504110.1:c.53G>A	4.37:g.120221638C>T	ENSP00000427214:p.Arg18Gln						p.R18Q	NM_001001701	NP_001001701	Q8WVX3	CD003_HUMAN			1	331	-			18					Q6J203	Missense_Mutation	SNP	ENST00000504110.1	37	c.53G>A	CCDS43266.1	.	.	.	.	.	.	.	.	.	.	C	13.72	2.322398	0.41096	.	.	ENSG00000164096	ENST00000399075;ENST00000504110	T;T	0.37915	1.17;1.23	4.91	3.12	0.35913	.	0.765424	0.10409	N	0.678157	T	0.52451	0.1735	.	.	.	0.25247	N	0.989702	D	0.71674	0.998	P	0.61592	0.891	T	0.57021	-0.7882	8	0.59425	D	0.04	-1.6494	8.222	0.31547	0.1795:0.6475:0.173:0.0	.	18	Q8WVX3	CD003_HUMAN	Q	151;18	ENSP00000382026:R151Q;ENSP00000427214:R18Q	ENSP00000382026:R151Q	R	-	2	0	C4orf3	120441086	0.033000	0.19621	0.381000	0.26106	0.193000	0.23685	0.171000	0.16685	0.528000	0.28580	0.563000	0.77884	CGA		0.567	C4orf3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364576.3	NM_001001701		47	35	0	0	0	0.01441	0	47	35				
USP38	84640	broad.mit.edu	37	4	144118998	144118998	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr4:144118998C>T	ENST00000307017.4	+	4	1477	c.971C>T	c.(970-972)cCt>cTt	p.P324L	USP38_ENST00000510377.1_Missense_Mutation_p.P324L	NM_032557.5	NP_115946.2	Q8NB14	UBP38_HUMAN	ubiquitin specific peptidase 38	324					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)	p.P324L(1)		breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(3)	33	all_hematologic(180;0.158)					CTTTGGTTTCCTCTTGTGAGA	0.388																																							uc003ijb.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|ovary(1)|breast(1)|pancreas(1)	5						c.(970-972)CCT>CTT		ubiquitin specific peptidase 38							186.0	168.0	174.0					4																	144118998		2203	4300	6503	SO:0001583	missense	84640				ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity	g.chr4:144118998C>T	AF211481	CCDS3758.1	4q31.1	2008-02-05	2005-08-08		ENSG00000170185	ENSG00000170185		"""Ubiquitin-specific peptidases"""	20067	protein-coding gene	gene with protein product			"""ubiquitin specific protease 38"""			12838346	Standard	NM_032557		Approved	KIAA1891, HP43.8KD	uc003ijb.3	Q8NB14	OTTHUMG00000161420	ENST00000307017.4:c.971C>T	4.37:g.144118998C>T	ENSP00000303434:p.Pro324Leu					USP38_uc003ija.3_Missense_Mutation_p.P324L|USP38_uc003ijc.2_RNA	p.P324L	NM_032557	NP_115946	Q8NB14	UBP38_HUMAN			4	1505	+	all_hematologic(180;0.158)		324					B3KX93|Q3ZCV1|Q8NDF5|Q96DK6|Q96PZ6|Q9BY55	Missense_Mutation	SNP	ENST00000307017.4	37	c.971C>T	CCDS3758.1	.	.	.	.	.	.	.	.	.	.	C	33	5.260754	0.95368	.	.	ENSG00000170185	ENST00000510377;ENST00000307017	T;T	0.45276	0.9;0.9	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.64538	0.2607	M	0.62723	1.935	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.66284	-0.5962	10	0.87932	D	0	-5.954	19.0916	0.93228	0.0:1.0:0.0:0.0	.	324;324	Q8NB14;Q3ZCV1	UBP38_HUMAN;.	L	324	ENSP00000427647:P324L;ENSP00000303434:P324L	ENSP00000303434:P324L	P	+	2	0	USP38	144338448	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.600000	0.87896	0.655000	0.94253	CCT		0.388	USP38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364869.1	NM_032557		66	46	0	0	0	0.01441	0	66	46				
MARCH1	55016	broad.mit.edu	37	4	164449921	164449921	+	Silent	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr4:164449921G>T	ENST00000503008.1	-	8	1825	c.849C>A	c.(847-849)ccC>ccA	p.P283P	RP11-218F10.3_ENST00000609356.1_lincRNA|MARCH1_ENST00000514618.1_Silent_p.P539P|MARCH1_ENST00000274056.7_Silent_p.P283P|MARCH1_ENST00000339875.5_Silent_p.P266P	NM_001166373.1	NP_001159845.1	Q8TCQ1	MARH1_HUMAN	membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase	283					antigen processing and presentation of peptide antigen via MHC class II (GO:0002495)|immune response (GO:0006955)|protein polyubiquitination (GO:0000209)	cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	ligase activity (GO:0016874)|MHC protein binding (GO:0042287)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P283P(1)|p.P266P(1)		endometrium(2)|kidney(3)|large_intestine(3)|lung(20)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	36	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				CAACTTCAGGGGGGCCACCCT	0.453																																							uc003iqs.1		NA																	2	Substitution - coding silent(2)		lung(2)	lung(2)	2						c.(847-849)CCC>CCA		membrane-associated RING-CH protein I							83.0	76.0	78.0					4																	164449921		2203	4300	6503	SO:0001819	synonymous_variant	55016				antigen processing and presentation of peptide antigen via MHC class II|immune response	cytoplasmic vesicle membrane|early endosome membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|plasma membrane	MHC protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr4:164449921G>T	AK000675	CCDS3806.1, CCDS54814.1	4q32.2	2013-01-09	2012-02-23			ENSG00000145416		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	26077	protein-coding gene	gene with protein product		613331	"""membrane-associated ring finger (C3HC4) 1"""			14722266	Standard	NM_017923		Approved	FLJ20668, MARCH-I, RNF171	uc003iqs.2	Q8TCQ1		ENST00000503008.1:c.849C>A	4.37:g.164449921G>T						MARCH1_uc003iqr.1_Silent_p.P266P	p.P283P	NM_017923	NP_060393	Q8TCQ1	MARH1_HUMAN			8	1826	-	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)	283					D3DP29|Q9NWR0	Silent	SNP	ENST00000503008.1	37	c.849C>A	CCDS54814.1																																																																																				0.453	MARCH1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364493.2	NM_017923		35	25	1	0	2.87052e-16	0.005524	3.61438e-16	35	25				
PLEKHG4B	153478	broad.mit.edu	37	5	182248	182248	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr5:182248C>T	ENST00000283426.6	+	18	3676	c.3626C>T	c.(3625-3627)tCg>tTg	p.S1209L		NM_052909.3	NP_443141.3	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4B	1209	Ser-rich.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.S1209L(1)		endometrium(1)|large_intestine(2)|lung(2)|prostate(3)|skin(3)	11			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		ATCCTGGGGTCGCTGGGCCTG	0.637																																							uc003jak.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(3625-3627)TCG>TTG		pleckstrin homology domain containing, family G							78.0	72.0	74.0					5																	182248		2203	4300	6503	SO:0001583	missense	153478				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity	g.chr5:182248C>T	BC008352	CCDS34124.1	5p15.33	2013-01-11			ENSG00000153404	ENSG00000153404		"""Pleckstrin homology (PH) domain containing"""	29399	protein-coding gene	gene with protein product						11572484	Standard	NM_052909		Approved	KIAA1909	uc003jak.2	Q96PX9	OTTHUMG00000161570	ENST00000283426.6:c.3626C>T	5.37:g.182248C>T	ENSP00000283426:p.Ser1209Leu						p.S1209L	NM_052909	NP_443141	Q96PX9	PKH4B_HUMAN	all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)	18	3676	+			1209			Ser-rich.			Missense_Mutation	SNP	ENST00000283426.6	37	c.3626C>T	CCDS34124.1	.	.	.	.	.	.	.	.	.	.	C	9.637	1.138013	0.21123	.	.	ENSG00000153404	ENST00000283426	T	0.37411	1.2	3.37	2.5	0.30297	.	.	.	.	.	T	0.19046	0.0457	N	0.14661	0.345	0.26521	N	0.974431	B	0.31209	0.313	B	0.23275	0.045	T	0.14117	-1.0484	9	0.72032	D	0.01	.	6.4785	0.22049	0.0:0.8563:0.0:0.1437	.	1209	Q96PX9	PKH4B_HUMAN	L	1209	ENSP00000283426:S1209L	ENSP00000283426:S1209L	S	+	2	0	PLEKHG4B	235248	0.500000	0.26091	0.000000	0.03702	0.007000	0.05969	1.837000	0.39201	0.384000	0.24942	0.467000	0.42956	TCG		0.637	PLEKHG4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365359.1	NM_052909		46	53	0	0	0	0.01441	0	46	53				
FBXL7	23194	broad.mit.edu	37	5	15928526	15928526	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr5:15928526G>T	ENST00000504595.1	+	3	1136	c.655G>T	c.(655-657)Gtc>Ttc	p.V219F	FBXL7_ENST00000329673.7_Missense_Mutation_p.V207F|FBXL7_ENST00000510662.1_Missense_Mutation_p.V172F	NM_001278317.1|NM_012304.3	NP_001265246.1|NP_036436.1	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7	219					cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)	p.V219F(1)		cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(13)|lung(33)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	60						GCGACTGGAAGTCTCAGGCTG	0.562																																							uc003jfn.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(1)	3						c.(655-657)GTC>TTC		F-box and leucine-rich repeat protein 7							87.0	85.0	86.0					5																	15928526		2055	4195	6250	SO:0001583	missense	23194				ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity	g.chr5:15928526G>T	AB020647	CCDS54833.1, CCDS64129.1	5p15.1	2011-06-09				ENSG00000183580		"""F-boxes / Leucine-rich repeats"""	13604	protein-coding gene	gene with protein product		605656				10048485, 10531035	Standard	NM_012304		Approved	KIAA0840, FBL7, FBL6	uc003jfn.1	Q9UJT9		ENST00000504595.1:c.655G>T	5.37:g.15928526G>T	ENSP00000423630:p.Val219Phe						p.V219F	NM_012304	NP_036436	Q9UJT9	FBXL7_HUMAN			3	1136	+			219			LRR 2.		B9EGF1|D6RDY7|O94926	Missense_Mutation	SNP	ENST00000504595.1	37	c.655G>T	CCDS54833.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.733644	0.89482	.	.	ENSG00000183580	ENST00000504595;ENST00000510662;ENST00000329673	T;T;T	0.53206	0.63;0.63;0.63	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	T	0.58864	0.2152	L	0.54908	1.71	0.80722	D	1	D	0.61697	0.99	P	0.53954	0.738	T	0.62821	-0.6773	10	0.66056	D	0.02	.	18.5969	0.91232	0.0:0.0:1.0:0.0	.	219	Q9UJT9	FBXL7_HUMAN	F	219;172;207	ENSP00000423630:V219F;ENSP00000425184:V172F;ENSP00000329632:V207F	ENSP00000329632:V207F	V	+	1	0	FBXL7	15981526	1.000000	0.71417	0.998000	0.56505	0.985000	0.73830	7.954000	0.87848	2.401000	0.81631	0.561000	0.74099	GTC		0.562	FBXL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366117.1	NM_012304		31	63	1	0	1.36615e-20	0.013726	1.79159e-20	31	63				
SLC45A2	51151	broad.mit.edu	37	5	33947450	33947450	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr5:33947450C>A	ENST00000296589.4	-	6	1332	c.1186G>T	c.(1186-1188)Gga>Tga	p.G396*	SLC45A2_ENST00000342059.3_Nonsense_Mutation_p.G337*|SLC45A2_ENST00000382102.3_Nonsense_Mutation_p.G396*	NM_016180.3	NP_057264	Q9UMX9	S45A2_HUMAN	solute carrier family 45, member 2	396					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)		p.G396*(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(25)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48						CCCTTTAATCCAATGTAGGAT	0.448																																					Ovarian(31;380 859 8490 22203 49048)	Ovarian(31;380 859 8490 22203 49048)	uc003jid.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3						c.(1186-1188)GGA>TGA		membrane-associated transporter protein isoform							96.0	99.0	98.0					5																	33947450		2203	4300	6503	SO:0001587	stop_gained	51151				melanin biosynthetic process|response to stimulus|transmembrane transport|visual perception	integral to membrane|melanosome membrane		g.chr5:33947450C>A	AF172849	CCDS3901.1, CCDS43308.1, CCDS75232.1	5p13.3	2013-08-06	2005-10-06	2005-10-06	ENSG00000164175	ENSG00000164175		"""Solute carriers"""	16472	protein-coding gene	gene with protein product		606202	"""membrane associated transporter"""	MATP		11916009, 11574907	Standard	NM_001012509		Approved	AIM-1, OCA4	uc003jid.3	Q9UMX9	OTTHUMG00000090719	ENST00000296589.4:c.1186G>T	5.37:g.33947450C>A	ENSP00000296589:p.Gly396*					SLC45A2_uc003jie.2_Nonsense_Mutation_p.G396*	p.G396*	NM_016180	NP_057264	Q9UMX9	S45A2_HUMAN			6	1278	-			396			Cytoplasmic (Potential).		Q6P2P0|Q9BTM3	Nonsense_Mutation	SNP	ENST00000296589.4	37	c.1186G>T	CCDS3901.1	.	.	.	.	.	.	.	.	.	.	C	36	5.934059	0.97122	.	.	ENSG00000164175	ENST00000296589;ENST00000342059;ENST00000382102;ENST00000510600	.	.	.	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-11.2249	19.6445	0.95771	0.0:1.0:0.0:0.0	.	.	.	.	X	396;337;396;221	.	ENSP00000296589:G396X	G	-	1	0	SLC45A2	33983207	1.000000	0.71417	0.965000	0.40720	0.916000	0.54674	5.825000	0.69286	2.646000	0.89796	0.655000	0.94253	GGA		0.448	SLC45A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207443.2	NM_016180		60	130	1	0	2.08403e-16	0.01441	2.63282e-16	60	130				
OSMR	9180	broad.mit.edu	37	5	38919157	38919157	+	Silent	SNP	C	C	T	rs61734274	byFrequency	TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr5:38919157C>T	ENST00000274276.3	+	11	1980	c.1578C>T	c.(1576-1578)ccC>ccT	p.P526P		NM_003999.2	NP_003990.1	Q99650	OSMR_HUMAN	oncostatin M receptor	526	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	oncostatin-M receptor complex (GO:0005900)	growth factor binding (GO:0019838)|oncostatin-M receptor activity (GO:0004924)	p.P526P(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(8)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	46	all_lung(31;0.000365)					CTGCAGACCCCGAAAACAGTG	0.373																																							uc003jln.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						c.(1576-1578)CCC>CCT		oncostatin M receptor precursor		C		0,4406		0,0,2203	109.0	104.0	106.0		1578	-2.1	0.0	5	dbSNP_129	106	8,8592	5.7+/-21.5	0,8,4292	no	coding-synonymous	OSMR	NM_003999.2		0,8,6495	TT,TC,CC		0.093,0.0,0.0615		526/980	38919157	8,12998	2203	4300	6503	SO:0001819	synonymous_variant	9180				cell proliferation|positive regulation of cell proliferation	oncostatin-M receptor complex	growth factor binding|oncostatin-M receptor activity	g.chr5:38919157C>T	U60805	CCDS3928.1, CCDS54847.1	5p13.2	2013-02-11			ENSG00000145623	ENSG00000145623		"""Fibronectin type III domain containing"""	8507	protein-coding gene	gene with protein product		601743				8999038	Standard	NM_001168355		Approved	OSMRB	uc003jln.2	Q99650	OTTHUMG00000090811	ENST00000274276.3:c.1578C>T	5.37:g.38919157C>T						OSMR_uc011cpj.1_5'UTR	p.P526P	NM_003999	NP_003990	Q99650	OSMR_HUMAN			11	1945	+	all_lung(31;0.000365)		526			Fibronectin type-III 3.|Extracellular (Potential).		Q6P4E8|Q96QJ6	Silent	SNP	ENST00000274276.3	37	c.1578C>T	CCDS3928.1																																																																																				0.373	OSMR-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000207609.2	NM_003999		48	69	0	0	0	0.01441	0	48	69				
C7	730	broad.mit.edu	37	5	40979921	40979921	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr5:40979921A>T	ENST00000313164.9	+	17	2619	c.2260A>T	c.(2260-2262)Aat>Tat	p.N754Y	C7_ENST00000494960.1_3'UTR	NM_000587.2	NP_000578.2	P10643	CO7_HUMAN	complement component 7	754	Factor I module (FIM) 1.				cellular sodium ion homeostasis (GO:0006883)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)		p.N754Y(1)					Ovarian(839;0.0112)				TCAGGGTAGAAATTACACCCT	0.498																																							uc003jmh.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2260-2262)AAT>TAT		complement component 7 precursor							77.0	77.0	77.0					5																	40979921		1977	4160	6137	SO:0001583	missense	730				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular region|membrane attack complex		g.chr5:40979921A>T	J03507	CCDS47201.1	5p13.1	2014-09-17			ENSG00000112936	ENSG00000112936		"""Complement system"""	1346	protein-coding gene	gene with protein product		217070					Standard	NM_000587		Approved		uc003jmh.3	P10643	OTTHUMG00000150340	ENST00000313164.9:c.2260A>T	5.37:g.40979921A>T	ENSP00000322061:p.Asn754Tyr					C7_uc011cpn.1_RNA	p.N754Y	NM_000587	NP_000578	P10643	CO7_HUMAN			17	2374	+		Ovarian(839;0.0112)	754			Complement control factor I module 1.		Q6P3T5|Q92489	Missense_Mutation	SNP	ENST00000313164.9	37	c.2260A>T	CCDS47201.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.013977	0.75161	.	.	ENSG00000112936	ENST00000313164	T	0.64260	-0.09	5.8	5.8	0.92144	Factor I / membrane attack complex (1);	0.540943	0.20973	N	0.082349	T	0.68815	0.3042	L	0.57536	1.79	0.30470	N	0.773438	D	0.52996	0.957	P	0.53035	0.716	T	0.72679	-0.4220	10	0.66056	D	0.02	-11.6286	12.3429	0.55103	0.8591:0.1409:0.0:0.0	.	754	P10643	CO7_HUMAN	Y	754	ENSP00000322061:N754Y	ENSP00000322061:N754Y	N	+	1	0	C7	41015678	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	3.407000	0.52644	2.215000	0.71742	0.460000	0.39030	AAT		0.498	C7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317680.1			28	33	0	0	0	0.012213	0	28	33				
NAIP	4671	broad.mit.edu	37	5	70308281	70308281	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr5:70308281C>A	ENST00000517649.1	-	4	752	c.462G>T	c.(460-462)atG>atT	p.M154I	NAIP_ENST00000194097.4_Missense_Mutation_p.M154I|NAIP_ENST00000503719.2_Intron|NAIP_ENST00000508426.2_Missense_Mutation_p.M154I|NAIP_ENST00000523981.1_Intron	NM_004536.2	NP_004527.2	Q13075	BIRC1_HUMAN	NLR family, apoptosis inhibitory protein	154					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|nervous system development (GO:0007399)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|metal ion binding (GO:0046872)	p.M154I(1)		central_nervous_system(1)	1		Lung NSC(167;4.15e-05)|Prostate(74;0.00996)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;3.04e-60)|Epithelial(20;7.09e-58)|all cancers(19;1.13e-53)|Lung(70;0.0174)		CTTGGTACCTCATTTTACCTC	0.473																																							uc003kar.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(460-462)ATG>ATT		NLR family, apoptosis inhibitory protein isoform							213.0	162.0	179.0					5																	70308281		2202	4296	6498	SO:0001583	missense	4671				anti-apoptosis|apoptosis|nervous system development	basolateral plasma membrane|cytoplasm	caspase inhibitor activity|metal ion binding|nucleoside-triphosphatase activity|nucleotide binding	g.chr5:70308281C>A	U19251	CCDS4009.1, CCDS43327.1	5q13.2	2010-06-16	2006-12-08	2006-12-08	ENSG00000249437	ENSG00000249437		"""Baculoviral IAP repeat containing"", ""Nucleotide-binding domain and leucine rich repeat containing"""	7634	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and BIR domain containing 1"", ""NLR family, BIR domain containing 1"""	600355	"""baculoviral IAP repeat-containing 1"""	BIRC1		7813013	Standard	NM_022892		Approved	NLRB1	uc003jyj.1	Q13075	OTTHUMG00000163318	ENST00000517649.1:c.462G>T	5.37:g.70308281C>A	ENSP00000428657:p.Met154Ile					NAIP_uc003kat.1_Intron|NAIP_uc011crs.1_Missense_Mutation_p.M154I|NAIP_uc003kas.1_Intron	p.M154I	NM_004536	NP_004527	Q13075	BIRC1_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;3.04e-60)|Epithelial(20;7.09e-58)|all cancers(19;1.13e-53)|Lung(70;0.0174)	4	1180	-		Lung NSC(167;4.15e-05)|Prostate(74;0.00996)|Ovarian(174;0.0448)|Breast(144;0.198)	154					B9EG72|E9PHD1|O75857|Q13730|Q59GI6|Q8TDZ4|Q99796	Missense_Mutation	SNP	ENST00000517649.1	37	c.462G>T	CCDS4009.1	.	.	.	.	.	.	.	.	.	.	c	2.179	-0.388150	0.04932	.	.	ENSG00000249437	ENST00000517649;ENST00000194097;ENST00000508426	T;T;T	0.03663	3.85;3.85;3.85	3.26	-6.51	0.01878	Baculoviral inhibition of apoptosis protein repeat (1);	0.843637	0.09638	U	0.775404	T	0.01905	0.0060	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.04013	0.0;0.001	T	0.46775	-0.9167	10	0.23891	T	0.37	.	11.4918	0.50385	0.0:0.6357:0.2289:0.1354	.	154;154	E7EQW0;Q13075	.;BIRC1_HUMAN	I	154	ENSP00000428657:M154I;ENSP00000443944:M154I;ENSP00000429545:M154I	ENSP00000443944:M154I	M	-	3	0	NAIP	70344037	0.000000	0.05858	0.000000	0.03702	0.187000	0.23431	-2.073000	0.01376	-2.499000	0.00511	0.436000	0.28706	ATG		0.473	NAIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372649.6	NM_004536		23	402	1	0	2.98393e-07	0.00278	3.24974e-07	23	402				
VCAN	1462	broad.mit.edu	37	5	82786237	82786237	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr5:82786237G>T	ENST00000265077.3	+	3	956	c.391G>T	c.(391-393)Gac>Tac	p.D131Y	VCAN_ENST00000342785.4_Missense_Mutation_p.D131Y|VCAN_ENST00000343200.5_Missense_Mutation_p.D131Y|VCAN_ENST00000502527.2_Missense_Mutation_p.D131Y|VCAN_ENST00000513984.1_Missense_Mutation_p.D131Y|VCAN_ENST00000512590.2_Missense_Mutation_p.D83Y	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	131	Ig-like V-type.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)	p.D131Y(1)		NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	TTACCGCTGTGACGTCATGTA	0.522																																							uc003kii.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16						c.(391-393)GAC>TAC		versican isoform 1 precursor							148.0	142.0	144.0					5																	82786237		2203	4300	6503	SO:0001583	missense	1462				cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding	g.chr5:82786237G>T	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.391G>T	5.37:g.82786237G>T	ENSP00000265077:p.Asp131Tyr					VCAN_uc003kij.3_Missense_Mutation_p.D131Y|VCAN_uc010jau.2_Missense_Mutation_p.D131Y|VCAN_uc003kik.3_Missense_Mutation_p.D131Y|VCAN_uc003kih.3_Missense_Mutation_p.D131Y	p.D131Y	NM_004385	NP_004376	P13611	CSPG2_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	3	747	+		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)	131			Ig-like V-type.		P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	37	c.391G>T	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	G	19.01	3.744118	0.69418	.	.	ENSG00000038427	ENST00000265077;ENST00000343200;ENST00000342785;ENST00000512590;ENST00000513960;ENST00000513984;ENST00000502527	T;T;T;T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21;-0.21;-0.21;-0.21	5.73	5.73	0.89815	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000003	T	0.73249	0.3563	N	0.19112	0.55	0.58432	D	0.999998	D;B;D;D;B	0.89917	1.0;0.407;1.0;0.999;0.08	D;B;D;D;B	0.91635	0.999;0.176;0.996;0.999;0.091	T	0.75947	-0.3138	10	0.59425	D	0.04	.	19.9058	0.97007	0.0:0.0:1.0:0.0	.	131;131;131;131;131	P13611-3;P13611-4;P13611-2;P13611;Q86W61	.;.;.;CSPG2_HUMAN;.	Y	131;131;131;83;131;131;131	ENSP00000265077:D131Y;ENSP00000340062:D131Y;ENSP00000342768:D131Y;ENSP00000425959:D83Y;ENSP00000426251:D131Y;ENSP00000426715:D131Y;ENSP00000421362:D131Y	ENSP00000265077:D131Y	D	+	1	0	VCAN	82821993	1.000000	0.71417	0.211000	0.23655	0.348000	0.29142	6.325000	0.72901	2.716000	0.92895	0.561000	0.74099	GAC		0.522	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385		62	66	1	0	1.8515e-17	0.01441	2.36269e-17	62	66				
VCAN	1462	broad.mit.edu	37	5	82833543	82833543	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr5:82833543T>A	ENST00000265077.3	+	8	5286	c.4721T>A	c.(4720-4722)gTa>gAa	p.V1574E	VCAN_ENST00000342785.4_Intron|VCAN_ENST00000343200.5_Missense_Mutation_p.V587E|VCAN_ENST00000513016.1_3'UTR|VCAN_ENST00000502527.2_Intron|VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000512590.2_Intron	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	1574	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)	p.V1574E(1)		NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	GGTGAAGAGGTAGAAAAAAGT	0.408																																							uc003kii.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16						c.(4720-4722)GTA>GAA		versican isoform 1 precursor							83.0	85.0	84.0					5																	82833543		2203	4300	6503	SO:0001583	missense	1462				cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding	g.chr5:82833543T>A	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.4721T>A	5.37:g.82833543T>A	ENSP00000265077:p.Val1574Glu					VCAN_uc003kij.3_Missense_Mutation_p.V587E|VCAN_uc010jau.2_Intron|VCAN_uc003kik.3_Intron|VCAN_uc003kil.3_Missense_Mutation_p.V238E	p.V1574E	NM_004385	NP_004376	P13611	CSPG2_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	8	5077	+		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)	1574			GAG-beta.		P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	37	c.4721T>A	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	T	10.69	1.422263	0.25639	.	.	ENSG00000038427	ENST00000265077;ENST00000343200;ENST00000513960	D;D;T	0.85339	-1.93;-1.97;3.18	5.78	1.99	0.26369	.	0.670235	0.14405	N	0.321664	T	0.65502	0.2697	N	0.14661	0.345	0.09310	N	1	B;B	0.32467	0.372;0.255	B;B	0.27500	0.08;0.071	T	0.52975	-0.8503	10	0.24483	T	0.36	.	2.5285	0.04697	0.12:0.4471:0.1175:0.3155	.	587;1574	P13611-2;P13611	.;CSPG2_HUMAN	E	1574;587;587	ENSP00000265077:V1574E;ENSP00000340062:V587E;ENSP00000426251:V587E	ENSP00000265077:V1574E	V	+	2	0	VCAN	82869299	0.000000	0.05858	0.238000	0.24106	0.718000	0.41266	-0.344000	0.07780	0.779000	0.33543	-0.242000	0.12053	GTA		0.408	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385		32	67	0	0	0	0.003271	0	32	67				
PJA2	9867	broad.mit.edu	37	5	108704449	108704449	+	Splice_Site	SNP	T	T	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr5:108704449T>A	ENST00000361189.2	-	5	1523		c.e5-2		PJA2_ENST00000361557.3_Splice_Site	NM_014819.4	NP_055634.3	O43164	PJA2_HUMAN	praja ring finger 2, E3 ubiquitin protein ligase						long-term memory (GO:0007616)|protein ubiquitination (GO:0016567)|regulation of protein kinase A signaling (GO:0010738)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ligase activity (GO:0016874)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.?(1)		endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	21		all_cancers(142;4.4e-06)|all_epithelial(76;8.17e-08)|Prostate(80;0.00676)|Lung NSC(167;0.0436)|Ovarian(225;0.0443)|all_lung(232;0.053)|Colorectal(57;0.0946)|Breast(839;0.151)		OV - Ovarian serous cystadenocarcinoma(64;3.46e-10)|Epithelial(69;6.02e-09)|COAD - Colon adenocarcinoma(37;0.224)		CATTCAGAACTGCAAATCAGA	0.388																																							uc003kos.3		NA																	1	Unknown(1)		lung(1)	ovary(1)|skin(1)	2						c.e5-1		praja 2, RING-H2 motif containing							74.0	70.0	71.0					5																	108704449		2202	4300	6502	SO:0001630	splice_region_variant	9867				long-term memory|regulation of protein kinase A signaling cascade	cell junction|endoplasmic reticulum membrane|Golgi membrane|postsynaptic density|postsynaptic membrane	ligase activity|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|zinc ion binding	g.chr5:108704449T>A	AB007898	CCDS4099.1	5q22.1	2013-01-09	2012-02-23	2003-06-05	ENSG00000198961	ENSG00000198961		"""RING-type (C3HC4) zinc fingers"""	17481	protein-coding gene	gene with protein product			"""ring finger protein 131"", ""praja ring finger 2"""	RNF131			Standard	NM_014819		Approved	KIAA0438, Neurodap1	uc003kos.4	O43164	OTTHUMG00000128750	ENST00000361189.2:c.1284-2A>T	5.37:g.108704449T>A							p.S428_splice	NM_014819	NP_055634	O43164	PJA2_HUMAN		OV - Ovarian serous cystadenocarcinoma(64;3.46e-10)|Epithelial(69;6.02e-09)|COAD - Colon adenocarcinoma(37;0.224)	5	1504	-		all_cancers(142;4.4e-06)|all_epithelial(76;8.17e-08)|Prostate(80;0.00676)|Lung NSC(167;0.0436)|Ovarian(225;0.0443)|all_lung(232;0.053)|Colorectal(57;0.0946)|Breast(839;0.151)						A8K6U4|D3DSZ5|Q68D49|Q8N1G5	Splice_Site	SNP	ENST00000361189.2	37	c.1284_splice	CCDS4099.1	.	.	.	.	.	.	.	.	.	.	T	17.05	3.288818	0.59976	.	.	ENSG00000198961	ENST00000361189;ENST00000361557	.	.	.	5.98	5.98	0.97165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4696	0.84102	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	PJA2	108732348	1.000000	0.71417	0.984000	0.44739	0.613000	0.37349	6.306000	0.72810	2.289000	0.77006	0.482000	0.46254	.		0.388	PJA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250663.1	NM_014819	Intron	11	58	0	0	0	0.00245	0	11	58				
LECT2	3950	broad.mit.edu	37	5	135272539	135272539	+	Intron	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr5:135272539G>A	ENST00000522943.1	-	3	418				FBXL21_ENST00000467490.1_RNA|FBXL21_ENST00000297158.9_RNA|LECT2_ENST00000471827.1_5'Flank			O14960	LECT2_HUMAN	leukocyte cell-derived chemotaxin 2						chemotaxis (GO:0006935)|negative regulation of Wnt signaling pathway (GO:0030178)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	identical protein binding (GO:0042802)	p.E86K(1)		large_intestine(1)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GAGAAAGTTTGAATTTGAACT	0.368																																							uc010jec.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)	1						c.(256-258)GAA>AAA		F-box and leucine-rich repeat protein 21							107.0	106.0	106.0					5																	135272539		1876	4103	5979	SO:0001627	intron_variant	26223				rhythmic process	ubiquitin ligase complex	ubiquitin-protein ligase activity	g.chr5:135272539G>A	AB007546	CCDS4190.1	5q31.1	2008-05-15			ENSG00000145826	ENSG00000145826			6550	protein-coding gene	gene with protein product		602882				9545637	Standard	NM_002302		Approved	chm-II, chm2	uc003lbe.1	O14960	OTTHUMG00000129146	ENST00000522943.1:c.289+14372C>T	5.37:g.135272539G>A						FBXL21_uc003lbc.2_RNA	p.E86K	NM_012159	NP_036291	Q9UKT6	FXL21_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)		2	277	+			86					B2RA90|O14565|Q52M49	Missense_Mutation	SNP	ENST00000522943.1	37	c.256G>A																																																																																					0.368	LECT2-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000381629.1	NM_002302		27	70	0	0	0	0.004656	0	27	70				
PPARGC1B	133522	broad.mit.edu	37	5	149216087	149216087	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr5:149216087G>T	ENST00000309241.5	+	8	2101	c.2069G>T	c.(2068-2070)gGa>gTa	p.G690V	PPARGC1B_ENST00000403750.1_Missense_Mutation_p.G626V|PPARGC1B_ENST00000394320.3_Missense_Mutation_p.G690V|PPARGC1B_ENST00000360453.4_Missense_Mutation_p.G651V	NM_133263.3	NP_573570.3	Q86YN6	PRGC2_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 beta	690					actin filament organization (GO:0007015)|bone trabecula formation (GO:0060346)|cellular lipid metabolic process (GO:0044255)|cellular response to reactive oxygen species (GO:0034614)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of bone resorption (GO:0045780)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of phosphorylation (GO:0042327)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|transcription from mitochondrial promoter (GO:0006390)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AF-2 domain binding (GO:0050682)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|receptor activator activity (GO:0030546)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)	p.G690V(1)		NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(2)|lung(15)|ovary(3)|prostate(2)|stomach(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			TGTTCCTTTGGAGACCATGAC	0.627																																							uc003lrc.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2068-2070)GGA>GTA		peroxisome proliferator-activated receptor							52.0	55.0	54.0					5																	149216087		2203	4300	6503	SO:0001583	missense	133522				estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter	mediator complex	AF-2 domain binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|receptor activator activity|RNA binding|RNA polymerase II transcription cofactor activity	g.chr5:149216087G>T	AF468496	CCDS4298.1, CCDS54933.1, CCDS54934.1	5q33.1	2013-02-12	2006-10-17		ENSG00000155846	ENSG00000155846		"""RNA binding motif (RRM) containing"""	30022	protein-coding gene	gene with protein product		608886	"""peroxisome proliferative activated receptor, gamma, coactivator 1, beta"""			11793024, 11854298	Standard	NM_133263		Approved	PERC, PGC1B	uc003lrc.3	Q86YN6	OTTHUMG00000130055	ENST00000309241.5:c.2069G>T	5.37:g.149216087G>T	ENSP00000312649:p.Gly690Val					PPARGC1B_uc003lrb.1_Missense_Mutation_p.G690V|PPARGC1B_uc003lrd.2_Missense_Mutation_p.G651V|PPARGC1B_uc003lrf.2_Missense_Mutation_p.G669V|PPARGC1B_uc003lre.1_Missense_Mutation_p.G669V	p.G690V	NM_133263	NP_573570	Q86YN6	PRGC2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		8	2111	+			690					A2RUM8|A2RUN0|B3KVW0|Q86YN3|Q86YN4|Q86YN5|Q8N1N9|Q8TDE4|Q8TDE5	Missense_Mutation	SNP	ENST00000309241.5	37	c.2069G>T	CCDS4298.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.7|20.7	4.026602|4.026602	0.75390|0.75390	.|.	.|.	ENSG00000155846|ENSG00000155846	ENST00000360453;ENST00000394320;ENST00000309241;ENST00000403750|ENST00000434684	T;T;T;T|.	0.20881|.	2.05;2.04;2.07;2.04|.	4.47|4.47	4.47|4.47	0.54385|0.54385	.|.	0.063289|.	0.64402|.	D|.	0.000007|.	T|T	0.78648|0.78648	0.4316|0.4316	M|M	0.82193|0.82193	2.58|2.58	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D|.	0.97110|.	1.0;1.0;1.0;0.999;1.0|.	T|T	0.81348|0.81348	-0.0973|-0.0973	10|5	0.87932|.	D|.	0|.	-15.0793|-15.0793	17.5766|17.5766	0.87952|0.87952	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	669;669;651;690;690|.	Q86YN6-2;Q86YN6-4;Q86YN6-5;Q86YN6;Q86YN6-3|.	.;.;.;PRGC2_HUMAN;.|.	V|C	651;690;690;626|376	ENSP00000353638:G651V;ENSP00000377855:G690V;ENSP00000312649:G690V;ENSP00000384403:G626V|.	ENSP00000312649:G690V|.	G|W	+|+	2|3	0|0	PPARGC1B|PPARGC1B	149196280|149196280	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	8.456000|8.456000	0.90359|0.90359	2.212000|2.212000	0.71576|0.71576	0.456000|0.456000	0.33151|0.33151	GGA|TGG		0.627	PPARGC1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252334.1	NM_133263		40	49	1	0	4.0181e-32	0.01441	5.64022e-32	40	49				
GLRA1	2741	broad.mit.edu	37	5	151266343	151266343	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr5:151266343G>A	ENST00000455880.2	-	3	477	c.191C>T	c.(190-192)cCa>cTa	p.P64L	GLRA1_ENST00000545569.1_5'UTR|GLRA1_ENST00000471351.2_5'UTR|GLRA1_ENST00000274576.4_Missense_Mutation_p.P64L			P23415	GLRA1_HUMAN	glycine receptor, alpha 1	64					acrosome reaction (GO:0007340)|action potential (GO:0001508)|adult walking behavior (GO:0007628)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|muscle contraction (GO:0006936)|negative regulation of transmission of nerve impulse (GO:0051970)|neuromuscular process controlling posture (GO:0050884)|neuropeptide signaling pathway (GO:0007218)|positive regulation of acrosome reaction (GO:2000344)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|righting reflex (GO:0060013)|startle response (GO:0001964)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|external side of plasma membrane (GO:0009897)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|taurine binding (GO:0030977)|transmitter-gated ion channel activity (GO:0022824)	p.P64L(1)		breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	23		all_hematologic(541;0.0341)|Medulloblastoma(196;0.0912)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Ethanol(DB00898)|Ginkgo biloba(DB01381)|Glycine(DB00145)|Halothane(DB01159)|Isoflurane(DB00753)|Lindane(DB00431)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	CACGTTCACTGGGGGACCTGC	0.488																																							uc003lut.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(190-192)CCA>CTA		glycine receptor, alpha 1 isoform 1 precursor	Desflurane(DB01189)|Enflurane(DB00228)|Ethanol(DB00898)|Glycine(DB00145)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)						104.0	95.0	98.0					5																	151266343		2203	4300	6503	SO:0001583	missense	2741				muscle contraction|negative regulation of transmission of nerve impulse|neuropeptide signaling pathway|positive regulation of acrosome reaction|regulation of membrane potential|startle response	cell junction|chloride channel complex|integral to plasma membrane|intracellular membrane-bounded organelle|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|glycine binding|protein binding|receptor activity|taurine binding|transmitter-gated ion channel activity	g.chr5:151266343G>A		CCDS4320.1, CCDS54942.1	5q33.1	2012-02-07	2008-01-24		ENSG00000145888	ENSG00000145888		"""Ligand-gated ion channels / Glycine receptors"""	4326	protein-coding gene	gene with protein product	"""startle disease/hyperekplexia"", ""stiff person syndrome"""	138491	"""glycine receptor, alpha 1 (startle disease/hyperekplexia)"""	STHE		1355335, 8298642	Standard	NM_000171		Approved		uc003lut.3	P23415	OTTHUMG00000130121	ENST00000455880.2:c.191C>T	5.37:g.151266343G>A	ENSP00000411593:p.Pro64Leu					GLRA1_uc003lur.2_Missense_Mutation_p.P64L|GLRA1_uc003lus.2_5'UTR	p.P64L	NM_001146040	NP_001139512	P23415	GLRA1_HUMAN	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		3	478	-		all_hematologic(541;0.0341)|Medulloblastoma(196;0.0912)	64			Extracellular (Probable).		B2R6T3|Q14C77|Q6DJV9	Missense_Mutation	SNP	ENST00000455880.2	37	c.191C>T	CCDS54942.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.838534	0.91117	.	.	ENSG00000145888	ENST00000274576;ENST00000455880	T;T	0.79845	-1.31;-1.31	5.45	5.45	0.79879	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.92358	0.7575	H	0.94886	3.595	0.80722	D	1	D;D	0.55605	0.972;0.965	D;P	0.63113	0.911;0.818	D	0.93953	0.7233	10	0.66056	D	0.02	.	19.2864	0.94072	0.0:0.0:1.0:0.0	.	64;64	P23415;P23415-2	GLRA1_HUMAN;.	L	64	ENSP00000274576:P64L;ENSP00000411593:P64L	ENSP00000274576:P64L	P	-	2	0	GLRA1	151246536	1.000000	0.71417	0.961000	0.40146	0.973000	0.67179	9.247000	0.95444	2.559000	0.86315	0.655000	0.94253	CCA		0.488	GLRA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000373959.1			9	40	0	0	0	0.013537	0	9	40				
NMUR2	56923	broad.mit.edu	37	5	151784223	151784223	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr5:151784223G>C	ENST00000255262.3	-	1	617	c.452C>G	c.(451-453)cCg>cGg	p.P151R	NMUR2_ENST00000518933.1_Intron	NM_020167.4	NP_064552.3	Q9GZQ4	NMUR2_HUMAN	neuromedin U receptor 2	151					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|arachidonic acid secretion (GO:0050482)|calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|cell-cell signaling (GO:0007267)|central nervous system development (GO:0007417)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|feeding behavior (GO:0007631)|grooming behavior (GO:0007625)|inositol phosphate-mediated signaling (GO:0048016)|neuropeptide signaling pathway (GO:0007218)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|reduction of food intake in response to dietary excess (GO:0002023)|regulation of smooth muscle contraction (GO:0006940)|response to pain (GO:0048265)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|GTP binding (GO:0005525)|intracellular calcium activated chloride channel activity (GO:0005229)|neuromedin U binding (GO:0042924)|neuromedin U receptor activity (GO:0001607)	p.P151R(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(12)|liver(1)|lung(15)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	44		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)	Kidney(363;0.000106)|KIRC - Kidney renal clear cell carcinoma(527;0.000672)			GGCGCGGAACGGGTGTAGGAT	0.642																																							uc003luv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)|lung(1)|breast(1)|pancreas(1)	8						c.(451-453)CCG>CGG		neuromedin U receptor 2							49.0	55.0	53.0					5																	151784223		2203	4300	6503	SO:0001583	missense	56923				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|arachidonic acid secretion|calcium ion transport|central nervous system development|elevation of cytosolic calcium ion concentration|regulation of smooth muscle contraction	integral to membrane|plasma membrane	GTP binding|intracellular calcium activated chloride channel activity|neuromedin U receptor activity	g.chr5:151784223G>C	AF242874	CCDS4321.1	5q33.1	2012-08-08		2004-05-28	ENSG00000132911	ENSG00000132911		"""GPCR / Class A : Neuromedin U receptors"""	16454	protein-coding gene	gene with protein product		605108		NMU2R		8940772, 10894543	Standard	NM_020167		Approved		uc003luv.2	Q9GZQ4	OTTHUMG00000130131	ENST00000255262.3:c.452C>G	5.37:g.151784223G>C	ENSP00000255262:p.Pro151Arg						p.P151R	NM_020167	NP_064552	Q9GZQ4	NMUR2_HUMAN	Kidney(363;0.000106)|KIRC - Kidney renal clear cell carcinoma(527;0.000672)		1	618	-		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)	151			Cytoplasmic (Potential).		Q7LC54|Q96AM5|Q9NRA6	Missense_Mutation	SNP	ENST00000255262.3	37	c.452C>G	CCDS4321.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.153682	0.78114	.	.	ENSG00000132911	ENST00000255262	T	0.61274	0.12	5.35	5.35	0.76521	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000001	D	0.86843	0.6030	H	0.99182	4.46	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92515	0.6020	10	0.87932	D	0	-21.6404	18.0632	0.89383	0.0:0.0:1.0:0.0	.	151	Q9GZQ4	NMUR2_HUMAN	R	151	ENSP00000255262:P151R	ENSP00000255262:P151R	P	-	2	0	NMUR2	151764416	1.000000	0.71417	0.946000	0.38457	0.607000	0.37147	9.507000	0.97996	2.502000	0.84385	0.591000	0.81541	CCG		0.642	NMUR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252439.1	NM_020167		39	54	0	0	0	0.013114	0	39	54				
ATP10B	23120	broad.mit.edu	37	5	160039758	160039758	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr5:160039758G>T	ENST00000327245.5	-	18	3674	c.2828C>A	c.(2827-2829)aCa>aAa	p.T943K	CTC-348L5.1_ENST00000523598.1_RNA	NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	943					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.T943K(1)		NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTGATTCTCTGTATTGATGGT	0.473																																							uc003lym.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(1)|pancreas(1)	5						c.(2827-2829)ACA>AAA		ATPase, class V, type 10B							62.0	62.0	62.0					5																	160039758		2076	4220	6296	SO:0001583	missense	23120				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr5:160039758G>T	AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.2828C>A	5.37:g.160039758G>T	ENSP00000313600:p.Thr943Lys					ATP10B_uc010jit.1_Missense_Mutation_p.T260K|ATP10B_uc003lyn.2_Missense_Mutation_p.T501K	p.T943K	NM_025153	NP_079429	O94823	AT10B_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		18	3675	-	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	943			Cytoplasmic (Potential).		Q9H725	Missense_Mutation	SNP	ENST00000327245.5	37	c.2828C>A	CCDS43394.1	.	.	.	.	.	.	.	.	.	.	G	17.48	3.400209	0.62177	.	.	ENSG00000118322	ENST00000327245;ENST00000520108	D;D	0.92858	-3.12;-3.12	5.17	5.17	0.71159	HAD-like domain (2);	0.131872	0.47852	D	0.000204	D	0.93220	0.7840	L	0.31294	0.92	0.50171	D	0.999858	D;D	0.89917	1.0;1.0	D;D	0.77557	0.99;0.99	D	0.92279	0.5832	9	.	.	.	.	18.0585	0.89370	0.0:0.0:1.0:0.0	.	551;943	Q2YDW8;O94823	.;AT10B_HUMAN	K	943;551	ENSP00000313600:T943K;ENSP00000431081:T551K	.	T	-	2	0	ATP10B	159972336	1.000000	0.71417	0.994000	0.49952	0.385000	0.30292	7.398000	0.79919	2.567000	0.86603	0.650000	0.86243	ACA		0.473	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374127.1	NM_025153		22	21	1	0	4.16121e-05	0.00278	4.4053e-05	22	21				
DBN1	1627	broad.mit.edu	37	5	176885526	176885526	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr5:176885526C>A	ENST00000309007.5	-	12	1528	c.1309G>T	c.(1309-1311)Gag>Tag	p.E437*	DBN1_ENST00000292385.5_Nonsense_Mutation_p.E439*|DBN1_ENST00000393563.4_Nonsense_Mutation_p.E169*|DBN1_ENST00000512501.1_Nonsense_Mutation_p.E169*|DBN1_ENST00000393565.1_Nonsense_Mutation_p.E483*	NM_004395.3	NP_004386	Q16643	DREB_HUMAN	drebrin 1	437					actin filament organization (GO:0007015)|cell communication by chemical coupling (GO:0010643)|cell communication by electrical coupling (GO:0010644)|maintenance of protein location in cell (GO:0032507)|neural precursor cell proliferation (GO:0061351)|regulation of dendrite development (GO:0050773)|regulation of neuronal synaptic plasticity (GO:0048168)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|gap junction (GO:0005921)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|profilin binding (GO:0005522)	p.E437*(1)|p.E439*(1)		breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(12)|ovary(1)|skin(2)	25	all_cancers(89;2.17e-05)|Renal(175;0.000269)|Lung NSC(126;0.0014)|all_lung(126;0.0025)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GTGGCAGGCTCCACGGGAGCA	0.637																																							uc003mgy.2		NA																	2	Substitution - Nonsense(2)		lung(2)	breast(3)|ovary(1)|lung(1)|skin(1)	6						c.(1309-1311)GAG>TAG		drebrin 1 isoform a							72.0	89.0	83.0					5																	176885526		2203	4300	6503	SO:0001587	stop_gained	1627				actin filament organization|regulation of dendrite development|regulation of neuronal synaptic plasticity	actomyosin|cytoplasm|dendrite	actin binding|profilin binding	g.chr5:176885526C>A		CCDS4420.1, CCDS4421.1	5q35.3	2008-02-05			ENSG00000113758	ENSG00000113758			2695	protein-coding gene	gene with protein product		126660		D0S117E		8216329	Standard	NM_004395		Approved		uc003mgy.2	Q16643	OTTHUMG00000130856	ENST00000309007.5:c.1309G>T	5.37:g.176885526C>A	ENSP00000308532:p.Glu437*					DBN1_uc011dga.1_Nonsense_Mutation_p.E169*|DBN1_uc003mgx.2_Nonsense_Mutation_p.E439*|DBN1_uc010jkn.1_Nonsense_Mutation_p.E387*|DBN1_uc003mgz.1_Nonsense_Mutation_p.E420*	p.E437*	NM_004395	NP_004386	Q16643	DREB_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		12	1481	-	all_cancers(89;2.17e-05)|Renal(175;0.000269)|Lung NSC(126;0.0014)|all_lung(126;0.0025)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	437					A8MV58|B2RBG0|Q9UFZ5	Nonsense_Mutation	SNP	ENST00000309007.5	37	c.1309G>T	CCDS4420.1	.	.	.	.	.	.	.	.	.	.	C	18.72	3.684847	0.68157	.	.	ENSG00000113758	ENST00000309007;ENST00000292385;ENST00000393565;ENST00000512501;ENST00000393563	.	.	.	3.83	3.83	0.44106	.	5.482520	0.00848	N	0.001817	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-16.3066	14.0284	0.64599	0.0:1.0:0.0:0.0	.	.	.	.	X	437;439;483;169;169	.	ENSP00000292385:E439X	E	-	1	0	DBN1	176818132	0.008000	0.16893	0.862000	0.33874	0.247000	0.25773	1.081000	0.30791	2.447000	0.82792	0.313000	0.20887	GAG		0.637	DBN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253429.2	NM_080881		16	41	1	0	2.4624e-09	0.008871	2.78582e-09	16	41				
DBN1	1627	broad.mit.edu	37	5	176894024	176894024	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr5:176894024C>T	ENST00000309007.5	-	7	814	c.595G>A	c.(595-597)Gcc>Acc	p.A199T	DBN1_ENST00000292385.5_Missense_Mutation_p.A201T|DBN1_ENST00000393565.1_Missense_Mutation_p.A199T	NM_004395.3	NP_004386	Q16643	DREB_HUMAN	drebrin 1	199					actin filament organization (GO:0007015)|cell communication by chemical coupling (GO:0010643)|cell communication by electrical coupling (GO:0010644)|maintenance of protein location in cell (GO:0032507)|neural precursor cell proliferation (GO:0061351)|regulation of dendrite development (GO:0050773)|regulation of neuronal synaptic plasticity (GO:0048168)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|gap junction (GO:0005921)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|profilin binding (GO:0005522)	p.A199T(1)|p.A201T(1)		breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(12)|ovary(1)|skin(2)	25	all_cancers(89;2.17e-05)|Renal(175;0.000269)|Lung NSC(126;0.0014)|all_lung(126;0.0025)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TCATCCAGGGCCTTCTTCCGC	0.672																																							uc003mgy.2		NA																	2	Substitution - Missense(2)		lung(2)	breast(3)|ovary(1)|lung(1)|skin(1)	6						c.(595-597)GCC>ACC		drebrin 1 isoform a							68.0	70.0	70.0					5																	176894024		2203	4300	6503	SO:0001583	missense	1627				actin filament organization|regulation of dendrite development|regulation of neuronal synaptic plasticity	actomyosin|cytoplasm|dendrite	actin binding|profilin binding	g.chr5:176894024C>T		CCDS4420.1, CCDS4421.1	5q35.3	2008-02-05			ENSG00000113758	ENSG00000113758			2695	protein-coding gene	gene with protein product		126660		D0S117E		8216329	Standard	NM_004395		Approved		uc003mgy.2	Q16643	OTTHUMG00000130856	ENST00000309007.5:c.595G>A	5.37:g.176894024C>T	ENSP00000308532:p.Ala199Thr					DBN1_uc003mgx.2_Missense_Mutation_p.A201T|DBN1_uc010jkn.1_Missense_Mutation_p.A149T|DBN1_uc003mgz.1_Missense_Mutation_p.A136T	p.A199T	NM_004395	NP_004386	Q16643	DREB_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		7	767	-	all_cancers(89;2.17e-05)|Renal(175;0.000269)|Lung NSC(126;0.0014)|all_lung(126;0.0025)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	199					A8MV58|B2RBG0|Q9UFZ5	Missense_Mutation	SNP	ENST00000309007.5	37	c.595G>A	CCDS4420.1	.	.	.	.	.	.	.	.	.	.	C	34	5.383204	0.95967	.	.	ENSG00000113758	ENST00000309007;ENST00000292385;ENST00000393565;ENST00000477391	T;T;T	0.41758	0.99;0.99;1.53	4.99	4.99	0.66335	.	0.058705	0.64402	D	0.000002	T	0.56217	0.1970	M	0.61703	1.905	0.80722	D	1	D;P;P;P	0.55800	0.973;0.9;0.856;0.911	P;B;B;P	0.54026	0.74;0.334;0.355;0.558	T	0.61023	-0.7146	10	0.87932	D	0	-11.8466	18.0729	0.89417	0.0:1.0:0.0:0.0	.	149;199;199;201	B3KSQ7;A8MV58;Q16643;Q16643-2	.;.;DREB_HUMAN;.	T	199;201;199;198	ENSP00000308532:A199T;ENSP00000292385:A201T;ENSP00000377195:A199T	ENSP00000292385:A201T	A	-	1	0	DBN1	176826630	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	5.232000	0.65332	2.586000	0.87340	0.655000	0.94253	GCC		0.672	DBN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253429.2	NM_080881		24	95	0	0	0	0.005443	0	24	95				
PROP1	5626	broad.mit.edu	37	5	177421277	177421277	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr5:177421277G>A	ENST00000308304.2	-	2	480	c.172C>T	c.(172-174)Ccg>Tcg	p.P58S		NM_006261.4	NP_006252	O75360	PROP1_HUMAN	PROP paired-like homeobox 1	58					blood vessel development (GO:0001568)|canonical Wnt signaling pathway (GO:0060070)|cell migration (GO:0016477)|central nervous system development (GO:0007417)|dorsal/ventral pattern formation (GO:0009953)|hypophysis morphogenesis (GO:0048850)|hypothalamus cell differentiation (GO:0021979)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|somatotropin secreting cell differentiation (GO:0060126)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)	p.P58S(1)		endometrium(1)|large_intestine(2)|lung(9)|stomach(1)	13	all_cancers(89;0.00176)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCTCCTTGCGGGGAGAACCTT	0.657																																							uc003mif.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(172-174)CCG>TCG		PROP paired-like homeobox 1							24.0	26.0	25.0					5																	177421277		2199	4300	6499	SO:0001583	missense	5626				central nervous system development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr5:177421277G>A	AF076215	CCDS4430.1	5q35.3	2011-06-20	2007-07-12		ENSG00000175325	ENSG00000175325		"""Homeoboxes / PRD class"""	9455	protein-coding gene	gene with protein product		601538	"""prophet of Pit1, paired-like homeodomain transcription factor"""			9462743	Standard	NM_006261		Approved		uc003mif.1	O75360	OTTHUMG00000130887	ENST00000308304.2:c.172C>T	5.37:g.177421277G>A	ENSP00000311290:p.Pro58Ser						p.P58S	NM_006261	NP_006252	O75360	PROP1_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		2	481	-	all_cancers(89;0.00176)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	58						Missense_Mutation	SNP	ENST00000308304.2	37	c.172C>T	CCDS4430.1	.	.	.	.	.	.	.	.	.	.	.	9.896	1.205459	0.22205	.	.	ENSG00000175325	ENST00000308304	D	0.90385	-2.66	3.15	1.17	0.20885	Homeodomain-related (1);	0.602886	0.13932	N	0.352805	T	0.81541	0.4844	L	0.34521	1.04	0.09310	N	1	P	0.39480	0.675	B	0.37144	0.242	T	0.70033	-0.4983	10	0.33141	T	0.24	-2.4902	4.1093	0.10052	0.1378:0.0:0.6342:0.228	.	58	O75360	PROP1_HUMAN	S	58	ENSP00000311290:P58S	ENSP00000311290:P58S	P	-	1	0	PROP1	177353883	0.004000	0.15560	0.000000	0.03702	0.223000	0.24884	0.323000	0.19593	0.120000	0.18254	0.306000	0.20318	CCG		0.657	PROP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253472.1	NM_006261		6	26	0	0	0	0.001168	0	6	26				
ADAMTS2	9509	broad.mit.edu	37	5	178555091	178555091	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr5:178555091G>A	ENST00000251582.7	-	17	2587	c.2486C>T	c.(2485-2487)tCa>tTa	p.S829L		NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	829	Spacer.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.S829L(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		GTACGTCAGTGAGACCCGGGT	0.572																																							uc003mjw.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						c.(2485-2487)TCA>TTA		ADAM metallopeptidase with thrombospondin type 1							156.0	125.0	135.0					5																	178555091		2203	4300	6503	SO:0001583	missense	9509				collagen catabolic process	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:178555091G>A	AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.2486C>T	5.37:g.178555091G>A	ENSP00000251582:p.Ser829Leu						p.S829L	NM_014244	NP_055059	O95450	ATS2_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)	17	2486	-	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	829			Spacer.			Missense_Mutation	SNP	ENST00000251582.7	37	c.2486C>T	CCDS4444.1	.	.	.	.	.	.	.	.	.	.	G	17.88	3.496857	0.64186	.	.	ENSG00000087116	ENST00000251582	T	0.53423	0.62	4.55	4.55	0.56014	ADAM-TS Spacer 1 (1);	0.133496	0.34268	N	0.004105	T	0.51278	0.1665	M	0.74881	2.28	0.80722	D	1	B	0.14012	0.009	B	0.14578	0.011	T	0.55909	-0.8066	10	0.62326	D	0.03	.	16.6512	0.85203	0.0:0.0:1.0:0.0	.	829	O95450	ATS2_HUMAN	L	829	ENSP00000251582:S829L	ENSP00000251582:S829L	S	-	2	0	ADAMTS2	178487697	1.000000	0.71417	0.977000	0.42913	0.677000	0.39632	3.251000	0.51453	2.232000	0.73038	0.462000	0.41574	TCA		0.572	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253507.1	NM_014244		32	38	0	0	0	0.009535	0	32	38				
RNF130	55819	broad.mit.edu	37	5	179467544	179467544	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr5:179467544C>G	ENST00000261947.4	-	2	749	c.351G>C	c.(349-351)gaG>gaC	p.E117D	RNF130_ENST00000522208.2_Missense_Mutation_p.E117D|RNF130_ENST00000521389.1_Missense_Mutation_p.E117D	NM_001280801.1	NP_001267730.1			ring finger protein 130									p.E117D(1)		breast(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	17	all_cancers(89;5.49e-05)|all_epithelial(37;1.94e-05)|Renal(175;0.000159)|Lung NSC(126;0.00118)|all_lung(126;0.00212)	all_cancers(40;0.0294)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GTGATATTTTCTCTTTAAACG	0.448																																					GBM(24;432 554 38471 39699 51728)	GBM(24;432 554 38471 39699 51728)	uc003mll.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|ovary(1)	3						c.(349-351)GAG>GAC		ring finger protein 130 precursor							124.0	120.0	121.0					5																	179467544		2203	4300	6503	SO:0001583	missense	55819				apoptosis	cytoplasm|integral to membrane|nucleus	ubiquitin-protein ligase activity|zinc ion binding	g.chr5:179467544C>G	AF155650	CCDS4451.1, CCDS64340.1	5q35.3	2013-01-09			ENSG00000113269	ENSG00000113269		"""RING-type (C3HC4) zinc fingers"""	18280	protein-coding gene	gene with protein product						10806348	Standard	NM_018434		Approved	GP, G1RZFP, GOLIATH	uc003mll.1	Q86XS8	OTTHUMG00000130909	ENST00000261947.4:c.351G>C	5.37:g.179467544C>G	ENSP00000261947:p.Glu117Asp					RNF130_uc003mlm.1_Missense_Mutation_p.E117D	p.E117D	NM_018434	NP_060904	Q86XS8	GOLI_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		2	758	-	all_cancers(89;5.49e-05)|all_epithelial(37;1.94e-05)|Renal(175;0.000159)|Lung NSC(126;0.00118)|all_lung(126;0.00212)	all_cancers(40;0.0294)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	117			Extracellular (Potential).|PA.			Missense_Mutation	SNP	ENST00000261947.4	37	c.351G>C		.	.	.	.	.	.	.	.	.	.	C	10.66	1.413923	0.25465	.	.	ENSG00000113269	ENST00000522208;ENST00000521389;ENST00000261947	T;T;T	0.06449	3.3;3.3;3.3	5.78	4.02	0.46733	Protease-associated domain, PA (1);	0.049955	0.85682	D	0.000000	T	0.03827	0.0108	N	0.16478	0.41	0.45342	D	0.998338	B;B	0.17667	0.023;0.001	B;B	0.20955	0.032;0.01	T	0.29305	-1.0016	10	0.06625	T	0.88	.	10.5896	0.45302	0.0:0.7936:0.0:0.2064	.	134;117	Q59EL1;Q86XS8	.;GOLI_HUMAN	D	117	ENSP00000429509:E117D;ENSP00000430237:E117D;ENSP00000261947:E117D	ENSP00000261947:E117D	E	-	3	2	RNF130	179400150	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	2.404000	0.44539	0.797000	0.33971	0.650000	0.86243	GAG		0.448	RNF130-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000374205.1	NM_018434		34	113	0	0	0	0.003755	0	34	113				
TRIM7	81786	broad.mit.edu	37	5	180625764	180625764	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr5:180625764G>C	ENST00000274773.7	-	5	975	c.914C>G	c.(913-915)tCt>tGt	p.S305C	TRIM7_ENST00000393319.3_Missense_Mutation_p.S123C|CTC-338M12.6_ENST00000511517.1_RNA|CTC-338M12.6_ENST00000512508.1_RNA|TRIM7_ENST00000504241.1_5'Flank|CTC-338M12.6_ENST00000502812.2_RNA|TRIM7_ENST00000393315.1_Missense_Mutation_p.S97C|CTC-338M12.6_ENST00000514784.1_RNA|TRIM7_ENST00000361809.3_Missense_Mutation_p.S97C|CTC-338M12.6_ENST00000419707.2_RNA|TRIM7_ENST00000422067.2_Missense_Mutation_p.S97C|CTC-338M12.6_ENST00000509080.1_RNA	NM_203293.1	NP_976038.1	Q9C029	TRIM7_HUMAN	tripartite motif containing 7	305						cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.S305C(1)		NS(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(2)|skin(1)|stomach(1)	17	all_cancers(89;6.03e-06)|all_epithelial(37;7.1e-07)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.000172)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;2e-06)|Epithelial(171;1.35e-05)|OV - Ovarian serous cystadenocarcinoma(192;0.000128)|Kidney(146;0.0674)|GBM - Glioblastoma multiforme(465;0.0802)		CTTCATCTCAGAAGAGACTGT	0.527																																					Esophageal Squamous(128;2258 2308 35507 48647)	Esophageal Squamous(128;2258 2308 35507 48647)	uc003mmz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(913-915)TCT>TGT		tripartite motif-containing 7 isoform 1							51.0	55.0	54.0					5																	180625764		2203	4300	6503	SO:0001583	missense	81786					cytoplasm|nucleus	zinc ion binding	g.chr5:180625764G>C	AF220032	CCDS4462.1, CCDS4463.1, CCDS4464.1, CCDS43414.1	5q35.3	2013-01-09	2011-01-25		ENSG00000146054	ENSG00000146054		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16278	protein-coding gene	gene with protein product	"""glycogenin-interacting protein"", ""tripartite motif protein TRIM7"""	609315	"""tripartite motif-containing 7"""			11331580	Standard	NM_203294		Approved	RNF90, GNIP	uc003mmz.1	Q9C029	OTTHUMG00000130963	ENST00000274773.7:c.914C>G	5.37:g.180625764G>C	ENSP00000274773:p.Ser305Cys					TRIM7_uc003mmv.1_Missense_Mutation_p.S123C|TRIM7_uc003mmw.1_Missense_Mutation_p.S97C|TRIM7_uc003mmx.1_Missense_Mutation_p.S97C|TRIM7_uc003mmy.1_Missense_Mutation_p.S97C	p.S305C	NM_203293	NP_976038	Q9C029	TRIM7_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;2e-06)|Epithelial(171;1.35e-05)|OV - Ovarian serous cystadenocarcinoma(192;0.000128)|Kidney(146;0.0674)|GBM - Glioblastoma multiforme(465;0.0802)	5	981	-	all_cancers(89;6.03e-06)|all_epithelial(37;7.1e-07)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.000172)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	305					A2RUE4|D3DWR7|Q969F5|Q96F67|Q96J89|Q96J90	Missense_Mutation	SNP	ENST00000274773.7	37	c.914C>G	CCDS4462.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.029058	0.75504	.	.	ENSG00000146054	ENST00000274773;ENST00000393315;ENST00000361809;ENST00000393319;ENST00000422067	T;T;T;T;T	0.05139	3.49;3.49;3.49;3.49;3.49	6.04	6.04	0.98038	.	0.347345	0.24999	N	0.033930	T	0.16769	0.0403	L	0.60455	1.87	0.38413	D	0.945988	D;D	0.65815	0.995;0.969	P;P	0.54270	0.747;0.655	T	0.00071	-1.2131	10	0.54805	T	0.06	.	16.0793	0.80989	0.0:0.0:1.0:0.0	.	305;123	Q9C029;Q9C029-4	TRIM7_HUMAN;.	C	305;97;97;123;97	ENSP00000274773:S305C;ENSP00000376991:S97C;ENSP00000355059:S97C;ENSP00000376994:S123C;ENSP00000391458:S97C	ENSP00000274773:S305C	S	-	2	0	TRIM7	180558370	0.179000	0.23135	1.000000	0.80357	0.990000	0.78478	3.357000	0.52277	2.873000	0.98535	0.561000	0.74099	TCT		0.527	TRIM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253569.3	NM_203296		10	34	0	0	0	0.010729	0	10	34				
ZBED9	114821	broad.mit.edu	37	6	28540528	28540528	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr6:28540528C>A	ENST00000452236.2	-	4	3755	c.3138G>T	c.(3136-3138)atG>atT	p.M1046I		NM_052923.1	NP_443155.1												p.M1046I(1)		NS(3)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(14)|liver(1)|lung(29)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)	71						gatcagcttccatattatcac	0.299																																							uc003nlo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(3136-3138)ATG>ATT		SCAN domain containing 3							64.0	67.0	66.0					6																	28540528		2203	4300	6503	SO:0001583	missense	114821				DNA integration|viral reproduction	nucleus	DNA binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity	g.chr6:28540528C>A																												ENST00000452236.2:c.3138G>T	6.37:g.28540528C>A	ENSP00000395259:p.Met1046Ile						p.M1046I	NM_052923	NP_443155	Q6R2W3	SCND3_HUMAN			4	3756	-			1046						Missense_Mutation	SNP	ENST00000452236.2	37	c.3138G>T	CCDS34355.1	.	.	.	.	.	.	.	.	.	.	C	9.731	1.162157	0.21538	.	.	ENSG00000232040	ENST00000452236	T	0.27104	1.69	2.14	2.14	0.27477	Ribonuclease H-like (1);	0.292688	0.27258	N	0.020198	T	0.14098	0.0341	L	0.54965	1.715	0.25608	N	0.986525	B	0.30211	0.273	B	0.42214	0.38	T	0.15378	-1.0439	10	0.30078	T	0.28	.	7.8439	0.29414	0.0:1.0:0.0:0.0	.	1046	Q6R2W3	SCND3_HUMAN	I	1046	ENSP00000395259:M1046I	ENSP00000395259:M1046I	M	-	3	0	SCAND3	28648507	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.852000	0.39348	1.507000	0.48752	0.561000	0.74099	ATG		0.299	SCAND3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000043551.3			66	50	1	0	3.83939e-23	0.01441	5.16003e-23	66	50				
OR12D2	26529	broad.mit.edu	37	6	29364792	29364792	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr6:29364792G>T	ENST00000383555.2	+	1	377	c.316G>T	c.(316-318)Ggc>Tgc	p.G106C	OR5V1_ENST00000377154.1_Intron	NM_013936.3	NP_039224.2	P58182	O12D2_HUMAN	olfactory receptor, family 12, subfamily D, member 2 (gene/pseudogene)	106						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G106C(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(20)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	31						CCACTCCCTGGGCAGCACGGA	0.493																																							uc003nmf.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(316-318)GGC>TGC		olfactory receptor, family 12, subfamily D,							81.0	85.0	84.0					6																	29364792		1511	2707	4218	SO:0001583	missense	26529				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr6:29364792G>T		CCDS4659.1	6p22.2-p21.31	2013-10-10	2013-10-10		ENSG00000168787	ENSG00000168787		"""GPCR / Class A : Olfactory receptors"""	8178	protein-coding gene	gene with protein product			"""olfactory receptor, family 12, subfamily D, member 2"""				Standard	NM_013936		Approved	hs6M1-20	uc003nmf.4	P58182	OTTHUMG00000031049	ENST00000383555.2:c.316G>T	6.37:g.29364792G>T	ENSP00000373047:p.Gly106Cys						p.G106C	NM_013936	NP_039224	P58182	O12D2_HUMAN			1	377	+			106			Helical; Name=3; (Potential).		B0S862|Q5SUN9|Q6IET9	Missense_Mutation	SNP	ENST00000383555.2	37	c.316G>T	CCDS4659.1	.	.	.	.	.	.	.	.	.	.	G	12.21	1.869284	0.32977	.	.	ENSG00000168787	ENST00000383555	T	0.01369	4.97	4.03	4.03	0.46877	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000010	T	0.04770	0.0129	M	0.90705	3.14	0.33325	D	0.567898	D	0.89917	1.0	D	0.91635	0.999	T	0.01071	-1.1461	10	0.66056	D	0.02	.	7.4847	0.27425	0.0953:0.1716:0.7331:0.0	.	106	P58182	O12D2_HUMAN	C	106	ENSP00000373047:G106C	ENSP00000373047:G106C	G	+	1	0	OR12D2	29472771	0.019000	0.18553	0.991000	0.47740	0.250000	0.25880	1.680000	0.37607	2.086000	0.62901	0.405000	0.27470	GGC		0.493	OR12D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076054.2			16	16	1	0	6.5261e-18	0.00874	8.4129e-18	16	16				
SIM1	6492	broad.mit.edu	37	6	100838959	100838959	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr6:100838959G>T	ENST00000369208.3	-	12	2361	c.1579C>A	c.(1579-1581)Cat>Aat	p.H527N	SIM1_ENST00000262901.4_Missense_Mutation_p.H527N			P81133	SIM1_HUMAN	single-minded family bHLH transcription factor 1	527	Single-minded C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00632}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.H527N(1)		breast(1)|central_nervous_system(4)|endometrium(5)|kidney(1)|large_intestine(15)|lung(34)|ovary(4)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	79		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		TCATCCCAATGACCTCGCCCT	0.393																																							uc003pqj.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)	4						c.(1579-1581)CAT>AAT		single-minded homolog 1							50.0	52.0	52.0					6																	100838959		2203	4300	6503	SO:0001583	missense	6492				cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity	g.chr6:100838959G>T	U70212	CCDS5045.1	6q16.3	2013-10-17	2013-10-17		ENSG00000112246	ENSG00000112246		"""Basic helix-loop-helix proteins"""	10882	protein-coding gene	gene with protein product		603128	"""single-minded (Drosophila) homolog 1"", ""single-minded homolog 1 (Drosophila)"""			9199934, 11448938	Standard	NM_005068		Approved	bHLHe14	uc003pqj.4	P81133	OTTHUMG00000015275	ENST00000369208.3:c.1579C>A	6.37:g.100838959G>T	ENSP00000358210:p.His527Asn					SIM1_uc010kcu.2_Missense_Mutation_p.H527N	p.H527N	NM_005068	NP_005059	P81133	SIM1_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0774)	11	1786	-		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)	527			Single-minded C-terminal.		Q5TDP7	Missense_Mutation	SNP	ENST00000369208.3	37	c.1579C>A	CCDS5045.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.290115	0.80914	.	.	ENSG00000112246	ENST00000369208;ENST00000262901	T;T	0.32753	1.44;1.44	5.9	5.9	0.94986	Single-minded, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.22437	0.0541	N	0.24115	0.695	0.80722	D	1	P	0.52692	0.955	P	0.48488	0.579	T	0.00958	-1.1500	10	0.44086	T	0.13	.	20.2789	0.98501	0.0:0.0:1.0:0.0	.	527	P81133	SIM1_HUMAN	N	527	ENSP00000358210:H527N;ENSP00000262901:H527N	ENSP00000262901:H527N	H	-	1	0	SIM1	100945680	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.434000	0.97515	2.788000	0.95919	0.650000	0.86243	CAT		0.393	SIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041628.3	NM_005068		45	31	1	0	2.68985e-26	0.01441	3.69367e-26	45	31				
TIAM2	26230	broad.mit.edu	37	6	155465909	155465909	+	Silent	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr6:155465909C>T	ENST00000461783.3	+	8	3073	c.1800C>T	c.(1798-1800)ttC>ttT	p.F600F	TIAM2_ENST00000456144.1_Silent_p.F600F|TIAM2_ENST00000529824.2_Silent_p.F600F|TIAM2_ENST00000360366.4_Silent_p.F600F|TIAM2_ENST00000318981.5_Silent_p.F600F|TIAM2_ENST00000367174.2_5'UTR			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	600	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.F600F(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		TCTACCTTTTCCAGGTACTGC	0.403																																							uc003qqb.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|breast(1)	4						c.(1798-1800)TTC>TTT		T-cell lymphoma invasion and metastasis 2							142.0	138.0	139.0					6																	155465909		2203	4300	6503	SO:0001819	synonymous_variant	26230				apoptosis|cellular lipid metabolic process|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|filopodium|growth cone|lamellipodium	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity	g.chr6:155465909C>T		CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.1800C>T	6.37:g.155465909C>T						TIAM2_uc003qqe.2_Silent_p.F600F|TIAM2_uc010kjj.2_Silent_p.F133F	p.F600F	NM_012454	NP_036586	Q8IVF5	TIAM2_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)	8	3073	+		Ovarian(120;0.196)	600			PH 1.		B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	Silent	SNP	ENST00000461783.3	37	c.1800C>T	CCDS34558.1																																																																																				0.403	TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000387980.2	NM_012454		72	67	0	0	0	0.01441	0	72	67				
LPA	4018	broad.mit.edu	37	6	160953584	160953584	+	Silent	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr6:160953584G>A	ENST00000316300.5	-	38	5984	c.5940C>T	c.(5938-5940)gcC>gcT	p.A1980A	LPA_ENST00000447678.1_Silent_p.A1980A			P08519	APOA_HUMAN	lipoprotein, Lp(a)	4488	Kringle 18. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)	p.A1980A(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	CAGTGCCTCTGGCCAAATGCT	0.473																																							uc003qtl.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|skin(2)|pancreas(1)	6						c.(5938-5940)GCC>GCT		lipoprotein Lp(a) precursor	Aminocaproic Acid(DB00513)						79.0	81.0	80.0					6																	160953584		2155	4281	6436	SO:0001819	synonymous_variant	4018				blood circulation|lipid metabolic process|lipid transport|lipoprotein metabolic process|proteolysis|receptor-mediated endocytosis	plasma lipoprotein particle	apolipoprotein binding|endopeptidase inhibitor activity|fibronectin binding|heparin binding|serine-type endopeptidase activity	g.chr6:160953584G>A	X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.5940C>T	6.37:g.160953584G>A							p.A1980A	NM_005577	NP_005568	P08519	APOA_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	39	6060	-		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)	4488			Peptidase S1.		Q5VTD7|Q9UD88	Silent	SNP	ENST00000316300.5	37	c.5940C>T	CCDS43523.1																																																																																				0.473	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042957.1	NM_005577		42	28	0	0	0	0.010771	0	42	28				
PDE10A	10846	broad.mit.edu	37	6	165808736	165808736	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr6:165808736C>A	ENST00000366882.1	-	16	1563	c.1409G>T	c.(1408-1410)gGt>gTt	p.G470V	PDE10A_ENST00000354448.4_Missense_Mutation_p.G470V|PDE10A_ENST00000539869.2_Missense_Mutation_p.G480V			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A	470					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)	p.G470V(1)		breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	TTCAAAAGGACCAATGTCAAA	0.328																																					Esophageal Squamous(22;308 615 5753 12038 40624)	Esophageal Squamous(22;308 615 5753 12038 40624)	uc003qun.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)	5						c.(1408-1410)GGT>GTT		phosphodiesterase 10A isoform 2	Dipyridamole(DB00975)						71.0	69.0	70.0					6																	165808736		2203	4300	6503	SO:0001583	missense	10846				platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cAMP binding|cGMP binding|metal ion binding	g.chr6:165808736C>A	AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000366882.1:c.1409G>T	6.37:g.165808736C>A	ENSP00000355847:p.Gly470Val					PDE10A_uc011egj.1_RNA|PDE10A_uc011egk.1_Missense_Mutation_p.G400V|PDE10A_uc003quo.2_Missense_Mutation_p.G480V	p.G470V	NM_006661	NP_006652	Q9Y233	PDE10_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	16	1650	-		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)	470					Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	Missense_Mutation	SNP	ENST00000366882.1	37	c.1409G>T		.	.	.	.	.	.	.	.	.	.	C	9.886	1.202801	0.22121	.	.	ENSG00000112541	ENST00000366882;ENST00000539869;ENST00000343842;ENST00000354448;ENST00000392126	T;T	0.77489	-1.1;-1.1	5.57	5.57	0.84162	5&apos (1);-cyclic nucleotide phosphodiesterase, catalytic domain (1);3&apos (1);	0.625761	0.17922	N	0.157444	T	0.46908	0.1417	N	0.22421	0.69	0.58432	D	0.999996	P;B	0.34815	0.47;0.033	B;B	0.26416	0.069;0.02	T	0.49476	-0.8936	10	0.19590	T	0.45	.	12.8444	0.57821	0.0:0.9257:0.0:0.0743	.	480;470	Q9ULW9;Q9Y233	.;PDE10_HUMAN	V	470;498;480;470;469	ENSP00000355847:G470V;ENSP00000346435:G470V	ENSP00000341187:G480V	G	-	2	0	PDE10A	165728726	0.977000	0.34250	0.995000	0.50966	0.997000	0.91878	3.030000	0.49720	2.619000	0.88677	0.650000	0.86243	GGT		0.328	PDE10A-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000043031.1			31	24	1	0	1.26612e-14	0.003271	1.55294e-14	31	24				
SDK1	221935	broad.mit.edu	37	7	4153810	4153810	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr7:4153810G>A	ENST00000404826.2	+	25	3866	c.3727G>A	c.(3727-3729)Gag>Aag	p.E1243K	SDK1_ENST00000389531.3_Missense_Mutation_p.E1243K	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	1243	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.E1243K(1)		NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		CGAGGAGCTGGAGGAGTGGAT	0.632																																							uc003smx.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(3)|ovary(2)|skin(1)	6						c.(3727-3729)GAG>AAG		sidekick 1 precursor							53.0	51.0	52.0					7																	4153810		2203	4300	6503	SO:0001583	missense	221935				cell adhesion	integral to membrane		g.chr7:4153810G>A	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.3727G>A	7.37:g.4153810G>A	ENSP00000385899:p.Glu1243Lys					SDK1_uc010kso.2_Missense_Mutation_p.E519K	p.E1243K	NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)	25	3866	+		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)	1243			Fibronectin type-III 6.		Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	37	c.3727G>A	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.419234	0.83559	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.56611	0.45;0.45	5.38	5.38	0.77491	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	T	0.64735	0.2625	M	0.62154	1.92	0.44595	D	0.997565	D;P	0.54047	0.964;0.923	P;P	0.55713	0.782;0.582	T	0.65298	-0.6202	10	0.48119	T	0.1	.	16.1907	0.81987	0.0:0.1328:0.8672:0.0	.	1243;1243	F8W6X9;Q7Z5N4	.;SDK1_HUMAN	K	1243	ENSP00000385899:E1243K;ENSP00000374182:E1243K	ENSP00000374182:E1243K	E	+	1	0	SDK1	4120336	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	5.176000	0.65026	2.507000	0.84556	0.655000	0.94253	GAG		0.632	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744		24	60	0	0	0	0.003954	0	24	60				
BBS9	27241	broad.mit.edu	37	7	33397600	33397600	+	Silent	SNP	C	C	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr7:33397600C>A	ENST00000242067.6	+	16	2207	c.1686C>A	c.(1684-1686)ctC>ctA	p.L562L	BBS9_ENST00000396127.2_Silent_p.L527L|BBS9_ENST00000350941.3_Silent_p.L522L|BBS9_ENST00000354265.4_Silent_p.L527L|BBS9_ENST00000355070.2_Silent_p.L557L	NM_198428.2	NP_940820.1	Q3SYG4	PTHB1_HUMAN	Bardet-Biedl syndrome 9	562					cilium assembly (GO:0042384)|fat cell differentiation (GO:0045444)|protein transport (GO:0015031)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)		p.L562L(2)	BBS9/PKD1L1(2)	NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	50			GBM - Glioblastoma multiforme(11;0.0894)			TTCTTAGTCTCTTCCCAGGTA	0.383									Bardet-Biedl syndrome																														uc003tdn.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5						c.(1684-1686)CTC>CTA		parathyroid hormone-responsive B1 isoform 2							90.0	87.0	88.0					7																	33397600		2203	4299	6502	SO:0001819	synonymous_variant	27241	Bardet-Biedl_syndrome	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	fat cell differentiation|response to stimulus|visual perception	BBSome|cilium membrane|microtubule organizing center|nucleus	protein binding	g.chr7:33397600C>A		CCDS5441.1, CCDS34618.1, CCDS43566.1, CCDS47572.1	7p14	2014-06-17			ENSG00000122507	ENSG00000122507			30000	protein-coding gene	gene with protein product	"""parathyroid hormone responsive B1 gene"""	607968				16380913, 10221542	Standard	XM_005249701		Approved	B1, PTHB1	uc003tdn.1	Q3SYG4	OTTHUMG00000128659	ENST00000242067.6:c.1686C>A	7.37:g.33397600C>A						BBS9_uc003tdo.1_Silent_p.L527L|BBS9_uc003tdp.1_Silent_p.L557L|BBS9_uc003tdq.1_Silent_p.L522L|BBS9_uc010kwn.1_RNA|BBS9_uc003tdr.1_Silent_p.L86L|BBS9_uc003tds.1_5'UTR|BBS9_uc011kao.1_Silent_p.L440L	p.L562L	NM_198428	NP_940820	Q3SYG4	PTHB1_HUMAN	GBM - Glioblastoma multiforme(11;0.0894)		16	2199	+			562					E9PDC9|P78514|Q7KYS6|Q7KYS7|Q8N570|Q99844|Q99854|Q9Y699|Q9Y6A0	Silent	SNP	ENST00000242067.6	37	c.1686C>A	CCDS43566.1	.	.	.	.	.	.	.	.	.	.	C	8.057	0.767296	0.15983	.	.	ENSG00000122507	ENST00000434373	T	0.18174	2.23	5.85	4.05	0.47172	.	0.136573	0.49916	D	0.000136	T	0.17195	0.0413	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.08432	-1.0722	7	0.27785	T	0.31	-12.9469	4.9509	0.14013	0.0:0.5715:0.1505:0.2781	.	.	.	.	I	129	ENSP00000388114:L129I	ENSP00000388114:L129I	L	+	1	0	BBS9	33364125	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.558000	0.23469	0.822000	0.34565	0.643000	0.83706	CTT		0.383	BBS9-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000329064.1			9	146	1	0	0.00448238	0.004482	0.00460385	9	146				
TRGC2	6967	broad.mit.edu	37	7	38279737	38279737	+	RNA	SNP	G	G	A	rs187511270		TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr7:38279737G>A	ENST00000436911.2	-	0	456							P03986	TRGC2_HUMAN	T cell receptor gamma constant 2						immune response (GO:0006955)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)										GTAATATGCAGAGGTGTTTGT	0.423													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19607	0.0		0.0	False		,,,				2504	0.0						uc003tfu.3		NA																	0					NA						c.(271-273)TCT>TTT		SubName: Full=TARP protein;							96.0	81.0	86.0					7																	38279737		1933	4090	6023			0							g.chr7:38279737G>A	M15002		7p14	2012-02-07			ENSG00000227191	ENSG00000227191		"""T cell receptors / TRG locus"""	12276	other	T cell receptor gene	"""T-cell receptor, gamma, constant region C2"""	615450		TCRGC2		3458221	Standard	NG_001336		Approved	TRGC2(2X), TRGC2(3X)		P03986	OTTHUMG00000155215		7.37:g.38279737G>A						uc003tfv.2_Missense_Mutation_p.S91F	p.S91F							5	507	-									Missense_Mutation	SNP	ENST00000436911.2	37	c.272C>T																																																																																					0.423	TRGC2-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	TR_C_gene	TR_C_gene	OTTHUMT00000338821.2	NG_001336		25	23	0	0	0	0.00632	0	25	23				
ABCA13	154664	broad.mit.edu	37	7	48266982	48266982	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr7:48266982G>T	ENST00000435803.1	+	6	616	c.592G>T	c.(592-594)Ggc>Tgc	p.G198C		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	198					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.G198C(1)|p.G143C(1)		breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TGTGGAAGATGGCATGGATGT	0.373																																							uc003toq.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|central_nervous_system(4)|skin(1)	10						c.(592-594)GGC>TGC		ATP binding cassette, sub-family A (ABC1),							119.0	115.0	116.0					7																	48266982		1882	4126	6008	SO:0001583	missense	154664				transport	integral to membrane	ATP binding|ATPase activity	g.chr7:48266982G>T	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.592G>T	7.37:g.48266982G>T	ENSP00000411096:p.Gly198Cys					ABCA13_uc003top.2_Missense_Mutation_p.G198C|ABCA13_uc010kyr.2_5'UTR	p.G198C	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN			6	617	+			198					K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	c.592G>T	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	G	14.48	2.548479	0.45383	.	.	ENSG00000179869	ENST00000435803	T	0.31769	1.48	5.21	-4.79	0.03200	.	1.113020	0.07114	N	0.842752	T	0.35068	0.0919	L	0.50333	1.59	0.09310	N	1	P;D	0.67145	0.832;0.996	B;P	0.59288	0.286;0.855	T	0.24905	-1.0147	10	0.38643	T	0.18	.	2.9265	0.05786	0.4862:0.115:0.2819:0.117	.	198;198	Q86UQ4;Q86UQ4-2	ABCAD_HUMAN;.	C	198	ENSP00000411096:G198C	ENSP00000409268:G198C	G	+	1	0	ABCA13	48237528	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.062000	0.14389	-1.607000	0.01589	-0.226000	0.12346	GGC		0.373	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701		51	57	1	0	4.98926e-31	0.01441	6.9776e-31	51	57				
FKBP9P1	360132	broad.mit.edu	37	7	55753014	55753014	+	RNA	SNP	C	C	G	rs185524994	byFrequency	TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr7:55753014C>G	ENST00000455909.1	-	0	549				RNU6-389P_ENST00000517048.1_RNA	NR_027340.1|NR_027342.1		Q75LS8	FKB9L_HUMAN							protein folding (GO:0006457)		calcium ion binding (GO:0005509)	p.G35R(1)		endometrium(1)|kidney(1)|lung(3)	5						ACGGCACTGCCGGGCACTTCT	0.602																																							uc010kzl.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(436-438)GGC>CGC		SubName: Full=cDNA, FLJ79189, highly similar to FK506-binding protein 9 (EC 5.2.1.8);							96.0	82.0	86.0					7																	55753014		692	1590	2282			360132							g.chr7:55753014C>G																													7.37:g.55753014C>G						FKBP9L_uc010kzk.2_Missense_Mutation_p.G35R|FKBP9L_uc003tqt.2_Missense_Mutation_p.G35R|FKBP9L_uc011kcs.1_Missense_Mutation_p.G35R	p.G146R	NR_003949						5	536	-								B2R7H1	Missense_Mutation	SNP	ENST00000455909.1	37	c.436G>C																																																																																					0.602	FKBP9L-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000251473.2			4	34	0	0	0	0.009096	0	4	34				
TRRAP	8295	broad.mit.edu	37	7	98563408	98563408	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr7:98563408G>T	ENST00000359863.4	+	48	7254	c.7045G>T	c.(7045-7047)Gcc>Tcc	p.A2349S	TRRAP_ENST00000446306.3_Missense_Mutation_p.A2331S|TRRAP_ENST00000355540.3_Missense_Mutation_p.A2331S	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	2349	Interaction with TP53.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			CTTCATCCAGGCCATCCTGAC	0.542																																							uc003upp.2		NA																	0				ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37						c.(7045-7047)GCC>TCC		transformation/transcription domain-associated							119.0	102.0	108.0					7																	98563408		2203	4300	6503	SO:0001583	missense	8295				histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity	g.chr7:98563408G>T	AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.7045G>T	7.37:g.98563408G>T	ENSP00000352925:p.Ala2349Ser					TRRAP_uc011kis.1_Missense_Mutation_p.A2331S|TRRAP_uc003upr.2_Missense_Mutation_p.A2048S	p.A2349S	NM_003496	NP_003487	Q9Y4A5	TRRAP_HUMAN	STAD - Stomach adenocarcinoma(171;0.215)		48	7254	+	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		2349			Interaction with TP53.		A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	ENST00000359863.4	37	c.7045G>T	CCDS59066.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.66|10.66	1.413760|1.413760	0.25465|0.25465	.|.	.|.	ENSG00000196367|ENSG00000196367	ENST00000359863;ENST00000355540;ENST00000446306|ENST00000456197	T;T|.	0.65549|.	-0.16;-0.16|.	6.02|6.02	4.21|4.21	0.49690|0.49690	Armadillo-like helical (1);|.	0.163532|.	0.56097|.	D|.	0.000038|.	T|T	0.28300|0.28300	0.0699|0.0699	N|N	0.08118|0.08118	0|0	0.32948|0.32948	D|D	0.519326|0.519326	B;B;B|.	0.12013|.	0.003;0.003;0.005|.	B;B;B|.	0.08055|.	0.003;0.002;0.002|.	T|T	0.36625|0.36625	-0.9740|-0.9740	10|5	0.07813|.	T|.	0.8|.	.|.	9.4337|9.4337	0.38626|0.38626	0.2161:0.0:0.7839:0.0|0.2161:0.0:0.7839:0.0	.|.	2331;2070;2349|.	Q9Y4A5-2;Q59FH1;Q9Y4A5|.	.;.;TRRAP_HUMAN|.	S|S	2349;2331;2330|2070	ENSP00000352925:A2349S;ENSP00000347733:A2331S|.	ENSP00000347733:A2331S|.	A|R	+|+	1|3	0|2	TRRAP|TRRAP	98401344|98401344	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	6.445000|6.445000	0.73456|0.73456	0.873000|0.873000	0.35799|0.35799	0.655000|0.655000	0.94253|0.94253	GCC|AGG		0.542	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317978.1	NM_003496		12	298	1	0	4.84862e-15	0.010729	5.98575e-15	12	298				
ACHE	43	broad.mit.edu	37	7	100490353	100490353	+	Silent	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr7:100490353G>A	ENST00000412389.1	-	2	1310	c.1155C>T	c.(1153-1155)atC>atT	p.I385I	ACHE_ENST00000411582.1_Silent_p.I385I|ACHE_ENST00000302913.4_Silent_p.I385I|ACHE_ENST00000419336.2_Intron|ACHE_ENST00000241069.5_Silent_p.I385I|ACHE_ENST00000428317.1_Silent_p.I385I			P22303	ACES_HUMAN	acetylcholinesterase (Yt blood group)	385					acetylcholine catabolic process (GO:0006581)|acetylcholine catabolic process in synaptic cleft (GO:0001507)|amyloid precursor protein metabolic process (GO:0042982)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|choline metabolic process (GO:0019695)|DNA replication (GO:0006260)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|negative regulation of synaptic transmission, cholinergic (GO:0032223)|nervous system development (GO:0007399)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter receptor biosynthetic process (GO:0045212)|osteoblast development (GO:0002076)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of protein secretion (GO:0050714)|protein tetramerization (GO:0051262)|receptor internalization (GO:0031623)|regulation of axonogenesis (GO:0050770)|regulation of dendrite morphogenesis (GO:0048814)|regulation of receptor recycling (GO:0001919)|response to wounding (GO:0009611)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|basal lamina (GO:0005605)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	acetylcholine binding (GO:0042166)|acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|cholinesterase activity (GO:0004104)|collagen binding (GO:0005518)|hydrolase activity (GO:0016787)|laminin binding (GO:0043236)|protein homodimerization activity (GO:0042803)|serine hydrolase activity (GO:0017171)	p.I385I(2)		large_intestine(3)|lung(7)|skin(3)|urinary_tract(3)	16	Lung NSC(181;0.041)|all_lung(186;0.0581)				Ambenonium(DB01122)|Choline(DB00122)|Decamethonium(DB01245)|Demecarium(DB00944)|Dipivefrin(DB00449)|Donepezil(DB00843)|Edrophonium(DB01010)|Ephedrine(DB01364)|Galantamine(DB00674)|Gallamine Triethiodide(DB00483)|Isoflurophate(DB00677)|Mefloquine(DB00358)|Minaprine(DB00805)|Neostigmine(DB01400)|Physostigmine(DB00981)|Pralidoxime(DB00733)|Pyridostigmine(DB00545)|Rivastigmine(DB00989)|Tubocurarine(DB01199)	CGGCCCGGCTGATGAGAGACT	0.622																																							uc003uxd.2		NA																	2	Substitution - coding silent(2)		lung(2)	skin(2)	2						c.(1153-1155)ATC>ATT		acetylcholinesterase isoform E4-E6 precursor	Ambenonium(DB01122)|Atropine(DB00572)|Choline(DB00122)|Decamethonium(DB01245)|Demecarium bromide(DB00944)|Donepezil(DB00843)|Edrophonium(DB01010)|Ephedrine(DB01364)|Galantamine(DB00674)|Gallamine Triethiodide(DB00483)|Isoflurophate(DB00677)|Neostigmine(DB01400)|Physostigmine(DB00981)|Pyridostigmine(DB00545)|Rivastigmine(DB00989)|Tacrine(DB00382)|Tubocurarine(DB01199)						24.0	26.0	26.0					7																	100490353		2203	4300	6503	SO:0001819	synonymous_variant	43				acetylcholine catabolic process in synaptic cleft|amyloid precursor protein metabolic process|cell adhesion|cell proliferation|choline metabolic process|DNA replication|muscle organ development|neurotransmitter biosynthetic process|osteoblast development|positive regulation of protein secretion|regulation of axonogenesis|regulation of dendrite morphogenesis|response to wounding|synapse assembly	anchored to membrane|axon|basal lamina|cell junction|cell surface|dendrite|endoplasmic reticulum lumen|extracellular space|Golgi apparatus|neuromuscular junction|nucleus|perinuclear region of cytoplasm|postsynaptic membrane|presynaptic membrane|synaptic cleft	acetylcholine binding|acetylcholinesterase activity|beta-amyloid binding|carboxylesterase activity|cholinesterase activity|collagen binding|laminin-1 binding|protein homodimerization activity|serine hydrolase activity	g.chr7:100490353G>A		CCDS5709.1, CCDS5710.1, CCDS64736.1	7q22	2014-07-19	2014-01-02		ENSG00000087085	ENSG00000087085	3.1.1.7	"""Blood group antigens"""	108	protein-coding gene	gene with protein product	"""Yt blood group"""	100740	"""acetylcholinesterase (YT blood group)"", ""acetylcholinesterase (Yt blood group)"", ""acetylcholinesterase"""	YT		1380483	Standard	XM_005250357		Approved		uc003uxe.3	P22303	OTTHUMG00000157033	ENST00000412389.1:c.1155C>T	7.37:g.100490353G>A						ACHE_uc003uxe.2_Silent_p.I385I|ACHE_uc003uxf.2_Silent_p.I385I|ACHE_uc003uxg.2_Silent_p.I385I|ACHE_uc003uxh.2_Intron|ACHE_uc003uxi.2_Silent_p.I385I	p.I385I	NM_000665	NP_000656	P22303	ACES_HUMAN			2	1311	-	Lung NSC(181;0.041)|all_lung(186;0.0581)		385					A4D2E2|B7ZKZ0|D6W5X7|Q16169|Q29S23|Q2M324|Q504V3|Q53F46|Q86TM9|Q86YX9|Q9BXP7	Silent	SNP	ENST00000412389.1	37	c.1155C>T	CCDS5709.1																																																																																				0.622	ACHE-013	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347201.1	NM_015831		46	90	0	0	0	0.01441	0	46	90				
DNAJC2	27000	broad.mit.edu	37	7	102968127	102968127	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr7:102968127C>G	ENST00000379263.3	-	4	656	c.406G>C	c.(406-408)Gac>Cac	p.D136H	DNAJC2_ENST00000249270.7_Missense_Mutation_p.D136H|PMPCB_ENST00000420236.2_Intron	NM_014377.1	NP_055192.1	Q99543	DNJC2_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 2	136	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				'de novo' cotranslational protein folding (GO:0051083)|chromatin modification (GO:0016568)|DNA replication (GO:0006260)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA biosynthetic process (GO:2000279)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone binding (GO:0042393)|Hsp70 protein binding (GO:0030544)|poly(A) RNA binding (GO:0044822)|ubiquitin binding (GO:0043130)	p.D136H(2)		endometrium(1)|kidney(9)|large_intestine(6)|lung(4)|ovary(1)	21						GTGAAGTAGTCATTATCTCCT	0.333																																							uc003vbo.2		NA																	2	Substitution - Missense(2)		lung(2)	kidney(1)	1						c.(406-408)GAC>CAC		DnaJ (Hsp40) homolog, subfamily C, member 2							157.0	147.0	150.0					7																	102968127		1827	4083	5910	SO:0001583	missense	27000				'de novo' cotranslational protein folding|chromatin modification|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nuclear membrane	chromatin binding|DNA binding|histone binding|Hsp70 protein binding|ubiquitin binding	g.chr7:102968127C>G	X98260	CCDS43628.1, CCDS47679.1	7q22-q32	2011-09-02	2008-07-01	2008-07-01	ENSG00000105821	ENSG00000105821		"""Heat shock proteins / DNAJ (HSP40)"""	13192	protein-coding gene	gene with protein product		605502	"""zuotin related factor 1"""	ZRF1		8885239	Standard	NM_001129887		Approved	MPP11, MPHOSPH11, ZUO1, zuotin	uc003vbo.3	Q99543	OTTHUMG00000157202	ENST00000379263.3:c.406G>C	7.37:g.102968127C>G	ENSP00000368565:p.Asp136His					PMPCB_uc011kll.1_Intron|DNAJC2_uc003vbn.2_5'UTR|DNAJC2_uc010lix.2_Missense_Mutation_p.D136H|DNAJC2_uc003vbp.2_5'UTR|DNAJC2_uc003vbq.1_RNA	p.D136H	NM_014377	NP_055192	Q99543	DNJC2_HUMAN			4	657	-			136			J.		A4VCI0|Q9BVX1	Missense_Mutation	SNP	ENST00000379263.3	37	c.406G>C	CCDS43628.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.6|24.6	4.553617|4.553617	0.86231|0.86231	.|.	.|.	ENSG00000105821|ENSG00000105821	ENST00000249270;ENST00000379263;ENST00000537811;ENST00000454277|ENST00000426036	T;T;T|.	0.29397|.	1.57;1.57;1.57|.	5.12|5.12	5.12|5.12	0.69794|0.69794	Heat shock protein DnaJ, N-terminal (5);|.	0.097095|.	0.64402|.	D|.	0.000001|.	T|T	0.68723|0.68723	0.3032|0.3032	L|L	0.46741|0.46741	1.465|1.465	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	0.998;1.0|.	D;D|.	0.91635|.	0.952;0.999|.	T|T	0.64668|0.64668	-0.6353|-0.6353	10|5	0.59425|.	D|.	0.04|.	-29.2206|-29.2206	18.7485|18.7485	0.91804|0.91804	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	136;136|.	Q99543-2;Q99543|.	.;DNJC2_HUMAN|.	H|I	136;136;136;62|124	ENSP00000249270:D136H;ENSP00000368565:D136H;ENSP00000399058:D62H|.	ENSP00000249270:D136H|.	D|M	-|-	1|3	0|0	DNAJC2|DNAJC2	102755363|102755363	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	6.961000|6.961000	0.76042|0.76042	2.655000|2.655000	0.90218|0.90218	0.462000|0.462000	0.41574|0.41574	GAC|ATG		0.333	DNAJC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347891.1			21	331	0	0	0	0.010504	0	21	331				
WNT2	7472	broad.mit.edu	37	7	116937675	116937675	+	Silent	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr7:116937675G>T	ENST00000265441.3	-	4	1143	c.844C>A	c.(844-846)Cga>Aga	p.R282R		NM_003391.2	NP_003382.1	P09544	WNT2_HUMAN	wingless-type MMTV integration site family member 2	282					atrial cardiac muscle tissue morphogenesis (GO:0055009)|canonical Wnt signaling pathway (GO:0060070)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|iris morphogenesis (GO:0061072)|labyrinthine layer blood vessel development (GO:0060716)|lens development in camera-type eye (GO:0002088)|lung development (GO:0030324)|lung induction (GO:0060492)|mammary gland epithelium development (GO:0061180)|neuron differentiation (GO:0030182)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)	p.R282R(1)		breast(2)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|liver(1)|lung(13)|ovary(3)|prostate(1)|skin(2)	31	all_epithelial(6;2.24e-06)|Lung NSC(10;0.000936)|all_lung(10;0.00109)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		CCTGCCTCTCGGTCCCTGATA	0.403																																							uc003viz.2		NA																	1	Substitution - coding silent(1)		lung(1)	breast(2)|central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	7						c.(844-846)CGA>AGA		wingless-type MMTV integration site family							100.0	100.0	100.0					7																	116937675		2203	4300	6503	SO:0001819	synonymous_variant	7472				atrial cardiac muscle tissue morphogenesis|canonical Wnt receptor signaling pathway|cardiac epithelial to mesenchymal transition|cellular response to retinoic acid|cellular response to transforming growth factor beta stimulus|dorsal/ventral axis specification|iris morphogenesis|labyrinthine layer blood vessel development|lens development in camera-type eye|lung induction|mammary gland epithelium development|neuron differentiation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of fibroblast proliferation|positive regulation of mesenchymal cell proliferation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|Wnt receptor signaling pathway, calcium modulating pathway	cytoplasm|extracellular space|proteinaceous extracellular matrix	cytokine activity|frizzled binding|frizzled-2 binding|signal transducer activity	g.chr7:116937675G>T	X07876	CCDS5771.1	7q31	2013-02-28			ENSG00000105989	ENSG00000105989		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12780	protein-coding gene	gene with protein product	"""secreted growth factor"""	147870		INT1L1		2971536	Standard	NM_003391		Approved	IRP	uc003viz.3	P09544	OTTHUMG00000023428	ENST00000265441.3:c.844C>A	7.37:g.116937675G>T						WNT2_uc003vja.2_Silent_p.R186R	p.R282R	NM_003391	NP_003382	P09544	WNT2_HUMAN	STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)	4	1144	-	all_epithelial(6;2.24e-06)|Lung NSC(10;0.000936)|all_lung(10;0.00109)		282					A4D0V1|Q75N05|Q9UDP9	Silent	SNP	ENST00000265441.3	37	c.844C>A	CCDS5771.1																																																																																				0.403	WNT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059749.3	NM_003391		68	42	1	0	1.86864e-30	0.01441	2.5942e-30	68	42				
FEZF1	389549	broad.mit.edu	37	7	121943805	121943805	+	Nonsense_Mutation	SNP	G	G	T	rs533225178		TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr7:121943805G>T	ENST00000442488.2	-	1	754	c.687C>A	c.(685-687)taC>taA	p.Y229*	FEZF1-AS1_ENST00000428449.1_RNA|FEZF1-AS1_ENST00000437317.1_RNA|FEZF1_ENST00000427185.2_Nonsense_Mutation_p.Y179*|FEZF1_ENST00000331178.4_Nonsense_Mutation_p.Y229*	NM_001024613.2|NM_001160264.1	NP_001019784.2|NP_001153736.1	A0PJY2	FEZF1_HUMAN	FEZ family zinc finger 1	229					axon guidance (GO:0007411)|forebrain anterior/posterior pattern specification (GO:0021797)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)	p.Y229*(1)		breast(1)|large_intestine(3)|lung(18)|ovary(2)|prostate(1)	25						TTTCTTTCATGTAATGCTGCA	0.502																																							uc003vkd.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|breast(1)	3						c.(685-687)TAC>TAA		FEZ family zinc finger 1 isoform 1							84.0	91.0	88.0					7																	121943805		2203	4300	6503	SO:0001587	stop_gained	389549				cell differentiation|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:121943805G>T	AY726588	CCDS34741.1, CCDS34741.2, CCDS55157.1	7q31.32	2013-01-08	2006-08-15	2006-08-15	ENSG00000128610	ENSG00000128610		"""Zinc fingers, C2H2-type"""	22788	protein-coding gene	gene with protein product		613301	"""zinc finger protein 312B"""	ZNF312B			Standard	NM_001024613		Approved		uc003vkd.3	A0PJY2	OTTHUMG00000157091	ENST00000442488.2:c.687C>A	7.37:g.121943805G>T	ENSP00000411145:p.Tyr229*					FEZF1_uc003vkc.2_Nonsense_Mutation_p.Y179*|uc010lko.1_RNA|uc003vkf.1_5'Flank	p.Y229*	NM_001024613	NP_001019784	A0PJY2	FEZF1_HUMAN			1	761	-			229					A0PJY3|A4D0W3|B4DUP9|B7ZM98	Nonsense_Mutation	SNP	ENST00000442488.2	37	c.687C>A	CCDS34741.2	.	.	.	.	.	.	.	.	.	.	g	25.5	4.646868	0.87958	.	.	ENSG00000128610	ENST00000442488;ENST00000331178;ENST00000427185	.	.	.	5.24	-0.544	0.11847	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-30.6152	7.0018	0.24813	0.257:0.0:0.6368:0.1062	.	.	.	.	X	229;229;179	.	ENSP00000332777:Y229X	Y	-	3	2	FEZF1	121731041	1.000000	0.71417	0.984000	0.44739	0.985000	0.73830	1.719000	0.38011	-0.085000	0.12573	-0.226000	0.12346	TAC		0.502	FEZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347410.1	NM_001024613		93	54	1	0	5.70515e-31	0.01441	7.94945e-31	93	54				
AKR1B15	441282	broad.mit.edu	37	7	134253052	134253052	+	Missense_Mutation	SNP	G	G	T	rs200408342		TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr7:134253052G>T	ENST00000457545.2	+	4	553	c.293G>T	c.(292-294)cGg>cTg	p.R98L	AKR1B15_ENST00000423958.1_Missense_Mutation_p.R70L	NM_001080538.2	NP_001074007.2	C9JRZ8	AK1BF_HUMAN	aldo-keto reductase family 1, member B15	98							oxidoreductase activity (GO:0016491)	p.R70L(2)|p.R98L(1)		endometrium(1)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|urinary_tract(1)	18						GCTGTGATGCGGGAGGACCTG	0.517																																							uc011kpr.1		NA																	3	Substitution - Missense(3)		lung(3)	ovary(1)	1						c.(292-294)CGG>CTG		aldo-keto reductase family 1, member B15							180.0	182.0	181.0					7																	134253052		2203	4300	6503	SO:0001583	missense	441282						oxidoreductase activity	g.chr7:134253052G>T		CCDS47715.1, CCDS47715.2	7q33	2009-09-09			ENSG00000227471	ENSG00000227471		"""Aldo-keto reductases"""	37281	protein-coding gene	gene with protein product							Standard	NM_001080538		Approved		uc011kpr.2	C9JRZ8	OTTHUMG00000155376	ENST00000457545.2:c.293G>T	7.37:g.134253052G>T	ENSP00000389289:p.Arg98Leu					AKR1B15_uc003vrt.2_Missense_Mutation_p.R70L|AKR1B15_uc011kps.1_Missense_Mutation_p.R70L	p.R98L	NM_001080538	NP_001074007	C9JRZ8	AK1BF_HUMAN			4	592	+			98					C9J3V2	Missense_Mutation	SNP	ENST00000457545.2	37	c.293G>T	CCDS47715.2	.	.	.	.	.	.	.	.	.	.	-	16.99	3.274271	0.59649	.	.	ENSG00000227471	ENST00000457545;ENST00000423958	T;T	0.36157	1.27;1.27	2.72	2.72	0.32119	NADP-dependent oxidoreductase domain (3);	.	.	.	.	T	0.73745	0.3626	H	0.99582	4.64	0.54753	D	0.99998	D;D;D	0.89917	0.998;1.0;0.999	D;D;D	0.73380	0.951;0.98;0.977	T	0.83164	-0.0097	9	0.87932	D	0	.	11.2294	0.48903	0.0:0.0:1.0:0.0	.	70;98;70	C9JRZ8-2;C9JRZ8;A4D1P0	.;AK1BF_HUMAN;.	L	98;70	ENSP00000389289:R98L;ENSP00000397009:R70L	ENSP00000397009:R70L	R	+	2	0	AKR1B15	133903592	0.999000	0.42202	0.983000	0.44433	0.447000	0.32167	4.992000	0.63889	1.516000	0.48900	0.508000	0.49915	CGG		0.517	AKR1B15-001	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000339726.2			86	56	1	0	9.62396e-42	0.01441	1.37641e-41	86	56				
CUL1	8454	broad.mit.edu	37	7	148497615	148497615	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr7:148497615G>C	ENST00000325222.4	+	22	2551	c.2272G>C	c.(2272-2274)Gag>Cag	p.E758Q	CUL1_ENST00000602748.1_Missense_Mutation_p.E758Q|CUL1_ENST00000409469.1_Missense_Mutation_p.E758Q	NM_003592.2	NP_003583.2	Q13616	CUL1_HUMAN	cullin 1	758					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic cell cycle (GO:0000278)|negative regulation of cell proliferation (GO:0008285)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|viral process (GO:0016032)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|SCF ubiquitin ligase complex (GO:0019005)		p.E758Q(1)		breast(2)|central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(10)|liver(2)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	40	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			CATTCTAATTGAGAAAGAATA	0.408																																							uc010lpg.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)	1						c.(2272-2274)GAG>CAG		cullin 1							101.0	94.0	96.0					7																	148497615		2203	4300	6503	SO:0001583	missense	8454				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell cycle arrest|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein ubiquitination|S phase of mitotic cell cycle|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	cytosol|nucleoplasm|SCF ubiquitin ligase complex	ubiquitin protein ligase binding	g.chr7:148497615G>C	U58087	CCDS34772.1	7q36.1	2011-05-24			ENSG00000055130	ENSG00000055130			2551	protein-coding gene	gene with protein product		603134				8681378	Standard	NM_003592		Approved		uc003wey.3	Q13616	OTTHUMG00000152776	ENST00000325222.4:c.2272G>C	7.37:g.148497615G>C	ENSP00000326804:p.Glu758Gln					CUL1_uc003wey.2_Missense_Mutation_p.E758Q|CUL1_uc003wez.2_Missense_Mutation_p.E648Q|CUL1_uc003wfa.2_Missense_Mutation_p.E419Q	p.E758Q	NM_003592	NP_003583	Q13616	CUL1_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00291)		22	2798	+	Melanoma(164;0.15)		758					D3DWG3|O60719|Q08AL6|Q8IYW1	Missense_Mutation	SNP	ENST00000325222.4	37	c.2272G>C	CCDS34772.1	.	.	.	.	.	.	.	.	.	.	.	29.0	4.967495	0.92855	.	.	ENSG00000055130	ENST00000409469;ENST00000325222;ENST00000433865	T;T	0.80214	-1.35;-1.35	5.48	5.48	0.80851	Cullin protein, neddylation domain (2);Winged helix-turn-helix transcription repressor DNA-binding (1);Cullin, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.91901	0.7436	M	0.89840	3.065	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.985;0.995	D	0.93169	0.6564	10	0.87932	D	0	1.0104	19.3349	0.94312	0.0:0.0:1.0:0.0	.	685;758	E7EWR0;Q13616	.;CUL1_HUMAN	Q	758;758;685	ENSP00000387160:E758Q;ENSP00000326804:E758Q	ENSP00000326804:E758Q	E	+	1	0	CUL1	148128548	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	9.466000	0.97665	2.575000	0.86900	0.467000	0.42956	GAG		0.408	CUL1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467785.1	NM_003592		24	91	0	0	0	0.004656	0	24	91				
CSMD1	64478	broad.mit.edu	37	8	3063038	3063038	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr8:3063038G>T	ENST00000520002.1	-	32	5530	c.4975C>A	c.(4975-4977)Cca>Aca	p.P1659T	CSMD1_ENST00000539096.1_Missense_Mutation_p.P1658T|CSMD1_ENST00000542608.1_Missense_Mutation_p.P1658T|CSMD1_ENST00000602557.1_Missense_Mutation_p.P1659T|CSMD1_ENST00000400186.3_Missense_Mutation_p.P1659T|CSMD1_ENST00000602723.1_Missense_Mutation_p.P1659T|CSMD1_ENST00000537824.1_Missense_Mutation_p.P1658T|CSMD1_ENST00000523387.1_5'UTR			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1659	CUB 10. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)		p.P1658T(1)|p.P1387T(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		AATTCCTTTGGTACCGTGATG	0.393																																							uc011kwk.1		NA																	2	Substitution - Missense(2)		lung(2)	breast(20)|large_intestine(5)	25						c.(4975-4977)CCA>ACA		CUB and Sushi multiple domains 1 precursor							70.0	68.0	69.0					8																	3063038		1845	4088	5933	SO:0001583	missense	64478					integral to membrane		g.chr8:3063038G>T			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.4975C>A	8.37:g.3063038G>T	ENSP00000430733:p.Pro1659Thr					CSMD1_uc011kwj.1_Missense_Mutation_p.P1051T|CSMD1_uc003wqe.2_Missense_Mutation_p.P815T	p.P1659T	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)	31	5365	-		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)	1659			Extracellular (Potential).|CUB 10.		Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37	c.4975C>A		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.14|12.14	1.848310|1.848310	0.32699|0.32699	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096|ENST00000335551	T;T;T;T;T|.	0.63255|.	-0.03;-0.03;-0.03;-0.03;-0.03|.	5.28|5.28	5.28|5.28	0.74379|0.74379	CUB (5);|.	0.155272|.	0.44688|.	N|.	0.000428|.	T|T	0.76307|0.76307	0.3969|0.3969	M|M	0.73217|0.73217	2.22|2.22	0.51012|0.51012	D|D	0.999906|0.999906	D;D;P|.	0.89917|.	1.0;0.959;0.725|.	D;P;P|.	0.91635|.	0.999;0.833;0.687|.	T|T	0.75363|0.75363	-0.3344|-0.3344	10|5	0.72032|.	D|.	0.01|.	.|.	19.2736|19.2736	0.94021|0.94021	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1659;1659;1659|.	E5RIG2;Q96PZ7;Q96PZ7-4|.	.;CSMD1_HUMAN;.|.	T|N	1659;1659;1521;1658;1658;1658|1138	ENSP00000383047:P1659T;ENSP00000430733:P1659T;ENSP00000441462:P1658T;ENSP00000446243:P1658T;ENSP00000441675:P1658T|.	ENSP00000320445:P1521T|.	P|T	-|-	1|2	0|0	CSMD1|CSMD1	3050445|3050445	1.000000|1.000000	0.71417|0.71417	0.963000|0.963000	0.40424|0.40424	0.327000|0.327000	0.28475|0.28475	5.784000|5.784000	0.68990|0.68990	2.617000|2.617000	0.88574|0.88574	0.655000|0.655000	0.94253|0.94253	CCA|ACC		0.393	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225		4	2	1	0	0.00909568	0.009096	0.00929181	4	2				
DLC1	10395	broad.mit.edu	37	8	12957250	12957250	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr8:12957250G>A	ENST00000276297.4	-	9	3005	c.2596C>T	c.(2596-2598)Cgc>Tgc	p.R866C	DLC1_ENST00000512044.2_Missense_Mutation_p.R463C|DLC1_ENST00000358919.2_Missense_Mutation_p.R429C|DLC1_ENST00000520226.1_Missense_Mutation_p.R355C	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein	866	Focal adhesion-targeting (FAT).				actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)	p.R866C(1)		NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						GAAGAATTGCGTCTCTTCAGT	0.587																																							uc003wwm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|pancreas(2)|lung(1)|kidney(1)	7						c.(2596-2598)CGC>TGC		deleted in liver cancer 1 isoform 1							72.0	62.0	66.0					8																	12957250		2203	4300	6503	SO:0001583	missense	10395				actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding	g.chr8:12957250G>A	AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.2596C>T	8.37:g.12957250G>A	ENSP00000276297:p.Arg866Cys					DLC1_uc003wwk.1_Missense_Mutation_p.R429C|DLC1_uc003wwl.1_Missense_Mutation_p.R463C|DLC1_uc011kxx.1_Missense_Mutation_p.R355C	p.R866C	NM_182643	NP_872584	Q96QB1	RHG07_HUMAN			9	3040	-			866					B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Missense_Mutation	SNP	ENST00000276297.4	37	c.2596C>T	CCDS5989.1	.	.	.	.	.	.	.	.	.	.	G	13.04	2.117492	0.37339	.	.	ENSG00000164741	ENST00000276297;ENST00000358919;ENST00000512044;ENST00000520226	T;T;T;T	0.07327	3.45;3.21;3.2;3.2	5.57	5.57	0.84162	.	0.185362	0.46442	D	0.000283	T	0.19366	0.0465	M	0.78637	2.42	0.80722	D	1	P;P;D	0.64830	0.812;0.918;0.994	B;B;P	0.46049	0.075;0.39;0.502	T	0.01024	-1.1477	10	0.46703	T	0.11	.	19.9445	0.97177	0.0:0.0:1.0:0.0	.	866;463;429	Q96QB1;E9PDZ8;Q96QB1-1	RHG07_HUMAN;.;.	C	866;429;463;355	ENSP00000276297:R866C;ENSP00000351797:R429C;ENSP00000422595:R463C;ENSP00000428028:R355C	ENSP00000276297:R866C	R	-	1	0	DLC1	13001621	1.000000	0.71417	0.966000	0.40874	0.416000	0.31233	5.317000	0.65822	2.797000	0.96272	0.655000	0.94253	CGC		0.587	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207632.2	NM_182643, NM_006094		17	13	0	0	0	0.008871	0	17	13				
DOCK5	80005	broad.mit.edu	37	8	25182907	25182907	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr8:25182907A>G	ENST00000276440.7	+	18	1791	c.1747A>G	c.(1747-1749)Aaa>Gaa	p.K583E		NM_024940.6	NP_079216.4	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	583	DHR-1.				positive regulation of GTPase activity (GO:0043547)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.K583E(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(9)|large_intestine(13)|lung(20)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		GGAAGATGCTAAATTCTACCT	0.403																																					Pancreas(145;34 1887 3271 10937 30165)	Pancreas(145;34 1887 3271 10937 30165)	uc003xeg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(1747-1749)AAA>GAA		dedicator of cytokinesis 5							112.0	112.0	112.0					8																	25182907		2203	4300	6503	SO:0001583	missense	80005					cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity	g.chr8:25182907A>G		CCDS6047.1	8p21.2	2009-04-17			ENSG00000147459	ENSG00000147459			23476	protein-coding gene	gene with protein product						12432077	Standard	NM_024940		Approved	FLJ21034	uc003xeg.3	Q9H7D0	OTTHUMG00000131991	ENST00000276440.7:c.1747A>G	8.37:g.25182907A>G	ENSP00000276440:p.Lys583Glu					DOCK5_uc010luf.1_RNA|DOCK5_uc003xeh.1_Missense_Mutation_p.K297E|DOCK5_uc003xei.2_Missense_Mutation_p.K153E|DOCK5_uc003xej.2_RNA	p.K583E	NM_024940	NP_079216	Q9H7D0	DOCK5_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)	18	1884	+		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)	583			DHR-1.		B2RNY0|Q5XKD5|Q6AI11|Q6PJS6|Q6ZTS6	Missense_Mutation	SNP	ENST00000276440.7	37	c.1747A>G	CCDS6047.1	.	.	.	.	.	.	.	.	.	.	A	16.72	3.201366	0.58234	.	.	ENSG00000147459	ENST00000276440	T	0.14266	2.52	5.8	5.8	0.92144	.	0.049080	0.85682	D	0.000000	T	0.13543	0.0328	L	0.32530	0.975	0.58432	D	0.999997	P;B;P	0.42993	0.797;0.03;0.797	B;B;B	0.43082	0.407;0.063;0.407	T	0.11767	-1.0574	10	0.12766	T	0.61	.	16.1596	0.81693	1.0:0.0:0.0:0.0	.	573;358;583	D3DSS6;Q68DL4;Q9H7D0	.;.;DOCK5_HUMAN	E	583	ENSP00000276440:K583E	ENSP00000276440:K583E	K	+	1	0	DOCK5	25238824	1.000000	0.71417	0.997000	0.53966	0.991000	0.79684	7.383000	0.79741	2.216000	0.71823	0.533000	0.62120	AAA		0.403	DOCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254955.2	NM_024940		46	32	0	0	0	0.01441	0	46	32				
TEX15	56154	broad.mit.edu	37	8	30705190	30705190	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr8:30705190T>A	ENST00000256246.2	-	1	1418	c.1344A>T	c.(1342-1344)gaA>gaT	p.E448D	TEX15_ENST00000523186.1_5'Flank	NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	448					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)			p.E448D(1)		NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		GACCCCTATCTTCAACATAAG	0.328																																							uc003xil.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7						c.(1342-1344)GAA>GAT		testis expressed 15							172.0	172.0	172.0					8																	30705190		2203	4300	6503	SO:0001583	missense	56154							g.chr8:30705190T>A	AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.1344A>T	8.37:g.30705190T>A	ENSP00000256246:p.Glu448Asp						p.E448D	NM_031271	NP_112561	Q9BXT5	TEX15_HUMAN		KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)	1	1344	-			448						Missense_Mutation	SNP	ENST00000256246.2	37	c.1344A>T	CCDS6080.1	.	.	.	.	.	.	.	.	.	.	T	7.933	0.741104	0.15642	.	.	ENSG00000133863	ENST00000256246	T	0.10860	2.83	5.51	-3.85	0.04243	.	0.916693	0.09263	N	0.826176	T	0.04227	0.0117	N	0.03608	-0.345	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.41787	-0.9489	10	0.87932	D	0	.	7.0731	0.25189	0.2662:0.0:0.4271:0.3067	.	448	Q9BXT5	TEX15_HUMAN	D	448	ENSP00000256246:E448D	ENSP00000256246:E448D	E	-	3	2	TEX15	30824732	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.169000	0.09911	-0.398000	0.07679	0.477000	0.44152	GAA		0.328	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376193.1			99	85	0	0	0	0.01441	0	99	85				
HTRA4	203100	broad.mit.edu	37	8	38831817	38831817	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr8:38831817G>T	ENST00000302495.4	+	1	135	c.35G>T	c.(34-36)gGa>gTa	p.G12V	CTD-2544N14.3_ENST00000520863.1_RNA	NM_153692.3	NP_710159.1	P83105	HTRA4_HUMAN	HtrA serine peptidase 4	12					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)	p.G12V(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(7)|upper_aerodigestive_tract(1)	11		all_lung(54;0.0344)|Hepatocellular(245;0.0512)|Lung NSC(58;0.0955)	LUSC - Lung squamous cell carcinoma(45;1.5e-07)			GCGGGGCTGGGACGATGCCTC	0.627																																							uc003xmj.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(34-36)GGA>GTA		HtrA serine peptidase 4 precursor							30.0	27.0	28.0					8																	38831817		2200	4296	6496	SO:0001583	missense	203100				proteolysis|regulation of cell growth	extracellular region	insulin-like growth factor binding|serine-type endopeptidase activity	g.chr8:38831817G>T	AK075205	CCDS6110.1	8p11.23	2008-02-05			ENSG00000169495	ENSG00000169495			26909	protein-coding gene	gene with protein product		610700					Standard	NM_153692		Approved	FLJ90724	uc003xmj.3	P83105	OTTHUMG00000164070	ENST00000302495.4:c.35G>T	8.37:g.38831817G>T	ENSP00000305919:p.Gly12Val						p.G12V	NM_153692	NP_710159	P83105	HTRA4_HUMAN	LUSC - Lung squamous cell carcinoma(45;1.5e-07)		1	150	+		all_lung(54;0.0344)|Hepatocellular(245;0.0512)|Lung NSC(58;0.0955)	12					Q542Z4|Q6PF13	Missense_Mutation	SNP	ENST00000302495.4	37	c.35G>T	CCDS6110.1	.	.	.	.	.	.	.	.	.	.	G	12.81	2.048727	0.36181	.	.	ENSG00000169495	ENST00000302495	D	0.84516	-1.86	4.02	3.12	0.35913	.	1.238380	0.06133	N	0.671119	T	0.81527	0.4841	L	0.47716	1.5	0.09310	N	0.999999	P	0.40875	0.731	B	0.36719	0.231	T	0.69386	-0.5159	10	0.62326	D	0.03	0.0109	10.607	0.45400	0.0:0.2059:0.7941:0.0	.	12	P83105	HTRA4_HUMAN	V	12	ENSP00000305919:G12V	ENSP00000305919:G12V	G	+	2	0	HTRA4	38950974	0.002000	0.14202	0.001000	0.08648	0.013000	0.08279	1.165000	0.31822	0.872000	0.35775	0.655000	0.94253	GGA		0.627	HTRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377077.1	NM_153692		7	5	1	0	0.000157383	0.00308	0.000165231	7	5				
SNTG1	54212	broad.mit.edu	37	8	51449322	51449322	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr8:51449322C>T	ENST00000522124.1	+	11	1295	c.634C>T	c.(634-636)Ctt>Ttt	p.L212F	SNTG1_ENST00000276467.5_Missense_Mutation_p.L212F|SNTG1_ENST00000517473.1_Missense_Mutation_p.L212F|SNTG1_ENST00000518864.1_Missense_Mutation_p.L212F	NM_018967.2	NP_061840.1	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1	212					cell communication (GO:0007154)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)|syntrophin complex (GO:0016013)	protein C-terminus binding (GO:0008022)	p.L212F(2)		NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(36)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	66		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				GATCCCTCTACTTCATTCGCG	0.483																																							uc010lxy.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)	5						c.(634-636)CTT>TTT		syntrophin, gamma 1							218.0	193.0	202.0					8																	51449322		2203	4300	6503	SO:0001583	missense	54212				cell communication	cytoplasm|cytoskeleton|nucleus|ruffle membrane|syntrophin complex	actin binding|protein C-terminus binding	g.chr8:51449322C>T	AJ003030	CCDS6147.1, CCDS75737.1	8q11-q12	2008-07-03				ENSG00000147481			13740	protein-coding gene	gene with protein product		608714				10747910	Standard	NM_018967		Approved	SYN4, G1SYN	uc003xqs.1	Q9NSN8		ENST00000522124.1:c.634C>T	8.37:g.51449322C>T	ENSP00000429842:p.Leu212Phe					SNTG1_uc003xqs.1_Missense_Mutation_p.L212F|SNTG1_uc010lxz.1_Missense_Mutation_p.L212F|SNTG1_uc011ldl.1_RNA	p.L212F	NM_018967	NP_061840	Q9NSN8	SNTG1_HUMAN			12	1005	+		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)	212					Q2M3Q0|Q9NY98	Missense_Mutation	SNP	ENST00000522124.1	37	c.634C>T	CCDS6147.1	.	.	.	.	.	.	.	.	.	.	C	11.08	1.534714	0.27475	.	.	ENSG00000147481	ENST00000518864;ENST00000522124;ENST00000517473;ENST00000276467	T;T;T;T	0.55413	0.52;0.52;0.52;0.52	4.91	4.91	0.64330	Pleckstrin homology domain (1);	0.000000	0.85682	D	0.000000	T	0.66346	0.2780	L	0.45581	1.43	0.80722	D	1	P;D	0.65815	0.513;0.995	B;D	0.72982	0.286;0.979	T	0.67389	-0.5683	10	0.51188	T	0.08	.	16.6713	0.85267	0.0:1.0:0.0:0.0	.	212;212	Q9NSN8-2;Q9NSN8	.;SNTG1_HUMAN	F	212	ENSP00000429276:L212F;ENSP00000429842:L212F;ENSP00000431123:L212F;ENSP00000276467:L212F	ENSP00000276467:L212F	L	+	1	0	SNTG1	51611875	1.000000	0.71417	0.127000	0.21898	0.083000	0.17756	3.706000	0.54830	2.281000	0.76405	0.491000	0.48974	CTT		0.483	SNTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377964.1			146	121	0	0	0	0.01441	0	146	121				
LY96	23643	broad.mit.edu	37	8	74903787	74903787	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr8:74903787G>T	ENST00000284818.2	+	1	201	c.110G>T	c.(109-111)tGt>tTt	p.C37F	LY96_ENST00000518893.1_Missense_Mutation_p.C37F	NM_015364.4	NP_056179	Q9Y6Y9	LY96_HUMAN	lymphocyte antigen 96	37					cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|response to lipopolysaccharide (GO:0032496)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	endosome membrane (GO:0010008)|extracellular region (GO:0005576)|lipopolysaccharide receptor complex (GO:0046696)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)|lipopolysaccharide receptor activity (GO:0001875)	p.C37F(1)		endometrium(1)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	5	Breast(64;0.0311)		Epithelial(68;0.0208)|BRCA - Breast invasive adenocarcinoma(89;0.0499)|all cancers(69;0.0619)			TACACCTACTGTGGTAAGTAA	0.393																																					GBM(131;1357 1748 34893 50149 52212)	GBM(131;1357 1748 34893 50149 52212)	uc003yad.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(109-111)TGT>TTT		MD-2 protein precursor							153.0	142.0	145.0					8																	74903787		2203	4300	6503	SO:0001583	missense	23643				cellular defense response|detection of lipopolysaccharide|I-kappaB kinase/NF-kappaB cascade|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	extracellular space|lipopolysaccharide receptor complex|plasma membrane	coreceptor activity|lipopolysaccharide receptor activity|protein binding	g.chr8:74903787G>T	AB018549	CCDS6216.1, CCDS56540.1	8q13.3	2004-01-22			ENSG00000154589	ENSG00000154589			17156	protein-coding gene	gene with protein product		605243				10359581, 11466383	Standard	NM_015364		Approved	MD-2	uc003yad.3	Q9Y6Y9	OTTHUMG00000164504	ENST00000284818.2:c.110G>T	8.37:g.74903787G>T	ENSP00000284818:p.Cys37Phe						p.C37F	NM_015364	NP_056179	Q9Y6Y9	LY96_HUMAN	Epithelial(68;0.0208)|BRCA - Breast invasive adenocarcinoma(89;0.0499)|all cancers(69;0.0619)		1	201	+	Breast(64;0.0311)		37					B3Y6A5|E5RJJ7	Missense_Mutation	SNP	ENST00000284818.2	37	c.110G>T	CCDS6216.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.020389	0.75275	.	.	ENSG00000154589	ENST00000284818;ENST00000518893	D;T	0.97430	-4.38;-0.88	5.25	5.25	0.73442	MD-2-related lipid-recognition (2);Immunoglobulin E-set (1);	0.000000	0.64402	D	0.000002	D	0.98369	0.9458	M	0.80028	2.48	0.58432	D	0.999993	D	0.89917	1.0	D	0.97110	1.0	D	0.99153	1.0859	10	0.87932	D	0	.	16.7681	0.85528	0.0:0.0:1.0:0.0	.	37	Q9Y6Y9	LY96_HUMAN	F	37	ENSP00000284818:C37F;ENSP00000430533:C37F	ENSP00000284818:C37F	C	+	2	0	LY96	75066341	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.175000	0.65021	2.719000	0.93026	0.655000	0.94253	TGT		0.393	LY96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379032.2	NM_015364		35	186	1	0	1.66425e-11	0.004878	1.95279e-11	35	186				
ZBTB10	65986	broad.mit.edu	37	8	81426180	81426180	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr8:81426180G>C	ENST00000430430.1	+	4	2676	c.1897G>C	c.(1897-1899)Gat>Cat	p.D633H	ZBTB10_ENST00000455036.3_Missense_Mutation_p.D633H|ZBTB10_ENST00000426744.2_Missense_Mutation_p.D633H|ZBTB10_ENST00000379091.4_Missense_Mutation_p.D341H	NM_001277145.1	NP_001264074.1	Q96DT7	ZBT10_HUMAN	zinc finger and BTB domain containing 10	633					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D633H(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(4)	20	all_cancers(3;1.68e-09)|all_epithelial(4;5.13e-11)|Lung NSC(7;1.75e-07)|all_lung(9;7.38e-07)|Breast(3;2.96e-06)		BRCA - Breast invasive adenocarcinoma(6;0.000434)|Epithelial(68;0.00486)|all cancers(69;0.0296)			GCCAGATGGTGATAGGAATGT	0.413																																							uc003ybx.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)	1						c.(1897-1899)GAT>CAT		zinc finger and BTB domain containing 10 isoform							135.0	129.0	131.0					8																	81426180		1955	4146	6101	SO:0001583	missense	65986				transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr8:81426180G>C	AK022814	CCDS47880.1, CCDS64920.1	8q13-q21.1	2013-01-09			ENSG00000205189	ENSG00000205189		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	30953	protein-coding gene	gene with protein product						12477932	Standard	NM_001105539		Approved	RINZF, FLJ12752	uc003ybx.5	Q96DT7	OTTHUMG00000155016	ENST00000430430.1:c.1897G>C	8.37:g.81426180G>C	ENSP00000387462:p.Asp633His					ZBTB10_uc003ybv.3_Missense_Mutation_p.D341H|ZBTB10_uc003ybw.3_Missense_Mutation_p.D633H|ZBTB10_uc010lzt.2_Missense_Mutation_p.D631H	p.D633H	NM_001105539	NP_001099009	Q96DT7	ZBT10_HUMAN	BRCA - Breast invasive adenocarcinoma(6;0.000434)|Epithelial(68;0.00486)|all cancers(69;0.0296)		3	2495	+	all_cancers(3;1.68e-09)|all_epithelial(4;5.13e-11)|Lung NSC(7;1.75e-07)|all_lung(9;7.38e-07)|Breast(3;2.96e-06)		633					A4FVD0|Q86W96|Q8IXI9|Q96MH9	Missense_Mutation	SNP	ENST00000430430.1	37	c.1897G>C	CCDS47880.1	.	.	.	.	.	.	.	.	.	.	G	18.75	3.691161	0.68271	.	.	ENSG00000205189	ENST00000379091;ENST00000430430;ENST00000455036;ENST00000426744;ENST00000519370	T;T;T;T	0.10668	2.91;2.87;2.87;2.85	5.26	5.26	0.73747	.	0.304708	0.29861	N	0.011005	T	0.18841	0.0452	N	0.24115	0.695	0.41546	D	0.988544	P;D;D;D	0.71674	0.952;0.997;0.998;0.998	P;P;D;D	0.70935	0.667;0.907;0.971;0.911	T	0.03673	-1.1014	10	0.33141	T	0.24	.	14.3607	0.66768	0.0:0.0:1.0:0.0	.	487;633;633;341	A8E4L4;Q96DT7;Q96DT7-2;Q96DT7-4	.;ZBT10_HUMAN;.;.	H	341;633;633;633;459	ENSP00000368384:D341H;ENSP00000387462:D633H;ENSP00000412036:D633H;ENSP00000416134:D633H	ENSP00000368384:D341H	D	+	1	0	ZBTB10	81588735	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.489000	0.60309	2.452000	0.82932	0.561000	0.74099	GAT		0.413	ZBTB10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338055.2	NM_023929		11	44	0	0	0	0.013537	0	11	44				
RUNX1T1	862	broad.mit.edu	37	8	92983040	92983040	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr8:92983040G>T	ENST00000523629.1	-	11	1839	c.1385C>A	c.(1384-1386)aCg>aAg	p.T462K	RUNX1T1_ENST00000422361.2_Missense_Mutation_p.T425K|RUNX1T1_ENST00000265814.3_Missense_Mutation_p.T462K|RUNX1T1_ENST00000360348.2_Missense_Mutation_p.T425K|RUNX1T1_ENST00000396218.1_Missense_Mutation_p.T435K|RUNX1T1_ENST00000520724.1_Missense_Mutation_p.T425K|RUNX1T1_ENST00000436581.2_Missense_Mutation_p.T473K|RUNX1T1_ENST00000518844.1_Missense_Mutation_p.T435K	NM_001198626.1|NM_001198630.1|NM_001198633.1|NM_175634.2	NP_001185555.1|NP_001185559.1|NP_001185562.1|NP_783552.1	Q06455	MTG8_HUMAN	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)	462					fat cell differentiation (GO:0045444)|generation of precursor metabolites and energy (GO:0006091)|regulation of DNA binding (GO:0051101)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T473K(1)|p.T425K(1)|p.T462K(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(54)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	86			BRCA - Breast invasive adenocarcinoma(11;0.0141)			CTGCAGCTCCGTCATCGCCTG	0.587																																							uc003yfd.2		NA																	3	Substitution - Missense(3)	p.E462K(1)	lung(3)	lung(9)|large_intestine(3)|breast(2)|central_nervous_system(1)|pancreas(1)	16						c.(1384-1386)ACG>AAG		acute myelogenous leukemia 1 translocation 1							71.0	56.0	61.0					8																	92983040		2203	4300	6503	SO:0001583	missense	862				generation of precursor metabolites and energy	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:92983040G>T	D43638	CCDS6256.1, CCDS6257.1, CCDS47891.1, CCDS56544.1, CCDS75766.1, CCDS75767.1	8q22	2007-01-29	2005-01-20	2005-01-22	ENSG00000079102	ENSG00000079102		"""Zinc fingers, MYND-type"""	1535	protein-coding gene	gene with protein product		133435	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related"""	AML1T1, CBFA2T1		1391946, 9790752	Standard	NM_004349		Approved	CDR, ETO, MTG8, ZMYND2	uc011lgi.2	Q06455	OTTHUMG00000164066	ENST00000523629.1:c.1385C>A	8.37:g.92983040G>T	ENSP00000428543:p.Thr462Lys					RUNX1T1_uc003yfc.1_Missense_Mutation_p.T435K|RUNX1T1_uc003yfe.1_Missense_Mutation_p.T425K|RUNX1T1_uc010mao.2_Missense_Mutation_p.T435K|RUNX1T1_uc011lgi.1_Missense_Mutation_p.T473K|RUNX1T1_uc010man.1_Missense_Mutation_p.T87K|RUNX1T1_uc003yfb.1_Missense_Mutation_p.T425K	p.T462K	NM_175634	NP_783552	Q06455	MTG8_HUMAN	BRCA - Breast invasive adenocarcinoma(11;0.0141)		10	1469	-			462					B7Z4P4|E7EPN4|O14784|Q06456|Q14873|Q16239|Q16346|Q16347|Q6IBL1|Q6NXH1|Q7Z4J5|Q92479|Q9BRZ0	Missense_Mutation	SNP	ENST00000523629.1	37	c.1385C>A	CCDS6256.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.102474	0.76983	.	.	ENSG00000079102	ENST00000523629;ENST00000396218;ENST00000265814;ENST00000360348;ENST00000422361;ENST00000520724;ENST00000436581;ENST00000518844	T;T;T;T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.92	5.87	5.87	0.94306	.	0.148524	0.64402	D	0.000008	T	0.29850	0.0746	N	0.14661	0.345	0.58432	D	0.999999	B;B;B;B	0.27316	0.174;0.097;0.174;0.175	B;B;B;B	0.29942	0.081;0.079;0.081;0.109	T	0.10823	-1.0613	10	0.09084	T	0.74	-14.182	20.2181	0.98305	0.0:0.0:1.0:0.0	.	473;425;462;435	E7EPN4;Q7Z4J5;Q06455;Q06455-2	.;.;MTG8_HUMAN;.	K	462;435;462;425;425;425;473;435	ENSP00000428543:T462K;ENSP00000379520:T435K;ENSP00000265814:T462K;ENSP00000353504:T425K;ENSP00000390137:T425K;ENSP00000428742:T425K;ENSP00000402257:T473K;ENSP00000430728:T435K	ENSP00000265814:T462K	T	-	2	0	RUNX1T1	93052216	1.000000	0.71417	0.974000	0.42286	0.964000	0.63967	9.869000	0.99810	2.785000	0.95823	0.655000	0.94253	ACG		0.587	RUNX1T1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377045.3	NM_004349, NM_175635		21	49	1	0	3.08376e-08	0.00333	3.38767e-08	21	49				
KIAA0196	9897	broad.mit.edu	37	8	126091004	126091004	+	Silent	SNP	C	C	G			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr8:126091004C>G	ENST00000318410.7	-	6	1036	c.687G>C	c.(685-687)ctG>ctC	p.L229L	KIAA0196_ENST00000517845.1_Silent_p.L81L	NM_014846.3	NP_055661.3	Q12768	STRUM_HUMAN	KIAA0196	229				L -> R (in Ref. 4; AAH26951). {ECO:0000305}.	cell death (GO:0008219)|endosomal transport (GO:0016197)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|WASH complex (GO:0071203)		p.L229L(1)		NS(1)|breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	42	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			CATCAGATCTCAGTCGACCAA	0.403																																							uc003yrt.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(685-687)CTG>CTC		strumpellin							132.0	114.0	120.0					8																	126091004		2203	4300	6503	SO:0001819	synonymous_variant	9897				cell death	WASH complex		g.chr8:126091004C>G		CCDS6355.1	8q24.13	2014-05-09			ENSG00000164961	ENSG00000164961			28984	protein-coding gene	gene with protein product	"""strumpellin"""	610657	"""spastic paraplegia 8 (autosomal dominant)"""	SPG8		9973294, 17160902, 23085491	Standard	NM_014846		Approved		uc003yrt.3	Q12768	OTTHUMG00000164991	ENST00000318410.7:c.687G>C	8.37:g.126091004C>G						KIAA0196_uc011lir.1_Silent_p.L81L	p.L229L	NM_014846	NP_055661	Q12768	STRUM_HUMAN	STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)		6	1016	-	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		229	L -> R (in Ref. 4; AAH26951).				A8K4R7|Q3KQX5|Q8TBQ2	Silent	SNP	ENST00000318410.7	37	c.687G>C	CCDS6355.1																																																																																				0.403	KIAA0196-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381369.1	NM_014846		74	59	0	0	0	0.01441	0	74	59				
JRK	8629	broad.mit.edu	37	8	143747207	143747207	+	RNA	SNP	G	G	A	rs192430225	byFrequency	TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr8:143747207G>A	ENST00000507178.2	-	0	603							O75564	JERKY_HUMAN	Jrk homolog (mouse)							nucleus (GO:0005634)	DNA binding (GO:0003677)					all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;2.31e-05)				tacaggacgcggtccaggtgc	0.657													G|||	2	0.000399361	0.0015	0.0	5008	,	,		16656	0.0		0.0	False		,,,				2504	0.0						uc003ywo.2		NA																	0					0						c.(271-273)CGC>TGC		jerky isoform b							28.0	34.0	32.0					8																	143747207		2120	4228	6348			8629							g.chr8:143747207G>A	AF072467	CCDS75796.1, CCDS75797.1	8q24.3	2014-03-28	2014-03-28			ENSG00000234616			6199	protein-coding gene	gene with protein product		603210	"""jerky (mouse) homolog"", ""jerky homolog (mouse)"""			9675132	Standard	NM_003724		Approved	JH8, jerky	uc003ywo.3	O75564			8.37:g.143747207G>A						JRK_uc003ywp.2_Missense_Mutation_p.R91C|JRK_uc010mew.1_Missense_Mutation_p.R91C	p.R91C	NM_001077527	NP_001070995					2	785	-	all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;2.31e-05)						O75565	Missense_Mutation	SNP	ENST00000507178.2	37	c.271C>T																																																																																					0.657	JRK-003	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000362914.1	NM_003724		8	5	0	0	0	0.008291	0	8	5				
ZNF623	9831	broad.mit.edu	37	8	144733027	144733027	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr8:144733027A>T	ENST00000501748.2	+	1	1074	c.985A>T	c.(985-987)Att>Ttt	p.I329F	ZNF623_ENST00000458270.2_Missense_Mutation_p.I289F|ZNF623_ENST00000526926.1_Missense_Mutation_p.I289F	NM_014789.3	NP_055604	O75123	ZN623_HUMAN	zinc finger protein 623	329					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I329F(1)		endometrium(2)|kidney(3)|large_intestine(6)|lung(11)|prostate(1)|stomach(1)|urinary_tract(3)	27	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;5.28e-40)|all cancers(56;5.23e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			GAAAGCCTTTATTCGGAGTTC	0.488																																							uc003yzd.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(985-987)ATT>TTT		zinc finger protein 623 isoform 1							95.0	91.0	92.0					8																	144733027		2203	4300	6503	SO:0001583	missense	9831				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr8:144733027A>T	AB014528	CCDS34957.1, CCDS47931.1	8q24.3	2013-01-08				ENSG00000183309		"""Zinc fingers, C2H2-type"""	29084	protein-coding gene	gene with protein product						9734811	Standard	NM_014789		Approved	KIAA0628	uc003yzd.2	O75123		ENST00000501748.2:c.985A>T	8.37:g.144733027A>T	ENSP00000445979:p.Ile329Phe					ZNF623_uc011lkp.1_Missense_Mutation_p.I289F|ZNF623_uc003yzc.2_Missense_Mutation_p.I289F	p.I329F	NM_014789	NP_055604	O75123	ZN623_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;5.28e-40)|all cancers(56;5.23e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)		1	1074	+	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		329			C2H2-type 8.		A4FU80|B4DGP3|E7ENV5	Missense_Mutation	SNP	ENST00000501748.2	37	c.985A>T	CCDS34957.1	.	.	.	.	.	.	.	.	.	.	A	8.973	0.973356	0.18736	.	.	ENSG00000183309	ENST00000526926;ENST00000328466;ENST00000458270;ENST00000532796;ENST00000501748	T;T;T	0.10382	2.88;2.88;2.88	4.25	4.25	0.50352	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.11239	0.0274	N	0.03304	-0.355	0.09310	N	1	D	0.61080	0.989	P	0.60789	0.879	T	0.35126	-0.9801	9	0.38643	T	0.18	-11.9064	11.6398	0.51227	1.0:0.0:0.0:0.0	.	329	O75123	ZN623_HUMAN	F	289;289;289;329;329	ENSP00000435232:I289F;ENSP00000411139:I289F;ENSP00000445979:I329F	ENSP00000330358:I289F	I	+	1	0	ZNF623	144804170	0.000000	0.05858	0.278000	0.24718	0.815000	0.46073	1.428000	0.34892	1.911000	0.55334	0.533000	0.62120	ATT		0.488	ZNF623-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382522.3	NM_014789		26	78	0	0	0	0.005443	0	26	78				
DMRT3	58524	broad.mit.edu	37	9	990765	990765	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr9:990765C>A	ENST00000190165.2	+	2	1217	c.1179C>A	c.(1177-1179)aaC>aaA	p.N393K		NM_021240.2	NP_067063.1	Q9NQL9	DMRT3_HUMAN	doublesex and mab-3 related transcription factor 3	393					adult walking behavior (GO:0007628)|male sex differentiation (GO:0046661)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|sex differentiation (GO:0007548)|transcription, DNA-templated (GO:0006351)|transmission of nerve impulse (GO:0019226)|ventral spinal cord interneuron specification (GO:0021521)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.N393K(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(5)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	26		all_lung(10;1.39e-08)|Lung NSC(10;1.42e-08)		Lung(218;0.0196)		CCCTGTGGAACACCATGACGC	0.577																																							uc003zgw.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(1177-1179)AAC>AAA		doublesex and mab-3 related transcription factor							69.0	54.0	59.0					9																	990765		2203	4300	6503	SO:0001583	missense	58524				cell differentiation|multicellular organismal development|sex differentiation	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity	g.chr9:990765C>A	AJ301581	CCDS6443.1	9p24.3	2008-07-21	2001-12-17	2001-12-07	ENSG00000064218	ENSG00000064218			13909	protein-coding gene	gene with protein product	"""testis-specific protein"""	614754	"""DMRT-like family A3"""	DMRTA3		11543627, 10729223	Standard	NM_021240		Approved		uc003zgw.2	Q9NQL9	OTTHUMG00000019436	ENST00000190165.2:c.1179C>A	9.37:g.990765C>A	ENSP00000190165:p.Asn393Lys						p.N393K	NM_021240	NP_067063	Q9NQL9	DMRT3_HUMAN		Lung(218;0.0196)	2	1217	+		all_lung(10;1.39e-08)|Lung NSC(10;1.42e-08)	393					Q7LA03|Q7LCH8|Q96SC7|Q9NRQ9	Missense_Mutation	SNP	ENST00000190165.2	37	c.1179C>A	CCDS6443.1	.	.	.	.	.	.	.	.	.	.	C	16.08	3.020855	0.54576	.	.	ENSG00000064218	ENST00000190165	T	0.30714	1.52	5.33	4.42	0.53409	.	0.000000	0.85682	D	0.000000	T	0.44371	0.1290	L	0.32530	0.975	0.49687	D	0.999819	D	0.76494	0.999	D	0.80764	0.994	T	0.43261	-0.9402	10	0.72032	D	0.01	-45.6054	14.3584	0.66752	0.0:0.928:0.0:0.072	.	393	Q9NQL9	DMRT3_HUMAN	K	393	ENSP00000190165:N393K	ENSP00000190165:N393K	N	+	3	2	DMRT3	980765	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.675000	0.37555	1.221000	0.43506	0.655000	0.94253	AAC		0.577	DMRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051490.1	NM_021240		15	15	1	0	5.01169e-05	0.00499	5.2909e-05	15	15				
ZCCHC7	84186	broad.mit.edu	37	9	37305697	37305697	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr9:37305697G>T	ENST00000336755.5	+	5	1043	c.937G>T	c.(937-939)Ggc>Tgc	p.G313C	ZCCHC7_ENST00000461038.1_3'UTR|ZCCHC7_ENST00000534928.1_Missense_Mutation_p.G23C	NM_032226.2	NP_115602.2	Q8N3Z6	ZCHC7_HUMAN	zinc finger, CCHC domain containing 7	313						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.G313C(1)		central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	30				GBM - Glioblastoma multiforme(29;0.0137)		TCATATGCTAGGCCACTATAC	0.423																																							uc003zzq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(937-939)GGC>TGC		zinc finger, CCHC domain containing 7							104.0	86.0	92.0					9																	37305697		2203	4300	6503	SO:0001583	missense	84186						nucleic acid binding|zinc ion binding	g.chr9:37305697G>T	AK026264	CCDS6608.2	9p13.1	2008-05-02			ENSG00000147905	ENSG00000147905		"""Zinc fingers, CCHC domain containing"""	26209	protein-coding gene	gene with protein product							Standard	NM_032226		Approved	FLJ22611, AIR1	uc003zzq.3	Q8N3Z6	OTTHUMG00000019915	ENST00000336755.5:c.937G>T	9.37:g.37305697G>T	ENSP00000337839:p.Gly313Cys					ZCCHC7_uc011lqh.1_Missense_Mutation_p.G23C|ZCCHC7_uc011lqi.1_Missense_Mutation_p.G312C|ZCCHC7_uc010mlt.2_Missense_Mutation_p.G312C	p.G313C	NM_032226	NP_115602	Q8N3Z6	ZCHC7_HUMAN		GBM - Glioblastoma multiforme(29;0.0137)	5	1110	+			313			CCHC-type 3.		B2RCI4|D3DRQ0|Q5T0Q8|Q5T0Q9|Q5T0R0|Q8N2M1|Q8N4J2|Q8TBK8|Q9H648|Q9P0F0	Missense_Mutation	SNP	ENST00000336755.5	37	c.937G>T	CCDS6608.2	.	.	.	.	.	.	.	.	.	.	G	20.4	3.988400	0.74589	.	.	ENSG00000147905	ENST00000336755;ENST00000534928	T;T	0.53857	0.95;0.6	5.72	5.72	0.89469	Zinc finger, CCHC retroviral-type (1);Zinc finger, CCHC-type (1);	0.048870	0.85682	D	0.000000	T	0.79106	0.4390	M	0.89715	3.055	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82418	-0.0467	10	0.87932	D	0	-20.1284	19.0144	0.92888	0.0:0.0:1.0:0.0	.	313	Q8N3Z6	ZCHC7_HUMAN	C	313;23	ENSP00000337839:G313C;ENSP00000443113:G23C	ENSP00000337839:G313C	G	+	1	0	ZCCHC7	37295697	1.000000	0.71417	0.999000	0.59377	0.731000	0.41821	6.105000	0.71505	2.865000	0.98341	0.655000	0.94253	GGC		0.423	ZCCHC7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052453.2	NM_032226		33	30	1	0	3.90053e-15	0.012213	4.83104e-15	33	30				
MSANTD3	91283	broad.mit.edu	37	9	103213223	103213223	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr9:103213223A>G	ENST00000395067.2	+	3	1074	c.803A>G	c.(802-804)aAc>aGc	p.N268S	MSANTD3_ENST00000489377.1_3'UTR|TMEFF1_ENST00000334943.6_Intron|MSANTD3-TMEFF1_ENST00000502978.1_Intron	NM_001198805.1|NM_001198806.1|NM_080655.2	NP_001185734.1|NP_001185735.1|NP_542386.1	Q96H12	MSD3_HUMAN	Myb/SANT-like DNA-binding domain containing 3	268								p.N268S(1)		endometrium(2)|lung(2)	4						TCCTCATTTAACCGGCCCTTT	0.418																																							uc004baw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(802-804)AAC>AGC		hypothetical protein LOC91283							47.0	49.0	48.0					9																	103213223		2181	4296	6477	SO:0001583	missense	91283							g.chr9:103213223A>G	BC008993	CCDS6749.1, CCDS56579.1	9q31.1	2012-03-13	2012-03-13	2012-03-13	ENSG00000066697	ENSG00000066697			23370	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 30"""	C9orf30			Standard	NM_080655		Approved	MGC17337		Q96H12	OTTHUMG00000020365	ENST00000395067.2:c.803A>G	9.37:g.103213223A>G	ENSP00000378506:p.Asn268Ser					TMEFF1_uc004bay.1_Intron|C9orf30_uc004bax.2_RNA	p.N268S	NM_080655	NP_542386	Q96H12	CI030_HUMAN			3	870	+		Acute lymphoblastic leukemia(62;0.0527)	268					B2RC35|Q5T726|Q5T727|Q5T728	Missense_Mutation	SNP	ENST00000395067.2	37	c.803A>G	CCDS6749.1	.	.	.	.	.	.	.	.	.	.	A	17.53	3.412222	0.62511	.	.	ENSG00000066697	ENST00000395067	.	.	.	6.07	4.91	0.64330	.	.	.	.	.	T	0.31949	0.0813	N	0.08118	0	0.80722	D	1	B	0.29212	0.237	B	0.17722	0.019	T	0.17289	-1.0374	8	0.87932	D	0	-14.5623	12.6363	0.56685	0.8618:0.1382:0.0:0.0	.	268	Q96H12	CI030_HUMAN	S	268	.	ENSP00000378506:N268S	N	+	2	0	C9orf30	102253044	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.025000	0.70864	1.066000	0.40716	0.533000	0.62120	AAC		0.418	MSANTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053410.1	NM_080655		52	13	0	0	0	0.01441	0	52	13				
ABCA1	19	broad.mit.edu	37	9	107550287	107550287	+	Missense_Mutation	SNP	T	T	G	rs150283412	byFrequency	TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr9:107550287T>G	ENST00000374736.3	-	46	6512	c.6118A>C	c.(6118-6120)Aaa>Caa	p.K2040Q		NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	2040	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)	p.K2040Q(1)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	CCAGCATATTTTTCTCCATAC	0.473																																							uc004bcl.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(4)|lung(4)|ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	17						c.(6118-6120)AAA>CAA		ATP-binding cassette, sub-family A member 1	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)						187.0	166.0	173.0					9																	107550287		2203	4300	6503	SO:0001583	missense	19				Cdc42 protein signal transduction|cellular lipid metabolic process|cholesterol efflux|cholesterol homeostasis|cholesterol metabolic process|endosome transport|G-protein coupled receptor protein signaling pathway|high-density lipoprotein particle assembly|interleukin-1 beta secretion|intracellular cholesterol transport|lysosome organization|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|phospholipid efflux|phospholipid homeostasis|platelet dense granule organization|positive regulation of cAMP biosynthetic process|reverse cholesterol transport	integral to plasma membrane|membrane fraction|membrane raft|phagocytic vesicle	anion transmembrane transporter activity|apolipoprotein A-I receptor activity|ATP binding|ATPase activity|cholesterol transporter activity|phospholipid transporter activity|small GTPase binding|syntaxin-13 binding	g.chr9:107550287T>G	AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.6118A>C	9.37:g.107550287T>G	ENSP00000363868:p.Lys2040Gln					NIPSNAP3B_uc004bcj.1_RNA	p.K2040Q	NM_005502	NP_005493	O95477	ABCA1_HUMAN		OV - Ovarian serous cystadenocarcinoma(323;0.023)	46	6431	-			2040			ABC transporter 2.		Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Missense_Mutation	SNP	ENST00000374736.3	37	c.6118A>C	CCDS6762.1	.	.	.	.	.	.	.	.	.	.	T	15.66	2.899204	0.52227	.	.	ENSG00000165029	ENST00000374736	D	0.93906	-3.31	5.84	5.84	0.93424	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	L	0.39566	1.225	0.80722	D	1	B	0.29232	0.238	B	0.29353	0.101	D	0.88096	0.2816	10	0.40728	T	0.16	.	16.5601	0.84551	0.0:0.0:0.0:1.0	.	2040	O95477	ABCA1_HUMAN	Q	2040	ENSP00000363868:K2040Q	ENSP00000363868:K2040Q	K	-	1	0	ABCA1	106590108	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.129000	0.57957	2.367000	0.80283	0.529000	0.55759	AAA		0.473	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053491.1	NM_005502		43	124	0	0	0	0.011902	0	43	124				
SVEP1	79987	broad.mit.edu	37	9	113194786	113194786	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr9:113194786C>A	ENST00000401783.2	-	31	5525	c.5189G>T	c.(5188-5190)tGt>tTt	p.C1730F	SVEP1_ENST00000374469.1_Missense_Mutation_p.C1707F	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	1730	Sushi 6. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)	p.C1733F(1)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						ATTATCTGTACAGAACATCCT	0.453																																							uc010mtz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)	7						c.(5188-5190)TGT>TTT		polydom							147.0	143.0	144.0					9																	113194786		1957	4141	6098	SO:0001583	missense	79987				cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding	g.chr9:113194786C>A	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.5189G>T	9.37:g.113194786C>A	ENSP00000384917:p.Cys1730Phe						p.C1730F	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN			31	5526	-			1730			Sushi 6.		Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	37	c.5189G>T	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.923135	0.92319	.	.	ENSG00000165124	ENST00000401783;ENST00000374469	D;D	0.92647	-3.08;-3.08	5.81	5.81	0.92471	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	D	0.97926	0.9318	H	0.98178	4.165	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98750	1.0720	10	0.87932	D	0	.	20.0826	0.97783	0.0:1.0:0.0:0.0	.	1730	Q4LDE5	SVEP1_HUMAN	F	1730;1707	ENSP00000384917:C1730F;ENSP00000363593:C1707F	ENSP00000363593:C1707F	C	-	2	0	SVEP1	112234607	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.486000	0.81215	2.746000	0.94184	0.655000	0.94253	TGT		0.453	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				90	40	1	0	1.16668e-32	0.01441	1.64376e-32	90	40				
STXBP1	6812	broad.mit.edu	37	9	130428493	130428493	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr9:130428493G>C	ENST00000373299.1	+	9	827	c.712G>C	c.(712-714)Gac>Cac	p.D238H	STXBP1_ENST00000373302.3_Missense_Mutation_p.D238H	NM_001032221.3	NP_001027392.1	P61764	STXB1_HUMAN	syntaxin binding protein 1	238					axon target recognition (GO:0007412)|energy reserve metabolic process (GO:0006112)|glutamate secretion (GO:0014047)|long term synaptic depression (GO:0060292)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|protein stabilization (GO:0050821)|protein transport (GO:0015031)|regulation of insulin secretion (GO:0050796)|regulation of SNARE complex assembly (GO:0035542)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|regulation of synaptic vesicle priming (GO:0010807)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|synaptic vesicle maturation (GO:0016188)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|protein complex (GO:0043234)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|SNARE binding (GO:0000149)|syntaxin binding (GO:0019905)|syntaxin-1 binding (GO:0017075)	p.D238H(2)		breast(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(7)|skin(2)	23						TCGAGGCTTTGACCCCAGCTC	0.517																																							uc004brl.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(712-714)GAC>CAC		syntaxin binding protein 1 isoform b							111.0	96.0	101.0					9																	130428493		2203	4300	6503	SO:0001583	missense	6812				axon target recognition|energy reserve metabolic process|glutamate secretion|negative regulation of synaptic transmission, GABAergic|neurotransmitter secretion|platelet aggregation|platelet degranulation|protein transport|regulation of insulin secretion|regulation of synaptic vesicle priming|synaptic vesicle maturation|vesicle docking involved in exocytosis	cytosol|mitochondrion|plasma membrane|platelet alpha granule|protein complex	identical protein binding|syntaxin-1 binding|syntaxin-2 binding	g.chr9:130428493G>C	AF004563	CCDS6874.1, CCDS35146.1	9q34.1	2008-07-21			ENSG00000136854	ENSG00000136854			11444	protein-coding gene	gene with protein product	"""syntaxin-binding protein 1"""	602926				9545644	Standard	NM_001032221		Approved	hUNC18, MUNC18-1, UNC18, rbSec1	uc004brk.2	P61764	OTTHUMG00000020713	ENST00000373299.1:c.712G>C	9.37:g.130428493G>C	ENSP00000362396:p.Asp238His					STXBP1_uc004brk.2_Missense_Mutation_p.D238H	p.D238H	NM_001032221	NP_001027392	P61764	STXB1_HUMAN			9	909	+			238					B1AM97|Q28208|Q62759|Q64320|Q96TG8	Missense_Mutation	SNP	ENST00000373299.1	37	c.712G>C	CCDS35146.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.998118	0.93227	.	.	ENSG00000136854	ENST00000535154;ENST00000373302;ENST00000541198;ENST00000373299	D;D	0.96459	-4.02;-4.02	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	D	0.98899	0.9627	H	0.97291	3.975	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99470	1.0945	10	0.87932	D	0	-15.9351	17.3903	0.87428	0.0:0.0:1.0:0.0	.	238;238	P61764;P61764-2	STXB1_HUMAN;.	H	192;238;70;238	ENSP00000362399:D238H;ENSP00000362396:D238H	ENSP00000362396:D238H	D	+	1	0	STXBP1	129468314	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.758000	0.98927	2.717000	0.92951	0.655000	0.94253	GAC		0.517	STXBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054229.1	NM_003165		47	37	0	0	0	0.01441	0	47	37				
AIF1L	83543	broad.mit.edu	37	9	133995667	133995667	+	Silent	SNP	A	A	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr9:133995667A>T	ENST00000247291.3	+	6	499	c.411A>T	c.(409-411)ccA>ccT	p.P137P	AIF1L_ENST00000372312.3_Silent_p.P142P|AIF1L_ENST00000372301.2_Silent_p.P81P|AIF1L_ENST00000372302.1_Silent_p.P129P|AIF1L_ENST00000372309.3_Silent_p.P163P|AIF1L_ENST00000372300.1_3'UTR|AIF1L_ENST00000372298.1_Intron|AIF1L_ENST00000372297.2_3'UTR	NM_031426.3	NP_113614.1	Q9BQI0	AIF1L_HUMAN	allograft inflammatory factor 1-like	137						actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)	p.P137P(1)|p.P163P(1)		lung(2)	2						GCCCCAAGCCAGTTGGCCCCC	0.532																																					Esophageal Squamous(95;611 1423 5044 34794 42333)	Esophageal Squamous(95;611 1423 5044 34794 42333)	uc004cab.1		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(409-411)CCA>CCT		ionized calcium binding adapter molecule 2							64.0	66.0	65.0					9																	133995667		2203	4300	6503	SO:0001819	synonymous_variant	83543					actin cytoskeleton|cytoplasm|focal adhesion|ruffle membrane	actin filament binding|calcium ion binding	g.chr9:133995667A>T	AL136566	CCDS6939.1, CCDS55348.1, CCDS55349.1	9q34.13-q34.3	2013-01-10	2008-10-21	2008-10-21	ENSG00000126878	ENSG00000126878		"""EF-hand domain containing"""	28904	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 58"""	C9orf58		11230166	Standard	NM_001185095		Approved	IBA2, FLJ12783	uc004cad.2	Q9BQI0	OTTHUMG00000020817	ENST00000247291.3:c.411A>T	9.37:g.133995667A>T						AIF1L_uc004cad.1_Silent_p.P163P|AIF1L_uc004cae.1_3'UTR|AIF1L_uc004cac.1_RNA|AIF1L_uc011mce.1_Silent_p.P142P	p.P137P	NM_031426	NP_113614	Q9BQI0	AIF1L_HUMAN			6	516	+			137					B2RBC4|Q6ZR40|Q8NAX7|Q8WU47|Q9H9G0	Silent	SNP	ENST00000247291.3	37	c.411A>T	CCDS6939.1																																																																																				0.532	AIF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054703.2	NM_031426		25	17	0	0	0	0.009535	0	25	17				
EHMT1	79813	broad.mit.edu	37	9	140611349	140611349	+	Silent	SNP	C	C	G			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr9:140611349C>G	ENST00000460843.1	+	3	384	c.357C>G	c.(355-357)gtC>gtG	p.V119V	EHMT1_ENST00000371394.2_3'UTR|EHMT1_ENST00000462484.1_Silent_p.V119V|EHMT1_ENST00000334856.6_Silent_p.V88V	NM_024757.4	NP_079033.4	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1	119					chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|embryo development (GO:0009790)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|methyltransferase activity (GO:0008168)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)	p.V119V(1)|p.V88V(1)		breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		AGACTTCTGTCATCGGCAGCA	0.537																																							uc011mfc.1		NA																	2	Substitution - coding silent(2)		lung(2)	breast(2)|pancreas(1)	3						c.(355-357)GTC>GTG		euchromatic histone-lysine N-methyltransferase 1							95.0	101.0	99.0					9																	140611349		2203	4300	6503	SO:0001819	synonymous_variant	79813				DNA methylation|embryo development|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding	g.chr9:140611349C>G	AY083210	CCDS7050.1, CCDS7050.2, CCDS56595.1	9q34.3	2013-09-20			ENSG00000181090	ENSG00000181090	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	24650	protein-coding gene	gene with protein product		607001	"""euchromatic histone methyltransferase 1"""			11347906, 12004135	Standard	NM_024757		Approved	Eu-HMTase1, FLJ12879, KIAA1876, bA188C12.1, KMT1D	uc011mfc.2	Q9H9B1	OTTHUMG00000020995	ENST00000460843.1:c.357C>G	9.37:g.140611349C>G						EHMT1_uc004coa.2_Silent_p.V119V|EHMT1_uc004cob.1_Silent_p.V88V	p.V119V	NM_024757	NP_079033	Q9H9B1	EHMT1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)	3	394	+	all_cancers(76;0.164)		119					B1AQ58|B1AQ59|Q86X08|Q8TCN7|Q96F53|Q96JF1|Q96KH4	Silent	SNP	ENST00000460843.1	37	c.357C>G	CCDS7050.2																																																																																				0.537	EHMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055371.2	NM_024757		78	35	0	0	0	0.01441	0	78	35				
MXRA5	25878	broad.mit.edu	37	X	3242083	3242083	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chrX:3242083G>A	ENST00000217939.6	-	5	1797	c.1643C>T	c.(1642-1644)tCt>tTt	p.S548F		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	548	Ig-like C2-type 1.					extracellular vesicular exosome (GO:0070062)		p.S548F(2)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				GCCTGAGTCAGATGGCTCCAT	0.542																																							uc004crg.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8						c.(1642-1644)TCT>TTT		adlican precursor							50.0	37.0	41.0					X																	3242083		2203	4300	6503	SO:0001583	missense	25878					extracellular region		g.chrX:3242083G>A	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.1643C>T	X.37:g.3242083G>A	ENSP00000217939:p.Ser548Phe						p.S548F	NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN			5	1800	-		all_lung(23;0.00031)|Lung NSC(23;0.000946)	548			Ig-like C2-type 1.		Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	ENST00000217939.6	37	c.1643C>T	CCDS14124.1	.	.	.	.	.	.	.	.	.	.	G	2.358	-0.347290	0.05208	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.32753	1.44	3.63	2.76	0.32466	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.655352	0.12565	U	0.457877	T	0.30665	0.0772	M	0.65975	2.015	0.09310	N	1	B	0.24258	0.1	B	0.23852	0.049	T	0.23084	-1.0198	10	0.39692	T	0.17	.	7.6719	0.28463	0.2048:0.0:0.7952:0.0	.	548	Q9NR99	MXRA5_HUMAN	F	548	ENSP00000217939:S548F	ENSP00000217939:S548F	S	-	2	0	MXRA5	3252083	0.010000	0.17322	0.001000	0.08648	0.009000	0.06853	1.712000	0.37940	0.418000	0.25898	0.431000	0.28591	TCT		0.542	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419		6	8	0	0	0	0.004482	0	6	8				
MID1	4281	broad.mit.edu	37	X	10535644	10535644	+	Splice_Site	SNP	C	C	T			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chrX:10535644C>T	ENST00000317552.4	-	2	345		c.e2-1		MID1_ENST00000380779.1_Splice_Site|MID1_ENST00000380780.1_Splice_Site|MID1_ENST00000380782.2_Splice_Site|MID1_ENST00000380785.1_Splice_Site|MID1_ENST00000453318.2_Splice_Site|MID1_ENST00000380787.1_Splice_Site	NM_000381.3|NM_033289.1	NP_000372.1|NP_150631.1	O15344	TRI18_HUMAN	midline 1						microtubule cytoskeleton organization (GO:0000226)|negative regulation of microtubule depolymerization (GO:0007026)|pattern specification process (GO:0007389)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein localization to microtubule (GO:0035372)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	ligase activity (GO:0016874)|microtubule binding (GO:0008017)|phosphoprotein binding (GO:0051219)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	26						GATCAGCTATCTGGAAACAAG	0.453																																							uc004cte.3		NA																	0				ovary(2)|pancreas(1)	3						c.e2-1		midline 1																																				SO:0001630	splice_region_variant	4281				microtubule cytoskeleton organization|pattern specification process|positive regulation of stress-activated MAPK cascade	cytoplasm|microtubule|microtubule associated complex|spindle	ligase activity|ubiquitin protein ligase binding|zinc ion binding	g.chrX:10535644C>T	Y13667	CCDS14138.1, CCDS75952.1, CCDS75953.1	Xp22	2014-06-18	2014-06-18		ENSG00000101871	ENSG00000101871		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	7095	protein-coding gene	gene with protein product	"""Opitz/BBB syndrome"""	300552				9354791, 9425238	Standard	NM_001098624		Approved	OS, FXY, TRIM18, RNF59	uc004cti.4	O15344	OTTHUMG00000021127	ENST00000317552.4:c.56-1G>A	X.37:g.10535644C>T						MID1_uc004ctd.3_5'Flank|MID1_uc004ctg.3_Splice_Site|MID1_uc004cth.3_Splice_Site|MID1_uc004ctk.3_Splice_Site|MID1_uc004cti.3_Splice_Site|MID1_uc004ctj.3_Splice_Site|MID1_uc011mie.1_Splice_Site|MID1_uc004ctm.1_Splice_Site|MID1_uc004ctn.1_Splice_Site|MID1_uc004cto.1_Splice_Site|MID1_uc010ndw.1_5'Flank|MID1_uc004cts.1_5'Flank|MID1_uc004ctt.2_Splice_Site|MID1_uc004ctu.2_Splice_Site|MID1_uc004ctv.2_Splice_Site|MID1_uc004ctw.2_Splice_Site|MID1_uc010ndy.1_Splice_Site|uc010ndz.1_5'Flank|MID1_uc004cty.2_Splice_Site|MID1_uc004ctz.1_5'Flank|MID1_uc004cua.1_Splice_Site|MID1_uc004cub.1_Splice_Site|MID1_uc010nea.1_5'Flank|MID1_uc004cuc.1_Splice_Site|MID1_uc004cud.1_Splice_Site|MID1_uc004cue.1_Splice_Site|MID1_uc004cuf.1_Splice_Site|MID1_uc004cug.1_Intron		NM_033290	NP_150632	O15344	TRI18_HUMAN			2	136	-								B2RCG2|O75361|Q9BZX5	Splice_Site	SNP	ENST00000317552.4	37	c.-55_splice	CCDS14138.1																																																																																				0.453	MID1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055738.1		Intron	5	23	0	0	0	0.000602	0	5	23				
MAGEB3	4114	broad.mit.edu	37	X	30254710	30254710	+	Silent	SNP	C	C	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chrX:30254710C>A	ENST00000361644.2	+	5	1406	c.669C>A	c.(667-669)atC>atA	p.I223I		NM_002365.4	NP_002356.2	O15480	MAGB3_HUMAN	melanoma antigen family B, 3	223	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.I223I(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|prostate(2)|skin(2)	25						AGGAGAAGATCTGGGAATTCC	0.473																																							uc004dca.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(667-669)ATC>ATA		melanoma antigen family B, 3							45.0	40.0	42.0					X																	30254710		2202	4300	6502	SO:0001819	synonymous_variant	4114							g.chrX:30254710C>A	AK057441	CCDS14220.1	Xp21.3	2009-03-17			ENSG00000198798	ENSG00000198798			6810	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 5"""	300152				9441743	Standard	NM_002365		Approved	CT3.5	uc004dca.2	O15480	OTTHUMG00000021320	ENST00000361644.2:c.669C>A	X.37:g.30254710C>A							p.I223I	NM_002365	NP_002356	O15480	MAGB3_HUMAN			5	1406	+			223			MAGE.		A0AVE4|B3KQ52|O75861	Silent	SNP	ENST00000361644.2	37	c.669C>A	CCDS14220.1																																																																																				0.473	MAGEB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056158.2	NM_002365		7	11	1	0	0.000274275	0.004482	0.000287155	7	11				
MAGEB1	4112	broad.mit.edu	37	X	30268769	30268769	+	Silent	SNP	T	T	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chrX:30268769T>A	ENST00000378981.3	+	4	480	c.159T>A	c.(157-159)ccT>ccA	p.P53P	MAGEB1_ENST00000397548.2_Silent_p.P53P|MAGEB1_ENST00000397550.1_Silent_p.P53P	NM_002363.4	NP_002354.2	P43366	MAGB1_HUMAN	melanoma antigen family B, 1	53								p.P53P(1)		NS(2)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(8)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	32						CAAGCTCCCCTGCTGCTGGCA	0.587																																							uc004dcc.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(157-159)CCT>CCA		melanoma antigen family B, 1							35.0	28.0	30.0					X																	30268769		2202	4299	6501	SO:0001819	synonymous_variant	4112							g.chrX:30268769T>A		CCDS14222.1	Xp21.3	2009-03-17			ENSG00000214107	ENSG00000214107			6808	protein-coding gene	gene with protein product	"""DSS/AHC critical interval MAGE superfamily 10"", ""cancer/testis antigen family 3, member 1"""	300097				7761436, 9441743	Standard	NM_002363		Approved	MAGEL1, MAGE-Xp, DAM10, MGC9322, CT3.1	uc004dce.3	P43366	OTTHUMG00000021322	ENST00000378981.3:c.159T>A	X.37:g.30268769T>A						MAGEB1_uc004dcd.2_Silent_p.P53P|MAGEB1_uc004dce.2_Silent_p.P53P	p.P53P	NM_002363	NP_002354	P43366	MAGB1_HUMAN			4	479	+			53					B2RC79|O00601|O75862|Q6FHJ0|Q96CW8	Silent	SNP	ENST00000378981.3	37	c.159T>A	CCDS14222.1																																																																																				0.587	MAGEB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056160.1	NM_002363		6	7	0	0	0	0.001984	0	6	7				
RBM10	8241	broad.mit.edu	37	X	47044476	47044477	+	Missense_Mutation	DNP	GG	GG	AT			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chrX:47044476_47044477GG>AT	ENST00000377604.3	+	18	2715_2716	c.1973_1974GG>AT	c.(1972-1974)tGG>tAT	p.W658Y	RBM10_ENST00000329236.7_Missense_Mutation_p.W580Y|RBM10_ENST00000345781.6_Missense_Mutation_p.W581Y	NM_001204467.1|NM_001204468.1|NM_005676.4	NP_001191396.1|NP_001191397.1|NP_005667.2	P98175	RBM10_HUMAN	RNA binding motif protein 10	658					3'-UTR-mediated mRNA stabilization (GO:0070935)|mRNA processing (GO:0006397)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|zinc ion binding (GO:0008270)	p.W658Y(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	48						ATGGAACGCTGGGCCCGCAGTC	0.55																																					Melanoma(171;120 2705 19495 39241)	Melanoma(171;120 2705 19495 39241)	uc004dhf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|large_intestine(1)|prostate(1)|breast(1)|pancreas(1)	5						c.(1972-1974)TGG>TAT		RNA binding motif protein 10 isoform 1																																				SO:0001583	missense	8241				mRNA processing|RNA splicing	chromatin remodeling complex	nucleotide binding|RNA binding|zinc ion binding	g.chrX:47044476_47044477GG>AT	U35373	CCDS14274.1, CCDS56600.1, CCDS75969.1	Xp11.3	2014-06-09			ENSG00000182872	ENSG00000182872		"""Zinc fingers, RAN-binding domain containing"", ""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9896	protein-coding gene	gene with protein product		300080				8590280, 8808293	Standard	NM_005676		Approved	DXS8237E, KIAA0122, GPATC9, ZRANB5, GPATCH9	uc004dhi.3	P98175	OTTHUMG00000021432	Exception_encountered	X.37:g.47044476_47044477delinsAT	ENSP00000366829:p.Trp658Tyr					RBM10_uc004dhg.2_Missense_Mutation_p.W580Y|RBM10_uc004dhh.2_Missense_Mutation_p.W657Y|RBM10_uc010nhq.2_Missense_Mutation_p.W581Y|RBM10_uc004dhi.2_Missense_Mutation_p.W723Y	p.W658Y	NM_005676	NP_005667	P98175	RBM10_HUMAN			18	2352_2353	+			658					C4AM81|Q14136|Q5JRR2|Q9BTE4|Q9BTX0|Q9NTB1	Missense_Mutation	DNP	ENST00000377604.3	37	c.1973_1974GG>AT	CCDS14274.1																																																																																				0.550	RBM10-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056381.1	NM_005676		6	4	0	0	0	0.004672	0	6	4				
GLOD5	392465	broad.mit.edu	37	X	48629475	48629475	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chrX:48629475G>C	ENST00000303227.6	+	3	375	c.334G>C	c.(334-336)Gag>Cag	p.E112Q	GLOD5_ENST00000470676.1_3'UTR	NM_001080489.2	NP_001073958.2	A6NK44	GLOD5_HUMAN	glyoxalase domain containing 5	112								p.E164Q(1)		endometrium(1)|lung(2)	3						GGTGCCTTTGGAGGAAATGAT	0.488																																							uc011mmh.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(334-336)GAG>CAG		glyoxalase domain containing 5							65.0	59.0	61.0					X																	48629475		1886	4116	6002	SO:0001583	missense	392465							g.chrX:48629475G>C		CCDS55410.1	Xp11.23	2008-02-05			ENSG00000171433	ENSG00000171433			33358	protein-coding gene	gene with protein product							Standard	NM_001080489		Approved		uc011mmh.2	A6NK44	OTTHUMG00000024125	ENST00000303227.6:c.334G>C	X.37:g.48629475G>C	ENSP00000302552:p.Glu112Gln						p.E112Q	NM_001080489	NP_001073958					3	375	+									Missense_Mutation	SNP	ENST00000303227.6	37	c.334G>C	CCDS55410.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	10.12|10.12	1.262644|1.262644	0.23051|0.23051	.|.	.|.	ENSG00000171433|ENSG00000171433	ENST00000303227|ENST00000445229	.|.	.|.	.|.	4.88|4.88	0.852|0.852	0.18995|0.18995	.|.	0.545245|.	0.21288|.	N|.	0.077026|.	T|T	0.35595|0.35595	0.0937|0.0937	L|L	0.46670|0.46670	1.46|1.46	0.20489|0.20489	N|N	0.999898|0.999898	B|.	0.16802|.	0.019|.	B|.	0.23150|.	0.044|.	T|T	0.27226|0.27226	-1.0080|-1.0080	9|5	0.40728|.	T|.	0.16|.	.|.	4.9437|4.9437	0.13978|0.13978	0.3801:0.1478:0.4721:0.0|0.3801:0.1478:0.4721:0.0	.|.	100|.	A6NK44|.	GLOD5_HUMAN|.	Q|C	112|78	.|.	ENSP00000302552:E112Q|.	E|W	+|+	1|3	0|0	GLOD5|GLOD5	48514419|48514419	0.929000|0.929000	0.31497|0.31497	0.035000|0.035000	0.18076|0.18076	0.950000|0.950000	0.60333|0.60333	0.444000|0.444000	0.21661|0.21661	0.094000|0.094000	0.17404|0.17404	0.380000|0.380000	0.24917|0.24917	GAG|TGG		0.488	GLOD5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001080489		11	8	0	0	0	0.001855	0	11	8				
NRK	203447	broad.mit.edu	37	X	105167242	105167242	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chrX:105167242G>A	ENST00000243300.9	+	18	3046	c.2743G>A	c.(2743-2745)Gaa>Aaa	p.E915K	NRK_ENST00000428173.2_Missense_Mutation_p.E916K	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	915					activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.E916K(1)		breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						TCAGCCACCTGAAGAGGATGG	0.423										HNSCC(51;0.14)																													uc004emd.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14						c.(2743-2745)GAA>AAA		Nik related kinase							60.0	57.0	58.0					X																	105167242		2039	4167	6206	SO:0001583	missense	203447						ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity	g.chrX:105167242G>A	BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.2743G>A	X.37:g.105167242G>A	ENSP00000434830:p.Glu915Lys	HNSCC(51;0.14)				NRK_uc010npc.1_Missense_Mutation_p.E583K	p.E915K	NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN			18	3046	+			915					Q32ND6|Q5H9K2|Q6ZMP2	Missense_Mutation	SNP	ENST00000243300.9	37	c.2743G>A		.	.	.	.	.	.	.	.	.	.	g	19.82	3.898882	0.72754	.	.	ENSG00000123572	ENST00000243300;ENST00000428173	T;T	0.78707	-1.19;-1.2	3.58	3.58	0.41010	.	0.000000	0.39909	N	0.001227	T	0.78886	0.4354	L	0.29908	0.895	0.80722	D	1	D;D	0.76494	0.999;0.993	D;D	0.80764	0.994;0.968	T	0.77940	-0.2399	10	0.45353	T	0.12	.	9.7373	0.40395	0.0:0.0:1.0:0.0	.	583;915	Q7Z2Y5-2;Q7Z2Y5	.;NRK_HUMAN	K	915;916	ENSP00000434830:E915K;ENSP00000438378:E916K	ENSP00000434830:E915K	E	+	1	0	NRK	105053898	1.000000	0.71417	1.000000	0.80357	0.829000	0.46940	3.701000	0.54793	2.045000	0.60652	0.597000	0.82753	GAA		0.423	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000106480.6	NM_198465		17	17	0	0	0	0.006122	0	17	17				
MBNL3	55796	broad.mit.edu	37	X	131573492	131573492	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chrX:131573492G>A	ENST00000370853.3	-	1	226	c.148C>T	c.(148-150)Cgt>Tgt	p.R50C	MBNL3_ENST00000370839.3_Missense_Mutation_p.R50C|MBNL3_ENST00000370844.1_5'UTR|MBNL3_ENST00000370857.3_Missense_Mutation_p.R50C	NM_018388.3	NP_060858.2	Q9NUK0	MBNL3_HUMAN	muscleblind-like splicing regulator 3	50					mRNA processing (GO:0006397)|multicellular organismal development (GO:0007275)|negative regulation of myoblast differentiation (GO:0045662)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.R50C(2)		NS(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(5)|prostate(2)	16	Acute lymphoblastic leukemia(192;0.000127)					GCCACCACACGACCATTTTCC	0.393																																							uc004ewv.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(148-150)CGT>TGT		muscleblind-like 3 isoform G							139.0	131.0	134.0					X																	131573492		2203	4300	6503	SO:0001583	missense	55796				mRNA processing|multicellular organismal development|regulation of RNA splicing|RNA splicing	Golgi apparatus|nucleus	nucleic acid binding|zinc ion binding	g.chrX:131573492G>A	AF491305	CCDS14633.1, CCDS14634.1, CCDS55492.1, CCDS55493.1, CCDS55494.1	Xq26.2	2013-01-18	2012-02-23		ENSG00000076770	ENSG00000076770		"""Zinc fingers, CCCH-type domain containing"""	20564	protein-coding gene	gene with protein product		300413	"""muscleblind-like 3 (Drosophila)"""			12297108, 10970838	Standard	NM_018388		Approved	CHCR, FLJ11316, MBLX39, MBXL	uc004ewv.4	Q9NUK0	OTTHUMG00000022426	ENST00000370853.3:c.148C>T	X.37:g.131573492G>A	ENSP00000359890:p.Arg50Cys					MBNL3_uc004eww.2_5'UTR|MBNL3_uc010nrl.1_RNA|MBNL3_uc004ewu.3_Missense_Mutation_p.R50C	p.R50C	NM_018388	NP_060858	Q9NUK0	MBNL3_HUMAN			1	227	-	Acute lymphoblastic leukemia(192;0.000127)		50			C3H1-type 2.		Q5JXN8|Q5JXN9|Q5JXP4|Q6UDQ1|Q8IUR4|Q8TAD9|Q8TAF4|Q9H0Z7|Q9UF37	Missense_Mutation	SNP	ENST00000370853.3	37	c.148C>T	CCDS14633.1	.	.	.	.	.	.	.	.	.	.	G	18.89	3.719448	0.68844	.	.	ENSG00000076770	ENST00000370857;ENST00000370853;ENST00000370839	T;T;T	0.51325	0.71;0.71;0.71	5.83	5.83	0.93111	Zinc finger, CCCH-type (2);	0.000000	0.64402	D	0.000001	T	0.70771	0.3262	M	0.73962	2.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.72434	-0.4295	10	0.59425	D	0.04	-12.5221	19.106	0.93294	0.0:0.0:1.0:0.0	.	50;50	Q9NUK0;Q9NUK0-2	MBNL3_HUMAN;.	C	50	ENSP00000359894:R50C;ENSP00000359890:R50C;ENSP00000359876:R50C	ENSP00000359876:R50C	R	-	1	0	MBNL3	131401173	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.216000	0.58540	2.462000	0.83206	0.594000	0.82650	CGT		0.393	MBNL3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058319.1	NM_018388		22	97	0	0	0	0.00278	0	22	97				
MEAF6	64769	broad.mit.edu	37	1	37979055	37979075	+	In_Frame_Del	DEL	GAATAATATTGCCATACATCT	GAATAATATTGCCATACATCT	-			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	GAATAATATTGCCATACATCT	GAATAATATTGCCATACATCT	-	-	GAATAATATTGCCATACATCT	GAATAATATTGCCATACATCT	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr1:37979055_37979075delGAATAATATTGCCATACATCT	ENST00000296214.5	-	2	182_202	c.155_175delAGATGTATGGCAATATTATTC	c.(154-177)cagatgtatggcaatattattcgt>cgt	p.QMYGNII52del	MEAF6_ENST00000373075.2_In_Frame_Del_p.QMYGNII52del|MEAF6_ENST00000475828.1_5'UTR|MEAF6_ENST00000373074.1_In_Frame_Del_p.QMYGNII30del|MEAF6_ENST00000448519.2_In_Frame_Del_p.QMYGNII52del|MEAF6_ENST00000373073.4_In_Frame_Del_p.QMYGNII52del	NM_001270875.1	NP_001257804.1	Q9HAF1	EAF6_HUMAN	MYST/Esa1-associated factor 6	52					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H3-K14 acetylation (GO:0044154)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.I58delI(1)		autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(3)	7						TCCCAGCCACGAATAATATTGCCATACATCTGAGTGTCTTC	0.425																																							uc001cbg.1		NA																	1	Deletion - In frame(1)		autonomic_ganglia(1)		0						c.(154-177)CAGATGTATGGCAATATTATTCGT>CGT		MYST/Esa1-associated factor 6																																				SO:0001651	inframe_deletion	64769				histone H2A acetylation|histone H3-K14 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|NuA4 histone acetyltransferase complex|nucleolus	protein binding	g.chr1:37979055_37979075delGAATAATATTGCCATACATCT	BC016328	CCDS418.1, CCDS59195.1, CCDS59196.1	1p35.3-p33	2011-08-12	2009-07-13	2009-07-13	ENSG00000163875	ENSG00000163875			25674	protein-coding gene	gene with protein product	"""Esa1p-associated factor 6 homolog (S. cerevisiae)"", ""centromere protein 28"""	611001	"""chromosome 1 open reading frame 149"""	C1orf149		8619474, 9110174, 12963728, 14966270, 16387653	Standard	NM_022756		Approved	NY-SAR-91, FLJ11730, Eaf6, CENP-28	uc001cbe.2	Q9HAF1	OTTHUMG00000004223	ENST00000296214.5:c.155_175delAGATGTATGGCAATATTATTC	1.37:g.37979055_37979075delGAATAATATTGCCATACATCT	ENSP00000296214:p.Gln52_Ile58del					MEAF6_uc001cbd.1_In_Frame_Del_p.QMYGNII30del|MEAF6_uc001cbe.1_In_Frame_Del_p.QMYGNII52del|MEAF6_uc009vvd.1_RNA|MEAF6_uc001cbf.1_RNA|MEAF6_uc001cbh.1_In_Frame_Del_p.QMYGNII52del	p.QMYGNII52del	NM_022756	NP_073593	Q9HAF1	EAF6_HUMAN			2	172_192	-			52_58					B1AK64|Q4F967|Q7Z311|Q86WE3	In_Frame_Del	DEL	ENST00000296214.5	37	c.155_175delAGATGTATGGCAATATTATTC	CCDS59196.1																																																																																				0.425	MEAF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012161.1	NM_022756		26	120	NA	NA	NA	NA	NA	26	120	---	---	---	---
C1orf35	79169	broad.mit.edu	37	1	228289088	228289093	+	In_Frame_Del	DEL	TCTTTG	TCTTTG	-	rs377409030		TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	TCTTTG	TCTTTG	-	-	TCTTTG	TCTTTG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr1:228289088_228289093delTCTTTG	ENST00000272139.4	-	7	849_854	c.615_620delCAAAGA	c.(613-621)gacaaagag>gag	p.DK205del	C1orf35_ENST00000472617.1_5'UTR	NM_024319.2	NP_077295.1	Q9BU76	MMTA2_HUMAN	chromosome 1 open reading frame 35	205	Lys-rich.						poly(A) RNA binding (GO:0044822)			large_intestine(1)|lung(1)|skin(1)	3		Prostate(94;0.0488)				CCGCCTGTGCTCTTTGTCTttcttct	0.51																																							uc001hrx.2		NA																	0					0						c.(613-621)GACAAAGAG>GAG		hypothetical protein LOC79169																																				SO:0001651	inframe_deletion	79169							g.chr1:228289088_228289093delTCTTTG	AY137773	CCDS1566.1	1q42.13	2012-06-25			ENSG00000143793	ENSG00000143793			19032	protein-coding gene	gene with protein product	"""multiple myeloma tumor-associated protein 2"""					12545221	Standard	NM_024319		Approved	MGC4174, MMTAG2	uc001hrx.3	Q9BU76	OTTHUMG00000037793	ENST00000272139.4:c.615_620delCAAAGA	1.37:g.228289088_228289093delTCTTTG	ENSP00000272139:p.Asp205_Lys206del					C1orf35_uc009xew.2_RNA	p.DK205del	NM_024319	NP_077295	Q9BU76	MMTA2_HUMAN			7	709_714	-		Prostate(94;0.0488)	205_206			Lys-rich.		Q6P5Y0|Q6ZTZ6|Q6ZWA6|Q8IZH3	In_Frame_Del	DEL	ENST00000272139.4	37	c.615_620delCAAAGA	CCDS1566.1																																																																																				0.510	C1orf35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092245.1	NM_024319		21	47	NA	NA	NA	NA	NA	21	47	---	---	---	---
NLRP5	126206	broad.mit.edu	37	19	56538866	56538867	+	Frame_Shift_Ins	INS	-	-	CC	rs374218026		TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr19:56538866_56538867insCC	ENST00000390649.3	+	7	1267_1268	c.1267_1268insCC	c.(1267-1269)tctfs	p.S423fs		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	423	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		AGAGGTCGTGTCTCCCCGTTAC	0.55																																							uc002qmj.2		NA																	0				ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7						c.(1267-1269)TCTfs		NACHT, LRR and PYD containing protein 5																																				SO:0001589	frameshift_variant	126206					mitochondrion|nucleolus	ATP binding	g.chr19:56538866_56538867insCC	AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	Exception_encountered	19.37:g.56538866_56538867insCC	ENSP00000375063:p.Ser423fs					NLRP5_uc002qmi.2_Frame_Shift_Ins_p.S404fs	p.S423fs	NM_153447	NP_703148	P59047	NALP5_HUMAN		GBM - Glioblastoma multiforme(193;0.0326)	7	1267_1268	+		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)	423			NACHT.		A8MTY4|Q86W29	Frame_Shift_Ins	INS	ENST00000390649.3	37	c.1267_1268insCC	CCDS12938.1																																																																																				0.550	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313735.1	NM_153447		11	13	NA	NA	NA	NA	NA	11	13	---	---	---	---
ALPP	250	broad.mit.edu	37	2	233244592	233244592	+	Frame_Shift_Del	DEL	C	C	-			TCGA-05-4395-01A-01D-1265-08	TCGA-05-4395-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	dc45b4de-4c03-4fe4-89e0-d1cf378084b6	9e14ff2f-9657-4899-b988-f3b449284d39	g.chr2:233244592delC	ENST00000392027.2	+	5	872	c.603delC	c.(601-603)cgcfs	p.R201fs	AC068134.8_ENST00000439072.1_RNA|AC068134.8_ENST00000441266.1_RNA	NM_001632.3	NP_001623.3	P05187	PPB1_HUMAN	alkaline phosphatase, placental	201					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|magnesium ion binding (GO:0000287)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|endometrium(1)|kidney(4)|large_intestine(2)|liver(1)|lung(10)|ovary(2)	22		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)		CCTCCGCCCGCCAGGAGGGGT	0.667																																							uc002vsq.2		NA																	0				ovary(1)	1						c.(601-603)CGCfs		placental alkaline phosphatase preproprotein							58.0	62.0	60.0					2																	233244592		2203	4299	6502	SO:0001589	frameshift_variant	250					anchored to membrane|cell surface|integral to membrane|plasma membrane	alkaline phosphatase activity|metal ion binding	g.chr2:233244592delC	M14169	CCDS2490.1	2q37.1	2010-06-24	2010-06-24		ENSG00000163283	ENSG00000163283	3.1.3.1		439	protein-coding gene	gene with protein product	"""Regan isozyme"""	171800	"""alkaline phosphatase, placental (Regan isozyme)"""			3001717, 3461452	Standard	XM_005246439		Approved		uc002vsq.3	P05187	OTTHUMG00000133255	ENST00000392027.2:c.603delC	2.37:g.233244592delC	ENSP00000375881:p.Arg201fs					ALPP_uc002vsr.2_5'Flank	p.R201fs	NM_001632	NP_001623	P05187	PPB1_HUMAN		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)	5	768	+		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)	201					P05188|P06861|Q53S78|Q96DB7	Frame_Shift_Del	DEL	ENST00000392027.2	37	c.603delC	CCDS2490.1																																																																																				0.667	ALPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257032.3	NM_001632		34	40	NA	NA	NA	NA	NA	34	40	---	---	---	---
