#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
TNFRSF4	7293	broad.mit.edu	37	1	1148430	1148430	+	Silent	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:1148430G>A	ENST00000379236.3	-	3	316	c.312C>T	c.(310-312)gaC>gaT	p.D104D	TNFRSF4_ENST00000453580.1_5'UTR	NM_003327.3	NP_003318.1	P43489	TNR4_HUMAN	tumor necrosis factor receptor superfamily, member 4	104					cellular defense response (GO:0006968)|immune response (GO:0006955)|inflammatory response (GO:0006954)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of immunoglobulin secretion (GO:0051024)|regulation of apoptotic process (GO:0042981)|regulation of protein kinase activity (GO:0045859)|T cell proliferation (GO:0042098)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	tumor necrosis factor-activated receptor activity (GO:0005031)	p.D104D(1)		large_intestine(1)|lung(2)|urinary_tract(1)	4	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;3.73e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.01e-21)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;4.22e-05)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		GGCAGACTGTGTCCTGTGTGG	0.692																																							uc001ade.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(310-312)GAC>GAT		tumor necrosis factor receptor superfamily,							17.0	19.0	18.0					1																	1148430		2193	4287	6480	SO:0001819	synonymous_variant	7293				immune response|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription, DNA-dependent|positive regulation of B cell proliferation|positive regulation of immunoglobulin secretion|T cell proliferation	integral to plasma membrane	tumor necrosis factor receptor activity	g.chr1:1148430G>A	X75962	CCDS11.1	1p36	2008-02-05			ENSG00000186827	ENSG00000186827		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11918	protein-coding gene	gene with protein product		600315		TXGP1L		7510240, 2828930	Standard	NM_003327		Approved	ACT35, OX40, CD134	uc001ade.3	P43489	OTTHUMG00000001415	ENST00000379236.3:c.312C>T	1.37:g.1148430G>A						TNFRSF4_uc001adf.2_Silent_p.D108D	p.D104D	NM_003327	NP_003318	P43489	TNR4_HUMAN		Epithelial(90;3.73e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.01e-21)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;4.22e-05)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)	3	317	-	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)	104			TNFR-Cys 2.|Extracellular (Potential).		Q13663|Q2M312|Q5T7M0	Silent	SNP	ENST00000379236.3	37	c.312C>T	CCDS11.1	.	.	.	.	.	.	.	.	.	.	g	0.855	-0.737325	0.03111	.	.	ENSG00000186827	ENST00000453580	.	.	.	3.69	1.75	0.24633	.	.	.	.	.	T	0.54127	0.1839	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43637	-0.9379	4	.	.	.	-41.5468	6.5596	0.22479	0.2275:0.0:0.7725:0.0	.	.	.	.	Y	50	.	.	H	-	1	0	TNFRSF4	1138293	1.000000	0.71417	0.306000	0.25113	0.086000	0.17979	2.108000	0.41854	0.347000	0.23924	0.472000	0.43445	CAC		0.692	TNFRSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004086.1			5	28	0	0	0	0.004482	0	5	28				
FAM132A	388581	broad.mit.edu	37	1	1178014	1178014	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:1178014C>A	ENST00000330388.2	-	8	854	c.823G>T	c.(823-825)Gct>Tct	p.A275S		NM_001014980.2	NP_001014980.1	Q5T7M4	ADIPL_HUMAN	family with sequence similarity 132, member A	275	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				negative regulation of gluconeogenesis (GO:0045721)|negative regulation of inflammatory response (GO:0050728)|positive regulation of glucose import (GO:0046326)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of glucose import (GO:0046324)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)	p.A275S(1)		haematopoietic_and_lymphoid_tissue(1)|lung(1)	2	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;2.83e-35)|OV - Ovarian serous cystadenocarcinoma(86;2.22e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		AACACAGAAGCGTACTGTCCA	0.672																																							uc001adl.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(823-825)GCT>TCT		family with sequence similarity 132, member A							69.0	52.0	58.0					1																	1178014		2171	4281	6452	SO:0001583	missense	388581					extracellular region		g.chr1:1178014C>A	BC089443	CCDS30554.1	1p36.33	2012-03-26	2007-03-27	2007-03-27	ENSG00000184163	ENSG00000184163			32308	protein-coding gene	gene with protein product	"""adipolin"", ""adipose-derived insulin-sensitizing factor"""		"""C1q domain containing 2"""	C1QDC2		21849507	Standard	NM_001014980		Approved	MGC105127, C1QTNF12, CTRP12	uc001adl.2	Q5T7M4	OTTHUMG00000001412	ENST00000330388.2:c.823G>T	1.37:g.1178014C>A	ENSP00000329137:p.Ala275Ser						p.A275S	NM_001014980	NP_001014980	Q5T7M4	F132A_HUMAN		Epithelial(90;2.83e-35)|OV - Ovarian serous cystadenocarcinoma(86;2.22e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)	8	855	-	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)	275					Q5EBL5	Missense_Mutation	SNP	ENST00000330388.2	37	c.823G>T	CCDS30554.1	.	.	.	.	.	.	.	.	.	.	C	9.341	1.063135	0.19987	.	.	ENSG00000184163	ENST00000330388	T	0.42513	0.97	3.28	-0.96	0.10340	Tumour necrosis factor-like (2);	0.316572	0.32687	N	0.005780	T	0.25717	0.0626	L	0.28115	0.83	0.20074	N	0.999937	B	0.33103	0.397	B	0.35727	0.209	T	0.15694	-1.0428	10	0.59425	D	0.04	.	6.1408	0.20259	0.0:0.428:0.0:0.572	.	275	Q5T7M4	F132A_HUMAN	S	275	ENSP00000329137:A275S	ENSP00000329137:A275S	A	-	1	0	FAM132A	1167877	0.019000	0.18553	0.038000	0.18304	0.013000	0.08279	-0.047000	0.11963	-0.045000	0.13468	0.555000	0.69702	GCT		0.672	FAM132A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004080.4	XM_371208		3	8	1	0	6.4e-05	0.004672	7.32707e-05	3	8				
ACAP3	116983	broad.mit.edu	37	1	1237394	1237394	+	Silent	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:1237394C>A	ENST00000354700.5	-	5	514	c.312G>T	c.(310-312)cgG>cgT	p.R104R	ACAP3_ENST00000353662.3_Silent_p.R62R	NM_030649.2	NP_085152.2	Q96P50	ACAP3_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH domains 3	104					regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.R104R(1)|p.R62R(1)		endometrium(3)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	14						GGAGCTGCTGCCGCACGGACC	0.652																																							uc001aeb.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(310-312)CGG>CGT		ArfGAP with coiled-coil, ankyrin repeat and PH							47.0	53.0	51.0					1																	1237394		2198	4295	6493	SO:0001819	synonymous_variant	116983				filopodium assembly|regulation of ARF GTPase activity|signal transduction		ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding	g.chr1:1237394C>A	AF411981	CCDS19.2	1p36	2013-01-10	2008-09-22	2008-09-22	ENSG00000131584	ENSG00000131584		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16754	protein-coding gene	gene with protein product			"""centaurin, beta 5"""	CENTB5			Standard	NM_030649		Approved	KIAA1716	uc001aeb.2	Q96P50	OTTHUMG00000002235	ENST00000354700.5:c.312G>T	1.37:g.1237394C>A						ACAP3_uc001aea.2_Silent_p.R62R|ACAP3_uc001aec.1_Silent_p.R62R	p.R104R	NM_030649	NP_085152	Q96P50	ACAP3_HUMAN			5	386	-			104					B1AMF5|Q5TA42|Q5TA43|Q86UT3|Q9BSR9|Q9C0E7	Silent	SNP	ENST00000354700.5	37	c.312G>T	CCDS19.2																																																																																				0.652	ACAP3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006366.2	NM_030649		4	90	1	0	5.9392e-07	0.001168	7.45051e-07	4	90				
ACTRT2	140625	broad.mit.edu	37	1	2938683	2938683	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:2938683G>A	ENST00000378404.2	+	1	638	c.433G>A	c.(433-435)Gct>Act	p.A145T		NM_080431.4	NP_536356.3	Q8TDY3	ACTT2_HUMAN	actin-related protein T2	145						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.A145T(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(15)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	26	all_cancers(77;0.00205)|all_epithelial(69;0.0011)|Ovarian(185;0.0634)|Lung NSC(156;0.0893)|all_lung(157;0.0909)	all_epithelial(116;2.66e-20)|all_lung(118;1.56e-08)|Lung NSC(185;2.54e-06)|Breast(487;0.00156)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;7.19e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.15e-22)|GBM - Glioblastoma multiforme(42;1.1e-12)|Colorectal(212;3.98e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.000329)|BRCA - Breast invasive adenocarcinoma(365;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.125)		GGCGGTGCTGGCTCTCTACGC	0.632																																							uc001ajz.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(433-435)GCT>ACT		actin-related protein M2							66.0	61.0	63.0					1																	2938683		2203	4300	6503	SO:0001583	missense	140625					cytoplasm|cytoskeleton		g.chr1:2938683G>A	AF440740, AB057364	CCDS45.1	1p36.3	2008-02-05	2005-11-22		ENSG00000169717	ENSG00000169717			24026	protein-coding gene	gene with protein product		608535				11750065, 12243744	Standard	NM_080431		Approved	Arp-T2, ARPM2, FLJ25424	uc001ajz.3	Q8TDY3	OTTHUMG00000000562	ENST00000378404.2:c.433G>A	1.37:g.2938683G>A	ENSP00000367658:p.Ala145Thr						p.A145T	NM_080431	NP_536356	Q8TDY3	ACTT2_HUMAN		Epithelial(90;7.19e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.15e-22)|GBM - Glioblastoma multiforme(42;1.1e-12)|Colorectal(212;3.98e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.000329)|BRCA - Breast invasive adenocarcinoma(365;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.125)	1	638	+	all_cancers(77;0.00205)|all_epithelial(69;0.0011)|Ovarian(185;0.0634)|Lung NSC(156;0.0893)|all_lung(157;0.0909)	all_epithelial(116;2.66e-20)|all_lung(118;1.56e-08)|Lung NSC(185;2.54e-06)|Breast(487;0.00156)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)	145					B1AN52|Q8NHS6|Q8TDG1	Missense_Mutation	SNP	ENST00000378404.2	37	c.433G>A	CCDS45.1	.	.	.	.	.	.	.	.	.	.	G	15.12	2.739684	0.49045	.	.	ENSG00000169717	ENST00000378404;ENST00000543312	D	0.97553	-4.43	4.85	3.93	0.45458	.	0.000000	0.56097	D	0.000036	D	0.94598	0.8259	L	0.54863	1.705	0.47659	D	0.999486	B	0.27166	0.17	B	0.30029	0.11	D	0.92036	0.5637	10	0.87932	D	0	.	6.9316	0.24444	0.0901:0.0:0.7374:0.1725	.	145	Q8TDY3	ACTT2_HUMAN	T	145	ENSP00000367658:A145T	ENSP00000367658:A145T	A	+	1	0	ACTRT2	2928543	1.000000	0.71417	0.996000	0.52242	0.362000	0.29581	2.399000	0.44495	1.029000	0.39812	0.561000	0.74099	GCT		0.632	ACTRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001331.1	NM_080431		8	52	0	0	0	0.00308	0	8	52				
TAS1R1	80835	broad.mit.edu	37	1	6631143	6631143	+	Silent	SNP	A	A	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:6631143A>T	ENST00000333172.6	+	2	559	c.366A>T	c.(364-366)ccA>ccT	p.P122P	TAS1R1_ENST00000351136.3_Silent_p.P122P|TAS1R1_ENST00000328191.4_Silent_p.P122P	NM_138697.3	NP_619642.2	Q7RTX1	TS1R1_HUMAN	taste receptor, type 1, member 1	122					detection of chemical stimulus involved in sensory perception of taste (GO:0050912)|sensory perception of umami taste (GO:0050917)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)	p.P122P(1)		NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(13)|ovary(1)|skin(1)|urinary_tract(2)	29	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;8.73e-34)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		TCTCCCTGCCAGGGCAACACC	0.587																																							uc001ant.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(364-366)CCA>CCT		sweet taste receptor T1r isoform b							173.0	155.0	161.0					1																	6631143		2203	4300	6503	SO:0001819	synonymous_variant	80835				sensory perception of umami taste	plasma membrane	protein heterodimerization activity|taste receptor activity	g.chr1:6631143A>T		CCDS81.1, CCDS82.1	1p36.23	2012-08-22	2003-03-24		ENSG00000173662	ENSG00000173662		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14448	protein-coding gene	gene with protein product		606225	"""G protein-coupled receptor 70"""	GPR70			Standard	NM_138697		Approved	T1R1, TR1	uc001ant.3	Q7RTX1	OTTHUMG00000001441	ENST00000333172.6:c.366A>T	1.37:g.6631143A>T						TAS1R1_uc001anu.2_Silent_p.P122P|TAS1R1_uc001anv.2_Silent_p.P122P|TAS1R1_uc001anw.2_Silent_p.P122P	p.P122P	NM_138697	NP_619642	Q7RTX1	TS1R1_HUMAN		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)	2	366	+	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;8.73e-34)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)	122			Extracellular (Potential).		B2RMX0|Q5SY22|Q5SY24|Q8NGZ7|Q8TDJ7|Q8TDJ8|Q8TDJ9|Q8TDK0	Silent	SNP	ENST00000333172.6	37	c.366A>T	CCDS81.1	.	.	.	.	.	.	.	.	.	.	A	6.191	0.403368	0.11754	.	.	ENSG00000173662	ENST00000411823;ENST00000415267	.	.	.	5.08	-9.61	0.00550	.	.	.	.	.	T	0.24392	0.0591	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.26360	-1.0105	4	.	.	.	.	8.0695	0.30680	0.474:0.3267:0.1993:0.0	.	.	.	.	L	48	.	.	Q	+	2	0	TAS1R1	6553730	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.907000	0.01589	-1.500000	0.01819	-0.280000	0.10049	CAG		0.587	TAS1R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004211.1			14	179	0	0	0	0.003163	0	14	179				
SPEN	23013	broad.mit.edu	37	1	16265829	16265829	+	Silent	SNP	C	C	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:16265829C>T	ENST00000375759.3	+	15	11106	c.10902C>T	c.(10900-10902)ttC>ttT	p.F3634F		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	3634	SPOC. {ECO:0000255|PROSITE- ProRule:PRU00249}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)	p.F3634F(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		CCTGTGAGTTCTCTGAGAGTC	0.582																																							uc001axk.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(6)|breast(3)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15						c.(10900-10902)TTC>TTT		spen homolog, transcriptional regulator							216.0	202.0	207.0					1																	16265829		2203	4300	6503	SO:0001819	synonymous_variant	23013				interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|Notch signaling pathway	nucleus	nucleotide binding|protein binding|RNA binding	g.chr1:16265829C>T		CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.10902C>T	1.37:g.16265829C>T						SPEN_uc010obp.1_Silent_p.F3593F	p.F3634F	NM_015001	NP_055816	Q96T58	MINT_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)	15	11106	+		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)	3634			SPOC.		Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Silent	SNP	ENST00000375759.3	37	c.10902C>T	CCDS164.1																																																																																				0.582	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	NM_015001		74	135	0	0	0	0.00361	0	74	135				
TAS1R2	80834	broad.mit.edu	37	1	19186147	19186147	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:19186147G>T	ENST00000375371.3	-	1	29	c.8C>A	c.(7-9)cCc>cAc	p.P3H	RP13-279N23.2_ENST00000494072.3_3'UTR	NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	3					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)	p.P3H(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	CTTTGCCCTGGGCCCCATGGC	0.562																																							uc001bba.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)|central_nervous_system(1)	4						c.(7-9)CCC>CAC		taste receptor, type 1, member 2 precursor	Aspartame(DB00168)						97.0	92.0	94.0					1																	19186147		2203	4300	6503	SO:0001583	missense	80834				detection of chemical stimulus involved in sensory perception of sweet taste	plasma membrane	protein heterodimerization activity|taste receptor activity	g.chr1:19186147G>T		CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.8C>A	1.37:g.19186147G>T	ENSP00000364520:p.Pro3His						p.P3H	NM_152232	NP_689418	Q8TE23	TS1R2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	1	9	-		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)	3					Q5TZ19	Missense_Mutation	SNP	ENST00000375371.3	37	c.8C>A	CCDS187.1	.	.	.	.	.	.	.	.	.	.	g	14.35	2.510480	0.44660	.	.	ENSG00000179002	ENST00000375371	D	0.88818	-2.43	3.94	-1.58	0.08479	.	.	.	.	.	D	0.89167	0.6638	L	0.47716	1.5	0.09310	N	1	D	0.76494	0.999	D	0.65573	0.936	T	0.78745	-0.2084	9	0.87932	D	0	.	4.2577	0.10726	0.4049:0.1689:0.4261:0.0	.	3	Q8TE23	TS1R2_HUMAN	H	3	ENSP00000364520:P3H	ENSP00000364520:P3H	P	-	2	0	TAS1R2	19058734	0.002000	0.14202	0.003000	0.11579	0.227000	0.25037	0.172000	0.16704	-0.423000	0.07394	0.306000	0.20318	CCC		0.562	TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000006953.1			9	66	1	0	1.58986e-06	0.008291	1.92151e-06	9	66				
RHD	6007	broad.mit.edu	37	1	25627475	25627475	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:25627475C>A	ENST00000328664.4	+	4	680	c.525C>A	c.(523-525)ttC>ttA	p.F175L	RHD_ENST00000423810.2_Missense_Mutation_p.F175L|RHD_ENST00000454452.2_Missense_Mutation_p.F175L|RHD_ENST00000342055.5_Missense_Mutation_p.F175L|RHD_ENST00000423253.1_3'UTR|RHD_ENST00000568195.1_Missense_Mutation_p.F175L|RHD_ENST00000357542.4_Missense_Mutation_p.F175L|RHD_ENST00000417538.2_Missense_Mutation_p.F175L	NM_001282867.1|NM_016124.3	NP_001269796.1|NP_057208	Q02161	RHD_HUMAN	Rh blood group, D antigen	175						integral component of plasma membrane (GO:0005887)	ammonium transmembrane transporter activity (GO:0008519)	p.F175L(1)		breast(2)|large_intestine(4)|lung(7)|prostate(1)	14		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;7.39e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;6.43e-07)|STAD - Stomach adenocarcinoma(196;0.000332)|BRCA - Breast invasive adenocarcinoma(304;0.000438)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|GBM - Glioblastoma multiforme(114;0.000908)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		TCTACGTGTTCGCAGCCTATT	0.532																																							uc001bjz.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(523-525)TTC>TTA		Rh blood group D antigen isoform 1							221.0	151.0	176.0					1																	25627475		2124	3754	5878	SO:0001583	missense	6007					integral to plasma membrane		g.chr1:25627475C>A	AB012623	CCDS262.1, CCDS53285.1, CCDS60027.1, CCDS60028.1, CCDS60029.1, CCDS60030.1, CCDS60031.1	1p36.11	2014-07-19	2013-10-02		ENSG00000187010	ENSG00000187010		"""CD molecules"", ""Blood group antigens"""	10009	protein-coding gene	gene with protein product		111680	"""Rhesus blood group, D antigen"", ""Rh blood group, D antigen"""	RH		8220426	Standard	NM_016124		Approved	Rh30a, Rh4, RhPI, RhII, DIIIc, CD240D	uc001bjz.3	Q02161	OTTHUMG00000003476	ENST00000328664.4:c.525C>A	1.37:g.25627475C>A	ENSP00000331871:p.Phe175Leu					RHD_uc010oep.1_Missense_Mutation_p.F175L|RHD_uc001bkc.2_Missense_Mutation_p.F175L|RHD_uc009vrm.2_Missense_Mutation_p.F7L|RHD_uc001bka.2_Missense_Mutation_p.F175L|RHD_uc001bkb.2_Missense_Mutation_p.F175L|RHD_uc009vrn.2_Missense_Mutation_p.F175L|RHD_uc009vro.2_Missense_Mutation_p.F175L|RHD_uc009vrp.2_Missense_Mutation_p.F175L	p.F175L	NM_016124	NP_057208	Q02161	RHD_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;7.39e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;6.43e-07)|STAD - Stomach adenocarcinoma(196;0.000332)|BRCA - Breast invasive adenocarcinoma(304;0.000438)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|GBM - Glioblastoma multiforme(114;0.000908)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)	4	583	+		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)	175			Helical; (Potential).		Q02162|Q07618|Q16147|Q16235|Q16355|Q5VSK0|Q5XLS9|Q5XLT1|Q5XLT2|Q9NPK0|Q9UQ20|Q9UQ21|Q9UQ22|Q9UQ23	Missense_Mutation	SNP	ENST00000328664.4	37	c.525C>A	CCDS262.1	.	.	.	.	.	.	.	.	.	.	.	12.14	1.847503	0.32606	.	.	ENSG00000187010	ENST00000328664;ENST00000419831;ENST00000454452;ENST00000342055;ENST00000357542;ENST00000417538;ENST00000423810	T;T;T;T;T;T	0.22743	1.94;1.94;1.94;1.94;1.94;1.94	3.95	-1.28	0.09318	Ammonium transporter AmtB-like (3);	0.000000	0.85682	D	0.000000	T	0.48466	0.1501	M	0.93197	3.39	0.58432	D	0.999999	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;0.994;1.0;1.0;0.999;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	1.0;1.0;0.987;1.0;1.0;0.996;1.0;0.992	T	0.50566	-0.8813	10	0.87932	D	0	-19.7587	7.3018	0.26424	0.0:0.4979:0.0:0.5021	.	175;175;175;175;175;175;175;175	B4DLT8;Q5XLT1;Q5XLS9;Q5XLT2;Q5XLT3;E7EVW1;Q5XLT0;Q02161	.;.;.;.;.;.;.;RHD_HUMAN	L	175	ENSP00000331871:F175L;ENSP00000413849:F175L;ENSP00000339577:F175L;ENSP00000350150:F175L;ENSP00000396420:F175L;ENSP00000399640:F175L	ENSP00000331871:F175L	F	+	3	2	RHD	25500062	0.998000	0.40836	0.829000	0.32907	0.002000	0.02628	0.233000	0.17911	-0.179000	0.10654	-0.515000	0.04445	TTC		0.532	RHD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009660.5	NM_016124		25	152	1	0	9.86323e-18	0.003954	1.53976e-17	25	152				
CSMD2	114784	broad.mit.edu	37	1	34258067	34258067	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:34258067C>T	ENST00000338325.1	-	5	743	c.331G>A	c.(331-333)Ggt>Agt	p.G111S	CSMD2_ENST00000373381.4_Missense_Mutation_p.G503S			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	463	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G463S(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CCACCATCACCGACCGTCAGG	0.572																																							uc001bxn.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|skin(5)|pancreas(1)	12						c.(1387-1389)GGT>AGT		CUB and Sushi multiple domains 2							192.0	156.0	169.0					1																	34258067		2203	4300	6503	SO:0001583	missense	114784					integral to membrane|plasma membrane	protein binding	g.chr1:34258067C>T	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000338325.1:c.331G>A	1.37:g.34258067C>T	ENSP00000340311:p.Gly111Ser					CSMD2_uc001bxm.1_Missense_Mutation_p.G503S	p.G463S	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN			11	1416	-		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)	463			CUB 3.|Extracellular (Potential).		B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000338325.1	37	c.1387G>A		.	.	.	.	.	.	.	.	.	.	C	26.2	4.717147	0.89205	.	.	ENSG00000121904	ENST00000373381;ENST00000338325	T;T	0.26957	1.7;1.7	5.2	5.2	0.72013	CUB (5);	0.000000	0.85682	D	0.000000	T	0.39809	0.1092	L	0.29908	0.895	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.13361	-1.0512	10	0.45353	T	0.12	.	16.2961	0.82769	0.0:1.0:0.0:0.0	.	463;503	Q7Z408;E7EUA6	CSMD2_HUMAN;.	S	503;111	ENSP00000362479:G503S;ENSP00000340311:G111S	ENSP00000241312:G463S	G	-	1	0	CSMD2	34030654	1.000000	0.71417	0.985000	0.45067	0.925000	0.55904	7.468000	0.80943	2.466000	0.83321	0.461000	0.40582	GGT		0.572	CSMD2-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000036404.2	NM_052896		30	65	0	0	0	0.002096	0	30	65				
POMGNT1	55624	broad.mit.edu	37	1	46658031	46658031	+	Silent	SNP	C	C	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:46658031C>T	ENST00000371984.3	-	16	1519	c.1362G>A	c.(1360-1362)agG>agA	p.R454R	POMGNT1_ENST00000485714.1_5'UTR|POMGNT1_ENST00000396420.3_3'UTR|POMGNT1_ENST00000371992.1_Silent_p.R454R|POMGNT1_ENST00000535522.1_Silent_p.R432R|POMGNT1_ENST00000371986.3_Silent_p.R454R	NM_017739.3	NP_060209	Q8WZA1	PMGT1_HUMAN	protein O-linked mannose N-acetylglucosaminyltransferase 1 (beta 1,2-)	454					protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,3-N-acetylglucosaminyltransferase activity (GO:0047223)	p.R454R(2)		breast(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	20	Acute lymphoblastic leukemia(166;0.155)					ACAAGGACCTCCTGAGCACCC	0.602																																							uc001cpe.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(1360-1362)AGG>AGA		O-linked mannose							74.0	72.0	73.0					1																	46658031		2203	4300	6503	SO:0001819	synonymous_variant	55624				protein N-linked glycosylation|protein O-linked glycosylation	Golgi membrane|integral to membrane|microsome	alpha-1,3-mannosylglycoprotein 2-beta-N-acetylglucosaminyltransferase activity|beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,3-N-acetylglucosaminyltransferase activity	g.chr1:46658031C>T		CCDS531.1, CCDS57995.1	1p34.1	2014-09-17	2013-07-31		ENSG00000085998	ENSG00000085998	2.4.1.-	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	19139	protein-coding gene	gene with protein product	"""protein O-mannose beta-1,2-N-acetylglucosaminyltransferase"""	606822	"""muscle-eye-brain disease"", ""protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase"""	MEB		11742540, 12788071	Standard	NM_017739		Approved	FLJ20277, MGAT1.2, LGMD2O	uc001cpg.3	Q8WZA1	OTTHUMG00000007604	ENST00000371984.3:c.1362G>A	1.37:g.46658031C>T						POMGNT1_uc010olx.1_Silent_p.R432R|POMGNT1_uc010oly.1_RNA|POMGNT1_uc010olz.1_Silent_p.R311R|POMGNT1_uc001cpg.2_Silent_p.R454R|POMGNT1_uc001cpf.2_Silent_p.R121R|POMGNT1_uc001cph.1_Silent_p.R32R|POMGNT1_uc001cpi.1_Silent_p.R121R	p.R454R	NM_017739	NP_060209	Q8WZA1	PMGT1_HUMAN			16	1526	-	Acute lymphoblastic leukemia(166;0.155)		454			Lumenal (Potential).		D3DQ16|Q5VST2|Q5VST3|Q9BV55|Q9H9L8|Q9NXF9|Q9NYF7	Silent	SNP	ENST00000371984.3	37	c.1362G>A	CCDS531.1																																																																																				0.602	POMGNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020146.1	NM_017739		9	68	0	0	0	0.004482	0	9	68				
LRRC42	115353	broad.mit.edu	37	1	54417792	54417792	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:54417792G>T	ENST00000371370.3	+	3	641	c.120G>T	c.(118-120)aaG>aaT	p.K40N	LRRC42_ENST00000319223.4_Missense_Mutation_p.K40N	NM_001256409.1	NP_001243338.1	Q9Y546	LRC42_HUMAN	leucine rich repeat containing 42	40								p.K40N(1)		breast(2)|kidney(1)|large_intestine(1)|lung(5)	9						GCCTGCAGAAGCCAAGGCCTT	0.517																																							uc001cwj.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(118-120)AAG>AAT		leucine rich repeat containing 42							80.0	81.0	80.0					1																	54417792		2203	4300	6503	SO:0001583	missense	115353							g.chr1:54417792G>T	AK075201	CCDS585.1	1p33-p32.1	2014-02-12			ENSG00000116212	ENSG00000116212			28792	protein-coding gene	gene with protein product						12477932	Standard	NM_001256409		Approved	MGC8974	uc001cwj.2	Q9Y546	OTTHUMG00000008436	ENST00000371370.3:c.120G>T	1.37:g.54417792G>T	ENSP00000360421:p.Lys40Asn					LRRC42_uc001cwl.1_Missense_Mutation_p.K40N|LRRC42_uc001cwk.1_Missense_Mutation_p.K40N|LRRC42_uc009vzm.1_Missense_Mutation_p.K40N	p.K40N	NM_052940	NP_443172	Q9Y546	LRC42_HUMAN			2	320	+			40					D3DQ46|Q8N2Q8	Missense_Mutation	SNP	ENST00000371370.3	37	c.120G>T	CCDS585.1	.	.	.	.	.	.	.	.	.	.	G	11.91	1.778635	0.31502	.	.	ENSG00000116212	ENST00000371370;ENST00000371368;ENST00000319223;ENST00000444987	.	.	.	5.64	4.73	0.59995	.	0.380688	0.29737	N	0.011321	T	0.23094	0.0558	N	0.14661	0.345	0.30719	N	0.748405	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.06405	0.002;0.002;0.0	T	0.09228	-1.0684	9	0.42905	T	0.14	-10.3527	5.4258	0.16425	0.1707:0.0:0.6669:0.1624	.	40;40;40	E7EP35;A6NL66;Q9Y546	.;.;LRC42_HUMAN	N	40	.	ENSP00000318185:K40N	K	+	3	2	LRRC42	54190380	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.272000	0.51616	1.528000	0.49103	0.650000	0.86243	AAG		0.517	LRRC42-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023250.1	NM_052940		30	72	1	0	2.85442e-18	0.002096	4.46847e-18	30	72				
FAM151A	338094	broad.mit.edu	37	1	55080475	55080475	+	Missense_Mutation	SNP	C	C	T	rs150113940	byFrequency	TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:55080475C>T	ENST00000302250.2	-	4	633	c.473G>A	c.(472-474)cGg>cAg	p.R158Q	FAM151A_ENST00000371304.2_Missense_Mutation_p.R158Q|ACOT11_ENST00000371316.3_Intron	NM_176782.2	NP_788954.2	Q8WW52	F151A_HUMAN	family with sequence similarity 151, member A	158						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.R158Q(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	12						TGTCAGCTGCCGCAGGAGGTC	0.557													C|||	3	0.000599042	0.0	0.0	5008	,	,		18449	0.0		0.003	False		,,,				2504	0.0						uc001cxn.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(472-474)CGG>CAG		hypothetical protein LOC338094		C	,GLN/ARG	6,4400	11.4+/-27.6	0,6,2197	90.0	79.0	82.0		,473	3.6	0.9	1	dbSNP_134	82	25,8575	19.2+/-60.6	0,25,4275	yes	intron,missense	ACOT11,FAM151A	NM_015547.3,NM_176782.2	,43	0,31,6472	TT,TC,CC		0.2907,0.1362,0.2384	,probably-damaging	,158/586	55080475	31,12975	2203	4300	6503	SO:0001583	missense	338094					integral to membrane		g.chr1:55080475C>T	AK091901	CCDS594.1	1p32.3	2008-02-05	2007-12-18	2007-12-18	ENSG00000162391	ENSG00000162391			25032	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 179"""	C1orf179		17273976	Standard	NM_176782		Approved	MGC27169	uc001cxn.3	Q8WW52	OTTHUMG00000009888	ENST00000302250.2:c.473G>A	1.37:g.55080475C>T	ENSP00000306888:p.Arg158Gln					ACOT11_uc001cxm.1_Intron	p.R158Q	NM_176782	NP_788954	Q8WW52	F151A_HUMAN			4	605	-			158					Q5VUG5|Q6DKH5|Q6UWV0|Q8NAX9|Q96KY5	Missense_Mutation	SNP	ENST00000302250.2	37	c.473G>A	CCDS594.1	3	0.0013736263736263737	0	0.0	0	0.0	0	0.0	3	0.00395778364116095	C	11.04	1.520558	0.27211	0.001362	0.002907	ENSG00000162391	ENST00000302250;ENST00000371304;ENST00000294370	T;T	0.12039	2.72;2.72	3.6	3.6	0.41247	.	0.444374	0.19958	N	0.102273	T	0.13841	0.0335	M	0.67953	2.075	0.20563	N	0.999885	B	0.31581	0.329	B	0.25140	0.058	T	0.12400	-1.0549	10	0.22109	T	0.4	-29.7803	10.9205	0.47161	0.0:1.0:0.0:0.0	.	158	Q8WW52	F151A_HUMAN	Q	158	ENSP00000306888:R158Q;ENSP00000360353:R158Q	ENSP00000294370:R158Q	R	-	2	0	FAM151A	54853063	0.000000	0.05858	0.932000	0.37286	0.919000	0.55068	0.062000	0.14389	1.993000	0.58246	0.462000	0.41574	CGG		0.557	FAM151A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027342.1	NM_176782		5	59	0	0	0	0.001168	0	5	59				
C1orf168	199920	broad.mit.edu	37	1	57257990	57257990	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:57257990C>A	ENST00000343433.6	-	2	576	c.496G>T	c.(496-498)Gcc>Tcc	p.A166S	C1orf168_ENST00000484327.1_5'UTR	NM_001004303.4	NP_001004303.3	Q5VWT5	CA168_HUMAN	chromosome 1 open reading frame 168	166								p.A166S(1)		NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(13)|ovary(3)|skin(6)|stomach(1)|urinary_tract(2)	46						AGATGGATGGCCTTACTTCCA	0.483																																							uc001cym.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)	5						c.(496-498)GCC>TCC		hypothetical protein LOC199920							102.0	99.0	100.0					1																	57257990		2203	4300	6503	SO:0001583	missense	199920							g.chr1:57257990C>A	BX648439	CCDS30729.1	1p32.2	2011-02-22			ENSG00000187889	ENSG00000187889			27295	protein-coding gene	gene with protein product						14702039	Standard	NM_001004303		Approved	RP4-758N20.2, FLJ43208	uc001cym.4	Q5VWT5	OTTHUMG00000008281	ENST00000343433.6:c.496G>T	1.37:g.57257990C>A	ENSP00000345972:p.Ala166Ser					C1orf168_uc009vzu.1_RNA|C1orf168_uc009vzv.1_Missense_Mutation_p.A166S	p.A166S	NM_001004303	NP_001004303	Q5VWT5	CA168_HUMAN			2	902	-			166					Q63HM3|Q6ZUY6	Missense_Mutation	SNP	ENST00000343433.6	37	c.496G>T	CCDS30729.1	.	.	.	.	.	.	.	.	.	.	C	8.184	0.794512	0.16327	.	.	ENSG00000187889	ENST00000343433	T	0.33654	1.4	4.55	-0.207	0.13189	.	0.453672	0.18881	N	0.128567	T	0.15349	0.0370	N	0.14661	0.345	0.09310	N	1	B;B	0.23891	0.093;0.027	B;B	0.26864	0.074;0.015	T	0.21759	-1.0236	10	0.13470	T	0.59	0.294	3.2732	0.06889	0.1801:0.4436:0.0:0.3763	.	166;166	Q5VWT5-2;Q5VWT5	.;CA168_HUMAN	S	166	ENSP00000345972:A166S	ENSP00000345972:A166S	A	-	1	0	C1orf168	57030578	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.307000	0.08167	-0.120000	0.11809	-1.138000	0.01928	GCC		0.483	C1orf168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022751.2	NM_001004303		6	121	1	0	0.00116845	0.001168	0.00125798	6	121				
PDE4B	5142	broad.mit.edu	37	1	66713283	66713283	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:66713283A>T	ENST00000329654.4	+	4	609	c.422A>T	c.(421-423)gAc>gTc	p.D141V	PDE4B_ENST00000371049.3_Missense_Mutation_p.D141V|PDE4B_ENST00000423207.2_Missense_Mutation_p.D126V	NM_001037341.1	NP_001032418.1	Q07343	PDE4B_HUMAN	phosphodiesterase 4B, cAMP-specific	141					cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|leukocyte migration (GO:0050900)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|neutrophil homeostasis (GO:0001780)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of high voltage-gated calcium channel activity (GO:1901841)|T cell receptor signaling pathway (GO:0050852)	cell periphery (GO:0071944)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)	p.D141V(1)|p.D126V(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	37					Adenosine monophosphate(DB00131)|Amrinone(DB01427)|Caffeine(DB00201)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Papaverine(DB01113)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theobromine(DB01412)|Theophylline(DB00277)	TCAGACAGCGACTATGACTTG	0.527																																							uc001dcn.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|central_nervous_system(1)	3						c.(421-423)GAC>GTC		phosphodiesterase 4B isoform 1	Adenosine monophosphate(DB00131)|Amrinone(DB01427)|Caffeine(DB00201)|Cilostazol(DB01166)|Dyphylline(DB00651)|Enprofylline(DB00824)|Papaverine(DB01113)|Pentoxifylline(DB00806)|Theophylline(DB00277)						131.0	121.0	124.0					1																	66713283		2203	4300	6503	SO:0001583	missense	5142				signal transduction	cytosol|insoluble fraction|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding	g.chr1:66713283A>T	L20971	CCDS632.1, CCDS30742.1, CCDS30743.1, CCDS72802.1	1p31	2010-06-24	2010-06-24		ENSG00000184588	ENSG00000184588		"""Phosphodiesterases"""	8781	protein-coding gene	gene with protein product	"""phosphodiesterase E4 dunce homolog (Drosophila)"""	600127	"""phosphodiesterase 4B, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E4)"", ""phosphodiesterase 4B, cAMP-specific (phosphodiesterase E4 dunce homolog, Drosophila)"""	DPDE4			Standard	XM_005270925		Approved		uc001dco.3	Q07343	OTTHUMG00000009088	ENST00000329654.4:c.422A>T	1.37:g.66713283A>T	ENSP00000332116:p.Asp141Val					PDE4B_uc009war.2_Missense_Mutation_p.D49V|PDE4B_uc001dco.2_Missense_Mutation_p.D141V|PDE4B_uc001dcp.2_Missense_Mutation_p.D126V	p.D141V	NM_001037341	NP_001032418	Q07343	PDE4B_HUMAN			4	613	+			141					A5YW33|O15443|Q13945|Q5TEK4|Q5TEK5|Q5TEK6	Missense_Mutation	SNP	ENST00000329654.4	37	c.422A>T	CCDS632.1	.	.	.	.	.	.	.	.	.	.	A	28.8	4.950122	0.92660	.	.	ENSG00000184588	ENST00000329654;ENST00000341517;ENST00000371049;ENST00000423207;ENST00000412480	T;T;T;T;D	0.83419	-0.79;-0.79;-0.79;-0.8;-1.72	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	D	0.89203	0.6648	M	0.77406	2.37	0.80722	D	1	D;D;D	0.71674	0.998;0.997;0.991	D;D;P	0.68483	0.958;0.91;0.806	D	0.90808	0.4699	10	0.87932	D	0	.	16.0858	0.81049	1.0:0.0:0.0:0.0	.	126;131;141	Q07343-3;Q59GM8;Q07343	.;.;PDE4B_HUMAN	V	141;141;141;126;49	ENSP00000332116:D141V;ENSP00000342637:D141V;ENSP00000360088:D141V;ENSP00000392947:D126V;ENSP00000397548:D49V	ENSP00000332116:D141V	D	+	2	0	PDE4B	66485871	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.339000	0.96797	2.198000	0.70561	0.533000	0.62120	GAC		0.527	PDE4B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000025188.3	NM_002600		25	132	0	0	0	0.003954	0	25	132				
ZZZ3	26009	broad.mit.edu	37	1	78098198	78098198	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:78098198T>C	ENST00000370801.3	-	5	1317	c.842A>G	c.(841-843)aAa>aGa	p.K281R	ZZZ3_ENST00000370798.1_Intron|ZZZ3_ENST00000476275.1_5'UTR	NM_015534.4	NP_056349.1	Q8IYH5	ZZZ3_HUMAN	zinc finger, ZZ-type containing 3	281					chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.K281R(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(2)	39						AGTTACTATTTTGTGGTCCTC	0.443																																							uc001dhq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|large_intestine(1)	5						c.(841-843)AAA>AGA		zinc finger, ZZ-type containing 3							115.0	108.0	110.0					1																	78098198		2203	4300	6503	SO:0001583	missense	26009				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr1:78098198T>C	AL080063	CCDS677.1	1p31.1	2012-08-13			ENSG00000036549	ENSG00000036549		"""Zinc fingers, ZZ-type"""	24523	protein-coding gene	gene with protein product	"""ATAC component 1 homolog (Drosophila)"""					16428443, 21304275	Standard	NM_015534		Approved	DKFZP564I052, ATAC1	uc001dhq.3	Q8IYH5	OTTHUMG00000009652	ENST00000370801.3:c.842A>G	1.37:g.78098198T>C	ENSP00000359837:p.Lys281Arg					ZZZ3_uc001dhr.2_Intron|ZZZ3_uc009wbz.1_Missense_Mutation_p.K281R|ZZZ3_uc001dhp.2_Missense_Mutation_p.K281R	p.K281R	NM_015534	NP_056349	Q8IYH5	ZZZ3_HUMAN			5	1318	-			281					B7WPC6|Q6N004|Q6N070|Q8IYP0|Q8IYR1|Q8TEK4|Q9Y4U0	Missense_Mutation	SNP	ENST00000370801.3	37	c.842A>G	CCDS677.1	.	.	.	.	.	.	.	.	.	.	T	9.243	1.038879	0.19669	.	.	ENSG00000036549	ENST00000370801	.	.	.	5.49	4.34	0.51931	.	0.414313	0.29692	N	0.011444	T	0.24084	0.0583	L	0.44542	1.39	0.80722	D	1	B;B;B	0.34015	0.145;0.309;0.435	B;B;B	0.27380	0.079;0.026;0.058	T	0.09143	-1.0688	8	.	.	.	.	9.4062	0.38462	0.0:0.1407:0.0:0.8593	.	281;281;281	Q8IYH5-4;Q8IYH5;Q8IYH5-2	.;ZZZ3_HUMAN;.	R	281	.	.	K	-	2	0	ZZZ3	77870786	0.998000	0.40836	0.997000	0.53966	0.824000	0.46624	2.250000	0.43178	2.213000	0.71641	0.528000	0.53228	AAA		0.443	ZZZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026615.1	NM_015534		55	91	0	0	0	0.00361	0	55	91				
GBP6	163351	broad.mit.edu	37	1	89846073	89846073	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:89846073G>A	ENST00000370456.4	+	6	847	c.754G>A	c.(754-756)Gtg>Atg	p.V252M	GBP6_ENST00000535065.1_Missense_Mutation_p.V122M	NM_198460.2	NP_940862.2	Q6ZN66	GBP6_HUMAN	guanylate binding protein family, member 6	252	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.				cellular response to interferon-gamma (GO:0071346)|defense response to bacterium (GO:0042742)|immune response (GO:0006955)	extracellular vesicular exosome (GO:0070062)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.V252M(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	42		Lung NSC(277;0.0908)		all cancers(265;0.0108)|Epithelial(280;0.0398)		TATTGAGAAGGTGTCAGAAAA	0.438																																							uc001dnf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(754-756)GTG>ATG		guanylate binding protein family, member 6							78.0	74.0	76.0					1																	89846073		2203	4300	6503	SO:0001583	missense	163351						GTP binding|GTPase activity	g.chr1:89846073G>A	BX537949	CCDS723.1	1p22	2008-02-05			ENSG00000183347	ENSG00000183347			25395	protein-coding gene	gene with protein product		612467					Standard	NM_198460		Approved	DKFZp686G0786	uc001dnf.2	Q6ZN66	OTTHUMG00000010123	ENST00000370456.4:c.754G>A	1.37:g.89846073G>A	ENSP00000359485:p.Val252Met					GBP6_uc010ost.1_Missense_Mutation_p.V122M	p.V252M	NM_198460	NP_940862	Q6ZN66	GBP6_HUMAN		all cancers(265;0.0108)|Epithelial(280;0.0398)	6	1028	+		Lung NSC(277;0.0908)	252					A2RRM3|Q6ZN86|Q7Z3F0	Missense_Mutation	SNP	ENST00000370456.4	37	c.754G>A	CCDS723.1	.	.	.	.	.	.	.	.	.	.	G	8.172	0.791964	0.16258	.	.	ENSG00000183347	ENST00000544311;ENST00000370456;ENST00000535065	T;T	0.75821	-0.97;-0.97	4.54	-1.2	0.09554	Guanylate-binding protein, N-terminal (1);	0.562455	0.16060	N	0.231552	T	0.45677	0.1354	L	0.43646	1.37	0.09310	N	1	B	0.24483	0.104	B	0.39562	0.303	T	0.54098	-0.8344	10	0.42905	T	0.14	-2.9867	1.0161	0.01508	0.2796:0.2787:0.2996:0.1421	.	252	Q6ZN66	GBP6_HUMAN	M	223;252;122	ENSP00000359485:V252M;ENSP00000442530:V122M	ENSP00000359485:V252M	V	+	1	0	GBP6	89618661	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.136000	0.15974	-0.665000	0.05317	-0.216000	0.12614	GTG		0.438	GBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028001.1	NM_198460		7	48	0	0	0	0.001984	0	7	48				
EVI5	7813	broad.mit.edu	37	1	93131509	93131509	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:93131509T>A	ENST00000370331.1	-	11	1340	c.1331A>T	c.(1330-1332)gAg>gTg	p.E444V	EVI5_ENST00000543509.1_Missense_Mutation_p.E444V|EVI5_ENST00000540033.1_Missense_Mutation_p.E444V|EVI5_ENST00000491940.1_5'UTR	NM_005665.4	NP_005656.4	O60447	EVI5_HUMAN	ecotropic viral integration site 5	444	Dimerization.|Interaction with alpha-tubulin, gamma- tubulin, BIRC5 and FBXO5.|Targeting to the centrosomes.				cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|retrograde transport, endosome to Golgi (GO:0042147)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)	p.E444V(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|prostate(1)|skin(1)	38		all_lung(203;0.00146)|Lung NSC(277;0.00565)|all_neural(321;0.185)|Melanoma(281;0.193)|Glioma(108;0.203)		Epithelial(280;8.09e-25)|OV - Ovarian serous cystadenocarcinoma(397;1.27e-22)|all cancers(265;1.74e-21)|GBM - Glioblastoma multiforme(16;0.00233)|BRCA - Breast invasive adenocarcinoma(282;0.211)		TTCTAATGTCTCGATGCGCTG	0.313																																							uc001dox.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(1330-1332)GAG>GTG		ecotropic viral integration site 5							131.0	127.0	129.0					1																	93131509		2203	4298	6501	SO:0001583	missense	7813				cell cycle|cell division|cell proliferation|multicellular organismal development	microtubule organizing center|nucleus|spindle	protein binding|Rab GTPase activator activity	g.chr1:93131509T>A	AF008915	CCDS30774.1	1p22	2013-07-09			ENSG00000067208	ENSG00000067208			3501	protein-coding gene	gene with protein product	"""neuroblastoma stage 4S gene"""	602942				9618176	Standard	XM_005271180		Approved	NB4S	uc001dox.3	O60447	OTTHUMG00000010895	ENST00000370331.1:c.1331A>T	1.37:g.93131509T>A	ENSP00000359356:p.Glu444Val					EVI5_uc010otf.1_Missense_Mutation_p.E444V|EVI5_uc001doy.1_RNA	p.E444V	NM_005665	NP_005656	O60447	EVI5_HUMAN		Epithelial(280;8.09e-25)|OV - Ovarian serous cystadenocarcinoma(397;1.27e-22)|all cancers(265;1.74e-21)|GBM - Glioblastoma multiforme(16;0.00233)|BRCA - Breast invasive adenocarcinoma(282;0.211)	11	1341	-		all_lung(203;0.00146)|Lung NSC(277;0.00565)|all_neural(321;0.185)|Melanoma(281;0.193)|Glioma(108;0.203)	444			Dimerization.|Targeting to the centrosomes.|Potential.|Interaction with alpha-tubulin, gamma- tubulin, BIRC5 and FBXO5.		A6NKX8|B9A6J0|Q9H1Y9	Missense_Mutation	SNP	ENST00000370331.1	37	c.1331A>T	CCDS30774.1	.	.	.	.	.	.	.	.	.	.	T	22.6	4.315068	0.81358	.	.	ENSG00000067208	ENST00000370331;ENST00000540033;ENST00000543509;ENST00000338689	T;T;T	0.06449	3.38;3.38;3.3	5.07	5.07	0.68467	.	0.060253	0.64402	D	0.000003	T	0.14056	0.0340	M	0.69358	2.11	0.53005	D	0.999962	D;D	0.69078	0.997;0.996	D;D	0.71184	0.972;0.939	T	0.00972	-1.1495	10	0.48119	T	0.1	-17.6227	14.8205	0.70068	0.0:0.0:0.0:1.0	.	444;444	F5H4R0;O60447	.;EVI5_HUMAN	V	444;444;444;83	ENSP00000359356:E444V;ENSP00000440826:E444V;ENSP00000445019:E444V	ENSP00000345500:E83V	E	-	2	0	EVI5	92904097	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	7.405000	0.80007	1.887000	0.54652	0.477000	0.44152	GAG		0.313	EVI5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030047.1	NM_005665		9	65	0	0	0	0.008291	0	9	65				
DPYD	1806	broad.mit.edu	37	1	97981448	97981448	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:97981448T>C	ENST00000370192.3	-	13	1674	c.1574A>G	c.(1573-1575)tAc>tGc	p.Y525C		NM_000110.3	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase	525					beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase catabolic process (GO:0006145)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymidine catabolic process (GO:0006214)|thymine catabolic process (GO:0006210)|UMP biosynthetic process (GO:0006222)|uracil catabolic process (GO:0006212)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|dihydroorotate dehydrogenase activity (GO:0004152)|dihydropyrimidine dehydrogenase (NADP+) activity (GO:0017113)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)	p.Y525C(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(18)|lung(30)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	83		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Flavin adenine dinucleotide(DB03147)|Fluorouracil(DB00544)	AATAGGAGTGTAAAAGAGGGG	0.413																																							uc001drv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(3)|breast(2)	8						c.(1573-1575)TAC>TGC		dihydropyrimidine dehydrogenase isoform 1	Capecitabine(DB01101)|Enfuvirtide(DB00109)						71.0	67.0	68.0					1																	97981448		2203	4299	6502	SO:0001583	missense	1806				'de novo' pyrimidine base biosynthetic process|purine base catabolic process|thymidine catabolic process|thymine catabolic process|UMP biosynthetic process|uracil catabolic process	cytosol	4 iron, 4 sulfur cluster binding|dihydroorotate oxidase activity|dihydropyrimidine dehydrogenase (NADP+) activity|electron carrier activity|flavin adenine dinucleotide binding|metal ion binding|NADP binding|protein homodimerization activity	g.chr1:97981448T>C	U20938	CCDS30777.1, CCDS53346.1	1p22	2014-09-17			ENSG00000188641	ENSG00000188641	1.3.1.2		3012	protein-coding gene	gene with protein product		612779				7713523	Standard	NM_000110		Approved	DPD	uc001drv.3	Q12882	OTTHUMG00000039683	ENST00000370192.3:c.1574A>G	1.37:g.97981448T>C	ENSP00000359211:p.Tyr525Cys						p.Y525C	NM_000110	NP_000101	Q12882	DPYD_HUMAN		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	13	1711	-		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)	525					A2RRQ2|A2RRQ3|A8K5A2|A8MWG9|B1AN21|E9PFN1|Q16694|Q16761|Q32NB0|Q96HL6|Q96TH1	Missense_Mutation	SNP	ENST00000370192.3	37	c.1574A>G	CCDS30777.1	.	.	.	.	.	.	.	.	.	.	T	7.184	0.590270	0.13812	.	.	ENSG00000188641	ENST00000370192	D	0.92048	-2.96	5.2	2.6	0.31112	.	0.185201	0.48767	D	0.000169	D	0.85703	0.5758	M	0.79258	2.445	0.80722	D	1	B	0.15473	0.013	B	0.10450	0.005	D	0.83475	0.0061	10	0.48119	T	0.1	-3.3154	9.1854	0.37168	0.0:0.1619:0.0:0.8381	.	525	Q12882	DPYD_HUMAN	C	525	ENSP00000359211:Y525C	ENSP00000359211:Y525C	Y	-	2	0	DPYD	97754036	1.000000	0.71417	0.847000	0.33407	0.053000	0.15095	2.468000	0.45102	0.797000	0.33971	0.477000	0.44152	TAC		0.413	DPYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095698.3	NM_000110		23	42	0	0	0	0.002299	0	23	42				
AP4B1	10717	broad.mit.edu	37	1	114437980	114437980	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:114437980G>C	ENST00000369569.1	-	10	2207	c.1927C>G	c.(1927-1929)Cag>Gag	p.Q643E	AP4B1_ENST00000256658.4_Missense_Mutation_p.Q643E|AP4B1_ENST00000369567.1_Missense_Mutation_p.Q475E|AP4B1-AS1_ENST00000419536.1_RNA|AP4B1_ENST00000462591.1_5'UTR	NM_001253852.1	NP_001240781.1	Q9Y6B7	AP4B1_HUMAN	adaptor-related protein complex 4, beta 1 subunit	643					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|coated pit (GO:0005905)|trans-Golgi network (GO:0005802)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)	p.Q643E(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(9)|ovary(3)|prostate(3)	25	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.1e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AACACTTGCTGATGAGCAACT	0.498																																							uc001eeb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(1)	4						c.(1927-1929)CAG>GAG		adaptor-related protein complex 4, beta 1							94.0	96.0	95.0					1																	114437980		2203	4300	6503	SO:0001583	missense	10717				intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|soluble fraction|trans-Golgi network	protein binding|protein transporter activity	g.chr1:114437980G>C	AF092094	CCDS865.1	1p13.2	2012-03-30			ENSG00000134262	ENSG00000134262			572	protein-coding gene	gene with protein product	"""beta 4 subunit of AP-4"""	607245	"""spastic paraplegia 47"""	SPG47		10066790	Standard	NM_006594		Approved	BETA-4	uc001eeb.3	Q9Y6B7	OTTHUMG00000011943	ENST00000369569.1:c.1927C>G	1.37:g.114437980G>C	ENSP00000358582:p.Gln643Glu					uc001edv.1_Intron|AP4B1_uc001eec.2_Missense_Mutation_p.Q475E|AP4B1_uc001eed.2_Missense_Mutation_p.Q643E|AP4B1_uc010owp.1_Missense_Mutation_p.Q544E|AP4B1_uc001eea.1_3'UTR|AP4B1_uc001eee.1_3'UTR	p.Q643E	NM_006594	NP_006585	Q9Y6B7	AP4B1_HUMAN		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)	10	2070	-	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.1e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)	643					B7Z4X3|Q59EJ4|Q96CL6	Missense_Mutation	SNP	ENST00000369569.1	37	c.1927C>G	CCDS865.1	.	.	.	.	.	.	.	.	.	.	G	12.67	2.006530	0.35415	.	.	ENSG00000134262	ENST00000369567;ENST00000369569;ENST00000256658	T;T;T	0.62941	-0.01;0.0;0.0	5.83	4.92	0.64577	Clathrin adaptor, beta-adaptin, appendage, C-terminal subdomain (1);Beta2-adaptin/TATA-box binding, C-terminal (1);	0.554881	0.19443	N	0.114136	T	0.36138	0.0956	L	0.29908	0.895	0.80722	D	1	B;B	0.21452	0.056;0.053	B;B	0.28465	0.086;0.09	T	0.24261	-1.0165	10	0.31617	T	0.26	.	13.3554	0.60625	0.073:0.0:0.927:0.0	.	475;643	B1ALD0;Q9Y6B7	.;AP4B1_HUMAN	E	475;643;643	ENSP00000358580:Q475E;ENSP00000358582:Q643E;ENSP00000256658:Q643E	ENSP00000256658:Q643E	Q	-	1	0	AP4B1	114239503	0.999000	0.42202	1.000000	0.80357	0.975000	0.68041	3.351000	0.52232	1.473000	0.48159	0.563000	0.77884	CAG		0.498	AP4B1-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033037.1	NM_006594		5	133	0	0	0	0.001984	0	5	133				
SYCP1	6847	broad.mit.edu	37	1	115487071	115487071	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:115487071G>T	ENST00000369522.3	+	24	2278	c.2038G>T	c.(2038-2040)Gaa>Taa	p.E680*	SYCP1_ENST00000369518.1_Nonsense_Mutation_p.E680*	NM_001282541.1|NM_003176.2	NP_001269470.1|NP_003167.2	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	680					chiasma assembly (GO:0051026)|lateral element assembly (GO:0051878)|meiotic DNA repair synthesis (GO:0000711)|reciprocal meiotic recombination (GO:0007131)|regulation of protein localization (GO:0032880)|sperm chromatin condensation (GO:0035092)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)|male germ cell nucleus (GO:0001673)|transverse filament (GO:0000802)	DNA binding (GO:0003677)	p.E680*(1)	RGS22/SYCP1(2)	NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		AAATCTTTTGGAAGAGGTGGG	0.269																																							uc001efr.2		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(1)	1						c.(2038-2040)GAA>TAA		synaptonemal complex protein 1							26.0	29.0	28.0					1																	115487071		2199	4269	6468	SO:0001587	stop_gained	6847				cell division|reciprocal meiotic recombination|spermatogenesis|synaptonemal complex assembly		DNA binding	g.chr1:115487071G>T	D67035	CCDS879.1, CCDS72840.1	1p13-p12	2009-03-12			ENSG00000198765	ENSG00000198765			11487	protein-coding gene	gene with protein product	"""cancer/testis antigen 8"""	602162				9560255	Standard	XM_005271154		Approved	HOM-TES-14, SCP1, CT8	uc001efr.3	Q15431	OTTHUMG00000012057	ENST00000369522.3:c.2038G>T	1.37:g.115487071G>T	ENSP00000358535:p.Glu680*					SYCP1_uc010owt.1_RNA|SYCP1_uc001efq.2_Nonsense_Mutation_p.E680*|SYCP1_uc009wgw.2_Nonsense_Mutation_p.E680*	p.E680*	NM_003176	NP_003167	Q15431	SYCP1_HUMAN		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	24	2247	+	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)	680			Nuclear localization signal (Potential).|Potential.		O14963|Q5VXJ6	Nonsense_Mutation	SNP	ENST00000369522.3	37	c.2038G>T	CCDS879.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.820872	0.90873	.	.	ENSG00000198765	ENST00000369522;ENST00000536734;ENST00000455987;ENST00000369518	.	.	.	4.24	0.0829	0.14431	.	0.947650	0.08903	N	0.876928	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.8846	5.4209	0.16400	0.3382:0.1439:0.5179:0.0	.	.	.	.	X	680	.	ENSP00000358531:E680X	E	+	1	0	SYCP1	115288594	1.000000	0.71417	0.851000	0.33527	0.606000	0.37113	1.988000	0.40697	0.053000	0.16036	-0.136000	0.14681	GAA		0.269	SYCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033386.1	NM_003176		12	42	1	0	1.61879e-10	0.001368	2.23528e-10	12	42				
FLG2	388698	broad.mit.edu	37	1	152325739	152325739	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:152325739T>C	ENST00000388718.5	-	3	4595	c.4523A>G	c.(4522-4524)gAa>gGa	p.E1508G	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000445097.1_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	1508					establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGAGTGCACTTCACTGTCACT	0.502																																							uc001ezw.3		NA																	0				ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17						c.(4522-4524)GAA>GGA		filaggrin family member 2							336.0	324.0	328.0					1																	152325739		2203	4300	6503	SO:0001583	missense	388698						calcium ion binding|structural molecule activity	g.chr1:152325739T>C	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.4523A>G	1.37:g.152325739T>C	ENSP00000373370:p.Glu1508Gly					uc001ezv.2_Intron	p.E1508G	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	4596	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		1508			Filaggrin 5.		Q9H4U1	Missense_Mutation	SNP	ENST00000388718.5	37	c.4523A>G	CCDS30861.1	.	.	.	.	.	.	.	.	.	.	t	13.81	2.348660	0.41599	.	.	ENSG00000143520	ENST00000388718	T	0.08896	3.04	4.54	4.54	0.55810	.	.	.	.	.	T	0.02455	0.0075	L	0.41492	1.28	0.09310	N	1	P	0.36065	0.535	B	0.31614	0.133	T	0.40289	-0.9571	9	0.22706	T	0.39	-5.8528	10.6905	0.45869	0.0:0.0:0.0:1.0	.	1508	Q5D862	FILA2_HUMAN	G	1508	ENSP00000373370:E1508G	ENSP00000373370:E1508G	E	-	2	0	FLG2	150592363	0.025000	0.19082	0.015000	0.15790	0.032000	0.12392	3.229000	0.51278	1.852000	0.53769	0.369000	0.22263	GAA		0.502	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342		13	814	0	0	0	0.001855	0	13	814				
FLG2	388698	broad.mit.edu	37	1	152329152	152329152	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:152329152C>A	ENST00000388718.5	-	3	1182	c.1110G>T	c.(1108-1110)tgG>tgT	p.W370C	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000445097.1_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	370	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.W370C(1)		NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGCCTGTTCTCCATTGTCCTC	0.483																																							uc001ezw.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17						c.(1108-1110)TGG>TGT		filaggrin family member 2							143.0	130.0	134.0					1																	152329152		2203	4300	6503	SO:0001583	missense	388698						calcium ion binding|structural molecule activity	g.chr1:152329152C>A	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.1110G>T	1.37:g.152329152C>A	ENSP00000373370:p.Trp370Cys					uc001ezv.2_Intron	p.W370C	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	1183	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		370			Ser-rich.		Q9H4U1	Missense_Mutation	SNP	ENST00000388718.5	37	c.1110G>T	CCDS30861.1	.	.	.	.	.	.	.	.	.	.	C	4.094	0.015516	0.07959	.	.	ENSG00000143520	ENST00000388718	T	0.14766	2.48	4.94	-1.19	0.09585	.	.	.	.	.	T	0.02156	0.0067	N	0.08118	0	0.09310	N	1	P	0.39060	0.657	B	0.37780	0.258	T	0.40664	-0.9551	9	0.52906	T	0.07	-2.4626	8.3291	0.32175	0.0:0.376:0.0:0.624	.	370	Q5D862	FILA2_HUMAN	C	370	ENSP00000373370:W370C	ENSP00000373370:W370C	W	-	3	0	FLG2	150595776	0.981000	0.34729	0.066000	0.19879	0.137000	0.21094	1.261000	0.32980	-0.150000	0.11195	0.655000	0.94253	TGG		0.483	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342		55	124	1	0	1.63038e-21	0.00361	2.62542e-21	55	124				
SCAMP3	10067	broad.mit.edu	37	1	155226464	155226464	+	Splice_Site	SNP	C	C	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:155226464C>G	ENST00000302631.3	-	8	1005		c.e8+1		FAM189B_ENST00000361361.2_5'Flank|FAM189B_ENST00000472550.1_5'Flank|FAM189B_ENST00000368368.3_5'Flank|SCAMP3_ENST00000355379.3_Splice_Site|SCAMP3_ENST00000472397.1_Splice_Site|FAM189B_ENST00000350210.2_5'Flank	NM_005698.3	NP_005689.2	O14828	SCAM3_HUMAN	secretory carrier membrane protein 3						post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|response to retinoic acid (GO:0032526)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ubiquitin protein ligase binding (GO:0031625)	p.?(1)		breast(1)|endometrium(3)|large_intestine(3)|lung(7)|ovary(4)|urinary_tract(1)	19	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			ACAGCCCTCACCCGTTTCAGC	0.607																																							uc001fjs.2		NA																	1	Unknown(1)		lung(1)	ovary(3)	3						c.e8+1		secretory carrier membrane protein 3 isoform 1							111.0	86.0	94.0					1																	155226464		2203	4300	6503	SO:0001630	splice_region_variant	10067				post-Golgi vesicle-mediated transport|protein transport	integral to membrane		g.chr1:155226464C>G	AF005039	CCDS1105.1, CCDS1106.1	1q21	2013-02-21			ENSG00000116521	ENSG00000116521		"""Secretory carrier membrane proteins"""	10565	protein-coding gene	gene with protein product	"""Propin 1"""	606913		C1orf3		9331372, 9658162	Standard	NM_005698		Approved		uc001fjs.3	O14828	OTTHUMG00000035874	ENST00000302631.3:c.897+1G>C	1.37:g.155226464C>G						RAG1AP1_uc010pey.1_Intron|FAM189B_uc001fjm.2_5'Flank|FAM189B_uc001fjn.2_5'Flank|FAM189B_uc001fjo.2_5'Flank|FAM189B_uc001fjp.2_5'Flank|FAM189B_uc001fjq.1_5'Flank|SCAMP3_uc001fjr.2_Splice_Site_p.R146_splice|SCAMP3_uc001fju.2_Splice_Site_p.R285_splice|SCAMP3_uc001fjv.2_Splice_Site|SCAMP3_uc001fjt.2_Splice_Site_p.R273_splice	p.R299_splice	NM_005698	NP_005689	O14828	SCAM3_HUMAN	Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)		8	1150	-	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)							A9Z1W6|B1AVS6|O15128|Q96FR8|Q9BPY0	Splice_Site	SNP	ENST00000302631.3	37	c.897_splice	CCDS1105.1	.	.	.	.	.	.	.	.	.	.	C	18.30	3.594672	0.66219	.	.	ENSG00000116521	ENST00000302631;ENST00000355379	.	.	.	4.87	3.93	0.45458	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.3942	0.49832	0.0:0.9089:0.0:0.0911	.	.	.	.	.	-1	.	.	.	-	.	.	SCAMP3	153493088	1.000000	0.71417	1.000000	0.80357	0.830000	0.47004	5.572000	0.67411	2.547000	0.85894	0.561000	0.74099	.		0.607	SCAMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087399.1	NM_005698	Intron	10	75	0	0	0	0.006214	0	10	75				
UBQLN4	56893	broad.mit.edu	37	1	156020953	156020953	+	Silent	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:156020953C>A	ENST00000368309.3	-	3	518	c.426G>T	c.(424-426)ggG>ggT	p.G142G	UBQLN4_ENST00000472638.1_5'UTR	NM_020131.3	NP_064516.2	Q9NRR5	UBQL4_HUMAN	ubiquilin 4	142					regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|polyubiquitin binding (GO:0031593)	p.G142G(1)		NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(1)|lung(6)|pancreas(1)|skin(2)	16	Hepatocellular(266;0.133)|all_neural(408;0.195)					CCGGAGAGGGCCCCCCACCAC	0.647																																							uc001fna.2		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(1)|skin(1)	2						c.(424-426)GGG>GGT		ataxin-1 ubiquitin-like interacting protein							16.0	18.0	17.0					1																	156020953		2203	4300	6503	SO:0001819	synonymous_variant	56893					cytosol|endoplasmic reticulum membrane|nucleus	identical protein binding	g.chr1:156020953C>A	BC018403	CCDS1127.1	1q21	2013-02-12	2004-11-05	2004-11-06	ENSG00000160803	ENSG00000160803		"""Ubiquilin family"""	1237	protein-coding gene	gene with protein product	"""ataxin-1 ubiquitin-like interacting protein"""	605440	"""chromosome 1 open reading frame 6"""	C1orf6		10575211, 11001934	Standard	NM_020131		Approved	A1U, UBIN	uc001fna.3	Q9NRR5	OTTHUMG00000017461	ENST00000368309.3:c.426G>T	1.37:g.156020953C>A						UBQLN4_uc010pgx.1_Intron	p.G142G	NM_020131	NP_064516	Q9NRR5	UBQL4_HUMAN			3	450	-	Hepatocellular(266;0.133)|all_neural(408;0.195)		142					A6ND44|B2RAY7|Q5VYA0|Q5VYA1|Q9BR98|Q9UHX4	Silent	SNP	ENST00000368309.3	37	c.426G>T	CCDS1127.1																																																																																				0.647	UBQLN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046193.1	NM_020131		15	28	1	0	1.5739e-10	0.004007	2.19486e-10	15	28				
FCRL2	79368	broad.mit.edu	37	1	157738381	157738381	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:157738381T>A	ENST00000361516.3	-	5	754	c.706A>T	c.(706-708)Aca>Tca	p.T236S	FCRL2_ENST00000368181.4_Intron|FCRL2_ENST00000392274.3_Missense_Mutation_p.T236S|FCRL2_ENST00000469986.1_5'Flank	NM_030764.3	NP_110391.2	Q96LA5	FCRL2_HUMAN	Fc receptor-like 2	236	Ig-like C2-type 3.				cell-cell signaling (GO:0007267)|positive regulation of signal transduction (GO:0009967)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)	p.T236S(1)		central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|skin(2)	51	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			CAGGAGAATGTGACATTTCCT	0.542																																							uc001fre.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(706-708)ACA>TCA		Fc receptor-like 2 precursor							148.0	149.0	149.0					1																	157738381		2203	4300	6503	SO:0001583	missense	79368				cell-cell signaling	integral to membrane|plasma membrane|soluble fraction	receptor activity|SH3/SH2 adaptor activity	g.chr1:157738381T>A	AF319438	CCDS1168.1	1q23.1	2013-01-14	2002-01-14	2005-03-23	ENSG00000132704	ENSG00000132704		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14875	protein-coding gene	gene with protein product		606509	"""SH2 domain-containing phosphatase anchor protein 1"""	SPAP1		11162587	Standard	NM_030764		Approved	FCRH2, IRTA4, CD307b	uc001fre.2	Q96LA5	OTTHUMG00000019399	ENST00000361516.3:c.706A>T	1.37:g.157738381T>A	ENSP00000355157:p.Thr236Ser					FCRL2_uc001frd.2_5'Flank|FCRL2_uc010phz.1_Missense_Mutation_p.T236S|FCRL2_uc009wsp.2_Intron	p.T236S	NM_030764	NP_110391	Q96LA5	FCRL2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.24)		5	765	-	all_hematologic(112;0.0378)		236			Ig-like C2-type 3.|Extracellular (Potential).		A0N0M5|A1L307|A6NMS0|Q6NTA1|Q9BZI4|Q9BZI5|Q9BZI6	Missense_Mutation	SNP	ENST00000361516.3	37	c.706A>T	CCDS1168.1	.	.	.	.	.	.	.	.	.	.	T	16.04	3.010169	0.54361	.	.	ENSG00000132704	ENST00000361516;ENST00000392274	T;T	0.11277	2.79;2.79	3.43	3.43	0.39272	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.850571	0.09884	N	0.743246	T	0.09069	0.0224	M	0.64260	1.97	0.22811	N	0.998707	B;D	0.56287	0.417;0.975	P;P	0.57548	0.574;0.823	T	0.12941	-1.0528	10	0.09590	T	0.72	.	8.5689	0.33556	0.0:0.0:0.0:1.0	.	236;236	B4DVJ9;Q96LA5	.;FCRL2_HUMAN	S	236	ENSP00000355157:T236S;ENSP00000376100:T236S	ENSP00000355157:T236S	T	-	1	0	FCRL2	156005005	0.869000	0.29996	0.899000	0.35326	0.544000	0.35116	0.891000	0.28309	1.781000	0.52344	0.533000	0.62120	ACA		0.542	FCRL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051408.2	NM_030764		92	211	0	0	0	0.00361	0	92	211				
CD1B	910	broad.mit.edu	37	1	158300661	158300661	+	Missense_Mutation	SNP	C	C	G	rs149817745		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:158300661C>G	ENST00000368168.3	-	2	360	c.253G>C	c.(253-255)Gag>Cag	p.E85Q		NM_001764.2	NP_001755.1	P29016	CD1B_HUMAN	CD1b molecule	85					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	cell surface (GO:0009986)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)		p.E85Q(1)		breast(2)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	30	all_hematologic(112;0.0378)					AATATCTCCTCTAACTCAGCA	0.458													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19899	0.0		0.0	False		,,,				2504	0.0						uc001frx.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(253-255)GAG>CAG		CD1B antigen precursor		C	GLN/GLU	2,4404	4.2+/-10.8	0,2,2201	286.0	285.0	285.0		253	-0.4	0.0	1	dbSNP_134	285	0,8600		0,0,4300	no	missense	CD1B	NM_001764.2	29	0,2,6501	GG,GC,CC		0.0,0.0454,0.0154	benign	85/334	158300661	2,13004	2203	4300	6503	SO:0001583	missense	910				antigen processing and presentation|immune response	endosome membrane|integral to membrane|lysosomal membrane|plasma membrane	protein binding	g.chr1:158300661C>G	M28826	CCDS1176.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158485	ENSG00000158485		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1635	protein-coding gene	gene with protein product		188360	"""CD1B antigen, b polypeptide"", ""CD1b antigen"""	CD1		2447586	Standard	NM_001764		Approved		uc001frx.3	P29016	OTTHUMG00000017513	ENST00000368168.3:c.253G>C	1.37:g.158300661C>G	ENSP00000357150:p.Glu85Gln					CD1B_uc001frw.2_5'UTR|CD1B_uc010pic.1_Missense_Mutation_p.E85Q	p.E85Q	NM_001764	NP_001755	P29016	CD1B_HUMAN			2	361	-	all_hematologic(112;0.0378)		85			Extracellular (Potential).		Q5TDK9|Q5TDL0|Q9UMM2	Missense_Mutation	SNP	ENST00000368168.3	37	c.253G>C	CCDS1176.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.367|0.367	-0.936199|-0.936199	0.02340|0.02340	4.54E-4|4.54E-4	0.0|0.0	ENSG00000158485|ENSG00000158485	ENST00000368168|ENST00000451207	T|.	0.07216|.	3.21|.	4.01|4.01	-0.39|-0.39	0.12450|0.12450	MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);|.	0.793515|.	0.10648|.	N|.	0.650195|.	T|T	0.14787|0.14787	0.0357|0.0357	L|L	0.41710|0.41710	1.295|1.295	0.09310|0.09310	N|N	1|1	P;B|.	0.39831|.	0.69;0.015|.	B;B|.	0.38296|.	0.27;0.005|.	T|T	0.29852|0.29852	-0.9998|-0.9998	10|5	0.06494|.	T|.	0.89|.	0.3496|0.3496	4.4006|4.4006	0.11385|0.11385	0.0:0.423:0.3617:0.2153|0.0:0.423:0.3617:0.2153	.|.	85;85|.	B4E0D2;P29016|.	.;CD1B_HUMAN|.	Q|T	85|52	ENSP00000357150:E85Q|.	ENSP00000357150:E85Q|.	E|R	-|-	1|2	0|0	CD1B|CD1B	156567285|156567285	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	-0.100000|-0.100000	0.10990|0.10990	0.117000|0.117000	0.18138|0.18138	-0.136000|-0.136000	0.14681|0.14681	GAG|AGA		0.458	CD1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046350.2	NM_001764		67	624	0	0	0	0.00361	0	67	624				
SPTA1	6708	broad.mit.edu	37	1	158647525	158647525	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:158647525G>T	ENST00000368147.4	-	7	1092	c.912C>A	c.(910-912)caC>caA	p.H304Q		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	304					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.H304Q(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CCTTGTGACTGTGAAACAGTC	0.478																																							uc001fst.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8						c.(910-912)CAC>CAA		spectrin, alpha, erythrocytic 1							96.0	90.0	92.0					1																	158647525		1952	4156	6108	SO:0001583	missense	6708				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158647525G>T	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.912C>A	1.37:g.158647525G>T	ENSP00000357129:p.His304Gln						p.H304Q	NM_003126	NP_003117	P02549	SPTA1_HUMAN			7	1111	-	all_hematologic(112;0.0378)		304			Spectrin 4.		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	c.912C>A	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	G	18.73	3.686213	0.68157	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.44881	0.91;0.91	4.58	2.62	0.31277	.	0.000000	0.33610	N	0.004738	T	0.34774	0.0909	M	0.72118	2.19	0.34620	D	0.718547	P	0.41947	0.766	P	0.50270	0.636	T	0.23762	-1.0179	10	0.49607	T	0.09	.	6.9185	0.24374	0.3078:0.0:0.6922:0.0	.	304	P02549	SPTA1_HUMAN	Q	304	ENSP00000357130:H304Q;ENSP00000357129:H304Q	ENSP00000357129:H304Q	H	-	3	2	SPTA1	156914149	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	0.808000	0.27154	0.583000	0.29574	0.655000	0.94253	CAC		0.478	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		7	109	1	0	8.12818e-05	0.001984	9.24704e-05	7	109				
OR6N1	128372	broad.mit.edu	37	1	158735770	158735770	+	Silent	SNP	T	T	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:158735770T>G	ENST00000335094.2	-	1	722	c.703A>C	c.(703-705)Agg>Cgg	p.R235R		NM_001005185.1	NP_001005185.1	Q8NGY5	OR6N1_HUMAN	olfactory receptor, family 6, subfamily N, member 1	235						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R235R(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_hematologic(112;0.0378)					ATGGCCTTCCTCTTGCCGGCA	0.507																																							uc010piq.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(703-705)AGG>CGG		olfactory receptor, family 6, subfamily N,							145.0	139.0	141.0					1																	158735770		2203	4300	6503	SO:0001819	synonymous_variant	128372				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158735770T>G	BK004199	CCDS30905.1	1q23.1	2012-08-09			ENSG00000197403	ENSG00000197403		"""GPCR / Class A : Olfactory receptors"""	15034	protein-coding gene	gene with protein product							Standard	NM_001005185		Approved		uc010piq.2	Q8NGY5	OTTHUMG00000022774	ENST00000335094.2:c.703A>C	1.37:g.158735770T>G							p.R235R	NM_001005185	NP_001005185	Q8NGY5	OR6N1_HUMAN			1	703	-	all_hematologic(112;0.0378)		235			Cytoplasmic (Potential).		Q5VUU8|Q96R35	Silent	SNP	ENST00000335094.2	37	c.703A>C	CCDS30905.1																																																																																				0.507	OR6N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059067.1	NM_001005185		12	184	0	0	0	0.000978	0	12	184				
IFI16	3428	broad.mit.edu	37	1	159002405	159002405	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:159002405G>A	ENST00000295809.7	+	7	1508	c.1253G>A	c.(1252-1254)aGc>aAc	p.S418N	IFI16_ENST00000340979.6_Missense_Mutation_p.S418N|IFI16_ENST00000448393.2_Missense_Mutation_p.S418N|IFI16_ENST00000368131.4_Missense_Mutation_p.S418N|IFI16_ENST00000430894.2_Missense_Mutation_p.S366N|IFI16_ENST00000359709.3_Missense_Mutation_p.S362N|IFI16_ENST00000368132.3_Missense_Mutation_p.S418N			Q16666	IF16_HUMAN	interferon, gamma-inducible protein 16	418					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of innate immune response (GO:0002218)|autophagy (GO:0006914)|cell proliferation (GO:0008283)|cellular response to glucose starvation (GO:0042149)|cellular response to ionizing radiation (GO:0071479)|defense response to virus (GO:0051607)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|monocyte differentiation (GO:0030224)|myeloid cell differentiation (GO:0030099)|negative regulation of cysteine-type endopeptidase activity (GO:2000117)|negative regulation of DNA binding (GO:0043392)|negative regulation of innate immune response (GO:0045824)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|positive regulation of cytokine production (GO:0001819)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of autophagy (GO:0010506)|regulation of gene expression, epigenetic (GO:0040029)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)	p.S418N(1)		cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0429)					TCAGAGGCCAGCACAACCTTC	0.493																																							uc001ftg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1252-1254)AGC>AAC		interferon, gamma-inducible protein 16							135.0	126.0	129.0					1																	159002405		2203	4300	6503	SO:0001583	missense	3428				cell proliferation|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|monocyte differentiation|negative regulation of transcription, DNA-dependent|response to virus|transcription, DNA-dependent	cytoplasm|nuclear speck|nucleolus	double-stranded DNA binding|protein binding	g.chr1:159002405G>A	M63838	CCDS1180.3, CCDS58039.1	1q22	2008-02-05			ENSG00000163565	ENSG00000163565			5395	protein-coding gene	gene with protein product		147586				1526658, 7959953	Standard	NM_005531		Approved	IFNGIP1, PYHIN2	uc010pis.2	Q16666	OTTHUMG00000037108	ENST00000295809.7:c.1253G>A	1.37:g.159002405G>A	ENSP00000295809:p.Ser418Asn					IFI16_uc010pis.1_Missense_Mutation_p.S362N|IFI16_uc001fth.2_Missense_Mutation_p.S17N|IFI16_uc010pit.1_Missense_Mutation_p.S17N	p.S418N	NM_005531	NP_005522	Q16666	IF16_HUMAN			7	1543	+	all_hematologic(112;0.0429)		418					B4DJT8|H3BLV7|Q59GX0|Q5T3W7|Q5T3W8|Q5T3X0|Q5T3X1|Q5T3X2|Q8N9E5|Q8NEQ7|Q96AJ5|Q9UH78	Missense_Mutation	SNP	ENST00000295809.7	37	c.1253G>A		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	6.376|6.376	0.437571|0.437571	0.12104|0.12104	.|.	.|.	ENSG00000163565|ENSG00000163565	ENST00000448393|ENST00000295809;ENST00000340979;ENST00000368131;ENST00000368132;ENST00000430894	.|T;T;T;T;T	.|0.06294	.|3.39;3.43;3.45;3.45;3.32	2.15|2.15	1.21|1.21	0.21127|0.21127	.|.	.|.	.|.	.|.	.|.	T|T	0.01730|0.01730	0.0055|0.0055	L|L	0.38175|0.38175	1.15|1.15	0.09310|0.09310	N|N	1|1	.|B;B;B	.|0.34329	.|0.1;0.135;0.449	.|B;B;B	.|0.38106	.|0.117;0.035;0.265	T|T	0.48031|0.48031	-0.9070|-0.9070	5|9	.|0.26408	.|T	.|0.33	.|.	4.3029|4.3029	0.10933|0.10933	0.2016:0.0:0.7984:0.0|0.2016:0.0:0.7984:0.0	.|.	.|366;418;418	.|E7EPR3;Q16666-3;Q16666-2	.|.;.;.	T|N	239|418;418;418;418;366	.|ENSP00000295809:S418N;ENSP00000342741:S418N;ENSP00000357113:S418N;ENSP00000357114:S418N;ENSP00000394935:S366N	.|ENSP00000295809:S418N	A|S	+|+	1|2	0|0	IFI16|IFI16	157269029|157269029	0.002000|0.002000	0.14202|0.14202	0.000000|0.000000	0.03702|0.03702	0.016000|0.016000	0.09150|0.09150	1.276000|1.276000	0.33156|0.33156	0.442000|0.442000	0.26555|0.26555	0.462000|0.462000	0.41574|0.41574	GCA|AGC		0.493	IFI16-013	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000421720.1	NM_005531		21	70	0	0	0	0.003271	0	21	70				
CADM3	57863	broad.mit.edu	37	1	159163316	159163316	+	Silent	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:159163316G>T	ENST00000368125.4	+	4	643	c.486G>T	c.(484-486)cgG>cgT	p.R162R	CADM3_ENST00000368124.4_Silent_p.R196R|CTA-134P22.2_ENST00000415675.2_RNA	NM_001127173.1	NP_001120645.1	Q8N126	CADM3_HUMAN	cell adhesion molecule 3	162	Ig-like C2-type 1.		R -> W (in dbSNP:rs3026987).		adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|protein localization (GO:0008104)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)	p.R196R(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(20)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55	all_hematologic(112;0.0429)					CTGCAGCCCGGCTCACCTGGA	0.517																																							uc001ftl.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(484-486)CGG>CGT		cell adhesion molecule 3 isoform 2							77.0	75.0	75.0					1																	159163316		2203	4300	6503	SO:0001819	synonymous_variant	57863				adherens junction organization|cell junction assembly|heterophilic cell-cell adhesion|homophilic cell adhesion	cell-cell junction|integral to membrane	protein homodimerization activity	g.chr1:159163316G>T	AY046418	CCDS1182.1, CCDS44251.1	1q21.2-q22	2013-01-29	2007-02-07	2007-02-07	ENSG00000162706	ENSG00000162706		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17601	protein-coding gene	gene with protein product	"""nectin-like 1"""	609743	"""immunoglobulin superfamily, member 4B"""	IGSF4B		11536053	Standard	NM_021189		Approved	BIgR, FLJ10698, TSLL1, NECL1, SynCAM3, Necl-1	uc001ftk.2	Q8N126	OTTHUMG00000037177	ENST00000368125.4:c.486G>T	1.37:g.159163316G>T						CADM3_uc009wsx.1_Silent_p.R196R|CADM3_uc009wsy.1_Silent_p.R162R|CADM3_uc001ftk.2_Silent_p.R196R	p.R162R	NM_001127173	NP_001120645	Q8N126	CADM3_HUMAN			4	628	+	all_hematologic(112;0.0429)		162			Ig-like C2-type 1.|Extracellular (Potential).		Q8IZQ9|Q9NVJ5|Q9UJP1	Silent	SNP	ENST00000368125.4	37	c.486G>T	CCDS44251.1																																																																																				0.517	CADM3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090330.1	NM_021189		33	70	1	0	2.46105e-21	0.002096	3.94049e-21	33	70				
PPOX	5498	broad.mit.edu	37	1	161138874	161138875	+	Missense_Mutation	DNP	GC	GC	AT			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	GC	GC	-	-	GC	GC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:161138874_161138875GC>AT	ENST00000367999.4	+	7	974_975	c.708_709GC>AT	c.(706-711)ttGCct>ttATct	p.P237S	PPOX_ENST00000544598.1_Intron|PPOX_ENST00000352210.5_Missense_Mutation_p.P237S|B4GALT3_ENST00000470882.1_5'Flank|PPOX_ENST00000535223.1_Intron|PPOX_ENST00000432542.2_Intron|PPOX_ENST00000495483.1_3'UTR	NM_001122764.1	NP_001116236.1	P50336	PPOX_HUMAN	protoporphyrinogen oxidase	237					heme biosynthetic process (GO:0006783)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound biosynthetic process (GO:0006779)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	integral component of mitochondrial inner membrane (GO:0031305)|intrinsic component of mitochondrial inner membrane (GO:0031304)|mitochondrial intermembrane space (GO:0005758)|mitochondrial membrane (GO:0031966)	flavin adenine dinucleotide binding (GO:0050660)|oxygen-dependent protoporphyrinogen oxidase activity (GO:0004729)	p.P237S(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(3)	15	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			TAGAGATGTTGCCTCAGGCCCT	0.629																																							uc001fyj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(706-711)TTGCCT>TTATCT		protoporphyrinogen oxidase																																				SO:0001583	missense	5498	Porphyria_Variegata			heme biosynthetic process	intrinsic to mitochondrial inner membrane|mitochondrial intermembrane space	flavin adenine dinucleotide binding|oxygen-dependent protoporphyrinogen oxidase activity	g.chr1:161138874_161138875GC>AT	BC002357	CCDS1221.1	1q22	2008-02-05			ENSG00000143224	ENSG00000143224	1.3.3.4		9280	protein-coding gene	gene with protein product		600923	"""variegate porphyria"""	VP		8575762, 10457135	Standard	NM_000309		Approved	PPO	uc001fyg.2	P50336	OTTHUMG00000034342	Exception_encountered	1.37:g.161138874_161138875delinsAT	ENSP00000356978:p.Pro237Ser					PPOX_uc001fyn.2_Intron|PPOX_uc001fyg.2_Missense_Mutation_p.P237S|PPOX_uc001fyl.2_Missense_Mutation_p.P203S|PPOX_uc001fym.2_RNA|PPOX_uc001fyk.2_Missense_Mutation_p.P75S|PPOX_uc001fyh.2_Missense_Mutation_p.P75S|PPOX_uc010pkg.1_Missense_Mutation_p.P75S|PPOX_uc009wuc.1_Missense_Mutation_p.P75S|PPOX_uc010pkh.1_Intron|PPOX_uc001fyi.2_Missense_Mutation_p.P75S	p.P237S	NM_001122764	NP_001116236	P50336	PPOX_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00275)		7	998_999	+	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		237					D3DVG0|Q5VTW8	Missense_Mutation	DNP	ENST00000367999.4	37	c.708_709GC>AT	CCDS1221.1																																																																																				0.629	PPOX-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082993.1	NM_000309		53	90	0	0	0	0.004672	0	53	90				
TNR	7143	broad.mit.edu	37	1	175334328	175334328	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:175334328T>A	ENST00000367674.2	-	12	3113	c.2405A>T	c.(2404-2406)gAc>gTc	p.D802V	TNR_ENST00000263525.2_Missense_Mutation_p.D802V			Q92752	TENR_HUMAN	tenascin R	802	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)		p.D802V(1)		NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					AATGAGTCTGTCTGCTGGGGG	0.532																																							uc001gkp.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11						c.(2404-2406)GAC>GTC		tenascin R precursor							105.0	99.0	101.0					1																	175334328		2203	4300	6503	SO:0001583	missense	7143				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix		g.chr1:175334328T>A	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.2405A>T	1.37:g.175334328T>A	ENSP00000356646:p.Asp802Val					TNR_uc009wwu.1_Missense_Mutation_p.D802V	p.D802V	NM_003285	NP_003276	Q92752	TENR_HUMAN			10	2486	-	Renal(580;0.146)		802			Fibronectin type-III 6.		C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	ENST00000367674.2	37	c.2405A>T	CCDS1318.1	.	.	.	.	.	.	.	.	.	.	T	25.0	4.595003	0.86953	.	.	ENSG00000116147	ENST00000367674;ENST00000263525	T;T	0.53206	0.63;0.63	5.91	5.91	0.95273	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.049536	0.85682	D	0.000000	T	0.65984	0.2744	L	0.60012	1.86	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	T	0.68496	-0.5393	10	0.87932	D	0	.	16.0098	0.80391	0.0:0.0:0.0:1.0	.	802	Q92752	TENR_HUMAN	V	802	ENSP00000356646:D802V;ENSP00000263525:D802V	ENSP00000263525:D802V	D	-	2	0	TNR	173600951	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	7.555000	0.82223	2.254000	0.74563	0.533000	0.62120	GAC		0.532	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285		20	65	0	0	0	0.008871	0	20	65				
CEP350	9857	broad.mit.edu	37	1	180047644	180047644	+	Silent	SNP	A	A	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:180047644A>G	ENST00000367607.3	+	29	6232	c.5814A>G	c.(5812-5814)ctA>ctG	p.L1938L		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	1938					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)		p.L1938L(2)		central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						ACTCTCATCTAAACAGTGAAA	0.433																																							uc001gnt.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(4)	4						c.(5812-5814)CTA>CTG		centrosome-associated protein 350							57.0	55.0	56.0					1																	180047644		2203	4300	6503	SO:0001819	synonymous_variant	9857					centrosome|nucleus|spindle		g.chr1:180047644A>G	AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.5814A>G	1.37:g.180047644A>G						CEP350_uc009wxl.2_Silent_p.L1937L|CEP350_uc001gnv.2_Silent_p.L73L	p.L1938L	NM_014810	NP_055625	Q5VT06	CE350_HUMAN			29	6197	+			1938					O75068|Q8TDK3|Q8WY20	Silent	SNP	ENST00000367607.3	37	c.5814A>G	CCDS1336.1	.	.	.	.	.	.	.	.	.	.	A	7.085	0.571042	0.13623	.	.	ENSG00000135837	ENST00000429851	.	.	.	5.05	-4.67	0.03319	.	.	.	.	.	T	0.40015	0.1100	.	.	.	0.35350	D	0.787255	.	.	.	.	.	.	T	0.44742	-0.9308	4	.	.	.	.	4.8661	0.13609	0.2033:0.136:0.5269:0.1338	.	.	.	.	E	113	.	.	K	+	1	0	CEP350	178314267	0.021000	0.18746	0.008000	0.14137	0.878000	0.50629	-0.141000	0.10327	-0.881000	0.03992	-0.353000	0.07706	AAA		0.433	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	NM_014810		11	50	0	0	0	0.000978	0	11	50				
CACNA1E	777	broad.mit.edu	37	1	181701955	181701955	+	Silent	SNP	G	G	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:181701955G>C	ENST00000367573.2	+	20	2733	c.2733G>C	c.(2731-2733)cgG>cgC	p.R911R	CACNA1E_ENST00000526775.1_Silent_p.R892R|CACNA1E_ENST00000367570.1_Silent_p.R911R|CACNA1E_ENST00000358338.5_Silent_p.R843R|CACNA1E_ENST00000357570.5_Silent_p.R862R|CACNA1E_ENST00000360108.3_Silent_p.R892R|CACNA1E_ENST00000367567.4_Silent_p.R518R	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	911					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)	p.R911R(2)		NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						TTGAGGACCGGGCCAGGCACA	0.672																																							uc001gow.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|central_nervous_system(2)|pancreas(1)	6						c.(2731-2733)CGG>CGC		calcium channel, voltage-dependent, R type,							43.0	52.0	49.0					1																	181701955		2131	4236	6367	SO:0001819	synonymous_variant	777				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity	g.chr1:181701955G>C	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.2733G>C	1.37:g.181701955G>C						CACNA1E_uc009wxs.2_Silent_p.R799R|CACNA1E_uc001gox.1_Silent_p.R137R|CACNA1E_uc009wxt.2_Silent_p.R137R	p.R911R	NM_000721	NP_000712	Q15878	CAC1E_HUMAN			20	2898	+			911			Cytoplasmic (Potential).		B1AM12|B1AM13|B1AM14|Q14580|Q14581	Silent	SNP	ENST00000367573.2	37	c.2733G>C	CCDS55664.1																																																																																				0.672	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721		10	159	0	0	0	0.008291	0	10	159				
CACNA1E	777	broad.mit.edu	37	1	181745260	181745260	+	Silent	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:181745260C>A	ENST00000367573.2	+	38	5163	c.5163C>A	c.(5161-5163)gtC>gtA	p.V1721V	CACNA1E_ENST00000526775.1_Silent_p.V1702V|CACNA1E_ENST00000367570.1_Silent_p.V1721V|CACNA1E_ENST00000358338.5_Silent_p.V1653V|CACNA1E_ENST00000357570.5_Silent_p.V1672V|CACNA1E_ENST00000360108.3_Silent_p.V1702V|CACNA1E_ENST00000367567.4_Silent_p.V1328V	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1721					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)	p.V1721V(2)		NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						TTGTGGCCGTCATCATGGACA	0.552																																							uc001gow.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|central_nervous_system(2)|pancreas(1)	6						c.(5161-5163)GTC>GTA		calcium channel, voltage-dependent, R type,							223.0	224.0	224.0					1																	181745260		2020	4205	6225	SO:0001819	synonymous_variant	777				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity	g.chr1:181745260C>A	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.5163C>A	1.37:g.181745260C>A						CACNA1E_uc009wxs.2_Silent_p.V1609V|CACNA1E_uc001gox.1_Silent_p.V947V|CACNA1E_uc009wxt.2_Silent_p.V947V	p.V1721V	NM_000721	NP_000712	Q15878	CAC1E_HUMAN			38	5328	+			1721			IV.|Helical; Name=S6 of repeat IV.		B1AM12|B1AM13|B1AM14|Q14580|Q14581	Silent	SNP	ENST00000367573.2	37	c.5163C>A	CCDS55664.1																																																																																				0.552	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721		25	443	1	0	3.73148e-12	0.007291	5.41884e-12	25	443				
CACNA1E	777	broad.mit.edu	37	1	181745334	181745334	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:181745334G>A	ENST00000367573.2	+	38	5237	c.5237G>A	c.(5236-5238)cGc>cAc	p.R1746H	CACNA1E_ENST00000526775.1_Missense_Mutation_p.R1727H|CACNA1E_ENST00000367570.1_Missense_Mutation_p.R1746H|CACNA1E_ENST00000358338.5_Missense_Mutation_p.R1678H|CACNA1E_ENST00000357570.5_Missense_Mutation_p.R1697H|CACNA1E_ENST00000360108.3_Missense_Mutation_p.R1727H|CACNA1E_ENST00000367567.4_Missense_Mutation_p.R1353H	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1746	EF-hand. {ECO:0000255|PROSITE- ProRule:PRU00448}.				calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)	p.R1746H(2)		NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						GAGTTTGTCCGCGTCTGGGCA	0.607																																							uc001gow.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|central_nervous_system(2)|pancreas(1)	6						c.(5236-5238)CGC>CAC		calcium channel, voltage-dependent, R type,							127.0	129.0	128.0					1																	181745334		1974	4152	6126	SO:0001583	missense	777				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity	g.chr1:181745334G>A	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.5237G>A	1.37:g.181745334G>A	ENSP00000356545:p.Arg1746His					CACNA1E_uc009wxs.2_Missense_Mutation_p.R1634H|CACNA1E_uc001gox.1_Missense_Mutation_p.R972H|CACNA1E_uc009wxt.2_Missense_Mutation_p.R972H	p.R1746H	NM_000721	NP_000712	Q15878	CAC1E_HUMAN			38	5402	+			1746			EF-hand.|Cytoplasmic (Potential).		B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	37	c.5237G>A	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	G	36	5.967055	0.97156	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.96885	-4.07;-4.07;-4.16;-4.07;-4.15;-4.16;-4.16	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	D	0.98488	0.9496	M	0.89163	3.01	0.80722	D	1	P;D;D	0.89917	0.948;1.0;1.0	P;D;D	0.91635	0.744;0.999;0.996	D	0.99078	1.0836	10	0.87932	D	0	.	19.7135	0.96105	0.0:0.0:1.0:0.0	.	1727;1746;1746	Q15878-2;Q15878;Q15878-3	.;CAC1E_HUMAN;.	H	1746;1727;1697;1678;1353;1727;1746	ENSP00000356542:R1746H;ENSP00000434814:R1727H;ENSP00000350183:R1697H;ENSP00000351101:R1678H;ENSP00000356539:R1353H;ENSP00000353222:R1727H;ENSP00000356545:R1746H	ENSP00000350183:R1697H	R	+	2	0	CACNA1E	180011957	1.000000	0.71417	0.700000	0.30305	0.991000	0.79684	9.731000	0.98807	2.769000	0.95229	0.655000	0.94253	CGC		0.607	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721		23	281	0	0	0	0.002299	0	23	281				
SWT1	54823	broad.mit.edu	37	1	185159774	185159774	+	Splice_Site	SNP	C	C	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:185159774C>T	ENST00000367500.4	+	10	1688	c.1523C>T	c.(1522-1524)aCg>aTg	p.T508M	SWT1_ENST00000367501.3_Splice_Site_p.T508M	NM_017673.6	NP_060143.4	Q5T5J6	SWT1_HUMAN	SWT1 RNA endoribonuclease homolog (S. cerevisiae)	508	PINc.							p.T508M(2)		breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(16)|ovary(1)|prostate(1)|urinary_tract(1)	41						ATTCTGTGCACGTGAGTTTCA	0.318																																							uc001grg.3		NA																	2	Substitution - Missense(2)		lung(1)|liver(1)		0						c.(1522-1524)ACG>ATG		hypothetical protein LOC54823							131.0	117.0	122.0					1																	185159774		2203	4300	6503	SO:0001630	splice_region_variant	54823							g.chr1:185159774C>T	AF288392	CCDS1367.1	1q25	2013-08-29	2011-01-24	2011-01-24	ENSG00000116668	ENSG00000116668			16785	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 26"""	C1orf26		11318611, 19127978, 23768067	Standard	NM_017673		Approved	FLJ20121, HsSwt1	uc001grg.4	Q5T5J6	OTTHUMG00000035390	ENST00000367500.4:c.1523+1C>T	1.37:g.185159774C>T						C1orf26_uc001grh.3_Missense_Mutation_p.T508M	p.T508M	NM_001105518	NP_001098988	Q5T5J6	SWT1_HUMAN			10	1637	+			508			PINc.		Q8NEK9|Q9BZQ7|Q9NXQ0	Missense_Mutation	SNP	ENST00000367500.4	37	c.1523C>T	CCDS1367.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.213873	0.79352	.	.	ENSG00000116668	ENST00000367501;ENST00000367500	T;T	0.26660	1.72;1.72	5.52	5.52	0.82312	Nucleotide binding protein, PINc (1);	0.000000	0.85682	D	0.000000	T	0.59500	0.2198	M	0.89478	3.035	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.67086	-0.5759	10	0.87932	D	0	.	17.6092	0.88047	0.0:1.0:0.0:0.0	.	508	Q5T5J6	SWT1_HUMAN	M	508	ENSP00000356471:T508M;ENSP00000356470:T508M	ENSP00000356470:T508M	T	+	2	0	SWT1	183426397	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	5.776000	0.68924	2.580000	0.87095	0.561000	0.74099	ACG		0.318	SWT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085790.1	NM_017673	Missense_Mutation	31	59	0	0	0	0.008361	0	31	59				
F13B	2165	broad.mit.edu	37	1	197032176	197032176	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:197032176C>G	ENST00000367412.1	-	2	119	c.76G>C	c.(76-78)Ggt>Cgt	p.G26R		NM_001994.2	NP_001985.2	P05160	F13B_HUMAN	coagulation factor XIII, B polypeptide	26	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation (GO:0007596)	extracellular region (GO:0005576)		p.G26R(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(5)|liver(1)|lung(40)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	66						TGAGGAAAACCACAGGGTTTC	0.294																																							uc001gtt.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						c.(76-78)GGT>CGT		coagulation factor XIII B subunit precursor							88.0	100.0	96.0					1																	197032176		2203	4300	6503	SO:0001583	missense	2165				blood coagulation	extracellular region		g.chr1:197032176C>G	M14057	CCDS1388.1	1q31-q32.1	2012-10-02			ENSG00000143278	ENSG00000143278			3534	protein-coding gene	gene with protein product		134580				2339067, 2271707	Standard	NM_001994		Approved	FXIIIB	uc001gtt.1	P05160	OTTHUMG00000036519	ENST00000367412.1:c.76G>C	1.37:g.197032176C>G	ENSP00000356382:p.Gly26Arg						p.G26R	NM_001994	NP_001985	P05160	F13B_HUMAN			2	120	-			26			Sushi 1.		A8K3E5|Q5VYL5	Missense_Mutation	SNP	ENST00000367412.1	37	c.76G>C	CCDS1388.1	.	.	.	.	.	.	.	.	.	.	C	14.07	2.425918	0.43020	.	.	ENSG00000143278	ENST00000367412	T	0.52526	0.66	5.58	3.69	0.42338	Complement control module (2);Sushi/SCR/CCP (1);	1.076690	0.07450	N	0.898803	T	0.50735	0.1633	L	0.51422	1.61	0.22156	N	0.999323	P	0.48016	0.904	P	0.47470	0.548	T	0.35822	-0.9773	10	0.37606	T	0.19	.	10.9521	0.47336	0.0:0.7988:0.1309:0.0702	.	26	P05160	F13B_HUMAN	R	26	ENSP00000356382:G26R	ENSP00000356382:G26R	G	-	1	0	F13B	195298799	0.911000	0.30947	0.396000	0.26296	0.996000	0.88848	1.928000	0.40104	1.347000	0.45714	0.655000	0.94253	GGT		0.294	F13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088821.2	NM_001994		80	249	0	0	0	0.00361	0	80	249				
CNTN2	6900	broad.mit.edu	37	1	205039560	205039560	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:205039560G>T	ENST00000331830.4	+	19	2722	c.2438G>T	c.(2437-2439)aGg>aTg	p.R813M		NM_005076.3	NP_005067.1	Q02246	CNTN2_HUMAN	contactin 2 (axonal)	813					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|central nervous system myelination (GO:0022010)|cerebral cortex GABAergic interneuron migration (GO:0021853)|clustering of voltage-gated potassium channels (GO:0045163)|establishment of protein localization to juxtaparanode region of axon (GO:0071206)|learning (GO:0007612)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|positive regulation of protein processing (GO:0010954)|presynaptic membrane organization (GO:0097090)|receptor internalization (GO:0031623)|regulation of astrocyte differentiation (GO:0048710)|regulation of axon diameter (GO:0031133)|regulation of neuronal synaptic plasticity (GO:0048168)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|juxtaparanode region of axon (GO:0044224)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated potassium channel complex (GO:0008076)	carbohydrate binding (GO:0030246)|identical protein binding (GO:0042802)	p.R813M(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(11)|lung(23)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	54	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			CCAGAGCCCAGGGTGGCCCCT	0.582																																					Melanoma(183;2548 2817 37099 41192)	Melanoma(183;2548 2817 37099 41192)	uc001hbr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2437-2439)AGG>ATG		contactin 2 precursor							34.0	31.0	32.0					1																	205039560		2203	4300	6503	SO:0001583	missense	6900				axon guidance|clustering of voltage-gated potassium channels	anchored to membrane|juxtaparanode region of axon|myelin sheath|node of Ranvier|synapse part	identical protein binding	g.chr1:205039560G>T	X67734	CCDS1449.1	1q32.1	2013-02-11			ENSG00000184144	ENSG00000184144		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2172	protein-coding gene	gene with protein product		190197		TAX, AXT		8307567, 8586965	Standard	NM_005076		Approved	TAG-1, TAX1	uc001hbr.3	Q02246	OTTHUMG00000037105	ENST00000331830.4:c.2438G>T	1.37:g.205039560G>T	ENSP00000330633:p.Arg813Met					CNTN2_uc001hbq.1_Missense_Mutation_p.R704M|CNTN2_uc001hbs.2_Missense_Mutation_p.R601M	p.R813M	NM_005076	NP_005067	Q02246	CNTN2_HUMAN	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)		19	2707	+	all_cancers(21;0.144)|Breast(84;0.0437)		813			Fibronectin type-III 3.		P78432|Q5T054	Missense_Mutation	SNP	ENST00000331830.4	37	c.2438G>T	CCDS1449.1	.	.	.	.	.	.	.	.	.	.	G	13.97	2.396558	0.42512	.	.	ENSG00000184144	ENST00000331830	T	0.17370	2.28	5.22	2.17	0.27698	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.362603	0.22061	N	0.065172	T	0.11367	0.0277	N	0.13043	0.29	0.29451	N	0.858437	B;B	0.33073	0.153;0.396	B;B	0.39068	0.195;0.289	T	0.16689	-1.0394	10	0.35671	T	0.21	.	9.4748	0.38864	0.3207:0.0:0.6793:0.0	.	813;704	Q02246;Q68DA2	CNTN2_HUMAN;.	M	813	ENSP00000330633:R813M	ENSP00000330633:R813M	R	+	2	0	CNTN2	203306183	0.999000	0.42202	0.999000	0.59377	0.955000	0.61496	1.160000	0.31761	0.147000	0.19030	-0.444000	0.05651	AGG		0.582	CNTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090080.3	NM_005076		16	29	1	0	4.14922e-12	0.004007	5.97913e-12	16	29				
DSTYK	25778	broad.mit.edu	37	1	205133027	205133027	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:205133027T>A	ENST00000367162.3	-	4	1411	c.1381A>T	c.(1381-1383)Atc>Ttc	p.I461F	DSTYK_ENST00000367160.4_Intron|DSTYK_ENST00000367161.3_Missense_Mutation_p.I461F	NM_015375.2	NP_056190.1	Q6XUX3	DUSTY_HUMAN	dual serine/threonine and tyrosine protein kinase	461					cellular response to fibroblast growth factor stimulus (GO:0044344)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of kinase activity (GO:0033674)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)	p.I461F(1)		breast(2)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(2)	14						ATCTGTCGGATGCAGCATTTG	0.483																																							uc001hbw.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)	1						c.(1381-1383)ATC>TTC		receptor interacting protein kinase 5 isoform 1							187.0	159.0	169.0					1																	205133027		2203	4300	6503	SO:0001583	missense	25778					cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr1:205133027T>A	AF068286	CCDS1451.1, CCDS1452.1	1q32	2008-12-18	2008-12-18	2008-12-18	ENSG00000133059	ENSG00000133059			29043	protein-coding gene	gene with protein product		612666	"""receptor interacting protein kinase 5"""	RIPK5		15178406	Standard	NM_015375		Approved	KIAA0472, DustyPK, RIP5	uc001hbw.3	Q6XUX3	OTTHUMG00000037102	ENST00000367162.3:c.1381A>T	1.37:g.205133027T>A	ENSP00000356130:p.Ile461Phe					DSTYK_uc001hbx.2_Missense_Mutation_p.I461F|DSTYK_uc001hby.1_Intron	p.I461F	NM_015375	NP_056190	Q6XUX3	DUSTY_HUMAN			4	1445	-			461					B7ZL64|O75060|Q17R94|Q5RKT0|Q6IN87|Q6P997|Q86Y03|Q9P1S5	Missense_Mutation	SNP	ENST00000367162.3	37	c.1381A>T	CCDS1451.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.474125	0.84640	.	.	ENSG00000133059	ENST00000367161;ENST00000367162	T;T	0.80123	-1.28;-1.34	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	D	0.86628	0.5978	L	0.47716	1.5	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.76575	0.988;0.979	D	0.87734	0.2581	10	0.72032	D	0.01	-18.7887	15.8221	0.78662	0.0:0.0:0.0:1.0	.	461;461	Q6XUX3-2;Q6XUX3	.;DUSTY_HUMAN	F	461	ENSP00000356129:I461F;ENSP00000356130:I461F	ENSP00000356129:I461F	I	-	1	0	DSTYK	203399650	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	6.119000	0.71590	2.227000	0.72691	0.460000	0.39030	ATC		0.483	DSTYK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090345.1	NM_015375		16	248	0	0	0	0.006122	0	16	248				
CR1	1378	broad.mit.edu	37	1	207679324	207679324	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:207679324G>T	ENST00000367049.4	+	2	197	c.197G>T	c.(196-198)gGg>gTg	p.G66V	CR1_ENST00000400960.2_Missense_Mutation_p.G66V|CR1_ENST00000367053.1_Missense_Mutation_p.G66V|CR1_ENST00000367051.1_Missense_Mutation_p.G66V|CR1_ENST00000367052.1_Missense_Mutation_p.G66V|CR1_ENST00000367050.4_3'UTR	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	66	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)	p.G71V(1)|p.G66V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						TTTCCCATTGGGACATATCTG	0.468																																							uc001hfy.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)	3						c.(196-198)GGG>GTG		complement receptor 1 isoform F precursor							165.0	154.0	157.0					1																	207679324		1850	4082	5932	SO:0001583	missense	1378				complement activation, classical pathway|innate immune response	integral to plasma membrane	complement receptor activity	g.chr1:207679324G>T	Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.197G>T	1.37:g.207679324G>T	ENSP00000356016:p.Gly66Val					CR1_uc009xcl.1_Missense_Mutation_p.G66V|CR1_uc001hfx.2_Missense_Mutation_p.G66V|CR1_uc010psg.1_Missense_Mutation_p.G66V|CR1_uc009xcj.1_Missense_Mutation_p.G66V|CR1_uc009xck.1_Missense_Mutation_p.G66V	p.G66V	NM_000573	NP_000564	P17927	CR1_HUMAN			2	337	+			66			Sushi 1.|Extracellular (Potential).		Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Missense_Mutation	SNP	ENST00000367049.4	37	c.197G>T	CCDS44308.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.90|13.90	2.373803|2.373803	0.42105|0.42105	.|.	.|.	ENSG00000203710|ENSG00000203710	ENST00000367052;ENST00000367051;ENST00000367053;ENST00000400960;ENST00000534202;ENST00000367049|ENST00000529814	T;T;T;T;T;T|.	0.72725|.	-0.68;-0.68;-0.68;-0.68;-0.68;-0.68|.	4.13|4.13	4.13|4.13	0.48395|0.48395	Complement control module (2);Sushi/SCR/CCP (3);|.	.|.	.|.	.|.	.|.	D|.	0.82332|.	0.5014|.	M|M	0.94101|0.94101	3.495|3.495	0.54753|0.54753	D|D	0.999987|0.999987	D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D|.	0.97110|.	1.0;1.0;1.0;1.0;1.0|.	T|.	0.83072|.	-0.0142|.	9|.	0.87932|0.28530	D|T	0|0.3	.|.	12.0894|12.0894	0.53717|0.53717	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	66;66;41;66;66|.	Q5SR44;E9PQN4;Q5SR42;P17927;E9PDY4|.	.;.;.;CR1_HUMAN;.|.	V|X	66|42	ENSP00000356019:G66V;ENSP00000356018:G66V;ENSP00000356020:G66V;ENSP00000383744:G66V;ENSP00000436139:G66V;ENSP00000356016:G66V|.	ENSP00000356016:G66V|ENSP00000434718:G42X	G|G	+|+	2|1	0|0	CR1|CR1	205745947|205745947	0.886000|0.886000	0.30341|0.30341	0.821000|0.821000	0.32701|0.32701	0.022000|0.022000	0.10575|0.10575	3.767000|3.767000	0.55288|0.55288	2.303000|2.303000	0.77524|0.77524	0.591000|0.591000	0.81541|0.81541	GGG|GGA		0.468	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382527.1	NM_000573		68	155	1	0	4.83677e-39	0.00361	8.33824e-39	68	155				
CR1	1378	broad.mit.edu	37	1	207751547	207751547	+	Splice_Site	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:207751547G>T	ENST00000367049.4	+	29	4935	c.4935G>T	c.(4933-4935)agG>agT	p.R1645S	RP11-78B10.2_ENST00000597497.1_RNA|CR1_ENST00000400960.2_Splice_Site_p.R1195S|RP11-78B10.2_ENST00000596003.1_RNA|CR1_ENST00000367053.1_Splice_Site_p.R1195S|CR1_ENST00000367051.1_Splice_Site_p.R1195S|CR1_ENST00000367052.1_Splice_Site_p.R1195S	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	1195	Sushi 25. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)	p.R1200S(1)|p.R1645S(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						GCTGCTCCAGGGGTGAGTCTG	0.537																																							uc001hfy.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)	3						c.(3583-3585)AGG>AGT		complement receptor 1 isoform F precursor							61.0	65.0	64.0					1																	207751547		2000	4170	6170	SO:0001630	splice_region_variant	1378				complement activation, classical pathway|innate immune response	integral to plasma membrane	complement receptor activity	g.chr1:207751547G>T	Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.4936+1G>T	1.37:g.207751547G>T						CR1_uc009xcl.1_Missense_Mutation_p.R745S|CR1_uc001hfx.2_Missense_Mutation_p.R1645S	p.R1195S	NM_000573	NP_000564	P17927	CR1_HUMAN			21	3725	+			1195			Extracellular (Potential).|Sushi 19.|Sushi 18.		Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Missense_Mutation	SNP	ENST00000367049.4	37	c.3585G>T	CCDS44308.1	.	.	.	.	.	.	.	.	.	.	G	18.00	3.525991	0.64860	.	.	ENSG00000203710	ENST00000367052;ENST00000367051;ENST00000367053;ENST00000400960;ENST00000534202;ENST00000367049	T;T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78;0.78	2.8	2.8	0.32819	Complement control module (1);Sushi/SCR/CCP (1);	.	.	.	.	T	0.53965	0.1829	M	0.86740	2.835	0.26653	N	0.972057	B;P;D	0.59357	0.245;0.928;0.985	B;B;P	0.45577	0.219;0.38;0.486	T	0.51482	-0.8700	9	0.30854	T	0.27	.	9.3467	0.38113	0.0:0.0:1.0:0.0	.	1195;1195;1645	Q5SR44;P17927;E9PDY4	.;CR1_HUMAN;.	S	1195;1195;1195;1195;745;1645	ENSP00000356019:R1195S;ENSP00000356018:R1195S;ENSP00000356020:R1195S;ENSP00000383744:R1195S;ENSP00000436139:R745S;ENSP00000356016:R1645S	ENSP00000356016:R1645S	R	+	3	2	CR1	205818170	0.488000	0.25996	1.000000	0.80357	0.984000	0.73092	0.233000	0.17911	1.895000	0.54865	0.580000	0.79431	AGG		0.537	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382527.1	NM_000573	Missense_Mutation	15	194	1	0	1.3612e-06	0.003163	1.65584e-06	15	194				
CENPF	1063	broad.mit.edu	37	1	214820636	214820636	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:214820636A>G	ENST00000366955.3	+	13	7891	c.7723A>G	c.(7723-7725)Aaa>Gaa	p.K2575E		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	2671	Sufficient for centromere localization.|Sufficient for self-association.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)	p.K2575E(1)		NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		GCTACAATCCAAAAATGCCTC	0.418																																					Colon(80;575 1284 11000 14801 43496)	Colon(80;575 1284 11000 14801 43496)	uc001hkm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13						c.(7723-7725)AAA>GAA		centromere protein F							65.0	64.0	64.0					1																	214820636		2203	4300	6503	SO:0001583	missense	1063				cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding	g.chr1:214820636A>G	U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.7723A>G	1.37:g.214820636A>G	ENSP00000355922:p.Lys2575Glu						p.K2575E	NM_016343	NP_057427	P49454	CENPF_HUMAN		all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)	13	7897	+			2671			Potential.|Sufficient for self-association.|Sufficient for centromere localization.		Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	ENST00000366955.3	37	c.7723A>G	CCDS31023.1	.	.	.	.	.	.	.	.	.	.	A	1.079	-0.667405	0.03428	.	.	ENSG00000117724	ENST00000366955	T	0.03386	3.95	5.06	-0.218	0.13142	.	0.682220	0.12125	N	0.497346	T	0.02688	0.0081	L	0.39633	1.23	0.09310	N	1	B	0.12630	0.006	B	0.15052	0.012	T	0.49360	-0.8948	10	0.05620	T	0.96	.	5.5883	0.17287	0.361:0.4591:0.1799:0.0	.	2671	P49454	CENPF_HUMAN	E	2575	ENSP00000355922:K2575E	ENSP00000355922:K2575E	K	+	1	0	CENPF	212887259	0.007000	0.16637	0.045000	0.18777	0.092000	0.18411	0.198000	0.17217	-0.219000	0.10003	0.496000	0.49642	AAA		0.418	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343		4	67	0	0	0	0.009096	0	4	67				
URB2	9816	broad.mit.edu	37	1	229779310	229779310	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:229779310A>T	ENST00000258243.2	+	5	3801	c.3665A>T	c.(3664-3666)gAt>gTt	p.D1222V		NM_014777.2	NP_055592.2	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	1222						aggresome (GO:0016235)|nucleolus (GO:0005730)|nucleus (GO:0005634)		p.D1222V(1)		breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(6)	73						GTCACTCAGGATATTGAGCCT	0.453																																							uc001hts.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|ovary(1)	3						c.(3664-3666)GAT>GTT		URB2 ribosome biogenesis 2 homolog							134.0	130.0	131.0					1																	229779310		2203	4300	6503	SO:0001583	missense	9816					nucleolus		g.chr1:229779310A>T	D50923	CCDS31052.1	1q42.13	2009-11-06	2008-10-01	2008-10-01	ENSG00000135763	ENSG00000135763			28967	protein-coding gene	gene with protein product	"""nucleolar preribosomal-associated protein 1"""		"""KIAA0133"""	KIAA0133		8590280	Standard	NM_014777		Approved	NPA2, NET10	uc001hts.1	Q14146	OTTHUMG00000039464	ENST00000258243.2:c.3665A>T	1.37:g.229779310A>T	ENSP00000258243:p.Asp1222Val					URB2_uc009xfd.1_Missense_Mutation_p.D1222V	p.D1222V	NM_014777	NP_055592	Q14146	URB2_HUMAN			5	3801	+			1222					Q5VYC9	Missense_Mutation	SNP	ENST00000258243.2	37	c.3665A>T	CCDS31052.1	.	.	.	.	.	.	.	.	.	.	A	10.64	1.407634	0.25378	.	.	ENSG00000135763	ENST00000258243	T	0.36878	1.23	5.36	2.96	0.34315	.	0.618062	0.18336	N	0.144337	T	0.21921	0.0528	L	0.27053	0.805	0.45403	D	0.998389	P	0.41313	0.745	B	0.33750	0.169	T	0.01819	-1.1267	9	.	.	.	-2.6314	11.5866	0.50923	0.7165:0.2835:0.0:0.0	.	1222	Q14146	URB2_HUMAN	V	1222	ENSP00000258243:D1222V	.	D	+	2	0	URB2	227845933	0.127000	0.22367	0.185000	0.23176	0.225000	0.24961	0.756000	0.26419	0.387000	0.25024	0.528000	0.53228	GAT		0.453	URB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095232.1	NM_014777		8	182	0	0	0	0.004482	0	8	182				
SIPA1L2	57568	broad.mit.edu	37	1	232581492	232581492	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:232581492T>C	ENST00000366630.1	-	10	3494	c.3136A>G	c.(3136-3138)Aaa>Gaa	p.K1046E	SIPA1L2_ENST00000262861.4_Missense_Mutation_p.K1046E|SIPA1L2_ENST00000308942.4_Missense_Mutation_p.K120E			Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like 2	1046					regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)	p.K1046E(1)		NS(1)|breast(5)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(49)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	103		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				CTGTCGAGTTTATATTCCACC	0.582																																							uc001hvg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(2)|pancreas(1)|skin(1)	6						c.(3136-3138)AAA>GAA		signal-induced proliferation-associated 1 like							90.0	92.0	91.0					1																	232581492		1881	4111	5992	SO:0001583	missense	57568				regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity	g.chr1:232581492T>C	AB037810	CCDS41474.1	1q42.2	2008-02-05			ENSG00000116991	ENSG00000116991			23800	protein-coding gene	gene with protein product		611609					Standard	NM_020808		Approved	KIAA1389	uc001hvg.3	Q9P2F8	OTTHUMG00000037820	ENST00000366630.1:c.3136A>G	1.37:g.232581492T>C	ENSP00000355589:p.Lys1046Glu					SIPA1L2_uc001hvf.2_Missense_Mutation_p.K120E	p.K1046E	NM_020808	NP_065859	Q9P2F8	SI1L2_HUMAN			9	3294	-		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)	1046					Q2TV88|Q5VXR7|Q5VXR8|Q641Q4|Q8NA38|Q96DZ3|Q9H9F6	Missense_Mutation	SNP	ENST00000366630.1	37	c.3136A>G	CCDS41474.1	.	.	.	.	.	.	.	.	.	.	T	19.38	3.815964	0.70912	.	.	ENSG00000116991	ENST00000366630;ENST00000262861;ENST00000308942	T;T;T	0.69435	-0.4;-0.4;-0.4	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.75496	0.3857	M	0.73217	2.22	0.58432	D	0.999994	P;P	0.51537	0.946;0.692	P;P	0.54664	0.758;0.64	T	0.74318	-0.3704	10	0.29301	T	0.29	-25.9026	15.4475	0.75243	0.0:0.0:0.0:1.0	.	1046;120	Q9P2F8;Q9P2F8-2	SI1L2_HUMAN;.	E	1046;1046;120	ENSP00000355589:K1046E;ENSP00000262861:K1046E;ENSP00000309102:K120E	ENSP00000262861:K1046E	K	-	1	0	SIPA1L2	230648115	1.000000	0.71417	0.986000	0.45419	0.889000	0.51656	7.695000	0.84257	2.048000	0.60808	0.529000	0.55759	AAA		0.582	SIPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092318.1	XM_045839		64	175	0	0	0	0.00361	0	64	175				
RYR2	6262	broad.mit.edu	37	1	237656311	237656311	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:237656311C>A	ENST00000366574.2	+	19	2202	c.1885C>A	c.(1885-1887)Cag>Aag	p.Q629K	RYR2_ENST00000360064.6_Missense_Mutation_p.Q627K|RYR2_ENST00000542537.1_Missense_Mutation_p.Q613K	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	629	B30.2/SPRY 1. {ECO:0000255|PROSITE- ProRule:PRU00548}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.Q627K(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CCGTTCTAACCAGCATCTCAT	0.473																																							uc001hyl.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(1885-1887)CAG>AAG		cardiac muscle ryanodine receptor							136.0	147.0	143.0					1																	237656311		2030	4189	6219	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237656311C>A	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.1885C>A	1.37:g.237656311C>A	ENSP00000355533:p.Gln629Lys						p.Q629K	NM_001035	NP_001026	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		19	2005	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	629			Cytoplasmic (By similarity).|B30.2/SPRY 1.		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.1885C>A	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.145021	0.77888	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.97089	-4.24;-4.24;-4.24	6.16	6.16	0.99307	Intracellular calcium-release channel (1);B30.2/SPRY domain (1);	0.000000	0.64402	D	0.000009	D	0.97436	0.9161	M	0.87758	2.905	0.80722	D	1	B	0.23185	0.081	B	0.27887	0.084	D	0.94743	0.7920	10	0.87932	D	0	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	629	Q92736	RYR2_HUMAN	K	629;627;613	ENSP00000355533:Q629K;ENSP00000353174:Q627K;ENSP00000443798:Q613K	ENSP00000353174:Q627K	Q	+	1	0	RYR2	235722934	1.000000	0.71417	1.000000	0.80357	0.313000	0.28021	7.760000	0.85248	2.937000	0.99478	0.650000	0.86243	CAG		0.473	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		12	32	1	0	4.36969e-10	0.001855	5.98967e-10	12	32				
RYR2	6262	broad.mit.edu	37	1	237951363	237951363	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:237951363C>A	ENST00000366574.2	+	92	13721	c.13404C>A	c.(13402-13404)caC>caA	p.H4468Q	RYR2_ENST00000360064.6_Missense_Mutation_p.H4474Q|RYR2_ENST00000542537.1_Missense_Mutation_p.H4452Q	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4468					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.H4466Q(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TTCACACACACAGATACGGAG	0.378																																							uc001hyl.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(13402-13404)CAC>CAA		cardiac muscle ryanodine receptor							91.0	102.0	98.0					1																	237951363		2107	4250	6357	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237951363C>A	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.13404C>A	1.37:g.237951363C>A	ENSP00000355533:p.His4468Gln						p.H4468Q	NM_001035	NP_001026	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		92	13524	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	4468					Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.13404C>A	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	C	3.438	-0.114743	0.06881	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.92647	-3.08;-3.08;-3.08	4.55	-4.91	0.03085	Ryanodine Receptor TM 4-6 (1);	0.198626	0.33534	U	0.004819	T	0.72317	0.3445	N	0.01874	-0.695	0.41283	D	0.986922	B	0.30211	0.273	B	0.31016	0.123	T	0.62324	-0.6878	10	0.06099	T	0.92	.	12.6846	0.56940	0.0:0.4593:0.0:0.5407	.	4468	Q92736	RYR2_HUMAN	Q	4468;4474;4452	ENSP00000355533:H4468Q;ENSP00000353174:H4474Q;ENSP00000443798:H4452Q	ENSP00000353174:H4474Q	H	+	3	2	RYR2	236017986	0.019000	0.18553	0.847000	0.33407	0.898000	0.52572	-1.147000	0.03188	-0.998000	0.03446	0.585000	0.79938	CAC		0.378	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		12	25	1	0	4.3838e-07	0.001855	5.52398e-07	12	25				
PLD5	200150	broad.mit.edu	37	1	242511434	242511434	+	Silent	SNP	T	T	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:242511434T>A	ENST00000536534.2	-	2	541	c.300A>T	c.(298-300)tcA>tcT	p.S100S	PLD5_ENST00000442594.2_Missense_Mutation_p.Q6L|PLD5_ENST00000427495.1_Silent_p.S38S			Q8N7P1	PLD5_HUMAN	phospholipase D family, member 5	100						integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)	p.S100S(1)|p.Q6L(1)		breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(22)|ovary(6)|skin(3)|urinary_tract(1)	55	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			AATTTTTTTCTGAGAGTCCAT	0.453																																							uc001hzn.1		NA																	2	Substitution - Missense(1)|Substitution - coding silent(1)		lung(2)	ovary(6)	6						c.(298-300)TCA>TCT		RecName: Full=Inactive phospholipase D5;          Short=Inactive PLD 5; AltName: Full=Inactive choline phosphatase 5; AltName: Full=Inactive phosphatidylcholine-hydrolyzing phospholipase D5; AltName: Full=PLDc;							123.0	116.0	119.0					1																	242511434		2203	4300	6503	SO:0001819	synonymous_variant	200150					integral to membrane	catalytic activity	g.chr1:242511434T>A	AK098092	CCDS1621.1, CCDS1621.2, CCDS55692.1	1q43	2008-02-05			ENSG00000180287	ENSG00000180287			26879	protein-coding gene	gene with protein product							Standard	NM_001195811		Approved	FLJ40773	uc001hzn.2	Q8N7P1	OTTHUMG00000039867	ENST00000536534.2:c.300A>T	1.37:g.242511434T>A						PLD5_uc001hzl.3_Silent_p.S38S|PLD5_uc001hzm.3_5'UTR|PLD5_uc001hzo.1_Missense_Mutation_p.Q6L	p.S100S			Q8N7P1	PLD5_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0329)		2	427	-	Melanoma(84;0.242)		100					A1KXV0|B7Z324|Q494U9|Q8NB22	Silent	SNP	ENST00000536534.2	37	c.300A>T	CCDS1621.2	.	.	.	.	.	.	.	.	.	.	T	11.11	1.542929	0.27563	.	.	ENSG00000180287	ENST00000442594	T	0.39406	1.08	5.33	-3.45	0.04781	.	0.501289	0.20012	N	0.101119	T	0.25901	0.0631	.	.	.	0.25363	N	0.988761	B	0.02656	0.0	B	0.01281	0.0	T	0.10567	-1.0624	9	0.54805	T	0.06	-5.1131	8.2713	0.31846	0.1044:0.4236:0.0:0.472	.	6	Q8N7P1-2	.	L	6	ENSP00000414188:Q6L	ENSP00000414188:Q6L	Q	-	2	0	PLD5	240578057	0.809000	0.29036	0.971000	0.41717	0.983000	0.72400	-0.233000	0.09041	-0.771000	0.04608	-1.139000	0.01908	CAG		0.453	PLD5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397213.2	NM_152666		17	206	0	0	0	0.007413	0	17	206				
C1orf101	257044	broad.mit.edu	37	1	244643077	244643077	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:244643077A>G	ENST00000366534.4	+	5	371	c.317A>G	c.(316-318)tAt>tGt	p.Y106C	C1orf101_ENST00000473875.1_3'UTR|C1orf101_ENST00000366531.3_5'UTR|C1orf101_ENST00000366533.4_Missense_Mutation_p.Y106C	NM_001130957.1	NP_001124429.1	Q5SY80	CA101_HUMAN	chromosome 1 open reading frame 101	106						CatSper complex (GO:0036128)		p.Y106C(2)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	36	all_cancers(71;2.99e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)		all cancers(7;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.001)|GBM - Glioblastoma multiforme(7;0.0154)			CTGTGGTACTATAGAGTTAGG	0.284																																							uc001iam.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|breast(1)	2						c.(316-318)TAT>TGT		hypothetical protein LOC257044 isoform 1							139.0	140.0	139.0					1																	244643077		2202	4297	6499	SO:0001583	missense	257044					integral to membrane		g.chr1:244643077A>G	BC032859	CCDS1625.1, CCDS44340.1, CCDS55693.1	1q44	2012-12-20			ENSG00000179397	ENSG00000179397			28491	protein-coding gene	gene with protein product						12477932	Standard	NM_173807		Approved	MGC33370	uc001iam.3	Q5SY80	OTTHUMG00000040103	ENST00000366534.4:c.317A>G	1.37:g.244643077A>G	ENSP00000355492:p.Tyr106Cys					C1orf101_uc001iak.1_5'UTR|C1orf101_uc001ial.2_Missense_Mutation_p.Y106C|C1orf101_uc010pym.1_5'UTR|C1orf101_uc010pyn.1_Missense_Mutation_p.Y109C	p.Y106C	NM_001130957	NP_001124429	Q5SY80	CA101_HUMAN	all cancers(7;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.001)|GBM - Glioblastoma multiforme(7;0.0154)		5	376	+	all_cancers(71;2.99e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)		106			Extracellular (Potential).		B4DZR4|B7Z7X5|E9PEA3|Q8IYZ6	Missense_Mutation	SNP	ENST00000366534.4	37	c.317A>G	CCDS44340.1	.	.	.	.	.	.	.	.	.	.	A	11.19	1.565876	0.27915	.	.	ENSG00000179397	ENST00000391841;ENST00000366534;ENST00000366533;ENST00000428042	T;T;T	0.39997	1.13;1.12;1.05	4.27	-1.23	0.09465	.	1.559260	0.03765	N	0.258814	T	0.36524	0.0970	L	0.50333	1.59	0.20074	N	0.999934	B;B;B	0.24882	0.113;0.113;0.113	B;B;B	0.25405	0.035;0.035;0.06	T	0.35748	-0.9776	10	0.72032	D	0.01	.	4.0623	0.09844	0.4284:0.0:0.0939:0.4777	.	96;106;106	B1AQM6;Q5SY80;Q5SY80-2	.;CA101_HUMAN;.	C	106;106;106;96	ENSP00000355492:Y106C;ENSP00000355491:Y106C;ENSP00000395796:Y96C	ENSP00000355491:Y106C	Y	+	2	0	C1orf101	242709700	0.010000	0.17322	0.071000	0.20095	0.638000	0.38207	-0.249000	0.08842	-0.207000	0.10187	0.477000	0.44152	TAT		0.284	C1orf101-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096701.1	NM_173807		13	125	0	0	0	0.001368	0	13	125				
OR2G3	81469	broad.mit.edu	37	1	247769209	247769209	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:247769209G>T	ENST00000320002.2	+	1	354	c.322G>T	c.(322-324)Ggc>Tgc	p.G108C	RNU6-691P_ENST00000516585.1_RNA|RP11-978I15.10_ENST00000435333.1_RNA|RP11-978I15.10_ENST00000446347.1_RNA	NM_001001914.1	NP_001001914.1	Q8NGZ4	OR2G3_HUMAN	olfactory receptor, family 2, subfamily G, member 3	108						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G108C(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(31)|skin(5)	50	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			TCTGGCACTGGGCTCCACTGA	0.488																																							uc010pyz.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(322-324)GGC>TGC		olfactory receptor, family 2, subfamily G,							283.0	247.0	259.0					1																	247769209		2203	4300	6503	SO:0001583	missense	81469				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247769209G>T	BK004417	CCDS31093.1	1q44	2012-08-09			ENSG00000177476	ENSG00000177476		"""GPCR / Class A : Olfactory receptors"""	15008	protein-coding gene	gene with protein product							Standard	NM_001001914		Approved		uc010pyz.2	Q8NGZ4	OTTHUMG00000040576	ENST00000320002.2:c.322G>T	1.37:g.247769209G>T	ENSP00000326301:p.Gly108Cys						p.G108C	NM_001001914	NP_001001914	Q8NGZ4	OR2G3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.017)		1	322	+	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		108			Helical; Name=3; (Potential).		B2RN64|Q5JQT1|Q6IF45	Missense_Mutation	SNP	ENST00000320002.2	37	c.322G>T	CCDS31093.1	.	.	.	.	.	.	.	.	.	.	G	15.28	2.787717	0.49997	.	.	ENSG00000177476	ENST00000320002	T	0.01369	4.97	3.8	3.8	0.43715	GPCR, rhodopsin-like superfamily (1);	0.000000	0.37393	U	0.002118	T	0.12390	0.0301	H	0.94385	3.53	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.04454	-1.0950	10	0.87932	D	0	.	13.5842	0.61919	0.0:0.0:1.0:0.0	.	108	Q8NGZ4	OR2G3_HUMAN	C	108	ENSP00000326301:G108C	ENSP00000326301:G108C	G	+	1	0	OR2G3	245835832	0.070000	0.21116	0.979000	0.43373	0.962000	0.63368	2.847000	0.48270	2.120000	0.65058	0.492000	0.49549	GGC		0.488	OR2G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097624.1			138	306	1	0	7.47599e-62	0.00361	1.31297e-61	138	306				
OR6F1	343169	broad.mit.edu	37	1	247875457	247875457	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:247875457C>G	ENST00000302084.2	-	1	648	c.601G>C	c.(601-603)Gtg>Ctg	p.V201L	RP11-634B7.4_ENST00000449298.1_RNA	NM_001005286.1	NP_001005286.1	Q8NGZ6	OR6F1_HUMAN	olfactory receptor, family 6, subfamily F, member 1	201						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V201L(1)		breast(1)|kidney(1)|large_intestine(5)|lung(34)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)	47	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0168)			ACAGCAATCACAAAGGCCACA	0.542																																							uc001idj.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(601-603)GTG>CTG		olfactory receptor, family 6, subfamily F,							122.0	109.0	113.0					1																	247875457		2203	4300	6503	SO:0001583	missense	343169				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247875457C>G	BK004460	CCDS31095.1	1q44	2012-08-09			ENSG00000169214	ENSG00000169214		"""GPCR / Class A : Olfactory receptors"""	15027	protein-coding gene	gene with protein product							Standard	NM_001005286		Approved	OST731	uc001idj.1	Q8NGZ6	OTTHUMG00000040213	ENST00000302084.2:c.601G>C	1.37:g.247875457C>G	ENSP00000305640:p.Val201Leu						p.V201L	NM_001005286	NP_001005286	Q8NGZ6	OR6F1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0168)		1	601	-	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		201			Helical; Name=5; (Potential).		B2RNV6|Q6IF02|Q96R39	Missense_Mutation	SNP	ENST00000302084.2	37	c.601G>C	CCDS31095.1	.	.	.	.	.	.	.	.	.	.	C	0.028	-1.353345	0.01256	.	.	ENSG00000169214	ENST00000302084	T	0.00193	8.58	3.72	1.83	0.25207	GPCR, rhodopsin-like superfamily (1);	0.841722	0.09911	N	0.739828	T	0.00109	0.0003	N	0.13098	0.295	0.21445	N	0.999686	B	0.23128	0.08	B	0.23852	0.049	T	0.01762	-1.1279	10	0.08599	T	0.76	-5.4178	6.8576	0.24050	0.0:0.6971:0.0:0.3029	.	201	Q8NGZ6	OR6F1_HUMAN	L	201	ENSP00000305640:V201L	ENSP00000305640:V201L	V	-	1	0	OR6F1	245942080	0.000000	0.05858	0.085000	0.20634	0.020000	0.10135	-1.403000	0.02497	0.368000	0.24481	-0.185000	0.12909	GTG		0.542	OR6F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096870.1	NM_001005286		28	166	0	0	0	0.00632	0	28	166				
OR2T33	391195	broad.mit.edu	37	1	248436320	248436320	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:248436320G>T	ENST00000318021.2	-	1	818	c.797C>A	c.(796-798)aCt>aAt	p.T266N		NM_001004695.1	NP_001004695.1	Q8NG76	O2T33_HUMAN	olfactory receptor, family 2, subfamily T, member 33	266						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T266N(1)		NS(2)|breast(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(41)|ovary(1)|prostate(1)|skin(4)	67	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			GTCATGGTTAGTGGACCTATG	0.478																																							uc010pzi.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(796-798)ACT>AAT		olfactory receptor, family 2, subfamily T,							144.0	154.0	151.0					1																	248436320		2203	4300	6503	SO:0001583	missense	391195				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248436320G>T		CCDS31109.1	1q44	2012-08-09			ENSG00000177212	ENSG00000177212		"""GPCR / Class A : Olfactory receptors"""	31255	protein-coding gene	gene with protein product							Standard	NM_001004695		Approved		uc010pzi.2	Q8NG76	OTTHUMG00000040458	ENST00000318021.2:c.797C>A	1.37:g.248436320G>T	ENSP00000324687:p.Thr266Asn						p.T266N	NM_001004695	NP_001004695	Q8NG76	O2T33_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0245)		1	797	-	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		266			Extracellular (Potential).		B2RNN0	Missense_Mutation	SNP	ENST00000318021.2	37	c.797C>A	CCDS31109.1	.	.	.	.	.	.	.	.	.	.	-	1.474	-0.558959	0.03967	.	.	ENSG00000177212	ENST00000318021	T	0.00107	8.72	1.77	0.706	0.18133	GPCR, rhodopsin-like superfamily (1);	0.899723	0.08983	U	0.865464	T	0.00144	0.0004	L	0.29908	0.895	0.09310	N	1	P	0.34562	0.457	B	0.36030	0.216	T	0.23048	-1.0199	10	0.87932	D	0	.	9.1007	0.36667	0.0:0.0:0.778:0.222	.	266	Q8NG76	O2T33_HUMAN	N	266	ENSP00000324687:T266N	ENSP00000324687:T266N	T	-	2	0	OR2T33	246502943	0.000000	0.05858	0.023000	0.16930	0.016000	0.09150	-0.809000	0.04510	0.239000	0.21243	0.418000	0.28097	ACT		0.478	OR2T33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097354.1	NM_001004695		105	245	1	0	1.70018e-41	0.00361	2.95822e-41	105	245				
PRKCQ	5588	broad.mit.edu	37	10	6498720	6498720	+	Silent	SNP	C	C	A	rs55867019		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr10:6498720C>A	ENST00000263125.5	-	15	1662	c.1563G>T	c.(1561-1563)gcG>gcT	p.A521A	PRKCQ_ENST00000539722.1_Silent_p.A396A|PRKCQ_ENST00000397176.2_Silent_p.A521A	NM_001282644.1|NM_006257.3	NP_001269573.1|NP_006248.1	Q04759	KPCT_HUMAN	protein kinase C, theta	521	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of T cell apoptotic process (GO:0070233)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of T-helper 2 cell activation (GO:2000570)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of transcription, DNA-templated (GO:0006355)|rhodopsin mediated signaling pathway (GO:0016056)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin-protein transferase activity (GO:0004842)	p.A521A(1)		NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(2)	45					Tamoxifen(DB00675)	TTCCAAAATCCGCGATCTTGA	0.418																																					Ovarian(50;572 1126 10530 25349 30594)	Ovarian(50;572 1126 10530 25349 30594)	uc001ijj.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|lung(2)|large_intestine(1)	6						c.(1561-1563)GCG>GCT		protein kinase C, theta							262.0	209.0	227.0					10																	6498720		2203	4300	6503	SO:0001819	synonymous_variant	5588				axon guidance|cellular component disassembly involved in apoptosis|intracellular signal transduction|membrane protein ectodomain proteolysis|platelet activation|regulation of cell growth|T cell receptor signaling pathway	cytosol	ATP binding|metal ion binding|protein binding|protein kinase C activity	g.chr10:6498720C>A	L07032	CCDS7079.1, CCDS55701.1, CCDS60482.1	10p15	2009-07-10			ENSG00000065675	ENSG00000065675	2.7.11.1		9410	protein-coding gene	gene with protein product		600448				8444877	Standard	NM_001282645		Approved		uc001ijj.2	Q04759	OTTHUMG00000017623	ENST00000263125.5:c.1563G>T	10.37:g.6498720C>A						PRKCQ_uc009xim.1_Silent_p.A521A|PRKCQ_uc001iji.1_Silent_p.A554A|PRKCQ_uc009xin.1_Silent_p.A485A|PRKCQ_uc010qax.1_Silent_p.A396A	p.A521A	NM_006257	NP_006248	Q04759	KPCT_HUMAN			15	1638	-			521			Protein kinase.		B4DF52|Q14DH6|Q3MJF1|Q64FY5|Q9H508|Q9H549	Silent	SNP	ENST00000263125.5	37	c.1563G>T	CCDS7079.1	.	.	.	.	.	.	.	.	.	.	C	0.194	-1.050492	0.01981	.	.	ENSG00000065675	ENST00000397178	.	.	.	5.55	-11.1	0.00147	.	.	.	.	.	T	0.39462	0.1079	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46843	-0.9162	4	.	.	.	.	4.3151	0.10990	0.0961:0.089:0.2558:0.5591	.	.	.	.	L	294	.	.	R	-	2	0	PRKCQ	6538726	0.000000	0.05858	0.110000	0.21437	0.015000	0.08874	-2.511000	0.00958	-2.519000	0.00498	-0.259000	0.10710	CGG		0.418	PRKCQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046665.1	NM_006257		25	50	1	0	9.22233e-05	0.004656	0.000104706	25	50				
OPTN	10133	broad.mit.edu	37	10	13152401	13152401	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr10:13152401G>A	ENST00000378748.3	+	5	656	c.294G>A	c.(292-294)atG>atA	p.M98I	OPTN_ENST00000378757.2_Missense_Mutation_p.M98I|OPTN_ENST00000263036.5_Missense_Mutation_p.M98I|OPTN_ENST00000378764.2_Missense_Mutation_p.M98I|OPTN_ENST00000482140.1_Intron|OPTN_ENST00000378752.3_Missense_Mutation_p.M98I|OPTN_ENST00000378747.3_Missense_Mutation_p.M98I	NM_001008211.1|NM_001008213.1	NP_001008212|NP_001008214	Q96CV9	OPTN_HUMAN	optineurin	98	Interaction with Rab8.		M -> K (may modify intraocular pressure and increase risk of GLC1E and NPG, induces TFRC degradation leading to autophagic death in retinal ganglion cells; may be a common polymorphism; dbSNP:rs11258194). {ECO:0000269|PubMed:11834836, ECO:0000269|PubMed:14627677, ECO:0000269|PubMed:15498064, ECO:0000269|PubMed:15557444}.		cell death (GO:0008219)|defense response to Gram-negative bacterium (GO:0050829)|G2/M transition of mitotic cell cycle (GO:0000086)|Golgi organization (GO:0007030)|Golgi ribbon formation (GO:0090161)|Golgi to plasma membrane protein transport (GO:0043001)|macroautophagy (GO:0016236)|mitotic cell cycle (GO:0000278)|negative regulation of receptor recycling (GO:0001920)|protein targeting to Golgi (GO:0000042)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	polyubiquitin binding (GO:0031593)|protein C-terminus binding (GO:0008022)|Rab GTPase binding (GO:0017137)	p.M98I(1)		breast(1)|endometrium(2)|large_intestine(5)|lung(9)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22						AGCGTCTAATGGCCTTGAGTC	0.438																																							uc001ilu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(292-294)ATG>ATA		optineurin							105.0	118.0	113.0					10																	13152401		2203	4300	6503	SO:0001583	missense	10133				cell death|Golgi ribbon formation|Golgi to plasma membrane protein transport|protein targeting to Golgi|signal transduction	perinuclear region of cytoplasm|trans-Golgi network	protein C-terminus binding	g.chr10:13152401G>A	AF420371	CCDS7094.1	10p14	2014-01-28	2003-09-08		ENSG00000123240	ENSG00000123240			17142	protein-coding gene	gene with protein product		602432	"""glaucoma 1, open angle, E (adult-onset)"""	GLC1E		11834836, 9488477	Standard	NM_001008211		Approved	FIP2, HYPL, FIP-2, TFIIIA-INTP, NRP, HIP7	uc001ilx.1	Q96CV9	OTTHUMG00000017690	ENST00000378748.3:c.294G>A	10.37:g.13152401G>A	ENSP00000368022:p.Met98Ile					OPTN_uc001ilv.1_Missense_Mutation_p.M98I|OPTN_uc001ilw.1_Missense_Mutation_p.M98I|OPTN_uc001ilx.1_Missense_Mutation_p.M98I|OPTN_uc001ily.1_Missense_Mutation_p.M98I|OPTN_uc010qbr.1_Missense_Mutation_p.M41I|OPTN_uc001ilz.1_Missense_Mutation_p.M98I	p.M98I	NM_001008213	NP_001008214	Q96CV9	OPTN_HUMAN			5	732	+			98			Interaction with Rab8.|Potential.		B3KP00|D3DRS4|D3DRS8|Q5T672|Q5T673|Q5T674|Q5T675|Q7LDL9|Q8N562|Q9UET9|Q9UEV4|Q9Y218	Missense_Mutation	SNP	ENST00000378748.3	37	c.294G>A	CCDS7094.1	.	.	.	.	.	.	.	.	.	.	G	10.29	1.308852	0.23821	.	.	ENSG00000123240	ENST00000263036;ENST00000378764;ENST00000378757;ENST00000378752;ENST00000378748;ENST00000430081;ENST00000378747	D;D;D;D;D;D;D	0.82167	-1.58;-1.58;-1.58;-1.58;-1.58;-1.58;-1.58	5.98	1.37	0.22104	NF-kappa-B essential modulator NEMO, N-terminal (1);	0.586858	0.21037	N	0.081226	T	0.63861	0.2547	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.11329	0.004;0.006	T	0.53802	-0.8387	10	0.38643	T	0.18	-3.4751	8.4113	0.32644	0.5199:0.0:0.4801:0.0	.	98;98	Q96CV9-2;Q96CV9	.;OPTN_HUMAN	I	98;98;98;98;98;41;98	ENSP00000263036:M98I;ENSP00000368040:M98I;ENSP00000368032:M98I;ENSP00000368027:M98I;ENSP00000368022:M98I;ENSP00000414747:M41I;ENSP00000368021:M98I	ENSP00000263036:M98I	M	+	3	0	OPTN	13192407	0.000000	0.05858	0.644000	0.29465	0.643000	0.38383	-0.333000	0.07894	0.376000	0.24707	0.655000	0.94253	ATG		0.438	OPTN-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046834.1	NM_021980		4	43	0	0	0	0.009096	0	4	43				
HSPA14	51182	broad.mit.edu	37	10	14894416	14894416	+	Missense_Mutation	SNP	T	T	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr10:14894416T>G	ENST00000378372.3	+	8	859	c.620T>G	c.(619-621)gTc>gGc	p.V207G		NM_016299.2	NP_057383.2	Q0VDF9	HSP7E_HUMAN	heat shock 70kDa protein 14	207					'de novo' cotranslational protein folding (GO:0051083)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)	p.V207G(1)		breast(4)|endometrium(2)|kidney(2)|large_intestine(3)|lung(4)|ovary(2)	17						TCTCTCAGCGTCATGGAAGTT	0.363																																							uc001inf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(2)|lung(1)	5						c.(619-621)GTC>GGC		heat shock 70kDa protein 14 isoform 1							171.0	162.0	165.0					10																	14894416		2203	4300	6503	SO:0001583	missense	51182				'de novo' cotranslational protein folding	cytosol	ATP binding|protein binding	g.chr10:14894416T>G	AF112210	CCDS7103.1, CCDS60487.1	10p13	2011-09-02			ENSG00000187522	ENSG00000187522		"""Heat shock proteins / HSP70"""	29526	protein-coding gene	gene with protein product		610369				12477932	Standard	NM_016299		Approved	HSP70-4, HSP70L1	uc001ind.4	Q0VDF9	OTTHUMG00000017712	ENST00000378372.3:c.620T>G	10.37:g.14894416T>G	ENSP00000367623:p.Val207Gly						p.V207G	NM_016299	NP_057383	Q0VDF9	HSP7E_HUMAN			8	761	+			207					A8K8F8|B0YIY9|Q9P0X2|Q9UI07	Missense_Mutation	SNP	ENST00000378372.3	37	c.620T>G	CCDS7103.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.003645	0.74932	.	.	ENSG00000187522	ENST00000378372	T	0.01221	5.15	5.43	5.43	0.79202	.	0.267843	0.35970	N	0.002873	T	0.10208	0.0250	M	0.90870	3.155	0.80722	D	1	P	0.49783	0.928	P	0.58780	0.845	T	0.00287	-1.1846	10	0.87932	D	0	-2.0895	15.4884	0.75584	0.0:0.0:0.0:1.0	.	207	Q0VDF9	HSP7E_HUMAN	G	207	ENSP00000367623:V207G	ENSP00000367623:V207G	V	+	2	0	HSPA14	14934422	0.923000	0.31300	0.986000	0.45419	0.965000	0.64279	3.824000	0.55723	2.073000	0.62155	0.533000	0.62120	GTC		0.363	HSPA14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046910.1	NM_016299		51	180	0	0	0	0.00361	0	51	180				
FAM171A1	221061	broad.mit.edu	37	10	15255798	15255798	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr10:15255798C>T	ENST00000378116.4	-	8	1795	c.1789G>A	c.(1789-1791)Gtc>Atc	p.V597I	FAM171A1_ENST00000477161.1_5'Flank	NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	597						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.V597I(2)		breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						GGCTGGCTGACATAGGAGTGG	0.562																																							uc001iob.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|breast(1)|skin(1)	4						c.(1789-1791)GTC>ATC		hypothetical protein LOC221061 precursor							71.0	78.0	75.0					10																	15255798		2203	4300	6503	SO:0001583	missense	221061					integral to membrane		g.chr10:15255798C>T	AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.1789G>A	10.37:g.15255798C>T	ENSP00000367356:p.Val597Ile						p.V597I	NM_001010924	NP_001010924	Q5VUB5	F1711_HUMAN			8	1796	-			597			Cytoplasmic (Potential).		D3DRT9|Q32M49|Q8N4I0	Missense_Mutation	SNP	ENST00000378116.4	37	c.1789G>A	CCDS31154.1	.	.	.	.	.	.	.	.	.	.	C	17.28	3.349628	0.61183	.	.	ENSG00000148468	ENST00000378116;ENST00000396781	T	0.34472	1.36	5.52	5.52	0.82312	.	0.128864	0.53938	D	0.000052	T	0.53883	0.1824	L	0.54323	1.7	0.44843	D	0.997855	D	0.63046	0.992	P	0.59948	0.866	T	0.44997	-0.9291	10	0.44086	T	0.13	-35.7433	19.6296	0.95694	0.0:1.0:0.0:0.0	.	597	Q5VUB5	F1711_HUMAN	I	597;596	ENSP00000367356:V597I	ENSP00000367356:V597I	V	-	1	0	FAM171A1	15295804	1.000000	0.71417	0.997000	0.53966	0.700000	0.40528	3.862000	0.56009	2.873000	0.98535	0.563000	0.77884	GTC		0.562	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046984.1	XM_167709		52	120	0	0	0	0.00361	0	52	120				
ZNF485	220992	broad.mit.edu	37	10	44112635	44112635	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr10:44112635T>C	ENST00000361807.3	+	5	1338	c.1144T>C	c.(1144-1146)Tat>Cat	p.Y382H	ZNF485_ENST00000374435.3_Missense_Mutation_p.Y382H|ZNF485_ENST00000374437.2_Missense_Mutation_p.Y291H	NM_145312.3	NP_660355.2	Q8NCK3	ZN485_HUMAN	zinc finger protein 485	382					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Y343H(1)|p.Y382H(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|skin(1)|urinary_tract(1)	16						AGAAAAACCCTATCACTGTAA	0.433																																							uc010qfc.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1144-1146)TAT>CAT		zinc finger protein 485							68.0	64.0	65.0					10																	44112635		2203	4300	6503	SO:0001583	missense	220992				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr10:44112635T>C	AK074679	CCDS7205.2	10q11.21	2013-01-08			ENSG00000198298	ENSG00000198298		"""Zinc fingers, C2H2-type"", ""-"""	23440	protein-coding gene	gene with protein product							Standard	NM_145312		Approved		uc010qfc.2	Q8NCK3	OTTHUMG00000018040	ENST00000361807.3:c.1144T>C	10.37:g.44112635T>C	ENSP00000354694:p.Tyr382His					ZNF485_uc010qfd.1_Missense_Mutation_p.Y291H	p.Y382H	NM_145312	NP_660355	Q8NCK3	ZN485_HUMAN			5	1338	+			382			C2H2-type 10.		B4DSE6|Q96CL0	Missense_Mutation	SNP	ENST00000361807.3	37	c.1144T>C	CCDS7205.2	.	.	.	.	.	.	.	.	.	.	T	9.647	1.140474	0.21205	.	.	ENSG00000198298	ENST00000361807;ENST00000374437;ENST00000374435	T;T;T	0.21734	1.99;1.99;1.99	1.86	0.71	0.18157	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.26122	0.0637	L	0.33792	1.035	0.09310	N	1	P	0.50710	0.938	P	0.59487	0.858	T	0.11665	-1.0578	9	0.87932	D	0	.	5.1965	0.15241	0.0:0.1665:0.0:0.8335	.	382	Q8NCK3	ZN485_HUMAN	H	382;291;382	ENSP00000354694:Y382H;ENSP00000363560:Y291H;ENSP00000363558:Y382H	ENSP00000354694:Y382H	Y	+	1	0	ZNF485	43432641	0.009000	0.17119	0.133000	0.22050	0.957000	0.61999	1.619000	0.36965	0.182000	0.20032	0.260000	0.18958	TAT		0.433	ZNF485-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047719.2	NM_145312		4	83	0	0	0	0.009096	0	4	83				
HNRNPA3P1	10151	broad.mit.edu	37	10	44285350	44285350	+	IGR	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr10:44285350C>A								RP11-272J7.4 (11077 upstream) : LINC00619 (55403 downstream)																							TTTTTCCACTCTGCCTGTCTT	0.333																																							uc010qfe.1		NA																	0					0						c.(484-486)CAG>CAT		SubName: Full=cDNA FLJ52659, highly similar to Heterogeneous nuclear ribonucleoprotein A3; SubName: Full=cDNA, FLJ79333, highly similar to Heterogeneous nuclear ribonucleoprotein A3; SubName: Full=Heterogeneous nuclear ribonucleoprotein A3, isoform CRA_a;																																				SO:0001628	intergenic_variant	10151							g.chr10:44285350C>A																													10.37:g.44285350C>A							p.Q162H	NR_002726						1	516	-									Missense_Mutation	SNP		37	c.486G>T																																																																																				0	0.333									22	51	1	0	4.35082e-09	0.010504	5.8357e-09	22	51				
ALOX5	240	broad.mit.edu	37	10	45941036	45941036	+	Silent	SNP	C	C	A	rs28395861	byFrequency	TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr10:45941036C>A	ENST00000374391.2	+	14	1979	c.1926C>A	c.(1924-1926)ctC>ctA	p.L642L	ALOX5_ENST00000542434.1_Silent_p.L585L|RP11-67C2.2_ENST00000435635.1_RNA	NM_000698.3|NM_001256153.1	NP_000689.1|NP_001243082.1	P09917	LOX5_HUMAN	arachidonate 5-lipoxygenase	642	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				arachidonic acid metabolic process (GO:0019369)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|leukotriene production involved in inflammatory response (GO:0002540)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular space (GO:0005615)|nuclear envelope (GO:0005635)|nuclear envelope lumen (GO:0005641)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)	arachidonate 5-lipoxygenase activity (GO:0004051)|iron ion binding (GO:0005506)	p.L642L(1)		breast(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Lung SC(717;0.0257)			Aminosalicylic Acid(DB00233)|Balsalazide(DB01014)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Masoprocol(DB00179)|Meclofenamic acid(DB00939)|Mesalazine(DB00244)|Minocycline(DB01017)|Montelukast(DB00471)|Sulfasalazine(DB00795)|Vitamin E(DB00163)|Zileuton(DB00744)	GCAAGAACCTCGAGGCCATTG	0.542																																							uc001jce.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(1924-1926)CTC>CTA		arachidonate 5-lipoxygenase	Diethylcarbamazine(DB00711)|Hydrocortisone(DB00741)|Leflunomide(DB01097)|Masoprocol(DB00179)|Meclofenamic acid(DB00939)|Minocycline(DB01017)|Montelukast(DB00471)|Quinacrine(DB01103)|Vitamin E(DB00163)|Zileuton(DB00744)						103.0	97.0	99.0					10																	45941036		2203	4300	6503	SO:0001819	synonymous_variant	240				hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process	cytosol|nuclear envelope lumen|nuclear matrix|nuclear membrane	arachidonate 5-lipoxygenase activity|iron ion binding|lipoxygenase activity|protein binding	g.chr10:45941036C>A	J03571	CCDS7212.1, CCDS58078.1	10q11.2	2008-03-18			ENSG00000012779	ENSG00000012779	1.13.11.34	"""Arachidonate lipoxygenases"""	435	protein-coding gene	gene with protein product		152390				2565035	Standard	NM_001256153		Approved	5-LOX	uc001jce.4	P09917	OTTHUMG00000018081	ENST00000374391.2:c.1926C>A	10.37:g.45941036C>A						ALOX5_uc009xmt.2_Silent_p.L610L|ALOX5_uc010qfg.1_Silent_p.L585L	p.L642L	NM_000698	NP_000689	P09917	LOX5_HUMAN			14	2025	+		Lung SC(717;0.0257)	642			Lipoxygenase.		B7ZLS0|E5FPY5|E5FPY7|E5FPY8|Q5JQ14	Silent	SNP	ENST00000374391.2	37	c.1926C>A	CCDS7212.1																																																																																				0.542	ALOX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047780.1			25	71	1	0	1.04121e-07	0.005443	1.34211e-07	25	71				
A1CF	29974	broad.mit.edu	37	10	52595854	52595854	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr10:52595854G>A	ENST00000373993.1	-	4	628	c.584C>T	c.(583-585)gCg>gTg	p.A195V	A1CF_ENST00000395495.1_Missense_Mutation_p.A195V|A1CF_ENST00000373997.3_Missense_Mutation_p.A195V|A1CF_ENST00000373995.3_Missense_Mutation_p.A203V|A1CF_ENST00000282641.2_Missense_Mutation_p.A195V|A1CF_ENST00000374001.2_Missense_Mutation_p.A195V|A1CF_ENST00000395489.2_Missense_Mutation_p.A188V			Q9NQ94	A1CF_HUMAN	APOBEC1 complementation factor	195	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cytidine to uridine editing (GO:0016554)|gene expression (GO:0010467)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|protein stabilization (GO:0050821)	apolipoprotein B mRNA editing enzyme complex (GO:0030895)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)	p.A203V(2)|p.A195V(2)		NS(1)|breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(14)|prostate(2)|skin(3)	29						TTTCCTCCTCGCCATGGCAGC	0.488																																							uc001jjj.2		NA																	4	Substitution - Missense(4)		lung(2)|breast(2)	central_nervous_system(1)	1						c.(583-585)GCG>GTG		apobec-1 complementation factor isoform 2							106.0	96.0	100.0					10																	52595854		2203	4300	6503	SO:0001583	missense	29974				cytidine to uridine editing|mRNA modification|mRNA processing|protein stabilization	apolipoprotein B mRNA editing enzyme complex|endoplasmic reticulum|nucleoplasm	nucleotide binding|protein binding|single-stranded RNA binding	g.chr10:52595854G>A	AF271790	CCDS7241.1, CCDS7242.1, CCDS7243.1, CCDS73133.1	10q21.1	2013-02-12			ENSG00000148584	ENSG00000148584		"""RNA binding motif (RRM) containing"""	24086	protein-coding gene	gene with protein product						11815617, 11072063	Standard	NM_014576		Approved	ACF, ASP, ACF64, ACF65, APOBEC1CF	uc001jjj.3	Q9NQ94	OTTHUMG00000018240	ENST00000373993.1:c.584C>T	10.37:g.52595854G>A	ENSP00000363105:p.Ala195Val					A1CF_uc010qhn.1_Missense_Mutation_p.A203V|A1CF_uc001jji.2_Missense_Mutation_p.A195V|A1CF_uc001jjh.2_Missense_Mutation_p.A203V|A1CF_uc010qho.1_Missense_Mutation_p.A203V|A1CF_uc009xov.2_Missense_Mutation_p.A195V	p.A195V	NM_138932	NP_620310	Q9NQ94	A1CF_HUMAN			6	772	-			195			RRM 2.		A1L4F2|A8K7G7|B7ZM14|Q5SZQ0|Q9NQ93|Q9NQX8|Q9NQX9|Q9NXC9|Q9NZD3	Missense_Mutation	SNP	ENST00000373993.1	37	c.584C>T	CCDS7242.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.550854	0.86127	.	.	ENSG00000148584	ENST00000374001;ENST00000373993;ENST00000373997;ENST00000373995;ENST00000282641;ENST00000395495;ENST00000395488;ENST00000395489;ENST00000414883	T;T;T;T;T;T;T;T	0.35973	1.28;1.28;1.28;1.28;1.28;1.28;1.28;1.28	6.04	5.1	0.69264	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.046025	0.85682	D	0.000000	T	0.64616	0.2614	M	0.88450	2.955	0.80722	D	1	D;D;D;D	0.76494	0.999;0.997;0.993;0.998	D;P;P;P	0.64042	0.921;0.893;0.73;0.888	T	0.71255	-0.4647	10	0.87932	D	0	-9.2963	16.5645	0.84575	0.0:0.1418:0.8582:0.0	.	188;195;195;203	F8W9F8;Q9NQ94;Q9NQ94-2;Q9NQ94-4	.;A1CF_HUMAN;.;.	V	195;195;195;203;195;195;178;188;195	ENSP00000363113:A195V;ENSP00000363105:A195V;ENSP00000363109:A195V;ENSP00000363107:A203V;ENSP00000282641:A195V;ENSP00000378873:A195V;ENSP00000378868:A188V;ENSP00000397953:A195V	ENSP00000282641:A195V	A	-	2	0	A1CF	52265860	1.000000	0.71417	0.999000	0.59377	0.619000	0.37552	7.811000	0.86092	2.873000	0.98535	0.563000	0.77884	GCG		0.488	A1CF-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048086.2	NM_014576		7	120	0	0	0	0.00308	0	7	120				
UNC5B	219699	broad.mit.edu	37	10	73053217	73053217	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr10:73053217A>T	ENST00000335350.6	+	12	2244	c.1828A>T	c.(1828-1830)Aca>Tca	p.T610S	UNC5B_ENST00000373192.4_Missense_Mutation_p.T599S	NM_170744.4	NP_734465.2	Q8IZJ1	UNC5B_HUMAN	unc-5 homolog B (C. elegans)	610	ZU5. {ECO:0000255|PROSITE- ProRule:PRU00485}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)		p.T610S(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(4)|skin(4)	49						CTGTGGACCCACAGGCCTCCT	0.627																																							uc001jro.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(1)	3						c.(1828-1830)ACA>TCA		unc-5 homolog B precursor							102.0	101.0	101.0					10																	73053217		2203	4300	6503	SO:0001583	missense	219699				apoptosis|axon guidance|regulation of apoptosis	integral to membrane		g.chr10:73053217A>T	AB096256	CCDS7309.1, CCDS58083.1	10q22.2	2013-01-11	2001-11-28		ENSG00000107731	ENSG00000107731		"""Immunoglobulin superfamily / I-set domain containing"""	12568	protein-coding gene	gene with protein product		607870	"""unc5 (C.elegans homolog) b"""				Standard	NM_170744		Approved	UNC5H2, p53RDL1	uc001jro.3	Q8IZJ1	OTTHUMG00000018422	ENST00000335350.6:c.1828A>T	10.37:g.73053217A>T	ENSP00000334329:p.Thr610Ser					UNC5B_uc001jrp.2_Missense_Mutation_p.T599S	p.T610S	NM_170744	NP_734465	Q8IZJ1	UNC5B_HUMAN			12	2273	+			610			Cytoplasmic (Potential).|ZU5.		Q5T3R9|Q5T3S0|Q86SN3|Q8N1Y2|Q9H9F3	Missense_Mutation	SNP	ENST00000335350.6	37	c.1828A>T	CCDS7309.1	.	.	.	.	.	.	.	.	.	.	A	12.22	1.873973	0.33069	.	.	ENSG00000107731	ENST00000335350;ENST00000373192	T;T	0.40756	1.02;1.02	4.9	2.41	0.29592	ZU5 (3);	0.303615	0.32301	N	0.006290	T	0.21387	0.0515	N	0.12182	0.205	0.40052	D	0.975786	B;B	0.06786	0.0;0.001	B;B	0.12837	0.002;0.008	T	0.04840	-1.0923	10	0.27785	T	0.31	-13.0561	7.3286	0.26569	0.7796:0.1441:0.0763:0.0	.	599;610	Q8IZJ1-2;Q8IZJ1	.;UNC5B_HUMAN	S	610;599	ENSP00000334329:T610S;ENSP00000362288:T599S	ENSP00000334329:T610S	T	+	1	0	UNC5B	72723223	1.000000	0.71417	0.980000	0.43619	0.831000	0.47069	2.514000	0.45503	0.726000	0.32339	-0.609000	0.04063	ACA		0.627	UNC5B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048541.1	NM_170744		35	99	0	0	0	0.003755	0	35	99				
POLR3A	11128	broad.mit.edu	37	10	79773421	79773421	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr10:79773421A>T	ENST00000372371.3	-	11	1696	c.1559T>A	c.(1558-1560)cTt>cAt	p.L520H	POLR3A_ENST00000484760.1_5'UTR	NM_007055.3	NP_008986.2	O14802	RPC1_HUMAN	polymerase (RNA) III (DNA directed) polypeptide A, 155kDa	520					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|ribonucleoside binding (GO:0032549)|zinc ion binding (GO:0008270)	p.L520H(1)		breast(1)|endometrium(7)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)			CATCAGAACAAGGGCCTCTGC	0.438																																							uc001jzn.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1558-1560)CTT>CAT		polymerase (RNA) III (DNA directed) polypeptide							168.0	151.0	157.0					10																	79773421		2203	4300	6503	SO:0001583	missense	11128				innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	DNA-directed RNA polymerase III complex	DNA binding|DNA-directed RNA polymerase activity|ribonucleoside binding|zinc ion binding	g.chr10:79773421A>T	AF021351	CCDS7354.1	10q22-q23	2013-01-21			ENSG00000148606	ENSG00000148606		"""RNA polymerase subunits"""	30074	protein-coding gene	gene with protein product		614258				9331371, 12391170	Standard	NM_007055		Approved	RPC1, RPC155, hRPC155	uc001jzn.3	O14802	OTTHUMG00000018550	ENST00000372371.3:c.1559T>A	10.37:g.79773421A>T	ENSP00000361446:p.Leu520His						p.L520H	NM_007055	NP_008986	O14802	RPC1_HUMAN	Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)		11	1653	-	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		520					Q8IW34|Q8TCW5	Missense_Mutation	SNP	ENST00000372371.3	37	c.1559T>A	CCDS7354.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.167798	0.78339	.	.	ENSG00000148606	ENST00000372371;ENST00000540842	T	0.69435	-0.4	5.46	5.46	0.80206	RNA polymerase, alpha subunit (1);RNA polymerase, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.75095	0.3803	M	0.86651	2.83	0.80722	D	1	P	0.48294	0.908	P	0.48400	0.576	T	0.78964	-0.1996	9	.	.	.	-18.4948	10.7404	0.46149	0.8581:0.0:0.0:0.1419	.	520	O14802	RPC1_HUMAN	H	520	ENSP00000361446:L520H	.	L	-	2	0	POLR3A	79443427	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	6.899000	0.75682	2.078000	0.62432	0.528000	0.53228	CTT		0.438	POLR3A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048923.1	NM_007055		7	161	0	0	0	0.001984	0	7	161				
AGAP11	119385	broad.mit.edu	37	10	88769657	88769657	+	RNA	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr10:88769657G>T	ENST00000444431.1	+	0	4257				RP11-96C23.5_ENST00000433214.2_RNA|RP11-96C23.14_ENST00000444180.3_RNA|RP11-96C23.10_ENST00000451760.1_RNA			Q8TF27	AGA11_HUMAN	ankyrin repeat and GTPase domain Arf GTPase activating protein 11						regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)										CGACGAGTGCGTGTAGTATCT	0.498																																							uc001kee.2		NA																	0					0						c.(1648-1650)GTG>TTG		ankyrin repeat and GTPase domain Arf GTPase							12.0	13.0	13.0					10																	88769657		2195	4278	6473			119385				regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding	g.chr10:88769657G>T			10q23.2	2013-01-11			ENSG00000151303	ENSG00000151303		"""ADP-ribosylation factor GTPase activating proteins"", ""Ankyrin repeat domain containing"""	29421	protein-coding gene	gene with protein product						11853319	Standard	NM_133447		Approved	KIAA1975	uc001kee.2	Q8TF27	OTTHUMG00000018667		10.37:g.88769657G>T						AGAP11_uc001kef.2_Intron	p.V550L	NM_133447	NP_597704	Q8TF27	AGA11_HUMAN			12	2852	+			550					B9EIP7|D3DWE4	Missense_Mutation	SNP	ENST00000444431.1	37	c.1648G>T																																																																																					0.498	AGAP11-001	KNOWN	basic|readthrough_transcript	processed_transcript	processed_transcript	OTTHUMT00000049193.1	NM_133447		28	140	1	0	4.92203e-23	0.00623	8.08824e-23	28	140				
HOGA1	112817	broad.mit.edu	37	10	99361691	99361691	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr10:99361691G>A	ENST00000370646.4	+	6	1139	c.778G>A	c.(778-780)Ggg>Agg	p.G260R	PI4K2A_ENST00000370649.3_Missense_Mutation_p.G97R|HOGA1_ENST00000370647.4_Missense_Mutation_p.G97R|PI4K2A_ENST00000555577.1_Missense_Mutation_p.G97R	NM_138413.3	NP_612422.2	Q86XE5	HOGA1_HUMAN	4-hydroxy-2-oxoglutarate aldolase 1	260					4-hydroxyproline catabolic process (GO:0019470)|glyoxylate catabolic process (GO:0009436)|glyoxylate metabolic process (GO:0046487)|oxalate metabolic process (GO:0033609)|pyruvate biosynthetic process (GO:0042866)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	4-hydroxy-2-oxoglutarate aldolase activity (GO:0008700)|protein homodimerization activity (GO:0042803)	p.G97R(1)|p.G260R(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|prostate(2)|skin(1)|stomach(1)	14						GTGCTGCACGGGGCAATGGGA	0.677																																							uc010qoy.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(1)|skin(1)	2						c.(289-291)GGG>AGG		phosphatidylinositol 4-kinase type 2 alpha							31.0	30.0	30.0					10																	99361691		2203	4300	6503	SO:0001583	missense	55361				phosphatidylinositol biosynthetic process	cytoplasm|integral to plasma membrane|membrane raft	1-phosphatidylinositol 4-kinase activity|ATP binding|magnesium ion binding	g.chr10:99361691G>A	BC011916	CCDS7467.1, CCDS44469.1	10q24.1	2010-12-19	2010-12-19	2010-12-19	ENSG00000241935	ENSG00000241935			25155	protein-coding gene	gene with protein product	"""dihydrodipicolinate synthetase homolog 2 (E. coli)"", ""N-acetylneuraminate pyruvate lyase 2 (putative)"""	613597	"""chromosome 10 open reading frame 65"", ""dihydrodipicolinate synthase-like, mitochondrial"""	C10orf65, DHDPSL		20797690	Standard	NM_001134670		Approved	FLJ37472, DHDPS2, NPL2		Q86XE5	OTTHUMG00000018859	ENST00000370646.4:c.778G>A	10.37:g.99361691G>A	ENSP00000359680:p.Gly260Arg					DHDPSL_uc001kny.2_Missense_Mutation_p.G260R|DHDPSL_uc001knz.2_Missense_Mutation_p.G97R	p.G97R	NM_018425	NP_060895	Q9BTU6	P4K2A_HUMAN		Epithelial(162;1.24e-10)|all cancers(201;1.2e-08)	2	648	+		Colorectal(252;0.162)	Error:Variant_position_missing_in_Q9BTU6_after_alignment					A8K075|Q5T680|Q5T684|Q711P0|Q8N9F2|Q96EV5	Missense_Mutation	SNP	ENST00000370646.4	37	c.289G>A	CCDS7467.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.1|25.1	4.606494|4.606494	0.87157|0.87157	.|.	.|.	ENSG00000241935|ENSG00000241935;ENSG00000241935;ENSG00000155252;ENSG00000249967	ENST00000370642|ENST00000370647;ENST00000370646;ENST00000555577;ENST00000370649	.|D;D;D;D	.|0.97752	.|-4.52;-4.52;-2.35;-2.35	5.07|5.07	5.07|5.07	0.68467|0.68467	.|Aldolase-type TIM barrel (1);	0.048130|0.048130	0.85682|0.85682	D|D	0.000000|0.000000	D|D	0.99039|0.99039	0.9671|0.9671	M|M	0.92459|0.92459	3.31|3.31	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|0.999;1.0;0.999	.|D;D;D	.|0.79108	.|0.979;0.992;0.961	D|D	0.99544|0.99544	1.0964|1.0964	6|10	.|0.87932	.|D	.|0	-24.2293|-24.2293	18.8138|18.8138	0.92070|0.92070	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|97;97;260	.|E9PAM4;Q86XE5-3;Q86XE5	.|.;.;HOGA1_HUMAN	E|R	63|97;260;97;97	.|ENSP00000359681:G97R;ENSP00000359680:G260R;ENSP00000452243:G97R;ENSP00000359683:G97R	.|ENSP00000359680:G260R	G|G	+|+	2|1	0|0	HOGA1|PI4K2A;HOGA1;RP11-548K23.11	99351681|99351681	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.628000|0.628000	0.37860|0.37860	9.291000|9.291000	0.96070|0.96070	2.530000|2.530000	0.85305|0.85305	0.561000|0.561000	0.74099|0.74099	GGG|GGG		0.677	HOGA1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049726.1	NM_138413		9	50	0	0	0	0.006214	0	9	50				
CHUK	1147	broad.mit.edu	37	10	101964958	101964958	+	Splice_Site	SNP	T	T	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr10:101964958T>A	ENST00000370397.7	-	12	1318		c.e12-2			NM_001278.3	NP_001269.3	O15111	IKKA_HUMAN	conserved helix-loop-helix ubiquitous kinase						anatomical structure morphogenesis (GO:0009653)|cellular response to tumor necrosis factor (GO:0071356)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell proliferation (GO:0033598)|morphogenesis of an epithelial sheet (GO:0002011)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoclast differentiation (GO:0030316)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|protein phosphorylation (GO:0006468)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to hydroperoxide (GO:0033194)|response to lipopolysaccharide (GO:0032496)|response to toxic substance (GO:0009636)|response to virus (GO:0009615)|Rho protein signal transduction (GO:0007266)|skeletal muscle contraction (GO:0003009)|striated muscle cell differentiation (GO:0051146)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|scaffold protein binding (GO:0097110)	p.?(1)		breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(9)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)	27		Colorectal(252;0.117)		Epithelial(162;2.05e-10)|all cancers(201;1.91e-08)	Acetylcysteine(DB06151)|Aminosalicylic Acid(DB00233)|Mesalazine(DB00244)|Sulfasalazine(DB00795)	TGTCCTGTACTATATACAAGA	0.398																																					Ovarian(159;52 1904 10536 35305 37148)	Ovarian(159;52 1904 10536 35305 37148)	uc001kqp.2		NA																	1	Unknown(1)		lung(1)	ovary(2)|central_nervous_system(2)|large_intestine(1)|lung(1)|breast(1)	7						c.e12-1		conserved helix-loop-helix ubiquitous kinase							113.0	104.0	107.0					10																	101964958		2203	4300	6503	SO:0001630	splice_region_variant	1147				I-kappaB phosphorylation|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	CD40 receptor complex|cytosol|internal side of plasma membrane|nucleus	ATP binding|identical protein binding|IkappaB kinase activity	g.chr10:101964958T>A	AF009225	CCDS7488.1	10q24-q25	2008-08-01			ENSG00000213341	ENSG00000213341			1974	protein-coding gene	gene with protein product		600664		TCF16		7558004, 16902410	Standard	XR_246062		Approved	IKK1, IKK-alpha, IkBKA, NFKBIKA, IKKA	uc001kqp.3	O15111	OTTHUMG00000018899	ENST00000370397.7:c.1232-2A>T	10.37:g.101964958T>A							p.V411_splice	NM_001278	NP_001269	O15111	IKKA_HUMAN		Epithelial(162;2.05e-10)|all cancers(201;1.91e-08)	12	1287	-		Colorectal(252;0.117)						O14666|Q13132|Q5W0I4|Q92467	Splice_Site	SNP	ENST00000370397.7	37	c.1232_splice	CCDS7488.1	.	.	.	.	.	.	.	.	.	.	T	14.68	2.607784	0.46527	.	.	ENSG00000213341	ENST00000370397	.	.	.	4.9	4.9	0.64082	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.746	0.57281	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	CHUK	101954948	1.000000	0.71417	0.916000	0.36221	0.332000	0.28634	7.928000	0.87587	1.963000	0.57068	0.377000	0.23210	.		0.398	CHUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049836.1	NM_001278	Intron	5	106	0	0	0	0.001168	0	5	106				
CFAP58	159686	broad.mit.edu	37	10	106214201	106214201	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr10:106214201G>T	ENST00000369704.3	+	18	2666	c.2532G>T	c.(2530-2532)atG>atT	p.M844I		NM_001008723.1	NP_001008723.1	Q5T655	CC147_HUMAN		844						extracellular space (GO:0005615)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	52		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;7.55e-10)|all cancers(201;3.37e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0189)		CAGCACCCATGGATAACACCT	0.433																																							uc001kyh.2		NA																	0				ovary(2)|central_nervous_system(2)|skin(1)	5						c.(2530-2532)ATG>ATT		coiled-coil domain containing 147							216.0	197.0	204.0					10																	106214201		2203	4300	6503	SO:0001583	missense	159686							g.chr10:106214201G>T																												ENST00000369704.3:c.2532G>T	10.37:g.106214201G>T	ENSP00000358718:p.Met844Ile						p.M844I	NM_001008723	NP_001008723	Q5T655	CC147_HUMAN		Epithelial(162;7.55e-10)|all cancers(201;3.37e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0189)	18	2666	+		Colorectal(252;0.103)|Breast(234;0.122)	844					D3DRA6|Q8NA27	Missense_Mutation	SNP	ENST00000369704.3	37	c.2532G>T	CCDS31282.1	.	.	.	.	.	.	.	.	.	.	G	1.944	-0.442999	0.04604	.	.	ENSG00000120051	ENST00000369704	T	0.30714	1.52	5.47	0.131	0.14755	.	0.775046	0.12679	N	0.448169	T	0.21103	0.0508	L	0.44542	1.39	0.09310	N	0.999996	B	0.06786	0.001	B	0.06405	0.002	T	0.19910	-1.0291	10	0.37606	T	0.19	-1.7622	4.291	0.10878	0.441:0.0:0.3935:0.1654	.	844	Q5T655	CC147_HUMAN	I	844	ENSP00000358718:M844I	ENSP00000358718:M844I	M	+	3	0	CCDC147	106204191	0.091000	0.21658	0.002000	0.10522	0.018000	0.09664	0.200000	0.17257	0.176000	0.19873	0.650000	0.86243	ATG		0.433	CCDC147-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050216.1			38	183	1	0	1.67305e-13	0.00623	2.46139e-13	38	183				
SORCS1	114815	broad.mit.edu	37	10	108380225	108380225	+	Silent	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr10:108380225G>A	ENST00000263054.6	-	20	2764	c.2757C>T	c.(2755-2757)ggC>ggT	p.G919G	SORCS1_ENST00000369698.1_Silent_p.G454G|SORCS1_ENST00000344440.6_Silent_p.G919G|SORCS1_ENST00000478809.2_5'Flank	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	919					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)	p.G919G(2)		breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		AAGTGAGGGTGCCCACTTGGC	0.557																																							uc001kym.2		NA																	2	Substitution - coding silent(2)		lung(2)	breast(1)|central_nervous_system(1)	2						c.(2755-2757)GGC>GGT		SORCS receptor 1 isoform a							171.0	137.0	148.0					10																	108380225		2203	4300	6503	SO:0001819	synonymous_variant	114815					integral to membrane	neuropeptide receptor activity|protein binding	g.chr10:108380225G>A	AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.2757C>T	10.37:g.108380225G>A						SORCS1_uc001kyl.2_Silent_p.G919G|SORCS1_uc009xxs.2_Silent_p.G919G|SORCS1_uc001kyn.1_Silent_p.G919G|SORCS1_uc001kyo.2_Silent_p.G919G	p.G919G	NM_052918	NP_443150	Q8WY21	SORC1_HUMAN		Epithelial(162;1.66e-05)|all cancers(201;0.000689)	20	2765	-		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)	919			Lumenal (Potential).		A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Silent	SNP	ENST00000263054.6	37	c.2757C>T	CCDS7559.1																																																																																				0.557	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	NM_052918		11	125	0	0	0	0.008291	0	11	125				
DOCK1	1793	broad.mit.edu	37	10	128821561	128821561	+	Silent	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr10:128821561G>T	ENST00000280333.6	+	14	1471	c.1362G>T	c.(1360-1362)gtG>gtT	p.V454V	RP11-223P11.3_ENST00000599979.1_RNA|RP11-223P11.3_ENST00000601242.1_RNA|RP11-223P11.2_ENST00000420941.2_RNA|RP11-223P11.3_ENST00000432554.2_RNA|RP11-223P11.3_ENST00000594614.1_RNA|RP11-223P11.3_ENST00000594559.1_RNA|RP11-223P11.3_ENST00000601826.1_RNA|RP11-223P11.3_ENST00000595456.1_RNA|RP11-223P11.3_ENST00000608350.1_RNA	NM_001380.3	NP_001371.1	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	454	DHR-1.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|hematopoietic progenitor cell differentiation (GO:0002244)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|phagocytosis, engulfment (GO:0006911)|positive regulation of GTPase activity (GO:0043547)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)	p.V454V(1)		NS(2)|breast(1)|central_nervous_system(7)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(10)|lung(15)|ovary(4)|prostate(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	72		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		CGGTGTCTGTGTACGATGAGG	0.433																																							uc001ljt.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9						c.(1360-1362)GTG>GTT		dedicator of cytokinesis 1							338.0	355.0	350.0					10																	128821561		2038	4182	6220	SO:0001819	synonymous_variant	1793				apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding	g.chr10:128821561G>T	D50857	CCDS73222.1	10q26.13-q26.3	2009-10-28			ENSG00000150760	ENSG00000150760			2987	protein-coding gene	gene with protein product	"""DOwnstream of CrK"""	601403	"""dedicator of cyto-kinesis 1"""			8657152, 8661160	Standard	XM_006717681		Approved	DOCK180, ced5	uc001ljt.3	Q14185	OTTHUMG00000019249	ENST00000280333.6:c.1362G>T	10.37:g.128821561G>T						DOCK1_uc010qun.1_Silent_p.V475V	p.V454V	NM_001380	NP_001371	Q14185	DOCK1_HUMAN		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)	14	1426	+		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)	454			DHR-1.		A9Z1Z5	Silent	SNP	ENST00000280333.6	37	c.1362G>T																																																																																					0.433	DOCK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050979.2	NM_001380		15	340	1	0	1.37285e-15	0.004007	2.08525e-15	15	340				
MKI67	4288	broad.mit.edu	37	10	129903152	129903152	+	Missense_Mutation	SNP	C	C	A	rs564562573		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr10:129903152C>A	ENST00000368654.3	-	13	7327	c.6952G>T	c.(6952-6954)Ggc>Tgc	p.G2318C	MKI67_ENST00000368653.3_Missense_Mutation_p.G1958C	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	2318	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)	p.G2318C(1)		NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				TCTTTGAAGCCAGCCAGGTCT	0.502																																							uc001lke.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(2)|skin(1)	7						c.(6952-6954)GGC>TGC		antigen identified by monoclonal antibody Ki-67							224.0	238.0	233.0					10																	129903152		2203	4300	6503	SO:0001583	missense	4288				cell proliferation	nucleolus	ATP binding|protein C-terminus binding	g.chr10:129903152C>A	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.6952G>T	10.37:g.129903152C>A	ENSP00000357643:p.Gly2318Cys					MKI67_uc001lkf.2_Missense_Mutation_p.G1958C|MKI67_uc009yav.1_Missense_Mutation_p.G1893C|MKI67_uc009yaw.1_Missense_Mutation_p.G1468C	p.G2318C	NM_002417	NP_002408	P46013	KI67_HUMAN			13	7147	-		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)	2318			16 X 122 AA approximate repeats.|11.		Q5VWH2	Missense_Mutation	SNP	ENST00000368654.3	37	c.6952G>T	CCDS7659.1	.	.	.	.	.	.	.	.	.	.	C	13.57	2.278037	0.40294	.	.	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609	T;T	0.03358	3.96;3.96	3.32	1.32	0.21799	.	0.250769	0.21060	N	0.080848	T	0.13841	0.0335	M	0.77313	2.365	0.29914	N	0.823326	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	T	0.01853	-1.1260	10	0.56958	D	0.05	.	6.9669	0.24627	0.0:0.7233:0.1758:0.1009	.	2317;1958;2318	F5H4V4;P46013-2;P46013	.;.;KI67_HUMAN	C	2318;1958;2317	ENSP00000357643:G2318C;ENSP00000357642:G1958C	ENSP00000357642:G1958C	G	-	1	0	MKI67	129793142	0.001000	0.12720	0.082000	0.20525	0.021000	0.10359	1.021000	0.30040	0.191000	0.20236	-0.305000	0.09177	GGC		0.502	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417		143	425	1	0	8.19216e-75	0.00361	1.44326e-74	143	425				
Unknown	0	broad.mit.edu	37	10	135491123	135491123	+	IGR	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr10:135491123G>A								AL845259.1 (17944 upstream) : None (None downstream)																							GCCCACACCGGCGCGTGGGGA	0.786																																							uc010qvi.1		NA																	0					0						c.(733-735)GGC>GAC		double homeobox, 4-like							12.0	12.0	12.0					10																	135491123		1087	2139	3226	SO:0001628	intergenic_variant	653544					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr10:135491123G>A																													10.37:g.135491123G>A							p.G245D	NM_001127389	NP_001120861	F5GZ66	F5GZ66_HUMAN			1	845	+			245						Missense_Mutation	SNP		37	c.734G>A																																																																																				0	0.786									4	30	0	0	0	0.008291	0	4	30				
EIF4G2	1982	broad.mit.edu	37	11	10822111	10822111	+	Silent	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr11:10822111G>A	ENST00000526148.1	-	17	2238	c.1728C>T	c.(1726-1728)caC>caT	p.H576H	EIF4G2_ENST00000339995.5_Silent_p.H576H|SNORD97_ENST00000459187.1_RNA|EIF4G2_ENST00000396525.2_Silent_p.H538H|EIF4G2_ENST00000525681.1_Silent_p.H576H|RP11-685M7.5_ENST00000532365.1_RNA	NM_001172705.1	NP_001166176			eukaryotic translation initiation factor 4 gamma, 2									p.H576H(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	43				all cancers(16;2.8e-07)|Epithelial(150;4.18e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		CAGGAAGAAAGTGTTTAGGAG	0.373																																							uc001mjc.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(1726-1728)CAC>CAT		eukaryotic translation initiation factor 4							179.0	175.0	177.0					11																	10822111		2201	4294	6495	SO:0001819	synonymous_variant	1982				cell cycle arrest|cell death|regulation of translational initiation|RNA metabolic process	eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity	g.chr11:10822111G>A	U73824	CCDS31428.1, CCDS41618.1	11p15	2005-09-29			ENSG00000110321	ENSG00000110321			3297	protein-coding gene	gene with protein product		602325				9030685, 9032289	Standard	NM_001042559		Approved	DAP5, NAT1, p97	uc001mjc.3	P78344	OTTHUMG00000165823	ENST00000526148.1:c.1728C>T	11.37:g.10822111G>A						EIF4G2_uc001mjb.2_Silent_p.H370H|EIF4G2_uc009ygf.2_Silent_p.H370H|EIF4G2_uc001mjd.2_Silent_p.H538H	p.H576H	NM_001418	NP_001409	P78344	IF4G2_HUMAN		all cancers(16;2.8e-07)|Epithelial(150;4.18e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)	17	2145	-			576			MI.			Silent	SNP	ENST00000526148.1	37	c.1728C>T	CCDS31428.1																																																																																				0.373	EIF4G2-006	KNOWN	alternative_5_UTR|non_ATG_start|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000386603.1	NM_001418		70	77	0	0	0	0.00361	0	70	77				
EHF	26298	broad.mit.edu	37	11	34680205	34680205	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr11:34680205G>T	ENST00000533754.1	+	8	950	c.733G>T	c.(733-735)Gtg>Ttg	p.V245L	EHF_ENST00000531794.1_Missense_Mutation_p.V267L|EHF_ENST00000257831.3_Missense_Mutation_p.V245L|EHF_ENST00000530286.1_Missense_Mutation_p.V245L|EHF_ENST00000450654.2_Missense_Mutation_p.V222L					ets homologous factor									p.V245L(1)	NFIA/EHF(2)	autonomic_ganglia(1)|cervix(1)|endometrium(3)|kidney(3)|lung(8)|upper_aerodigestive_tract(1)	17		all_hematologic(20;0.117)	Epithelial(1;0.055)|all cancers(1;0.137)|STAD - Stomach adenocarcinoma(6;0.235)			ATCAGAGGCAGTGGCTCAGCT	0.458																																							uc001mvr.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(733-735)GTG>TTG		ets homologous factor							94.0	97.0	96.0					11																	34680205		2202	4298	6500	SO:0001583	missense	26298				cell proliferation|epithelial cell differentiation|multicellular organismal development|positive regulation of transcription, DNA-dependent		protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr11:34680205G>T	AF170583	CCDS7894.1, CCDS55752.1, CCDS55753.1	11p12	2008-07-18				ENSG00000135373			3246	protein-coding gene	gene with protein product	"""epithelium-specific ets factor 3"", ""ESE3 transcription factor"""	605439				10527851	Standard	NM_012153		Approved	ESE3, ESEJ	uc021qfu.1	Q9NZC4		ENST00000533754.1:c.733G>T	11.37:g.34680205G>T	ENSP00000435837:p.Val245Leu					EHF_uc009yke.1_Missense_Mutation_p.V222L|EHF_uc009ykf.1_Missense_Mutation_p.V248L	p.V245L	NM_012153	NP_036285	Q9NZC4	EHF_HUMAN	Epithelial(1;0.055)|all cancers(1;0.137)|STAD - Stomach adenocarcinoma(6;0.235)		8	844	+		all_hematologic(20;0.117)	245			ETS.			Missense_Mutation	SNP	ENST00000533754.1	37	c.733G>T	CCDS7894.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.077143	0.76415	.	.	ENSG00000135373	ENST00000257831;ENST00000450654;ENST00000530286;ENST00000533754;ENST00000531794	T;T;T;T;T	0.17528	2.27;2.27;2.27;2.27;2.27	5.7	5.7	0.88788	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (4);	0.000000	0.85682	D	0.000000	T	0.30572	0.0769	N	0.25286	0.73	0.80722	D	1	D;D;D	0.71674	0.998;0.959;0.998	D;D;D	0.87578	0.998;0.949;0.997	T	0.02477	-1.1153	10	0.33141	T	0.24	.	19.8388	0.96673	0.0:0.0:1.0:0.0	.	267;222;245	E9PSB2;Q9NZC4-2;Q9NZC4	.;.;EHF_HUMAN	L	245;222;245;245;267	ENSP00000257831:V245L;ENSP00000399733:V222L;ENSP00000433508:V245L;ENSP00000435837:V245L;ENSP00000435835:V267L	ENSP00000257831:V245L	V	+	1	0	EHF	34636781	1.000000	0.71417	0.990000	0.47175	0.993000	0.82548	9.869000	0.99810	2.695000	0.91970	0.561000	0.74099	GTG		0.458	EHF-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000389855.1	NM_012153		46	70	1	0	3.39706e-21	0.00361	5.42371e-21	46	70				
PRDM11	56981	broad.mit.edu	37	11	45226314	45226314	+	Missense_Mutation	SNP	A	A	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr11:45226314A>C	ENST00000530656.1	+	5	641	c.641A>C	c.(640-642)aAa>aCa	p.K214T	PRDM11_ENST00000263765.4_Missense_Mutation_p.K214T|PRDM11_ENST00000424263.2_Missense_Mutation_p.K180T|PRDM11_ENST00000528980.1_3'UTR			Q9NQV5	PRD11_HUMAN	PR domain containing 11	214	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.			K -> E (in Ref. 1; AAF87244). {ECO:0000305}.			methyltransferase activity (GO:0008168)	p.K214T(1)		endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	26						GACGAGACCAAAGCCAACTGG	0.542																																					NSCLC(118;1511 1736 6472 36603 43224)	NSCLC(118;1511 1736 6472 36603 43224)	uc001myo.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)	1						c.(640-642)AAA>ACA		PR domain containing 11							125.0	116.0	119.0					11																	45226314		2203	4299	6502	SO:0001583	missense	56981							g.chr11:45226314A>C	AF275818	CCDS58130.1, CCDS73277.1	11p11	2008-07-21			ENSG00000019485	ENSG00000019485			13996	protein-coding gene	gene with protein product	"""PR-domain containing protein 11"""						Standard	NM_001256695		Approved	PFM8	uc031qab.1	Q9NQV5	OTTHUMG00000166478	ENST00000530656.1:c.641A>C	11.37:g.45226314A>C	ENSP00000435976:p.Lys214Thr						p.K214T	NM_020229	NP_064614	Q9NQV5	PRD11_HUMAN			6	890	+			214	K -> E (in Ref. 1; AAF87244).		SET.		Q8N9F1	Missense_Mutation	SNP	ENST00000530656.1	37	c.641A>C		.	.	.	.	.	.	.	.	.	.	A	12.30	1.897119	0.33535	.	.	ENSG00000019485	ENST00000263765;ENST00000530656;ENST00000526442;ENST00000424263	T;T;T;T	0.56611	0.45;0.45;0.45;0.45	4.95	4.95	0.65309	SET domain (2);	0.000000	0.56097	D	0.000029	T	0.40767	0.1130	L	0.38649	1.16	0.36007	D	0.83779	B	0.17667	0.023	B	0.14578	0.011	T	0.45425	-0.9262	10	0.31617	T	0.26	-10.3196	10.0903	0.42443	0.8318:0.1681:0.0:0.0	.	214	Q9NQV5	PRD11_HUMAN	T	214;214;180;180	ENSP00000263765:K214T;ENSP00000435976:K214T;ENSP00000431898:K180T;ENSP00000394314:K180T	ENSP00000263765:K214T	K	+	2	0	PRDM11	45182890	1.000000	0.71417	0.981000	0.43875	0.984000	0.73092	2.973000	0.49264	1.853000	0.53794	0.460000	0.39030	AAA		0.542	PRDM11-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000389928.1	NM_020229		19	102	0	0	0	0.008871	0	19	102				
OR5T2	219464	broad.mit.edu	37	11	56000616	56000616	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr11:56000616G>C	ENST00000313264.4	-	1	121	c.46C>G	c.(46-48)Cat>Gat	p.H16D		NM_001004746.1	NP_001004746.1	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T, member 2	16						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H16D(1)		endometrium(6)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(3)	41	Esophageal squamous(21;0.00448)					ACAACACCATGACTCAAGGGG	0.348																																							uc010rjc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(46-48)CAT>GAT		olfactory receptor, family 5, subfamily T,							128.0	121.0	123.0					11																	56000616		2201	4295	6496	SO:0001583	missense	219464				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56000616G>C	AB065838	CCDS31523.1	11q11	2012-08-09			ENSG00000181718	ENSG00000181718		"""GPCR / Class A : Olfactory receptors"""	15296	protein-coding gene	gene with protein product							Standard	NM_001004746		Approved		uc010rjc.2	Q8NGG2	OTTHUMG00000166851	ENST00000313264.4:c.46C>G	11.37:g.56000616G>C	ENSP00000323688:p.His16Asp						p.H16D	NM_001004746	NP_001004746	Q8NGG2	OR5T2_HUMAN			1	46	-	Esophageal squamous(21;0.00448)		16			Extracellular (Potential).		B9EGX5|Q6IFC8	Missense_Mutation	SNP	ENST00000313264.4	37	c.46C>G	CCDS31523.1	.	.	.	.	.	.	.	.	.	.	G	4.001	-0.002528	0.07819	.	.	ENSG00000181718	ENST00000313264	T	0.00646	6.0	2.78	-0.349	0.12609	.	.	.	.	.	T	0.00412	0.0013	N	0.08118	0	0.09310	N	1	B	0.29432	0.244	B	0.21917	0.037	T	0.46925	-0.9156	9	0.87932	D	0	.	2.586	0.04830	0.3904:0.0:0.3749:0.2346	.	16	Q8NGG2	OR5T2_HUMAN	D	16	ENSP00000323688:H16D	ENSP00000323688:H16D	H	-	1	0	OR5T2	55757192	0.000000	0.05858	0.000000	0.03702	0.058000	0.15608	0.031000	0.13710	-0.048000	0.13401	0.458000	0.33432	CAT		0.348	OR5T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391598.1	NM_001004746		18	102	0	0	0	0.010504	0	18	102				
GLYATL2	219970	broad.mit.edu	37	11	58605840	58605840	+	Splice_Site	SNP	A	A	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr11:58605840A>T	ENST00000287275.1	-	3	470	c.80T>A	c.(79-81)gTa>gAa	p.V27E	GLYATL2_ENST00000533636.1_5'UTR|GLYATL2_ENST00000532258.1_Splice_Site_p.V27E	NM_145016.3	NP_659453.3	Q8WU03	GLYL2_HUMAN	glycine-N-acyltransferase-like 2	27						endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	glycine N-acyltransferase activity (GO:0047961)	p.V27E(1)		breast(1)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	23		Breast(21;0.0044)|all_epithelial(135;0.0216)			Glycine(DB00145)	GGCGCCATATACCTACGATGC	0.418																																							uc001nnd.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(79-81)GTA>GAA		glycine-N-acyltransferase-like 2	Glycine(DB00145)						80.0	79.0	79.0					11																	58605840		1922	4147	6069	SO:0001630	splice_region_variant	219970					mitochondrion	glycine N-acyltransferase activity	g.chr11:58605840A>T	AF426250	CCDS41649.1	11q12.1	2008-02-05				ENSG00000156689			24178	protein-coding gene	gene with protein product		614762				12477932	Standard	NM_145016		Approved	BXMAS2-10, MGC24009	uc001nnd.4	Q8WU03		ENST00000287275.1:c.79-1T>A	11.37:g.58605840A>T						GLYATL2_uc009ymq.2_Missense_Mutation_p.V27E	p.V27E	NM_145016	NP_659453	Q8WU03	GLYL2_HUMAN			3	211	-		Breast(21;0.0044)|all_epithelial(135;0.0216)	27					A5LGC7|Q86WC3|Q96AT2	Missense_Mutation	SNP	ENST00000287275.1	37	c.80T>A	CCDS41649.1	.	.	.	.	.	.	.	.	.	.	A	15.87	2.959756	0.53400	.	.	ENSG00000156689	ENST00000287275;ENST00000532258	T;T	0.26067	1.76;1.76	3.57	3.57	0.40892	Glycine N-acyltransferase, N-terminal (1);	0.000000	0.48767	U	0.000169	T	0.49525	0.1562	M	0.83603	2.65	0.28299	N	0.923205	D	0.89917	1.0	D	0.91635	0.999	T	0.44329	-0.9335	10	0.56958	D	0.05	.	8.6828	0.34218	1.0:0.0:0.0:0.0	.	27	Q8WU03	GLYL2_HUMAN	E	27	ENSP00000287275:V27E;ENSP00000434277:V27E	ENSP00000287275:V27E	V	-	2	0	GLYATL2	58362416	0.721000	0.28007	0.088000	0.20740	0.095000	0.18619	1.095000	0.30964	1.290000	0.44636	0.445000	0.29226	GTA		0.418	GLYATL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394599.1	NM_145016	Missense_Mutation	3	55	0	0	0	0.004672	0	3	55				
PPP1R32	220004	broad.mit.edu	37	11	61250221	61250221	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr11:61250221C>T	ENST00000338608.2	+	4	447	c.322C>T	c.(322-324)Cgc>Tgc	p.R108C	RP11-286N22.8_ENST00000544880.1_Intron|PPP1R32_ENST00000432063.2_Missense_Mutation_p.R108C	NM_145017.2	NP_659454.2	Q7Z5V6	PPR32_HUMAN	protein phosphatase 1, regulatory subunit 32	108							phosphatase binding (GO:0019902)	p.R108C(1)									CTGGAGCATGCGCCAGACCAG	0.672											OREG0021002	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001nru.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(322-324)CGC>TGC		IIIG9 protein							36.0	37.0	36.0					11																	61250221		2202	4299	6501	SO:0001583	missense	220004							g.chr11:61250221C>T	AK057333	CCDS8008.1, CCDS53641.1	11q12.2	2012-04-17	2011-10-11	2011-10-11	ENSG00000162148	ENSG00000162148		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	28869	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 66"""	C11orf66		12477932	Standard	NM_145017		Approved	IIIG9, FLJ32771	uc001nru.2	Q7Z5V6	OTTHUMG00000168176	ENST00000338608.2:c.322C>T	11.37:g.61250221C>T	ENSP00000344140:p.Arg108Cys		OREG0021002	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1052	C11orf66_uc009ynq.1_Missense_Mutation_p.R108C	p.R108C	NM_145017	NP_659454	Q7Z5V6	CK066_HUMAN			4	447	+			108					Q4G0P4|Q96M77	Missense_Mutation	SNP	ENST00000338608.2	37	c.322C>T	CCDS8008.1	.	.	.	.	.	.	.	.	.	.	C	12.80	2.047248	0.36085	.	.	ENSG00000162148	ENST00000432063;ENST00000338608	T;T	0.45276	0.9;1.48	5.06	-3.52	0.04682	.	0.801011	0.11146	N	0.594691	T	0.16428	0.0395	N	0.08118	0	0.24288	N	0.995171	B;B	0.33171	0.398;0.4	B;B	0.16289	0.01;0.015	T	0.09378	-1.0677	10	0.66056	D	0.02	-27.2811	7.5473	0.27775	0.0:0.4125:0.1133:0.4742	.	108;108	Q7Z5V6-2;Q7Z5V6	.;PPR32_HUMAN	C	108	ENSP00000391560:R108C;ENSP00000344140:R108C	ENSP00000344140:R108C	R	+	1	0	C11orf66	61006797	0.005000	0.15991	0.008000	0.14137	0.011000	0.07611	-0.885000	0.04161	-0.605000	0.05753	-0.254000	0.11334	CGC		0.672	PPP1R32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398621.1	NM_145017		20	21	0	0	0	0.010504	0	20	21				
TSGA10IP	254187	broad.mit.edu	37	11	65714870	65714870	+	RNA	SNP	T	T	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr11:65714870T>A	ENST00000532620.1	+	0	805				TSGA10IP_ENST00000608857.1_RNA			Q3SY00	T10IP_HUMAN	testis specific, 10 interacting protein									p.S162T(1)		endometrium(2)|kidney(3)|lung(9)	14						GGAGCTAGGATCAGAGCCCCC	0.642																																							uc001ogk.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(574-576)TCA>ACA		testis specific, 10 interacting protein							19.0	23.0	22.0					11																	65714870		1919	4144	6063			254187							g.chr11:65714870T>A	AK057442	CCDS66138.1	11q13.1	2014-03-25			ENSG00000175513	ENSG00000175513			26555	protein-coding gene	gene with protein product						14702039	Standard	NM_152762		Approved	FLJ32880, FAM161C	uc001ogk.1	Q3SY00	OTTHUMG00000166753		11.37:g.65714870T>A						TSGA10IP_uc009yqw.1_RNA|TSGA10IP_uc009yqx.1_Intron	p.S192T	NM_152762	NP_689975	Q3SY00	T10IP_HUMAN			5	606	+			192					Q3SXZ9|Q3SY01|Q96M26	Missense_Mutation	SNP	ENST00000532620.1	37	c.574T>A																																																																																					0.642	TSGA10IP-001	KNOWN	basic	processed_transcript	polymorphic_pseudogene	OTTHUMT00000391373.2	NM_152762		16	10	0	0	0	0.003163	0	16	10				
SDHD	6392	broad.mit.edu	37	11	111959712	111959712	+	Silent	SNP	A	A	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr11:111959712A>T	ENST00000375549.3	+	3	426	c.291A>T	c.(289-291)gcA>gcT	p.A97A	SDHD_ENST00000526592.1_Silent_p.A97A|TIMM8B_ENST00000541231.1_5'Flank|SDHD_ENST00000528048.1_Intron|SDHD_ENST00000528021.1_Silent_p.A97A|SDHD_ENST00000525291.1_Silent_p.A58A|SDHD_ENST00000532699.1_Silent_p.A97A|TIMM8B_ENST00000504148.2_5'Flank|TIMM8B_ENST00000507614.1_5'Flank|SDHD_ENST00000528182.1_Silent_p.A97A	NM_003002.2	NP_002993.1	O14521	DHSD_HUMAN	succinate dehydrogenase complex, subunit D, integral membrane protein	97					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	integral component of membrane (GO:0016021)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|succinate dehydrogenase activity (GO:0000104)|ubiquinone binding (GO:0048039)	p.A97A(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)|urinary_tract(1)	9		all_cancers(61;5.7e-14)|all_epithelial(67;3.4e-08)|Melanoma(852;8.81e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;6.13e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;1.05e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0515)	Hexachlorophene(DB00756)|Succinic acid(DB00139)	CCCTGGCTGCAGCCCTCACTC	0.468			"""Mis, N, F, S"""			"""paraganglioma, pheochromocytoma"""			Familial Paragangliomas;Cowden syndrome;Carney-Stratakis syndrome																														uc001pmz.2		NA	yes	Rec		Familial paraganglioma	11	11q23	6392	Mis|N|F|S	"""succinate dehydrogenase complex, subunit D, integral membrane protein"""			O		paraganglioma|pheochromocytoma			1	Substitution - coding silent(1)		lung(1)		0						c.(289-291)GCA>GCT		succinate dehydrogenase complex, subunit D	Succinic acid(DB00139)						90.0	89.0	89.0					11																	111959712		2201	4297	6498	SO:0001819	synonymous_variant	6392	Familial_Paragangliomas|Carney-Stratakis_syndrome|Cowden_syndrome	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;Carney-Stratakis dyad, Paraganglioma-Gastric Stromal Sarcoma dyad	respiratory electron transport chain|transport|tricarboxylic acid cycle	integral to membrane|mitochondrial respiratory chain complex II	electron carrier activity|heme binding|succinate dehydrogenase activity|ubiquinone binding	g.chr11:111959712A>T	AB006202	CCDS31678.1, CCDS60958.1, CCDS60959.1, CCDS60960.1	11q23	2014-09-17				ENSG00000204370		"""Mitochondrial respiratory chain complex / Complex II"""	10683	protein-coding gene	gene with protein product		602690		PGL, PGL1		9533030, 1301144	Standard	NM_003002		Approved		uc001pmz.4	O14521		ENST00000375549.3:c.291A>T	11.37:g.111959712A>T						TIMM8B_uc001pmx.2_5'Flank|TIMM8B_uc001pmy.2_5'Flank	p.A97A	NM_003002	NP_002993	O14521	DHSD_HUMAN		Epithelial(105;6.13e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;1.05e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0515)	3	352	+		all_cancers(61;5.7e-14)|all_epithelial(67;3.4e-08)|Melanoma(852;8.81e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)	97			Helical; (By similarity).		A6ND90|B3KQQ8|E9PIC0|E9PIG3|E9PQI9|Q53XW5|Q6IRW2	Silent	SNP	ENST00000375549.3	37	c.291A>T	CCDS31678.1																																																																																				0.468	SDHD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392351.1	NM_003002		63	56	0	0	0	0.00361	0	63	56				
APOA4	337	broad.mit.edu	37	11	116691784	116691784	+	Silent	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr11:116691784G>A	ENST00000357780.3	-	3	1104	c.990C>T	c.(988-990)ggC>ggT	p.G330G		NM_000482.3	NP_000473.2	P06727	APOA4_HUMAN	apolipoprotein A-IV	330	13 X 22 AA approximate tandem repeats.				cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|chylomicron assembly (GO:0034378)|chylomicron remodeling (GO:0034371)|high-density lipoprotein particle remodeling (GO:0034375)|hydrogen peroxide catabolic process (GO:0042744)|innate immune response in mucosa (GO:0002227)|leukocyte cell-cell adhesion (GO:0007159)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|multicellular organismal lipid catabolic process (GO:0044240)|negative regulation of plasma lipoprotein particle oxidation (GO:0034445)|phosphatidylcholine metabolic process (GO:0046470)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of triglyceride catabolic process (GO:0010898)|protein-lipid complex assembly (GO:0065005)|regulation of cholesterol transport (GO:0032374)|regulation of intestinal cholesterol absorption (GO:0030300)|removal of superoxide radicals (GO:0019430)|response to lipid hydroperoxide (GO:0006982)|response to stilbenoid (GO:0035634)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|very-low-density lipoprotein particle remodeling (GO:0034372)	blood microparticle (GO:0072562)|chylomicron (GO:0042627)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)|very-low-density lipoprotein particle (GO:0034361)	antioxidant activity (GO:0016209)|cholesterol transporter activity (GO:0017127)|copper ion binding (GO:0005507)|lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)|phosphatidylcholine binding (GO:0031210)|phosphatidylcholine-sterol O-acyltransferase activator activity (GO:0060228)|protein homodimerization activity (GO:0042803)	p.G330G(1)		cervix(1)|endometrium(2)|lung(10)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	20	all_hematologic(175;0.0487)	Breast(348;0.0126)|Medulloblastoma(222;0.0425)|all_hematologic(158;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|Epithelial(105;1.62e-05)|all cancers(92;0.000165)|OV - Ovarian serous cystadenocarcinoma(223;0.148)		CCGCATGGGGGCCCAGTTTCT	0.592																																							uc001pps.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(988-990)GGC>GGT		apolipoprotein A-IV precursor							68.0	66.0	66.0					11																	116691784		2201	4292	6493	SO:0001819	synonymous_variant	337							g.chr11:116691784G>A		CCDS31681.1	11q23.3	2013-01-24			ENSG00000110244	ENSG00000110244		"""Apolipoproteins"""	602	protein-coding gene	gene with protein product		107690					Standard	NM_000482		Approved		uc001pps.1	P06727	OTTHUMG00000046110	ENST00000357780.3:c.990C>T	11.37:g.116691784G>A							p.G330G	NM_000482	NP_000473				BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|Epithelial(105;1.62e-05)|all cancers(92;0.000165)|OV - Ovarian serous cystadenocarcinoma(223;0.148)	3	1094	-	all_hematologic(175;0.0487)	Breast(348;0.0126)|Medulloblastoma(222;0.0425)|all_hematologic(158;0.0564)|all_neural(223;0.234)						A8MSL6|Q14CW8|Q6Q787	Silent	SNP	ENST00000357780.3	37	c.990C>T	CCDS31681.1																																																																																				0.592	APOA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106279.2	NM_000482		70	73	0	0	0	0.00361	0	70	73				
IGSF9B	22997	broad.mit.edu	37	11	133789980	133789980	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr11:133789980C>A	ENST00000321016.8	-	18	3870	c.3640G>T	c.(3640-3642)Ggc>Tgc	p.G1214C	IGSF9B_ENST00000533871.2_Missense_Mutation_p.G1214C			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	1214	Pro-rich.				homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)		p.G670C(1)|p.G1214C(1)		breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		TCAGGGGAGCCGGTGCGGGAG	0.701																																							uc001qgx.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(3640-3642)GGC>TGC		immunoglobulin superfamily, member 9B							23.0	28.0	27.0					11																	133789980		1860	4063	5923	SO:0001583	missense	22997					integral to membrane|plasma membrane		g.chr11:133789980C>A	AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.3640G>T	11.37:g.133789980C>A	ENSP00000317980:p.Gly1214Cys						p.G1214C	NM_014987	NP_055802	Q9UPX0	TUTLB_HUMAN		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)	18	3871	-	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)	1214			Pro-rich.|Cytoplasmic (Potential).		G5EA26	Missense_Mutation	SNP	ENST00000321016.8	37	c.3640G>T		.	.	.	.	.	.	.	.	.	.	C	11.86	1.765747	0.31228	.	.	ENSG00000080854	ENST00000321016;ENST00000533871	T;T	0.71461	-0.25;-0.57	5.11	3.22	0.36961	.	0.154942	0.30244	N	0.010065	T	0.65302	0.2678	L	0.27053	0.805	0.39584	D	0.969472	D	0.64830	0.994	P	0.53146	0.719	T	0.66897	-0.5807	10	0.87932	D	0	.	8.46	0.32923	0.0:0.6997:0.0:0.3003	.	1214	Q9UPX0	TUTLB_HUMAN	C	1214;1056	ENSP00000317980:G1214C;ENSP00000436552:G1056C	ENSP00000317980:G1214C	G	-	1	0	IGSF9B	133295190	0.998000	0.40836	0.823000	0.32752	0.031000	0.12232	3.634000	0.54302	0.550000	0.28991	0.555000	0.69702	GGC		0.701	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_290502		36	49	1	0	5.43694e-19	0.005524	8.58303e-19	36	49				
CRACR2A	84766	broad.mit.edu	37	12	3763466	3763466	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr12:3763466C>A	ENST00000252322.1	-	10	1426	c.958G>T	c.(958-960)Gag>Tag	p.E320*	EFCAB4B_ENST00000444507.1_Nonsense_Mutation_p.E320*|EFCAB4B_ENST00000440314.2_Nonsense_Mutation_p.E320*	NM_032680.3	NP_116069.1	Q9BSW2	EFC4B_HUMAN		320					activation of store-operated calcium channel activity (GO:0032237)|immune system process (GO:0002376)|positive regulation of calcium ion transport (GO:0051928)|store-operated calcium entry (GO:0002115)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.E320*(2)		breast(1)|endometrium(3)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(1)	24			OV - Ovarian serous cystadenocarcinoma(31;0.00287)|COAD - Colon adenocarcinoma(12;0.0264)			GAAGTCCGCTCCAGCTCCCGG	0.572																																							uc001qmj.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(1)|pancreas(1)	2						c.(958-960)GAG>TAG		EF-hand calcium binding domain 4B isoform c							69.0	66.0	67.0					12																	3763466		2203	4300	6503	SO:0001587	stop_gained	84766				activation of store-operated calcium channel activity|store-operated calcium entry	cytoplasm	calcium ion binding|protein binding	g.chr12:3763466C>A																												ENST00000252322.1:c.958G>T	12.37:g.3763466C>A	ENSP00000252322:p.Glu320*					EFCAB4B_uc010sen.1_Nonsense_Mutation_p.E320*|EFCAB4B_uc010seo.1_Nonsense_Mutation_p.E320*|EFCAB4B_uc001qmi.1_RNA	p.E320*	NM_032680	NP_116069	Q9BSW2	EFC4B_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.00287)|COAD - Colon adenocarcinoma(12;0.0264)		10	1530	-			320			Potential.		B4E1X0|B9EK63	Nonsense_Mutation	SNP	ENST00000252322.1	37	c.958G>T	CCDS8522.1	.	.	.	.	.	.	.	.	.	.	C	28.7	4.938837	0.92526	.	.	ENSG00000130038	ENST00000440314;ENST00000444507;ENST00000252322	.	.	.	4.27	4.27	0.50696	.	0.285381	0.38164	N	0.001792	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-5.5296	14.2563	0.66053	0.0:1.0:0.0:0.0	.	.	.	.	X	320	.	ENSP00000252322:E320X	E	-	1	0	EFCAB4B	3633727	1.000000	0.71417	1.000000	0.80357	0.634000	0.38068	4.097000	0.57741	2.211000	0.71520	0.462000	0.41574	GAG		0.572	EFCAB4B-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000398673.1			19	30	1	0	4.63292e-17	0.008871	7.13343e-17	19	30				
TPI1	7167	broad.mit.edu	37	12	6979285	6979285	+	Missense_Mutation	SNP	C	C	T	rs201946216		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr12:6979285C>T	ENST00000229270.4	+	6	1064	c.727C>T	c.(727-729)Cgt>Tgt	p.R243C	TPI1_ENST00000535434.1_Missense_Mutation_p.R124C|TPI1_ENST00000396705.5_Missense_Mutation_p.R206C|TPI1_ENST00000488464.2_Missense_Mutation_p.R124C	NM_001159287.1	NP_001152759.1	P60174	TPIS_HUMAN	triosephosphate isomerase 1	243					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glyceraldehyde-3-phosphate metabolic process (GO:0019682)|glycolytic process (GO:0006096)|multicellular organismal development (GO:0007275)|pentose-phosphate shunt (GO:0006098)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	triose-phosphate isomerase activity (GO:0004807)	p.R206C(1)|p.R206S(1)|p.R243C(1)|p.R243S(1)		endometrium(2)|kidney(2)|large_intestine(1)|lung(11)|prostate(1)|skin(2)	19						TCAGAGCACCCGTATCATTTA	0.572											OREG0021638	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	1	0.000199681	0.0	0.0	5008	,	,		-128	0.001		0.0	False		,,,				2504	0.0						uc001qrk.2		NA																	4	Substitution - Missense(4)		lung(4)		0						c.(616-618)CGT>TGT		triosephosphate isomerase 1 isoform 1							119.0	114.0	116.0					12																	6979285		2203	4300	6503	SO:0001583	missense	7167				fatty acid biosynthetic process|gluconeogenesis|glycolysis|pentose-phosphate shunt	cytosol	triose-phosphate isomerase activity	g.chr12:6979285C>T		CCDS8566.1, CCDS53740.1, CCDS58206.1	12p13.31	2012-10-02			ENSG00000111669	ENSG00000111669	5.3.1.1		12009	protein-coding gene	gene with protein product		190450					Standard	NM_000365		Approved		uc001qrk.4	P60174	OTTHUMG00000133767	ENST00000229270.4:c.727C>T	12.37:g.6979285C>T	ENSP00000229270:p.Arg243Cys		OREG0021638	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	638	TPI1_uc010sfo.1_Missense_Mutation_p.R124C	p.R206C	NM_000365	NP_000356	P60174	TPIS_HUMAN			6	654	+			206					B7Z5D8|D3DUS9|P00938|Q6FHP9|Q6IS07|Q8WWD0|Q96AG5	Missense_Mutation	SNP	ENST00000229270.4	37	c.616C>T	CCDS53740.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	18.13	3.554530	0.65425	.	.	ENSG00000111669	ENST00000229270;ENST00000396705;ENST00000535434	D;D;D	0.94828	-3.53;-3.53;-3.53	5.44	4.47	0.54385	Aldolase-type TIM barrel (1);	0.000000	0.85682	U	0.000000	D	0.98261	0.9424	H	0.97940	4.11	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.98965	1.0799	10	0.87932	D	0	.	14.6927	0.69098	0.1745:0.8255:0.0:0.0	.	243	P60174	TPIS_HUMAN	C	243;206;124	ENSP00000229270:R243C;ENSP00000379933:R206C;ENSP00000443599:R124C	ENSP00000229270:R243C	R	+	1	0	TPI1	6849546	0.696000	0.27757	1.000000	0.80357	0.973000	0.67179	0.343000	0.19944	2.550000	0.86006	0.462000	0.41574	CGT		0.572	TPI1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000258252.1	NM_000365		6	106	0	0	0	0.001984	0	6	106				
ATN1	1822	broad.mit.edu	37	12	7048172	7048172	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr12:7048172T>A	ENST00000356654.4	+	7	3283	c.3046T>A	c.(3046-3048)Tcc>Acc	p.S1016T	ATN1_ENST00000396684.2_Missense_Mutation_p.S1016T	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	1016					cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)	p.S1016T(1)		breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						GCCTGACATGTCCTATGCTGA	0.667																																							uc001qrw.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(2)|pancreas(1)|skin(1)	6						c.(3046-3048)TCC>ACC		atrophin-1							47.0	52.0	50.0					12																	7048172		2202	4299	6501	SO:0001583	missense	1822				cell death|central nervous system development	cytoplasm|nucleus	protein domain specific binding	g.chr12:7048172T>A	U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.3046T>A	12.37:g.7048172T>A	ENSP00000349076:p.Ser1016Thr					ATN1_uc001qrx.1_Missense_Mutation_p.S1016T	p.S1016T	NM_001007026	NP_001007027	P54259	ATN1_HUMAN			7	3283	+			1016					Q99495|Q99621|Q9UEK7	Missense_Mutation	SNP	ENST00000356654.4	37	c.3046T>A	CCDS31734.1	.	.	.	.	.	.	.	.	.	.	T	16.99	3.275157	0.59649	.	.	ENSG00000111676	ENST00000356654;ENST00000396684;ENST00000544325;ENST00000229279	T;T;T	0.50001	0.76;0.76;0.76	4.82	4.82	0.62117	.	0.512077	0.14585	U	0.310639	T	0.50531	0.1621	L	0.38838	1.175	0.43347	D	0.995408	B	0.24132	0.098	B	0.41236	0.351	T	0.50742	-0.8792	10	0.48119	T	0.1	.	14.8997	0.70670	0.0:0.0:0.0:1.0	.	1016	P54259	ATN1_HUMAN	T	1016;1016;1016;601	ENSP00000349076:S1016T;ENSP00000379915:S1016T;ENSP00000441744:S1016T	ENSP00000229279:S601T	S	+	1	0	ATN1	6918433	0.999000	0.42202	0.997000	0.53966	0.488000	0.33401	2.878000	0.48515	2.168000	0.68352	0.529000	0.55759	TCC		0.667	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401948.2	NM_001940		5	82	0	0	0	0.000602	0	5	82				
A2M	2	broad.mit.edu	37	12	9243913	9243913	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr12:9243913A>G	ENST00000318602.7	-	19	2660	c.2353T>C	c.(2353-2355)Tct>Cct	p.S785P		NM_000014.4	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin	785					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|stem cell differentiation (GO:0048863)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	calcium-dependent protein binding (GO:0048306)|enzyme binding (GO:0019899)|growth factor binding (GO:0019838)|interleukin-1 binding (GO:0019966)|interleukin-8 binding (GO:0019959)|protease binding (GO:0002020)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|tumor necrosis factor binding (GO:0043120)	p.S785P(1)		breast(1)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(17)|lung(30)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	77					Bacitracin(DB00626)|Becaplermin(DB00102)|Ocriplasmin(DB08888)	GCTCGGAGAGAGGCAGTGGAA	0.552																																							uc001qvk.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(4)|skin(1)	5						c.(2353-2355)TCT>CCT		alpha-2-macroglobulin precursor	Bacitracin(DB00626)|Becaplermin(DB00102)						111.0	119.0	117.0					12																	9243913		2203	4300	6503	SO:0001583	missense	2				blood coagulation, intrinsic pathway|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|extracellular space|platelet alpha granule lumen	enzyme binding|GTPase activator activity|interleukin-1 binding|interleukin-8 binding|serine-type endopeptidase inhibitor activity|tumor necrosis factor binding	g.chr12:9243913A>G	BX647329, X68728, M11313	CCDS44827.1	12p13.31	2010-02-24			ENSG00000175899	ENSG00000175899			7	protein-coding gene	gene with protein product		103950					Standard	XM_006719056		Approved	FWP007, S863-7, CPAMD5	uc001qvk.1	P01023	OTTHUMG00000150267	ENST00000318602.7:c.2353T>C	12.37:g.9243913A>G	ENSP00000323929:p.Ser785Pro					A2M_uc009zgk.1_Missense_Mutation_p.S635P	p.S785P	NM_000014	NP_000005	P01023	A2MG_HUMAN			19	2466	-			785					Q13677|Q59F47|Q5QTS0|Q68DN2|Q6PIY3|Q6PN97	Missense_Mutation	SNP	ENST00000318602.7	37	c.2353T>C	CCDS44827.1	.	.	.	.	.	.	.	.	.	.	A	13.46	2.243219	0.39697	.	.	ENSG00000175899	ENST00000318602;ENST00000540099	T	0.27402	1.67	5.28	-0.249	0.13011	Alpha-2-macroglobulin (1);	0.516016	0.20330	N	0.094455	T	0.27629	0.0679	M	0.61703	1.905	0.09310	N	1	B	0.27700	0.186	B	0.35688	0.208	T	0.28106	-1.0054	10	0.46703	T	0.11	.	2.7996	0.05411	0.3682:0.1103:0.0711:0.4504	.	785	P01023	A2MG_HUMAN	P	785;800	ENSP00000323929:S785P	ENSP00000323929:S785P	S	-	1	0	A2M	9135180	0.045000	0.20229	0.083000	0.20561	0.980000	0.70556	0.504000	0.22626	-0.309000	0.08779	0.455000	0.32223	TCT		0.552	A2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317233.2	NM_000014		16	89	0	0	0	0.004007	0	16	89				
PZP	5858	broad.mit.edu	37	12	9317851	9317851	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr12:9317851A>G	ENST00000261336.2	-	19	2399	c.2371T>C	c.(2371-2373)Tct>Cct	p.S791P	PZP_ENST00000539983.1_5'UTR|PZP_ENST00000381997.2_Missense_Mutation_p.S660P	NM_002864.2	NP_002855.2	P20742	PZP_HUMAN	pregnancy-zone protein	791					female pregnancy (GO:0007565)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.S791P(1)|p.S660P(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(21)|lung(46)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)	102						GCTCGGAGAGAGGCAGTGGAA	0.552																																					Melanoma(125;1402 1695 4685 34487 38571)	Melanoma(125;1402 1695 4685 34487 38571)	uc001qvl.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)	5						c.(2371-2373)TCT>CCT		pregnancy-zone protein precursor							98.0	91.0	93.0					12																	9317851		2203	4300	6503	SO:0001583	missense	5858							g.chr12:9317851A>G	X54380, M24416, X51541	CCDS8600.1	12p13-p12.2	2008-02-01			ENSG00000126838	ENSG00000126838			9750	protein-coding gene	gene with protein product		176420					Standard	NM_002864		Approved	CPAMD6	uc001qvl.3	P20742	OTTHUMG00000154915	ENST00000261336.2:c.2371T>C	12.37:g.9317851A>G	ENSP00000261336:p.Ser791Pro					PZP_uc009zgl.2_Missense_Mutation_p.S660P|PZP_uc010sgo.1_RNA|PZP_uc009zgm.1_Missense_Mutation_p.S123P	p.S791P	NM_002864	NP_002855					19	2400	-								A6ND27|Q15273|Q2NKL2|Q7M4N7	Missense_Mutation	SNP	ENST00000261336.2	37	c.2371T>C	CCDS8600.1	.	.	.	.	.	.	.	.	.	.	A	14.35	2.510101	0.44660	.	.	ENSG00000126838	ENST00000261336;ENST00000381997	T;T	0.27402	1.67;1.67	3.7	0.993	0.19825	Alpha-2-macroglobulin (1);	0.216160	0.31760	U	0.007111	T	0.28400	0.0702	L	0.54908	1.71	0.09310	N	1	B;P;B	0.50617	0.186;0.937;0.186	B;P;B	0.47044	0.248;0.535;0.248	T	0.12091	-1.0561	10	0.46703	T	0.11	.	4.5093	0.11903	0.574:0.0:0.0899:0.336	.	791;660;791	B2R950;P20742-2;P20742	.;.;PZP_HUMAN	P	791;660	ENSP00000261336:S791P;ENSP00000371427:S660P	ENSP00000261336:S791P	S	-	1	0	PZP	9209118	0.000000	0.05858	0.013000	0.15412	0.928000	0.56348	0.020000	0.13466	0.053000	0.16036	0.383000	0.25322	TCT		0.552	PZP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337624.1	NM_002864		23	73	0	0	0	0.002299	0	23	73				
CLEC1A	51267	broad.mit.edu	37	12	10233927	10233927	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr12:10233927C>A	ENST00000315330.4	-	3	362	c.300G>T	c.(298-300)ttG>ttT	p.L100F	CLEC1A_ENST00000457018.2_Missense_Mutation_p.L67F|CLEC1A_ENST00000420265.2_Intron|RN7SKP161_ENST00000411110.1_RNA	NM_016511.2	NP_057595.2	Q8NC01	CLC1A_HUMAN	C-type lectin domain family 1, member A	100					cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)	p.L100F(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	23						GAAGAGATTGCAACTCTTGGG	0.423																																							uc001qxb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(298-300)TTG>TTT		C-type lectin-like receptor-1							129.0	128.0	128.0					12																	10233927		2203	4300	6503	SO:0001583	missense	51267				cell surface receptor linked signaling pathway|defense response	integral to plasma membrane|intracellular	sugar binding|transmembrane receptor activity	g.chr12:10233927C>A	AY358587	CCDS8612.1, CCDS73443.1	12p13.31	2005-02-09				ENSG00000150048		"""C-type lectin domain containing"""	24355	protein-coding gene	gene with protein product		606782				10671229, 11745369	Standard	XM_005253383		Approved	CLEC1, MGC34328	uc001qxb.3	Q8NC01		ENST00000315330.4:c.300G>T	12.37:g.10233927C>A	ENSP00000326407:p.Leu100Phe					CLEC1A_uc009zhf.2_Missense_Mutation_p.L12F|CLEC1A_uc001qxc.2_Missense_Mutation_p.L12F|CLEC1A_uc001qxd.2_Missense_Mutation_p.L57F|CLEC1A_uc010sgx.1_Intron	p.L100F	NM_016511	NP_057595	Q8NC01	CLC1A_HUMAN			3	384	-			100			Extracellular (Potential).		Q8IUW7|Q9NZH3	Missense_Mutation	SNP	ENST00000315330.4	37	c.300G>T	CCDS8612.1	.	.	.	.	.	.	.	.	.	.	C	4.033	0.003708	0.07866	.	.	ENSG00000150048	ENST00000315330;ENST00000457018	T;T	0.19105	2.17;2.17	4.71	-0.786	0.10946	.	0.406743	0.17930	N	0.157214	T	0.12646	0.0307	L	0.45470	1.425	0.46241	D	0.998941	B;B	0.15719	0.014;0.009	B;B	0.17979	0.02;0.005	T	0.17653	-1.0362	10	0.13853	T	0.58	.	2.6153	0.04902	0.3559:0.3169:0.0:0.3272	.	67;100	E9PFB4;Q8NC01	.;CLC1A_HUMAN	F	100;67	ENSP00000326407:L100F;ENSP00000415048:L67F	ENSP00000326407:L100F	L	-	3	2	CLEC1A	10125194	0.829000	0.29322	0.288000	0.24862	0.046000	0.14306	-0.037000	0.12164	-0.036000	0.13669	-0.261000	0.10672	TTG		0.423	CLEC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399924.1	NM_016511		27	52	1	0	2.79863e-10	0.004656	3.84555e-10	27	52				
RPL13AP20	387841	broad.mit.edu	37	12	13028751	13028751	+	IGR	SNP	G	G	C	rs199863259		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr12:13028751G>C								DDX47 (45836 upstream) : GPRC5A (14964 downstream)																							GGTGTTTGACGGCATCCCACC	0.612																																							uc010sho.1		NA																	0					0						c.(319-321)GGC>CGC		SubName: Full=Ribosomal protein L13a variant; Flags: Fragment;																																				SO:0001628	intergenic_variant	387841							g.chr12:13028751G>C																													12.37:g.13028751G>C							p.G107R	NR_003932						1	341	+									Missense_Mutation	SNP		37	c.319G>C																																																																																				0	0.612									3	13	0	0	0	0.004672	0	3	13				
SLCO1B1	10599	broad.mit.edu	37	12	21331534	21331534	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr12:21331534A>G	ENST00000256958.2	+	6	602	c.506A>G	c.(505-507)tAc>tGc	p.Y169C		NM_006446.4	NP_006437.3	Q9Y6L6	SO1B1_HUMAN	solute carrier organic anion transporter family, member 1B1	169					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)	p.Y169C(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	70					Acetylcysteine(DB06151)|Aminohippurate(DB00345)|Atorvastatin(DB01076)|Axitinib(DB06626)|Benzylpenicillin(DB01053)|Bezafibrate(DB01393)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dextrothyroxine(DB00509)|Digoxin(DB00390)|Dinoprostone(DB00917)|Eltrombopag(DB06210)|Estradiol(DB00783)|Estrone(DB00655)|Ezetimibe(DB00973)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Gemfibrozil(DB01241)|Indinavir(DB00224)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nelfinavir(DB00220)|Olmesartan(DB00275)|Ouabain(DB01092)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Penicillamine(DB00859)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Quinidine(DB00908)|Repaglinide(DB00912)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sumatriptan(DB00669)|Valsartan(DB00177)|Verapamil(DB00661)	TCTGGGTCATACATGTGGATA	0.333																																							uc001req.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(3)|pancreas(1)|central_nervous_system(1)	8						c.(505-507)TAC>TGC		solute carrier organic anion transporter family,	Digoxin(DB00390)|Gemfibrozil(DB01241)|Pravastatin(DB00175)						134.0	128.0	130.0					12																	21331534		2203	4300	6503	SO:0001583	missense	10599				bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|integral to plasma membrane|membrane fraction	bile acid transmembrane transporter activity|sodium-independent organic anion transmembrane transporter activity|thyroid hormone transmembrane transporter activity	g.chr12:21331534A>G		CCDS8685.1	12p12	2013-05-22	2003-11-25	2003-11-26	ENSG00000134538	ENSG00000134538		"""Solute carriers"""	10959	protein-coding gene	gene with protein product		604843	"""solute carrier family 21 (organic anion transporter), member 6"""	SLC21A6		10358072	Standard	NM_006446		Approved	OATP-C, LST-1, OATP1B1	uc001req.4	Q9Y6L6	OTTHUMG00000169047	ENST00000256958.2:c.506A>G	12.37:g.21331534A>G	ENSP00000256958:p.Tyr169Cys						p.Y169C	NM_006446	NP_006437	Q9Y6L6	SO1B1_HUMAN			6	610	+			169			Helical; Name=4; (Potential).		B2R7G2|Q29R64|Q9NQ37|Q9UBF3|Q9UH89	Missense_Mutation	SNP	ENST00000256958.2	37	c.506A>G	CCDS8685.1	.	.	.	.	.	.	.	.	.	.	A	9.242	1.038549	0.19669	.	.	ENSG00000134538	ENST00000256958	T	0.39056	1.1	3.62	2.35	0.29111	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.766591	0.12863	N	0.432969	T	0.55049	0.1896	M	0.63843	1.955	0.36566	D	0.872707	D	0.58970	0.984	P	0.61874	0.895	T	0.60110	-0.7327	10	0.38643	T	0.18	.	10.3451	0.43901	0.8363:0.1637:0.0:0.0	.	169	Q9Y6L6	SO1B1_HUMAN	C	169	ENSP00000256958:Y169C	ENSP00000256958:Y169C	Y	+	2	0	SLCO1B1	21222801	0.001000	0.12720	0.913000	0.36048	0.241000	0.25554	1.415000	0.34748	1.641000	0.50575	0.260000	0.18958	TAC		0.333	SLCO1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402070.1	NM_006446		27	63	0	0	0	0.005443	0	27	63				
CNTN1	1272	broad.mit.edu	37	12	41323638	41323638	+	Silent	SNP	A	A	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr12:41323638A>G	ENST00000551295.2	+	7	654	c.537A>G	c.(535-537)gtA>gtG	p.V179V	CNTN1_ENST00000347616.1_Silent_p.V179V|CNTN1_ENST00000547849.1_Silent_p.V179V|CNTN1_ENST00000348761.2_Silent_p.V168V|CNTN1_ENST00000360099.3_Silent_p.V179V|CNTN1_ENST00000547702.1_Silent_p.V179V	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	179	Ig-like C2-type 2.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.V179V(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				AATTTCCTGTATTTATCACAA	0.363																																							uc001rmm.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(4)|ovary(3)|large_intestine(1)|skin(1)	9						c.(535-537)GTA>GTG		contactin 1 isoform 1 precursor							94.0	93.0	93.0					12																	41323638		2203	4300	6503	SO:0001819	synonymous_variant	1272				axon guidance|cell adhesion|Notch signaling pathway	anchored to membrane|membrane fraction|plasma membrane		g.chr12:41323638A>G	Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.537A>G	12.37:g.41323638A>G						CNTN1_uc009zjy.1_Silent_p.V179V|CNTN1_uc001rmn.1_Silent_p.V168V|CNTN1_uc001rmo.2_Silent_p.V179V	p.V179V	NM_001843	NP_001834	Q12860	CNTN1_HUMAN			7	650	+	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)	179			Ig-like C2-type 2.		A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Silent	SNP	ENST00000551295.2	37	c.537A>G	CCDS8737.1																																																																																				0.363	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403692.2	NM_001843		13	67	0	0	0	0.001368	0	13	67				
DDN	23109	broad.mit.edu	37	12	49391858	49391858	+	Silent	SNP	C	C	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr12:49391858C>T	ENST00000421952.2	-	2	822	c.801G>A	c.(799-801)ggG>ggA	p.G267G	RP11-386G11.5_ENST00000547866.1_RNA|RP11-386G11.5_ENST00000552284.1_RNA|RP11-386G11.3_ENST00000549516.1_RNA|RP11-386G11.5_ENST00000547395.1_RNA|RP11-386G11.5_ENST00000552933.1_RNA	NM_015086.1	NP_055901.2	O94850	DEND_HUMAN	dendrin	267						cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.G213G(1)		NS(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|stomach(1)	8						TCTTTGTGCGCCCTCCGTCTG	0.647																																							uc001rsv.1		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)	1						c.(799-801)GGG>GGA		dendrin							48.0	56.0	53.0					12																	49391858		2202	4298	6500	SO:0001819	synonymous_variant	23109					dendritic spine membrane|endoplasmic reticulum membrane|nucleus|perikaryon		g.chr12:49391858C>T	AB018292	CCDS31791.2	12q13	2008-02-05			ENSG00000181418	ENSG00000181418			24458	protein-coding gene	gene with protein product		610588					Standard	NM_015086		Approved	KIAA0749	uc001rsv.1	O94850	OTTHUMG00000156183	ENST00000421952.2:c.801G>A	12.37:g.49391858C>T						uc001rsw.2_5'Flank	p.G267G	NM_015086	NP_055901	O94850	DEND_HUMAN			2	819	-			267						Silent	SNP	ENST00000421952.2	37	c.801G>A	CCDS31791.2																																																																																				0.647	DDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343335.1			14	83	0	0	0	0.004007	0	14	83				
KRT74	121391	broad.mit.edu	37	12	52967091	52967091	+	Splice_Site	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr12:52967091C>A	ENST00000305620.2	-	1	518	c.471G>T	c.(469-471)aaG>aaT	p.K157N	KRT74_ENST00000549343.1_Splice_Site_p.K157N	NM_175053.3	NP_778223.2	Q7RTS7	K2C74_HUMAN	keratin 74	157	Coil 1A.|Rod.				intermediate filament cytoskeleton organization (GO:0045104)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	keratin filament binding (GO:1990254)|structural molecule activity (GO:0005198)	p.K157N(1)		kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	28				BRCA - Breast invasive adenocarcinoma(357;0.191)		TGAGACCCACCTTGTCAATGA	0.592																																							uc001sap.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(469-471)AAG>AAT		keratin 6 irs4							103.0	96.0	99.0					12																	52967091		2203	4300	6503	SO:0001630	splice_region_variant	121391					keratin filament	structural molecule activity	g.chr12:52967091C>A	BK000977	CCDS8832.1	12q13.13	2013-06-25			ENSG00000170484	ENSG00000170484		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28929	protein-coding gene	gene with protein product		608248				12648212, 16831889	Standard	NM_175053		Approved	K6IRS4, KRT5C, KRT6IRS4	uc001sap.1	Q7RTS7	OTTHUMG00000169658	ENST00000305620.2:c.471+1G>T	12.37:g.52967091C>A							p.K157N	NM_175053	NP_778223	Q7RTS7	K2C74_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.191)	1	519	-			157			Coil 1A.|Rod.		B5MD61|Q86Y45	Missense_Mutation	SNP	ENST00000305620.2	37	c.471G>T	CCDS8832.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.405287	0.83230	.	.	ENSG00000170484	ENST00000549343;ENST00000305620	D;D	0.93953	-3.32;-3.32	4.4	4.4	0.53042	Filament (1);	0.000000	0.35805	N	0.002970	D	0.98229	0.9414	H	0.98951	4.38	0.58432	D	0.999991	D	0.89917	1.0	D	0.79108	0.992	D	0.99844	1.1064	9	.	.	.	.	17.8793	0.88835	0.0:1.0:0.0:0.0	.	157	Q7RTS7	K2C74_HUMAN	N	157	ENSP00000447447:K157N;ENSP00000307240:K157N	.	K	-	3	2	KRT74	51253358	1.000000	0.71417	0.999000	0.59377	0.751000	0.42716	7.773000	0.85462	2.383000	0.81215	0.561000	0.74099	AAG		0.592	KRT74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405324.1	NM_175053	Missense_Mutation	11	98	1	0	5.50884e-06	0.001368	6.55925e-06	11	98				
TMTC3	160418	broad.mit.edu	37	12	88566501	88566501	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr12:88566501G>T	ENST00000266712.6	+	8	1398	c.1178G>T	c.(1177-1179)tGg>tTg	p.W393L		NM_181783.3	NP_861448.2	Q6ZXV5	TMTC3_HUMAN	transmembrane and tetratricopeptide repeat containing 3	393					bud outgrowth involved in lung branching (GO:0060447)|lung alveolus development (GO:0048286)|muscle fiber development (GO:0048747)|post-embryonic development (GO:0009791)|regulation of gene expression (GO:0010468)	integral component of membrane (GO:0016021)				NS(1)|breast(2)|endometrium(1)|kidney(4)|large_intestine(5)|liver(1)|lung(12)|prostate(4)|skin(1)	31						GCCCATGGATGGCAGAAAATA	0.343																																							uc001tau.2		NA																	0				skin(1)	1						c.(1177-1179)TGG>TTG		transmembrane and tetratricopeptide repeat							105.0	100.0	102.0					12																	88566501		2203	4299	6502	SO:0001583	missense	160418					integral to membrane	binding	g.chr12:88566501G>T		CCDS9032.1	12q21.32	2014-09-04			ENSG00000139324	ENSG00000139324		"""Tetratricopeptide (TTC) repeat domain containing"""	26899	protein-coding gene	gene with protein product							Standard	NM_181783		Approved	FLJ90492, SMILE	uc001tau.3	Q6ZXV5	OTTHUMG00000169887	ENST00000266712.6:c.1178G>T	12.37:g.88566501G>T	ENSP00000266712:p.Trp393Leu					TMTC3_uc009zsm.2_RNA	p.W393L	NM_181783	NP_861448	Q6ZXV5	TMTC3_HUMAN			8	1398	+			393			Helical; (Potential).		Q5CZ86|Q5H9T6|Q68DQ6|Q68DX0|Q7Z332|Q8NC50	Missense_Mutation	SNP	ENST00000266712.6	37	c.1178G>T	CCDS9032.1	.	.	.	.	.	.	.	.	.	.	G	15.80	2.940419	0.52972	.	.	ENSG00000139324	ENST00000266712	T	0.39406	1.08	5.54	5.54	0.83059	.	0.105891	0.64402	D	0.000002	T	0.32224	0.0822	N	0.22421	0.69	0.58432	D	0.999997	B	0.06786	0.001	B	0.11329	0.006	T	0.10245	-1.0638	10	0.15499	T	0.54	-4.1877	19.4846	0.95024	0.0:0.0:1.0:0.0	.	393	Q6ZXV5-2	.	L	393	ENSP00000266712:W393L	ENSP00000266712:W393L	W	+	2	0	TMTC3	87090632	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.056000	0.76662	2.586000	0.87340	0.650000	0.86243	TGG		0.343	TMTC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406421.1	NM_181783		14	89	1	0	1.05317e-09	0.00245	1.43661e-09	14	89				
KERA	11081	broad.mit.edu	37	12	91449623	91449623	+	Nonsense_Mutation	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr12:91449623G>A	ENST00000266719.3	-	2	683	c.436C>T	c.(436-438)Caa>Taa	p.Q146*		NM_007035.3	NP_008966.1	O60938	KERA_HUMAN	keratocan	146					carbohydrate metabolic process (GO:0005975)|cornea development in camera-type eye (GO:0061303)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|response to stimulus (GO:0050896)|small molecule metabolic process (GO:0044281)|visual perception (GO:0007601)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)		p.Q146*(1)		breast(2)|large_intestine(8)|lung(5)|prostate(2)|skin(2)	19						AATTGTAATTGTTCTAAACTT	0.408																																							uc001tbl.2		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(1)	1						c.(436-438)CAA>TAA		keratocan precursor							110.0	107.0	108.0					12																	91449623		2201	4295	6496	SO:0001587	stop_gained	11081				response to stimulus|visual perception	proteinaceous extracellular matrix		g.chr12:91449623G>A	AF063301	CCDS9037.1	12q21.3-q22	2014-09-17				ENSG00000139330		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	6309	protein-coding gene	gene with protein product	"""keratocan proteoglycan"""	603288		CNA2		10565548, 10802664	Standard	NM_007035		Approved	SLRR2B	uc001tbl.3	O60938		ENST00000266719.3:c.436C>T	12.37:g.91449623G>A	ENSP00000266719:p.Gln146*						p.Q146*	NM_007035	NP_008966	O60938	KERA_HUMAN			2	1055	-			146			LRR 4.			Nonsense_Mutation	SNP	ENST00000266719.3	37	c.436C>T	CCDS9037.1	.	.	.	.	.	.	.	.	.	.	G	38	7.096199	0.98059	.	.	ENSG00000139330	ENST00000266719	.	.	.	6.08	6.08	0.98989	.	0.052358	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-20.8363	20.6634	0.99662	0.0:0.0:1.0:0.0	.	.	.	.	X	146	.	ENSP00000266719:Q146X	Q	-	1	0	KERA	89973754	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.476000	0.97823	2.894000	0.99253	0.655000	0.94253	CAA		0.408	KERA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407149.2	NM_007035		14	148	0	0	0	0.001855	0	14	148				
KERA	11081	broad.mit.edu	37	12	91449625	91449625	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr12:91449625T>C	ENST00000266719.3	-	2	681	c.434A>G	c.(433-435)gAa>gGa	p.E145G		NM_007035.3	NP_008966.1	O60938	KERA_HUMAN	keratocan	145					carbohydrate metabolic process (GO:0005975)|cornea development in camera-type eye (GO:0061303)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|response to stimulus (GO:0050896)|small molecule metabolic process (GO:0044281)|visual perception (GO:0007601)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)		p.E145G(1)		breast(2)|large_intestine(8)|lung(5)|prostate(2)|skin(2)	19						TTGTAATTGTTCTAAACTTCT	0.403																																							uc001tbl.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(433-435)GAA>GGA		keratocan precursor							110.0	107.0	108.0					12																	91449625		2201	4295	6496	SO:0001583	missense	11081				response to stimulus|visual perception	proteinaceous extracellular matrix		g.chr12:91449625T>C	AF063301	CCDS9037.1	12q21.3-q22	2014-09-17				ENSG00000139330		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	6309	protein-coding gene	gene with protein product	"""keratocan proteoglycan"""	603288		CNA2		10565548, 10802664	Standard	NM_007035		Approved	SLRR2B	uc001tbl.3	O60938		ENST00000266719.3:c.434A>G	12.37:g.91449625T>C	ENSP00000266719:p.Glu145Gly						p.E145G	NM_007035	NP_008966	O60938	KERA_HUMAN			2	1053	-			145			LRR 4.			Missense_Mutation	SNP	ENST00000266719.3	37	c.434A>G	CCDS9037.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.390629	0.82902	.	.	ENSG00000139330	ENST00000266719	T	0.59502	0.26	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.75012	0.3792	M	0.68593	2.085	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.75955	-0.3135	10	0.54805	T	0.06	-24.6326	16.6438	0.85155	0.0:0.0:0.0:1.0	.	145	O60938	KERA_HUMAN	G	145	ENSP00000266719:E145G	ENSP00000266719:E145G	E	-	2	0	KERA	89973756	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.698000	0.84413	2.333000	0.79357	0.533000	0.62120	GAA		0.403	KERA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407149.2	NM_007035		14	148	0	0	0	0.00245	0	14	148				
CEP83	51134	broad.mit.edu	37	12	94794689	94794689	+	Missense_Mutation	SNP	A	A	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr12:94794689A>C	ENST00000397809.5	-	6	1035	c.486T>G	c.(484-486)ttT>ttG	p.F162L	CCDC41_ENST00000547575.1_Missense_Mutation_p.F162L|CCDC41_ENST00000339839.5_Missense_Mutation_p.F162L|CCDC41_ENST00000549352.1_5'UTR|CCDC41_ENST00000397807.2_Missense_Mutation_p.F129L	NM_016122.2	NP_057206.2	Q9Y592	CEP83_HUMAN		154					cilium assembly (GO:0042384)|protein localization to centrosome (GO:0071539)|vesicle docking (GO:0048278)	centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|Golgi apparatus (GO:0005794)		p.F162L(1)		breast(1)|central_nervous_system(3)|kidney(3)|large_intestine(8)|lung(8)|prostate(2)|skin(2)	27						TCTGGTGTTCAAATTCTGACT	0.308																																							uc001tdd.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(484-486)TTT>TTG		NY-REN-58 antigen							113.0	107.0	109.0					12																	94794689		1810	4064	5874	SO:0001583	missense	51134							g.chr12:94794689A>C																												ENST00000397809.5:c.486T>G	12.37:g.94794689A>C	ENSP00000380911:p.Phe162Leu					CCDC41_uc001tde.2_Missense_Mutation_p.F162L|CCDC41_uc009zsw.1_RNA|CCDC41_uc001tdf.2_Missense_Mutation_p.F162L	p.F162L	NM_016122	NP_057206	Q9Y592	CCD41_HUMAN			6	1072	-			154			Potential.		A4FVB1|Q08AP1	Missense_Mutation	SNP	ENST00000397809.5	37	c.486T>G	CCDS41820.1	.	.	.	.	.	.	.	.	.	.	A	18.60	3.658934	0.67586	.	.	ENSG00000173588	ENST00000339839;ENST00000397809;ENST00000397807;ENST00000547575	T;T;T;T	0.53206	0.72;0.72;0.67;0.63	5.85	3.39	0.38822	.	.	.	.	.	T	0.56202	0.1969	M	0.63843	1.955	0.40911	D	0.984237	D;D;D	0.76494	0.999;0.999;0.998	D;D;D	0.76071	0.981;0.981;0.987	T	0.61103	-0.7130	9	0.02654	T	1	-12.8374	9.5545	0.39330	0.8444:0.0:0.1556:0.0	.	162;129;154	F8VYN8;Q9Y592-2;Q9Y592	.;.;CCD41_HUMAN	L	162;162;129;162	ENSP00000344655:F162L;ENSP00000380911:F162L;ENSP00000380909:F129L;ENSP00000448913:F162L	ENSP00000344655:F162L	F	-	3	2	CCDC41	93318820	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.895000	0.56258	0.423000	0.26033	0.528000	0.53228	TTT		0.308	CCDC41-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408147.3			14	116	0	0	0	0.00245	0	14	116				
GAS2L3	283431	broad.mit.edu	37	12	101017690	101017690	+	Silent	SNP	C	C	A	rs149531123		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr12:101017690C>A	ENST00000539410.1	+	9	1493	c.1107C>A	c.(1105-1107)gtC>gtA	p.V369V	GAS2L3_ENST00000537247.1_Silent_p.V265V|GAS2L3_ENST00000266754.5_Silent_p.V369V|GAS2L3_ENST00000547754.1_Silent_p.V369V			Q86XJ1	GA2L3_HUMAN	growth arrest-specific 2 like 3	369					actin cytoskeleton organization (GO:0030036)|cell cycle arrest (GO:0007050)|microtubule cytoskeleton organization (GO:0000226)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	actin binding (GO:0003779)|microtubule binding (GO:0008017)	p.V369V(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(15)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	35						CTATGTCAGTCCGTTCTAAAT	0.453																																							uc001thu.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(1105-1107)GTC>GTA		growth arrest-specific 2 like 3							106.0	102.0	103.0					12																	101017690		2203	4300	6503	SO:0001819	synonymous_variant	283431				cell cycle arrest			g.chr12:101017690C>A	AK095594	CCDS9079.1	12q23.1	2014-09-11			ENSG00000139354	ENSG00000139354			27475	protein-coding gene	gene with protein product							Standard	NM_174942		Approved		uc001thu.3	Q86XJ1	OTTHUMG00000170439	ENST00000539410.1:c.1107C>A	12.37:g.101017690C>A						GAS2L3_uc009zty.2_Silent_p.V369V|GAS2L3_uc001thv.2_Silent_p.V265V	p.V369V	NM_174942	NP_777602	Q86XJ1	GA2L3_HUMAN			10	1333	+			369					B2RCN2	Silent	SNP	ENST00000539410.1	37	c.1107C>A	CCDS9079.1																																																																																				0.453	GAS2L3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409143.1	NM_174942		40	115	1	0	9.85913e-13	0.009718	1.44292e-12	40	115				
CCDC53	51019	broad.mit.edu	37	12	102433651	102433651	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr12:102433651G>C	ENST00000240079.6	-	5	591	c.430C>G	c.(430-432)Caa>Gaa	p.Q144E	CCDC53_ENST00000545679.1_Missense_Mutation_p.Q143E|CCDC53_ENST00000539515.1_5'UTR	NM_016053.2	NP_057137.1	Q9Y3C0	CCD53_HUMAN	coiled-coil domain containing 53	144						actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|WASH complex (GO:0071203)		p.Q144E(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(1)	4						CTTACCACTTGAACCATTTTG	0.383																																							uc010svw.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(430-432)CAA>GAA		coiled-coil domain containing 53							206.0	192.0	196.0					12																	102433651		1861	4116	5977	SO:0001583	missense	51019					WASH complex	protein binding	g.chr12:102433651G>C	AF151874	CCDS44959.1, CCDS73512.1	12q23.3	2014-05-09			ENSG00000120860	ENSG00000120860			24256	protein-coding gene	gene with protein product						10810093, 20498093	Standard	XM_005268939		Approved	CGI-116	uc010svw.2	Q9Y3C0	OTTHUMG00000168187	ENST00000240079.6:c.430C>G	12.37:g.102433651G>C	ENSP00000240079:p.Gln144Glu					CCDC53_uc010svx.1_RNA|CCDC53_uc010svy.1_RNA|CCDC53_uc010svz.1_Missense_Mutation_p.Q143E	p.Q144E	NM_016053	NP_057137	Q9Y3C0	CCD53_HUMAN			5	589	-			144					B2RC74|Q53FF0|Q6IAI4|Q96QK0	Missense_Mutation	SNP	ENST00000240079.6	37	c.430C>G	CCDS44959.1	.	.	.	.	.	.	.	.	.	.	G	17.20	3.329164	0.60743	.	.	ENSG00000120860	ENST00000240079;ENST00000545679	.	.	.	5.82	5.82	0.92795	.	0.048634	0.85682	D	0.000000	T	0.63710	0.2534	M	0.79614	2.46	0.80722	D	1	P;P	0.48998	0.9;0.918	B;B	0.43990	0.407;0.438	T	0.65602	-0.6128	9	0.37606	T	0.19	-14.7738	17.0794	0.86594	0.0:0.0:1.0:0.0	.	143;144	F5GZ97;Q9Y3C0	.;CCD53_HUMAN	E	144;143	.	ENSP00000240079:Q144E	Q	-	1	0	CCDC53	100957781	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.385000	0.79763	2.767000	0.95098	0.644000	0.83932	CAA		0.383	CCDC53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398685.1	NM_016053		21	169	0	0	0	0.00333	0	21	169				
FZD10	11211	broad.mit.edu	37	12	130647951	130647951	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr12:130647951C>G	ENST00000229030.4	+	1	948	c.464C>G	c.(463-465)tCg>tGg	p.S155W	FZD10-AS1_ENST00000505807.2_RNA|FZD10_ENST00000539839.1_Silent_p.L122L			Q9ULW2	FZD10_HUMAN	frizzled class receptor 10	155					brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|gonad development (GO:0008406)|negative regulation of Rho GTPase activity (GO:0034259)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of actin cytoskeleton organization (GO:0032956)|vasculature development (GO:0001944)	cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.S155W(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|pancreas(1)|prostate(3)|urinary_tract(1)	35	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.3e-06)|Epithelial(86;1.66e-05)|all cancers(50;5.18e-05)		AACAACGGCTCGGACGAGCCC	0.697																																							uc001uii.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|breast(1)|central_nervous_system(1)	5						c.(463-465)TCG>TGG		frizzled 10 precursor							38.0	40.0	39.0					12																	130647951		2202	4298	6500	SO:0001583	missense	11211				brain development|canonical Wnt receptor signaling pathway|cellular response to retinoic acid|embryo development|gonad development|negative regulation of Rho GTPase activity|neuron differentiation|non-canonical Wnt receptor signaling pathway|positive regulation of JUN kinase activity|positive regulation of Rac GTPase activity|regulation of actin cytoskeleton organization|vasculature development	cell projection|cell surface|cytoplasm|integral to plasma membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding	g.chr12:130647951C>G	AB027464	CCDS9267.1	12q24.33	2014-01-29	2014-01-29			ENSG00000111432		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4039	protein-coding gene	gene with protein product		606147	"""frizzled (Drosophila) homolog 10"", ""frizzled homolog 10 (Drosophila)"", ""frizzled 10, seven transmembrane spanning receptor"", ""frizzled family receptor 10"""			10448064	Standard	NM_007197		Approved	CD350	uc001uii.3	Q9ULW2		ENST00000229030.4:c.464C>G	12.37:g.130647951C>G	ENSP00000229030:p.Ser155Trp					uc001uig.1_5'Flank|uc001uih.1_5'Flank	p.S155W	NM_007197	NP_009128	Q9ULW2	FZD10_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;1.3e-06)|Epithelial(86;1.66e-05)|all cancers(50;5.18e-05)	1	920	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		155			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000229030.4	37	c.464C>G	CCDS9267.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.307510	0.81247	.	.	ENSG00000111432	ENST00000229030	T	0.78595	-1.19	5.03	5.03	0.67393	.	0.091235	0.46442	U	0.000290	T	0.80544	0.4643	L	0.44542	1.39	0.80722	D	1	D	0.57571	0.98	P	0.52881	0.712	T	0.83121	-0.0118	10	0.72032	D	0.01	.	18.3422	0.90309	0.0:1.0:0.0:0.0	.	155	Q9ULW2	FZD10_HUMAN	W	155	ENSP00000229030:S155W	ENSP00000229030:S155W	S	+	2	0	FZD10	129213904	1.000000	0.71417	0.998000	0.56505	0.931000	0.56810	5.643000	0.67895	2.318000	0.78349	0.561000	0.74099	TCG		0.697	FZD10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				4	67	0	0	0	0.009096	0	4	67				
ULK1	8408	broad.mit.edu	37	12	132401562	132401562	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr12:132401562G>T	ENST00000321867.4	+	21	2488	c.2137G>T	c.(2137-2139)Gac>Tac	p.D713Y	ULK1_ENST00000540647.1_5'Flank	NM_003565.2	NP_003556	O75385	ULK1_HUMAN	unc-51 like autophagy activating kinase 1	713					autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|cellular response to nutrient levels (GO:0031669)|cerebellar granule cell differentiation (GO:0021707)|negative regulation of collateral sprouting (GO:0048671)|neuron projection development (GO:0031175)|neuron projection regeneration (GO:0031102)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|protein autophosphorylation (GO:0046777)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|radial glia guided migration of cerebellar granule cell (GO:0021933)|Ras protein signal transduction (GO:0007265)|receptor internalization (GO:0031623)|regulation of autophagy (GO:0010506)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|response to starvation (GO:0042594)	ATG1/UKL1 signaling complex (GO:0034273)|autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extrinsic component of autophagic vacuole membrane (GO:0097635)|extrinsic component of omegasome membrane (GO:0097629)|extrinsic component of pre-autophagosomal structure membrane (GO:0097632)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)	ATP binding (GO:0005524)|protein complex binding (GO:0032403)|protein serine/threonine kinase activity (GO:0004674)|Rab GTPase binding (GO:0017137)	p.D713Y(1)		breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	29	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)		ACAAGCCCCGGACCCGGGCAG	0.677																																							uc001uje.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4						c.(2137-2139)GAC>TAC		Unc-51-like kinase 1							32.0	42.0	39.0					12																	132401562		2193	4291	6484	SO:0001583	missense	8408				autophagy|protein localization|regulation of autophagy	autophagic vacuole|cytosol|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	ATP binding|protein complex binding|protein serine/threonine kinase activity	g.chr12:132401562G>T	AF045458	CCDS9274.1	12q24.3	2014-02-12	2013-07-02		ENSG00000177169	ENSG00000177169			12558	protein-coding gene	gene with protein product	"""ATG1 autophagy related 1 homolog (S. cerevisiae)"""	603168	"""unc-51 (C. elegans)-like kinase 1"", ""unc-51-like kinase 1 (C. elegans)"""			9693035	Standard	NM_003565		Approved	ATG1, ATG1A	uc001uje.3	O75385	OTTHUMG00000168052	ENST00000321867.4:c.2137G>T	12.37:g.132401562G>T	ENSP00000324560:p.Asp713Tyr						p.D713Y	NM_003565	NP_003556	O75385	ULK1_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)	21	2405	+	all_neural(191;0.0982)|Medulloblastoma(191;0.163)		713					Q9UQ28	Missense_Mutation	SNP	ENST00000321867.4	37	c.2137G>T	CCDS9274.1	.	.	.	.	.	.	.	.	.	.	g	15.53	2.860572	0.51482	.	.	ENSG00000177169	ENST00000321867;ENST00000541761	T;T	0.54479	0.57;0.57	5.06	4.17	0.49024	.	0.180783	0.47455	D	0.000230	T	0.54919	0.1888	L	0.56769	1.78	0.80722	D	1	D	0.53151	0.958	P	0.47827	0.558	T	0.56529	-0.7964	10	0.40728	T	0.16	-36.7732	13.638	0.62233	0.0755:0.0:0.9245:0.0	.	713	O75385	ULK1_HUMAN	Y	713;61	ENSP00000324560:D713Y;ENSP00000444298:D61Y	ENSP00000324560:D713Y	D	+	1	0	ULK1	130967515	1.000000	0.71417	0.362000	0.25862	0.006000	0.05464	6.830000	0.75319	1.259000	0.44117	0.556000	0.70494	GAC		0.677	ULK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397769.3			29	68	1	0	5.45727e-16	0.008361	8.3342e-16	29	68				
NBEA	26960	broad.mit.edu	37	13	35630253	35630253	+	Missense_Mutation	SNP	T	T	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr13:35630253T>G	ENST00000400445.3	+	7	1613	c.1079T>G	c.(1078-1080)gTt>gGt	p.V360G	NBEA_ENST00000310336.4_Missense_Mutation_p.V360G|NBEA_ENST00000379939.2_Missense_Mutation_p.V360G|NBEA_ENST00000540320.1_Missense_Mutation_p.V360G	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	360					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)		p.V360G(1)		NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		GCTTGGCATGTTAACACAAAT	0.313																																							uc001uvb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(9)|large_intestine(2)	11						c.(1078-1080)GTT>GGT		neurobeachin							163.0	155.0	157.0					13																	35630253		1858	4094	5952	SO:0001583	missense	26960					cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding	g.chr13:35630253T>G	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.1079T>G	13.37:g.35630253T>G	ENSP00000383295:p.Val360Gly						p.V360G	NM_015678	NP_056493	Q8NFP9	NBEA_HUMAN		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)	8	1285	+		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)	360					B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	ENST00000400445.3	37	c.1079T>G	CCDS45026.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.131613	0.77662	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336	T;T;T;T	0.64803	-0.12;-0.12;-0.12;-0.12	4.58	4.58	0.56647	.	0.000000	0.64402	D	0.000003	T	0.77745	0.4176	M	0.74258	2.255	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.79505	-0.1776	10	0.49607	T	0.09	.	14.2302	0.65887	0.0:0.0:0.0:1.0	.	360	Q5T321	.	G	360	ENSP00000440951:V360G;ENSP00000383295:V360G;ENSP00000369271:V360G;ENSP00000308534:V360G	ENSP00000308534:V360G	V	+	2	0	NBEA	34528253	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.997000	0.88414	1.837000	0.53436	0.460000	0.39030	GTT		0.313	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678		17	50	0	0	0	0.00499	0	17	50				
SETDB2	83852	broad.mit.edu	37	13	50038170	50038170	+	Missense_Mutation	SNP	A	A	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr13:50038170A>C	ENST00000317257.8	+	5	1047	c.222A>C	c.(220-222)aaA>aaC	p.K74N	SETDB2_ENST00000354234.4_Intron|SETDB2_ENST00000258672.5_Intron	NM_031915.2	NP_114121.2	Q96T68	SETB2_HUMAN	SET domain, bifurcated 2	74					chromosome segregation (GO:0007059)|heart looping (GO:0001947)|histone H3-K9 methylation (GO:0051567)|left/right axis specification (GO:0070986)|mitotic nuclear division (GO:0007067)|negative regulation of transcription, DNA-templated (GO:0045892)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|zinc ion binding (GO:0008270)	p.K74N(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	15		Lung NSC(96;0.000408)|Breast(56;0.00131)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;3.1e-09)		catcacagaaagaagtgaatg	0.418																																							uc001vcz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(220-222)AAA>AAC		SET domain, bifurcated 2 isoform a							55.0	51.0	52.0					13																	50038170		2203	4300	6503	SO:0001583	missense	83852				cell division|chromosome segregation|heart looping|left/right axis specification|mitosis|negative regulation of transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone methyltransferase activity (H3-K9 specific)|zinc ion binding	g.chr13:50038170A>C	AF334407	CCDS9417.1, CCDS53868.1	13q14	2011-07-01	2003-05-06	2003-05-09	ENSG00000136169	ENSG00000136169		"""Chromatin-modifying enzymes / K-methyltransferases"""	20263	protein-coding gene	gene with protein product		607865	"""chromosome 13 open reading frame 4"""	C13orf4		11306461	Standard	NM_031915		Approved	CLLD8, CLLL8, KMT1F	uc001vda.3	Q96T68	OTTHUMG00000016918	ENST00000317257.8:c.222A>C	13.37:g.50038170A>C	ENSP00000326477:p.Lys74Asn					SETDB2_uc010adg.2_Intron|SETDB2_uc001vcy.3_Intron|SETDB2_uc010adh.2_Intron|SETDB2_uc001vda.2_Intron	p.K74N	NM_031915	NP_114121	Q96T68	SETB2_HUMAN	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;3.1e-09)	5	1128	+		Lung NSC(96;0.000408)|Breast(56;0.00131)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	74					Q5TC65|Q5TC66|Q5W0A7|Q659A7|Q86UD6|Q96AI6	Missense_Mutation	SNP	ENST00000317257.8	37	c.222A>C	CCDS9417.1	.	.	.	.	.	.	.	.	.	.	A	8.442	0.851039	0.17034	.	.	ENSG00000136169	ENST00000317257	D	0.86366	-2.11	1.9	1.9	0.25705	.	1.853350	0.02911	N	0.136663	T	0.77545	0.4146	N	0.19112	0.55	0.09310	N	0.99999	B	0.12013	0.005	B	0.04013	0.001	T	0.62835	-0.6770	10	0.19590	T	0.45	.	5.8334	0.18593	1.0:0.0:0.0:0.0	.	74	Q96T68	SETB2_HUMAN	N	74	ENSP00000326477:K74N	ENSP00000326477:K74N	K	+	3	2	SETDB2	48936171	0.267000	0.24122	0.021000	0.16686	0.725000	0.41563	1.247000	0.32815	1.132000	0.42129	0.491000	0.48974	AAA		0.418	SETDB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044925.1	NM_031915		7	12	0	0	0	0.00308	0	7	12				
KLHL1	57626	broad.mit.edu	37	13	70681538	70681538	+	Silent	SNP	T	T	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr13:70681538T>A	ENST00000377844.4	-	1	1053	c.294A>T	c.(292-294)ccA>ccT	p.P98P	ATXN8OS_ENST00000414504.2_RNA|ATXN8OS_ENST00000424524.1_RNA|KLHL1_ENST00000545028.1_5'UTR	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1	98					actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)	p.P98P(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		TCGTGGCAACTGGAAGCAGGG	0.592																																							uc001vip.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(292-294)CCA>CCT		kelch-like 1 protein							54.0	54.0	54.0					13																	70681538		2203	4300	6503	SO:0001819	synonymous_variant	57626				actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding	g.chr13:70681538T>A	AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.294A>T	13.37:g.70681538T>A						KLHL1_uc010thm.1_Silent_p.P98P|ATXN8OS_uc010aej.1_RNA	p.P98P	NM_020866	NP_065917	Q9NR64	KLHL1_HUMAN		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)	1	1088	-		Breast(118;0.000162)	98					A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	Silent	SNP	ENST00000377844.4	37	c.294A>T	CCDS9445.1																																																																																				0.592	KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045231.3	NM_020866		15	40	0	0	0	0.00245	0	15	40				
FOXG1	2290	broad.mit.edu	37	14	29237715	29237715	+	Silent	SNP	C	C	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr14:29237715C>T	ENST00000313071.4	+	1	1429	c.1230C>T	c.(1228-1230)ctC>ctT	p.L410L	FOXG1_ENST00000382535.3_Silent_p.L410L	NM_005249.4	NP_005240.3	P55316	FOXG1_HUMAN	forkhead box G1	410					aging (GO:0007568)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|dorsal/ventral pattern formation (GO:0009953)|inner ear morphogenesis (GO:0042472)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron fate determination (GO:0048664)|positive regulation of cell cycle (GO:0045787)|positive regulation of neuroblast proliferation (GO:0002052)|pyramidal neuron migration (GO:0021852)|regulation of mitotic cell cycle (GO:0007346)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L410L(2)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(2)	43			LUAD - Lung adenocarcinoma(48;0.011)|Lung(238;0.0575)	GBM - Glioblastoma multiforme(265;0.00413)		TCAACCTGCTCGCGGGCCAGA	0.682																																							uc001wqe.2		NA																	2	Substitution - coding silent(2)		large_intestine(1)|lung(1)	ovary(2)|lung(2)	4						c.(1228-1230)CTC>CTT		forkhead box G1							49.0	40.0	43.0					14																	29237715		2203	4300	6503	SO:0001819	synonymous_variant	2290				axon midline choice point recognition|central nervous system neuron development|dorsal/ventral pattern formation|embryo development ending in birth or egg hatching|hindbrain development|inner ear morphogenesis|negative regulation of neuron differentiation|negative regulation of transcription, DNA-dependent|nonmotile primary cilium assembly|nose development|positive regulation of cell cycle|positive regulation of neuroblast proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of mitotic cell cycle|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding	g.chr14:29237715C>T		CCDS9636.1	14q11-q13	2007-10-05	2007-05-16	2007-05-16	ENSG00000176165	ENSG00000176165		"""Forkhead boxes"""	3811	protein-coding gene	gene with protein product		164874	"""forkhead box G1B"", ""forkhead box G1C"", ""forkhead box G1A"""	FKHL2, FOXG1B, FKHL4, FKH2, FKHL1, FOXG1C, FKHL3, FOXG1A		7959731, 17260156	Standard	NM_005249		Approved	HFK2, QIN, BF1, HFK1, HFK3, HBF-3	uc001wqe.4	P55316	OTTHUMG00000140187	ENST00000313071.4:c.1230C>T	14.37:g.29237715C>T							p.L410L	NM_005249	NP_005240	P55316	FOXG1_HUMAN	LUAD - Lung adenocarcinoma(48;0.011)|Lung(238;0.0575)	GBM - Glioblastoma multiforme(265;0.00413)	1	1429	+			410					A6NFY2|P55315|Q14488|Q86XT7	Silent	SNP	ENST00000313071.4	37	c.1230C>T	CCDS9636.1																																																																																				0.682	FOXG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276559.3			5	45	0	0	0	0.000602	0	5	45				
KCNH5	27133	broad.mit.edu	37	14	63175029	63175029	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr14:63175029G>T	ENST00000322893.7	-	11	2432	c.2164C>A	c.(2164-2166)Cag>Aag	p.Q722K	KCNH5_ENST00000420622.2_3'UTR	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5	722					potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)	p.Q722K(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		GTTGAGCCCTGATTCCGCAGC	0.577																																							uc001xfx.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(4)|central_nervous_system(1)	9						c.(2164-2166)CAG>AAG		potassium voltage-gated channel, subfamily H,							115.0	110.0	112.0					14																	63175029		2203	4300	6503	SO:0001583	missense	27133				regulation of transcription, DNA-dependent	integral to membrane	calmodulin binding|two-component sensor activity|voltage-gated potassium channel activity	g.chr14:63175029G>T	U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.2164C>A	14.37:g.63175029G>T	ENSP00000321427:p.Gln722Lys					KCNH5_uc001xfy.2_3'UTR	p.Q722K	NM_139318	NP_647479	Q8NCM2	KCNH5_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)	11	2215	-			722			Cytoplasmic (Potential).		C9JP98	Missense_Mutation	SNP	ENST00000322893.7	37	c.2164C>A	CCDS9756.1	.	.	.	.	.	.	.	.	.	.	G	0.305	-0.971632	0.02215	.	.	ENSG00000140015	ENST00000322893	T	0.21734	1.99	5.52	5.52	0.82312	.	0.154878	0.43747	D	0.000535	T	0.19287	0.0463	L	0.44542	1.39	0.80722	D	1	B	0.09022	0.002	B	0.09377	0.004	T	0.11299	-1.0593	10	0.05959	T	0.93	.	19.4558	0.94889	0.0:0.0:1.0:0.0	.	722	Q8NCM2	KCNH5_HUMAN	K	722	ENSP00000321427:Q722K	ENSP00000321427:Q722K	Q	-	1	0	KCNH5	62244782	1.000000	0.71417	1.000000	0.80357	0.441000	0.31987	7.725000	0.84808	2.611000	0.88343	0.655000	0.94253	CAG		0.577	KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411747.1	NM_139318		14	116	1	0	9.05144e-12	0.001855	1.28783e-11	14	116				
DLK1	8788	broad.mit.edu	37	14	101201115	101201115	+	Missense_Mutation	SNP	A	A	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr14:101201115A>C	ENST00000341267.4	+	5	1276	c.1034A>C	c.(1033-1035)aAg>aCg	p.K345T	RP11-566J3.4_ENST00000608876.1_lincRNA|DLK1_ENST00000331224.6_Missense_Mutation_p.K272T	NM_003836.5	NP_003827	P80370	DLK1_HUMAN	delta-like 1 homolog (Drosophila)	345					cell differentiation (GO:0030154)|embryonic skeletal system development (GO:0048706)|multicellular organismal development (GO:0007275)|negative regulation of Notch signaling pathway (GO:0045746)|Notch signaling pathway (GO:0007219)|post-embryonic development (GO:0009791)|regulation of gene expression (GO:0010468)	external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)		p.K345T(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(16)|ovary(2)|prostate(1)|skin(1)	29		Melanoma(154;0.155)				ATGCTGCGGAAGAAGAAGAAC	0.577																																							uc001yhs.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(1)|skin(1)	4						c.(1033-1035)AAG>ACG		delta-like 1 homolog precursor							110.0	100.0	103.0					14																	101201115		2203	4300	6503	SO:0001583	missense	8788				multicellular organismal development	extracellular space|integral to membrane|soluble fraction		g.chr14:101201115A>C	U15979	CCDS9963.1	14q32	2011-12-05	2001-12-03			ENSG00000185559			2907	protein-coding gene	gene with protein product		176290	"""delta-like homolog (Drosophila)"""			8095043, 7925474	Standard	NM_003836		Approved	FA1, pG2, Pref-1, ZOG, Delta1	uc001yhs.4	P80370		ENST00000341267.4:c.1034A>C	14.37:g.101201115A>C	ENSP00000340292:p.Lys345Thr					DLK1_uc001yhu.3_Missense_Mutation_p.K272T	p.K345T	NM_003836	NP_003827	P80370	DLK1_HUMAN			5	1187	+		Melanoma(154;0.155)	345			Cytoplasmic (Potential).		P15803|Q96DW5	Missense_Mutation	SNP	ENST00000341267.4	37	c.1034A>C	CCDS9963.1	.	.	.	.	.	.	.	.	.	.	A	17.75	3.466421	0.63625	.	.	ENSG00000185559	ENST00000341267;ENST00000331224	D;D	0.88664	-2.41;-2.23	4.45	4.45	0.53987	.	0.161690	0.40728	N	0.001022	D	0.89594	0.6760	N	0.24115	0.695	0.80722	D	1	D;D	0.67145	0.996;0.974	D;P	0.75484	0.986;0.563	D	0.90483	0.4461	10	0.59425	D	0.04	.	12.9113	0.58181	1.0:0.0:0.0:0.0	.	272;345	P80370-2;P80370	.;DLK1_HUMAN	T	345;272	ENSP00000340292:K345T;ENSP00000331081:K272T	ENSP00000331081:K272T	K	+	2	0	DLK1	100270868	1.000000	0.71417	1.000000	0.80357	0.771000	0.43674	4.393000	0.59665	1.648000	0.50643	0.260000	0.18958	AAG		0.577	DLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414389.1			7	86	0	0	0	0.001984	0	7	86				
DYNC1H1	1778	broad.mit.edu	37	14	102452390	102452390	+	Nonsense_Mutation	SNP	C	C	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr14:102452390C>T	ENST00000360184.4	+	8	1992	c.1828C>T	c.(1828-1830)Cag>Tag	p.Q610*		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	610	Interaction with DYNC1I2. {ECO:0000250}.|Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)	p.Q610K(1)|p.Q610*(1)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						CCAGCTGATCCAGCGCGTGAA	0.507																																							uc001yks.2		NA																	2	Substitution - Nonsense(1)|Substitution - Missense(1)		lung(2)	ovary(7)|central_nervous_system(2)|pancreas(1)	10						c.(1828-1830)CAG>TAG		cytoplasmic dynein 1 heavy chain 1							63.0	55.0	58.0					14																	102452390		2203	4300	6503	SO:0001587	stop_gained	1778				cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding	g.chr14:102452390C>T	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.1828C>T	14.37:g.102452390C>T	ENSP00000348965:p.Gln610*						p.Q610*	NM_001376	NP_001367	Q14204	DYHC1_HUMAN			8	1992	+			610			Interaction with DYNC1I2 (By similarity).|Stem (By similarity).		B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Nonsense_Mutation	SNP	ENST00000360184.4	37	c.1828C>T	CCDS9966.1	.	.	.	.	.	.	.	.	.	.	C	41	8.574050	0.98868	.	.	ENSG00000197102	ENST00000360184	.	.	.	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	.	20.155	0.98106	0.0:1.0:0.0:0.0	.	.	.	.	X	610	.	ENSP00000348965:Q610X	Q	+	1	0	DYNC1H1	101522143	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.484000	0.81180	2.760000	0.94817	0.655000	0.94253	CAG		0.507	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376		4	41	0	0	0	0.009096	0	4	41				
OR4N3P	390539	broad.mit.edu	37	15	22414180	22414180	+	IGR	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr15:22414180G>T								RP11-69H14.6 (30372 upstream) : RP11-2F9.4 (19709 downstream)																							ATGTCCACATGCACCACCCAT	0.488																																							uc001yuf.2		NA																	0					0						c.(478-480)TGC>TTC		RecName: Full=Olfactory receptor 4N2; AltName: Full=Olfactory receptor OR14-8; AltName: Full=Olfactory receptor OR14-13;																																				SO:0001628	intergenic_variant	390539							g.chr15:22414180G>T																													15.37:g.22414180G>T							p.C160F	NM_001080841	NP_001074310					1	479	+									Missense_Mutation	SNP		37	c.479G>T																																																																																				0	0.488									29	186	1	0	9.78306e-22	0.009535	1.58446e-21	29	186				
TJP1	7082	broad.mit.edu	37	15	30024944	30024944	+	Silent	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr15:30024944G>A	ENST00000346128.6	-	14	2286	c.1812C>T	c.(1810-1812)ttC>ttT	p.F604F	TJP1_ENST00000356107.6_Silent_p.F604F|TJP1_ENST00000545208.2_Silent_p.F604F|TJP1_ENST00000400011.2_Silent_p.F608F	NM_003257.3|NM_175610.2	NP_003248.3|NP_783297.2	Q07157	ZO1_HUMAN	tight junction protein 1	604	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				apoptotic process (GO:0006915)|blastocyst formation (GO:0001825)|cell-cell junction assembly (GO:0007043)|cell-cell signaling involved in cell-cell junction organization (GO:1901350)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to glucose stimulus (GO:0071333)|hippo signaling (GO:0035329)|membrane organization (GO:0061024)|negative regulation of vascular permeability (GO:0043116)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to magnetism (GO:0071000)|sensory perception of sound (GO:0007605)	apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gap junction (GO:0005921)|intercalated disc (GO:0014704)|intercellular canaliculus (GO:0046581)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)		p.F604F(1)		breast(4)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(1)	68		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		GAAGACCTCTGAATCTCCAGA	0.453																																					Melanoma(77;681 1843 6309 6570)	Melanoma(77;681 1843 6309 6570)	uc001zcr.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|central_nervous_system(1)|pancreas(1)	6						c.(1810-1812)TTC>TTT		tight junction protein 1 isoform a							58.0	57.0	57.0					15																	30024944		1835	4083	5918	SO:0001819	synonymous_variant	7082				cell-cell junction assembly|cellular component disassembly involved in apoptosis	basolateral plasma membrane|cell-cell adherens junction|Golgi apparatus|tight junction		g.chr15:30024944G>A		CCDS42007.1, CCDS45199.1, CCDS73702.1	15q13	2012-07-12	2012-07-12		ENSG00000104067	ENSG00000104067			11827	protein-coding gene	gene with protein product	"""zona occludens 1"", ""tight junction protein ZO-1"""	601009				8825647	Standard	XM_005254616		Approved	ZO-1, MGC133289, DKFZp686M05161	uc001zcr.3	Q07157	OTTHUMG00000137397	ENST00000346128.6:c.1812C>T	15.37:g.30024944G>A						TJP1_uc010azl.2_Silent_p.F592F|TJP1_uc001zcq.2_Silent_p.F608F|TJP1_uc001zcs.2_Silent_p.F604F	p.F604F	NM_003257	NP_003248	Q07157	ZO1_HUMAN		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)	14	2287	-		all_lung(180;7.48e-11)|Breast(32;0.000153)	604			Guanylate kinase-like.		B4E3K1|Q2NKP3|Q4ZGJ6	Silent	SNP	ENST00000346128.6	37	c.1812C>T	CCDS42007.1																																																																																				0.453	TJP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268237.3	NM_003257		23	40	0	0	0	0.001882	0	23	40				
CHRNA7	1139	broad.mit.edu	37	15	32450697	32450697	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr15:32450697G>T	ENST00000306901.3	+	7	780	c.683G>T	c.(682-684)cGc>cTc	p.R228L	CHRNA7_ENST00000454250.3_Missense_Mutation_p.R257L|CHRNA7_ENST00000455693.2_Missense_Mutation_p.R47L	NM_000746.5	NP_000737.1	P36544	ACHA7_HUMAN	cholinergic receptor, nicotinic, alpha 7 (neuronal)	228					activation of MAPK activity (GO:0000187)|associative learning (GO:0008306)|B cell activation (GO:0042113)|behavioral response to ethanol (GO:0048149)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cellular calcium ion homeostasis (GO:0006874)|cognition (GO:0050890)|dopamine biosynthetic process (GO:0042416)|endocytosis (GO:0006897)|generation of ovulation cycle rhythm (GO:0060112)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|memory (GO:0007613)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of tumor necrosis factor production (GO:0032720)|neuronal action potential (GO:0019228)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart rate involved in baroreceptor response to decreased systemic arterial blood pressure (GO:0001988)|regulation of norepinephrine secretion (GO:0014061)|regulation of synaptic transmission, dopaminergic (GO:0032225)|response to food (GO:0032094)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|signal transduction (GO:0007165)|sperm motility (GO:0030317)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|T cell activation (GO:0042110)	acetylcholine-gated channel complex (GO:0005892)|apical plasma membrane (GO:0016324)|asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|external side of plasma membrane (GO:0009897)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|acetylcholine-gated cation channel activity (GO:0022848)|beta-amyloid binding (GO:0001540)|chloride channel regulator activity (GO:0017081)|drug binding (GO:0008144)|protein homodimerization activity (GO:0042803)|toxic substance binding (GO:0015643)	p.R138L(1)|p.R228L(1)		endometrium(3)|large_intestine(1)|lung(6)|ovary(2)	12		all_lung(180;6.35e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)	ACCATGCGCCGCAGGACGCTC	0.592																																					Esophageal Squamous(193;529 2900 40232 43193)	Esophageal Squamous(193;529 2900 40232 43193)	uc001zft.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(682-684)CGC>CTC		cholinergic receptor, nicotinic, alpha 7	Nicotine(DB00184)|Varenicline(DB01273)						136.0	115.0	122.0					15																	32450697		2200	4297	6497	SO:0001583	missense	1139				activation of MAPK activity|calcium ion transport|cellular calcium ion homeostasis|memory|negative regulation of tumor necrosis factor production|positive regulation of angiogenesis|positive regulation of cell proliferation|response to hypoxia|response to nicotine	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|beta-amyloid binding|chloride channel regulator activity|nicotinic acetylcholine-activated cation-selective channel activity|protein homodimerization activity|toxin binding	g.chr15:32450697G>T	Z23141	CCDS10027.1, CCDS53924.1	15q13.3	2012-02-11	2012-02-07		ENSG00000175344	ENSG00000175344		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1960	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 7 (neuronal)"""	118511	"""cholinergic receptor, nicotinic, alpha polypeptide 7"""			8188270	Standard	NM_001190455		Approved		uc021sic.2	P36544	OTTHUMG00000129285	ENST00000306901.3:c.683G>T	15.37:g.32450697G>T	ENSP00000303727:p.Arg228Leu					uc001zfv.1_Intron|CHRNA7_uc010bae.1_RNA|CHRNA7_uc010baf.2_Missense_Mutation_p.R47L|CHRNA7_uc010baj.1_Missense_Mutation_p.R88L|CHRNA7_uc010bak.2_Missense_Mutation_p.R143L	p.R228L	NM_000746	NP_000737	P36544	ACHA7_HUMAN		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)	7	755	+		all_lung(180;6.35e-11)	228			Extracellular (Potential).		A8K7Q4|B4DFS0|Q15826|Q8IUZ4|Q96RH2|Q99555|Q9BXH0	Missense_Mutation	SNP	ENST00000306901.3	37	c.683G>T	CCDS10027.1	.	.	.	.	.	.	.	.	.	.	g	28.0	4.883867	0.91814	.	.	ENSG00000175344	ENST00000437966;ENST00000454250;ENST00000306901;ENST00000455693;ENST00000454016	D;D;D	0.96802	-4.13;-4.13;-4.13	4.51	4.51	0.55191	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.99023	0.9666	H	0.99525	4.61	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98626	1.0669	10	0.87932	D	0	.	15.1122	0.72368	0.0:0.0:1.0:0.0	.	257;124;228	B4DFS0;B1N7G6;P36544	.;.;ACHA7_HUMAN	L	138;257;228;47;152	ENSP00000407546:R257L;ENSP00000303727:R228L;ENSP00000405989:R47L	ENSP00000303727:R228L	R	+	2	0	CHRNA7	30237989	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.135000	0.94478	2.502000	0.84385	0.484000	0.47621	CGC		0.592	CHRNA7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251410.2			36	113	1	0	1.08114e-33	0.00361	1.84681e-33	36	113				
MEIS2	4212	broad.mit.edu	37	15	37184485	37184485	+	Missense_Mutation	SNP	G	G	T	rs139991974		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr15:37184485G>T	ENST00000561208.1	-	12	1741	c.1323C>A	c.(1321-1323)caC>caA	p.H441Q	MEIS2_ENST00000557796.2_3'UTR|MEIS2_ENST00000338564.5_Missense_Mutation_p.H434Q|MEIS2_ENST00000424352.2_3'UTR|MEIS2_ENST00000219869.9_3'UTR|MEIS2_ENST00000340545.5_3'UTR|MEIS2_ENST00000444725.1_3'UTR|MEIS2_ENST00000397620.2_3'UTR|MEIS2_ENST00000559085.1_3'UTR|MEIS2_ENST00000559408.1_5'Flank|MEIS2_ENST00000397624.3_3'UTR|MEIS2_ENST00000382766.2_Missense_Mutation_p.H434Q			O14770	MEIS2_HUMAN	Meis homeobox 2	441	Transcriptional activation domain.				eye development (GO:0001654)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pancreas development (GO:0031016)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to growth factor (GO:0070848)|response to mechanical stimulus (GO:0009612)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.H441H(1)|p.H441Q(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	36		all_epithelial(112;9.77e-14)|Lung NSC(122;1.42e-09)|all_lung(180;2.2e-08)|Ovarian(310;0.134)|Melanoma(134;0.155)		all cancers(64;9.33e-21)|GBM - Glioblastoma multiforme(113;1.71e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0288)		GGGGTCCTCCGTGCATCATCA	0.522																																							uc001zjr.2		NA																	2	Substitution - Missense(1)|Substitution - coding silent(1)		lung(1)|central_nervous_system(1)	ovary(2)	2						c.(1321-1323)CAC>CAA		Meis homeobox 2 isoform c							244.0	254.0	251.0					15																	37184485		2201	4297	6498	SO:0001583	missense	4212				negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity	g.chr15:37184485G>T	AF017418	CCDS10044.1, CCDS10045.1, CCDS42014.1, CCDS45217.1, CCDS45218.1, CCDS45219.1, CCDS45220.1	15q14	2011-06-20	2007-02-15		ENSG00000134138	ENSG00000134138		"""Homeoboxes / TALE class"""	7001	protein-coding gene	gene with protein product		601740	"""Meis (mouse) homolog 2"", ""Meis1, myeloid ecotropic viral integration site 1 homolog 2 (mouse)"""			9383298	Standard	NM_172315		Approved	MRG1, HsT18361	uc001zjr.4	O14770	OTTHUMG00000129781	ENST00000561208.1:c.1323C>A	15.37:g.37184485G>T	ENSP00000453793:p.His441Gln					MEIS2_uc001zjl.2_3'UTR|MEIS2_uc010ucj.1_Missense_Mutation_p.H421Q|MEIS2_uc001zjm.2_3'UTR|MEIS2_uc001zjn.2_3'UTR|MEIS2_uc001zjo.2_3'UTR|MEIS2_uc001zjp.2_3'UTR|MEIS2_uc001zjs.2_Missense_Mutation_p.H434Q|MEIS2_uc001zju.2_3'UTR|MEIS2_uc001zjt.2_Missense_Mutation_p.H434Q|MEIS2_uc001zjj.2_Missense_Mutation_p.H137Q|MEIS2_uc001zjk.2_Missense_Mutation_p.H130Q	p.H441Q	NM_170675	NP_733775	O14770	MEIS2_HUMAN		all cancers(64;9.33e-21)|GBM - Glioblastoma multiforme(113;1.71e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0288)	12	2360	-		all_epithelial(112;9.77e-14)|Lung NSC(122;1.42e-09)|all_lung(180;2.2e-08)|Ovarian(310;0.134)|Melanoma(134;0.155)	441					A6NJI5|A8MWD5|B3KP98|B3KPQ6|Q96DI2|Q96KI4|Q96KI5|Q9NRS1|Q9NRS2|Q9NRS3	Missense_Mutation	SNP	ENST00000561208.1	37	c.1323C>A	CCDS10044.1	.	.	.	.	.	.	.	.	.	.	G	11.90	1.775835	0.31411	.	.	ENSG00000134138	ENST00000314177;ENST00000338564;ENST00000382766	D;D	0.86497	-2.13;-2.13	5.72	3.85	0.44370	.	0.000000	0.85682	D	0.000000	D	0.89795	0.6818	L	0.55481	1.735	0.80722	D	1	P;D;D;P	0.62365	0.676;0.991;0.973;0.86	B;D;P;B	0.72982	0.16;0.979;0.489;0.353	D	0.88887	0.3343	10	0.56958	D	0.05	-22.3552	7.6321	0.28245	0.1434:0.1357:0.7209:0.0	.	434;441;421;137	O14770-4;O14770;B7Z6F6;Q6V703	.;MEIS2_HUMAN;.;.	Q	441;434;434	ENSP00000341400:H434Q;ENSP00000372216:H434Q	ENSP00000326296:H441Q	H	-	3	2	MEIS2	34971777	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.236000	0.43052	1.399000	0.46721	0.655000	0.94253	CAC		0.522	MEIS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252003.2	NM_170677		135	279	1	0	1.00589e-60	0.00361	1.7611e-60	135	279				
MEIS2	4212	broad.mit.edu	37	15	37184493	37184493	+	Missense_Mutation	SNP	T	T	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr15:37184493T>G	ENST00000561208.1	-	12	1733	c.1315A>C	c.(1315-1317)Atg>Ctg	p.M439L	MEIS2_ENST00000557796.2_3'UTR|MEIS2_ENST00000338564.5_Missense_Mutation_p.M432L|MEIS2_ENST00000424352.2_3'UTR|MEIS2_ENST00000219869.9_3'UTR|MEIS2_ENST00000340545.5_3'UTR|MEIS2_ENST00000444725.1_3'UTR|MEIS2_ENST00000397620.2_3'UTR|MEIS2_ENST00000559085.1_3'UTR|MEIS2_ENST00000559408.1_5'Flank|MEIS2_ENST00000397624.3_3'UTR|MEIS2_ENST00000382766.2_Missense_Mutation_p.M432L			O14770	MEIS2_HUMAN	Meis homeobox 2	439	Transcriptional activation domain.				eye development (GO:0001654)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pancreas development (GO:0031016)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to growth factor (GO:0070848)|response to mechanical stimulus (GO:0009612)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.M439L(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	36		all_epithelial(112;9.77e-14)|Lung NSC(122;1.42e-09)|all_lung(180;2.2e-08)|Ovarian(310;0.134)|Melanoma(134;0.155)		all cancers(64;9.33e-21)|GBM - Glioblastoma multiforme(113;1.71e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0288)		CCGTGCATCATCATGGCTGGG	0.512																																							uc001zjr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1315-1317)ATG>CTG		Meis homeobox 2 isoform c							247.0	256.0	253.0					15																	37184493		2201	4297	6498	SO:0001583	missense	4212				negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity	g.chr15:37184493T>G	AF017418	CCDS10044.1, CCDS10045.1, CCDS42014.1, CCDS45217.1, CCDS45218.1, CCDS45219.1, CCDS45220.1	15q14	2011-06-20	2007-02-15		ENSG00000134138	ENSG00000134138		"""Homeoboxes / TALE class"""	7001	protein-coding gene	gene with protein product		601740	"""Meis (mouse) homolog 2"", ""Meis1, myeloid ecotropic viral integration site 1 homolog 2 (mouse)"""			9383298	Standard	NM_172315		Approved	MRG1, HsT18361	uc001zjr.4	O14770	OTTHUMG00000129781	ENST00000561208.1:c.1315A>C	15.37:g.37184493T>G	ENSP00000453793:p.Met439Leu					MEIS2_uc001zjl.2_3'UTR|MEIS2_uc010ucj.1_Missense_Mutation_p.M419L|MEIS2_uc001zjm.2_3'UTR|MEIS2_uc001zjn.2_3'UTR|MEIS2_uc001zjo.2_3'UTR|MEIS2_uc001zjp.2_3'UTR|MEIS2_uc001zjs.2_Missense_Mutation_p.M432L|MEIS2_uc001zju.2_3'UTR|MEIS2_uc001zjt.2_Missense_Mutation_p.M432L|MEIS2_uc001zjj.2_Missense_Mutation_p.M135L|MEIS2_uc001zjk.2_Missense_Mutation_p.M128L	p.M439L	NM_170675	NP_733775	O14770	MEIS2_HUMAN		all cancers(64;9.33e-21)|GBM - Glioblastoma multiforme(113;1.71e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0288)	12	2352	-		all_epithelial(112;9.77e-14)|Lung NSC(122;1.42e-09)|all_lung(180;2.2e-08)|Ovarian(310;0.134)|Melanoma(134;0.155)	439					A6NJI5|A8MWD5|B3KP98|B3KPQ6|Q96DI2|Q96KI4|Q96KI5|Q9NRS1|Q9NRS2|Q9NRS3	Missense_Mutation	SNP	ENST00000561208.1	37	c.1315A>C	CCDS10044.1	.	.	.	.	.	.	.	.	.	.	T	5.627	0.300400	0.10678	.	.	ENSG00000134138	ENST00000314177;ENST00000338564;ENST00000382766	D;D	0.85339	-1.97;-1.97	5.72	4.57	0.56435	.	0.118466	0.64402	D	0.000020	T	0.71134	0.3304	N	0.13098	0.295	0.80722	D	1	B;B;B;B	0.06786	0.0;0.0;0.0;0.001	B;B;B;B	0.08055	0.001;0.0;0.0;0.003	T	0.63611	-0.6598	10	0.44086	T	0.13	-3.2363	7.133	0.25512	0.1302:0.0701:0.0:0.7997	.	432;439;419;135	O14770-4;O14770;B7Z6F6;Q6V703	.;MEIS2_HUMAN;.;.	L	439;432;432	ENSP00000341400:M432L;ENSP00000372216:M432L	ENSP00000326296:M439L	M	-	1	0	MEIS2	34971785	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.845000	0.48254	0.931000	0.37242	0.533000	0.62120	ATG		0.512	MEIS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252003.2	NM_170677		130	271	0	0	0	0.00361	0	130	271				
MAP1A	4130	broad.mit.edu	37	15	43821703	43821703	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr15:43821703C>G	ENST00000300231.5	+	4	8482	c.8032C>G	c.(8032-8034)Cca>Gca	p.P2678A	MAP1A_ENST00000399453.1_Missense_Mutation_p.P2678A|MAP1A_ENST00000382031.1_Missense_Mutation_p.P2916A			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	2678					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)	p.P2678A(1)		breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	CAAGGCAGGACCAAGTAAGTA	0.552																																							uc001zrt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(3)|pancreas(2)|skin(1)	9						c.(8032-8034)CCA>GCA		microtubule-associated protein 1A	Estramustine(DB01196)						31.0	36.0	34.0					15																	43821703		2063	4179	6242	SO:0001583	missense	4130					cytoplasm|microtubule|microtubule associated complex	protein binding|structural molecule activity	g.chr15:43821703C>G	U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.8032C>G	15.37:g.43821703C>G	ENSP00000300231:p.Pro2678Ala						p.P2678A	NM_002373	NP_002364	P78559	MAP1A_HUMAN		GBM - Glioblastoma multiforme(94;3.05e-06)	4	8499	+		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)	2678					O95643|Q12973|Q15882|Q9UJT4	Missense_Mutation	SNP	ENST00000300231.5	37	c.8032C>G	CCDS42031.1	.	.	.	.	.	.	.	.	.	.	C	1.726	-0.495422	0.04291	.	.	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231	T;T;T	0.01572	4.76;4.76;4.76	5.28	-0.318	0.12728	.	.	.	.	.	T	0.01320	0.0043	N	0.14661	0.345	0.09310	N	1	B	0.17667	0.023	B	0.17433	0.018	T	0.46470	-0.9189	9	0.62326	D	0.03	0.0629	6.1182	0.20137	0.0:0.5375:0.1316:0.3308	.	2678	P78559	MAP1A_HUMAN	A	2916;2678;2678	ENSP00000371462:P2916A;ENSP00000382380:P2678A;ENSP00000300231:P2678A	ENSP00000300231:P2678A	P	+	1	0	MAP1A	41608995	0.003000	0.15002	0.116000	0.21606	0.563000	0.35712	-0.161000	0.10026	0.068000	0.16574	0.462000	0.41574	CCA		0.552	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132894.5	NM_002373		5	41	0	0	0	0.001168	0	5	41				
SEMA6D	80031	broad.mit.edu	37	15	48053382	48053382	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr15:48053382G>A	ENST00000316364.5	+	5	749	c.310G>A	c.(310-312)Gat>Aat	p.D104N	SEMA6D_ENST00000389428.3_Missense_Mutation_p.D104N|SEMA6D_ENST00000537942.1_Missense_Mutation_p.D104N|SEMA6D_ENST00000558816.1_Missense_Mutation_p.D104N|SEMA6D_ENST00000558014.1_Missense_Mutation_p.D104N|SEMA6D_ENST00000355997.3_Missense_Mutation_p.D104N|SEMA6D_ENST00000389433.2_Missense_Mutation_p.D104N|SEMA6D_ENST00000389425.3_Missense_Mutation_p.D104N|SEMA6D_ENST00000354744.4_Missense_Mutation_p.D104N|SEMA6D_ENST00000536845.2_Missense_Mutation_p.D104N|SEMA6D_ENST00000389432.2_Missense_Mutation_p.D104N|SEMA6D_ENST00000358066.4_Missense_Mutation_p.D104N	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	104	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.D104N(2)		biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		AAGACAACAGGATCGAGAAAA	0.403																																							uc010bek.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(3)|breast(1)	4						c.(310-312)GAT>AAT		semaphorin 6D isoform 4 precursor							88.0	85.0	86.0					15																	48053382		2198	4297	6495	SO:0001583	missense	80031				axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity	g.chr15:48053382G>A	AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.310G>A	15.37:g.48053382G>A	ENSP00000324857:p.Asp104Asn					SEMA6D_uc001zvw.2_Missense_Mutation_p.D104N|SEMA6D_uc001zvx.1_Missense_Mutation_p.D104N|SEMA6D_uc001zvy.2_Missense_Mutation_p.D104N|SEMA6D_uc001zvz.2_Missense_Mutation_p.D104N|SEMA6D_uc001zwa.2_Missense_Mutation_p.D104N|SEMA6D_uc001zwb.2_Missense_Mutation_p.D104N|SEMA6D_uc001zwc.2_Missense_Mutation_p.D104N	p.D104N	NM_153618	NP_705871	Q8NFY4	SEM6D_HUMAN		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)	5	670	+		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)	104			Sema.|Extracellular (Potential).		A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Missense_Mutation	SNP	ENST00000316364.5	37	c.310G>A	CCDS32225.1	.	.	.	.	.	.	.	.	.	.	G	27.2	4.810430	0.90707	.	.	ENSG00000137872	ENST00000537942;ENST00000536845;ENST00000316364;ENST00000389433;ENST00000389432;ENST00000354744;ENST00000358066;ENST00000389428;ENST00000355997;ENST00000389425	T;T;T;T;T;T;T;T;T;T	0.25912	1.77;1.77;1.77;1.77;1.77;1.77;1.77;1.77;1.77;1.77	5.96	5.96	0.96718	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.54367	0.1854	M	0.72894	2.215	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.996;0.997;0.998;0.999;0.997	T	0.52335	-0.8589	10	0.72032	D	0.01	.	20.422	0.99049	0.0:0.0:1.0:0.0	.	104;104;104;104;104	Q8NFY4-3;A6NM95;Q8NFY4-4;Q8NFY4;Q8NFY4-2	.;.;.;SEM6D_HUMAN;.	N	104	ENSP00000442040:D104N;ENSP00000446152:D104N;ENSP00000324857:D104N;ENSP00000374084:D104N;ENSP00000374083:D104N;ENSP00000346786:D104N;ENSP00000350770:D104N;ENSP00000374079:D104N;ENSP00000348276:D104N;ENSP00000374076:D104N	ENSP00000324857:D104N	D	+	1	0	SEMA6D	45840674	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.476000	0.97823	2.832000	0.97577	0.655000	0.94253	GAT		0.403	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416868.1	NM_024966		6	27	0	0	0	0.001984	0	6	27				
SNUPN	10073	broad.mit.edu	37	15	75902273	75902273	+	Silent	SNP	G	G	A	rs139633458		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr15:75902273G>A	ENST00000564644.1	-	5	944	c.366C>T	c.(364-366)gtC>gtT	p.V122V	SNUPN_ENST00000564675.1_Silent_p.V122V|SNUPN_ENST00000567134.1_Silent_p.V122V|SNUPN_ENST00000371091.5_Silent_p.V164V|SNUPN_ENST00000308588.5_Silent_p.V122V			O95149	SPN1_HUMAN	snurportin 1	122	Necessary for interaction with XPO1.				gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|protein import into nucleus (GO:0006606)|RNA metabolic process (GO:0016070)|snRNA import into nucleus (GO:0061015)|spliceosomal snRNP assembly (GO:0000387)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nuclear pore (GO:0005643)	protein transporter activity (GO:0008565)|RNA cap binding (GO:0000339)	p.V122V(1)		endometrium(2)|large_intestine(3)|lung(2)|pancreas(1)	8						CAGGGCACACGACCACAATCC	0.502																																							uc002ban.2		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(1)	1						c.(364-366)GTC>GTT		snurportin 1			,,	0,4394		0,0,2197	94.0	78.0	84.0		366,366,366	-3.3	1.0	15	dbSNP_134	84	1,8587		0,1,4293	no	coding-synonymous,coding-synonymous,coding-synonymous	SNUPN	NM_001042581.1,NM_001042588.1,NM_005701.3	,,	0,1,6490	AA,AG,GG		0.0116,0.0,0.0077	,,	122/361,122/361,122/361	75902273	1,12981	2197	4294	6491	SO:0001819	synonymous_variant	10073				ncRNA metabolic process|protein import into nucleus|spliceosomal snRNP assembly	cytosol|nuclear pore	protein transporter activity|RNA cap binding	g.chr15:75902273G>A	AF039029	CCDS10281.1	15q24.2	2008-02-05	2006-07-14	2006-07-14	ENSG00000169371	ENSG00000169371			14245	protein-coding gene	gene with protein product		607902	"""RNA, U transporter 1"""	RNUT1		9670026	Standard	NM_005701		Approved	SNURPORTIN-1, Snurportin1	uc002bas.3	O95149	OTTHUMG00000142833	ENST00000564644.1:c.366C>T	15.37:g.75902273G>A						SNUPN_uc002bao.2_Silent_p.V122V|SNUPN_uc002bap.2_Silent_p.V164V|SNUPN_uc002baq.2_Silent_p.V122V|SNUPN_uc002bar.2_Silent_p.V122V|SNUPN_uc002bas.2_Silent_p.V122V	p.V122V	NM_005701	NP_005692	O95149	SPN1_HUMAN			4	456	-			122			Necessary for interaction with XPO1.		A6NE34|A8K0B0|D3DW76	Silent	SNP	ENST00000564644.1	37	c.366C>T	CCDS10281.1																																																																																				0.502	SNUPN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420332.1	NM_005701		6	60	0	0	0	0.001984	0	6	60				
PEAK1	79834	broad.mit.edu	37	15	77471865	77471865	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr15:77471865C>A	ENST00000560626.2	-	4	2879	c.2404G>T	c.(2404-2406)Gat>Tat	p.D802Y	PEAK1_ENST00000312493.4_Missense_Mutation_p.D802Y|PEAK1_ENST00000558305.1_Missense_Mutation_p.D802Y			Q9H792	PEAK1_HUMAN	pseudopodium-enriched atypical kinase 1	802	Pro-rich.				cell migration (GO:0016477)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.D802Y(2)									ACATCAGCATCTGGAGGAATG	0.512																																							uc002bcm.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(2404-2406)GAT>TAT		NKF3 kinase family member							82.0	83.0	83.0					15																	77471865		2011	4187	6198	SO:0001583	missense	79834				cell migration|protein autophosphorylation|substrate adhesion-dependent cell spreading	actin cytoskeleton|cytoplasm|focal adhesion	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding	g.chr15:77471865C>A		CCDS42062.1	15q24.3	2013-09-27			ENSG00000173517	ENSG00000173517			29431	protein-coding gene	gene with protein product		614248				16879967, 20534451	Standard	NM_024776		Approved	KIAA2002, sgk269		Q9H792	OTTHUMG00000172618	ENST00000560626.2:c.2404G>T	15.37:g.77471865C>A	ENSP00000452796:p.Asp802Tyr					SGK269_uc002bcn.2_Missense_Mutation_p.D802Y	p.D802Y	NM_024776	NP_079052	Q9H792	PEAK1_HUMAN		STAD - Stomach adenocarcinoma(199;0.124)	3	2712	-			802			Pro-rich.		Q6ZS78|Q8NAZ4|Q8NCM3|Q8TEG7	Missense_Mutation	SNP	ENST00000560626.2	37	c.2404G>T	CCDS42062.1	.	.	.	.	.	.	.	.	.	.	C	17.91	3.504335	0.64410	.	.	ENSG00000173517	ENST00000312493	T	0.73258	-0.73	5.78	5.78	0.91487	.	0.181563	0.31415	N	0.007693	T	0.74253	0.3692	L	0.32530	0.975	0.51233	D	0.999916	D	0.61697	0.99	P	0.54401	0.751	T	0.76594	-0.2902	10	0.87932	D	0	-3.4663	19.9954	0.97382	0.0:1.0:0.0:0.0	.	802	Q9H792	PEAK1_HUMAN	Y	802	ENSP00000309230:D802Y	ENSP00000309230:D802Y	D	-	1	0	AC087465.1	75258920	1.000000	0.71417	0.652000	0.29579	0.541000	0.35023	7.290000	0.78711	2.728000	0.93425	0.655000	0.94253	GAT		0.512	PEAK1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419483.3			21	127	1	0	1.10923e-09	0.00278	1.50941e-09	21	127				
ADAMTS7	11173	broad.mit.edu	37	15	79051780	79051780	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr15:79051780G>C	ENST00000388820.4	-	24	5254	c.5044C>G	c.(5044-5046)Cgg>Ggg	p.R1682G		NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	1682					cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.R1682G(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						CGGGCAACCCGCTGATGGCCT	0.731																																							uc002bej.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(5044-5046)CGG>GGG		ADAM metallopeptidase with thrombospondin type 1							8.0	9.0	9.0					15																	79051780		2103	4156	6259	SO:0001583	missense	11173				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr15:79051780G>C	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.5044C>G	15.37:g.79051780G>C	ENSP00000373472:p.Arg1682Gly						p.R1682G	NM_014272	NP_055087	Q9UKP4	ATS7_HUMAN			24	5255	-			1682					Q14F51|Q6P7J9	Missense_Mutation	SNP	ENST00000388820.4	37	c.5044C>G	CCDS32303.1	.	.	.	.	.	.	.	.	.	.	g	12.98	2.100758	0.37048	.	.	ENSG00000136378	ENST00000388820	T	0.63580	-0.05	2.92	1.95	0.26073	.	0.224079	0.29178	U	0.012916	T	0.68742	0.3034	L	0.55481	1.735	0.26677	N	0.971612	D	0.69078	0.997	D	0.65140	0.932	T	0.59904	-0.7366	10	0.87932	D	0	.	8.2653	0.31810	0.0:0.0:0.7614:0.2386	.	1682	Q9UKP4	ATS7_HUMAN	G	1682	ENSP00000373472:R1682G	ENSP00000373472:R1682G	R	-	1	2	ADAMTS7	76838835	0.006000	0.16342	0.407000	0.26434	0.489000	0.33432	-0.116000	0.10724	0.524000	0.28502	0.282000	0.19409	CGG		0.731	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272		4	14	0	0	0	0.009096	0	4	14				
RHCG	51458	broad.mit.edu	37	15	90019991	90019991	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr15:90019991A>G	ENST00000268122.4	-	9	1374	c.1306T>C	c.(1306-1308)Tgg>Cgg	p.W436R	RHCG_ENST00000544600.1_Missense_Mutation_p.W436R	NM_016321.1	NP_057405.1	Q9UBD6	RHCG_HUMAN	Rh family, C glycoprotein	436					amine transport (GO:0015837)|ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|cellular ion homeostasis (GO:0006873)|epithelial cell differentiation (GO:0030855)|homeostatic process (GO:0042592)|regulation of pH (GO:0006885)|transepithelial ammonium transport (GO:0070634)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ammonium transmembrane transporter activity (GO:0008519)|ankyrin binding (GO:0030506)	p.W436R(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Lung NSC(78;0.0237)|all_lung(78;0.0478)					CTCACCTCCCAGTAGACCGCA	0.567																																							uc002bnz.2		NA																	1	Substitution - Missense(1)		lung(1)	kidney(1)	1						c.(1306-1308)TGG>CGG		Rh family, C glycoprotein							98.0	90.0	93.0					15																	90019991		2200	4299	6499	SO:0001583	missense	51458				amine transport|cellular ion homeostasis|epithelial cell differentiation|transepithelial ammonium transport	apical plasma membrane|basolateral plasma membrane|cytoplasmic vesicle|integral to plasma membrane	ammonia transmembrane transporter activity|ammonium transmembrane transporter activity|ankyrin binding	g.chr15:90019991A>G	AF081497	CCDS10351.1	15q25	2013-05-22	2006-02-23		ENSG00000140519	ENSG00000140519		"""Solute carriers"""	18140	protein-coding gene	gene with protein product		605381	"""chromosome 15 open reading frame 6"", ""Rhesus blood group, C glycoprotein"""	C15orf6		10852913	Standard	NM_016321		Approved	RHGK, PDRC2, SLC42A3	uc002bnz.2	Q9UBD6	OTTHUMG00000149647	ENST00000268122.4:c.1306T>C	15.37:g.90019991A>G	ENSP00000268122:p.Trp436Arg					RHCG_uc002bny.2_Missense_Mutation_p.W207R|RHCG_uc002boa.2_RNA	p.W436R	NM_016321	NP_057405	Q9UBD6	RHCG_HUMAN			9	1330	-	Lung NSC(78;0.0237)|all_lung(78;0.0478)		436			Cytoplasmic (Potential).		A8K4D4|Q6X3Y4	Missense_Mutation	SNP	ENST00000268122.4	37	c.1306T>C	CCDS10351.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.370607	0.82573	.	.	ENSG00000140519	ENST00000544600;ENST00000268122;ENST00000536247	T;T	0.34275	1.37;1.46	5.69	5.69	0.88448	Ammonium transporter AmtB-like (1);	0.000000	0.85682	D	0.000000	T	0.42585	0.1209	N	0.24115	0.695	0.80722	D	1	D	0.69078	0.997	P	0.60886	0.88	T	0.23368	-1.0190	9	.	.	.	-11.5515	15.9467	0.79799	1.0:0.0:0.0:0.0	.	436	Q9UBD6	RHCG_HUMAN	R	436;436;427	ENSP00000438123:W436R;ENSP00000268122:W436R	.	W	-	1	0	RHCG	87820995	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.852000	0.92215	2.169000	0.68431	0.533000	0.62120	TGG		0.567	RHCG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000312855.2	NM_016321		14	67	0	0	0	0.004007	0	14	67				
ANPEP	290	broad.mit.edu	37	15	90348375	90348375	+	Silent	SNP	C	C	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr15:90348375C>G	ENST00000300060.6	-	4	1144	c.831G>C	c.(829-831)acG>acC	p.T277T	ANPEP_ENST00000558177.1_5'Flank	NM_001150.2	NP_001141.2	P15144	AMPN_HUMAN	alanyl (membrane) aminopeptidase	277	Interaction with HCoV-229E.|Metalloprotease.				angiogenesis (GO:0001525)|angiotensin maturation (GO:0002003)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|viral process (GO:0016032)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|receptor activity (GO:0004872)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)	p.T277T(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	57	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)|Icatibant(DB06196)	CCAGCAAGTACGTGGACATCT	0.567																																					NSCLC(30;827 977 2459 19669 26125)	NSCLC(30;827 977 2459 19669 26125)	uc002bop.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|skin(1)	4						c.(829-831)ACG>ACC		membrane alanine aminopeptidase precursor	Ezetimibe(DB00973)						335.0	277.0	297.0					15																	90348375		2200	4299	6499	SO:0001819	synonymous_variant	290				angiogenesis|cell differentiation|interspecies interaction between organisms	cytosol|ER-Golgi intermediate compartment|integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|receptor activity|zinc ion binding	g.chr15:90348375C>G	M22324	CCDS10356.1	15q25-q26	2008-07-31	2008-07-31		ENSG00000166825	ENSG00000166825	3.4.11.2	"""CD molecules"""	500	protein-coding gene	gene with protein product	"""aminopeptidase N"", ""aminopeptidase M"", ""microsomal aminopeptidase"""	151530		CD13, PEPN		2428842, 1977688	Standard	NM_001150		Approved	LAP1, gp150, p150	uc002bop.4	P15144	OTTHUMG00000149814	ENST00000300060.6:c.831G>C	15.37:g.90348375C>G							p.T277T	NM_001150	NP_001141	P15144	AMPN_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		4	1123	-	Lung NSC(78;0.0221)|all_lung(78;0.0448)		277			Extracellular.|Interaction with HCoV-229E.|Metalloprotease.		Q16728|Q6GT90|Q8IUK3|Q8IVH3|Q9UCE0	Silent	SNP	ENST00000300060.6	37	c.831G>C	CCDS10356.1																																																																																				0.567	ANPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313425.1			28	171	0	0	0	0.005443	0	28	171				
PKD1	5310	broad.mit.edu	37	16	2159381	2159382	+	Missense_Mutation	DNP	CT	CT	AA			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	CT	CT	-	-	CT	CT	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr16:2159381_2159382CT>AA	ENST00000262304.4	-	15	5994_5995	c.5786_5787AG>TT	c.(5785-5787)gAG>gTT	p.E1929V	PKD1_ENST00000423118.1_Missense_Mutation_p.E1929V|PKD1_ENST00000561991.1_5'Flank|RP11-304L19.4_ENST00000568795.1_RNA	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	1929	PKD 15. {ECO:0000255|PROSITE- ProRule:PRU00151}.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)	p.E1929V(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						CGGGGAGCACCTCGGGGTTGGC	0.698																																							uc002cos.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|skin(1)	3						c.(5785-5787)GAG>GTT		polycystin 1 isoform 1 precursor																																				SO:0001583	missense	5310				calcium-independent cell-matrix adhesion|homophilic cell adhesion|neuropeptide signaling pathway	basolateral plasma membrane|integral to plasma membrane	protein domain specific binding|sugar binding	g.chr16:2159381_2159382CT>AA	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.5786_5787delinsAA	16.37:g.2159381_2159382delinsAA	ENSP00000262304:p.Glu1929Val					PKD1_uc002cot.1_Missense_Mutation_p.E1929V	p.E1929V	NM_001009944	NP_001009944	P98161	PKD1_HUMAN			15	5995_5996	-			1929			Extracellular (Potential).|PKD 15.		Q15140|Q15141	Missense_Mutation	DNP	ENST00000262304.4	37	c.5786_5787AG>TT	CCDS32369.1																																																																																				0.698	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1			8	29	0	0	0	0.004672	0	8	29				
PKD1	5310	broad.mit.edu	37	16	2164306	2164306	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr16:2164306C>A	ENST00000262304.4	-	11	2926	c.2718G>T	c.(2716-2718)gaG>gaT	p.E906D	PKD1_ENST00000423118.1_Missense_Mutation_p.E906D|RP11-304L19.4_ENST00000568795.1_RNA	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	906	PKD 3. {ECO:0000255|PROSITE- ProRule:PRU00151}.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)	p.E906D(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						CCACCACGTGCTCCCCCTCAC	0.687																																							uc002cos.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|skin(1)	3						c.(2716-2718)GAG>GAT		polycystin 1 isoform 1 precursor							36.0	29.0	31.0					16																	2164306		2191	4294	6485	SO:0001583	missense	5310				calcium-independent cell-matrix adhesion|homophilic cell adhesion|neuropeptide signaling pathway	basolateral plasma membrane|integral to plasma membrane	protein domain specific binding|sugar binding	g.chr16:2164306C>A	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.2718G>T	16.37:g.2164306C>A	ENSP00000262304:p.Glu906Asp					PKD1_uc002cot.1_Missense_Mutation_p.E906D	p.E906D	NM_001009944	NP_001009944	P98161	PKD1_HUMAN			11	2927	-			906			Extracellular (Potential).|PKD 3.		Q15140|Q15141	Missense_Mutation	SNP	ENST00000262304.4	37	c.2718G>T	CCDS32369.1	.	.	.	.	.	.	.	.	.	.	c	3.947	-0.013053	0.07727	.	.	ENSG00000008710	ENST00000262304;ENST00000423118;ENST00000306101	T;T	0.66995	-0.24;-0.24	4.96	1.29	0.21616	Polycystin cation channel (1);	0.685203	0.14771	N	0.299370	T	0.42765	0.1217	N	0.20986	0.625	0.09310	N	1	B;B	0.15473	0.013;0.004	B;B	0.13407	0.009;0.004	T	0.14144	-1.0483	10	0.15952	T	0.53	.	2.5636	0.04778	0.1249:0.4328:0.2301:0.2122	.	906;906	P98161-3;P98161	.;PKD1_HUMAN	D	906;906;621	ENSP00000262304:E906D;ENSP00000399501:E906D	ENSP00000262304:E906D	E	-	3	2	PKD1	2104307	0.000000	0.05858	0.651000	0.29564	0.175000	0.22909	0.111000	0.15458	0.457000	0.26962	0.450000	0.29827	GAG		0.687	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1			9	35	1	0	0.000673444	0.008291	0.000734904	9	35				
TRAF7	84231	broad.mit.edu	37	16	2225515	2225515	+	Silent	SNP	G	G	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr16:2225515G>C	ENST00000326181.6	+	17	1650	c.1518G>C	c.(1516-1518)gtG>gtC	p.V506V		NM_032271.2	NP_115647.2	Q6Q0C0	TRAF7_HUMAN	TNF receptor-associated factor 7, E3 ubiquitin protein ligase	506					activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of MAPK cascade (GO:0043410)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasmic vesicle (GO:0031410)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.V506V(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	23						GGGACATCGTGGGCACTGAGC	0.627																																							uc002cow.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|lung(1)|breast(1)	3						c.(1516-1518)GTG>GTC		TNF receptor-associated factor 7							94.0	92.0	93.0					16																	2225515		2198	4300	6498	SO:0001819	synonymous_variant	84231				activation of MAPKKK activity|apoptosis|regulation of apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic membrane-bounded vesicle|ubiquitin ligase complex	identical protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr16:2225515G>C	AL136921	CCDS10461.1	16p13.3	2013-01-10	2012-02-23	2004-06-04	ENSG00000131653	ENSG00000131653		"""RING-type (C3HC4) zinc fingers"", ""WD repeat domain containing"""	20456	protein-coding gene	gene with protein product		606692	"""ring finger and WD repeat domain 1"", ""TNF receptor-associated factor 7"""	RFWD1		11230166, 15001576	Standard	NM_032271		Approved	RNF119, DKFZp586I021, MGC7807	uc002cow.3	Q6Q0C0	OTTHUMG00000128826	ENST00000326181.6:c.1518G>C	16.37:g.2225515G>C							p.V506V	NM_032271	NP_115647	Q6Q0C0	TRAF7_HUMAN			17	1617	+			506			WD 3.		Q9H073	Silent	SNP	ENST00000326181.6	37	c.1518G>C	CCDS10461.1																																																																																				0.627	TRAF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250762.1	NM_032271		15	128	0	0	0	0.004007	0	15	128				
RRN3	54700	broad.mit.edu	37	16	15155638	15155638	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr16:15155638G>A	ENST00000198767.6	-	18	2002	c.1919C>T	c.(1918-1920)tCc>tTc	p.S640F	RRN3_ENST00000563559.1_Intron|RRN3_ENST00000327307.7_Missense_Mutation_p.S607F|RRN3_ENST00000540462.1_Missense_Mutation_p.S458F|PDXDC1_ENST00000535621.2_Intron|RRN3_ENST00000429751.2_Missense_Mutation_p.S610F	NM_018427.3	NP_060897.3	Q9NYV6	RRN3_HUMAN	RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)	640	Interaction with EIF3L.|Interaction with TWISTNB.				cell proliferation (GO:0008283)|cytoplasm organization (GO:0007028)|gene expression (GO:0010467)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of intrinsic apoptotic signaling pathway by p53 class mediator (GO:1902254)|nucleolus organization (GO:0007000)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of DNA-templated transcription, initiation (GO:2000142)|ribosome biogenesis (GO:0042254)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.S640F(1)		NS(2)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)	20						CACGGGTGGGGAGCCCACACT	0.517																																							uc002dde.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1918-1920)TCC>TTC		RRN3 RNA polymerase I transcription factor							158.0	130.0	139.0					16																	15155638		2197	4300	6497	SO:0001583	missense	54700				regulation of transcription, DNA-dependent|transcription initiation from RNA polymerase I promoter	nucleolus|nucleoplasm		g.chr16:15155638G>A	AF227156	CCDS10559.1, CCDS73833.1	16p13.11	2009-10-26	2006-04-04		ENSG00000085721	ENSG00000085721			30346	protein-coding gene	gene with protein product		605121	"""RRN3 RNA polymerase I transcription factor homolog (yeast)"""			10758157, 11250903	Standard	XM_005255375		Approved	DKFZp566E104	uc002dde.3	Q9NYV6	OTTHUMG00000129847	ENST00000198767.6:c.1919C>T	16.37:g.15155638G>A	ENSP00000198767:p.Ser640Phe					PDXDC1_uc002ddc.2_Intron|RRN3_uc010uzp.1_Missense_Mutation_p.S508F|RRN3_uc010uzq.1_Missense_Mutation_p.S610F	p.S640F	NM_018427	NP_060897	Q9NYV6	RRN3_HUMAN			18	1987	-			640			Interaction with EIF3L.|Interaction with TWISTNB.		A2RTY9|B4E0J7|B4E3T2|Q3MHU9|Q6IPL4|Q9H4F0	Missense_Mutation	SNP	ENST00000198767.6	37	c.1919C>T	CCDS10559.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.647932	0.87958	.	.	ENSG00000085721	ENST00000198767;ENST00000429751;ENST00000327307;ENST00000540462	T;T;T;T	0.55930	0.49;0.61;0.56;0.56	6.08	6.08	0.98989	.	0.000000	0.64402	U	0.000001	T	0.73233	0.3561	M	0.72894	2.215	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.87578	0.998;0.996;0.996	T	0.69610	-0.5099	10	0.41790	T	0.15	.	19.6516	0.95815	0.0:0.0:1.0:0.0	.	610;541;640	F5H148;B4DZL9;Q9NYV6	.;.;RRN3_HUMAN	F	640;610;607;458	ENSP00000198767:S640F;ENSP00000402027:S610F;ENSP00000318484:S607F;ENSP00000437963:S458F	ENSP00000198767:S640F	S	-	2	0	RRN3	15063139	1.000000	0.71417	1.000000	0.80357	0.766000	0.43426	6.036000	0.70948	2.894000	0.99253	0.655000	0.94253	TCC		0.517	RRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252087.2	NM_018427		17	86	0	0	0	0.004007	0	17	86				
KIAA0430	9665	broad.mit.edu	37	16	15696062	15696062	+	Splice_Site	SNP	T	T	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr16:15696062T>C	ENST00000396368.3	-	23	4620		c.e23-2		KIAA0430_ENST00000548025.1_Splice_Site|KIAA0430_ENST00000540441.2_Splice_Site|KIAA0430_ENST00000602337.1_Splice_Site|KIAA0430_ENST00000547936.1_Splice_Site|KIAA0430_ENST00000551742.1_Splice_Site|KIAA0430_ENST00000344181.3_Splice_Site	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430						double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.?(1)		breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						AGTGAAAACCTGGTTAAAAAG	0.438																																							uc002ddr.2		NA																	1	Unknown(1)		lung(1)		0						c.e23-1		limkain b1							101.0	99.0	100.0					16																	15696062		1860	4100	5960	SO:0001630	splice_region_variant	9665					peroxisome	nucleotide binding|RNA binding	g.chr16:15696062T>C	AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593				9455477, 10493829, 15932519, 22442484, 23090997	Standard	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	Q9Y4F3	OTTHUMG00000129884	ENST00000396368.3:c.4414-2A>G	16.37:g.15696062T>C						KIAA0430_uc002ddq.2_Splice_Site_p.V1306_splice|KIAA0430_uc010uzv.1_Splice_Site_p.V1468_splice|KIAA0430_uc010uzw.1_Splice_Site_p.V1471_splice	p.V1472_splice	NM_014647	NP_055462	Q9Y4F3	LKAP_HUMAN			23	4607	-								A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	Splice_Site	SNP	ENST00000396368.3	37	c.4414_splice	CCDS10562.2	.	.	.	.	.	.	.	.	.	.	.	11.62	1.692827	0.30052	.	.	ENSG00000166783	ENST00000396368;ENST00000540441;ENST00000321370;ENST00000344181;ENST00000548025;ENST00000551742;ENST00000551298	.	.	.	5.69	5.69	0.88448	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9508	0.79835	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	KIAA0430	15603563	1.000000	0.71417	0.998000	0.56505	0.149000	0.21700	6.067000	0.71193	2.170000	0.68504	0.459000	0.35465	.		0.438	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252131.2	NM_014647	Intron	6	152	0	0	0	0.001168	0	6	152				
UBFD1	56061	broad.mit.edu	37	16	23573999	23573999	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr16:23573999A>T	ENST00000395878.3	+	5	1065	c.684A>T	c.(682-684)aaA>aaT	p.K228N	UBFD1_ENST00000567212.1_Missense_Mutation_p.K219N|UBFD1_ENST00000219638.4_Missense_Mutation_p.K452N|UBFD1_ENST00000571064.1_3'UTR	NM_019116.2	NP_061989.2	O14562	UBFD1_HUMAN	ubiquitin family domain containing 1	228							poly(A) RNA binding (GO:0044822)	p.K228N(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	7				GBM - Glioblastoma multiforme(48;0.0331)		CTGGAGGAAAAGTGAGACTCA	0.517																																					Melanoma(22;290 1069 22358 48158)	Melanoma(22;290 1069 22358 48158)	uc002dlv.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(682-684)AAA>AAT		ubiquitin-binding protein homolog							70.0	74.0	73.0					16																	23573999		2132	4242	6374	SO:0001583	missense	56061							g.chr16:23573999A>T	AK124139	CCDS10613.2	16p12.1	2008-11-05			ENSG00000103353	ENSG00000103353			30565	protein-coding gene	gene with protein product	"""ubiquitin-binding protein homolog"""					10493829	Standard	XM_006721064		Approved	FLJ42145, FLJ38870, UBPH	uc002dlv.3	O14562	OTTHUMG00000128855	ENST00000395878.3:c.684A>T	16.37:g.23573999A>T	ENSP00000379217:p.Lys228Asn						p.K228N	NM_019116	NP_061989	O14562	UBFD1_HUMAN		GBM - Glioblastoma multiforme(48;0.0331)	5	886	+			228					A8MW58|D3DWF2	Missense_Mutation	SNP	ENST00000395878.3	37	c.684A>T	CCDS10613.2	.	.	.	.	.	.	.	.	.	.	A	25.0	4.597797	0.87055	.	.	ENSG00000103353	ENST00000219638;ENST00000395878;ENST00000399462	.	.	.	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.79393	0.4438	M	0.85373	2.75	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.82329	-0.0511	9	0.87932	D	0	-5.7442	9.7409	0.40418	0.9237:0.0:0.0763:0.0	.	228	O14562	UBFD1_HUMAN	N	452;228;105	.	ENSP00000219638:K452N	K	+	3	2	UBFD1	23481500	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.986000	0.70563	2.206000	0.71126	0.533000	0.62120	AAA		0.517	UBFD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250795.2	NM_019116		26	58	0	0	0	0.00632	0	26	58				
PRKCB	5579	broad.mit.edu	37	16	24202456	24202456	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr16:24202456G>T	ENST00000321728.7	+	16	1943	c.1768G>T	c.(1768-1770)Ggc>Tgc	p.G590C	PRKCB_ENST00000303531.7_Missense_Mutation_p.G590C	NM_212535.2	NP_997700.1	P05771	KPCB_HUMAN	protein kinase C, beta	590	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|histone H3-T6 phosphorylation (GO:0035408)|intracellular signal transduction (GO:0035556)|lipoprotein transport (GO:0042953)|negative regulation of glucose transport (GO:0010829)|negative regulation of insulin receptor signaling pathway (GO:0046627)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|histone kinase activity (H3-T6 specific) (GO:0035403)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)	p.G590C(2)		central_nervous_system(3)|large_intestine(1)|lung(2)|ovary(3)	9					Tamoxifen(DB00675)|Vitamin E(DB00163)	TGGACCTGAAGGCGAACGTGA	0.433																																							uc002dmd.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|central_nervous_system(3)|lung(2)|large_intestine(1)	9						c.(1768-1770)GGC>TGC		protein kinase C, beta isoform 1	Vitamin E(DB00163)						106.0	103.0	104.0					16																	24202456		2197	4300	6497	SO:0001583	missense	5579				apoptosis|B cell activation|B cell receptor signaling pathway|intracellular signal transduction|lipoprotein transport|platelet activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|synaptic transmission|transcription, DNA-dependent	cytosol|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|histone binding|histone kinase activity (H3-T6 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|zinc ion binding	g.chr16:24202456G>T	M13975	CCDS10618.1, CCDS10619.1	16p12	2009-07-10	2008-08-18	2008-08-18	ENSG00000166501	ENSG00000166501	2.7.11.1		9395	protein-coding gene	gene with protein product		176970	"""protein kinase C, beta 1"""	PRKCB2, PKCB, PRKCB1		3658678	Standard	NM_002738		Approved		uc002dme.3	P05771	OTTHUMG00000131615	ENST00000321728.7:c.1768G>T	16.37:g.24202456G>T	ENSP00000318315:p.Gly590Cys					PRKCB_uc002dme.2_Missense_Mutation_p.G590C	p.G590C	NM_212535	NP_997700	P05771	KPCB_HUMAN			16	1965	+			590			Protein kinase.		C5IFJ8|D3DWF5|O43744|P05127|Q15138|Q93060|Q9UE49|Q9UE50|Q9UEH8|Q9UJ30|Q9UJ33	Missense_Mutation	SNP	ENST00000321728.7	37	c.1768G>T	CCDS10618.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.965091	0.92855	.	.	ENSG00000166501	ENST00000321728;ENST00000303531	T;T	0.74737	-0.87;-0.87	5.79	5.79	0.91817	Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.88153	0.6360	M	0.85462	2.755	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.994;0.996	D	0.88986	0.3411	10	0.66056	D	0.02	.	18.5987	0.91239	0.0:0.0:1.0:0.0	.	590;590	P05771-2;P05771	.;KPCB_HUMAN	C	590	ENSP00000318315:G590C;ENSP00000305355:G590C	ENSP00000305355:G590C	G	+	1	0	PRKCB	24109957	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	9.357000	0.97099	2.744000	0.94065	0.650000	0.86243	GGC		0.433	PRKCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254504.2	NM_212535		11	92	1	0	0.000978159	0.000978	0.0010633	11	92				
SH2B1	25970	broad.mit.edu	37	16	28856776	28856776	+	5'Flank	SNP	C	C	T	rs570472566		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr16:28856776C>T	ENST00000322610.8	+	0	0				MIR4721_ENST00000577590.1_RNA|TUFM_ENST00000313511.3_Silent_p.K91K			Q9NRF2	SH2B1_HUMAN	SH2B adaptor protein 1						blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|intracellular signal transduction (GO:0035556)|lamellipodium assembly (GO:0030032)|positive regulation of mitosis (GO:0045840)|regulation of DNA biosynthetic process (GO:2000278)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)	p.K91K(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25						ACTTCTTGAACTTAGCCCCAC	0.547													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19968	0.0		0.0	False		,,,				2504	0.0						uc002drh.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(271-273)AAG>AAA		Tu translation elongation factor, mitochondrial							69.0	64.0	66.0					16																	28856776		2197	4300	6497	SO:0001631	upstream_gene_variant	7284					mitochondrial nucleoid	GTP binding|GTPase activity|protein binding|translation elongation factor activity	g.chr16:28856776C>T	AK055104	CCDS32424.1, CCDS53996.1, CCDS53997.1	16p11.2	2013-02-14						"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	30417	protein-coding gene	gene with protein product	"""SH2-B homolog"""	608937				11827956, 10594240	Standard	NM_001145812		Approved	FLJ30542, SH2B	uc002drl.3	Q9NRF2			16.37:g.28856776C>T	Exception_encountered					uc010vct.1_Intron|SH2B1_uc002dri.2_5'Flank	p.K91K	NM_003321	NP_003312	P49411	EFTU_HUMAN			3	412	-			88					A8K2R7|Q96FK3|Q96SX3|Q9NRF1|Q9NRF3|Q9P2P7|Q9Y3Y3	Silent	SNP	ENST00000322610.8	37	c.273G>A	CCDS53996.1																																																																																				0.547	SH2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000432666.1	NM_015503		12	95	0	0	0	0.001855	0	12	95				
RNF40	9810	broad.mit.edu	37	16	30776581	30776581	+	Nonsense_Mutation	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr16:30776581G>A	ENST00000324685.6	+	7	1286	c.851G>A	c.(850-852)tGg>tAg	p.W284*	RNF40_ENST00000357890.5_Nonsense_Mutation_p.W284*|RNF40_ENST00000563683.1_Nonsense_Mutation_p.W284*|RNF40_ENST00000402121.3_Intron|C16orf93_ENST00000543610.1_5'Flank	NM_001207033.1|NM_014771.3	NP_001193962.1|NP_055586	O75150	BRE1B_HUMAN	ring finger protein 40, E3 ubiquitin protein ligase	284					histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|ubiquitin-dependent protein catabolic process (GO:0006511)	HULC complex (GO:0033503)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(10)|prostate(2)	30			Colorectal(24;0.198)			GACTTGCAGTGGGACATCGAG	0.577																																							uc002dzq.2		NA																	0				central_nervous_system(1)	1						c.(850-852)TGG>TAG		ring finger protein 40							109.0	107.0	108.0					16																	30776581		2197	4300	6497	SO:0001587	stop_gained	9810				histone H2B ubiquitination|histone monoubiquitination|ubiquitin-dependent protein catabolic process	nucleus|synaptosome|ubiquitin ligase complex	protein homodimerization activity|ubiquitin protein ligase binding|zinc ion binding	g.chr16:30776581G>A	AB014561	CCDS10691.1, CCDS55994.1	16p11.2-p11.1	2012-02-23	2012-02-23		ENSG00000103549	ENSG00000103549		"""RING-type (C3HC4) zinc fingers"""	16867	protein-coding gene	gene with protein product	"""BRE1 E3 ubiquitin ligase homolog B (S. cerevisiae)"""	607700	"""ring finger protein 40"""			9734811, 10944455, 12121982	Standard	NM_014771		Approved	KIAA0661, RBP95, BRE1B, STARING	uc002dzq.3	O75150	OTTHUMG00000132394	ENST00000324685.6:c.851G>A	16.37:g.30776581G>A	ENSP00000325677:p.Trp284*					RNF40_uc010caa.2_Nonsense_Mutation_p.W284*|RNF40_uc010cab.2_Nonsense_Mutation_p.W284*|RNF40_uc010vfa.1_Intron|RNF40_uc002dzr.2_Nonsense_Mutation_p.W284*|RNF40_uc010vfb.1_Intron|RNF40_uc010vfc.1_5'Flank	p.W284*	NM_014771	NP_055586	O75150	BRE1B_HUMAN	Colorectal(24;0.198)		7	974	+			284			Potential.		Q6AHZ6|Q6N005|Q7L3T6|Q8N615|Q96T18|Q9BSV9|Q9HC82	Nonsense_Mutation	SNP	ENST00000324685.6	37	c.851G>A	CCDS10691.1	.	.	.	.	.	.	.	.	.	.	G	38	6.711612	0.97780	.	.	ENSG00000103549	ENST00000324685;ENST00000357890;ENST00000452273	.	.	.	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-22.0527	18.7978	0.92003	0.0:0.0:1.0:0.0	.	.	.	.	X	284;284;133	.	ENSP00000325677:W284X	W	+	2	0	RNF40	30684082	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.465000	0.97660	2.735000	0.93741	0.655000	0.94253	TGG		0.577	RNF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255524.2	NM_014771		4	72	0	0	0	0.009096	0	4	72				
CYLD	1540	broad.mit.edu	37	16	50816329	50816329	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr16:50816329G>A	ENST00000427738.3	+	10	1983	c.1778G>A	c.(1777-1779)gGc>gAc	p.G593D	RP11-327F22.4_ENST00000575917.1_RNA|CYLD_ENST00000311559.9_Missense_Mutation_p.G593D|CYLD_ENST00000540145.1_Missense_Mutation_p.G593D|CYLD_ENST00000564326.1_Missense_Mutation_p.G590D|CYLD_ENST00000566206.1_Missense_Mutation_p.G590D|CYLD_ENST00000568704.2_Missense_Mutation_p.G408D|RP11-327F22.4_ENST00000564510.1_RNA|CYLD_ENST00000398568.2_Missense_Mutation_p.G590D|CYLD_ENST00000569418.1_Missense_Mutation_p.G590D			Q9NQC7	CYLD_HUMAN	cylindromatosis (turban tumor syndrome)	593	Interaction with TRIP.|USP.				cell cycle (GO:0007049)|innate immune response (GO:0045087)|necroptotic process (GO:0070266)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|protein K63-linked deubiquitination (GO:0070536)|regulation of intrinsic apoptotic signaling pathway (GO:2001242)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of mitotic cell cycle (GO:0007346)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)	centrosome (GO:0005813)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|microtubule (GO:0005874)|nucleus (GO:0005634)	Lys63-specific deubiquitinase activity (GO:0061578)|proline-rich region binding (GO:0070064)|protein kinase binding (GO:0019901)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.G593D(1)		central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(9)|lung(17)|pancreas(1)|skin(22)|upper_aerodigestive_tract(1)	62		all_cancers(37;0.0156)				AAGAAGAAAGGCATCCAGGGT	0.373			"""Mis, N, F, S"""		cylindroma	cylindroma			Multiple Trichoepithelioma, Familial;Familial Cylindromatosis																														uc002egp.1		NA	yes	Rec	yes	Familial cylindromatosis	16	16q12-q13	1540	Mis|N|F|S	familial cylindromatosis gene			E		cylindroma	cylindroma		1	Substitution - Missense(1)		lung(1)	skin(19)|large_intestine(3)|haematopoietic_and_lymphoid_tissue(3)|central_nervous_system(3)	28						c.(1777-1779)GGC>GAC		ubiquitin carboxyl-terminal hydrolase CYLD							112.0	110.0	111.0					16																	50816329		1877	4110	5987	SO:0001583	missense	1540	Familial_Cylindromatosis|Multiple_Trichoepithelioma_Familial	Familial Cancer Database	;FADC, Turban Tumor syndrome, Epithelioma Adenoides Cysticum of Brooke, Hereditary Multiple Benign Cystic Epithelioma, Dermal Eccrine Cylindromatosis, Brooke-Spiegler s.	cell cycle|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|protein K63-linked deubiquitination|regulation of microtubule cytoskeleton organization|regulation of mitotic cell cycle|translation|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway	cytosol|extrinsic to internal side of plasma membrane|microtubule|perinuclear region of cytoplasm|ribosome	proline-rich region binding|protein kinase binding|structural constituent of ribosome|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding	g.chr16:50816329G>A	AB020656	CCDS42164.1, CCDS45482.1	16q12-q13	2014-09-17							2584	protein-coding gene	gene with protein product	"""ubiquitin specific peptidase like 2"""	605018		CYLD1		7493027	Standard	NM_015247		Approved	KIAA0849, USPL2	uc002egq.1	Q9NQC7		ENST00000427738.3:c.1778G>A	16.37:g.50816329G>A	ENSP00000392025:p.Gly593Asp					CYLD_uc002ego.2_Missense_Mutation_p.G590D|CYLD_uc010cbs.1_Missense_Mutation_p.G590D|CYLD_uc002egq.1_Missense_Mutation_p.G590D|CYLD_uc002egr.1_Missense_Mutation_p.G590D|CYLD_uc002egs.1_Missense_Mutation_p.G590D	p.G593D	NM_015247	NP_056062	Q9NQC7	CYLD_HUMAN			11	2193	+		all_cancers(37;0.0156)	593			Interaction with TRIP.		O94934|Q7L3N6|Q96EH0|Q9NZX9	Missense_Mutation	SNP	ENST00000427738.3	37	c.1778G>A	CCDS45482.1	.	.	.	.	.	.	.	.	.	.	G	28.8	4.950836	0.92660	.	.	ENSG00000083799	ENST00000540145;ENST00000311559;ENST00000427738;ENST00000398568	D;D;D	0.98012	-4.66;-4.66;-4.66	5.61	5.61	0.85477	Cytoskeleton-associated protein, Gly-rich domain (1);Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2, conserved site (1);Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	D	0.98707	0.9566	M	0.77103	2.36	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.99748	1.1017	10	0.72032	D	0.01	-19.3102	19.6376	0.95740	0.0:0.0:1.0:0.0	.	590;593;590;593	A8KAB0;F5H2R7;Q9NQC7-2;Q9NQC7	.;.;.;CYLD_HUMAN	D	593;593;590;590	ENSP00000445447:G593D;ENSP00000308928:G593D;ENSP00000381574:G590D	ENSP00000308928:G593D	G	+	2	0	CYLD	49373830	1.000000	0.71417	0.987000	0.45799	0.983000	0.72400	9.368000	0.97152	2.633000	0.89246	0.591000	0.81541	GGC		0.373	CYLD-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000422998.2			20	59	0	0	0	0.008871	0	20	59				
SALL1	6299	broad.mit.edu	37	16	51174774	51174774	+	Silent	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr16:51174774G>A	ENST00000251020.4	-	2	1392	c.1359C>T	c.(1357-1359)ttC>ttT	p.F453F	SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_Silent_p.F356F|SALL1_ENST00000541611.1_Intron|SALL1_ENST00000562674.1_5'Flank	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	453					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.F453F(1)		NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			CCTTCGCGCAGAACCTGCACT	0.512																																					GBM(103;1352 1446 1855 4775 8890)	GBM(103;1352 1446 1855 4775 8890)	uc010vgs.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(5)|ovary(3)	8						c.(1357-1359)TTC>TTT		sal-like 1 isoform a							106.0	98.0	100.0					16																	51174774		2198	4300	6498	SO:0001819	synonymous_variant	6299				adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr16:51174774G>A	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.1359C>T	16.37:g.51174774G>A						SALL1_uc010vgr.1_Silent_p.F356F|SALL1_uc010cbv.2_Intron	p.F453F	NM_002968	NP_002959	Q9NSC2	SALL1_HUMAN	COAD - Colon adenocarcinoma(2;0.24)		2	1390	-		all_cancers(37;0.0322)	453			C2H2-type 1.		Q99881|Q9NSC3|Q9P1R0	Silent	SNP	ENST00000251020.4	37	c.1359C>T	CCDS10747.1																																																																																				0.512	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968		23	161	0	0	0	0.002299	0	23	161				
CES1	1066	broad.mit.edu	37	16	55862795	55862795	+	Silent	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr16:55862795C>A	ENST00000361503.4	-	2	271	c.141G>T	c.(139-141)gtG>gtT	p.V47V	CES1_ENST00000422046.2_Silent_p.V47V|CES1_ENST00000566555.1_5'Flank|CES1_ENST00000360526.3_Silent_p.V48V			P23141	EST1_HUMAN	carboxylesterase 1	47					epithelial cell differentiation (GO:0030855)|metabolic process (GO:0008152)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)	carboxylic ester hydrolase activity (GO:0052689)|methylumbelliferyl-acetate deacetylase activity (GO:0047374)	p.V48V(1)							all cancers(182;0.13)|Epithelial(162;0.137)	Benzocaine(DB01086)|Capecitabine(DB01101)|Ciclesonide(DB01410)|Clopidogrel(DB00758)|Cyclandelate(DB04838)|Dabigatran etexilate(DB06695)|Indomethacin(DB00328)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Mycophenolate mofetil(DB00688)|Oseltamivir(DB00198)|Probucol(DB01599)|Rufinamide(DB06201)|Tamoxifen(DB00675)|Trandolapril(DB00519)	GGAAAATGGCCACAGGCTGTG	0.567																																					NSCLC(162;1801 2756 42904 52896)	NSCLC(162;1801 2756 42904 52896)	uc002eim.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(139-141)GTG>GTT		carboxylesterase 1 isoform b precursor	Aminoglutethimide(DB00357)|Bezafibrate(DB01393)|Cholestyramine(DB01432)|Moexipril(DB00691)						85.0	72.0	77.0					16																	55862795		2198	4300	6498	SO:0001819	synonymous_variant	1066				response to toxin	endoplasmic reticulum lumen	carboxylesterase activity|methyl indole-3-acetate esterase activity|methyl jasmonate esterase activity|methyl salicylate esterase activity	g.chr16:55862795C>A	BC012418	CCDS32450.1, CCDS45488.1, CCDS45489.1	16q22.2	2010-10-12	2010-10-12		ENSG00000198848	ENSG00000198848	3.1.1.1	"""Carboxylesterases"""	1863	protein-coding gene	gene with protein product	"""human monocyte/macrophage serine esterase 1"""	114835	"""carboxylesterase 1 (monocyte/macrophage serine esterase 1)"""			2070086, 20931200	Standard	XM_005255774		Approved	HMSE, CES2, HMSE1, SES1, CEH, CES1A1, CES1A2	uc002eil.3	P23141		ENST00000361503.4:c.141G>T	16.37:g.55862795C>A						CES1_uc002eil.2_Silent_p.V48V|CES1_uc002ein.2_Silent_p.V47V	p.V47V	NM_001025194	NP_001020365	P23141	EST1_HUMAN		all cancers(182;0.13)|Epithelial(162;0.137)	2	249	-			47					A6NIM1|A8K3K8|A8K844|E9PAU8|P82127|Q00015|Q13657|Q14062|Q16737|Q16788|Q549X7|Q549X8|Q86UK2|Q96EE8|Q9UC52|Q9UDG8|Q9UK77|Q9ULY2	Silent	SNP	ENST00000361503.4	37	c.141G>T	CCDS45488.1																																																																																				0.567	CES1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000433285.1	NM_001266		21	79	1	0	4.63292e-17	0.008871	7.13343e-17	21	79				
HYDIN	54768	broad.mit.edu	37	16	70867931	70867931	+	Missense_Mutation	SNP	C	C	T	rs201554059	byFrequency	TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr16:70867931C>T	ENST00000393567.2	-	79	13688	c.13538G>A	c.(13537-13539)cGc>cAc	p.R4513H		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	4513					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)		p.R4464H(1)|p.R4512H(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				GAAGAGGGGGCGCAGGAGCCC	0.557													C|||	4	0.000798722	0.0008	0.0	5008	,	,		15702	0.001		0.002	False		,,,				2504	0.0						uc002ezr.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|skin(1)	2						c.(13534-13536)CGC>CAC		hydrocephalus inducing isoform a		C	HIS/ARG	0,3238		0,0,1619	7.0	7.0	7.0		13535	3.9	1.0	16		7	13,7347		0,13,3667	no	missense	HYDIN	NM_032821.2	29	0,13,5286	TT,TC,CC		0.1766,0.0,0.1227	probably-damaging	4512/5121	70867931	13,10585	1619	3680	5299	SO:0001583	missense	54768							g.chr16:70867931C>T	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.13538G>A	16.37:g.70867931C>T	ENSP00000377197:p.Arg4513His					HYDIN_uc010cfy.2_RNA	p.R4512H	NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN			79	13663	-		Ovarian(137;0.0654)	4513					A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	37	c.13535G>A	CCDS59269.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.106393	0.77096	0.0	0.001766	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.00976	5.48	4.87	3.92	0.45320	.	0.000000	0.33631	U	0.004713	T	0.04452	0.0122	M	0.77103	2.36	0.80722	D	1	D	0.71674	0.998	D	0.64042	0.921	T	0.32640	-0.9899	10	0.52906	T	0.07	.	12.6292	0.56646	0.0:0.9187:0.0:0.0813	.	4512	F8WD23	.	H	4513;4512	ENSP00000377197:R4513H	ENSP00000313052:R4512H	R	-	2	0	HYDIN	69425432	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	1.555000	0.36277	1.050000	0.40346	0.511000	0.50034	CGC		0.557	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3			13	28	0	0	0	0.00499	0	13	28				
CALB2	794	broad.mit.edu	37	16	71418734	71418734	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr16:71418734G>T	ENST00000302628.4	+	9	699	c.622G>T	c.(622-624)Gac>Tac	p.D208Y	CALB2_ENST00000349553.5_Intron	NM_001740.4	NP_001731.2	P22676	CALB2_HUMAN	calbindin 2	208	EF-hand 5. {ECO:0000255|PROSITE- ProRule:PRU00448}.				cytosolic calcium ion homeostasis (GO:0051480)	cytoplasm (GO:0005737)|gap junction (GO:0005921)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.D208Y(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	18		Ovarian(137;0.125)				CACATTTTACGACAAGGTAAG	0.517																																							uc002faa.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(622-624)GAC>TAC		calbindin 2 isoform 1							247.0	215.0	226.0					16																	71418734		2198	4300	6498	SO:0001583	missense	794						calcium ion binding	g.chr16:71418734G>T	X56667	CCDS10899.1	16q22.2	2013-01-10	2008-05-19		ENSG00000172137	ENSG00000172137		"""EF-hand domain containing"""	1435	protein-coding gene	gene with protein product	"""calretinin"""	114051	"""calbindin 2, 29kDa (calretinin)"""			1906795	Standard	NM_001740		Approved	CAL2	uc002faa.4	P22676	OTTHUMG00000137589	ENST00000302628.4:c.622G>T	16.37:g.71418734G>T	ENSP00000307508:p.Asp208Tyr					CALB2_uc010vme.1_RNA|CALB2_uc002fac.3_Intron	p.D208Y	NM_001740	NP_001731	P22676	CALB2_HUMAN			9	692	+		Ovarian(137;0.125)	208			5 (Probable).|EF-hand 5.		A8K4Y1|Q53HD2|Q96BK4	Missense_Mutation	SNP	ENST00000302628.4	37	c.622G>T	CCDS10899.1	.	.	.	.	.	.	.	.	.	.	g	19.44	3.828685	0.71258	.	.	ENSG00000172137	ENST00000302628	D	0.97831	-4.56	5.7	5.7	0.88788	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.99251	0.9739	H	0.97131	3.945	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98942	1.0791	10	0.87932	D	0	-20.4528	18.7235	0.91704	0.0:0.0:1.0:0.0	.	208	P22676	CALB2_HUMAN	Y	208	ENSP00000307508:D208Y	ENSP00000307508:D208Y	D	+	1	0	CALB2	69976235	1.000000	0.71417	1.000000	0.80357	0.534000	0.34807	7.575000	0.82447	2.700000	0.92200	0.627000	0.83407	GAC		0.517	CALB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268988.1	NM_001740		7	155	1	0	0.00307968	0.00308	0.00329046	7	155				
ITGAE	3682	broad.mit.edu	37	17	3663536	3663536	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr17:3663536G>T	ENST00000263087.4	-	7	742	c.644C>A	c.(643-645)cCc>cAc	p.P215H		NM_002208.4	NP_002199.3	P38570	ITAE_HUMAN	integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide)	215	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	external side of plasma membrane (GO:0009897)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)	p.P215H(1)		NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41				UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)		AAAGTCTGGGGGATCAATGCT	0.498																																					NSCLC(182;635 2928 8995 38788)	NSCLC(182;635 2928 8995 38788)	uc002fwo.3		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)|breast(1)|pancreas(1)	4						c.(643-645)CCC>CAC		integrin, alpha E precursor							108.0	89.0	95.0					17																	3663536		2203	4300	6503	SO:0001583	missense	3682				cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity	g.chr17:3663536G>T	L25851	CCDS32531.1	17p13	2010-03-23				ENSG00000083457		"""CD molecules"", ""Integrins"""	6147	protein-coding gene	gene with protein product		604682				8119947	Standard	NM_002208		Approved	CD103, HUMINAE	uc002fwo.4	P38570		ENST00000263087.4:c.644C>A	17.37:g.3663536G>T	ENSP00000263087:p.Pro215His						p.P215H	NM_002208	NP_002199	P38570	ITAE_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)	7	743	-			215			VWFA.|Extracellular (Potential).		Q17RS6|Q9NZU9	Missense_Mutation	SNP	ENST00000263087.4	37	c.644C>A	CCDS32531.1	.	.	.	.	.	.	.	.	.	.	G	15.16	2.751857	0.49362	.	.	ENSG00000083457	ENST00000263087	D	0.83591	-1.74	5.54	4.56	0.56223	von Willebrand factor, type A (3);	.	.	.	.	D	0.88299	0.6399	M	0.66378	2.025	0.09310	N	1	D	0.89917	1.0	D	0.77004	0.989	T	0.78237	-0.2282	9	0.51188	T	0.08	.	7.903	0.29746	0.0855:0.0:0.7515:0.163	.	215	P38570	ITAE_HUMAN	H	215	ENSP00000263087:P215H	ENSP00000263087:P215H	P	-	2	0	ITGAE	3610285	0.004000	0.15560	0.042000	0.18584	0.796000	0.44982	1.319000	0.33655	2.794000	0.96219	0.603000	0.83216	CCC		0.498	ITGAE-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438169.1	NM_002208		9	38	1	0	7.48243e-07	0.006214	9.30337e-07	9	38				
CAMTA2	23125	broad.mit.edu	37	17	4884585	4884585	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr17:4884585A>G	ENST00000348066.3	-	8	758	c.635T>C	c.(634-636)aTt>aCt	p.I212T	CAMTA2_ENST00000358183.4_Missense_Mutation_p.I212T|CAMTA2_ENST00000381311.5_Missense_Mutation_p.I214T|CAMTA2_ENST00000414043.3_Missense_Mutation_p.I235T|CAMTA2_ENST00000572543.1_Missense_Mutation_p.I217T|CAMTA2_ENST00000571831.1_5'Flank|CAMTA2_ENST00000361571.5_Missense_Mutation_p.I211T	NM_015099.3	NP_055914.2	O94983	CMTA2_HUMAN	calmodulin binding transcription activator 2	212					cardiac muscle hypertrophy in response to stress (GO:0014898)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|transcription factor binding (GO:0008134)	p.I212T(1)		breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(5)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	31						GGTGTCCAAAATCTGCTGCAC	0.547											OREG0024111	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002gah.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(634-636)ATT>ACT		calmodulin binding transcription activator 2							161.0	148.0	152.0					17																	4884585		2203	4300	6503	SO:0001583	missense	23125				cardiac muscle hypertrophy in response to stress|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	calmodulin binding|chromatin binding|histone deacetylase binding|transcription factor binding	g.chr17:4884585A>G	AB020716	CCDS11063.1, CCDS54071.1, CCDS54072.1, CCDS54073.1	17p13.3	2004-09-01			ENSG00000108509	ENSG00000108509			18807	protein-coding gene	gene with protein product		611508				11925432	Standard	NM_015099		Approved	KIAA0909	uc010cku.2	O94983	OTTHUMG00000099417	ENST00000348066.3:c.635T>C	17.37:g.4884585A>G	ENSP00000321813:p.Ile212Thr		OREG0024111	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	622	CAMTA2_uc010cku.1_Missense_Mutation_p.I235T|CAMTA2_uc002gag.1_Missense_Mutation_p.I211T|CAMTA2_uc002gai.1_Missense_Mutation_p.I214T|CAMTA2_uc010ckv.1_5'Flank|CAMTA2_uc010vsu.1_Missense_Mutation_p.I25T	p.I212T	NM_015099	NP_055914	O94983	CMTA2_HUMAN			8	743	-			212					B9EGL0|D3DTL5|E7EWU5|Q7Z6M8|Q8N3V0|Q8NDG4|Q96G17	Missense_Mutation	SNP	ENST00000348066.3	37	c.635T>C	CCDS11063.1	.	.	.	.	.	.	.	.	.	.	A	17.29	3.352149	0.61183	.	.	ENSG00000108509	ENST00000414043;ENST00000381311;ENST00000361571;ENST00000358183;ENST00000348066	T;T;T;T;T	0.38722	2.31;1.34;1.15;1.34;1.12	5.08	5.08	0.68730	.	0.000000	0.64402	D	0.000001	T	0.46560	0.1399	N	0.24115	0.695	0.43321	D	0.995346	B;P;P;D	0.55385	0.374;0.947;0.47;0.971	B;P;B;P	0.62885	0.362;0.908;0.35;0.908	T	0.41645	-0.9497	10	0.41790	T	0.15	-14.5493	12.8542	0.57876	1.0:0.0:0.0:0.0	.	235;214;212;211	E7EWU5;O94983-3;O94983;O94983-4	.;.;CMTA2_HUMAN;.	T	235;214;211;212;212	ENSP00000412886:I235T;ENSP00000370712:I214T;ENSP00000354828:I211T;ENSP00000350910:I212T;ENSP00000321813:I212T	ENSP00000321813:I212T	I	-	2	0	CAMTA2	4825309	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.735000	0.91549	2.129000	0.65627	0.459000	0.35465	ATT		0.547	CAMTA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216876.1	NM_015099		14	106	0	0	0	0.003163	0	14	106				
TP53	7157	broad.mit.edu	37	17	7577108	7577108	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr17:7577108C>A	ENST00000269305.4	-	8	1019	c.830G>T	c.(829-831)tGt>tTt	p.C277F	TP53_ENST00000445888.2_Missense_Mutation_p.C277F|TP53_ENST00000359597.4_Missense_Mutation_p.C277F|TP53_ENST00000420246.2_Missense_Mutation_p.C277F|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.C277F	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	277	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in an osteosarcoma with no family history; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C277F(24)|p.C277Y(15)|p.0?(8)|p.?(2)|p.A276_R283delACPGRDRR(1)|p.C275fs*20(1)|p.A276fs*64(1)|p.L265_K305del41(1)|p.A276_C277delAC(1)|p.F270_D281del12(1)|p.V274_P278del(1)|p.S269fs*21(1)|p.C275fs*67(1)|p.C277S(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCTCCCAGGACAGGCACAAAC	0.547		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		61	Substitution - Missense(40)|Whole gene deletion(8)|Deletion - In frame(7)|Deletion - Frameshift(4)|Unknown(2)	p.C277F(20)|p.C277Y(15)|p.0?(7)|p.C277*(6)|p.C277G(4)|p.C277C(4)|p.?(2)|p.C277W(2)|p.C277fs*29(2)|p.A276_R283delACPGRDRR(1)|p.A276fs*64(1)|p.V274_P278del(1)|p.C277_P278insXXXXXXX(1)|p.L265_K305del41(1)|p.C275_R283delCACPGRDRR(1)|p.S269fs*21(1)|p.A276_C277delAC(1)|p.F270_D281del12(1)|p.C275fs*67(1)|p.C277R(1)|p.C277S(1)|p.V272_K292del21(1)|p.C275fs*20(1)	lung(11)|haematopoietic_and_lymphoid_tissue(9)|breast(6)|bone(6)|upper_aerodigestive_tract(5)|oesophagus(5)|stomach(4)|urinary_tract(4)|central_nervous_system(3)|skin(2)|cervix(1)|peritoneum(1)|large_intestine(1)|ovary(1)|prostate(1)|liver(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245						c.(829-831)TGT>TTT	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							72.0	62.0	66.0					17																	7577108		2203	4300	6503	SO:0001583	missense	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7577108C>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.830G>T	17.37:g.7577108C>A	ENSP00000269305:p.Cys277Phe	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.C277F|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.C145F|TP53_uc010cng.1_Missense_Mutation_p.C145F|TP53_uc002gii.1_Missense_Mutation_p.C145F|TP53_uc010cnh.1_Missense_Mutation_p.C277F|TP53_uc010cni.1_Missense_Mutation_p.C277F|TP53_uc002gij.2_Missense_Mutation_p.C277F	p.C277F	NM_001126112	NP_001119584	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	8	1024	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	277		C -> W (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> F (in sporadic cancers; somatic mutation).|C -> Y (in an osteosarcoma with no family history; germline mutation and in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).	Interaction with DNA.||Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	c.830G>T	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.209345	0.79240	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99874	-7.39;-7.39;-7.39;-7.39;-7.39;-7.39	5.13	5.13	0.70059	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.044315	0.85682	D	0.000000	D	0.99880	0.9943	M	0.91872	3.25	0.58432	D	0.999999	D;D;D;D	0.89917	0.999;1.0;1.0;0.998	D;D;D;D	0.85130	0.982;0.997;0.99;0.986	D	0.96422	0.9312	10	0.87932	D	0	-10.0792	16.1198	0.81342	0.0:1.0:0.0:0.0	.	277;277;277;277	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	F	277;277;277;277;277;266;145	ENSP00000352610:C277F;ENSP00000269305:C277F;ENSP00000398846:C277F;ENSP00000391127:C277F;ENSP00000391478:C277F;ENSP00000425104:C145F	ENSP00000269305:C277F	C	-	2	0	TP53	7517833	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	5.781000	0.68964	2.667000	0.90743	0.462000	0.41574	TGT		0.547	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		13	37	1	0	5.50884e-06	0.001368	6.55925e-06	13	37				
TP53	7157	broad.mit.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	C	T	rs28934578		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr17:7578406C>T	ENST00000269305.4	-	5	713	c.524G>A	c.(523-525)cGc>cAc	p.R175H	TP53_ENST00000445888.2_Missense_Mutation_p.R175H|TP53_ENST00000359597.4_Missense_Mutation_p.R175H|TP53_ENST00000420246.2_Missense_Mutation_p.R175H|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000413465.2_Missense_Mutation_p.R175H|TP53_ENST00000455263.2_Missense_Mutation_p.R175H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	175	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; reduces interaction with ZNF385A; dbSNP:rs28934578). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:8825920}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R175H(847)|p.R43H(36)|p.R82H(36)|p.R175L(19)|p.0?(8)|p.R175P(6)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTGGGGGCAGCGCCTCACAAC	0.652	R175H(AU565_BREAST)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(HCC1395_BREAST)|R175H(HUCCT1_BILIARY_TRACT)|R175H(KLE_ENDOMETRIUM)|R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(LS123_LARGE_INTESTINE)|R175H(NCIH196_LUNG)|R175H(RKN_OVARY)|R175H(SKBR3_BREAST)|R175H(SKUT1_SOFT_TISSUE)|R175H(TYKNU_OVARY)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2	R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(HCC1395_BREAST)|R175H(KLE_ENDOMETRIUM)|R175H(NCIH196_LUNG)|R175H(AU565_BREAST)|R175H(TYKNU_OVARY)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(SKUT1_SOFT_TISSUE)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(LS123_LARGE_INTESTINE)|R175H(SKBR3_BREAST)|R175H(RKN_OVARY)|R175H(HUCCT1_BILIARY_TRACT)	111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		980	Substitution - Missense(944)|Deletion - Frameshift(17)|Whole gene deletion(8)|Deletion - In frame(8)|Complex - deletion inframe(3)	p.R175H(729)|p.R175L(19)|p.R175C(12)|p.R175G(11)|p.0?(7)|p.R175P(5)|p.R175S(5)|p.R43H(5)|p.R82H(5)|p.R175R(4)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.R175fs*5(2)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.K164_P219del(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*6(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R175fs*72(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)	large_intestine(350)|breast(103)|upper_aerodigestive_tract(74)|stomach(70)|central_nervous_system(69)|oesophagus(67)|ovary(58)|lung(40)|haematopoietic_and_lymphoid_tissue(39)|urinary_tract(22)|prostate(17)|liver(14)|pancreas(11)|endometrium(10)|biliary_tract(10)|bone(9)|kidney(4)|cervix(4)|skin(3)|vulva(2)|soft_tissue(2)|penis(1)|adrenal_gland(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245	GRCh37	CM062017|CM951224	TP53	M	rs28934578	c.(523-525)CGC>CAC	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							50.0	50.0	50.0					17																	7578406		2203	4300	6503	SO:0001583	missense	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7578406C>T	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.524G>A	17.37:g.7578406C>T	ENSP00000269305:p.Arg175His	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_uc002gig.1_Missense_Mutation_p.R175H|TP53_uc002gih.2_Missense_Mutation_p.R175H|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R43H|TP53_uc010cng.1_Missense_Mutation_p.R43H|TP53_uc002gii.1_Missense_Mutation_p.R43H|TP53_uc010cnh.1_Missense_Mutation_p.R175H|TP53_uc010cni.1_Missense_Mutation_p.R175H|TP53_uc002gij.2_Missense_Mutation_p.R175H|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.R82H|TP53_uc002gio.2_Missense_Mutation_p.R43H|TP53_uc010vug.1_Missense_Mutation_p.R136H	p.R175H	NM_001126112	NP_001119584	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	5	718	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	175		R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> C (in sporadic cancers; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	c.524G>A	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	31	5.079737	0.94050	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99889	-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.101149	0.64402	D	0.000008	D	0.99908	0.9956	M	0.92784	3.345	0.80722	A	1	D;P;D;D;P;B;D	0.89917	0.999;0.578;1.0;0.998;0.632;0.213;0.999	D;B;D;D;B;B;D	0.91635	0.985;0.26;0.999;0.921;0.378;0.144;0.939	D	0.96278	0.9204	9	0.87932	D	0	-11.8679	17.0767	0.86588	0.0:1.0:0.0:0.0	rs28934578	136;175;175;82;175;175;175	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	175;175;175;175;175;175;164;82;43;82;43	ENSP00000410739:R175H;ENSP00000352610:R175H;ENSP00000269305:R175H;ENSP00000398846:R175H;ENSP00000391127:R175H;ENSP00000391478:R175H;ENSP00000425104:R43H;ENSP00000423862:R82H	ENSP00000269305:R175H	R	-	2	0	TP53	7519131	1.000000	0.71417	0.989000	0.46669	0.795000	0.44927	6.042000	0.70996	2.702000	0.92279	0.655000	0.94253	CGC		0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		12	62	0	0	0	0.000978	0	12	62				
WDR16	146845	broad.mit.edu	37	17	9538752	9538752	+	Nonsense_Mutation	SNP	C	C	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr17:9538752C>T	ENST00000352665.5	+	11	1420	c.1351C>T	c.(1351-1353)Cag>Tag	p.Q451*	WDR16_ENST00000576714.1_3'UTR|WDR16_ENST00000396219.3_Nonsense_Mutation_p.Q383*|WDR16_ENST00000299764.5_Nonsense_Mutation_p.Q461*	NM_145054.4	NP_659491.4			WD repeat domain 16									p.Q451*(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	31						CTGTCAGACCCAGAAGCTGGA	0.532																																							uc002gly.2		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(2)|ovary(1)|central_nervous_system(1)	4						c.(1351-1353)CAG>TAG		WD40-repeat protein upregulated in HCC isoform							127.0	102.0	110.0					17																	9538752		2203	4300	6503	SO:0001587	stop_gained	146845					cytoplasm|intracellular membrane-bounded organelle	protein binding	g.chr17:9538752C>T	AB065281	CCDS11149.2, CCDS42262.1	17p13.1	2014-08-01			ENSG00000166596	ENSG00000166596		"""WD repeat domain containing"""	16053	protein-coding gene	gene with protein product	"""WD40-repeat protein upregulated in HCC"""	609804				15967112	Standard	NM_001080556		Approved	WDRPUH, FLJ37528	uc002gly.3	Q8N1V2	OTTHUMG00000150149	ENST00000352665.5:c.1351C>T	17.37:g.9538752C>T	ENSP00000339449:p.Gln451*					WDR16_uc002glz.2_Nonsense_Mutation_p.Q383*|WDR16_uc010coc.2_Nonsense_Mutation_p.Q461*	p.Q451*	NM_145054	NP_659491	Q8N1V2	WDR16_HUMAN			11	1420	+			451			WD 7.			Nonsense_Mutation	SNP	ENST00000352665.5	37	c.1351C>T	CCDS11149.2	.	.	.	.	.	.	.	.	.	.	C	40	8.461950	0.98822	.	.	ENSG00000166596	ENST00000352665;ENST00000396219;ENST00000299764	.	.	.	5.08	5.08	0.68730	.	0.175656	0.52532	D	0.000064	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.6514	17.2628	0.87075	0.0:1.0:0.0:0.0	.	.	.	.	X	451;383;461	.	ENSP00000299764:Q461X	Q	+	1	0	WDR16	9479477	0.996000	0.38824	0.995000	0.50966	0.712000	0.41017	3.342000	0.52159	2.351000	0.79841	0.655000	0.94253	CAG		0.532	WDR16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316569.2	NM_145054		7	90	0	0	0	0.00308	0	7	90				
MYH4	4622	broad.mit.edu	37	17	10358324	10358324	+	Missense_Mutation	SNP	G	G	A	rs143572602	byFrequency	TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr17:10358324G>A	ENST00000255381.2	-	21	2479	c.2369C>T	c.(2368-2370)aCg>aTg	p.T790M	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	790	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)	p.T790M(2)		NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						TTGAGTGCGCGTGATGAGTTG	0.458													G|||	3	0.000599042	0.0023	0.0	5008	,	,		18220	0.0		0.0	False		,,,				2504	0.0						uc002gmn.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(10)|skin(2)|central_nervous_system(1)	13						c.(2368-2370)ACG>ATG		myosin, heavy polypeptide 4, skeletal muscle		G	MET/THR	7,4399	12.9+/-30.5	0,7,2196	299.0	137.0	192.0		2369	5.0	1.0	17	dbSNP_134	192	1,8599		0,1,4299	yes	missense	MYH4	NM_017533.2	81	0,8,6495	AA,AG,GG		0.0116,0.1589,0.0615	probably-damaging	790/1940	10358324	8,12998	2203	4300	6503	SO:0001583	missense	4622				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr17:10358324G>A		CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.2369C>T	17.37:g.10358324G>A	ENSP00000255381:p.Thr790Met					uc002gml.1_Intron	p.T790M	NM_017533	NP_060003	Q9Y623	MYH4_HUMAN			21	2480	-			790			IQ.			Missense_Mutation	SNP	ENST00000255381.2	37	c.2369C>T	CCDS11154.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.289067	0.80914	0.001589	1.16E-4	ENSG00000141048	ENST00000255381	D	0.93659	-3.26	5.04	5.04	0.67666	.	0.000000	0.38492	U	0.001680	D	0.93245	0.7848	M	0.88450	2.955	0.80722	D	1	P	0.48089	0.905	B	0.33196	0.159	D	0.94977	0.8122	10	0.87932	D	0	.	18.7298	0.91731	0.0:0.0:1.0:0.0	.	790	Q9Y623	MYH4_HUMAN	M	790	ENSP00000255381:T790M	ENSP00000255381:T790M	T	-	2	0	MYH4	10299049	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	7.871000	0.87180	2.497000	0.84241	0.313000	0.20887	ACG		0.458	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1	NM_017533		6	77	0	0	0	0.001168	0	6	77				
MYH3	4621	broad.mit.edu	37	17	10533474	10533474	+	Missense_Mutation	SNP	T	T	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr17:10533474T>G	ENST00000583535.1	-	38	5584	c.5497A>C	c.(5497-5499)Aag>Cag	p.K1833Q	MYH3_ENST00000226209.7_Missense_Mutation_p.K1833Q	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	1833					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)	p.K1833Q(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						TCTGTGTTCTTCTTCTGCTCT	0.547																																							uc002gmq.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(2)|pancreas(1)	7						c.(5497-5499)AAG>CAG		myosin, heavy chain 3, skeletal muscle,							268.0	265.0	266.0					17																	10533474		2203	4300	6503	SO:0001583	missense	4621				muscle filament sliding|muscle organ development	cytosol|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity	g.chr17:10533474T>G		CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.5497A>C	17.37:g.10533474T>G	ENSP00000464317:p.Lys1833Gln						p.K1833Q	NM_002470	NP_002461	P11055	MYH3_HUMAN			37	5574	-			1833			Potential.		Q15492	Missense_Mutation	SNP	ENST00000583535.1	37	c.5497A>C	CCDS11157.1	.	.	.	.	.	.	.	.	.	.	T	15.18	2.757259	0.49468	.	.	ENSG00000109063	ENST00000226209	T	0.78003	-1.14	4.83	4.83	0.62350	Myosin tail (1);	.	.	.	.	T	0.76456	0.3990	M	0.67953	2.075	0.22926	N	0.998553	B	0.26318	0.146	B	0.29440	0.102	T	0.69760	-0.5058	9	0.59425	D	0.04	.	11.2401	0.48964	0.0:0.0:0.1962:0.8038	.	1833	P11055	MYH3_HUMAN	Q	1833	ENSP00000226209:K1833Q	ENSP00000226209:K1833Q	K	-	1	0	MYH3	10474199	0.368000	0.25031	1.000000	0.80357	0.985000	0.73830	1.619000	0.36965	2.159000	0.67721	0.533000	0.62120	AAG		0.547	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252734.2	NM_002470		23	376	0	0	0	0.004656	0	23	376				
DRG2	1819	broad.mit.edu	37	17	18002385	18002385	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr17:18002385G>A	ENST00000225729.3	+	4	508	c.370G>A	c.(370-372)Gcc>Acc	p.A124T	DRG2_ENST00000583355.1_Intron|DRG2_ENST00000395726.4_Missense_Mutation_p.A124T	NM_001388.4	NP_001379.1	P55039	DRG2_HUMAN	developmentally regulated GTP binding protein 2	124	OBG-type G. {ECO:0000255|PROSITE- ProRule:PRU01047}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)	p.A124T(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	14	all_neural(463;0.228)					TGAAGGCGCAGCCCAAGGTGG	0.547																																							uc002gsh.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(370-372)GCC>ACC		developmentally regulated GTP binding protein 2							96.0	93.0	94.0					17																	18002385		2203	4300	6503	SO:0001583	missense	1819				signal transduction		GTP binding	g.chr17:18002385G>A	X80754	CCDS11191.1	17p13-p12	2008-07-18	2001-11-28		ENSG00000108591	ENSG00000108591			3030	protein-coding gene	gene with protein product		602986	"""developmentally regulated GTP-binding protein 2"""			9605870, 7929244	Standard	NM_001388		Approved		uc002gsh.2	P55039	OTTHUMG00000059399	ENST00000225729.3:c.370G>A	17.37:g.18002385G>A	ENSP00000225729:p.Ala124Thr					DRG2_uc010vxg.1_Missense_Mutation_p.A124T|DRG2_uc002gsi.1_RNA|DRG2_uc002gsj.1_Missense_Mutation_p.A124T	p.A124T	NM_001388	NP_001379	P55039	DRG2_HUMAN			4	425	+	all_neural(463;0.228)		124			G.		B2R8G5|Q53Y50|Q9BWB2	Missense_Mutation	SNP	ENST00000225729.3	37	c.370G>A	CCDS11191.1	.	.	.	.	.	.	.	.	.	.	G	18.47	3.631645	0.67015	.	.	ENSG00000108591	ENST00000395726;ENST00000225729	T;T	0.16897	2.31;2.31	5.05	5.05	0.67936	GTP1/OBG, conserved site (1);Small GTP-binding protein domain (1);GTP1/OBG (1);GTP-binding domain, HSR1-related (1);	0.000000	0.85682	D	0.000000	T	0.48241	0.1489	M	0.84433	2.695	0.80722	D	1	D;P;P	0.69078	0.997;0.866;0.587	D;P;P	0.79108	0.992;0.676;0.559	T	0.54892	-0.8225	10	0.56958	D	0.05	-17.8611	18.4054	0.90533	0.0:0.0:1.0:0.0	.	124;124;124	B4DIG2;A8MZF9;P55039	.;.;DRG2_HUMAN	T	124	ENSP00000379076:A124T;ENSP00000225729:A124T	ENSP00000225729:A124T	A	+	1	0	DRG2	17943110	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.713000	0.98740	2.344000	0.79699	0.563000	0.77884	GCC		0.547	DRG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132075.3	NM_001388		5	83	0	0	0	0.001168	0	5	83				
ZNF286B	729288	broad.mit.edu	37	17	18566444	18566444	+	Silent	SNP	T	T	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr17:18566444T>G	ENST00000545289.1	-	5	625	c.375A>C	c.(373-375)tcA>tcC	p.S125S	ZNF286B_ENST00000285274.5_3'UTR	NM_001145045.1	NP_001138517.1	P0CG31	Z286B_HUMAN	zinc finger protein 286B	125					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S125S(2)		endometrium(1)|lung(1)	2						AATCTTGCACTGAAGTTGAAT	0.413																																							uc010vyd.1		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(373-375)TCA>TCC		zinc finger protein 286B							103.0	84.0	90.0					17																	18566444		692	1591	2283	SO:0001819	synonymous_variant	729288				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr17:18566444T>G		CCDS58523.1	17p11.2	2013-01-08			ENSG00000249459	ENSG00000249459		"""Zinc fingers, C2H2-type"""	33241	protein-coding gene	gene with protein product	"""zinc finger protein 590"""		"""zinc finger protein 286-like"", ""zinc finger 286C pseudogene"""	ZNF286L, ZNF286C			Standard	NM_001145045		Approved	ZNF590	uc010vyd.1	P0CG31	OTTHUMG00000178136	ENST00000545289.1:c.375A>C	17.37:g.18566444T>G							p.S125S	NM_001145045	NP_001138517	P0CG31	Z286B_HUMAN			5	626	-			125						Silent	SNP	ENST00000545289.1	37	c.375A>C	CCDS58523.1																																																																																				0.413	ZNF286B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_001723047		4	67	0	0	0	0.009096	0	4	67				
MAPK7	5598	broad.mit.edu	37	17	19283155	19283155	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr17:19283155G>A	ENST00000308406.5	+	3	679	c.293G>A	c.(292-294)cGg>cAg	p.R98Q	MAPK7_ENST00000395604.3_Missense_Mutation_p.R98Q|B9D1_ENST00000468679.3_5'Flank|MAPK7_ENST00000299612.7_Intron|B9D1_ENST00000477478.2_5'Flank|MAPK7_ENST00000571657.1_Intron|MAPK7_ENST00000395602.4_Missense_Mutation_p.R98Q|B9D1_ENST00000575403.1_5'Flank	NM_139033.2	NP_620602.2	Q13164	MK07_HUMAN	mitogen-activated protein kinase 7	98	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.|Required for binding to MAP2K5. {ECO:0000250}.				cAMP-mediated signaling (GO:0019933)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to transforming growth factor beta stimulus (GO:0071560)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cAMP catabolic process (GO:0030821)|negative regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051344)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NFAT protein import into nucleus (GO:0051534)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of response to cytokine stimulus (GO:0060761)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|regulation of angiogenesis (GO:0045765)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|mitogen-activated protein kinase binding (GO:0051019)	p.R98Q(1)		autonomic_ganglia(1)|central_nervous_system(4)|endometrium(5)|kidney(2)|large_intestine(4)|lung(9)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	30	all_cancers(12;2.87e-05)|all_epithelial(12;0.00114)|Hepatocellular(7;0.00345)|Breast(13;0.206)					AATGCCAAGCGGACCCTCAGG	0.527																																							uc002gvn.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(4)|lung(3)|stomach(1)|skin(1)	9						c.(292-294)CGG>CAG		mitogen-activated protein kinase 7 isoform 1							121.0	111.0	114.0					17																	19283155		2203	4300	6503	SO:0001583	missense	5598				cell cycle|cell differentiation|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase activity|protein binding	g.chr17:19283155G>A	U25278	CCDS11206.1, CCDS11207.1	17p11.2	2011-06-09			ENSG00000166484	ENSG00000166484	2.7.11.24	"""Mitogen-activated protein kinase cascade / Kinases"""	6880	protein-coding gene	gene with protein product	"""BMK1 kinase"", ""extracellular-signal-regulated kinase 5"""	602521		PRKM7		10072598, 7759517	Standard	NM_139032		Approved	BMK1, ERK5	uc002gvp.3	Q13164	OTTHUMG00000059587	ENST00000308406.5:c.293G>A	17.37:g.19283155G>A	ENSP00000311005:p.Arg98Gln					B9D1_uc010cqm.1_5'Flank|B9D1_uc002gvl.3_5'Flank|MAPK7_uc002gvo.2_Intron|MAPK7_uc002gvq.2_Missense_Mutation_p.R98Q|MAPK7_uc002gvp.2_Missense_Mutation_p.R98Q	p.R98Q	NM_139033	NP_620602	Q13164	MK07_HUMAN			3	679	+	all_cancers(12;2.87e-05)|all_epithelial(12;0.00114)|Hepatocellular(7;0.00345)|Breast(13;0.206)		98			Required for binding to MAP2K5 (By similarity).|Protein kinase.		Q16634|Q59F50|Q6QLU7|Q7L4P4|Q969G1|Q96G51	Missense_Mutation	SNP	ENST00000308406.5	37	c.293G>A	CCDS11206.1	.	.	.	.	.	.	.	.	.	.	G	33	5.286584	0.95517	.	.	ENSG00000166484	ENST00000308406;ENST00000443215;ENST00000395604;ENST00000395602	T;T;T;T	0.64803	-0.12;-0.12;-0.12;-0.12	4.31	4.31	0.51392	Serine/threonine-protein kinase-like domain (1);MAP kinase, conserved site (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.77336	0.4115	M	0.70842	2.15	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.80420	-0.1390	10	0.87932	D	0	-17.5882	14.6907	0.69083	0.0:0.0:1.0:0.0	.	98	Q13164	MK07_HUMAN	Q	98	ENSP00000311005:R98Q;ENSP00000412902:R98Q;ENSP00000378968:R98Q;ENSP00000378966:R98Q	ENSP00000311005:R98Q	R	+	2	0	MAPK7	19223748	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	9.187000	0.94912	2.396000	0.81511	0.563000	0.77884	CGG		0.527	MAPK7-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132506.1	NM_139033		9	140	0	0	0	0.008291	0	9	140				
SARM1	23098	broad.mit.edu	37	17	26715397	26715397	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr17:26715397G>T	ENST00000457710.3	+	7	2131	c.1660G>T	c.(1660-1662)Ggc>Tgc	p.G554C	SARM1_ENST00000379061.4_3'UTR	NM_015077.2	NP_055892.2	Q6SZW1	SARM1_HUMAN	sterile alpha and TIR motif containing 1	588					innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|regulation of apoptotic process (GO:0042981)|regulation of dendrite morphogenesis (GO:0048814)|regulation of neuron death (GO:1901214)|response to glucose (GO:0009749)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of mitochondrial outer membrane (GO:0031315)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|synapse (GO:0045202)		p.G586C(1)		cervix(1)|endometrium(1)|large_intestine(3)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	12	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		GCAGCTGCATGGCTTCAGTGT	0.582																																							uc010crl.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1762-1764)GGC>TGC		sterile alpha and TIR motif containing 1							88.0	73.0	78.0					17																	26715397		2203	4300	6503	SO:0001583	missense	23098				innate immune response	cytoplasm|intrinsic to membrane	binding|transmembrane receptor activity	g.chr17:26715397G>T	AB011096		17q11	2013-01-10			ENSG00000004139	ENSG00000004139		"""Sterile alpha motif (SAM) domain containing"""	17074	protein-coding gene	gene with protein product		607732				9628581	Standard	NM_015077		Approved	SARM, SAMD2, KIAA0524	uc010crl.1	Q6SZW1	OTTHUMG00000132499	ENST00000457710.3:c.1660G>T	17.37:g.26715397G>T	ENSP00000406738:p.Gly554Cys					SARM1_uc010waj.1_RNA|SARM1_uc002hbe.1_Missense_Mutation_p.G132C	p.G588C	NM_015077	NP_055892	Q6SZW1	SARM1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (53;0.154)	10	1829	+	all_lung(13;0.000533)|Lung NSC(42;0.00171)		588			TIR.		O60277|Q7LGG3|Q9NXY5	Missense_Mutation	SNP	ENST00000457710.3	37	c.1762G>T		.	.	.	.	.	.	.	.	.	.	G	29.6	5.021297	0.93462	.	.	ENSG00000004139	ENST00000457710;ENST00000003834	.	.	.	5.39	5.39	0.77823	Toll/interleukin-1 receptor homology (TIR) domain (2);	0.000000	0.85682	D	0.000000	T	0.80737	0.4680	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82713	-0.0321	8	0.87932	D	0	-36.2537	17.5118	0.87762	0.0:0.0:1.0:0.0	.	588	Q6SZW1	SARM1_HUMAN	C	586;554	.	ENSP00000003834:G554C	G	+	1	0	SARM1	23739524	1.000000	0.71417	0.994000	0.49952	0.993000	0.82548	9.657000	0.98554	2.795000	0.96236	0.655000	0.94253	GGC		0.582	SARM1-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000255679.3	NM_015077		14	53	1	0	9.05144e-12	0.001855	1.28783e-11	14	53				
SUPT6H	6830	broad.mit.edu	37	17	27009765	27009766	+	Missense_Mutation	DNP	GG	GG	TC			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr17:27009765_27009766GG>TC	ENST00000314616.6	+	14	1901_1902	c.1618_1619GG>TC	c.(1618-1620)GGg>TCg	p.G540S	SUPT6H_ENST00000347486.4_Missense_Mutation_p.G540S	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	540	Interaction with KDM6A. {ECO:0000250}.|Interaction with PAAF1.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G540S(1)		NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					CAAAAAGTTTGGGCTTACTCCC	0.53																																							uc002hby.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(1618-1620)GGG>TCG		suppressor of Ty 6 homolog																																				SO:0001583	missense	6830				chromatin remodeling|regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter	nucleus	hydrolase activity, acting on ester bonds|RNA binding|sequence-specific DNA binding transcription factor activity	g.chr17:27009765_27009766GG>TC	U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		Exception_encountered	17.37:g.27009765_27009766delinsTC	ENSP00000319104:p.Gly540Ser					SUPT6H_uc010crt.2_Missense_Mutation_p.G540S	p.G540S	NM_003170	NP_003161	Q7KZ85	SPT6H_HUMAN			14	1708_1709	+	Lung NSC(42;0.00431)		540					A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	DNP	ENST00000314616.6	37	c.1618_1619GG>TC	CCDS32596.1																																																																																				0.530	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170		30	85	0	0	0	0.004672	0	30	85				
SGCA	6442	broad.mit.edu	37	17	48245884	48245884	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr17:48245884T>A	ENST00000262018.3	+	5	571	c.535T>A	c.(535-537)Ttg>Atg	p.L179M	SGCA_ENST00000344627.6_Missense_Mutation_p.L179M|HILS1_ENST00000504307.1_RNA|SGCA_ENST00000513942.1_3'UTR|SGCA_ENST00000451235.2_Missense_Mutation_p.L77M|SGCA_ENST00000543315.1_Missense_Mutation_p.L179M	NM_000023.2	NP_000014.1	Q16586	SGCA_HUMAN	sarcoglycan, alpha (50kDa dystrophin-associated glycoprotein)	179					muscle contraction (GO:0006936)|muscle organ development (GO:0007517)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|sarcoglycan complex (GO:0016012)|sarcolemma (GO:0042383)	calcium ion binding (GO:0005509)	p.L179M(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(7)|ovary(2)|skin(1)	14						CACCTCTGCCTTGGACCGTGG	0.622																																							uc002iqi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(535-537)TTG>ATG		sarcoglycan, alpha isoform 1 precursor							25.0	25.0	25.0					17																	48245884		2200	4295	6495	SO:0001583	missense	6442				muscle contraction|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma	calcium ion binding	g.chr17:48245884T>A	L34355	CCDS32679.1, CCDS45729.1	17q21	2014-09-17	2002-08-29		ENSG00000108823	ENSG00000108823			10805	protein-coding gene	gene with protein product	"""50kD DAG"", ""Sarcoglycan, alpha (50kD dystrophin-associated glycoprotein; adhalin)"", ""adhalin (limb girdle muscular dystrophy 2D)"""	600119	"""sarcoglycan, alpha (50kD dystrophin-associated glycoprotein)"""	ADL		7937874	Standard	NM_000023		Approved	SCARMD1, LGMD2D, adhalin, DMDA2, A2	uc002iqi.3	Q16586	OTTHUMG00000162024	ENST00000262018.3:c.535T>A	17.37:g.48245884T>A	ENSP00000262018:p.Leu179Met					SGCA_uc010wmh.1_Missense_Mutation_p.L77M|SGCA_uc002iqj.2_Missense_Mutation_p.L179M|SGCA_uc010wmi.1_RNA|uc010dbn.1_5'Flank	p.L179M	NM_000023	NP_000014	Q16586	SGCA_HUMAN			5	571	+			179			Extracellular (Potential).		A6NEB8|A8K3K7|Q13710|Q13712	Missense_Mutation	SNP	ENST00000262018.3	37	c.535T>A	CCDS32679.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.41|19.41	3.821858|3.821858	0.71028|0.71028	.|.	.|.	ENSG00000108823|ENSG00000108823	ENST00000504073|ENST00000344627;ENST00000262018;ENST00000543315;ENST00000451235;ENST00000511303	.|D;D;D;D;D	.|0.98381	.|-4.9;-4.9;-4.9;-4.9;-4.9	4.58|4.58	2.32|2.32	0.28847|0.28847	.|.	0.000000|0.000000	0.64402|0.64402	D|D	0.000005|0.000005	D|D	0.98229|0.98229	0.9414|0.9414	M|M	0.72894|0.72894	2.215|2.215	0.50171|0.50171	D|D	0.99985|0.99985	.|D;D;D	.|0.89917	.|1.0;1.0;0.999	.|D;D;D	.|0.87578	.|0.996;0.998;0.983	D|D	0.97431|0.97431	1.0015|1.0015	6|10	.|0.66056	.|D	.|0.02	-4.2989|-4.2989	6.6153|6.6153	0.22773|0.22773	0.0:0.2024:0.0:0.7976|0.0:0.2024:0.0:0.7976	.|.	.|77;179;179	.|B7Z1L1;Q16586-2;Q16586	.|.;.;SGCA_HUMAN	H|M	1|179;179;179;77;86	.|ENSP00000345522:L179M;ENSP00000262018:L179M;ENSP00000444539:L179M;ENSP00000390371:L77M;ENSP00000426104:L86M	.|ENSP00000262018:L179M	L|L	+|+	2|1	0|2	SGCA|SGCA	45600883|45600883	0.956000|0.956000	0.32656|0.32656	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	0.811000|0.811000	0.27198|0.27198	0.709000|0.709000	0.31976|0.31976	0.379000|0.379000	0.24179|0.24179	CTT|TTG		0.622	SGCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366841.1	NM_000023		6	9	0	0	0	0.001168	0	6	9				
WFIKKN2	124857	broad.mit.edu	37	17	48917075	48917076	+	Missense_Mutation	DNP	CA	CA	AG			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	CA	CA	-	-	CA	CA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr17:48917075_48917076CA>AG	ENST00000311378.4	+	2	954_955	c.426_427CA>AG	c.(424-429)ccCAgc>ccAGgc	p.S143G	RP11-506D12.5_ENST00000572491.2_RNA|WFIKKN2_ENST00000426127.1_Missense_Mutation_p.S50G	NM_175575.5	NP_783165.1	Q8TEU8	WFKN2_HUMAN	WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2	143	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				muscle fiber development (GO:0048747)|negative regulation of DNA binding (GO:0043392)|negative regulation of protein binding (GO:0032091)|palate development (GO:0060021)|skeletal system development (GO:0001501)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)	metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.S143G(1)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(13)|ovary(4)|skin(1)	29			BRCA - Breast invasive adenocarcinoma(22;1.09e-08)			AGAAGGAGCCCAGCTTTACCTG	0.584																																							uc002isv.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(424-429)CCCAGC>CCAGGC		WFIKKN2 protein																																				SO:0001583	missense	124857					extracellular region	metalloendopeptidase inhibitor activity|protein binding|serine-type endopeptidase inhibitor activity	g.chr17:48917075_48917076CA>AG	AY358142	CCDS11575.1	17q21.33	2013-01-21			ENSG00000173714	ENSG00000173714		"""Immunoglobulin superfamily / I-set domain containing"", ""WAP four-disulfide core domain containing"""	30916	protein-coding gene	gene with protein product	"""WAP four-disulfide core domain 20B"""	610895				11928817, 12709070	Standard	NM_175575		Approved	WFIKKNRP, WFDC20B	uc002isv.4	Q8TEU8	OTTHUMG00000162274	Exception_encountered	17.37:g.48917075_48917076delinsAG	ENSP00000311184:p.Ser143Gly					WFIKKN2_uc010dbu.2_Missense_Mutation_p.S50G	p.S143G	NM_175575	NP_783165	Q8TEU8	WFKN2_HUMAN	BRCA - Breast invasive adenocarcinoma(22;1.09e-08)		2	1120_1121	+			143			Kazal-like.		Q6UXZ9	Missense_Mutation	DNP	ENST00000311378.4	37	c.426_427CA>AG	CCDS11575.1																																																																																				0.584	WFIKKN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368358.1	NM_175575		10	42	0	0	0	0.004672	0	10	42				
SEPT4	5414	broad.mit.edu	37	17	56598633	56598633	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr17:56598633G>A	ENST00000317268.3	-	9	1272	c.1096C>T	c.(1096-1098)Ccc>Tcc	p.P366S	SEPT4_ENST00000579371.1_Missense_Mutation_p.P267S|SEPT4_ENST00000412945.3_Missense_Mutation_p.P358S|RP11-112H10.4_ENST00000580589.1_RNA|SEPT4_ENST00000426861.1_3'UTR|SEPT4_ENST00000580844.1_Missense_Mutation_p.P267S|SEPT4_ENST00000393086.1_Missense_Mutation_p.P347S|SEPT4_ENST00000317256.6_Missense_Mutation_p.P347S|SEPT4_ENST00000583114.1_Missense_Mutation_p.P219S|SEPT4_ENST00000457347.2_Missense_Mutation_p.P381S	NM_004574.3	NP_004565.1	O43236	SEPT4_HUMAN	septin 4	366	Septin-type G.				apoptotic process (GO:0006915)|brain development (GO:0007420)|cell cycle (GO:0007049)|cell division (GO:0051301)|GTP catabolic process (GO:0006184)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of protein ubiquitination (GO:0031398)|regulation of apoptotic process (GO:0042981)|sperm capacitation (GO:0048240)|sperm mitochondrion organization (GO:0030382)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|sperm annulus (GO:0097227)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)	p.P366S(1)		NS(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	18	Medulloblastoma(34;0.127)|all_neural(34;0.237)					ATGCCCCAGGGGTAGAGTCGA	0.587											OREG0024614	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002iwm.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1096-1098)CCC>TCC		septin 4 isoform 1							78.0	69.0	72.0					17																	56598633		2203	4300	6503	SO:0001583	missense	5414				apoptosis|cell cycle|cytokinesis|regulation of apoptosis	cytoskeleton|mitochondrion|nucleus	GTP binding|GTPase activity|protein binding|structural molecule activity	g.chr17:56598633G>A	AF073312	CCDS11609.1, CCDS11610.1, CCDS45743.1, CCDS56041.1, CCDS58581.1, CCDS58582.1	17q22	2013-01-21	2005-01-11	2005-01-12	ENSG00000108387	ENSG00000108387		"""Septins"""	9165	protein-coding gene	gene with protein product	"""bradeoin"", ""septin-M"""	603696	"""peanut-like 2 (Drosophila)"""	PNUTL2		9889007	Standard	NM_001198713		Approved	H5, CE5B3, hucep-7, ARTS, hCDCREL-2, MART	uc002iwm.2	O43236		ENST00000317268.3:c.1096C>T	17.37:g.56598633G>A	ENSP00000321674:p.Pro366Ser		OREG0024614	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1016	SEPT4_uc002iwk.1_Missense_Mutation_p.P219S|SEPT4_uc010wnw.1_Missense_Mutation_p.P219S|SEPT4_uc002iwl.1_Missense_Mutation_p.P219S|SEPT4_uc002iwn.1_Missense_Mutation_p.P267S|SEPT4_uc002iwo.1_Missense_Mutation_p.P347S|SEPT4_uc002iwp.1_3'UTR|SEPT4_uc010wnx.1_Missense_Mutation_p.P381S|SEPT4_uc010wny.1_Missense_Mutation_p.P358S|SEPT4_uc010dcy.1_3'UTR	p.P366S	NM_004574	NP_004565	O43236	SEPT4_HUMAN			9	1224	-	Medulloblastoma(34;0.127)|all_neural(34;0.237)		366					B2RD42|B3KSX9|B4DXC6|B4DXV5|Q6IAP3|Q9H315|Q9UM58	Missense_Mutation	SNP	ENST00000317268.3	37	c.1096C>T	CCDS11610.1	.	.	.	.	.	.	.	.	.	.	G	12.46	1.943258	0.34283	.	.	ENSG00000108387	ENST00000412945;ENST00000457347;ENST00000317256;ENST00000317268;ENST00000393086	T;T;T;T	0.55930	0.49;0.49;0.49;0.49	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.72382	0.3453	M	0.71581	2.175	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.979;1.0	D;D;D;P;D	0.97110	0.999;0.998;0.999;0.76;1.0	T	0.73329	-0.4017	10	0.56958	D	0.05	.	17.2516	0.87044	0.0:0.0:1.0:0.0	.	358;381;347;219;366	O43236-3;O43236-4;O43236-2;O43236-5;O43236	.;.;.;.;SEPT4_HUMAN	S	358;380;347;366;347	ENSP00000414779:P358S;ENSP00000321071:P347S;ENSP00000321674:P366S;ENSP00000376801:P347S	ENSP00000321071:P347S	P	-	1	0	SEPT4	53953632	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.845000	0.99498	2.657000	0.90304	0.655000	0.94253	CCC		0.587	SEPT4-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445420.1	NM_080417		24	73	0	0	0	0.00333	0	24	73				
C17orf47	284083	broad.mit.edu	37	17	56620571	56620571	+	Missense_Mutation	SNP	C	C	A	rs527602596		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr17:56620571C>A	ENST00000321691.3	-	1	1158	c.977G>T	c.(976-978)cGa>cTa	p.R326L	SEPT4_ENST00000457347.2_5'Flank|SEPT4_ENST00000412945.3_5'Flank|RP11-112H10.4_ENST00000580589.1_RNA|RP11-112H10.4_ENST00000580769.1_RNA|RP11-112H10.4_ENST00000578022.1_RNA	NM_001038704.2	NP_001033793	Q8NEP4	CQ047_HUMAN	chromosome 17 open reading frame 47	326								p.R326L(1)		NS(1)|breast(2)|endometrium(1)|kidney(4)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	24	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GCTGTTTCCTCGGATTGGGGT	0.542																																							uc002iwq.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(976-978)CGA>CTA		hypothetical protein LOC284083							102.0	90.0	94.0					17																	56620571		2203	4300	6503	SO:0001583	missense	284083							g.chr17:56620571C>A		CCDS32691.1	17q23.2	2012-10-11			ENSG00000181013	ENSG00000181013			26844	protein-coding gene	gene with protein product							Standard	NM_001038704		Approved	FLJ40121	uc002iwq.2	Q8NEP4	OTTHUMG00000179244	ENST00000321691.3:c.977G>T	17.37:g.56620571C>A	ENSP00000354874:p.Arg326Leu					SEPT4_uc010wnx.1_5'Flank|SEPT4_uc010wny.1_5'Flank	p.R326L	NM_001038704	NP_001033793	Q8NEP4	CQ047_HUMAN			1	1113	-	Medulloblastoma(34;0.127)|all_neural(34;0.237)		326					Q8N821	Missense_Mutation	SNP	ENST00000321691.3	37	c.977G>T	CCDS32691.1	.	.	.	.	.	.	.	.	.	.	C	16.74	3.207920	0.58343	.	.	ENSG00000181013	ENST00000321691	T	0.40225	1.04	5.32	2.26	0.28386	.	0.269469	0.26528	N	0.023865	T	0.38532	0.1044	L	0.32530	0.975	0.09310	N	1	D	0.58970	0.984	P	0.53360	0.724	T	0.12528	-1.0544	10	0.51188	T	0.08	-6.9546	6.6861	0.23146	0.0:0.7105:0.0:0.2895	.	326	Q8NEP4	CQ047_HUMAN	L	326	ENSP00000354874:R326L	ENSP00000354874:R326L	R	-	2	0	C17orf47	53975570	0.001000	0.12720	0.008000	0.14137	0.056000	0.15407	0.345000	0.19979	0.625000	0.30304	-0.448000	0.05591	CGA		0.542	C17orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445443.1	NM_001038704		19	55	1	0	1.33834e-09	0.007413	1.8124e-09	19	55				
TEX14	56155	broad.mit.edu	37	17	56688569	56688569	+	Silent	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr17:56688569G>T	ENST00000240361.8	-	10	1240	c.1155C>A	c.(1153-1155)atC>atA	p.I385I	TEX14_ENST00000349033.5_Silent_p.I379I|TEX14_ENST00000389934.3_Silent_p.I379I			Q8IWB6	TEX14_HUMAN	testis expressed 14	385	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				attachment of spindle microtubules to kinetochore (GO:0008608)|intercellular bridge organization (GO:0043063)|male meiosis (GO:0007140)|mitotic sister chromatid separation (GO:0051306)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of cytokinesis (GO:0032466)|negative regulation of protein binding (GO:0032091)	cell (GO:0005623)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|midbody (GO:0030496)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)	p.I379I(2)|p.I385I(2)		breast(6)|endometrium(5)|kidney(3)|large_intestine(22)|liver(1)|lung(24)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	81	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CACCTGGGGAGATGATATGGA	0.527																																							uc010dcz.1		NA																	4	Substitution - coding silent(4)		lung(4)	stomach(4)|lung(3)|breast(3)|ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)|pancreas(1)	17						c.(1153-1155)ATC>ATA		testis expressed sequence 14 isoform a							175.0	150.0	158.0					17																	56688569		2203	4300	6503	SO:0001819	synonymous_variant	56155					cytoplasm	ATP binding|protein kinase activity	g.chr17:56688569G>T	AF285601	CCDS32692.1, CCDS32693.1, CCDS56042.1	17q22	2013-09-20	2007-03-13		ENSG00000121101	ENSG00000121101			11737	protein-coding gene	gene with protein product	"""cancer/testis antigen 113"""	605792	"""testis expressed sequence 14"""			11279525, 12711554	Standard	NM_031272		Approved	CT113	uc010dcz.2	Q8IWB6	OTTHUMG00000179245	ENST00000240361.8:c.1155C>A	17.37:g.56688569G>T						TEX14_uc002iwr.1_Silent_p.I379I|TEX14_uc002iws.1_Silent_p.I379I|TEX14_uc010dda.1_Silent_p.I159I	p.I385I	NM_198393	NP_938207	Q8IWB6	TEX14_HUMAN			10	1273	-	Medulloblastoma(34;0.127)|all_neural(34;0.237)		385			Protein kinase.		A6NH19|Q7RTP3|Q8ND97|Q9BXT9	Silent	SNP	ENST00000240361.8	37	c.1155C>A	CCDS56042.1																																																																																				0.527	TEX14-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445446.1			43	157	1	0	3.54561e-26	0.009718	6.0019e-26	43	157				
RAD51C	5889	broad.mit.edu	37	17	56774181	56774181	+	Nonsense_Mutation	SNP	C	C	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr17:56774181C>T	ENST00000337432.4	+	3	603	c.532C>T	c.(532-534)Cag>Tag	p.Q178*	RAD51C_ENST00000583539.1_Nonsense_Mutation_p.Q178*|RAD51C_ENST00000487921.1_3'UTR	NM_058216.1	NP_478123.1	O43502	RA51C_HUMAN	RAD51 paralog C	178			Q -> P (in BROVCA3). {ECO:0000269|PubMed:21990120}.		blood coagulation (GO:0007596)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|female meiosis sister chromatid cohesion (GO:0007066)|male meiosis I (GO:0007141)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|reciprocal meiotic recombination (GO:0007131)|sister chromatid cohesion (GO:0007062)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Rad51B-Rad51C-Rad51D-XRCC2 complex (GO:0033063)|Rad51C-XRCC3 complex (GO:0033065)|replication fork (GO:0005657)	ATP binding (GO:0005524)|crossover junction endodeoxyribonuclease activity (GO:0008821)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)	p.Q178*(1)		upper_aerodigestive_tract(1)	1	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TGCCTGCATTCAGCACCTTCA	0.388								Homologous recombination	Hereditary Breast-Ovarian Cancer, non-BRCA1/2																														uc002iwu.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(532-534)CAG>TAG	Homologous_recombination	RAD51 homolog C isoform 1							164.0	153.0	157.0					17																	56774181		2203	4300	6503	SO:0001587	stop_gained	5889	Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2	Familial Cancer Database	BRCAX	blood coagulation|DNA repair	mitochondrion|nucleoplasm|perinuclear region of cytoplasm	ATP binding|DNA binding|DNA-dependent ATPase activity	g.chr17:56774181C>T	AF029670	CCDS11611.1, CCDS45745.1	17q25.1	2014-09-17	2013-07-02		ENSG00000108384	ENSG00000108384		"""Fanconi anemia, complementation groups"""	9820	protein-coding gene	gene with protein product		602774	"""RAD51 (S. cerevisiae) homolog C"", ""RAD51 homolog C (S. cerevisiae)"""			9469824, 22167183	Standard	NM_058216		Approved	RAD51L2, FANCO	uc002iwu.3	O43502	OTTHUMG00000141292	ENST00000337432.4:c.532C>T	17.37:g.56774181C>T	ENSP00000336701:p.Gln178*					RAD51C_uc010woa.1_Nonsense_Mutation_p.Q178*|RAD51C_uc010ddc.2_RNA|RAD51C_uc002iwv.2_Intron|RAD51C_uc002iww.2_Intron|RAD51C_uc010wob.1_RNA	p.Q178*	NM_058216	NP_478123	O43502	RA51C_HUMAN			3	574	+	Medulloblastoma(34;0.127)|all_neural(34;0.237)		178					O43503|Q3B783	Nonsense_Mutation	SNP	ENST00000337432.4	37	c.532C>T	CCDS11611.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	20.9|20.9	4.073772|4.073772	0.76415|0.76415	.|.	.|.	ENSG00000108384|ENSG00000108384	ENST00000337432;ENST00000425173|ENST00000413590	.|.	.|.	.|.	5.35|5.35	4.39|4.39	0.52855|0.52855	.|.	0.292492|.	0.39985|.	N|.	0.001216|.	.|T	.|0.70605	.|0.3243	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.70532	.|-0.4846	.|4	0.56958|.	D|.	0.05|.	-6.5656|-6.5656	15.2981|15.2981	0.73925|0.73925	0.0:0.8591:0.1409:0.0|0.0:0.8591:0.1409:0.0	.|.	.|.	.|.	.|.	X|L	178;110|57	.|.	ENSP00000336701:Q178X|.	Q|S	+|+	1|2	0|0	RAD51C|RAD51C	54129180|54129180	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	2.677000|2.677000	0.46892|0.46892	1.403000|1.403000	0.46800|0.46800	-0.121000|-0.121000	0.15023|0.15023	CAG|TCA		0.388	RAD51C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280540.2	NM_058216		13	112	0	0	0	0.003163	0	13	112				
PRKCA	5578	broad.mit.edu	37	17	64728940	64728940	+	Silent	SNP	A	A	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr17:64728940A>G	ENST00000413366.3	+	9	1079	c.1053A>G	c.(1051-1053)ggA>ggG	p.G351G		NM_002737.2	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha	351	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|chondrocyte differentiation (GO:0002062)|desmosome assembly (GO:0002159)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|histone H3-T6 phosphorylation (GO:0035408)|inactivation of MAPK activity (GO:0000188)|induction of positive chemotaxis (GO:0050930)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|mRNA metabolic process (GO:0016071)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|peptidyl-serine autophosphorylation (GO:0036289)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of dense core granule biogenesis (GO:2000707)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of inflammatory response (GO:0050729)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein phosphorylation (GO:0001934)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|regulation of muscle contraction (GO:0006937)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of the force of heart contraction (GO:0002026)|response to interleukin-1 (GO:0070555)|rhodopsin mediated signaling pathway (GO:0016056)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|enzyme binding (GO:0019899)|histone kinase activity (H3-T6 specific) (GO:0035403)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|zinc ion binding (GO:0008270)	p.G351G(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Ingenol Mebutate(DB05013)|Phosphatidylserine(DB00144)|Tamoxifen(DB00675)|Vitamin E(DB00163)	GGAGTTTTGGAAAGGTAAGAG	0.453																																							uc002jfp.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(4)|large_intestine(1)|stomach(1)|lung(1)|breast(1)|ovary(1)	9						c.(1051-1053)GGA>GGG		protein kinase C, alpha	Phosphatidylserine(DB00144)|Vitamin E(DB00163)						88.0	90.0	90.0					17																	64728940		2203	4300	6503	SO:0001819	synonymous_variant	5578				activation of phospholipase C activity|energy reserve metabolic process|induction of apoptosis by extracellular signals|intracellular signal transduction|mRNA metabolic process|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of blood vessel endothelial cell migration|regulation of insulin secretion|response to interleukin-1|synaptic transmission	cytosol|endoplasmic reticulum|membrane fraction|nucleoplasm|plasma membrane	ATP binding|enzyme binding|histone kinase activity (H3-T6 specific)|protein kinase C activity|zinc ion binding	g.chr17:64728940A>G		CCDS11664.1	17q22-q24	2009-07-10				ENSG00000154229	2.7.11.1		9393	protein-coding gene	gene with protein product		176960		PKCA			Standard	NM_002737		Approved		uc002jfp.1	P17252		ENST00000413366.3:c.1053A>G	17.37:g.64728940A>G						PRKCA_uc002jfo.1_Silent_p.G222G	p.G351G	NM_002737	NP_002728	P17252	KPCA_HUMAN	BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		9	1097	+			351			ATP (By similarity).|Protein kinase.		B5BU22|Q15137|Q32M72|Q96RE4	Silent	SNP	ENST00000413366.3	37	c.1053A>G	CCDS11664.1																																																																																				0.453	PRKCA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446976.1			40	141	0	0	0	0.006999	0	40	141				
SDK2	54549	broad.mit.edu	37	17	71394502	71394502	+	Missense_Mutation	SNP	G	G	T	rs200483752		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr17:71394502G>T	ENST00000392650.3	-	23	3160	c.3160C>A	c.(3160-3162)Cgc>Agc	p.R1054S	SDK2_ENST00000388726.3_Missense_Mutation_p.R1054S	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	1054	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.R1054S(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						TCCATGGAGCGGGCATCGGGC	0.642																																							uc010dfm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(3160-3162)CGC>AGC		sidekick 2							99.0	94.0	96.0					17																	71394502		2203	4300	6503	SO:0001583	missense	54549				cell adhesion	integral to membrane		g.chr17:71394502G>T	AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.3160C>A	17.37:g.71394502G>T	ENSP00000376421:p.Arg1054Ser					SDK2_uc002jjt.3_Missense_Mutation_p.R213S|SDK2_uc010dfn.2_Missense_Mutation_p.R733S	p.R1054S	NM_001144952	NP_001138424	Q58EX2	SDK2_HUMAN			23	3160	-			1054			Fibronectin type-III 5.|Extracellular (Potential).		A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	ENST00000392650.3	37	c.3160C>A	CCDS45769.1	.	.	.	.	.	.	.	.	.	.	G	13.51	2.259444	0.39995	.	.	ENSG00000069188	ENST00000409227;ENST00000392650;ENST00000388726;ENST00000424778;ENST00000316893	T;T;T	0.54071	0.59;0.59;0.59	4.55	4.55	0.56014	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.52075	0.1712	L	0.48362	1.52	0.58432	D	0.999999	B;B;B	0.28291	0.191;0.126;0.206	B;B;B	0.42386	0.194;0.386;0.267	T	0.41680	-0.9495	10	0.13853	T	0.58	.	12.5816	0.56393	0.0:0.0:0.834:0.166	.	1054;1054;1054	Q58EX2-2;Q58EX2;Q58EX2-3	.;SDK2_HUMAN;.	S	678;1054;1054;230;1054	ENSP00000376421:R1054S;ENSP00000373378:R1054S;ENSP00000407098:R230S	ENSP00000324967:R1054S	R	-	1	0	SDK2	68906097	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	5.251000	0.65438	2.361000	0.80049	0.462000	0.41574	CGC		0.642	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327598.2	NM_019064		27	92	1	0	1.12875e-08	0.00632	1.49613e-08	27	92				
FDXR	2232	broad.mit.edu	37	17	72859251	72859251	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr17:72859251G>A	ENST00000293195.5	-	11	1370	c.1292C>T	c.(1291-1293)cCc>cTc	p.P431L	FDXR_ENST00000413947.2_Missense_Mutation_p.P462L|FDXR_ENST00000581530.1_Missense_Mutation_p.P437L|FDXR_ENST00000420580.2_Missense_Mutation_p.P391L|FDXR_ENST00000582944.1_Missense_Mutation_p.P423L|GRIN2C_ENST00000578159.1_5'Flank|FDXR_ENST00000583917.1_Missense_Mutation_p.P403L|FDXR_ENST00000544854.1_Missense_Mutation_p.P379L|FDXR_ENST00000455107.2_3'UTR|FDXR_ENST00000442102.2_Missense_Mutation_p.P474L|GRIN2C_ENST00000347612.4_5'Flank	NM_001258014.1|NM_004110.3|NM_024417.2	NP_001244943.1|NP_004101.2|NP_077728.2	P22570	ADRO_HUMAN	ferredoxin reductase	431					cholesterol metabolic process (GO:0008203)|generation of precursor metabolites and energy (GO:0006091)|NADPH oxidation (GO:0070995)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ferredoxin-NADP+ reductase activity (GO:0004324)|NADPH binding (GO:0070402)|NADPH-adrenodoxin reductase activity (GO:0015039)	p.P437L(2)		central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(9)|prostate(1)|skin(1)	16	all_lung(278;0.172)|Lung NSC(278;0.207)				Flavin adenine dinucleotide(DB03147)	GGGGCCAGAGGGGAGCAACCC	0.647																																							uc002jly.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1291-1293)CCC>CTC		ferredoxin reductase isoform 1 precursor							41.0	37.0	38.0					17																	72859251		2203	4300	6503	SO:0001583	missense	2232				cholesterol metabolic process|electron transport chain|steroid biosynthetic process|transport	mitochondrial matrix	ferredoxin-NADP+ reductase activity|protein binding	g.chr17:72859251G>A	J03826	CCDS11707.1, CCDS58591.1, CCDS58592.1, CCDS58593.1, CCDS58594.1, CCDS58595.1, CCDS58596.1	17q25.1	2013-06-18			ENSG00000161513	ENSG00000161513	1.18.1.6		3642	protein-coding gene	gene with protein product	"""adrenodoxin-NADP(+) reductase"", ""adrenodoxin reductase"""	103270		ADXR		2969697	Standard	NM_001258014		Approved		uc010wrl.2	P22570	OTTHUMG00000179026	ENST00000293195.5:c.1292C>T	17.37:g.72859251G>A	ENSP00000293195:p.Pro431Leu					GRIN2C_uc002jlu.1_5'Flank|GRIN2C_uc002jlv.1_5'Flank|FDXR_uc010wri.1_Missense_Mutation_p.P379L|FDXR_uc010wrj.1_Missense_Mutation_p.P429L|FDXR_uc002jlw.2_Missense_Mutation_p.P188L|FDXR_uc002jlx.2_Missense_Mutation_p.P437L|FDXR_uc002jmc.2_Missense_Mutation_p.P403L|FDXR_uc010wrk.1_Missense_Mutation_p.P462L|FDXR_uc010wrl.1_Missense_Mutation_p.P474L|FDXR_uc002jma.2_Missense_Mutation_p.P432L|FDXR_uc010wrm.1_Missense_Mutation_p.P391L|FDXR_uc002jlz.2_Missense_Mutation_p.P423L|FDXR_uc002jmb.2_RNA	p.P431L	NM_024417	NP_077728	P22570	ADRO_HUMAN			11	1379	-	all_lung(278;0.172)|Lung NSC(278;0.207)		431					B4DDI7|B4DHX5|B4DQQ4|B4DX24|B7Z7G2|E7EQC1|Q13716|Q4PJI0|Q9BU12	Missense_Mutation	SNP	ENST00000293195.5	37	c.1292C>T	CCDS58593.1	.	.	.	.	.	.	.	.	.	.	G	8.831	0.939901	0.18281	.	.	ENSG00000161513	ENST00000420580;ENST00000544854;ENST00000293195;ENST00000442102;ENST00000413947	T;T;T;T	0.19806	3.05;3.06;2.12;2.12	4.74	4.74	0.60224	NAD(P)-binding domain (1);	0.298300	0.34802	N	0.003674	T	0.20292	0.0488	L	0.56199	1.76	0.20074	N	0.999932	P;P;P;P;B;P;B;P;B;P	0.47302	0.893;0.868;0.834;0.794;0.006;0.548;0.007;0.794;0.007;0.835	B;P;B;B;B;B;B;B;B;B	0.44518	0.405;0.452;0.442;0.2;0.004;0.1;0.003;0.2;0.003;0.093	T	0.13255	-1.0516	10	0.22706	T	0.39	-8.894	6.9186	0.24374	0.0953:0.179:0.7257:0.0	.	391;474;462;429;379;462;431;423;431;437	B4DQQ4;B4DHX5;E7EQC1;B4DDI9;B7Z7G2;B4DDI7;Q6GSK2;B4DX24;P22570;P22570-2	.;.;.;.;.;.;.;.;ADRO_HUMAN;.	L	391;379;437;474;462	ENSP00000414172:P391L;ENSP00000445432:P379L;ENSP00000416515:P474L;ENSP00000408595:P462L	ENSP00000293195:P437L	P	-	2	0	FDXR	70370846	0.199000	0.23386	0.894000	0.35097	0.115000	0.19883	2.880000	0.48530	2.171000	0.68590	0.462000	0.41574	CCC		0.647	FDXR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000444449.1	NM_004110		7	25	0	0	0	0.001984	0	7	25				
FBF1	85302	broad.mit.edu	37	17	73910944	73910944	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr17:73910944C>A	ENST00000586717.1	-	24	2929	c.2656G>T	c.(2656-2658)Gag>Tag	p.E886*	FBF1_ENST00000319129.5_Nonsense_Mutation_p.E885*|FBF1_ENST00000389570.4_Nonsense_Mutation_p.E886*|RP11-552F3.12_ENST00000587556.1_5'Flank			Q8TES7	FBF1_HUMAN	Fas (TNFRSF6) binding factor 1	886					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)		p.E885*(1)		large_intestine(2)|ovary(1)|upper_aerodigestive_tract(1)	4						TCCGCCCACTCGGCAGCCAGG	0.687																																							uc002jqc.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(2653-2655)GAG>TAG		Fas (TNFRSF6) binding factor 1							17.0	23.0	21.0					17																	73910944		2058	4186	6244	SO:0001587	stop_gained	85302							g.chr17:73910944C>A	AK074045	CCDS45779.1	17q25.3	2011-04-21			ENSG00000188878	ENSG00000188878			24674	protein-coding gene	gene with protein product	"""albatross"""					11347906	Standard	NM_001080542		Approved	FLJ00103, FBF-1, KIAA1863, ALB	uc002jqc.3	Q8TES7		ENST00000586717.1:c.2656G>T	17.37:g.73910944C>A	ENSP00000465132:p.Glu886*					FBF1_uc002jqa.1_RNA|FBF1_uc010wsp.1_Nonsense_Mutation_p.E876*|FBF1_uc002jqb.2_RNA|FBF1_uc010dgr.1_Nonsense_Mutation_p.E196*	p.E885*	NM_001080542	NP_001074011	Q8TES7	FBF1_HUMAN			24	2927	-			885					B5MEM5|Q96IF6|Q96JG4|Q96MA8	Nonsense_Mutation	SNP	ENST00000586717.1	37	c.2653G>T		.	.	.	.	.	.	.	.	.	.	C	41	8.616894	0.98886	.	.	ENSG00000188878	ENST00000389570;ENST00000319129;ENST00000427433	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-21.1664	18.6307	0.91359	0.0:1.0:0.0:0.0	.	.	.	.	X	886;885;899	.	ENSP00000324292:E885X	E	-	1	0	FBF1	71422539	1.000000	0.71417	0.969000	0.41365	0.352000	0.29268	6.954000	0.76001	2.503000	0.84419	0.650000	0.86243	GAG		0.687	FBF1-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000448945.2	NM_001080542		4	24	1	0	0.00024832	0.009096	0.000275802	4	24				
SEC14L1	6397	broad.mit.edu	37	17	75208256	75208256	+	Silent	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr17:75208256G>T	ENST00000413679.2	+	15	2139	c.1836G>T	c.(1834-1836)ctG>ctT	p.L612L	SEC14L1_ENST00000585618.1_Silent_p.L612L|SEC14L1_ENST00000436233.4_Silent_p.L612L|SEC14L1_ENST00000392476.2_Silent_p.L612L|SEC14L1_ENST00000591437.1_Silent_p.L578L|SEC14L1_ENST00000430767.4_Silent_p.L612L|SEC14L1_ENST00000443798.4_Silent_p.L612L|SEC14L1_ENST00000431431.2_Silent_p.L578L	NM_001143998.1|NM_001143999.1|NM_003003.3	NP_001137470|NP_001137471|NP_002994	Q92503	S14L1_HUMAN	SEC14-like 1 (S. cerevisiae)	612	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.				transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.P611fs*11(1)|p.L612L(1)		NS(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(2)	31						AGTCGCCTCTGATCTGCAAAG	0.552																																							uc002jto.2		NA																	2	Deletion - Frameshift(1)|Substitution - coding silent(1)		lung(2)	ovary(2)	2						c.(1834-1836)CTG>CTT		SEC14 (S. cerevisiae)-like 1 isoform a							110.0	120.0	117.0					17																	75208256		2203	4299	6502	SO:0001819	synonymous_variant	6397				transport	Golgi apparatus|integral to membrane	binding	g.chr17:75208256G>T	D67029	CCDS11752.1, CCDS42385.1, CCDS45789.1	17q25.2	2008-02-01	2001-11-28			ENSG00000129657			10698	protein-coding gene	gene with protein product		601504	"""SEC14 (S. cerevisiae)-like 1"""	SEC14L		8697811	Standard	NM_001143998		Approved	PRELID4A	uc002jto.3	Q92503		ENST00000413679.2:c.1836G>T	17.37:g.75208256G>T						SEC14L1_uc010dhc.2_Silent_p.L612L|SEC14L1_uc010wth.1_Silent_p.L612L|SEC14L1_uc002jtm.2_Silent_p.L612L|SEC14L1_uc010wti.1_Silent_p.L578L|SEC14L1_uc010wtj.1_Missense_Mutation_p.D101Y|SEC14L1_uc002jtr.2_Silent_p.L6L	p.L612L	NM_003003	NP_002994	Q92503	S14L1_HUMAN			15	2103	+			612			GOLD.		A8K4E8|B4DDI5|D5G3K1|Q99780	Silent	SNP	ENST00000413679.2	37	c.1836G>T	CCDS11752.1																																																																																				0.552	SEC14L1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000436240.1	NM_003003		64	192	1	0	4.83677e-39	0.00361	8.33824e-39	64	192				
NARF	26502	broad.mit.edu	37	17	80445829	80445829	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr17:80445829C>A	ENST00000309794.11	+	11	1365	c.1167C>A	c.(1165-1167)gaC>gaA	p.D389E	NARF_ENST00000390006.4_Missense_Mutation_p.D330E|NARF_ENST00000457415.3_Missense_Mutation_p.D435E|NARF_ENST00000345415.7_Missense_Mutation_p.D341E	NM_012336.3|NM_031968.2	NP_036468.1|NP_114174.1	Q9UHQ1	NARF_HUMAN	nuclear prelamin A recognition factor	389						lamin filament (GO:0005638)|nuclear lamina (GO:0005652)|nuclear lumen (GO:0031981)|nucleus (GO:0005634)	lamin binding (GO:0005521)	p.D435E(1)		endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			AGACTCCAGACGGACATGCGG	0.557																																							uc002kfg.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1165-1167)GAC>GAA		nuclear prelamin A recognition factor isoform a							74.0	71.0	72.0					17																	80445829		2203	4300	6503	SO:0001583	missense	26502					lamin filament	lamin binding	g.chr17:80445829C>A	BC000438	CCDS32777.1, CCDS42403.1, CCDS42404.1	17q25.3	2011-12-19			ENSG00000141562	ENSG00000141562			29916	protein-coding gene	gene with protein product	"""iron-only hydrogenase-like protein 2"""	605349				10514485, 15667261	Standard	NM_031968		Approved	FLJ10067, DKFZp434G0420, IOP2	uc002kfg.4	Q9UHQ1		ENST00000309794.11:c.1167C>A	17.37:g.80445829C>A	ENSP00000309899:p.Asp389Glu					NARF_uc002kff.3_Missense_Mutation_p.D330E|NARF_uc010dit.2_Missense_Mutation_p.D435E|NARF_uc002kfj.3_Missense_Mutation_p.D341E|NARF_uc002kfi.3_RNA|NARF_uc002kfh.3_Missense_Mutation_p.D435E|NARF_uc002kfk.2_RNA	p.D389E	NM_012336	NP_036468	Q9UHQ1	NARF_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)		11	1307	+	Breast(20;0.00106)|all_neural(118;0.0804)		389					A6NCJ3|B3KPX2|K4DI98|Q96AY9|Q9BWC6	Missense_Mutation	SNP	ENST00000309794.11	37	c.1167C>A	CCDS32777.1	.	.	.	.	.	.	.	.	.	.	.	2.160	-0.392370	0.04932	.	.	ENSG00000141562	ENST00000390006;ENST00000374611;ENST00000309794;ENST00000345415	T;T;T	0.44881	0.91;0.91;0.91	5.31	-9.8	0.00490	Iron hydrogenase (1);	0.332829	0.35615	N	0.003087	T	0.20210	0.0486	L	0.38175	1.15	0.80722	D	1	B;B;B;B	0.15473	0.012;0.013;0.003;0.001	B;B;B;B	0.21546	0.033;0.035;0.015;0.007	T	0.41431	-0.9509	10	0.10377	T	0.69	-21.2183	7.8783	0.29608	0.0765:0.2729:0.076:0.5747	.	435;341;436;389	Q9UHQ1-2;Q9UHQ1-3;E9PH27;Q9UHQ1	.;.;.;NARF_HUMAN	E	330;436;389;341	ENSP00000374656:D330E;ENSP00000309899:D389E;ENSP00000283996:D341E	ENSP00000309899:D389E	D	+	3	2	NARF	78039118	0.000000	0.05858	0.003000	0.11579	0.006000	0.05464	-2.797000	0.00763	-2.358000	0.00611	-1.904000	0.00526	GAC		0.557	NARF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443573.2	NM_031968		5	93	1	0	0.00116845	0.001168	0.00125798	5	93				
ZNF271	10778	broad.mit.edu	37	18	32887072	32887072	+	RNA	SNP	G	G	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr18:32887072G>C	ENST00000399070.3	+	0	1466					NR_024565.1|NR_024566.1		Q14591	ZN271_HUMAN	zinc finger protein 271						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E162Q(1)		large_intestine(3)|lung(9)	12						ATCCACACTGGAGAGAAACCT	0.398																																							uc002kyq.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(484-486)GAG>CAG		SubName: Full=cDNA FLJ13394 fis, clone PLACE1001304, highly similar to Homo sapiens zinc finger protein 271 (ZNF271), mRNA;							91.0	97.0	95.0					18																	32887072		2203	4300	6503			10778							g.chr18:32887072G>C	X78930		18q12.2	2013-04-03			ENSG00000257267	ENSG00000257267		"""Zinc fingers, C2H2-type"""	13065	other	unknown		604754				7865130, 11777961	Standard	NR_024565		Approved	HZF7, ZNFEB	uc002kyp.4	Q14591	OTTHUMG00000132563		18.37:g.32887072G>C						ZNF271_uc002kyp.3_Missense_Mutation_p.E162Q|ZNF271_uc002kyr.3_Missense_Mutation_p.E162Q	p.E162Q	NR_024565						3	1476	+								B3KN34|Q96T29|Q9BSX2|Q9UN33|Q9Y5B7	Missense_Mutation	SNP	ENST00000399070.3	37	c.484G>C																																																																																					0.398	ZNF271-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000255767.2	NR_024565		16	104	0	0	0	0.00499	0	16	104				
FHOD3	80206	broad.mit.edu	37	18	34298456	34298456	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr18:34298456G>T	ENST00000359247.4	+	15	2619	c.2619G>T	c.(2617-2619)caG>caT	p.Q873H	FHOD3_ENST00000590592.1_Missense_Mutation_p.Q1065H|FHOD3_ENST00000592128.1_5'Flank|FHOD3_ENST00000591635.1_Intron|FHOD3_ENST00000445677.1_Missense_Mutation_p.Q852H|FHOD3_ENST00000257209.4_Missense_Mutation_p.Q890H	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	873					actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)		p.Q890H(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				ACGCTCCTCAGGGCTTAGGGT	0.567																																							uc002kzt.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|large_intestine(2)|breast(2)|ovary(1)	8						c.(2617-2619)CAG>CAT		formin homology 2 domain containing 3							81.0	72.0	75.0					18																	34298456		2203	4300	6503	SO:0001583	missense	80206				actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding	g.chr18:34298456G>T	AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.2619G>T	18.37:g.34298456G>T	ENSP00000352186:p.Gln873His					FHOD3_uc002kzs.1_Missense_Mutation_p.Q890H|FHOD3_uc010dmz.1_Missense_Mutation_p.Q605H|FHOD3_uc010dna.1_Missense_Mutation_p.Q193H	p.Q873H	NM_025135	NP_079411	Q2V2M9	FHOD3_HUMAN			15	2716	+		all_epithelial(2;0.0181)|Colorectal(2;0.0195)	873					A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Missense_Mutation	SNP	ENST00000359247.4	37	c.2619G>T		.	.	.	.	.	.	.	.	.	.	G	14.90	2.673428	0.47781	.	.	ENSG00000134775	ENST00000257209;ENST00000359247;ENST00000445677	T;T;T	0.32515	1.45;1.45;1.45	4.46	4.46	0.54185	Actin-binding FH2 (1);	0.336020	0.29040	N	0.013325	T	0.47875	0.1469	M	0.66939	2.045	0.36262	D	0.854621	D;P;D	0.67145	0.987;0.952;0.996	P;P;P	0.62560	0.773;0.496;0.904	T	0.53173	-0.8476	10	0.14656	T	0.56	.	15.6858	0.77409	0.0:0.0:1.0:0.0	.	852;873;890	Q2V2M9-2;Q2V2M9;Q2V2M9-3	.;FHOD3_HUMAN;.	H	890;873;852	ENSP00000257209:Q890H;ENSP00000352186:Q873H;ENSP00000411430:Q852H	ENSP00000257209:Q890H	Q	+	3	2	FHOD3	32552454	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.958000	0.63660	2.034000	0.60081	0.555000	0.69702	CAG		0.567	FHOD3-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460884.1	XM_371114		15	60	1	0	2.61681e-11	0.00245	3.67662e-11	15	60				
FHOD3	80206	broad.mit.edu	37	18	34324019	34324019	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr18:34324019C>A	ENST00000359247.4	+	19	3328	c.3328C>A	c.(3328-3330)Ctc>Atc	p.L1110I	FHOD3_ENST00000590592.1_Missense_Mutation_p.L1302I|FHOD3_ENST00000592128.1_Missense_Mutation_p.L106I|FHOD3_ENST00000591635.1_Missense_Mutation_p.L323I|FHOD3_ENST00000445677.1_Missense_Mutation_p.L1089I|FHOD3_ENST00000257209.4_Missense_Mutation_p.L1127I	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	1110	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)		p.L1127I(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				GTTAAGCTACCTCGAGAAGGT	0.453																																							uc002kzt.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|large_intestine(2)|breast(2)|ovary(1)	8						c.(3328-3330)CTC>ATC		formin homology 2 domain containing 3							165.0	154.0	158.0					18																	34324019		2203	4300	6503	SO:0001583	missense	80206				actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding	g.chr18:34324019C>A	AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.3328C>A	18.37:g.34324019C>A	ENSP00000352186:p.Leu1110Ile					FHOD3_uc002kzs.1_Missense_Mutation_p.L1127I|FHOD3_uc010dmz.1_Missense_Mutation_p.L842I|FHOD3_uc010dnb.1_Missense_Mutation_p.L106I	p.L1110I	NM_025135	NP_079411	Q2V2M9	FHOD3_HUMAN			19	3425	+		all_epithelial(2;0.0181)|Colorectal(2;0.0195)	1110			FH2.		A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Missense_Mutation	SNP	ENST00000359247.4	37	c.3328C>A		.	.	.	.	.	.	.	.	.	.	C	20.5	4.004994	0.74932	.	.	ENSG00000134775	ENST00000257209;ENST00000359247;ENST00000445677	T;T;T	0.55930	0.49;0.49;0.49	5.22	5.22	0.72569	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.059074	0.64402	D	0.000002	T	0.74741	0.3756	M	0.80028	2.48	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;0.986;0.989;0.998	D;P;P;D	0.97110	1.0;0.782;0.861;0.993	T	0.78778	-0.2071	10	0.87932	D	0	.	17.3602	0.87348	0.0:1.0:0.0:0.0	.	331;1089;1110;1127	E7ETX5;Q2V2M9-2;Q2V2M9;Q2V2M9-3	.;.;FHOD3_HUMAN;.	I	1127;1110;1089	ENSP00000257209:L1127I;ENSP00000352186:L1110I;ENSP00000411430:L1089I	ENSP00000257209:L1127I	L	+	1	0	FHOD3	32578017	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.985000	0.56930	2.428000	0.82296	0.563000	0.77884	CTC		0.453	FHOD3-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460884.1	XM_371114		54	115	1	0	3.76997e-23	0.00361	6.21326e-23	54	115				
RNF152	220441	broad.mit.edu	37	18	59483224	59483224	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr18:59483224C>T	ENST00000312828.3	-	2	1572	c.473G>A	c.(472-474)cGg>cAg	p.R158Q		NM_173557.2	NP_775828.1	Q8N8N0	RN152_HUMAN	ring finger protein 152	158					apoptotic process (GO:0006915)|protein K48-linked ubiquitination (GO:0070936)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R158Q(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(10)|skin(1)	17		Colorectal(73;0.186)				CACCACGCCCCGCCTGTCCTG	0.622																																							uc002lih.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(472-474)CGG>CAG		ring finger protein 152							95.0	87.0	89.0					18																	59483224		2203	4300	6503	SO:0001583	missense	220441				apoptosis|protein K48-linked ubiquitination	integral to membrane|lysosomal membrane	ubiquitin-protein ligase activity|zinc ion binding	g.chr18:59483224C>T	AK096495	CCDS11978.1	18q21.33	2013-01-09			ENSG00000176641	ENSG00000176641		"""RING-type (C3HC4) zinc fingers"""	26811	protein-coding gene	gene with protein product							Standard	XM_005266650		Approved	FLJ39176	uc002lih.1	Q8N8N0	OTTHUMG00000132774	ENST00000312828.3:c.473G>A	18.37:g.59483224C>T	ENSP00000316628:p.Arg158Gln						p.R158Q	NM_173557	NP_775828	Q8N8N0	RN152_HUMAN			2	885	-		Colorectal(73;0.186)	158					B3KV99|Q52LA4	Missense_Mutation	SNP	ENST00000312828.3	37	c.473G>A	CCDS11978.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.213942	0.79352	.	.	ENSG00000176641	ENST00000312828	D	0.83992	-1.79	4.69	4.69	0.59074	.	0.360006	0.27976	N	0.017083	T	0.73674	0.3617	N	0.24115	0.695	0.50813	D	0.99989	D	0.53619	0.961	B	0.39339	0.297	T	0.79155	-0.1920	10	0.56958	D	0.05	0.0087	17.8094	0.88611	0.0:1.0:0.0:0.0	.	158	Q8N8N0	RN152_HUMAN	Q	158	ENSP00000316628:R158Q	ENSP00000316628:R158Q	R	-	2	0	RNF152	57634204	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	4.021000	0.57196	2.461000	0.83175	0.563000	0.77884	CGG		0.622	RNF152-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256180.1	NM_173557		26	47	0	0	0	0.00632	0	26	47				
SGTA	6449	broad.mit.edu	37	19	2762622	2762622	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr19:2762622T>C	ENST00000221566.2	-	7	679	c.518A>G	c.(517-519)aAc>aGc	p.N173S		NM_003021.3	NP_003012.1	O43765	SGTA_HUMAN	small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha	173					viral process (GO:0016032)	cytoplasm (GO:0005737)		p.N173S(1)		endometrium(2)|large_intestine(2)|lung(2)|ovary(1)	7		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CACGTGCTTGTTGAGGCTGGA	0.627																																							uc002lwi.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(517-519)AAC>AGC		small glutamine-rich tetratricopeptide							112.0	109.0	110.0					19																	2762622		2203	4300	6503	SO:0001583	missense	6449				interspecies interaction between organisms	cytoplasm	protein binding	g.chr19:2762622T>C	AJ223828	CCDS12094.1	19p13	2013-01-10	2003-11-24	2003-11-26		ENSG00000104969		"""Tetratricopeptide (TTC) repeat domain containing"""	10819	protein-coding gene	gene with protein product		603419	"""small glutamine-rich tetratricopeptide repeat (TPR)-containing"""	SGT		9740675, 12735788	Standard	NM_003021		Approved		uc002lwi.1	O43765		ENST00000221566.2:c.518A>G	19.37:g.2762622T>C	ENSP00000221566:p.Asn173Ser						p.N173S	NM_003021	NP_003012	O43765	SGTA_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	7	665	-		Hepatocellular(1079;0.137)	173			TPR 3.		D6W610|Q6FIA9|Q9BTZ9	Missense_Mutation	SNP	ENST00000221566.2	37	c.518A>G	CCDS12094.1	.	.	.	.	.	.	.	.	.	.	T	8.389	0.839274	0.16891	.	.	ENSG00000104969	ENST00000221566	T	0.63913	-0.07	4.11	4.11	0.48088	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.092792	0.64402	D	0.000001	T	0.54951	0.1890	L	0.45581	1.43	0.47862	D	0.999538	B	0.22909	0.077	B	0.26094	0.066	T	0.54221	-0.8326	10	0.40728	T	0.16	-23.0552	11.9807	0.53119	0.0:0.0:0.0:1.0	.	173	O43765	SGTA_HUMAN	S	173	ENSP00000221566:N173S	ENSP00000221566:N173S	N	-	2	0	SGTA	2713622	1.000000	0.71417	0.898000	0.35279	0.130000	0.20726	2.509000	0.45459	1.506000	0.48736	0.459000	0.35465	AAC		0.627	SGTA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451448.2	NM_003021		24	181	0	0	0	0.00333	0	24	181				
ZNF556	80032	broad.mit.edu	37	19	2877918	2877918	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr19:2877918G>A	ENST00000307635.2	+	4	1049	c.962G>A	c.(961-963)gGg>gAg	p.G321E	ZNF556_ENST00000586426.1_Missense_Mutation_p.G320E	NM_024967.1	NP_079243.1	Q9HAH1	ZN556_HUMAN	zinc finger protein 556	321					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G321E(1)		endometrium(2)|kidney(1)|large_intestine(7)|lung(10)|pancreas(1)|prostate(3)|skin(7)	31				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGAAAATGCGGGAAAGCATTC	0.522																																							uc002lwp.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)	3						c.(961-963)GGG>GAG		zinc finger protein 556							53.0	50.0	51.0					19																	2877918		2203	4300	6503	SO:0001583	missense	80032				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:2877918G>A	BC009374	CCDS12097.1, CCDS74254.1	19p13.3	2013-09-20			ENSG00000172000	ENSG00000172000		"""Zinc fingers, C2H2-type"", ""-"""	25669	protein-coding gene	gene with protein product						12477932	Standard	XM_005259647		Approved	FLJ11637	uc002lwp.1	Q9HAH1	OTTHUMG00000180501	ENST00000307635.2:c.962G>A	19.37:g.2877918G>A	ENSP00000302603:p.Gly321Glu					ZNF556_uc002lwq.2_Missense_Mutation_p.G320E	p.G321E	NM_024967	NP_079243	Q9HAH1	ZN556_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	4	1049	+			321			C2H2-type 7.		Q96GM3	Missense_Mutation	SNP	ENST00000307635.2	37	c.962G>A	CCDS12097.1	.	.	.	.	.	.	.	.	.	.	G	10.60	1.394684	0.25205	.	.	ENSG00000172000	ENST00000307635	T	0.35421	1.31	2.3	2.3	0.28687	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.43077	0.1231	L	0.37697	1.125	0.23232	N	0.998076	P	0.52316	0.952	P	0.58454	0.839	T	0.19910	-1.0291	9	0.87932	D	0	.	9.9087	0.41392	0.0:0.0:1.0:0.0	.	321	Q9HAH1	ZN556_HUMAN	E	321	ENSP00000302603:G321E	ENSP00000302603:G321E	G	+	2	0	ZNF556	2828918	1.000000	0.71417	0.236000	0.24074	0.019000	0.09904	2.606000	0.46291	1.091000	0.41335	0.407000	0.27541	GGG		0.522	ZNF556-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451638.2	NM_024967		16	55	0	0	0	0.003163	0	16	55				
ZNF77	58492	broad.mit.edu	37	19	2934603	2934603	+	Silent	SNP	G	G	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr19:2934603G>C	ENST00000314531.4	-	4	614	c.522C>G	c.(520-522)ctC>ctG	p.L174L		NM_021217.2	NP_067040.1	Q15935	ZNF77_HUMAN	zinc finger protein 77	174					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L174L(1)		breast(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(5)|ovary(1)	17				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|GBM - Glioblastoma multiforme(1328;2.11e-07)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.174)|STAD - Stomach adenocarcinoma(1328;0.18)		TTTGGCAGGAGAGGCAGCTGC	0.517																																							uc002lws.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(520-522)CTC>CTG		zinc finger protein 77							105.0	106.0	106.0					19																	2934603		2203	4300	6503	SO:0001819	synonymous_variant	58492				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|zinc ion binding	g.chr19:2934603G>C	X65230	CCDS12099.1	19p13.3	2013-01-08	2006-05-12					"""Zinc fingers, C2H2-type"", ""-"""	13150	protein-coding gene	gene with protein product		194551	"""zinc finger protein 77 (pT1)"""			8478004	Standard	NM_021217		Approved	pT1	uc002lws.4	Q15935		ENST00000314531.4:c.522C>G	19.37:g.2934603G>C							p.L174L	NM_021217	NP_067040	Q15935	ZNF77_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|GBM - Glioblastoma multiforme(1328;2.11e-07)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.174)|STAD - Stomach adenocarcinoma(1328;0.18)	4	653	-			174					Q86XJ3|Q9NPP0	Silent	SNP	ENST00000314531.4	37	c.522C>G	CCDS12099.1																																																																																				0.517	ZNF77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451924.1	NM_021217		6	208	0	0	0	0.001984	0	6	208				
RANBP3	8498	broad.mit.edu	37	19	5918634	5918634	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr19:5918634C>T	ENST00000340578.6	-	15	1403	c.1346G>A	c.(1345-1347)gGg>gAg	p.G449E	RANBP3_ENST00000034275.8_Missense_Mutation_p.G381E|RANBP3_ENST00000439268.2_Missense_Mutation_p.G444E|RANBP3_ENST00000541471.1_Missense_Mutation_p.G321E|RANBP3_ENST00000591092.1_Missense_Mutation_p.G376E	NM_003624.2|NM_007320.2|NM_007322.2	NP_003615.2|NP_015559.2|NP_015561.1	Q9H6Z4	RANB3_HUMAN	RAN binding protein 3	449	RanBD1. {ECO:0000255|PROSITE- ProRule:PRU00164}.				intracellular transport (GO:0046907)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	R-SMAD binding (GO:0070412)|Ran GTPase binding (GO:0008536)	p.G449E(1)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	18						TCGCAGGCTCCCCTGGGTCCG	0.607																																							uc002mdw.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(1345-1347)GGG>GAG		RAN binding protein 3 isoform RANBP3-d							122.0	138.0	133.0					19																	5918634		2119	4217	6336	SO:0001583	missense	8498				intracellular transport|protein transport	cytoplasm|nucleus	Ran GTPase binding	g.chr19:5918634C>T	Y08698	CCDS42477.1, CCDS42478.1, CCDS45935.1, CCDS74268.1	19p13.3	2008-02-05							9850	protein-coding gene	gene with protein product		603327				9637251	Standard	NM_007322		Approved		uc002mdw.3	Q9H6Z4		ENST00000340578.6:c.1346G>A	19.37:g.5918634C>T	ENSP00000341483:p.Gly449Glu					RANBP3_uc002mdv.2_Missense_Mutation_p.G168E|RANBP3_uc002mdx.2_Missense_Mutation_p.G444E|RANBP3_uc002mdy.2_Missense_Mutation_p.G381E|RANBP3_uc002mdz.2_Missense_Mutation_p.G376E|RANBP3_uc010duq.2_Missense_Mutation_p.G354E|RANBP3_uc002mea.2_Missense_Mutation_p.G316E|RANBP3_uc010xix.1_Missense_Mutation_p.G321E	p.G449E	NM_007322	NP_015561	Q9H6Z4	RANB3_HUMAN			15	1573	-			449			RanBD1.		B2RAT8|O60405|O75759|O75760|Q9BT47|Q9UG74	Missense_Mutation	SNP	ENST00000340578.6	37	c.1346G>A	CCDS42478.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.659616	0.88154	.	.	ENSG00000031823	ENST00000340578;ENST00000439268;ENST00000034275;ENST00000541471	T;T;T;T	0.42900	0.96;0.96;0.96;0.96	4.98	4.98	0.66077	Pleckstrin homology-type (1);Ran binding protein 1 (3);	0.000000	0.85682	D	0.000000	T	0.74520	0.3727	H	0.95224	3.64	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	T	0.82596	-0.0379	10	0.59425	D	0.04	-32.1759	15.7563	0.78030	0.0:1.0:0.0:0.0	.	321;444;321;376;381;444;449	F5H4C2;Q53GE1;B7Z5P4;B7Z7F3;Q9H6Z4-3;Q9H6Z4-2;Q9H6Z4	.;.;.;.;.;.;RANB3_HUMAN	E	449;444;381;321	ENSP00000341483:G449E;ENSP00000404837:G444E;ENSP00000034275:G381E;ENSP00000445071:G321E	ENSP00000034275:G381E	G	-	2	0	RANBP3	5869634	1.000000	0.71417	0.997000	0.53966	0.844000	0.47949	7.392000	0.79840	2.291000	0.77112	0.561000	0.74099	GGG		0.607	RANBP3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452304.1	NM_007322		13	102	0	0	0	0.001368	0	13	102				
VAV1	7409	broad.mit.edu	37	19	6825072	6825072	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr19:6825072G>C	ENST00000602142.1	+	7	745	c.663G>C	c.(661-663)ttG>ttC	p.L221F	VAV1_ENST00000304076.2_Missense_Mutation_p.L221F|VAV1_ENST00000599806.1_Missense_Mutation_p.L166F|VAV1_ENST00000596764.1_Missense_Mutation_p.L189F|VAV1_ENST00000539284.1_Missense_Mutation_p.L124F	NM_005428.3	NP_005419.2	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	221	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|reactive oxygen species metabolic process (GO:0072593)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L221F(1)		biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(16)|lung(18)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	62						AGCATTTCTTGAAGCCCCTGC	0.527																																							uc002mfu.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(4)|ovary(4)|breast(3)|central_nervous_system(2)|kidney(2)|skin(1)	16						c.(661-663)TTG>TTC		vav 1 guanine nucleotide exchange factor							124.0	126.0	126.0					19																	6825072		2203	4300	6503	SO:0001583	missense	7409				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|T cell costimulation	cytosol|plasma membrane	metal ion binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr19:6825072G>C		CCDS12174.1, CCDS59341.1, CCDS59342.1	19p13.2	2013-02-14	2007-07-25			ENSG00000141968		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12657	protein-coding gene	gene with protein product		164875	"""vav 1 oncogene"""	VAV		9438848	Standard	NM_005428		Approved		uc010xjh.2	P15498		ENST00000602142.1:c.663G>C	19.37:g.6825072G>C	ENSP00000472929:p.Leu221Phe					VAV1_uc010xjh.1_Missense_Mutation_p.L189F|VAV1_uc010dva.1_Missense_Mutation_p.L221F|VAV1_uc002mfv.1_Missense_Mutation_p.L166F	p.L221F	NM_005428	NP_005419	P15498	VAV_HUMAN			7	760	+			221			DH.		B4DVK9|M0QXX6|Q15860	Missense_Mutation	SNP	ENST00000602142.1	37	c.663G>C	CCDS12174.1	.	.	.	.	.	.	.	.	.	.	G	13.83	2.353278	0.41700	.	.	ENSG00000141968	ENST00000304076;ENST00000539284	T;T	0.59906	0.23;0.23	5.02	3.94	0.45596	Dbl homology (DH) domain (5);Calponin homology domain (1);	0.370054	0.26931	N	0.021767	T	0.64494	0.2603	M	0.73217	2.22	0.28218	N	0.926652	B;P;B;P	0.41393	0.411;0.526;0.229;0.748	B;B;B;P	0.47528	0.105;0.127;0.276;0.549	T	0.63079	-0.6717	10	0.66056	D	0.02	.	12.8124	0.57647	0.0:0.1661:0.8339:0.0	.	124;221;166;221	F5H5P4;B2R8B5;Q96D37;P15498	.;.;.;VAV_HUMAN	F	221;124	ENSP00000302269:L221F;ENSP00000443242:L124F	ENSP00000302269:L221F	L	+	3	2	VAV1	6776072	1.000000	0.71417	0.980000	0.43619	0.571000	0.35966	4.997000	0.63921	1.048000	0.40298	0.655000	0.94253	TTG		0.527	VAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458475.1			50	160	0	0	0	0.00361	0	50	160				
CERS4	79603	broad.mit.edu	37	19	8320764	8320764	+	Splice_Site	SNP	G	G	A	rs560901451		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr19:8320764G>A	ENST00000251363.5	+	6	768		c.e6+1		CERS4_ENST00000559450.1_Splice_Site|CERS4_ENST00000595722.1_Splice_Site|CERS4_ENST00000559336.1_Splice_Site|CERS4_ENST00000558331.1_Splice_Site	NM_024552.2	NP_078828.2	Q9HA82	CERS4_HUMAN	ceramide synthase 4						ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										CCTGTACCACGTGAGTATACC	0.587													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16165	0.0		0.0	False		,,,				2504	0.0						uc002mjg.2		NA																	0				ovary(1)	1						c.e6+1		LAG1 homolog, ceramide synthase 4							77.0	70.0	72.0					19																	8320764		2203	4300	6503	SO:0001630	splice_region_variant	79603					endoplasmic reticulum membrane|integral to membrane|nuclear membrane	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity	g.chr19:8320764G>A		CCDS12197.1	19p13.2	2014-09-11	2011-07-08	2011-07-08	ENSG00000090661	ENSG00000090661		"""Homeoboxes / CERS class"""	23747	protein-coding gene	gene with protein product		615334	"""LAG1 longevity assurance homolog 4 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 4"""	LASS4			Standard	NM_024552		Approved	FLJ12089, Trh1	uc002mjg.3	Q9HA82	OTTHUMG00000172570	ENST00000251363.5:c.468+1G>A	19.37:g.8320764G>A						LASS4_uc002mjh.2_Splice_Site_p.H105_splice|LASS4_uc002mji.2_Splice_Site|LASS4_uc010dvz.2_Splice_Site_p.H156_splice	p.H156_splice	NM_024552	NP_078828	Q9HA82	CERS4_HUMAN			6	788	+								D6W665	Splice_Site	SNP	ENST00000251363.5	37	c.468_splice	CCDS12197.1	.	.	.	.	.	.	.	.	.	.	G	10.65	1.410137	0.25465	.	.	ENSG00000090661	ENST00000251363	.	.	.	4.23	4.23	0.50019	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.095	0.53750	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CERS4	8226764	1.000000	0.71417	0.998000	0.56505	0.024000	0.10985	7.091000	0.76923	1.907000	0.55213	0.491000	0.48974	.		0.587	CERS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419200.1	NM_024552	Intron	4	72	0	0	0	0.009096	0	4	72				
MUC16	94025	broad.mit.edu	37	19	9047244	9047244	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr19:9047244G>T	ENST00000397910.4	-	5	34590	c.34387C>A	c.(34387-34389)Ctg>Atg	p.L11463M		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	11465	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.L11463M(1)|p.L7096M(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTGATGACCAGTGAGGTCAGC	0.493																																							uc002mkp.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(34387-34389)CTG>ATG		mucin 16							176.0	168.0	171.0					19																	9047244		2013	4198	6211	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9047244G>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.34387C>A	19.37:g.9047244G>T	ENSP00000381008:p.Leu11463Met						p.L11463M	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN			5	34591	-			11465			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.34387C>A	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	8.362	0.833366	0.16820	.	.	ENSG00000181143	ENST00000397910	T	0.02345	4.33	2.84	-0.741	0.11112	.	.	.	.	.	T	0.07279	0.0184	L	0.55481	1.735	.	.	.	D	0.65815	0.995	D	0.66351	0.943	T	0.29941	-0.9995	8	0.87932	D	0	.	2.3869	0.04368	0.2868:0.0:0.4747:0.2385	.	11463	B5ME49	.	M	11463	ENSP00000381008:L11463M	ENSP00000381008:L11463M	L	-	1	2	MUC16	8908244	0.000000	0.05858	0.001000	0.08648	0.480000	0.33159	-2.107000	0.01337	-0.062000	0.13088	0.306000	0.20318	CTG		0.493	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		59	162	1	0	1.16596e-39	0.00361	2.02243e-39	59	162				
MUC16	94025	broad.mit.edu	37	19	9091786	9091786	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr19:9091786G>T	ENST00000397910.4	-	1	232	c.29C>A	c.(28-30)tCa>tAa	p.S10*		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	10					cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.S10*(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGGAGAAGATGACCCAGGAAG	0.547																																							uc002mkp.2		NA																	2	Substitution - Nonsense(2)		lung(2)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(28-30)TCA>TAA		mucin 16							67.0	64.0	65.0					19																	9091786		1997	4160	6157	SO:0001587	stop_gained	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9091786G>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.29C>A	19.37:g.9091786G>T	ENSP00000381008:p.Ser10*						p.S10*	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN			1	233	-			10			Extracellular (Potential).		Q6ZQW5|Q96RK2	Nonsense_Mutation	SNP	ENST00000397910.4	37	c.29C>A	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	22.5	4.303658	0.81136	.	.	ENSG00000181143	ENST00000397910	.	.	.	1.35	0.172	0.15031	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	5.1959	0.15236	0.0:0.3745:0.6255:0.0	.	.	.	.	X	10	.	ENSP00000381008:S10X	S	-	2	0	MUC16	8952786	0.001000	0.12720	0.000000	0.03702	0.076000	0.17211	0.402000	0.20965	0.120000	0.18254	0.313000	0.20887	TCA		0.547	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		4	41	1	0	1.23904e-05	0.000602	1.45374e-05	4	41				
FARSA	2193	broad.mit.edu	37	19	13041475	13041475	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr19:13041475C>A	ENST00000314606.4	-	2	254	c.236G>T	c.(235-237)cGt>cTt	p.R79L	CTC-425F1.2_ENST00000592636.1_RNA|FARSA_ENST00000423140.2_Missense_Mutation_p.R79L|FARSA_ENST00000588025.1_Missense_Mutation_p.R119L	NM_004461.2	NP_004452.1	Q9Y285	SYFA_HUMAN	phenylalanyl-tRNA synthetase, alpha subunit	79					gene expression (GO:0010467)|phenylalanyl-tRNA aminoacylation (GO:0006432)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|phenylalanine-tRNA ligase activity (GO:0004826)|poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)	p.R79L(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|ovary(3)|upper_aerodigestive_tract(1)	20					L-Phenylalanine(DB00120)	TCGAAACACACGGGCCTCATG	0.612																																							uc002mvs.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(235-237)CGT>CTT		phenylalanyl-tRNA synthetase, alpha subunit	L-Phenylalanine(DB00120)						58.0	50.0	53.0					19																	13041475		2203	4300	6503	SO:0001583	missense	2193				phenylalanyl-tRNA aminoacylation	cytosol|soluble fraction	ATP binding|phenylalanine-tRNA ligase activity|protein binding|tRNA binding	g.chr19:13041475C>A	U07424	CCDS12287.1	19p13.2	2014-05-06	2007-02-23	2007-02-23	ENSG00000179115	ENSG00000179115	6.1.1.20	"""Aminoacyl tRNA synthetases / Class II"""	3592	protein-coding gene	gene with protein product	"""phenylalanine tRNA ligase 1, alpha, cytoplasmic"""	602918	"""phenylalanine-tRNA synthetase-like"", ""phenylalanyl-tRNA synthetase-like, alpha subunit"""	FARSL, FARSLA		9177188	Standard	NM_004461		Approved	CML33	uc002mvs.2	Q9Y285	OTTHUMG00000180569	ENST00000314606.4:c.236G>T	19.37:g.13041475C>A	ENSP00000320309:p.Arg79Leu					FARSA_uc002mvt.2_RNA|FARSA_uc010xmv.1_Missense_Mutation_p.R79L|FARSA_uc010dyy.1_Intron	p.R79L	NM_004461	NP_004452	Q9Y285	SYFA_HUMAN			2	284	-			79					B4E363|Q9NSD8|Q9Y4W8	Missense_Mutation	SNP	ENST00000314606.4	37	c.236G>T	CCDS12287.1	.	.	.	.	.	.	.	.	.	.	C	19.65	3.866822	0.72065	.	.	ENSG00000179115	ENST00000314606;ENST00000423140	T;T	0.67523	-0.27;0.28	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.64057	0.2564	L	0.57130	1.785	0.80722	D	1	B;B	0.15719	0.013;0.014	B;B	0.16722	0.016;0.009	T	0.59101	-0.7517	10	0.17832	T	0.49	-18.4734	18.1786	0.89769	0.0:1.0:0.0:0.0	.	79;79	B4E363;Q9Y285	.;SYFA_HUMAN	L	79	ENSP00000320309:R79L;ENSP00000396548:R79L	ENSP00000320309:R79L	R	-	2	0	FARSA	12902475	1.000000	0.71417	0.994000	0.49952	0.955000	0.61496	5.638000	0.67861	2.598000	0.87819	0.561000	0.74099	CGT		0.612	FARSA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451935.1	NM_004461		26	44	1	0	4.47668e-21	0.003954	7.12718e-21	26	44				
CPAMD8	27151	broad.mit.edu	37	19	17057956	17057956	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr19:17057956C>A	ENST00000443236.1	-	21	2762	c.2731G>T	c.(2731-2733)Gtg>Ttg	p.V911L		NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	864						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.V911L(1)		breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						CCGGGGGCCACACACATCTTC	0.587																																							uc002nfb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13						c.(2731-2733)GTG>TTG		C3 and PZP-like, alpha-2-macroglobulin domain							142.0	142.0	142.0					19																	17057956		2028	4187	6215	SO:0001583	missense	27151					extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity	g.chr19:17057956C>A	AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.2731G>T	19.37:g.17057956C>A	ENSP00000402505:p.Val911Leu						p.V911L	NM_015692	NP_056507	Q8IZJ3	CPMD8_HUMAN			21	2763	-			864					Q8NC09|Q9ULD7	Missense_Mutation	SNP	ENST00000443236.1	37	c.2731G>T	CCDS42519.1	.	.	.	.	.	.	.	.	.	.	C	16.50	3.139413	0.56936	.	.	ENSG00000160111	ENST00000291440	.	.	.	3.46	-1.73	0.08081	.	0.000000	0.64402	U	0.000006	T	0.45776	0.1359	M	0.73598	2.24	0.80722	D	1	B	0.29188	0.236	B	0.22386	0.039	T	0.17745	-1.0359	9	0.19147	T	0.46	.	6.1395	0.20251	0.0:0.542:0.2877:0.1703	.	864	Q8IZJ3	CPMD8_HUMAN	L	911	.	ENSP00000291440:V911L	V	-	1	0	CPAMD8	16918956	1.000000	0.71417	0.002000	0.10522	0.694000	0.40290	2.291000	0.43540	-0.682000	0.05197	0.491000	0.48974	GTG		0.587	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257531.2	NM_015692		41	153	1	0	1.15505e-17	0.009718	1.7932e-17	41	153				
CILP2	148113	broad.mit.edu	37	19	19654969	19654969	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr19:19654969C>T	ENST00000291495.5	+	8	1700	c.1615C>T	c.(1615-1617)Cct>Tct	p.P539S	CILP2_ENST00000586018.1_Missense_Mutation_p.P545S	NM_153221.2	NP_694953.2	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	539						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)		p.P539S(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	32						CCGGGTCTTGCCTTTTGATCC	0.602																																							uc002nmv.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1615-1617)CCT>TCT		cartilage intermediate layer protein 2							47.0	50.0	49.0					19																	19654969		2202	4300	6502	SO:0001583	missense	148113					proteinaceous extracellular matrix	carbohydrate binding|carboxypeptidase activity	g.chr19:19654969C>T	AF542080	CCDS12405.1	19p13.11	2013-01-14				ENSG00000160161		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	24213	protein-coding gene	gene with protein product		612419				12477932	Standard	NM_153221		Approved	MGC45771	uc002nmv.4	Q8IUL8		ENST00000291495.5:c.1615C>T	19.37:g.19654969C>T	ENSP00000291495:p.Pro539Ser					CILP2_uc002nmw.3_Missense_Mutation_p.P545S	p.P539S	NM_153221	NP_694953	Q8IUL8	CILP2_HUMAN			8	1700	+			539					Q6NV88|Q8N4A6|Q8WV21	Missense_Mutation	SNP	ENST00000291495.5	37	c.1615C>T	CCDS12405.1	.	.	.	.	.	.	.	.	.	.	C	12.78	2.039955	0.35989	.	.	ENSG00000160161	ENST00000291495	T	0.49139	0.79	3.77	3.77	0.43336	Carbohydrate-binding-like fold (1);	0.141721	0.46442	D	0.000281	T	0.63954	0.2555	M	0.64404	1.975	0.32998	D	0.525929	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.987	T	0.75001	-0.3471	10	0.72032	D	0.01	-12.2858	13.1452	0.59456	0.0:1.0:0.0:0.0	.	539;539	B2RAJ0;Q8IUL8	.;CILP2_HUMAN	S	539	ENSP00000291495:P539S	ENSP00000291495:P539S	P	+	1	0	CILP2	19515969	1.000000	0.71417	0.989000	0.46669	0.487000	0.33371	3.112000	0.50368	1.662000	0.50781	0.430000	0.28490	CCT		0.602	CILP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459738.3	NM_153221		18	62	0	0	0	0.006122	0	18	62				
CTC-260E6.6	0	broad.mit.edu	37	19	20369153	20369153	+	RNA	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr19:20369153G>T	ENST00000593655.1	-	0	199																											taactcgctagggtacaacaA	0.443																																							uc002nov.2		NA																	0					0						c.(-56--52)TAGGG>TATGG		SubName: Full=cDNA FLJ51655, highly similar to Actin-like protein 2;																																						284441							g.chr19:20369153G>T																													19.37:g.20369153G>T								NR_003128						1	697	+									Translation_Start_Site	SNP	ENST00000593655.1	37	c.-54G>T																																																																																					0.443	CTC-260E6.6-006	KNOWN	basic	antisense	antisense	OTTHUMT00000462901.1			6	63	1	0	0.00116845	0.001168	0.00125798	6	63				
ZNF208	7757	broad.mit.edu	37	19	22154156	22154156	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr19:22154156C>A	ENST00000397126.4	-	4	3828	c.3680G>T	c.(3679-3681)tGt>tTt	p.C1227F	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	1227					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.C1099F(2)|p.C1227F(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				ACATTCTTCACATTTGTAGGG	0.388																																							uc002nqp.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(5)|skin(2)	7						c.(3295-3297)TGT>TTT		zinc finger protein 208							45.0	49.0	48.0					19																	22154156		2112	4248	6360	SO:0001583	missense	7757							g.chr19:22154156C>A	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.3680G>T	19.37:g.22154156C>A	ENSP00000380315:p.Cys1227Phe					ZNF208_uc002nqo.1_Intron	p.C1099F	NM_007153	NP_009084					6	3445	-		all_lung(12;0.0961)|Lung NSC(12;0.103)							Missense_Mutation	SNP	ENST00000397126.4	37	c.3296G>T	CCDS54240.1	.	.	.	.	.	.	.	.	.	.	C	13.30	2.194861	0.38806	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	D	0.85088	-1.94	2.89	1.81	0.25067	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.87489	0.6190	.	.	.	0.23568	N	0.997393	D	0.60575	0.988	P	0.55011	0.766	T	0.77600	-0.2527	8	0.87932	D	0	.	8.6485	0.34020	0.0:0.8742:0.0:0.1258	.	1099	O43345	ZN208_HUMAN	F	1227;1099	ENSP00000380315:C1227F	ENSP00000380315:C1227F	C	-	2	0	ZNF208	21945996	0.926000	0.31397	0.004000	0.12327	0.134000	0.20937	2.893000	0.48633	0.210000	0.20664	0.306000	0.20318	TGT		0.388	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153		5	88	1	0	1.23904e-05	0.000602	1.45374e-05	5	88				
ZNF208	7757	broad.mit.edu	37	19	22155846	22155846	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr19:22155846G>T	ENST00000397126.4	-	4	2138	c.1990C>A	c.(1990-1992)Ccc>Acc	p.P664T	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	664					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.P564T(2)|p.P664T(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				CATTTGTAGGGCTTCTCTCCA	0.383																																							uc002nqp.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(5)|skin(2)	7						c.(1690-1692)CCC>ACC		zinc finger protein 208							55.0	62.0	59.0					19																	22155846		2065	4223	6288	SO:0001583	missense	7757							g.chr19:22155846G>T	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.1990C>A	19.37:g.22155846G>T	ENSP00000380315:p.Pro664Thr					ZNF208_uc002nqo.1_Intron	p.P564T	NM_007153	NP_009084					5	1839	-		all_lung(12;0.0961)|Lung NSC(12;0.103)							Missense_Mutation	SNP	ENST00000397126.4	37	c.1690C>A	CCDS54240.1	.	.	.	.	.	.	.	.	.	.	G	4.472	0.087553	0.08583	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.16897	2.31	2.43	2.43	0.29744	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.36193	0.0958	.	.	.	0.09310	N	1	D	0.89917	1.0	D	0.83275	0.996	T	0.05007	-1.0912	8	0.66056	D	0.02	.	8.3338	0.32202	0.0:0.2464:0.7536:0.0	.	564	O43345	ZN208_HUMAN	T	664;564	ENSP00000380315:P664T	ENSP00000380315:P664T	P	-	1	0	ZNF208	21947686	0.058000	0.20735	0.004000	0.12327	0.017000	0.09413	2.406000	0.44557	0.917000	0.36895	0.280000	0.19369	CCC		0.383	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153		11	112	1	0	0.000219431	0.00245	0.000245658	11	112				
RYR1	6261	broad.mit.edu	37	19	38948237	38948237	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr19:38948237T>A	ENST00000359596.3	+	17	1892	c.1892T>A	c.(1891-1893)cTg>cAg	p.L631Q	RYR1_ENST00000355481.4_Missense_Mutation_p.L631Q|RYR1_ENST00000360985.3_Missense_Mutation_p.L631Q			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	631	B30.2/SPRY 1. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.L631Q(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CGTGAGCTTCTGCTGCAGACA	0.522																																							uc002oit.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12						c.(1891-1893)CTG>CAG		skeletal muscle ryanodine receptor isoform 1	Dantrolene(DB01219)						252.0	204.0	220.0					19																	38948237		2203	4300	6503	SO:0001583	missense	6261				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr19:38948237T>A	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.1892T>A	19.37:g.38948237T>A	ENSP00000352608:p.Leu631Gln					RYR1_uc002oiu.2_Missense_Mutation_p.L631Q	p.L631Q	NM_000540	NP_000531	P21817	RYR1_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		17	2022	+	all_cancers(60;7.91e-06)		631			Cytoplasmic.|B30.2/SPRY 1.		Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	c.1892T>A	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	T	16.43	3.120933	0.56613	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.97831	-4.56;-4.56;-4.56	3.76	3.76	0.43208	Intracellular calcium-release channel (1);B30.2/SPRY domain (1);	0.000000	0.49916	U	0.000133	D	0.98626	0.9540	M	0.87269	2.87	0.51767	D	0.999932	D;D	0.89917	0.999;1.0	D;D	0.91635	0.987;0.999	D	0.99372	1.0920	10	0.87932	D	0	.	12.5993	0.56489	0.0:0.0:0.0:1.0	.	631;631	P21817-2;P21817	.;RYR1_HUMAN	Q	631	ENSP00000352608:L631Q;ENSP00000347667:L631Q;ENSP00000354254:L631Q	ENSP00000347667:L631Q	L	+	2	0	RYR1	43640077	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.825000	0.86693	1.716000	0.51395	0.454000	0.30748	CTG		0.522	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1			54	116	0	0	0	0.00361	0	54	116				
RYR1	6261	broad.mit.edu	37	19	38991553	38991553	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr19:38991553G>C	ENST00000359596.3	+	47	7537	c.7537G>C	c.(7537-7539)Gag>Cag	p.E2513Q	RYR1_ENST00000355481.4_Missense_Mutation_p.E2513Q|RYR1_ENST00000360985.3_Missense_Mutation_p.E2513Q			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	2513	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.E2513Q(1)|p.E2513*(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GTATGGCATCGAGAACCAGGA	0.632																																							uc002oit.2		NA																	2	Substitution - Missense(1)|Substitution - Nonsense(1)		lung(2)	ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12						c.(7537-7539)GAG>CAG		skeletal muscle ryanodine receptor isoform 1	Dantrolene(DB01219)						102.0	71.0	81.0					19																	38991553		2203	4300	6503	SO:0001583	missense	6261				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr19:38991553G>C	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.7537G>C	19.37:g.38991553G>C	ENSP00000352608:p.Glu2513Gln					RYR1_uc002oiu.2_Missense_Mutation_p.E2513Q|RYR1_uc002oiv.1_5'UTR	p.E2513Q	NM_000540	NP_000531	P21817	RYR1_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		47	7667	+	all_cancers(60;7.91e-06)		2513			Cytoplasmic.|6 X approximate repeats.		Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	c.7537G>C	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	G	13.04	2.117794	0.37339	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.97303	-4.33;-4.33;-4.33	4.41	4.41	0.53225	.	0.075454	0.50627	U	0.000103	D	0.95548	0.8553	L	0.42245	1.32	0.49299	D	0.999773	P;P	0.52061	0.95;0.917	P;B	0.46510	0.519;0.32	D	0.95346	0.8442	10	0.45353	T	0.12	.	15.9284	0.79639	0.0:0.0:1.0:0.0	.	2513;2513	P21817-2;P21817	.;RYR1_HUMAN	Q	2513	ENSP00000352608:E2513Q;ENSP00000347667:E2513Q;ENSP00000354254:E2513Q	ENSP00000347667:E2513Q	E	+	1	0	RYR1	43683393	1.000000	0.71417	0.986000	0.45419	0.416000	0.31233	6.561000	0.73955	2.259000	0.74868	0.491000	0.48974	GAG		0.632	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1			14	33	0	0	0	0.001855	0	14	33				
ZNF180	7733	broad.mit.edu	37	19	44981270	44981270	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr19:44981270C>G	ENST00000221327.4	-	5	1709	c.1428G>C	c.(1426-1428)caG>caC	p.Q476H	ZNF180_ENST00000592529.1_Missense_Mutation_p.Q449H|AC069278.4_ENST00000591684.1_lincRNA|ZNF180_ENST00000585514.1_5'Flank|ZNF180_ENST00000391956.4_Missense_Mutation_p.Q451H	NM_013256.3	NP_037388.2	Q9UJW8	ZN180_HUMAN	zinc finger protein 180	476					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q476H(1)		NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(14)|lung(6)|ovary(2)|urinary_tract(1)	33		Prostate(69;0.0435)				GTTTATAGCTCTGGATAAATG	0.363																																					Esophageal Squamous(180;1353 2003 32862 46574 49854)	Esophageal Squamous(180;1353 2003 32862 46574 49854)	uc002ozf.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1426-1428)CAG>CAC		zinc finger protein 180							74.0	75.0	75.0					19																	44981270		2203	4299	6502	SO:0001583	missense	7733				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:44981270C>G	AF192913	CCDS12639.1, CCDS62707.1, CCDS62708.1	19q13.2	2013-01-08	2006-08-22			ENSG00000167384		"""Zinc fingers, C2H2-type"", ""-"""	12970	protein-coding gene	gene with protein product		606740	"""zinc finger protein 180 (HHZ168)"""				Standard	NM_001288762		Approved	HHZ168	uc002ozf.4	Q9UJW8		ENST00000221327.4:c.1428G>C	19.37:g.44981270C>G	ENSP00000221327:p.Gln476His					ZNF180_uc002ozh.3_Missense_Mutation_p.Q133H|ZNF180_uc002ozi.3_Missense_Mutation_p.Q449H|ZNF180_uc002ozg.3_Missense_Mutation_p.Q475H|ZNF180_uc010ejm.2_Missense_Mutation_p.Q451H	p.Q476H	NM_013256	NP_037388	Q9UJW8	ZN180_HUMAN			5	1710	-		Prostate(69;0.0435)	476			C2H2-type 5.		B2RCN6|B3KV56|K7EQX9|Q58F03|Q9P1U2	Missense_Mutation	SNP	ENST00000221327.4	37	c.1428G>C	CCDS12639.1	.	.	.	.	.	.	.	.	.	.	C	8.154	0.788114	0.16258	.	.	ENSG00000167384	ENST00000221327;ENST00000391956	T;T	0.05513	3.43;3.43	5.2	2.96	0.34315	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.39985	N	0.001210	T	0.01905	0.0060	N	0.03029	-0.43	0.27342	N	0.956476	P;P;P	0.47302	0.869;0.893;0.893	B;B;B	0.35039	0.122;0.194;0.194	T	0.44757	-0.9307	10	0.18276	T	0.48	-6.6193	6.632	0.22861	0.0:0.69:0.1475:0.1624	.	451;475;476	G5E9B8;Q58F03;Q9UJW8	.;.;ZN180_HUMAN	H	476;451	ENSP00000221327:Q476H;ENSP00000375818:Q451H	ENSP00000221327:Q476H	Q	-	3	2	ZNF180	49673110	0.000000	0.05858	1.000000	0.80357	0.985000	0.73830	-0.896000	0.04114	1.174000	0.42811	0.460000	0.39030	CAG		0.363	ZNF180-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451601.1	NM_013256		9	110	0	0	0	0.004482	0	9	110				
STRN4	29888	broad.mit.edu	37	19	47223906	47223906	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr19:47223906G>T	ENST00000263280.6	-	17	2264	c.2215C>A	c.(2215-2217)Ctc>Atc	p.L739I	STRN4_ENST00000391910.3_Missense_Mutation_p.L746I|STRN4_ENST00000594357.2_5'Flank|STRN4_ENST00000539396.1_Missense_Mutation_p.L620I	NM_001039877.1|NM_013403.2	NP_001034966.1|NP_037535.2	Q9NRL3	STRN4_HUMAN	striatin, calmodulin binding protein 4	739						cell projection (GO:0042995)|cytoplasm (GO:0005737)|membrane (GO:0016020)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)	p.L739I(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000563)|all cancers(93;0.00138)|Epithelial(262;0.0217)|GBM - Glioblastoma multiforme(486;0.035)		CTGGCAATGAGGGCCTTGCTG	0.667																																							uc002pfl.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2215-2217)CTC>ATC		zinedin isoform 1							130.0	90.0	104.0					19																	47223906		2203	4300	6503	SO:0001583	missense	29888					cytoplasm|membrane	armadillo repeat domain binding|calmodulin binding|protein complex binding|protein phosphatase 2A binding	g.chr19:47223906G>T	AF212940	CCDS12690.1, CCDS42581.1	19q13.32	2013-01-10			ENSG00000090372	ENSG00000090372		"""WD repeat domain containing"""	15721	protein-coding gene	gene with protein product		614767				10748158	Standard	XM_006723171		Approved	zinedin, ZIN	uc002pfm.3	Q9NRL3		ENST00000263280.6:c.2215C>A	19.37:g.47223906G>T	ENSP00000263280:p.Leu739Ile					STRN4_uc002pfm.2_Missense_Mutation_p.L746I|STRN4_uc010xyf.1_RNA	p.L739I	NM_013403	NP_037535	Q9NRL3	STRN4_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.000563)|all cancers(93;0.00138)|Epithelial(262;0.0217)|GBM - Glioblastoma multiforme(486;0.035)	17	2248	-		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)	739			WD 7.		A0A024R0V2|B4DQH7|F8VYA6|Q8NE53	Missense_Mutation	SNP	ENST00000263280.6	37	c.2215C>A	CCDS12690.1	.	.	.	.	.	.	.	.	.	.	G	18.56	3.651480	0.67472	.	.	ENSG00000090372	ENST00000391910;ENST00000263280;ENST00000539396	D;D;D	0.81659	-1.52;-1.52;-1.52	4.45	3.41	0.39046	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.072613	0.56097	D	0.000028	T	0.71500	0.3347	L	0.33485	1.01	0.80722	D	1	P;B	0.41929	0.765;0.245	B;B	0.43052	0.406;0.197	T	0.69658	-0.5086	10	0.46703	T	0.11	-21.8369	8.1906	0.31366	0.1884:0.0:0.8116:0.0	.	746;739	F8VYA6;Q9NRL3	.;STRN4_HUMAN	I	746;739;620	ENSP00000375777:L746I;ENSP00000263280:L739I;ENSP00000440901:L620I	ENSP00000263280:L739I	L	-	1	0	STRN4	51915746	1.000000	0.71417	1.000000	0.80357	0.817000	0.46193	4.678000	0.61641	1.078000	0.41014	0.462000	0.41574	CTC		0.667	STRN4-001	KNOWN	NMD_exception|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466607.2			4	46	1	0	0.00116845	0.001168	0.00125798	4	46				
SULT2B1	6820	broad.mit.edu	37	19	49100065	49100065	+	Missense_Mutation	SNP	T	T	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr19:49100065T>G	ENST00000201586.2	+	6	893	c.715T>G	c.(715-717)Tcc>Gcc	p.S239A	SULT2B1_ENST00000594274.1_3'UTR|SULT2B1_ENST00000323090.4_Missense_Mutation_p.S224A	NM_177973.1	NP_814444.1	O00204	ST2B1_HUMAN	sulfotransferase family, cytosolic, 2B, member 1	239					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sulfate assimilation (GO:0000103)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	alcohol sulfotransferase activity (GO:0004027)|steroid sulfotransferase activity (GO:0050294)	p.S224A(1)|p.S239A(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(2)|skin(2)|urinary_tract(1)	11		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000115)|all cancers(93;0.000147)|GBM - Glioblastoma multiforme(486;0.00707)|Epithelial(262;0.0178)		GGCACTGGGCTCCGTCGTGGC	0.667																																							uc002pjl.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(715-717)TCC>GCC		sulfotransferase family, cytosolic, 2B, member 1							85.0	59.0	68.0					19																	49100065		2203	4300	6503	SO:0001583	missense	6820				3'-phosphoadenosine 5'-phosphosulfate metabolic process|steroid metabolic process|xenobiotic metabolic process	cytosol	alcohol sulfotransferase activity|protein binding|steroid sulfotransferase activity	g.chr19:49100065T>G	U92314	CCDS12723.1, CCDS12724.1	19q13.3	2008-02-05				ENSG00000088002		"""Sulfotransferases, cytosolic"""	11459	protein-coding gene	gene with protein product		604125				9799594	Standard	NM_177973		Approved	HSST2	uc002pjl.3	O00204		ENST00000201586.2:c.715T>G	19.37:g.49100065T>G	ENSP00000201586:p.Ser239Ala					SULT2B1_uc002pjm.2_Missense_Mutation_p.S224A	p.S239A	NM_177973	NP_814444	O00204	ST2B1_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.000115)|all cancers(93;0.000147)|GBM - Glioblastoma multiforme(486;0.00707)|Epithelial(262;0.0178)	6	796	+		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)	239			PAPS.		O00205|O75814	Missense_Mutation	SNP	ENST00000201586.2	37	c.715T>G	CCDS12723.1	.	.	.	.	.	.	.	.	.	.	T	8.920	0.960781	0.18583	.	.	ENSG00000088002	ENST00000201586;ENST00000323090	D;D	0.82526	-1.62;-1.62	4.29	4.29	0.51040	Sulfotransferase domain (1);	0.000000	0.56097	D	0.000040	T	0.82061	0.4955	N	0.25332	0.735	0.37622	D	0.921346	B;P	0.36837	0.447;0.571	B;P	0.56474	0.416;0.799	T	0.77555	-0.2544	10	0.10902	T	0.67	.	11.7383	0.51778	0.0:0.0:0.0:1.0	.	224;239	O00204-2;O00204	.;ST2B1_HUMAN	A	239;224	ENSP00000201586:S239A;ENSP00000312880:S224A	ENSP00000201586:S239A	S	+	1	0	SULT2B1	53791877	0.241000	0.23857	0.176000	0.23000	0.167000	0.22549	2.844000	0.48246	1.713000	0.51359	0.454000	0.30748	TCC		0.667	SULT2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466140.1	NM_004605		5	29	0	0	0	0.000602	0	5	29				
FTL	2512	broad.mit.edu	37	19	49469978	49469978	+	Missense_Mutation	SNP	C	C	G	rs1803580		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr19:49469978C>G	ENST00000331825.6	+	4	721	c.514C>G	c.(514-516)Ctc>Gtc	p.L172V	CTD-2639E6.9_ENST00000599784.1_lincRNA	NM_000146.3	NP_000137.2	P02792	FRIL_HUMAN	ferritin, light polypeptide	172					cell death (GO:0008219)|cellular iron ion homeostasis (GO:0006879)|iron ion homeostasis (GO:0055072)|iron ion transport (GO:0006826)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular ferritin complex (GO:0008043)|membrane (GO:0016020)	ferric iron binding (GO:0008199)|identical protein binding (GO:0042802)|iron ion binding (GO:0005506)	p.L172V(1)		cervix(1)|kidney(3)|lung(5)	9		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000152)|all cancers(93;0.000435)|GBM - Glioblastoma multiforme(486;0.0171)|Epithelial(262;0.0267)	Iron Dextran(DB00893)	AAGGCTCACTCTCAAGCACGA	0.567																																							uc002plo.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(514-516)CTC>GTC		ferritin, light polypeptide	Iron Dextran(DB00893)						58.0	61.0	60.0					19																	49469978		2203	4300	6503	SO:0001583	missense	2512				cell death|cellular iron ion homeostasis|cellular membrane organization|iron ion transport|post-Golgi vesicle-mediated transport	cytosol|intracellular ferritin complex	ferric iron binding|identical protein binding|oxidoreductase activity	g.chr19:49469978C>G	AY207005	CCDS33070.1	19q13.33	2014-05-19			ENSG00000087086	ENSG00000087086			3999	protein-coding gene	gene with protein product	"""ferritin light polypeptide-like 3"", ""L apoferritin"", ""ferritin L subunit"", ""ferritin light chain"", ""ferritin L-chain"", ""neurodegeneration with brain iron accumulation 3"""	134790				3000916, 9526618	Standard	NM_000146		Approved	MGC71996, NBIA3	uc002plo.3	P02792		ENST00000331825.6:c.514C>G	19.37:g.49469978C>G	ENSP00000366525:p.Leu172Val					FTL_uc002pln.1_3'UTR	p.L172V	NM_000146	NP_000137	P02792	FRIL_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.000152)|all cancers(93;0.000435)|GBM - Glioblastoma multiforme(486;0.0171)|Epithelial(262;0.0267)	4	713	+		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)	172					B2R4B9|Q6IBT7|Q7Z2W1|Q86WI9|Q8WU07|Q96AU9|Q96CU0|Q9BTZ8	Missense_Mutation	SNP	ENST00000331825.6	37	c.514C>G	CCDS33070.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.660548	0.88154	.	.	ENSG00000087086	ENST00000331825	T	0.70869	-0.52	4.46	4.46	0.54185	Ferritin/ribonucleotide reductase-like (1);Ferritin-related (1);	.	.	.	.	D	0.82761	0.5107	H	0.95079	3.62	0.37412	D	0.913283	P	0.39737	0.685	P	0.44811	0.461	D	0.89556	0.3803	9	0.72032	D	0.01	.	15.0094	0.71539	0.0:1.0:0.0:0.0	.	172	P02792	FRIL_HUMAN	V	172	ENSP00000366525:L172V	ENSP00000366525:L172V	L	+	1	0	FTL	54161790	0.996000	0.38824	0.991000	0.47740	0.980000	0.70556	3.395000	0.52558	2.485000	0.83878	0.563000	0.77884	CTC		0.567	FTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466233.1	NM_000146		4	107	0	0	0	0.009096	0	4	107				
GPR32	2854	broad.mit.edu	37	19	51274893	51274893	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr19:51274893T>C	ENST00000270590.4	+	1	1173	c.1036T>C	c.(1036-1038)Tca>Cca	p.S346P		NM_001506.1	NP_001497.1	O75388	GPR32_HUMAN	G protein-coupled receptor 32	346					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)	p.S346P(1)		breast(4)|endometrium(4)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	29		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		GGAGTTTCTGTCATCCTGTCC	0.537																																					Esophageal Squamous(113;152 1581 5732 15840 44398)	Esophageal Squamous(113;152 1581 5732 15840 44398)	uc010ycf.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)	1						c.(1036-1038)TCA>CCA		G protein-coupled receptor 32							62.0	68.0	66.0					19																	51274893		2203	4300	6503	SO:0001583	missense	2854					integral to plasma membrane	N-formyl peptide receptor activity	g.chr19:51274893T>C	AF045764	CCDS12801.1	19q13.33	2012-08-20			ENSG00000142511	ENSG00000142511		"""GPCR / Class A : Resolvin receptors"""	4487	protein-coding gene	gene with protein product	"""resolvin D1 receptor"""	603195				9653656	Standard	NM_001506		Approved	RVDR1	uc010ycf.3	O75388		ENST00000270590.4:c.1036T>C	19.37:g.51274893T>C	ENSP00000270590:p.Ser346Pro						p.S346P	NM_001506	NP_001497	O75388	GPR32_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)	1	1036	+		all_neural(266;0.131)	346			Cytoplasmic (Potential).		Q502U7|Q6NWS5	Missense_Mutation	SNP	ENST00000270590.4	37	c.1036T>C	CCDS12801.1	.	.	.	.	.	.	.	.	.	.	T	7.666	0.686006	0.14973	.	.	ENSG00000142511	ENST00000270590	T	0.31247	1.5	2.71	-1.3	0.09259	.	.	.	.	.	T	0.10337	0.0253	N	0.08118	0	0.09310	N	1	P	0.38110	0.618	B	0.25614	0.062	T	0.16689	-1.0394	9	0.66056	D	0.02	.	2.8779	0.05638	0.0:0.3186:0.2519:0.4294	.	346	O75388	GPR32_HUMAN	P	346	ENSP00000270590:S346P	ENSP00000270590:S346P	S	+	1	0	GPR32	55966705	0.001000	0.12720	0.002000	0.10522	0.014000	0.08584	0.161000	0.16481	-0.103000	0.12175	0.260000	0.18958	TCA		0.537	GPR32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465016.1			13	113	0	0	0	0.001855	0	13	113				
ZNF578	147660	broad.mit.edu	37	19	53014138	53014138	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr19:53014138C>G	ENST00000421239.2	+	6	748	c.504C>G	c.(502-504)caC>caG	p.H168Q	CTD-3099C6.5_ENST00000599143.1_RNA	NM_001099694.1	NP_001093164.1	Q96N58	ZN578_HUMAN	zinc finger protein 578	168					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H168Q(1)							GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)		CTGAACTCCACATATTTCAGC	0.413																																							uc002pzp.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(502-504)CAC>CAG		zinc finger protein 578							116.0	120.0	119.0					19																	53014138		2203	4300	6503	SO:0001583	missense	147660				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53014138C>G	AK095562	CCDS54310.1	19q13.41	2013-09-20			ENSG00000258405	ENSG00000258405		"""Zinc fingers, C2H2-type"", ""-"""	26449	protein-coding gene	gene with protein product							Standard	NM_001099694		Approved	FLJ31384	uc002pzp.4	Q96N58	OTTHUMG00000156468	ENST00000421239.2:c.504C>G	19.37:g.53014138C>G	ENSP00000459216:p.His168Gln						p.H168Q	NM_001099694	NP_001093164	Q96N58	ZN578_HUMAN		GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)	6	748	+			84			C2H2-type 3.		B4DR51|I3L1Y6	Missense_Mutation	SNP	ENST00000421239.2	37	c.504C>G	CCDS54310.1	.	.	.	.	.	.	.	.	.	.	-	0.060	-1.226356	0.01518	.	.	ENSG00000258405	ENST00000553364	.	.	.	1.42	-2.49	0.06403	.	.	.	.	.	T	0.10809	0.0264	N	0.01789	-0.72	0.09310	N	1	P	0.36535	0.557	B	0.38803	0.282	T	0.32561	-0.9902	7	.	.	.	.	7.8472	0.29433	0.0:0.4821:0.5179:0.0	.	168	G3V4F6	.	Q	168	.	.	H	+	3	2	ZNF578	57705950	0.000000	0.05858	0.002000	0.10522	0.037000	0.13140	-1.548000	0.02184	-0.074000	0.12820	0.134000	0.15878	CAC		0.413	ZNF578-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344298.3	NM_152472		10	227	0	0	0	0.006214	0	10	227				
ZNF347	84671	broad.mit.edu	37	19	53643854	53643854	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr19:53643854C>G	ENST00000334197.7	-	5	2295	c.2227G>C	c.(2227-2229)Ggg>Cgg	p.G743R	ZNF347_ENST00000601804.1_Intron|ZNF347_ENST00000601469.2_Missense_Mutation_p.G744R|ZNF347_ENST00000452676.2_Missense_Mutation_p.G744R	NM_032584.2	NP_115973.2	Q96SE7	ZN347_HUMAN	zinc finger protein 347	743					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G743R(1)		endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|prostate(3)|skin(1)	23				GBM - Glioblastoma multiforme(134;0.0179)		AAGACCTTCCCACACTCATTG	0.433																																					Melanoma(64;205 1597 17324 45721)	Melanoma(64;205 1597 17324 45721)	uc002qbb.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2227-2229)GGG>CGG		zinc finger protein 347							173.0	161.0	165.0					19																	53643854		2203	4300	6503	SO:0001583	missense	84671				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53643854C>G	AY029765	CCDS33097.1, CCDS54314.1	19q13.3	2013-01-08				ENSG00000197937		"""Zinc fingers, C2H2-type"", ""-"""	16447	protein-coding gene	gene with protein product							Standard	NM_032584		Approved	ZNF1111	uc010eql.2	Q96SE7		ENST00000334197.7:c.2227G>C	19.37:g.53643854C>G	ENSP00000334146:p.Gly743Arg					ZNF347_uc010eql.1_Missense_Mutation_p.G744R|ZNF347_uc002qbc.1_Missense_Mutation_p.G744R	p.G743R	NM_032584	NP_115973	Q96SE7	ZN347_HUMAN		GBM - Glioblastoma multiforme(134;0.0179)	5	2296	-			743			C2H2-type 18.		B3KU77|B9EG59|G5E9N4|Q8TCN1	Missense_Mutation	SNP	ENST00000334197.7	37	c.2227G>C	CCDS33097.1	.	.	.	.	.	.	.	.	.	.	C	16.47	3.131991	0.56828	.	.	ENSG00000197937	ENST00000334197;ENST00000452676	T;T	0.01484	4.84;4.84	3.08	-0.468	0.12146	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07773	0.0195	M	0.80183	2.485	0.23162	N	0.998197	D;D	0.89917	1.0;0.997	D;D	0.97110	1.0;0.923	T	0.14587	-1.0467	9	0.54805	T	0.06	.	5.4245	0.16417	0.0:0.6303:0.1656:0.2041	.	744;743	G5E9N4;Q96SE7	.;ZN347_HUMAN	R	743;744	ENSP00000334146:G743R;ENSP00000405218:G744R	ENSP00000334146:G743R	G	-	1	0	ZNF347	58335666	0.030000	0.19436	0.000000	0.03702	0.227000	0.25037	1.245000	0.32790	-0.103000	0.12175	0.655000	0.94253	GGG		0.433	ZNF347-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464170.1	NM_032584		40	158	0	0	0	0.007835	0	40	158				
ZNF665	79788	broad.mit.edu	37	19	53668345	53668345	+	Silent	SNP	G	G	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr19:53668345G>C	ENST00000600412.1	-	2	1318	c.1203C>G	c.(1201-1203)gtC>gtG	p.V401V	CTD-2245F17.2_ENST00000600257.1_RNA|ZNF665_ENST00000396424.3_Silent_p.V466V			Q9H7R5	ZN665_HUMAN	zinc finger protein 665	401					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V401V(1)|p.V466V(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	35				GBM - Glioblastoma multiforme(134;0.0196)		TTTGTGTGAAGACCTTACCGC	0.428																																							uc010eqm.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)	2						c.(1396-1398)GTC>GTG		zinc finger protein 665							82.0	85.0	84.0					19																	53668345		2203	4300	6503	SO:0001819	synonymous_variant	79788				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53668345G>C		CCDS46169.1	19q13.42	2013-01-08				ENSG00000197497		"""Zinc fingers, C2H2-type"", ""-"""	25885	protein-coding gene	gene with protein product							Standard	NM_024733		Approved	FLJ14345	uc010eqm.1	Q9H7R5		ENST00000600412.1:c.1203C>G	19.37:g.53668345G>C							p.V466V	NM_024733	NP_079009	Q9H7R5	ZN665_HUMAN		GBM - Glioblastoma multiforme(134;0.0196)	4	1498	-			401			C2H2-type 11.		A8K5T8	Silent	SNP	ENST00000600412.1	37	c.1398C>G																																																																																					0.428	ZNF665-002	PUTATIVE	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000464179.1	NM_024733		5	100	0	0	0	0.000602	0	5	100				
LILRB4	11006	broad.mit.edu	37	19	55177363	55177363	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr19:55177363G>T	ENST00000391736.1	+	9	1170	c.855G>T	c.(853-855)caG>caT	p.Q285H	LILRB4_ENST00000391733.3_Missense_Mutation_p.Q285H|LILRB4_ENST00000430952.2_Missense_Mutation_p.Q285H|LILRB4_ENST00000391734.3_Missense_Mutation_p.Q285H|LILRB4_ENST00000270452.2_Missense_Mutation_p.Q285H	NM_001278426.2|NM_001278428.2|NM_001278429.2|NM_001278430.2	NP_001265355.1|NP_001265357.1|NP_001265358.1|NP_001265359.1	Q8NHJ6	LIRB4_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4	285					immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)	p.Q285H(1)		breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(20)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)	39				GBM - Glioblastoma multiforme(193;0.035)		ACTGGCGTCAGGGAAAACACA	0.582																																							uc002qgp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(853-855)CAG>CAT		leukocyte immunoglobulin-like receptor,							126.0	87.0	100.0					19																	55177363		2203	4300	6503	SO:0001583	missense	11006					integral to membrane|plasma membrane	antigen binding|receptor activity	g.chr19:55177363G>T	U82979	CCDS12902.1, CCDS42618.1	19q13.4	2013-01-11				ENSG00000186818		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6608	protein-coding gene	gene with protein product		604821				9151699, 9079806	Standard	XM_005277050		Approved	LIR-5, ILT3, HM18, LIR5, CD85k	uc002qgp.3	Q8NHJ6		ENST00000391736.1:c.855G>T	19.37:g.55177363G>T	ENSP00000375616:p.Gln285His					LILRB4_uc002qgq.2_Missense_Mutation_p.Q285H|LILRB4_uc002qgr.2_Missense_Mutation_p.Q326H|LILRB4_uc010ert.2_Missense_Mutation_p.Q326H|LILRB4_uc010eru.2_Missense_Mutation_p.Q314H	p.Q285H	NM_006847	NP_006838	Q8NHJ6	LIRB4_HUMAN		GBM - Glioblastoma multiforme(193;0.035)	7	1217	+			285			Cytoplasmic (Potential).		A8MVL8|O15468|O75021|Q6FGQ9|Q8N1C7|Q8NHL5	Missense_Mutation	SNP	ENST00000391736.1	37	c.855G>T	CCDS12902.1	.	.	.	.	.	.	.	.	.	.	G	3.886	-0.024895	0.07589	.	.	ENSG00000186818	ENST00000391736;ENST00000270452;ENST00000430952;ENST00000391734;ENST00000391733;ENST00000434286	T;T;T;T;T;T	0.00493	7.11;7.11;7.1;7.07;7.12;7.0	1.86	0.799	0.18667	.	.	.	.	.	T	0.00845	0.0028	L	0.52126	1.63	0.09310	N	1	B;D;B;D;B	0.58268	0.099;0.978;0.05;0.982;0.141	B;P;B;D;B	0.65140	0.011;0.57;0.013;0.932;0.019	T	0.54463	-0.8290	9	0.37606	T	0.19	.	4.1764	0.10353	0.2158:0.0:0.7842:0.0	.	285;284;285;285;285	A8MUE1;C9JST2;Q8NHJ6-3;Q8NHJ6-2;Q8NHJ6	.;.;.;.;LIRB4_HUMAN	H	285;285;285;285;285;284	ENSP00000375616:Q285H;ENSP00000270452:Q285H;ENSP00000408995:Q285H;ENSP00000375614:Q285H;ENSP00000375613:Q285H;ENSP00000401962:Q284H	ENSP00000270452:Q285H	Q	+	3	2	LILRB4	59869175	0.001000	0.12720	0.001000	0.08648	0.008000	0.06430	0.174000	0.16743	0.342000	0.23796	0.407000	0.27541	CAG		0.582	LILRB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000141127.3			5	64	1	0	4.096e-09	0.001168	5.50706e-09	5	64				
LILRB4	11006	broad.mit.edu	37	19	55179179	55179179	+	Silent	SNP	C	C	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr19:55179179C>T	ENST00000391736.1	+	13	1450	c.1135C>T	c.(1135-1137)Ctg>Ttg	p.L379L	LILRB4_ENST00000391733.3_Silent_p.L380L|LILRB4_ENST00000430952.2_Silent_p.L378L|LILRB4_ENST00000391734.3_Intron|LILRB4_ENST00000270452.2_Silent_p.L379L	NM_001278426.2|NM_001278428.2|NM_001278429.2|NM_001278430.2	NP_001265355.1|NP_001265357.1|NP_001265358.1|NP_001265359.1	Q8NHJ6	LIRB4_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4	379					immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)	p.L379L(1)		breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(20)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)	39				GBM - Glioblastoma multiforme(193;0.035)		TCCCTCCCCACTGTCTGGGGA	0.582																																							uc002qgp.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)	3						c.(1135-1137)CTG>TTG		leukocyte immunoglobulin-like receptor,							70.0	70.0	70.0					19																	55179179		2202	4297	6499	SO:0001819	synonymous_variant	11006					integral to membrane|plasma membrane	antigen binding|receptor activity	g.chr19:55179179C>T	U82979	CCDS12902.1, CCDS42618.1	19q13.4	2013-01-11				ENSG00000186818		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6608	protein-coding gene	gene with protein product		604821				9151699, 9079806	Standard	XM_005277050		Approved	LIR-5, ILT3, HM18, LIR5, CD85k	uc002qgp.3	Q8NHJ6		ENST00000391736.1:c.1135C>T	19.37:g.55179179C>T						LILRB4_uc002qgq.2_Silent_p.L378L|LILRB4_uc002qgr.2_Silent_p.L421L|LILRB4_uc010ert.2_Silent_p.L420L|LILRB4_uc010eru.2_Silent_p.L409L	p.L379L	NM_006847	NP_006838	Q8NHJ6	LIRB4_HUMAN		GBM - Glioblastoma multiforme(193;0.035)	11	1497	+			379			Cytoplasmic (Potential).		A8MVL8|O15468|O75021|Q6FGQ9|Q8N1C7|Q8NHL5	Silent	SNP	ENST00000391736.1	37	c.1135C>T	CCDS12902.1																																																																																				0.582	LILRB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000141127.3			25	41	0	0	0	0.003954	0	25	41				
FCAR	2204	broad.mit.edu	37	19	55401199	55401199	+	Silent	SNP	C	C	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr19:55401199C>T	ENST00000355524.3	+	5	844	c.834C>T	c.(832-834)acC>acT	p.T278T	FCAR_ENST00000391726.3_Silent_p.T170T|FCAR_ENST00000353758.4_Silent_p.T169T|CTB-61M7.2_ENST00000594721.1_lincRNA|FCAR_ENST00000482092.2_3'UTR|FCAR_ENST00000391723.3_3'UTR|FCAR_ENST00000391725.3_Silent_p.T256T|FCAR_ENST00000345937.4_Silent_p.T182T|FCAR_ENST00000391724.3_Silent_p.T244T|FCAR_ENST00000359272.4_Silent_p.T266T	NM_002000.2	NP_001991.1	P24071	FCAR_HUMAN	Fc fragment of IgA, receptor for	278					immune response (GO:0006955)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.T278T(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|skin(2)	24				GBM - Glioblastoma multiforme(193;0.0443)		CAGGATTGACCTTTGCACGAA	0.527																																							uc002qhr.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(832-834)ACC>ACT		Fc alpha receptor isoform a precursor							119.0	120.0	120.0					19																	55401199		2203	4300	6503	SO:0001819	synonymous_variant	2204				immune response	extracellular region|integral to plasma membrane	IgA binding|receptor activity	g.chr19:55401199C>T	X54150	CCDS12907.1, CCDS12908.1, CCDS12909.1, CCDS12910.1, CCDS42622.1, CCDS42623.1, CCDS42624.1, CCDS42625.1, CCDS46180.1	19q13.42	2013-01-29			ENSG00000186431	ENSG00000186431		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3608	protein-coding gene	gene with protein product		147045				1577457	Standard	NM_133269		Approved	CD89	uc002qhr.1	P24071	OTTHUMG00000065936	ENST00000355524.3:c.834C>T	19.37:g.55401199C>T						FCAR_uc002qhs.1_RNA|FCAR_uc002qht.1_Silent_p.T229T|FCAR_uc010esi.1_Silent_p.T155T|FCAR_uc002qhu.1_Silent_p.T182T|FCAR_uc002qhv.1_Silent_p.T256T|FCAR_uc002qhw.1_Silent_p.T266T|FCAR_uc002qhx.1_Silent_p.T170T|FCAR_uc002qhy.1_Silent_p.T244T|FCAR_uc002qhz.1_3'UTR|FCAR_uc002qia.1_Silent_p.T169T	p.T278T	NM_002000	NP_001991	P24071	FCAR_HUMAN		GBM - Glioblastoma multiforme(193;0.0443)	5	1031	+			278			Cytoplasmic (Potential).		Q13603|Q13604|Q15727|Q15728|Q1AJL7|Q1AJL8|Q1AJL9|Q53X38|Q53X39|Q92587|Q92588|Q92590|Q92592|Q92593|Q9UEK0	Silent	SNP	ENST00000355524.3	37	c.834C>T	CCDS12907.1																																																																																				0.527	FCAR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000141243.1	NM_002000		13	125	0	0	0	0.001368	0	13	125				
NLRP5	126206	broad.mit.edu	37	19	56538820	56538820	+	Silent	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr19:56538820C>A	ENST00000390649.3	+	7	1221	c.1221C>A	c.(1219-1221)gtC>gtA	p.V407V		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	407	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)	p.V407V(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		TCCTGATCGTCACCGTCAGAG	0.547																																							uc002qmj.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7						c.(1219-1221)GTC>GTA		NACHT, LRR and PYD containing protein 5							44.0	46.0	45.0					19																	56538820		2091	4218	6309	SO:0001819	synonymous_variant	126206					mitochondrion|nucleolus	ATP binding	g.chr19:56538820C>A	AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.1221C>A	19.37:g.56538820C>A						NLRP5_uc002qmi.2_Silent_p.V388V	p.V407V	NM_153447	NP_703148	P59047	NALP5_HUMAN		GBM - Glioblastoma multiforme(193;0.0326)	7	1221	+		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)	407			NACHT.		A8MTY4|Q86W29	Silent	SNP	ENST00000390649.3	37	c.1221C>A	CCDS12938.1																																																																																				0.547	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313735.1	NM_153447		9	24	1	0	5.4927e-09	0.004482	7.3323e-09	9	24				
USP29	57663	broad.mit.edu	37	19	57641161	57641161	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr19:57641161C>A	ENST00000254181.4	+	4	1572	c.1118C>A	c.(1117-1119)gCt>gAt	p.A373D	USP29_ENST00000598197.1_Missense_Mutation_p.A373D	NM_020903.2	NP_065954.1	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	373	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)	p.A373V(1)|p.A373D(1)		breast(3)|endometrium(4)|kidney(3)|large_intestine(15)|lung(47)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		CAGAATGATGCTCATGAGTTT	0.353																																							uc002qny.2		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)	lung(6)|ovary(2)|breast(2)|pancreas(1)	11						c.(1117-1119)GCT>GAT		ubiquitin specific peptidase 29							56.0	57.0	56.0					19																	57641161		2203	4299	6502	SO:0001583	missense	57663				protein modification process|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity	g.chr19:57641161C>A		CCDS33124.1	19q13.4	2008-06-23	2005-08-08			ENSG00000131864		"""Ubiquitin-specific peptidases"""	18563	protein-coding gene	gene with protein product		609546	"""ubiquitin specific protease 29"""			12838346	Standard	NM_020903		Approved		uc002qny.3	Q9HBJ7		ENST00000254181.4:c.1118C>A	19.37:g.57641161C>A	ENSP00000254181:p.Ala373Asp						p.A373D	NM_020903	NP_065954	Q9HBJ7	UBP29_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)	4	1474	+		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)	373						Missense_Mutation	SNP	ENST00000254181.4	37	c.1118C>A	CCDS33124.1	.	.	.	.	.	.	.	.	.	.	C	13.71	2.319203	0.41096	.	.	ENSG00000131864	ENST00000254181	D	0.83250	-1.7	2.69	2.69	0.31865	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.44902	U	0.000413	D	0.90779	0.7105	M	0.87758	2.905	0.34037	D	0.654516	D	0.89917	1.0	D	0.97110	1.0	D	0.93738	0.7047	10	0.87932	D	0	-13.9409	11.5376	0.50648	0.0:1.0:0.0:0.0	.	373	Q9HBJ7	UBP29_HUMAN	D	373	ENSP00000254181:A373D	ENSP00000254181:A373D	A	+	2	0	USP29	62332973	0.998000	0.40836	0.895000	0.35142	0.174000	0.22865	3.208000	0.51114	1.767000	0.52121	0.591000	0.81541	GCT		0.353	USP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465075.1			12	77	1	0	7.93312e-07	0.00245	9.77722e-07	12	77				
USP29	57663	broad.mit.edu	37	19	57641213	57641213	+	Missense_Mutation	SNP	A	A	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr19:57641213A>C	ENST00000254181.4	+	4	1624	c.1170A>C	c.(1168-1170)aaA>aaC	p.K390N	USP29_ENST00000598197.1_Missense_Mutation_p.K390N	NM_020903.2	NP_065954.1	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	390	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)	p.K390N(1)		breast(3)|endometrium(4)|kidney(3)|large_intestine(15)|lung(47)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		ACATGGAAAAATTAAATGCCA	0.398																																							uc002qny.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(6)|ovary(2)|breast(2)|pancreas(1)	11						c.(1168-1170)AAA>AAC		ubiquitin specific peptidase 29							67.0	64.0	65.0					19																	57641213		2203	4299	6502	SO:0001583	missense	57663				protein modification process|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity	g.chr19:57641213A>C		CCDS33124.1	19q13.4	2008-06-23	2005-08-08			ENSG00000131864		"""Ubiquitin-specific peptidases"""	18563	protein-coding gene	gene with protein product		609546	"""ubiquitin specific protease 29"""			12838346	Standard	NM_020903		Approved		uc002qny.3	Q9HBJ7		ENST00000254181.4:c.1170A>C	19.37:g.57641213A>C	ENSP00000254181:p.Lys390Asn						p.K390N	NM_020903	NP_065954	Q9HBJ7	UBP29_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)	4	1526	+		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)	390						Missense_Mutation	SNP	ENST00000254181.4	37	c.1170A>C	CCDS33124.1	.	.	.	.	.	.	.	.	.	.	a	0.044	-1.272904	0.01421	.	.	ENSG00000131864	ENST00000254181	T	0.33438	1.41	2.69	-2.67	0.06059	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.235206	0.21800	N	0.068934	T	0.17280	0.0415	L	0.39245	1.2	0.09310	N	0.999999	B	0.14012	0.009	B	0.17722	0.019	T	0.11494	-1.0585	10	0.44086	T	0.13	-5.0334	1.4627	0.02399	0.4531:0.1445:0.2672:0.1353	.	390	Q9HBJ7	UBP29_HUMAN	N	390	ENSP00000254181:K390N	ENSP00000254181:K390N	K	+	3	2	USP29	62333025	0.099000	0.21834	0.000000	0.03702	0.000000	0.00434	-0.129000	0.10515	-1.266000	0.02446	-4.755000	0.00003	AAA		0.398	USP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465075.1			17	76	0	0	0	0.007413	0	17	76				
ZNF17	7565	broad.mit.edu	37	19	57931586	57931586	+	Silent	SNP	A	A	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr19:57931586A>T	ENST00000601808.1	+	3	939	c.726A>T	c.(724-726)ggA>ggT	p.G242G	AC004076.7_ENST00000597410.1_Intron|ZNF17_ENST00000307658.7_Silent_p.G244G	NM_006959.2	NP_008890.2	P17021	ZNF17_HUMAN	zinc finger protein 17	242					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G242G(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0234)|GBM - Glioblastoma multiforme(193;0.000426)|Lung(386;0.176)		ATCATACTGGAGAAAGGCCTT	0.403																																					Melanoma(149;1637 1853 29914 42869 44988)	Melanoma(149;1637 1853 29914 42869 44988)	uc002qoo.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(724-726)GGA>GGT		zinc finger protein 17							72.0	77.0	75.0					19																	57931586		2201	4299	6500	SO:0001819	synonymous_variant	7565				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:57931586A>T	X52341	CCDS42636.1	19q13.43	2013-01-08	2006-05-10			ENSG00000186272		"""Zinc fingers, C2H2-type"", ""-"""	12958	protein-coding gene	gene with protein product			"""zinc finger protein 17 (HPF3, KOX 10)"""			2115127, 2014798	Standard	NM_006959		Approved	HPF3, KOX10, KIAA1947, FLJ40864, FLJ46058, FLJ46615	uc002qoo.1	P17021		ENST00000601808.1:c.726A>T	19.37:g.57931586A>T						ZNF547_uc002qpm.3_Intron|ZNF17_uc002qop.1_Silent_p.G244G	p.G242G	NM_006959	NP_008890	P17021	ZNF17_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.0234)|GBM - Glioblastoma multiforme(193;0.000426)|Lung(386;0.176)	3	957	+		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)	242					B3KXU2|B3KY20|Q8N7M1|Q8N893|Q8TF54	Silent	SNP	ENST00000601808.1	37	c.726A>T	CCDS42636.1																																																																																				0.403	ZNF17-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466384.1	NM_006959		22	44	0	0	0	0.010504	0	22	44				
ZSCAN1	284312	broad.mit.edu	37	19	58564911	58564911	+	Missense_Mutation	SNP	G	G	T	rs267605735		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr19:58564911G>T	ENST00000282326.1	+	6	966	c.719G>T	c.(718-720)gGt>gTt	p.G240V		NM_182572.3	NP_872378.3	Q8NBB4	ZSCA1_HUMAN	zinc finger and SCAN domain containing 1	240					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription coactivator activity (GO:0003713)	p.G240V(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		AGCCCCAAGGGTCCAAGTGCT	0.602																																							uc002qrc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(718-720)GGT>GTT		zinc finger and SCAN domain containing 1							53.0	56.0	55.0					19																	58564911		2203	4300	6503	SO:0001583	missense	284312				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:58564911G>T	AK091098	CCDS12969.1	19q13.43	2013-06-13	2004-04-21		ENSG00000152467	ENSG00000152467		"""-"", ""Zinc fingers, C2H2-type"""	23712	protein-coding gene	gene with protein product			"""zinc finger with SCAN domain 1"""			12477932	Standard	NM_182572		Approved	FLJ33779, ZNF915	uc002qrc.1	Q8NBB4	OTTHUMG00000183381	ENST00000282326.1:c.719G>T	19.37:g.58564911G>T	ENSP00000282326:p.Gly240Val						p.G240V	NM_182572	NP_872378	Q8NBB4	ZSCA1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)	6	966	+		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)	240					Q3B798|Q6WLH8|Q86WS8	Missense_Mutation	SNP	ENST00000282326.1	37	c.719G>T	CCDS12969.1	.	.	.	.	.	.	.	.	.	.	G	2.517	-0.311539	0.05422	.	.	ENSG00000152467	ENST00000282326	T	0.04603	3.59	0.88	0.88	0.19161	.	.	.	.	.	T	0.02688	0.0081	N	0.08118	0	0.09310	N	0.999995	B	0.10296	0.003	B	0.10450	0.005	T	0.44982	-0.9292	9	0.34782	T	0.22	.	7.5791	0.27955	0.0:0.0:1.0:0.0	.	240	Q8NBB4	ZSCA1_HUMAN	V	240	ENSP00000282326:G240V	ENSP00000282326:G240V	G	+	2	0	ZSCAN1	63256723	0.000000	0.05858	0.015000	0.15790	0.022000	0.10575	-0.404000	0.07205	0.759000	0.33084	0.313000	0.20887	GGT		0.602	ZSCAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466427.1	NM_182572		20	37	1	0	2.54575e-18	0.010504	3.9964e-18	20	37				
TPO	7173	broad.mit.edu	37	2	1499813	1499813	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr2:1499813G>T	ENST00000345913.4	+	12	2150	c.2059G>T	c.(2059-2061)Gag>Tag	p.E687*	TPO_ENST00000349624.3_Nonsense_Mutation_p.E514*|TPO_ENST00000382201.3_Nonsense_Mutation_p.E630*|TPO_ENST00000337415.3_Nonsense_Mutation_p.E687*|TPO_ENST00000346956.3_Nonsense_Mutation_p.E687*|TPO_ENST00000497517.2_Intron|TPO_ENST00000329066.4_Nonsense_Mutation_p.E687*|TPO_ENST00000382198.1_Nonsense_Mutation_p.E514*	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	687					cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)	p.E687*(1)		breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	GCGTGAGCTGGAGAAGCACTC	0.562																																							uc002qww.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(7)|pancreas(6)|skin(5)|lung(1)|kidney(1)	20	GRCh37	CM024370	TPO	M		c.(2059-2061)GAG>TAG		thyroid peroxidase isoform a	Carbimazole(DB00389)|Methimazole(DB00763)|Propylthiouracil(DB00550)						81.0	66.0	71.0					2																	1499813		2203	4300	6503	SO:0001587	stop_gained	7173				cellular nitrogen compound metabolic process|hormone biosynthetic process|hydrogen peroxide catabolic process	cell surface|cytoplasm|integral to plasma membrane	calcium ion binding|heme binding|iodide peroxidase activity	g.chr2:1499813G>T		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.2059G>T	2.37:g.1499813G>T	ENSP00000318820:p.Glu687*					TPO_uc010ewj.2_Intron|TPO_uc002qwu.2_Nonsense_Mutation_p.E630*|TPO_uc002qwr.2_Nonsense_Mutation_p.E687*|TPO_uc002qwx.2_Nonsense_Mutation_p.E630*|TPO_uc010yio.1_Nonsense_Mutation_p.E514*|TPO_uc010yip.1_Nonsense_Mutation_p.E687*|TPO_uc002qwy.1_Nonsense_Mutation_p.E27*|TPO_uc002qwz.2_Intron	p.E687*	NM_000547	NP_000538	P07202	PERT_HUMAN		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	12	2150	+	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)	687			Extracellular (Potential).		P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Nonsense_Mutation	SNP	ENST00000345913.4	37	c.2059G>T	CCDS1643.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	36|36	5.753837|5.753837	0.96890|0.96890	.|.	.|.	ENSG00000115705|ENSG00000115705	ENST00000337415;ENST00000345913;ENST00000346956;ENST00000349624;ENST00000329066;ENST00000382201;ENST00000382198;ENST00000422464;ENST00000469607|ENST00000446278	.|.	.|.	.|.	4.52|4.52	3.62|3.62	0.41486|0.41486	.|.	0.821953|.	0.11254|.	N|.	0.583377|.	.|T	.|0.33323	.|0.0859	.|.	.|.	.|.	0.22754|0.22754	N|N	0.998778|0.998778	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.19224	.|-1.0312	.|4	0.07644|.	T|.	0.81|.	-5.1072|-5.1072	6.785|6.785	0.23668|0.23668	0.1279:0.1772:0.6949:0.0|0.1279:0.1772:0.6949:0.0	.|.	.|.	.|.	.|.	X|C	687;687;687;514;687;630;514;616;161|161	.|.	ENSP00000329869:E687X|.	E|W	+|+	1|3	0|0	TPO|TPO	1478820|1478820	0.001000|0.001000	0.12720|0.12720	0.191000|0.191000	0.23289|0.23289	0.371000|0.371000	0.29859|0.29859	0.380000|0.380000	0.20602|0.20602	0.994000|0.994000	0.38892|0.38892	0.561000|0.561000	0.74099|0.74099	GAG|TGG		0.562	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547		11	22	1	0	2.68362e-12	0.001368	3.90724e-12	11	22				
NBAS	51594	broad.mit.edu	37	2	15417165	15417165	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr2:15417165C>A	ENST00000281513.5	-	43	5224	c.5199G>T	c.(5197-5199)aaG>aaT	p.K1733N	NBAS_ENST00000441750.1_Missense_Mutation_p.K1613N	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	1733					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)		p.K1733N(1)		NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						CTGGATCAGTCTTCAAAGTCT	0.393																																							uc002rcc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|liver(1)|skin(1)	4						c.(5197-5199)AAG>AAT		neuroblastoma-amplified protein							77.0	76.0	76.0					2																	15417165		2203	4300	6503	SO:0001583	missense	51594							g.chr2:15417165C>A	BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.5199G>T	2.37:g.15417165C>A	ENSP00000281513:p.Lys1733Asn					NBAS_uc010exl.1_Missense_Mutation_p.K805N|NBAS_uc002rcd.1_RNA	p.K1733N	NM_015909	NP_056993	A2RRP1	NBAS_HUMAN			43	5225	-			1733					O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Missense_Mutation	SNP	ENST00000281513.5	37	c.5199G>T	CCDS1685.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.66|15.66	2.899107|2.899107	0.52227|0.52227	.|.	.|.	ENSG00000151779|ENSG00000151779	ENST00000441750;ENST00000281513|ENST00000442506	T;T|.	0.11169|.	2.8;2.99|.	5.49|5.49	2.66|2.66	0.31614|0.31614	.|.	0.133715|.	0.64402|.	D|.	0.000003|.	T|T	0.60894|0.60894	0.2304|0.2304	M|M	0.68317|0.68317	2.08|2.08	0.58432|0.58432	D|D	0.999994|0.999994	D;D|.	0.89917|.	0.996;1.0|.	P;D|.	0.71184|.	0.89;0.972|.	T|T	0.57136|0.57136	-0.7863|-0.7863	10|5	0.87932|.	D|.	0|.	.|.	6.7851|6.7851	0.23670|0.23670	0.0:0.5465:0.3243:0.1293|0.0:0.5465:0.3243:0.1293	.|.	1613;1733|.	A2RRP1-2;A2RRP1|.	.;NBAS_HUMAN|.	N|I	1613;1733|781	ENSP00000413201:K1613N;ENSP00000281513:K1733N|.	ENSP00000281513:K1733N|.	K|R	-|-	3|2	2|0	NBAS|NBAS	15334616|15334616	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.966000|0.966000	0.64601|0.64601	1.468000|1.468000	0.35332|0.35332	0.788000|0.788000	0.33755|0.33755	-0.175000|-0.175000	0.13238|0.13238	AAG|AGA		0.393	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241638.1	NM_015909		5	72	1	0	0.000602214	0.000602	0.000658452	5	72				
NBAS	51594	broad.mit.edu	37	2	15567913	15567913	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr2:15567913T>C	ENST00000281513.5	-	22	2370	c.2345A>G	c.(2344-2346)aAc>aGc	p.N782S	NBAS_ENST00000441750.1_Missense_Mutation_p.N782S	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	782					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)		p.N782S(1)		NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						GGAGTCACCGTTAAAACTCAA	0.393																																							uc002rcc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|liver(1)|skin(1)	4						c.(2344-2346)AAC>AGC		neuroblastoma-amplified protein							52.0	48.0	49.0					2																	15567913		2203	4300	6503	SO:0001583	missense	51594							g.chr2:15567913T>C	BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.2345A>G	2.37:g.15567913T>C	ENSP00000281513:p.Asn782Ser					NBAS_uc002rcd.1_RNA	p.N782S	NM_015909	NP_056993	A2RRP1	NBAS_HUMAN			22	2371	-			782					O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Missense_Mutation	SNP	ENST00000281513.5	37	c.2345A>G	CCDS1685.1	.	.	.	.	.	.	.	.	.	.	T	12.47	1.946462	0.34377	.	.	ENSG00000151779	ENST00000441750;ENST00000281513	T;T	0.17213	2.29;2.29	5.3	-6.4	0.01944	Secretory pathway Sec39 (1);	0.642064	0.17781	N	0.162245	T	0.06188	0.0160	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.21211	-1.0252	10	0.87932	D	0	.	7.1748	0.25738	0.0:0.4087:0.2332:0.3582	.	782	A2RRP1	NBAS_HUMAN	S	782	ENSP00000413201:N782S;ENSP00000281513:N782S	ENSP00000281513:N782S	N	-	2	0	NBAS	15485364	0.000000	0.05858	0.000000	0.03702	0.131000	0.20780	-2.371000	0.01074	-0.887000	0.03961	0.533000	0.62120	AAC		0.393	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241638.1	NM_015909		5	43	0	0	0	0.000602	0	5	43				
NCOA1	8648	broad.mit.edu	37	2	24933898	24933898	+	Silent	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr2:24933898G>A	ENST00000406961.1	+	14	3169	c.2517G>A	c.(2515-2517)gcG>gcA	p.A839A	NCOA1_ENST00000395856.3_Silent_p.A839A|NCOA1_ENST00000407230.1_Silent_p.A688A|NCOA1_ENST00000405141.1_Silent_p.A839A|NCOA1_ENST00000348332.3_Silent_p.A839A|NCOA1_ENST00000288599.5_Silent_p.A839A|NCOA1_ENST00000538539.1_Silent_p.A839A			Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1	839	Interaction with CREBBP.				androgen receptor signaling pathway (GO:0030521)|cellular lipid metabolic process (GO:0044255)|cellular response to hormone stimulus (GO:0032870)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|estrous cycle phase (GO:0060206)|hippocampus development (GO:0021766)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|labyrinthine layer morphogenesis (GO:0060713)|lactation (GO:0007595)|male gonad development (GO:0008584)|male mating behavior (GO:0060179)|ovulation cycle (GO:0042698)|positive regulation of apoptotic process (GO:0043065)|positive regulation of female receptivity (GO:0045925)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by galactose (GO:0000435)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular response to drug (GO:2001038)|response to estradiol (GO:0032355)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription coactivator activity (GO:0001105)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)	p.A839A(2)	PAX3/NCOA1(8)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(26)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	53	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGGATGGTGCGGTCACCAGTG	0.522			T	PAX3	alveolar rhadomyosarcoma																																		uc002rfk.2		NA		Dom	yes		2	2p23	8648	T	nuclear receptor coactivator 1			M	PAX3		alveolar rhadomyosarcoma	PAX3/NCOA1(8)	2	Substitution - coding silent(2)		lung(2)	soft_tissue(8)|ovary(1)|lung(1)|skin(1)	11						c.(2515-2517)GCG>GCA		nuclear receptor coactivator 1 isoform 1							121.0	106.0	111.0					2																	24933898		2203	4300	6503	SO:0001819	synonymous_variant	8648							g.chr2:24933898G>A	U40396	CCDS1712.1, CCDS1713.1, CCDS42660.1	2p23	2011-07-01			ENSG00000084676	ENSG00000084676		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7668	protein-coding gene	gene with protein product		602691				7481822, 9575154	Standard	XM_005264625		Approved	SRC1, F-SRC-1, NCoA-1, KAT13A, RIP160, bHLHe74	uc002rfk.3	Q15788	OTTHUMG00000125523	ENST00000406961.1:c.2517G>A	2.37:g.24933898G>A						NCOA1_uc010eye.2_Silent_p.A839A|NCOA1_uc002rfi.2_Silent_p.A688A|NCOA1_uc002rfj.2_Silent_p.A839A|NCOA1_uc002rfl.2_Silent_p.A839A	p.A839A	NM_003743	NP_003734	Q15788	NCOA1_HUMAN			12	2775	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		839			Interaction with CREBBP.		O00150|O43792|O43793|Q13071|Q13420|Q2T9G5|Q53SX3|Q6GVI5|Q7KYV3	Silent	SNP	ENST00000406961.1	37	c.2517G>A	CCDS1712.1																																																																																				0.522	NCOA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246852.3	NM_147223		22	38	0	0	0	0.001882	0	22	38				
C2orf70	339778	broad.mit.edu	37	2	26798827	26798827	+	Silent	SNP	C	C	A	rs534721835		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr2:26798827C>A	ENST00000329615.3	+	2	163	c.132C>A	c.(130-132)acC>acA	p.T44T	C2orf70_ENST00000409392.1_Missense_Mutation_p.H32N	NM_001105519.1	NP_001098989.1	A6NJV1	CB070_HUMAN	chromosome 2 open reading frame 70	44						nucleus (GO:0005634)		p.T44T(1)		breast(3)|endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(2)	13						ACGGCACCACCACCCTCAAGT	0.617																																							uc010eyn.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(130-132)ACC>ACA		hypothetical protein LOC339778							82.0	89.0	86.0					2																	26798827		2087	4209	6296	SO:0001819	synonymous_variant	339778							g.chr2:26798827C>A		CCDS42661.1	2p23.3	2011-05-09			ENSG00000173557	ENSG00000173557			27938	protein-coding gene	gene with protein product	"""hypothetical protein LOC339778"""						Standard	NM_001105519		Approved	LOC339778	uc010eyn.3	A6NJV1	OTTHUMG00000151994	ENST00000329615.3:c.132C>A	2.37:g.26798827C>A							p.T44T	NM_001105519	NP_001098989	A6NJV1	CB070_HUMAN			2	132	+			44						Silent	SNP	ENST00000329615.3	37	c.132C>A	CCDS42661.1	.	.	.	.	.	.	.	.	.	.	C	8.157	0.788654	0.16258	.	.	ENSG00000173557	ENST00000409392	.	.	.	4.8	3.91	0.45181	.	.	.	.	.	T	0.47154	0.1430	.	.	.	0.23727	N	0.997005	.	.	.	.	.	.	T	0.40757	-0.9546	5	0.87932	D	0	-8.1156	11.1637	0.48531	0.0:0.9052:0.0:0.0948	.	.	.	.	N	32	.	ENSP00000386615:H32N	H	+	1	0	C2orf70	26652331	0.864000	0.29904	0.994000	0.49952	0.319000	0.28217	0.492000	0.22435	2.196000	0.70406	0.462000	0.41574	CAC		0.617	C2orf70-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353258.1	NM_001105519		13	89	1	0	4.3838e-07	0.001855	5.52398e-07	13	89				
ZNF513	130557	broad.mit.edu	37	2	27600625	27600625	+	Silent	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr2:27600625G>A	ENST00000323703.6	-	4	1611	c.1413C>T	c.(1411-1413)ccC>ccT	p.P471P	ZNF513_ENST00000491924.1_5'UTR|ZNF513_ENST00000407879.1_Silent_p.P409P	NM_144631.5	NP_653232.3	Q8N8E2	ZN513_HUMAN	zinc finger protein 513	471					regulation of transcription, DNA-templated (GO:0006355)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription regulatory region DNA binding (GO:0044212)	p.P471P(1)		endometrium(5)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)	17	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CACAGCGGAAGGGCTTCTCGC	0.592																																							uc002rkk.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1411-1413)CCC>CCT		zinc finger protein 513							140.0	139.0	140.0					2																	27600625		2203	4300	6503	SO:0001819	synonymous_variant	130557				regulation of transcription, DNA-dependent|response to stimulus|retina development in camera-type eye|transcription, DNA-dependent|visual perception	nucleus	transcription regulatory region DNA binding|zinc ion binding	g.chr2:27600625G>A	AL833946	CCDS1751.1, CCDS56114.1	2p23.3	2014-01-28			ENSG00000163795	ENSG00000163795		"""Zinc fingers, C2H2-type"""	26498	protein-coding gene	gene with protein product		613598				12477932	Standard	NM_001201459		Approved	FLJ32203, RP58	uc002rkk.3	Q8N8E2	OTTHUMG00000097783	ENST00000323703.6:c.1413C>T	2.37:g.27600625G>A						ZNF513_uc002rkj.2_Silent_p.P409P	p.P471P	NM_144631	NP_653232	Q8N8E2	ZN513_HUMAN			4	1613	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		471					A8K3S5|B7WP71|Q3ZCU1|Q68CJ1|Q86UZ3|Q8NDL8|Q96ML3	Silent	SNP	ENST00000323703.6	37	c.1413C>T	CCDS1751.1																																																																																				0.592	ZNF513-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215026.2	NM_144631		69	147	0	0	0	0.00361	0	69	147				
C2orf16	84226	broad.mit.edu	37	2	27801985	27801985	+	Missense_Mutation	SNP	G	G	A	rs373409429	byFrequency	TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr2:27801985G>A	ENST00000408964.2	+	1	2597	c.2546G>A	c.(2545-2547)cGa>cAa	p.R849Q	AC074091.1_ENST00000408604.1_RNA	NM_032266.3	NP_115642.3	Q68DN1	CB016_HUMAN	chromosome 2 open reading frame 16	849						extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)		p.R849Q(2)		breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(33)|urinary_tract(1)	47	Acute lymphoblastic leukemia(172;0.155)					TGGAGATCACGATCTAGGACA	0.478													G|||	3	0.000599042	0.0	0.0	5008	,	,		19271	0.002		0.0	False		,,,				2504	0.001						uc002rkz.3		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(1)	1						c.(2545-2547)CGA>CAA		hypothetical protein LOC84226		G	GLN/ARG	2,3990		0,2,1994	59.0	61.0	60.0		2546	-4.7	0.0	2		60	0,8408		0,0,4204	no	missense	C2orf16	NM_032266.3	43	0,2,6198	AA,AG,GG		0.0,0.0501,0.0161	benign	849/1985	27801985	2,12398	1996	4204	6200	SO:0001583	missense	84226							g.chr2:27801985G>A	AL136898	CCDS42666.1	2p23.3	2013-09-20			ENSG00000221843	ENSG00000221843			25275	protein-coding gene	gene with protein product	"""P-S-E-R-S-H-H-S repeats containing"""						Standard	NM_032266		Approved	DKFZp434G118	uc002rkz.4	Q68DN1	OTTHUMG00000159099	ENST00000408964.2:c.2546G>A	2.37:g.27801985G>A	ENSP00000386190:p.Arg849Gln						p.R849Q	NM_032266	NP_115642	Q68DN1	CB016_HUMAN			1	2597	+	Acute lymphoblastic leukemia(172;0.155)		849					B9EIQ4|Q53S01|Q8ND64|Q9H088	Missense_Mutation	SNP	ENST00000408964.2	37	c.2546G>A	CCDS42666.1	.	.	.	.	.	.	.	.	.	.	G	15.01	2.706364	0.48412	5.01E-4	0.0	ENSG00000221843	ENST00000408964	T	0.05081	3.5	5.02	-4.7	0.03288	.	.	.	.	.	T	0.02380	0.0073	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.44034	-0.9354	9	0.44086	T	0.13	.	0.1171	0.00061	0.2893:0.2402:0.221:0.2495	.	849	Q68DN1	CB016_HUMAN	Q	849	ENSP00000386190:R849Q	ENSP00000386190:R849Q	R	+	2	0	C2orf16	27655489	0.000000	0.05858	0.032000	0.17829	0.375000	0.29983	-0.256000	0.08757	-0.687000	0.05162	-1.214000	0.01621	CGA		0.478	C2orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353292.1	NM_032266		5	123	0	0	0	0.000602	0	5	123				
TRMT61B	55006	broad.mit.edu	37	2	29092772	29092772	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr2:29092772C>A	ENST00000306108.5	-	1	395	c.372G>T	c.(370-372)atG>atT	p.M124I		NM_017910.3	NP_060380.3	Q9BVS5	TR61B_HUMAN	tRNA methyltransferase 61 homolog B (S. cerevisiae)	124					mitochondrial tRNA methylation (GO:0070901)|protein homooligomerization (GO:0051260)	mitochondrion (GO:0005739)|tRNA (m1A) methyltransferase complex (GO:0031515)	tRNA (adenine-N1-)-methyltransferase activity (GO:0016429)	p.M124I(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(8)	13						CCTGCGAGAGCATCGAAGGAT	0.617																																							uc002rmm.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(370-372)ATG>ATT		tRNA methyltransferase 61 homolog B							38.0	42.0	41.0					2																	29092772		2203	4300	6503	SO:0001583	missense	55006						tRNA (adenine-N1-)-methyltransferase activity	g.chr2:29092772C>A	BC010365	CCDS1768.1	2p23.2	2009-01-09			ENSG00000171103	ENSG00000171103			26070	protein-coding gene	gene with protein product						11230166	Standard	NM_017910		Approved	FLJ20628	uc002rmm.3	Q9BVS5	OTTHUMG00000128433	ENST00000306108.5:c.372G>T	2.37:g.29092772C>A	ENSP00000302801:p.Met124Ile					TRMT61B_uc002rmn.2_Missense_Mutation_p.M124I|TRMT61B_uc010ezk.2_RNA	p.M124I	NM_017910	NP_060380	Q9BVS5	TR61B_HUMAN			1	404	-			124					Q9H0Q9|Q9NWS7	Missense_Mutation	SNP	ENST00000306108.5	37	c.372G>T	CCDS1768.1	.	.	.	.	.	.	.	.	.	.	C	12.56	1.975098	0.34848	.	.	ENSG00000171103	ENST00000306108	T	0.41758	0.99	4.88	3.98	0.46160	.	1.591780	0.03942	N	0.287051	T	0.32315	0.0825	N	0.14661	0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.08889	-1.0700	10	0.37606	T	0.19	-8.7391	12.8355	0.57771	0.0:0.914:0.0:0.086	.	124;124	F8WDR2;Q9BVS5	.;TR61B_HUMAN	I	124	ENSP00000302801:M124I	ENSP00000302801:M124I	M	-	3	0	TRMT61B	28946276	0.000000	0.05858	0.005000	0.12908	0.005000	0.04900	-0.628000	0.05515	2.419000	0.82065	0.462000	0.41574	ATG		0.617	TRMT61B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250224.1	NM_017910		24	47	1	0	1.64293e-13	0.00333	2.42343e-13	24	47				
LTBP1	4052	broad.mit.edu	37	2	33525618	33525618	+	Silent	SNP	G	G	A	rs139837372		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr2:33525618G>A	ENST00000404816.2	+	21	3689	c.3336G>A	c.(3334-3336)tcG>tcA	p.S1112S	LTBP1_ENST00000272273.5_Silent_p.S52S|LTBP1_ENST00000404525.1_Silent_p.S733S|LTBP1_ENST00000390003.4_Silent_p.S787S|LTBP1_ENST00000407925.1_Silent_p.S786S|LTBP1_ENST00000418533.2_Silent_p.S786S|LTBP1_ENST00000354476.3_Silent_p.S1113S|LTBP1_ENST00000402934.1_Silent_p.S733S|LTBP1_ENST00000498013.1_3'UTR			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	1112	EGF-like 9; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)	p.S1113S(1)		breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				ACCAGCTGTCGGCAGCTAAAG	0.468																																							uc002ros.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8						c.(3337-3339)TCG>TCA		latent transforming growth factor beta binding		G	,,,,	1,4405	2.1+/-5.4	0,1,2202	78.0	78.0	78.0		2358,2358,2199,2199,3336	-5.8	0.5	2	dbSNP_134	78	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	LTBP1	NM_000627.3,NM_001166264.1,NM_001166265.1,NM_001166266.1,NM_206943.2	,,,,	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	,,,,	786/1396,786/1354,733/1343,733/1301,1112/1722	33525618	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	4052				negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity	g.chr2:33525618G>A		CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.3336G>A	2.37:g.33525618G>A						LTBP1_uc002rot.2_Silent_p.S787S|LTBP1_uc002rou.2_Silent_p.S786S|LTBP1_uc002rov.2_Silent_p.S733S|LTBP1_uc010ymz.1_Silent_p.S786S|LTBP1_uc010yna.1_Silent_p.S733S|LTBP1_uc010ynb.1_Silent_p.S52S	p.S1113S	NM_206943	NP_996826	Q14766	LTBP1_HUMAN			21	3339	+	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)	1112			EGF-like 9; calcium-binding (Potential).		A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Silent	SNP	ENST00000404816.2	37	c.3339G>A	CCDS33177.2	.	.	.	.	.	.	.	.	.	.	G	9.512	1.106127	0.20632	2.27E-4	1.16E-4	ENSG00000049323	ENST00000415140	.	.	.	5.39	-5.82	0.02333	.	.	.	.	.	T	0.34454	0.0898	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41805	-0.9488	4	.	.	.	.	0.3505	0.00348	0.3723:0.1732:0.1423:0.3121	.	.	.	.	Q	74	.	.	R	+	2	0	LTBP1	33379122	0.001000	0.12720	0.488000	0.27440	0.998000	0.95712	-0.204000	0.09425	-0.783000	0.04534	0.555000	0.69702	CGG		0.468	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326227.2	NM_206943		9	61	0	0	0	0.006214	0	9	61				
TTC7A	57217	broad.mit.edu	37	2	47251456	47251456	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr2:47251456G>T	ENST00000319190.5	+	14	1967	c.1599G>T	c.(1597-1599)caG>caT	p.Q533H	TTC7A_ENST00000409245.1_Missense_Mutation_p.Q499H|TTC7A_ENST00000461601.1_3'UTR|TTC7A_ENST00000263737.6_Missense_Mutation_p.Q179H|TTC7A_ENST00000394850.2_Missense_Mutation_p.Q533H	NM_020458.2	NP_065191.2	Q9ULT0	TTC7A_HUMAN	tetratricopeptide repeat domain 7A	533					cellular iron ion homeostasis (GO:0006879)|hemopoiesis (GO:0030097)			p.Q533H(1)		breast(4)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	25		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)			GTGACCCCCAGGTCATCCTCT	0.642																																							uc002rvo.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)|skin(1)	2						c.(1597-1599)CAG>CAT		tetratricopeptide repeat domain 7A							89.0	78.0	82.0					2																	47251456		2203	4300	6503	SO:0001583	missense	57217						binding	g.chr2:47251456G>T	AB032966	CCDS33193.1, CCDS74510.1, CCDS74511.1	2p16.3	2013-01-10	2004-06-02	2004-06-02	ENSG00000068724	ENSG00000068724		"""Tetratricopeptide (TTC) repeat domain containing"""	19750	protein-coding gene	gene with protein product		609332	"""tetratricopeptide repeat domain 7"""	TTC7		10574461	Standard	XM_005264439		Approved	KIAA1140	uc002rvo.3	Q9ULT0	OTTHUMG00000153121	ENST00000319190.5:c.1599G>T	2.37:g.47251456G>T	ENSP00000316699:p.Gln533His					TTC7A_uc002rvm.2_Missense_Mutation_p.Q499H|TTC7A_uc002rvn.1_Missense_Mutation_p.Q414H|TTC7A_uc010fbb.2_Missense_Mutation_p.Q533H|TTC7A_uc010fbc.2_Missense_Mutation_p.Q179H|TTC7A_uc002rvp.2_Missense_Mutation_p.Q414H|TTC7A_uc002rvq.2_Missense_Mutation_p.Q273H|TTC7A_uc002rvr.2_Translation_Start_Site	p.Q533H	NM_020458	NP_065191	Q9ULT0	TTC7A_HUMAN	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)		14	1967	+		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	533			TPR 5.		Q6PIX4|Q8ND67|Q9BUS3	Missense_Mutation	SNP	ENST00000319190.5	37	c.1599G>T	CCDS33193.1	.	.	.	.	.	.	.	.	.	.	G	12.27	1.888626	0.33348	.	.	ENSG00000068724	ENST00000409245;ENST00000319190;ENST00000394850;ENST00000263737;ENST00000434093	T;T;T;T	0.52057	0.68;0.68;0.68;0.68	5.43	2.46	0.29980	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.121727	0.56097	D	0.000024	T	0.59891	0.2227	M	0.65975	2.015	0.44899	D	0.997912	D;P;D;D;P	0.76494	0.984;0.953;0.999;0.991;0.942	D;P;D;D;P	0.72075	0.923;0.895;0.976;0.947;0.831	T	0.59637	-0.7417	10	0.52906	T	0.07	-28.9574	7.0467	0.25050	0.1651:0.1444:0.6905:0.0	.	533;499;533;361;499	Q2T9J9;B3KPK7;Q9ULT0;Q6P0M3;G5E9G4	.;.;TTC7A_HUMAN;.;.	H	499;533;533;179;360	ENSP00000386307:Q499H;ENSP00000316699:Q533H;ENSP00000378320:Q533H;ENSP00000263737:Q179H	ENSP00000263737:Q179H	Q	+	3	2	TTC7A	47104960	0.986000	0.35501	1.000000	0.80357	0.071000	0.16799	0.317000	0.19487	1.257000	0.44085	0.563000	0.77884	CAG		0.642	TTC7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329667.2	XM_372927		13	26	1	0	7.93312e-07	0.00245	9.77722e-07	13	26				
STARD7	56910	broad.mit.edu	37	2	96860740	96860740	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr2:96860740C>G	ENST00000337288.5	-	3	888	c.505G>C	c.(505-507)Gga>Cga	p.G169R	STARD7_ENST00000462501.1_5'UTR	NM_020151.3	NP_064536.2	Q9NQZ5	STAR7_HUMAN	StAR-related lipid transfer (START) domain containing 7	169	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.					mitochondrion (GO:0005739)	lipid binding (GO:0008289)	p.G169R(1)|p.G94R(1)		endometrium(2)|kidney(1)|large_intestine(1)|lung(8)|stomach(2)	14						GTGTAGGTTCCAAAAACTAGA	0.423																																							uc002svm.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(505-507)GGA>CGA		START domain containing 7 precursor							77.0	78.0	78.0					2																	96860740		2203	4300	6503	SO:0001583	missense	56910					mitochondrion		g.chr2:96860740C>G	AF270647	CCDS2017.2	2p11.1	2011-09-12	2007-08-16		ENSG00000084090	ENSG00000084090		"""StAR-related lipid transfer (START) domain containing"""	18063	protein-coding gene	gene with protein product			"""START domain containing 7"""				Standard	NM_020151		Approved	GTT1	uc002svm.4	Q9NQZ5	OTTHUMG00000130457	ENST00000337288.5:c.505G>C	2.37:g.96860740C>G	ENSP00000338030:p.Gly169Arg					STARD7_uc002svl.2_5'UTR	p.G169R	NM_020151	NP_064536	Q9NQZ5	STAR7_HUMAN			3	906	-			169			START.		D3DXG9|Q53T44|Q6GU43|Q969M6	Missense_Mutation	SNP	ENST00000337288.5	37	c.505G>C	CCDS2017.2	.	.	.	.	.	.	.	.	.	.	C	29.9	5.049614	0.93740	.	.	ENSG00000084090	ENST00000337288;ENST00000443962	T;T	0.34472	1.36;1.36	5.9	5.9	0.94986	Lipid-binding START (3);START-like domain (1);	0.054507	0.64402	D	0.000001	T	0.64821	0.2633	M	0.82517	2.595	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.65129	-0.6243	10	0.48119	T	0.1	-17.0304	17.7661	0.88478	0.0:1.0:0.0:0.0	.	169	Q9NQZ5	STAR7_HUMAN	R	169;68	ENSP00000338030:G169R;ENSP00000409410:G68R	ENSP00000338030:G169R	G	-	1	0	STARD7	96224467	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	6.918000	0.75788	2.793000	0.96121	0.563000	0.77884	GGA		0.423	STARD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252848.2			7	14	0	0	0	0.00308	0	7	14				
AFF3	3899	broad.mit.edu	37	2	100623335	100623335	+	Missense_Mutation	SNP	T	T	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr2:100623335T>G	ENST00000409236.2	-	5	744	c.632A>C	c.(631-633)cAc>cCc	p.H211P	AFF3_ENST00000317233.4_Missense_Mutation_p.H211P|AFF3_ENST00000356421.2_Missense_Mutation_p.H236P|AFF3_ENST00000409579.1_Missense_Mutation_p.H236P			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3	211					embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)	p.H236P(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						CTGAACACAGTGTCCGCTGCT	0.597																																							uc002tag.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)|lung(1)|kidney(1)|skin(1)	6						c.(631-633)CAC>CCC		AF4/FMR2 family, member 3 isoform 1							96.0	94.0	95.0					2																	100623335		2203	4300	6503	SO:0001583	missense	3899				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr2:100623335T>G	U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.632A>C	2.37:g.100623335T>G	ENSP00000387207:p.His211Pro					AFF3_uc002taf.2_Missense_Mutation_p.H236P|AFF3_uc010fiq.1_Missense_Mutation_p.H211P|AFF3_uc010yvr.1_Missense_Mutation_p.H365P|AFF3_uc002tah.1_Missense_Mutation_p.H236P|AFF3_uc010fir.1_Missense_Mutation_p.H288P|AFF3_uc002tai.2_Missense_Mutation_p.H133P	p.H211P	NM_002285	NP_002276	P51826	AFF3_HUMAN			6	868	-			211					B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	Missense_Mutation	SNP	ENST00000409236.2	37	c.632A>C	CCDS42723.1	.	.	.	.	.	.	.	.	.	.	T	17.69	3.451637	0.63290	.	.	ENSG00000144218	ENST00000317233;ENST00000356421;ENST00000409579;ENST00000409236;ENST00000433370;ENST00000444786;ENST00000432288	T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07	4.92	4.92	0.64577	.	0.218245	0.38720	N	0.001592	T	0.59918	0.2229	N	0.08118	0	0.47276	D	0.999378	D;D;D;D;D	0.76494	0.999;0.998;0.999;0.999;0.998	D;D;D;D;P	0.75020	0.985;0.934;0.985;0.977;0.905	T	0.61262	-0.7098	10	0.24483	T	0.36	.	14.7293	0.69368	0.0:0.0:0.0:1.0	.	365;365;211;211;236	B7Z4I6;C9JXV5;A8K353;P51826;P51826-2	.;.;.;AFF3_HUMAN;.	P	211;236;236;211;211;365;236	ENSP00000317421:H211P;ENSP00000348793:H236P;ENSP00000386834:H236P;ENSP00000387207:H211P	ENSP00000317421:H211P	H	-	2	0	AFF3	99989767	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	3.506000	0.53364	2.062000	0.61559	0.528000	0.53228	CAC		0.597	AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328982.3	NM_002285		5	132	0	0	0	0.001168	0	5	132				
NPAS2	4862	broad.mit.edu	37	2	101604708	101604708	+	Silent	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr2:101604708G>T	ENST00000335681.5	+	17	2082	c.1797G>T	c.(1795-1797)ctG>ctT	p.L599L	NPAS2_ENST00000542504.1_Silent_p.L664L	NM_002518.3	NP_002509.2	Q99743	NPAS2_HUMAN	neuronal PAS domain protein 2	599					cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|circadian sleep/wake cycle (GO:0042745)|locomotor rhythm (GO:0045475)|negative regulation of cell death (GO:0060548)|positive regulation of DNA repair (GO:0045739)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of response to DNA damage stimulus (GO:2001020)|response to redox state (GO:0051775)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|Hsp90 protein binding (GO:0051879)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.L599L(1)		cervix(1)|endometrium(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GCCAGCACCTGCTCAGAGAAT	0.567																																							uc002tap.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(1)	4						c.(1795-1797)CTG>CTT		neuronal PAS domain protein 2							50.0	55.0	54.0					2																	101604708		2200	4298	6498	SO:0001819	synonymous_variant	4862				central nervous system development|positive regulation of transcription from RNA polymerase II promoter|rhythmic process	transcription factor complex	DNA binding|Hsp90 protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity	g.chr2:101604708G>T	U77970	CCDS2048.1	2q11.2	2013-05-21			ENSG00000170485	ENSG00000170485		"""Basic helix-loop-helix proteins"""	7895	protein-coding gene	gene with protein product		603347				9012850, 9079689	Standard	NM_002518		Approved	MOP4, PASD4, bHLHe9	uc002tap.1	Q99743	OTTHUMG00000130675	ENST00000335681.5:c.1797G>T	2.37:g.101604708G>T						NPAS2_uc010yvt.1_Silent_p.L664L|NPAS2_uc010fit.1_Intron	p.L599L	NM_002518	NP_002509	Q99743	NPAS2_HUMAN			17	2083	+			599					Q4ZFV9|Q53SQ3|Q86V96|Q99629	Silent	SNP	ENST00000335681.5	37	c.1797G>T	CCDS2048.1	.	.	.	.	.	.	.	.	.	.	G	10.21	1.286171	0.23478	.	.	ENSG00000170485	ENST00000433408	.	.	.	5.7	5.7	0.88788	.	.	.	.	.	T	0.65544	0.2701	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.63028	-0.6728	4	.	.	.	.	13.5145	0.61533	0.0803:0.0:0.9197:0.0	.	.	.	.	S	98	.	.	A	+	1	0	NPAS2	100971140	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	1.648000	0.37271	2.673000	0.90976	0.655000	0.94253	GCT		0.567	NPAS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253168.3			4	108	1	0	0.00024832	0.009096	0.000275802	4	108				
GPR45	11250	broad.mit.edu	37	2	105859317	105859317	+	Silent	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr2:105859317C>A	ENST00000258456.1	+	1	1118	c.1002C>A	c.(1000-1002)gcC>gcA	p.A334A		NM_007227.3	NP_009158.3	Q9Y5Y3	GPR45_HUMAN	G protein-coupled receptor 45	334						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.A334A(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	28						TCCGCGAGGCCTGCATAGAGT	0.542																																							uc002tco.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|breast(1)|central_nervous_system(1)	3						c.(1000-1002)GCC>GCA		G protein-coupled receptor 45							82.0	86.0	85.0					2																	105859317		2203	4300	6503	SO:0001819	synonymous_variant	11250					integral to membrane|plasma membrane	G-protein coupled receptor activity|protein binding	g.chr2:105859317C>A	AF118266	CCDS2066.1	2q11.1-q12	2012-08-21			ENSG00000135973	ENSG00000135973		"""GPCR / Class A : Orphans"""	4503	protein-coding gene	gene with protein product		604838				10036181	Standard	NM_007227		Approved	PSP24, PSP24A	uc002tco.1	Q9Y5Y3	OTTHUMG00000130805	ENST00000258456.1:c.1002C>A	2.37:g.105859317C>A							p.A334A	NM_007227	NP_009158	Q9Y5Y3	GPR45_HUMAN			1	1118	+			334			Cytoplasmic (Potential).		Q6NWS4|Q6NXU6	Silent	SNP	ENST00000258456.1	37	c.1002C>A	CCDS2066.1																																																																																				0.542	GPR45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253348.1	NM_007227		13	115	1	0	0.00010058	0.001368	0.000113506	13	115				
ST6GAL2	84620	broad.mit.edu	37	2	107460416	107460416	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr2:107460416C>A	ENST00000409382.3	-	2	628	c.18G>T	c.(16-18)aaG>aaT	p.K6N	ST6GAL2_ENST00000409087.3_Missense_Mutation_p.K6N|AC016994.2_ENST00000425419.1_RNA|ST6GAL2_ENST00000361686.4_Missense_Mutation_p.K6N	NM_001142351.1	NP_001135823.1	Q96JF0	SIAT2_HUMAN	ST6 beta-galactosamide alpha-2,6-sialyltranferase 2	6					growth (GO:0040007)|multicellular organismal development (GO:0007275)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-galactoside alpha-2,6-sialyltransferase activity (GO:0003835)	p.K6N(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(30)|ovary(5)|pancreas(6)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	65						GTCTCCATTGCTTCAAGTGTG	0.493																																							uc002tdq.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(6)|ovary(4)|skin(1)	11						c.(16-18)AAG>AAT		ST6 beta-galactosamide							50.0	55.0	53.0					2																	107460416		2203	4300	6503	SO:0001583	missense	84620				growth|multicellular organismal development|oligosaccharide metabolic process|protein glycosylation	Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,6-sialyltransferase activity	g.chr2:107460416C>A	AB059555	CCDS2073.1, CCDS46380.1	2q11-q12	2008-02-05	2005-02-07	2005-02-07	ENSG00000144057	ENSG00000144057	2.4.99.2		10861	protein-coding gene	gene with protein product		608472	"""sialyltransferase 2 (monosialoganglioside sialyltransferase)"""	SIAT2			Standard	NM_032528		Approved	KIAA1877, St6gal2, St6GalII	uc002tdr.3	Q96JF0	OTTHUMG00000130923	ENST00000409382.3:c.18G>T	2.37:g.107460416C>A	ENSP00000386942:p.Lys6Asn					ST6GAL2_uc002tdr.2_Missense_Mutation_p.K6N|ST6GAL2_uc002tds.3_Missense_Mutation_p.K6N	p.K6N	NM_001142351	NP_001135823	Q96JF0	SIAT2_HUMAN			2	137	-			6			Cytoplasmic (Potential).		D3DVK3|Q53QP4|Q86Y44|Q8IUG7|Q96HE4	Missense_Mutation	SNP	ENST00000409382.3	37	c.18G>T	CCDS2073.1	.	.	.	.	.	.	.	.	.	.	C	15.29	2.788317	0.49997	.	.	ENSG00000144057	ENST00000361686;ENST00000409382;ENST00000409087;ENST00000419159	T;T;T	0.38560	2.16;2.16;1.13	5.74	2.69	0.31865	.	0.134505	0.64402	D	0.000002	T	0.56217	0.1970	L	0.57536	1.79	0.58432	D	0.999991	D;D	0.76494	0.999;0.999	D;D	0.74023	0.982;0.96	T	0.57118	-0.7866	10	0.87932	D	0	-38.6554	10.2147	0.43162	0.0:0.7781:0.0:0.2219	.	6;6	Q96JF0-2;Q96JF0	.;SIAT2_HUMAN	N	6	ENSP00000355273:K6N;ENSP00000386942:K6N;ENSP00000387332:K6N	ENSP00000355273:K6N	K	-	3	2	ST6GAL2	106826848	0.998000	0.40836	1.000000	0.80357	0.972000	0.66771	0.580000	0.23803	0.686000	0.31488	0.655000	0.94253	AAG		0.493	ST6GAL2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330065.1	NM_032528		30	52	1	0	5.77227e-19	0.008361	9.08688e-19	30	52				
RGPD4	285190	broad.mit.edu	37	2	108489238	108489238	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr2:108489238C>G	ENST00000408999.3	+	20	4855	c.4778C>G	c.(4777-4779)tCt>tGt	p.S1593C	RGPD4_ENST00000354986.4_Missense_Mutation_p.S1593C	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	1593					protein targeting to Golgi (GO:0000042)			p.S1593C(1)		breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						CAGAGTGGATCTGAAAGCAAA	0.383																																							uc010ywk.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(4777-4779)TCT>TGT		RANBP2-like and GRIP domain containing 4							35.0	30.0	32.0					2																	108489238		691	1591	2282	SO:0001583	missense	285190				intracellular transport		binding	g.chr2:108489238C>G	BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.4778C>G	2.37:g.108489238C>G	ENSP00000386810:p.Ser1593Cys					RGPD4_uc002tdu.2_Missense_Mutation_p.S780C|RGPD4_uc010ywl.1_RNA	p.S1593C	NM_182588	NP_872394	Q7Z3J3	RGPD4_HUMAN			20	4860	+			1593					B9A029	Missense_Mutation	SNP	ENST00000408999.3	37	c.4778C>G	CCDS46381.1	.	.	.	.	.	.	.	.	.	.	-	11.58	1.680885	0.29872	.	.	ENSG00000196862	ENST00000354986;ENST00000408999;ENST00000439322	T;T	0.41400	1.0;1.0	2.33	2.33	0.28932	.	.	.	.	.	T	0.34483	0.0899	L	0.51422	1.61	0.25027	N	0.991291	B	0.12630	0.006	B	0.08055	0.003	T	0.19549	-1.0302	9	0.35671	T	0.21	-8.3036	8.1755	0.31278	0.0:1.0:0.0:0.0	.	1593	Q7Z3J3	RGPD4_HUMAN	C	1593;1593;960	ENSP00000347081:S1593C;ENSP00000386810:S1593C	ENSP00000347081:S1593C	S	+	2	0	RGPD4	107855670	0.006000	0.16342	0.974000	0.42286	0.432000	0.31715	-0.054000	0.11826	1.303000	0.44873	0.162000	0.16502	TCT		0.383	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330096.2	XM_496581		16	492	0	0	0	0.006122	0	16	492				
IL37	27178	broad.mit.edu	37	2	113671403	113671403	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr2:113671403C>A	ENST00000263326.3	+	2	159	c.117C>A	c.(115-117)agC>agA	p.S39R	IL37_ENST00000311328.2_5'Flank|IL37_ENST00000349806.3_Intron|IL37_ENST00000353225.3_Missense_Mutation_p.S39R|IL37_ENST00000352179.3_Intron	NM_014439.3	NP_055254.2	Q9NZH6	IL37_HUMAN	interleukin 37	39					immune response (GO:0006955)|inflammatory response (GO:0006954)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleus (GO:0005634)	interleukin-1 receptor binding (GO:0005149)	p.S39R(1)		NS(1)|breast(2)|cervix(1)|endometrium(2)|large_intestine(1)|lung(7)|ovary(2)|skin(3)	19						CAGGCCCAAGCCTCCCCACCA	0.567																																							uc002tij.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(115-117)AGC>AGA		interleukin 1 family, member 7 isoform 1							89.0	74.0	79.0					2																	113671403		2203	4300	6503	SO:0001583	missense	27178				immune response	cytosol|extracellular space|nucleus	cytokine activity|interleukin-1 receptor antagonist activity|interleukin-1 receptor binding	g.chr2:113671403C>A	AF201832	CCDS2103.1, CCDS2104.1, CCDS2105.1, CCDS2106.1, CCDS2107.1	2q12-q14.1	2011-06-06	2011-06-06	2011-06-06	ENSG00000125571	ENSG00000125571		"""Interleukins and interleukin receptors"""	15563	protein-coding gene	gene with protein product	"""interleukin 1, zeta"", ""interleukin-1 homolog 4"", ""interleukin-1-related protein"""	605510	"""interleukin 1 family, member 7 (zeta)"""	IL1F7		10625660, 10512743, 12496389	Standard	NM_014439		Approved	FIL1, FIL1Z, FIL1(ZETA), IL-1H4, IL-1RP1, IL-1F7	uc002tij.3	Q9NZH6	OTTHUMG00000131345	ENST00000263326.3:c.117C>A	2.37:g.113671403C>A	ENSP00000263326:p.Ser39Arg					IL1F7_uc002tik.2_Intron|IL1F7_uc002til.2_Missense_Mutation_p.S39R|IL1F7_uc002tim.2_Intron|IL1F7_uc002tin.2_5'Flank	p.S39R	NM_014439	NP_055254	Q9NZH6	IL37_HUMAN			2	159	+			39					B5BU97|Q56AP9|Q8TD04|Q8TD05|Q9HBF2|Q9HBF3|Q9UHA6	Missense_Mutation	SNP	ENST00000263326.3	37	c.117C>A	CCDS2103.1	.	.	.	.	.	.	.	.	.	.	c	8.122	0.781143	0.16120	.	.	ENSG00000125571	ENST00000263326;ENST00000353225	T;T	0.58060	0.36;0.36	2.78	-1.39	0.08997	.	0.418705	0.17681	N	0.165611	T	0.38532	0.1044	L	0.51422	1.61	0.09310	N	1	B;B	0.20459	0.003;0.045	B;B	0.23018	0.008;0.043	T	0.31641	-0.9936	10	0.62326	D	0.03	-0.4362	2.6313	0.04945	0.2148:0.3803:0.0:0.4049	.	39;39	Q9NZH6-3;Q9NZH6	.;IL37_HUMAN	R	39	ENSP00000263326:S39R;ENSP00000309208:S39R	ENSP00000263326:S39R	S	+	3	2	IL37	113387874	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.857000	0.01660	-0.345000	0.08325	-0.269000	0.10298	AGC		0.567	IL37-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254126.1	NM_014439		5	47	1	0	0.000602214	0.000602	0.000658452	5	47				
CNTNAP5	129684	broad.mit.edu	37	2	125521656	125521656	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr2:125521656C>A	ENST00000431078.1	+	16	2826	c.2462C>A	c.(2461-2463)aCc>aAc	p.T821N		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	821	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.T821N(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		TTTTTTAAAACCACAGCATTA	0.398																																							uc002tno.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(10)	10						c.(2461-2463)ACC>AAC		contactin associated protein-like 5 precursor							138.0	130.0	132.0					2																	125521656		1826	4076	5902	SO:0001583	missense	129684				cell adhesion|signal transduction	integral to membrane	receptor binding	g.chr2:125521656C>A	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.2462C>A	2.37:g.125521656C>A	ENSP00000399013:p.Thr821Asn					CNTNAP5_uc010flu.2_Missense_Mutation_p.T822N	p.T821N	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.248)	16	2826	+			821			Laminin G-like 3.|Extracellular (Potential).		Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	ENST00000431078.1	37	c.2462C>A	CCDS46401.1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.876792	0.91664	.	.	ENSG00000155052	ENST00000431078	D	0.90004	-2.6	5.9	5.9	0.94986	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.52532	D	0.000072	D	0.96592	0.8888	H	0.98646	4.29	0.80722	D	1	D	0.58970	0.984	P	0.59288	0.855	D	0.97695	1.0181	10	0.87932	D	0	.	19.2581	0.93955	0.0:1.0:0.0:0.0	.	821	Q8WYK1	CNTP5_HUMAN	N	821	ENSP00000399013:T821N	ENSP00000399013:T821N	T	+	2	0	CNTNAP5	125238126	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.708000	0.84633	2.804000	0.96469	0.655000	0.94253	ACC		0.398	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3			6	179	1	0	5.9392e-07	0.001168	7.45051e-07	6	179				
TUBA3D	113457	broad.mit.edu	37	2	132235910	132235910	+	Silent	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr2:132235910C>A	ENST00000321253.6	+	2	284	c.177C>A	c.(175-177)ggC>ggA	p.G59G		NM_080386.3	NP_525125.2	Q13748	TBA3C_HUMAN	tubulin, alpha 3d	59					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.G59G(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	32				BRCA - Breast invasive adenocarcinoma(221;0.13)		CTGGAGCTGGCAAGCACGTGC	0.562																																					Ovarian(137;2059 2432 35543 39401)	Ovarian(137;2059 2432 35543 39401)	uc002tsu.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(175-177)GGC>GGA		tubulin, alpha 3d							49.0	42.0	44.0					2																	132235910		2203	4291	6494	SO:0001819	synonymous_variant	113457				'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity	g.chr2:132235910C>A	K03460	CCDS33290.1	2q21.1	2007-03-16			ENSG00000075886	ENSG00000075886		"""Tubulins"""	24071	protein-coding gene	gene with protein product	"""alpha-tubulin isotype H2-alpha"""					3785200	Standard	NM_080386		Approved	H2-ALPHA	uc002tsu.4	Q13748	OTTHUMG00000153600	ENST00000321253.6:c.177C>A	2.37:g.132235910C>A							p.G59G	NM_080386	NP_525125	Q13748	TBA3C_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.13)	2	284	+			59					A6NJQ0|Q5W099|Q6PEY3|Q96F18	Silent	SNP	ENST00000321253.6	37	c.177C>A	CCDS33290.1																																																																																				0.562	TUBA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331800.2	NM_080386		33	35	1	0	9.73076e-26	0.006999	1.63733e-25	33	35				
NXPH2	11249	broad.mit.edu	37	2	139429037	139429037	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr2:139429037G>T	ENST00000272641.3	-	2	356	c.250C>A	c.(250-252)Ctg>Atg	p.L84M		NM_007226.2	NP_009157.1	O95156	NXPH2_HUMAN	neurexophilin 2	84	II.				neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)		p.L84M(1)		endometrium(1)|large_intestine(3)|lung(6)|ovary(3)|prostate(3)|skin(3)|urinary_tract(3)	22				BRCA - Breast invasive adenocarcinoma(221;0.101)		ATGTTGGCCAGCCAATCCCAA	0.493																																							uc002tvi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(250-252)CTG>ATG		neurexophilin 2 precursor							86.0	85.0	85.0					2																	139429037		1884	4105	5989	SO:0001583	missense	11249				neuropeptide signaling pathway	extracellular region		g.chr2:139429037G>T	AF043467	CCDS46421.1	2q22.1	2008-05-15			ENSG00000144227	ENSG00000144227			8076	protein-coding gene	gene with protein product		604635				9570794	Standard	NM_007226		Approved	NPH2	uc002tvi.3	O95156	OTTHUMG00000153636	ENST00000272641.3:c.250C>A	2.37:g.139429037G>T	ENSP00000272641:p.Leu84Met						p.L84M	NM_007226	NP_009157	O95156	NXPH2_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.101)	2	250	-			84			II.		B7WP24|Q494R1|Q75QC3	Missense_Mutation	SNP	ENST00000272641.3	37	c.250C>A	CCDS46421.1	.	.	.	.	.	.	.	.	.	.	G	15.71	2.913964	0.52546	.	.	ENSG00000144227	ENST00000272641	.	.	.	5.66	2.72	0.32119	.	0.000000	0.85682	D	0.000000	T	0.70245	0.3202	M	0.70275	2.135	0.47905	D	0.999545	D	0.71674	0.998	D	0.71870	0.975	T	0.69518	-0.5124	8	.	.	.	-11.2714	10.313	0.43721	0.2901:0.0:0.7099:0.0	.	84	O95156	NXPH2_HUMAN	M	84	.	.	L	-	1	2	NXPH2	139145507	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.737000	0.38197	0.790000	0.33803	0.655000	0.94253	CTG		0.493	NXPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331901.1			73	76	1	0	3.76054e-38	0.00361	6.44336e-38	73	76				
LRP1B	53353	broad.mit.edu	37	2	141274503	141274503	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr2:141274503C>T	ENST00000389484.3	-	50	9075	c.8104G>A	c.(8104-8106)Gat>Aat	p.D2702N		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2702	LDL-receptor class A 15. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.D2702N(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TTCTGACCATCGCATATCCAG	0.328										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(8104-8106)GAT>AAT		low density lipoprotein-related protein 1B							166.0	151.0	156.0					2																	141274503		2203	4300	6503	SO:0001583	missense	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141274503C>T	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.8104G>A	2.37:g.141274503C>T	ENSP00000374135:p.Asp2702Asn	TSP Lung(27;0.18)					p.D2702N	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	50	9076	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	2702			Extracellular (Potential).|LDL-receptor class A 15.		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	c.8104G>A	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	35	5.591383	0.96590	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.98362	-4.89	4.92	4.92	0.64577	.	0.000000	0.64402	U	0.000001	D	0.98520	0.9506	L	0.54323	1.7	0.58432	D	0.999998	D	0.89917	1.0	D	0.91635	0.999	D	0.99790	1.1031	10	0.52906	T	0.07	.	18.12	0.89568	0.0:1.0:0.0:0.0	.	2702	Q9NZR2	LRP1B_HUMAN	N	2702;2640	ENSP00000374135:D2702N	ENSP00000374135:D2702N	D	-	1	0	LRP1B	140990973	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.768000	0.85345	2.237000	0.73441	0.563000	0.77884	GAT		0.328	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		6	74	0	0	0	0.001168	0	6	74				
LRP1B	53353	broad.mit.edu	37	2	141707905	141707905	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr2:141707905C>G	ENST00000389484.3	-	20	4006	c.3035G>C	c.(3034-3036)aGa>aCa	p.R1012T		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1012	LDL-receptor class A 7. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.R1012T(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ACTGGAACATCTGAACTGATT	0.488										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(3034-3036)AGA>ACA		low density lipoprotein-related protein 1B							115.0	80.0	92.0					2																	141707905		2203	4300	6503	SO:0001583	missense	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141707905C>G	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.3035G>C	2.37:g.141707905C>G	ENSP00000374135:p.Arg1012Thr	TSP Lung(27;0.18)				LRP1B_uc010fnl.1_Missense_Mutation_p.R194T	p.R1012T	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	20	4007	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	1012			Extracellular (Potential).|LDL-receptor class A 7.		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	c.3035G>C	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.958746	0.74016	.	.	ENSG00000168702	ENST00000389484;ENST00000544579;ENST00000434794	D;D	0.96073	-3.9;-3.9	5.8	4.02	0.46733	.	0.139510	0.47852	U	0.000209	D	0.95211	0.8447	L	0.33792	1.035	0.30966	N	0.723081	B;D	0.65815	0.387;0.995	B;D	0.69654	0.348;0.965	D	0.92652	0.6134	10	0.27785	T	0.31	.	12.7384	0.57238	0.0:0.8667:0.0:0.1333	.	195;1012	Q96NT6;Q9NZR2	.;LRP1B_HUMAN	T	1012;950;157	ENSP00000374135:R1012T;ENSP00000413239:R157T	ENSP00000374135:R1012T	R	-	2	0	LRP1B	141424375	1.000000	0.71417	0.994000	0.49952	0.998000	0.95712	3.898000	0.56281	0.812000	0.34326	0.563000	0.77884	AGA		0.488	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		13	61	0	0	0	0.003163	0	13	61				
TTC21B	79809	broad.mit.edu	37	2	166773863	166773863	+	Silent	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr2:166773863G>A	ENST00000243344.7	-	14	1940	c.1803C>T	c.(1801-1803)tcC>tcT	p.S601S		NM_024753.4	NP_079029.3	Q7Z4L5	TT21B_HUMAN	tetratricopeptide repeat domain 21B	601					forebrain dorsal/ventral pattern formation (GO:0021798)|intraciliary retrograde transport (GO:0035721)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|protein localization to cilium (GO:0061512)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intraciliary transport particle A (GO:0030991)|nuclear chromatin (GO:0000790)		p.S601S(1)		breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(9)|lung(28)|ovary(2)|pancreas(2)|skin(2)|urinary_tract(1)	58						TTGATTTTGTGGAAGCTCCAA	0.373																																							uc002udk.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|pancreas(2)|breast(1)	5						c.(1801-1803)TCC>TCT		tetratricopeptide repeat domain 21B							162.0	155.0	157.0					2																	166773863		2203	4300	6503	SO:0001819	synonymous_variant	79809					cilium axoneme|cytoplasm|cytoskeleton	binding	g.chr2:166773863G>A	AB082523	CCDS33315.1	2q24.3	2014-09-04			ENSG00000123607	ENSG00000123607		"""Tetratricopeptide (TTC) repeat domain containing"", ""Intraflagellar transport homologs"""	25660	protein-coding gene	gene with protein product		612014				12056414, 21258341	Standard	NM_024753		Approved	FLJ11457, JBTS11, NPHP12, IFT139, THM1	uc002udk.3	Q7Z4L5	OTTHUMG00000154083	ENST00000243344.7:c.1803C>T	2.37:g.166773863G>A							p.S601S	NM_024753	NP_079029	Q7Z4L5	TT21B_HUMAN			14	1936	-			601					A8MUZ3|Q3LIE4|Q53T84|Q6P4A1|Q6PIF5|Q8NCN3|Q96MA4|Q9HAK8	Silent	SNP	ENST00000243344.7	37	c.1803C>T	CCDS33315.1																																																																																				0.373	TTC21B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333770.1	NM_024753		5	127	0	0	0	0.001168	0	5	127				
SCN9A	6335	broad.mit.edu	37	2	167142874	167142874	+	Missense_Mutation	SNP	T	T	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr2:167142874T>G	ENST00000409435.1	-	10	1573	c.1574A>C	c.(1573-1575)cAt>cCt	p.H525P	SCN9A_ENST00000303354.6_Missense_Mutation_p.H526P|SCN9A_ENST00000409672.1_Missense_Mutation_p.H525P|AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000375387.4_Missense_Mutation_p.H526P			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	525					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)	p.H525P(1)		NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CCTCTTTTCATGTGCTCGCCT	0.438																																							uc010fpl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|central_nervous_system(5)|skin(2)	13						c.(1573-1575)CAT>CCT		sodium channel, voltage-gated, type IX, alpha	Lamotrigine(DB00555)|Lidocaine(DB00281)						256.0	240.0	245.0					2																	167142874		1920	4139	6059	SO:0001583	missense	6335					voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr2:167142874T>G	X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.1574A>C	2.37:g.167142874T>G	ENSP00000386330:p.His525Pro					uc002udp.2_Intron|SCN9A_uc002udr.1_Missense_Mutation_p.H396P|SCN9A_uc002uds.1_Missense_Mutation_p.H396P|SCN9A_uc002udt.1_Missense_Mutation_p.H396P	p.H525P	NM_002977	NP_002968	Q15858	SCN9A_HUMAN			11	1915	-			525					A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Missense_Mutation	SNP	ENST00000409435.1	37	c.1574A>C	CCDS46441.1	.	.	.	.	.	.	.	.	.	.	T	1.570	-0.534511	0.04082	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435;ENST00000454569;ENST00000452182	D;D;D;D;D;D	0.90620	-2.7;-2.7;-2.7;-2.7;-2.7;-2.7	5.76	0.127	0.14727	Domain of unknown function DUF3451 (1);	7.733620	0.00792	N	0.001359	D	0.83677	0.5306	N	0.08118	0	0.09310	N	1	B;B;B	0.18013	0.0;0.025;0.0	B;B;B	0.28232	0.001;0.087;0.0	T	0.71971	-0.4431	10	0.45353	T	0.12	.	10.763	0.46277	0.0:0.3853:0.0:0.6147	.	525;525;526	E7EUN6;Q15858;E9PF08	.;SCN9A_HUMAN;.	P	525;526;526;525;390;390	ENSP00000386306:H525P;ENSP00000364536:H526P;ENSP00000304748:H526P;ENSP00000386330:H525P;ENSP00000413212:H390P;ENSP00000393141:H390P	ENSP00000304748:H526P	H	-	2	0	SCN9A	166851120	0.005000	0.15991	0.012000	0.15200	0.032000	0.12392	0.397000	0.20883	-0.000000	0.14550	-0.292000	0.09595	CAT		0.438	SCN9A-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333639.1	NM_002977		17	400	0	0	0	0.006122	0	17	400				
XIRP2	129446	broad.mit.edu	37	2	167760365	167760365	+	Missense_Mutation	SNP	A	A	G	rs563195903		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr2:167760365A>G	ENST00000409728.1	+	2	462	c.373A>G	c.(373-375)Aag>Gag	p.K125E	XIRP2_ENST00000295237.9_Missense_Mutation_p.K125E|XIRP2_ENST00000409756.2_Missense_Mutation_p.K125E|XIRP2_ENST00000420519.1_Missense_Mutation_p.K125E|XIRP2_ENST00000409043.1_Missense_Mutation_p.K125E|XIRP2_ENST00000409195.1_Missense_Mutation_p.K125E	NM_001199143.1	NP_001186072.1	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	0					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)		p.K125E(2)		NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						TGAGGCTCCTAAGAGTGGAAA	0.483													A|||	1	0.000199681	0.0	0.0	5008	,	,		20605	0.0		0.0	False		,,,				2504	0.001						uc002udx.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(7)|ovary(6)|pancreas(1)	14						c.(373-375)AAG>GAG		xin actin-binding repeat containing 2 isoform 1							111.0	113.0	112.0					2																	167760365		1973	4169	6142	SO:0001583	missense	129446				actin cytoskeleton organization	cell junction	actin binding	g.chr2:167760365A>G	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409728.1:c.373A>G	2.37:g.167760365A>G	ENSP00000386619:p.Lys125Glu					XIRP2_uc010fpn.2_Missense_Mutation_p.K125E|XIRP2_uc010fpo.2_Missense_Mutation_p.K125E|XIRP2_uc010fpp.2_Missense_Mutation_p.K125E	p.K125E	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN			1	391	+			Error:Variant_position_missing_in_A4UGR9_after_alignment					A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409728.1	37	c.373A>G	CCDS56143.1	.	.	.	.	.	.	.	.	.	.	A	13.26	2.184446	0.38609	.	.	ENSG00000163092	ENST00000409043;ENST00000409728;ENST00000409195;ENST00000409756;ENST00000420519;ENST00000295237	T;T;T;T;T;T	0.78246	-1.15;-1.16;4.19;-1.15;-1.16;4.19	5.01	2.65	0.31530	.	.	.	.	.	T	0.60818	0.2298	.	.	.	0.09310	N	1	B;B	0.11235	0.002;0.004	B;B	0.12156	0.007;0.007	T	0.45056	-0.9287	8	0.23891	T	0.37	-1.4608	6.0522	0.19792	0.797:0.0:0.203:0.0	.	125;125	A4UGR9-4;A4UGR9-6	.;.	E	125	ENSP00000386454:K125E;ENSP00000386619:K125E;ENSP00000386840:K125E;ENSP00000386724:K125E;ENSP00000415541:K125E;ENSP00000295237:K125E	ENSP00000295237:K125E	K	+	1	0	XIRP2	167468611	0.077000	0.21312	0.005000	0.12908	0.492000	0.33523	0.556000	0.23438	0.763000	0.33175	-0.254000	0.11334	AAG		0.483	XIRP2-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333552.1	NM_152381		10	125	0	0	0	0.000978	0	10	125				
XIRP2	129446	broad.mit.edu	37	2	168107427	168107427	+	Silent	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr2:168107427C>A	ENST00000409195.1	+	9	9614	c.9525C>A	c.(9523-9525)ccC>ccA	p.P3175P	XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000295237.9_Silent_p.P3175P|XIRP2_ENST00000409273.1_Silent_p.P2953P|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000420519.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	3000					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)		p.P3175P(1)		NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						CTTCTCCACCCAGGAGTCGCT	0.498																																							uc002udx.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(7)|ovary(6)|pancreas(1)	14						c.(9523-9525)CCC>CCA		xin actin-binding repeat containing 2 isoform 1							86.0	85.0	85.0					2																	168107427		1916	4134	6050	SO:0001819	synonymous_variant	129446				actin cytoskeleton organization	cell junction	actin binding	g.chr2:168107427C>A	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.9525C>A	2.37:g.168107427C>A						XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Silent_p.P3000P|XIRP2_uc010fpq.2_Silent_p.P2953P|XIRP2_uc010fpr.2_Intron	p.P3175P	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN			8	9543	+			3000					A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Silent	SNP	ENST00000409195.1	37	c.9525C>A	CCDS42769.1																																																																																				0.498	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381		14	99	1	0	6.31663e-08	0.003163	8.19849e-08	14	99				
DLX1	1745	broad.mit.edu	37	2	172952820	172952820	+	Silent	SNP	C	C	T	rs541299088		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr2:172952820C>T	ENST00000361725.4	+	3	1055	c.603C>T	c.(601-603)aaC>aaT	p.N201N	DLX1_ENST00000550686.1_3'UTR|DLX1_ENST00000341900.6_3'UTR	NM_178120.4	NP_835221.2	P56177	DLX1_HUMAN	distal-less homeobox 1	201					cerebral cortex GABAergic interneuron fate commitment (GO:0021893)|embryonic skeletal system development (GO:0048706)|hippocampus development (GO:0021766)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis of dentin-containing tooth (GO:0042475)|proximal/distal pattern formation (GO:0009954)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|subpallium development (GO:0021544)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)	p.N201N(1)		central_nervous_system(1)|lung(4)|prostate(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.216)			CGTTGGCCAACGGTCGGGCCC	0.612													C|||	1	0.000199681	0.0	0.0	5008	,	,		15496	0.0		0.0	False		,,,				2504	0.001						uc002uhl.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(601-603)AAC>AAT		distal-less homeobox 1 isoform 1							84.0	96.0	92.0					2																	172952820		2203	4300	6503	SO:0001819	synonymous_variant	1745					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr2:172952820C>T	BC013010	CCDS2247.2, CCDS33328.1	2q31.1	2011-06-20	2005-12-22		ENSG00000144355	ENSG00000144355		"""Homeoboxes / ANTP class : NKL subclass"""	2914	protein-coding gene	gene with protein product		600029	"""distal-less homeo box 1"""			7907794	Standard	NM_001038493		Approved		uc002uhl.3	P56177	OTTHUMG00000073951	ENST00000361725.4:c.603C>T	2.37:g.172952820C>T						DLX1_uc002uhm.2_3'UTR	p.N201N	NM_178120	NP_835221	P56177	DLX1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.216)		3	801	+			201					D3DPD7|Q53ZU4|Q7Z724|Q8IYB2	Silent	SNP	ENST00000361725.4	37	c.603C>T	CCDS2247.2																																																																																				0.612	DLX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405916.1	XM_087198		29	147	0	0	0	0.00632	0	29	147				
TTN	7273	broad.mit.edu	37	2	179441915	179441915	+	Silent	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr2:179441915G>A	ENST00000591111.1	-	274	64448	c.64224C>T	c.(64222-64224)atC>atT	p.I21408I	RP11-171I2.5_ENST00000604215.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Silent_p.I14109I|TTN_ENST00000460472.2_Silent_p.I13984I|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Silent_p.I14176I|TTN_ENST00000589042.1_Silent_p.I23049I|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Silent_p.I20481I|RP11-171I2.2_ENST00000603521.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA			Q8WZ42	TITIN_HUMAN	titin	21408	Fibronectin type-III 55. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.I14109I(1)|p.I14176I(1)|p.I13984I(1)|p.I20481I(1)|p.I20479I(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AAACATTACTGATTTCAACAG	0.443																																							uc010zfg.1		NA																	5	Substitution - coding silent(5)		lung(5)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(61441-61443)ATC>ATT		titin isoform N2-A							60.0	59.0	59.0					2																	179441915		1946	4140	6086	SO:0001819	synonymous_variant	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179441915G>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.64224C>T	2.37:g.179441915G>A						uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.I14176I|TTN_uc010zfi.1_Silent_p.I14109I|TTN_uc010zfj.1_Silent_p.I13984I|uc002umv.1_5'Flank	p.I20481I	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		273	61667	-			21408					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37	c.61443C>T																																																																																					0.443	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		8	46	0	0	0	0.00308	0	8	46				
TTN	7273	broad.mit.edu	37	2	179567252	179567252	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr2:179567252T>C	ENST00000591111.1	-	105	29635	c.29411A>G	c.(29410-29412)cAg>cGg	p.Q9804R	TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.Q10121R|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.Q8877R			Q8WZ42	TITIN_HUMAN	titin	13882	Ig-like 79.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.Q8877R(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTTGTATTTCTGGCTCTCTGT	0.453																																							uc010zfg.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(26629-26631)CAG>CGG		titin isoform N2-A							267.0	263.0	264.0					2																	179567252		1991	4169	6160	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179567252T>C	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.29411A>G	2.37:g.179567252T>C	ENSP00000465570:p.Gln9804Arg					TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.Q5538R|TTN_uc010fre.1_5'UTR	p.Q8877R	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		104	26854	-			9804					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.26630A>G		.	.	.	.	.	.	.	.	.	.	T	14.65	2.597439	0.46318	.	.	ENSG00000155657	ENST00000342992	T	0.04454	3.62	5.72	5.72	0.89469	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.03739	0.0106	N	0.11756	0.17	0.80722	D	1	B	0.24317	0.101	B	0.18871	0.023	T	0.47535	-0.9110	9	0.87932	D	0	.	11.9637	0.53023	0.0:0.0:0.2551:0.7448	.	9804	Q8WZ42	TITIN_HUMAN	R	8877	ENSP00000343764:Q8877R	ENSP00000343764:Q8877R	Q	-	2	0	TTN	179275497	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.575000	0.60908	2.184000	0.69523	0.533000	0.62120	CAG		0.453	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		13	360	0	0	0	0.001368	0	13	360				
COL5A2	1290	broad.mit.edu	37	2	189910587	189910587	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr2:189910587C>A	ENST00000374866.3	-	46	3522	c.3248G>T	c.(3247-3249)gGt>gTt	p.G1083V		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	1083					axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)	p.G1083V(1)		NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			TCCAGGGGCACCCTGAGAGCC	0.483																																							uc002uqk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(3247-3249)GGT>GTT		alpha 2 type V collagen preproprotein							73.0	73.0	73.0					2																	189910587		2203	4300	6503	SO:0001583	missense	1290				axon guidance|collagen fibril organization|eye morphogenesis|skin development	collagen type V	extracellular matrix structural constituent	g.chr2:189910587C>A	Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.3248G>T	2.37:g.189910587C>A	ENSP00000364000:p.Gly1083Val					COL5A2_uc010frx.2_Missense_Mutation_p.G659V	p.G1083V	NM_000393	NP_000384	P05997	CO5A2_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)		46	3523	-			1083					P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Missense_Mutation	SNP	ENST00000374866.3	37	c.3248G>T	CCDS33350.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.130436	0.77549	.	.	ENSG00000204262	ENST00000374866;ENST00000452536	D	0.99488	-6.0	5.21	5.21	0.72293	.	0.000000	0.51477	D	0.000089	D	0.99778	0.9908	H	0.98351	4.21	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	0.998;1.0	D	0.96975	0.9711	10	0.87932	D	0	.	18.9674	0.92701	0.0:1.0:0.0:0.0	.	723;1083	Q5PR22;P05997	.;CO5A2_HUMAN	V	1083;723	ENSP00000364000:G1083V	ENSP00000364000:G1083V	G	-	2	0	COL5A2	189618832	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.651000	0.83577	2.720000	0.93068	0.650000	0.86243	GGT		0.483	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313523.1	NM_000393		36	71	1	0	6.57855e-14	0.009718	9.83283e-14	36	71				
NRP2	8828	broad.mit.edu	37	2	206614460	206614460	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr2:206614460A>G	ENST00000357785.5	+	11	1829	c.1798A>G	c.(1798-1800)Acg>Gcg	p.T600A	NRP2_ENST00000272849.3_Missense_Mutation_p.T600A|NRP2_ENST00000360409.3_Missense_Mutation_p.T600A|NRP2_ENST00000540178.1_Missense_Mutation_p.T600A|NRP2_ENST00000357118.4_Missense_Mutation_p.T600A|NRP2_ENST00000540841.1_Missense_Mutation_p.T600A|NRP2_ENST00000412873.2_Missense_Mutation_p.T600A			Q99435	NELL2_HUMAN	neuropilin 2	293	EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.T600A(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(14)|lung(19)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	52						CTCCAAGCCCACGGTAGAGAC	0.547																																							uc002vaw.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(2)|ovary(1)|central_nervous_system(1)	4						c.(1798-1800)ACG>GCG		neuropilin 2 isoform 1 precursor							90.0	89.0	90.0					2																	206614460		2203	4300	6503	SO:0001583	missense	8828				angiogenesis|axon guidance|cell adhesion	integral to membrane|membrane fraction|plasma membrane	heparin binding|metal ion binding|semaphorin receptor activity|vascular endothelial growth factor receptor activity	g.chr2:206614460A>G	AF016098	CCDS2364.1, CCDS2365.1, CCDS46496.1, CCDS46497.1, CCDS46498.1, CCDS46499.1	2q33.3	2008-05-23			ENSG00000118257	ENSG00000118257			8005	protein-coding gene	gene with protein product		602070				9529250, 9331348	Standard	NM_003872		Approved	VEGF165R2	uc002vaw.3	O60462	OTTHUMG00000132893	ENST00000357785.5:c.1798A>G	2.37:g.206614460A>G	ENSP00000350432:p.Thr600Ala					NRP2_uc002vau.2_Missense_Mutation_p.T600A|NRP2_uc002vav.2_Missense_Mutation_p.T600A|NRP2_uc002vax.2_Missense_Mutation_p.T600A|NRP2_uc002vay.2_Missense_Mutation_p.T600A	p.T600A	NM_201266	NP_957718	O60462	NRP2_HUMAN			11	2589	+			600			Extracellular (Potential).		B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Missense_Mutation	SNP	ENST00000357785.5	37	c.1798A>G	CCDS46496.1	.	.	.	.	.	.	.	.	.	.	A	13.16	2.153846	0.38021	.	.	ENSG00000118257	ENST00000360409;ENST00000540178;ENST00000540841;ENST00000357118;ENST00000357785;ENST00000412873;ENST00000272849	D;D;D;D;D;D;D	0.87650	-2.2;-2.21;-2.22;-2.26;-2.25;-2.28;-2.27	5.07	5.07	0.68467	.	0.143577	0.64402	D	0.000007	D	0.89033	0.6600	L	0.38838	1.175	0.80722	D	1	B;B;D;B;B	0.64830	0.035;0.035;0.994;0.068;0.038	B;B;D;B;B	0.70716	0.047;0.047;0.97;0.048;0.048	D	0.86303	0.1681	10	0.19590	T	0.45	-10.5034	15.1285	0.72500	1.0:0.0:0.0:0.0	.	600;600;600;600;600	O60462-2;O60462-3;O60462;O60462-4;O60462-5	.;.;NRP2_HUMAN;.;.	A	600	ENSP00000353582:T600A;ENSP00000439658:T600A;ENSP00000439261:T600A;ENSP00000349632:T600A;ENSP00000350432:T600A;ENSP00000407626:T600A;ENSP00000272849:T600A	ENSP00000272849:T600A	T	+	1	0	NRP2	206322705	1.000000	0.71417	0.985000	0.45067	0.906000	0.53458	6.067000	0.71193	2.038000	0.60285	0.459000	0.35465	ACG		0.547	NRP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000336467.1			12	80	0	0	0	0.001855	0	12	80				
ZDBF2	57683	broad.mit.edu	37	2	207171353	207171353	+	Missense_Mutation	SNP	T	T	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr2:207171353T>G	ENST00000374423.3	+	5	2487	c.2101T>G	c.(2101-2103)Tct>Gct	p.S701A		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	701							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.S701A(2)		endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						GAGTGTTCAGTCTAGCCGTTC	0.423																																							uc002vbp.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)	3						c.(2101-2103)TCT>GCT		zinc finger, DBF-type containing 2							83.0	81.0	82.0					2																	207171353		1885	4114	5999	SO:0001583	missense	57683						nucleic acid binding|zinc ion binding	g.chr2:207171353T>G	AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.2101T>G	2.37:g.207171353T>G	ENSP00000363545:p.Ser701Ala						p.S701A	NM_020923	NP_065974	Q9HCK1	ZDBF2_HUMAN			5	2351	+			701					Q6ZNP7|Q6ZSN8	Missense_Mutation	SNP	ENST00000374423.3	37	c.2101T>G	CCDS46501.1	.	.	.	.	.	.	.	.	.	.	T	6.554	0.470563	0.12461	.	.	ENSG00000204186	ENST00000374423	T	0.59906	0.23	4.42	0.475	0.16774	.	0.206500	0.24611	N	0.037044	T	0.43722	0.1260	L	0.55481	1.735	0.09310	N	1	P	0.41929	0.765	B	0.38921	0.285	T	0.39333	-0.9619	10	0.56958	D	0.05	.	2.6645	0.05037	0.1927:0.2459:0.0:0.5615	.	701	Q9HCK1	ZDBF2_HUMAN	A	701	ENSP00000363545:S701A	ENSP00000363545:S701A	S	+	1	0	ZDBF2	206879598	0.749000	0.28305	0.057000	0.19452	0.006000	0.05464	1.752000	0.38349	0.079000	0.16929	0.533000	0.62120	TCT		0.423	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336458.1	NM_020923		5	68	0	0	0	0.000602	0	5	68				
CPS1	1373	broad.mit.edu	37	2	211456608	211456608	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr2:211456608C>A	ENST00000233072.5	+	10	1197	c.1001C>A	c.(1000-1002)gCt>gAt	p.A334D	CPS1_ENST00000451903.2_5'Flank|CPS1_ENST00000430249.2_Missense_Mutation_p.A340D	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	334	Glutamine amidotransferase type-1.				anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)	p.A340D(1)|p.A334D(1)		breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	TTCATTACTGCTCAGAATCAT	0.413																																							uc002vee.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13						c.(1000-1002)GCT>GAT		carbamoyl-phosphate synthetase 1 isoform b							88.0	83.0	85.0					2																	211456608		2203	4300	6503	SO:0001583	missense	1373				carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity	g.chr2:211456608C>A	AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.1001C>A	2.37:g.211456608C>A	ENSP00000233072:p.Ala334Asp					CPS1_uc010fur.2_Missense_Mutation_p.A340D|CPS1_uc010fus.2_5'Flank	p.A334D	NM_001875	NP_001866	P31327	CPSM_HUMAN		Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	10	1133	+			334			Glutamine amidotransferase type-1.		B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	ENST00000233072.5	37	c.1001C>A	CCDS2393.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.937823	0.92526	.	.	ENSG00000021826	ENST00000430249;ENST00000539150;ENST00000233072;ENST00000536125	D;D	0.90069	-2.61;-2.61	5.77	5.77	0.91146	Carbamoyl-phosphate synthase, GATase domain (1);Glutamine amidotransferase type 1 (2);	0.101662	0.64402	D	0.000002	D	0.93090	0.7800	M	0.85945	2.785	0.80722	D	1	P;P	0.40970	0.734;0.734	P;P	0.46885	0.53;0.53	D	0.93348	0.6716	10	0.87932	D	0	1.275	20.3472	0.98799	0.0:1.0:0.0:0.0	.	344;334	Q59HF8;P31327	.;CPSM_HUMAN	D	340;342;334;334	ENSP00000402608:A340D;ENSP00000233072:A334D	ENSP00000233072:A334D	A	+	2	0	CPS1	211164853	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.445000	0.80570	2.890000	0.99128	0.650000	0.86243	GCT		0.413	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256569.5			10	91	1	0	2.17888e-05	0.006214	2.53002e-05	10	91				
ASIC4	55515	broad.mit.edu	37	2	220397160	220397160	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr2:220397160G>A	ENST00000347842.3	+	4	1374	c.1360G>A	c.(1360-1362)Gtg>Atg	p.V454M	ASIC4_ENST00000358078.4_Missense_Mutation_p.V454M|ASIC4_ENST00000473709.1_3'UTR	NM_182847.2	NP_878267.2	Q96FT7	ASIC4_HUMAN	acid-sensing (proton-gated) ion channel family member 4	454					ion transmembrane transport (GO:0034220)|sodium ion transmembrane transport (GO:0035725)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)	ion channel activity (GO:0005216)|sodium channel activity (GO:0005272)|sodium ion transmembrane transporter activity (GO:0015081)	p.V454M(1)									AAAGGAGGCCGTGCTTCAGCG	0.677																																							uc002vma.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1360-1362)GTG>ATG		amiloride-sensitive cation channel 4 isoform 2							44.0	42.0	43.0					2																	220397160		2203	4300	6503	SO:0001583	missense	55515					integral to plasma membrane	sodium channel activity|sodium ion transmembrane transporter activity	g.chr2:220397160G>A	AJ271643	CCDS2442.1	2q36.1	2012-02-22	2012-02-22	2012-02-22	ENSG00000072182	ENSG00000072182		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	21263	protein-coding gene	gene with protein product		606715	"""amiloride-sensitive cation channel 4, pituitary"", ""amiloride-sensitive cation channel family member 4, pituitary"""	ACCN4		10852210	Standard	NM_182847		Approved	BNAC4	uc002vma.3	Q96FT7	OTTHUMG00000058928	ENST00000347842.3:c.1360G>A	2.37:g.220397160G>A	ENSP00000326627:p.Val454Met					ACCN4_uc010fwi.1_Missense_Mutation_p.V454M|ACCN4_uc010fwj.1_Missense_Mutation_p.V454M|ACCN4_uc002vly.1_3'UTR|ACCN4_uc002vlz.2_Missense_Mutation_p.V454M|ACCN4_uc002vmb.2_Missense_Mutation_p.V108M	p.V454M	NM_182847	NP_878267	Q96FT7	ACCN4_HUMAN		Epithelial(149;5.47e-10)|all cancers(144;9e-08)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.0086)|READ - Rectum adenocarcinoma(5;0.156)	4	1374	+		Renal(207;0.0183)	454			Extracellular (Potential).		Q53SB7|Q6GMS1|Q6PIN9|Q9NQA4	Missense_Mutation	SNP	ENST00000347842.3	37	c.1360G>A	CCDS2442.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.586094	0.86851	.	.	ENSG00000072182	ENST00000347842;ENST00000358078	T;T	0.64085	-0.08;-0.08	4.1	4.1	0.47936	Na+ channel, amiloride-sensitive, conserved site (1);	0.000000	0.64402	D	0.000001	T	0.71065	0.3296	M	0.71296	2.17	0.80722	D	1	D;D	0.64830	0.994;0.986	P;P	0.59056	0.851;0.847	T	0.68603	-0.5365	10	0.07482	T	0.82	-18.7375	16.5064	0.84273	0.0:0.0:1.0:0.0	.	454;454	Q96FT7;Q96FT7-4	ACCN4_HUMAN;.	M	454	ENSP00000326627:V454M;ENSP00000350786:V454M	ENSP00000326627:V454M	V	+	1	0	ACCN4	220105404	0.995000	0.38212	0.954000	0.39281	0.903000	0.53119	2.500000	0.45381	2.305000	0.77605	0.561000	0.74099	GTG		0.677	ASIC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130263.1	NM_018674		6	50	0	0	0	0.001984	0	6	50				
DIS3L2	129563	broad.mit.edu	37	2	233103338	233103338	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr2:233103338G>T	ENST00000409307.1	+	10	1300	c.1300G>T	c.(1300-1302)Gtc>Ttc	p.V434F	DIS3L2_ENST00000273009.6_Missense_Mutation_p.V434F|DIS3L2_ENST00000325385.7_Missense_Mutation_p.V434F					DIS3 like 3'-5' exoribonuclease 2									p.V434F(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(18)|ovary(1)|prostate(2)|urinary_tract(1)	40		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)		GGCTACAAGCGTCTACTTGGT	0.423																																							uc010fxz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)|central_nervous_system(1)	3						c.(1300-1302)GTC>TTC		DIS3 mitotic control homolog (S.							113.0	113.0	113.0					2																	233103338		1858	4109	5967	SO:0001583	missense	129563						exonuclease activity|ribonuclease activity|RNA binding	g.chr2:233103338G>T	BC026166	CCDS42834.1, CCDS58752.1, CCDS58753.1	2q37.1	2014-09-17	2014-03-05		ENSG00000144535	ENSG00000144535			28648	protein-coding gene	gene with protein product		614184	"""family with sequence similarity 6, member A"", ""DIS3 mitotic control homolog (S. cerevisiae)-like 2"""	FAM6A		22306653, 23503588	Standard	NM_152383		Approved	FLJ36974, MGC42174	uc010fxz.3	Q8IYB7	OTTHUMG00000153385	ENST00000409307.1:c.1300G>T	2.37:g.233103338G>T	ENSP00000386799:p.Val434Phe					DIS3L2_uc002vsm.3_RNA|DIS3L2_uc002vso.2_RNA	p.V434F	NM_152383	NP_689596	Q8IYB7	DI3L2_HUMAN		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)	11	1576	+		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)	434						Missense_Mutation	SNP	ENST00000409307.1	37	c.1300G>T	CCDS42834.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.479341	0.84747	.	.	ENSG00000144535	ENST00000273009;ENST00000542873;ENST00000325385;ENST00000431466;ENST00000409307;ENST00000424049	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	5.68	5.68	0.88126	Ribonuclease II/R (2);	0.000000	0.85682	D	0.000000	T	0.72882	0.3516	M	0.90759	3.145	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	T	0.78242	-0.2280	10	0.87932	D	0	-26.8673	19.7994	0.96500	0.0:0.0:1.0:0.0	.	434	Q8IYB7	DI3L2_HUMAN	F	434;434;434;434;434;69	ENSP00000273009:V434F;ENSP00000315569:V434F;ENSP00000386799:V434F;ENSP00000415419:V69F	ENSP00000273009:V434F	V	+	1	0	DIS3L2	232811582	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.162000	0.94745	2.686000	0.91538	0.650000	0.86243	GTC		0.423	DIS3L2-015	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330988.1	NM_152383		20	34	1	0	1.87028e-06	0.001882	2.25075e-06	20	34				
ALPI	248	broad.mit.edu	37	2	233323382	233323382	+	Silent	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr2:233323382G>T	ENST00000295463.3	+	10	1301	c.1224G>T	c.(1222-1224)acG>acT	p.T408T		NM_001631.3	NP_001622.2	P09923	PPBI_HUMAN	alkaline phosphatase, intestinal	408					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|magnesium ion binding (GO:0000287)|protease binding (GO:0002020)|zinc ion binding (GO:0008270)	p.T408T(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|prostate(2)|upper_aerodigestive_tract(1)	24		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;1.64e-16)|Kidney(3;9.71e-08)|KIRC - Kidney renal clear cell carcinoma(3;2.74e-06)|BRCA - Breast invasive adenocarcinoma(100;0.000763)|Lung(119;0.00564)|LUSC - Lung squamous cell carcinoma(224;0.00746)		AAGCCTACACGTCCATCCTGT	0.607																																							uc002vst.3		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(1222-1224)ACG>ACT		intestinal alkaline phosphatase precursor							81.0	66.0	71.0					2																	233323382		2203	4300	6503	SO:0001819	synonymous_variant	248				phosphorylation	anchored to membrane|integral to membrane|plasma membrane	alkaline phosphatase activity|metal ion binding|protein binding	g.chr2:233323382G>T	M15694	CCDS2492.1	2q37.1	2008-02-05			ENSG00000163295	ENSG00000163295	3.1.3.1		437	protein-coding gene	gene with protein product		171740				3468508, 3469665	Standard	NM_001631		Approved		uc002vst.4	P09923	OTTHUMG00000133258	ENST00000295463.3:c.1224G>T	2.37:g.233323382G>T						ALPI_uc002vsu.3_Silent_p.T319T	p.T408T	NM_001631	NP_001622	P09923	PPBI_HUMAN		Epithelial(121;1.64e-16)|Kidney(3;9.71e-08)|KIRC - Kidney renal clear cell carcinoma(3;2.74e-06)|BRCA - Breast invasive adenocarcinoma(100;0.000763)|Lung(119;0.00564)|LUSC - Lung squamous cell carcinoma(224;0.00746)	10	1301	+		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)	408					B2R7Y4|Q53S80|Q9UBV5|Q9UCL2	Silent	SNP	ENST00000295463.3	37	c.1224G>T	CCDS2492.1																																																																																				0.607	ALPI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257035.2	NM_001631		19	25	1	0	1.87028e-06	0.001882	2.25075e-06	19	25				
UGT1A1	54658	broad.mit.edu	37	2	234526902	234526902	+	Silent	SNP	C	C	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr2:234526902C>T	ENST00000373450.4	+	1	612	c.549C>T	c.(547-549)tgC>tgT	p.C183C		NM_019076.4	NP_061949.3	P22309	UD11_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A1	186					acute-phase response (GO:0006953)|bilirubin conjugation (GO:0006789)|biphenyl catabolic process (GO:0070980)|cellular glucuronidation (GO:0052695)|cellular response to ethanol (GO:0071361)|cellular response to glucocorticoid stimulus (GO:0071385)|digestion (GO:0007586)|drug metabolic process (GO:0017144)|estrogen metabolic process (GO:0008210)|flavone metabolic process (GO:0051552)|flavonoid glucuronidation (GO:0052696)|heme catabolic process (GO:0042167)|heterocycle metabolic process (GO:0046483)|liver development (GO:0001889)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cellular glucuronidation (GO:2001030)|negative regulation of steroid metabolic process (GO:0045939)|organ regeneration (GO:0031100)|porphyrin-containing compound metabolic process (GO:0006778)|response to drug (GO:0042493)|response to lipopolysaccharide (GO:0032496)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|retinoic acid metabolic process (GO:0042573)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic glucuronidation (GO:0052697)|xenobiotic metabolic process (GO:0006805)	cytochrome complex (GO:0070069)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)|steroid binding (GO:0005496)	p.C183C(1)		breast(1)|central_nervous_system(2)|endometrium(7)|large_intestine(5)|lung(9)|skin(4)|urinary_tract(2)	30		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;4.1e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000435)|Lung(119;0.00211)|LUSC - Lung squamous cell carcinoma(224;0.0054)	Abacavir(DB01048)|Acetaminophen(DB00316)|Adenine(DB00173)|Atorvastatin(DB01076)|Axitinib(DB06626)|Diclofenac(DB00586)|Dolutegravir(DB08930)|Eltrombopag(DB06210)|Erlotinib(DB00530)|Estradiol(DB00783)|Etoposide(DB00773)|Ezetimibe(DB00973)|Ezogabine(DB04953)|Flunitrazepam(DB01544)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Ibuprofen(DB01050)|Indacaterol(DB05039)|Indomethacin(DB00328)|Irinotecan(DB00762)|Losartan(DB00678)|Lovastatin(DB00227)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Naltrexone(DB00704)|Naproxen(DB00788)|Nilotinib(DB04868)|Pazopanib(DB06589)|Propofol(DB00818)|Raltegravir(DB06817)|Regorafenib(DB08896)|Rifampicin(DB01045)|Simvastatin(DB00641)|Sorafenib(DB00398)|Suprofen(DB00870)|Testosterone Propionate(DB01420)	GTGCACAGTGCCCTGCTCCTC	0.493																																							uc002vup.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(547-549)TGC>TGT		UDP glycosyltransferase 1 family, polypeptide A8							161.0	167.0	165.0					2																	234526902		2203	4300	6503	SO:0001819	synonymous_variant	54576				drug metabolic process|fatty acid metabolic process|flavone metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	enzyme inhibitor activity|fatty acid binding|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|steroid binding	g.chr2:234526902C>T	M57899	CCDS2510.1	2q37.1	2014-09-17	2005-07-20		ENSG00000242366	ENSG00000242366	2.4.1.17	"""UDP glucuronosyltransferases"""	12530	other	complex locus constituent		191740	"""UDP glycosyltransferase 1 family, polypeptide A1"""	UGT1, GNT1		9295054, 9535849	Standard	NM_000463		Approved	UGT1A		P22309	OTTHUMG00000059117	ENST00000373450.4:c.549C>T	2.37:g.234526902C>T						UGT1A8_uc010zmv.1_Silent_p.C183C	p.C183C	NM_019076	NP_061949	Q9HAW9	UD18_HUMAN		Epithelial(121;2.56e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000482)|Lung(119;0.00404)|LUSC - Lung squamous cell carcinoma(224;0.008)	1	612	+		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0334)|Lung NSC(271;0.0461)|Lung SC(224;0.128)	183					A6NJC3|B8K286	Silent	SNP	ENST00000373450.4	37	c.549C>T	CCDS33402.1																																																																																				0.493	UGT1A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000130994.1			37	353	0	0	0	0.006999	0	37	353				
UGT1A9	54600	broad.mit.edu	37	2	234581299	234581299	+	Missense_Mutation	SNP	C	C	G	rs561534651		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr2:234581299C>G	ENST00000354728.4	+	1	801	c.719C>G	c.(718-720)aCg>aGg	p.T240R	UGT1A1_ENST00000609637.1_Missense_Mutation_p.T240R|UGT1A10_ENST00000344644.5_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A1_ENST00000373450.4_Intron			O60656	UD19_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A9	240					cellular glucuronidation (GO:0052695)|cellular lipid metabolic process (GO:0044255)|drug metabolic process (GO:0017144)|flavone metabolic process (GO:0051552)|flavonoid glucuronidation (GO:0052696)|metabolic process (GO:0008152)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cellular glucuronidation (GO:2001030)|negative regulation of fatty acid metabolic process (GO:0045922)|retinoic acid metabolic process (GO:0042573)|small molecule metabolic process (GO:0044281)|xenobiotic glucuronidation (GO:0052697)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)	p.T240R(1)		breast(2)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	37		Breast(86;0.000766)|all_lung(227;0.00269)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0331)|Lung NSC(271;0.0459)|Lung SC(224;0.128)		Epithelial(121;1.26e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000436)|Lung(119;0.00347)|LUSC - Lung squamous cell carcinoma(224;0.00757)	Acetaminophen(DB00316)|Buprenorphine(DB00921)|Canagliflozin(DB08907)|Dabigatran etexilate(DB06695)|Dapagliflozin(DB06292)|Entacapone(DB00494)|Etodolac(DB00749)|Ezogabine(DB04953)|Flurbiprofen(DB00712)|Haloperidol(DB00502)|Human Serum Albumin(DB00062)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ketobemidone(DB06738)|Lumiracoxib(DB01283)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Nateglinide(DB00731)|Niflumic Acid(DB04552)|Oxazepam(DB00842)|Propofol(DB00818)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sulfamethoxazole(DB01015)|Tapentadol(DB06204)|Valproic Acid(DB00313)|Zileuton(DB00744)	ACACCTGTTACGGAGTATGAT	0.428																																							uc002vus.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(1)|skin(1)	5						c.(718-720)ACG>AGG		UDP glycosyltransferase 1 family, polypeptide A9	Entacapone(DB00494)|Etodolac(DB00749)|Indomethacin(DB00328)|Irinotecan(DB00762)|Mycophenolic acid(DB01024)|Oxyphenonium(DB00219)|Propofol(DB00818)|Sorafenib(DB00398)						248.0	250.0	249.0					2																	234581299		2203	4300	6503	SO:0001583	missense	54600				drug metabolic process|flavone metabolic process|negative regulation of fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	enzyme binding|enzyme inhibitor activity|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|retinoic acid binding	g.chr2:234581299C>G	AF056188	CCDS2505.1	2q37	2010-03-05	2005-07-20		ENSG00000241119	ENSG00000241119		"""UDP glucuronosyltransferases"""	12541	other	complex locus constituent		606434	"""UDP glycosyltransferase 1 family, polypeptide A9"""			9295054, 1910331	Standard	NM_021027		Approved	HLUGP4, LUGP4, UGT1AI		O60656	OTTHUMG00000059124	ENST00000354728.4:c.719C>G	2.37:g.234581299C>G	ENSP00000346768:p.Thr240Arg					UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Missense_Mutation_p.T240R	p.T240R	NM_021027	NP_066307	O60656	UD19_HUMAN		Epithelial(121;1.26e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000436)|Lung(119;0.00347)|LUSC - Lung squamous cell carcinoma(224;0.00757)	1	756	+		Breast(86;0.000766)|all_lung(227;0.00269)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0331)|Lung NSC(271;0.0459)|Lung SC(224;0.128)	240					B8K285|P36509|Q9HAX0	Missense_Mutation	SNP	ENST00000354728.4	37	c.719C>G	CCDS2505.1	.	.	.	.	.	.	.	.	.	.	C	13.36	2.213773	0.39102	.	.	ENSG00000241119	ENST00000354728	T	0.61158	0.13	3.22	3.22	0.36961	.	.	.	.	.	T	0.81418	0.4818	M	0.94063	3.49	0.21579	N	0.999638	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	T	0.73550	-0.3947	9	0.62326	D	0.03	.	14.9734	0.71251	0.0:1.0:0.0:0.0	.	240;240	Q5DSZ5;O60656	.;UD19_HUMAN	R	240	ENSP00000346768:T240R	ENSP00000346768:T240R	T	+	2	0	UGT1A9	234246038	0.002000	0.14202	0.073000	0.20177	0.012000	0.07955	1.326000	0.33735	1.797000	0.52628	0.440000	0.28878	ACG		0.428	UGT1A9-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130995.1	NM_021027		248	309	0	0	0	0.00361	0	248	309				
UGT1A6	54578	broad.mit.edu	37	2	234652434	234652434	+	Intron	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr2:234652434C>A	ENST00000305139.6	+	2	1000				UGT1A6_ENST00000480628.1_Intron|UGT1A6_ENST00000373424.1_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A1_ENST00000609767.1_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A4_ENST00000373409.3_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A3_ENST00000482026.1_Intron|UGT1A5_ENST00000373414.3_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A1_ENST00000608381.1_Intron|UGT1A6_ENST00000406651.1_Intron|DNAJB3_ENST00000449667.1_RNA|UGT1A1_ENST00000373450.4_Intron	NM_001072.3	NP_001063.2	P19224	UD16_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A6						cellular glucuronidation (GO:0052695)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(1)	22		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;5.86e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000384)|Lung(119;0.00306)|LUSC - Lung squamous cell carcinoma(224;0.00702)	Acetaminophen(DB00316)|Deferiprone(DB08826)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Propofol(DB00818)|Valproic Acid(DB00313)	TGAATCTCCTCTCCGCTTCCT	0.627																																							uc002vuz.2		NA																	0					0						c.(127-129)GAG>GAT		DnaJ (Hsp40) homolog, subfamily B, member 3							136.0	151.0	146.0					2																	234652434		2113	4247	6360	SO:0001627	intron_variant	414061				protein folding		heat shock protein binding|unfolded protein binding	g.chr2:234652434C>A	M84130	CCDS2507.1, CCDS2508.1	2q37	2010-03-05	2005-07-20		ENSG00000167165	ENSG00000167165		"""UDP glucuronosyltransferases"""	12538	other	complex locus constituent		606431	"""UDP glycosyltransferase 1 family, polypeptide A6"""			9295054, 1339448	Standard	NM_001072		Approved	HLUGP, GNT1, UGT1F		P19224	OTTHUMG00000059122	ENST00000305139.6:c.862-23246C>A	2.37:g.234652434C>A						UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Intron|UGT1A7_uc002vut.2_Intron|UGT1A6_uc002vuu.2_Intron|UGT1A6_uc010zmy.1_Intron|UGT1A6_uc002vuv.3_Intron|UGT1A5_uc010zmz.1_Intron|UGT1A5_uc002vuw.2_Intron|UGT1A4_uc010zna.1_Intron|UGT1A4_uc002vux.2_Intron|UGT1A3_uc010znb.1_Intron|UGT1A3_uc002vuy.2_Intron	p.E43D	NM_001001394	NP_001001394	Q8WWF6	DNJB3_HUMAN			1	228	-			43			J.		A6NKK6|B8K289|Q96TE7	Missense_Mutation	SNP	ENST00000305139.6	37	c.129G>T	CCDS2507.1																																																																																				0.627	UGT1A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130988.1	NM_205862		24	270	1	0	4.06085e-26	0.007291	6.85345e-26	24	270				
COL6A3	1293	broad.mit.edu	37	2	238285946	238285946	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr2:238285946T>C	ENST00000295550.4	-	7	2991	c.2539A>G	c.(2539-2541)Aat>Gat	p.N847D	COL6A3_ENST00000409809.1_Missense_Mutation_p.N641D|COL6A3_ENST00000392004.3_Missense_Mutation_p.N641D|COL6A3_ENST00000472056.1_Missense_Mutation_p.N240D|COL6A3_ENST00000392003.2_Missense_Mutation_p.N440D|COL6A3_ENST00000353578.4_Missense_Mutation_p.N641D|COL6A3_ENST00000346358.4_Missense_Mutation_p.N647D|COL6A3_ENST00000347401.3_Missense_Mutation_p.N646D	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	847	Nonhelical region.|VWFA 5. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.N641D(1)|p.N847D(1)		breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		CCCACAAGATTGGCTGAGCCG	0.498																																							uc002vwl.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18						c.(2539-2541)AAT>GAT		alpha 3 type VI collagen isoform 1 precursor							99.0	102.0	101.0					2																	238285946		2203	4300	6503	SO:0001583	missense	1293				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity	g.chr2:238285946T>C	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.2539A>G	2.37:g.238285946T>C	ENSP00000295550:p.Asn847Asp					COL6A3_uc002vwo.2_Missense_Mutation_p.N641D|COL6A3_uc010znj.1_Missense_Mutation_p.N240D|COL6A3_uc002vwq.2_Missense_Mutation_p.N641D|COL6A3_uc002vwr.2_Missense_Mutation_p.N440D|COL6A3_uc010znk.1_Missense_Mutation_p.N647D	p.N847D	NM_004369	NP_004360	P12111	CO6A3_HUMAN		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)	7	2824	-		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)	847			Nonhelical region.|VWFA 5.		A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	c.2539A>G	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	T	13.73	2.323464	0.41096	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358;ENST00000392004;ENST00000392003;ENST00000433762	D;D;D;D;D;D;D;D;D	0.83506	-1.73;-1.73;-1.73;-1.73;-1.73;-1.73;-1.73;-1.73;-1.73	5.75	5.75	0.90469	von Willebrand factor, type A (3);	0.000000	0.56097	D	0.000022	D	0.86493	0.5946	L	0.46819	1.47	0.43214	D	0.99508	B;D;P;D;D;B	0.89917	0.238;1.0;0.511;1.0;0.999;0.238	B;D;B;D;D;B	0.91635	0.057;0.999;0.267;0.999;0.996;0.057	D	0.84399	0.0559	10	0.29301	T	0.29	.	10.4039	0.44246	0.0:0.0728:0.0:0.9272	.	647;240;440;641;641;847	E9PCV6;E9PFQ6;A8MT30;E9PGQ9;P12111-2;P12111	.;.;.;.;.;CO6A3_HUMAN	D	847;646;641;240;641;647;641;440;647	ENSP00000295550:N847D;ENSP00000315609:N646D;ENSP00000315873:N641D;ENSP00000418285:N240D;ENSP00000386844:N641D;ENSP00000295546:N647D;ENSP00000375861:N641D;ENSP00000375860:N440D;ENSP00000389539:N647D	ENSP00000295550:N847D	N	-	1	0	COL6A3	237950685	1.000000	0.71417	0.980000	0.43619	0.031000	0.12232	1.848000	0.39309	2.196000	0.70406	0.533000	0.62120	AAT		0.498	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369		53	57	0	0	0	0.00361	0	53	57				
SIRPA	140885	broad.mit.edu	37	20	1903223	1903223	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr20:1903223C>T	ENST00000358771.4	+	4	1171	c.1019C>T	c.(1018-1020)gCg>gTg	p.A340V	SIRPA_ENST00000400068.3_Missense_Mutation_p.A340V|SIRPA_ENST00000356025.3_Missense_Mutation_p.A340V	NM_001040023.1	NP_001035112.1	P78324	SHPS1_HUMAN	signal-regulatory protein alpha	340	Ig-like C1-type 2.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.A340V(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(13)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	21				Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)		GGGCAGCCAGCGGTCAGCAAA	0.572																																					GBM(155;1668 1920 5945 42733 48121)	GBM(155;1668 1920 5945 42733 48121)	uc002wfq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1018-1020)GCG>GTG		signal-regulatory protein alpha precursor							55.0	47.0	50.0					20																	1903223		2203	4296	6499	SO:0001583	missense	140885				blood coagulation|cell adhesion|cell junction assembly|leukocyte migration	integral to membrane|plasma membrane	SH3 domain binding	g.chr20:1903223C>T	D86043	CCDS13022.1	20p13	2013-01-11	2006-03-29	2006-03-29	ENSG00000198053	ENSG00000198053		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	9662	protein-coding gene	gene with protein product		602461	"""protein tyrosine phosphatase, non-receptor type substrate 1"""	PTPNS1		9070220, 9062191, 16339511	Standard	XM_005260669		Approved	SHPS1, SIRP, MYD-1, BIT, P84, SHPS-1, SIRPalpha, CD172a, SIRPalpha2, MFR, SIRP-ALPHA-1	uc002wfr.3	P78324	OTTHUMG00000031682	ENST00000358771.4:c.1019C>T	20.37:g.1903223C>T	ENSP00000351621:p.Ala340Val					SIRPA_uc010zps.1_Missense_Mutation_p.A320V|SIRPA_uc002wfr.2_Missense_Mutation_p.A340V|SIRPA_uc002wfs.2_Missense_Mutation_p.A340V|SIRPA_uc002wft.2_Missense_Mutation_p.A340V	p.A340V	NM_001040022	NP_001035111	P78324	SHPS1_HUMAN		Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)	5	1379	+			340			Ig-like C1-type 2.|Extracellular (Potential).		A2A2E1|A8K411|B2R6C3|O00683|O43799|Q8N517|Q8TAL8|Q9H0Z2|Q9UDX2|Q9UIJ6|Q9Y4U9	Missense_Mutation	SNP	ENST00000358771.4	37	c.1019C>T	CCDS13022.1	.	.	.	.	.	.	.	.	.	.	C	15.13	2.742890	0.49151	.	.	ENSG00000198053	ENST00000400068;ENST00000356025;ENST00000358771	T;T;T	0.09255	3.0;3.0;3.0	5.35	5.35	0.76521	Immunoglobulin-like (1);Immunoglobulin C1-set (1);Immunoglobulin-like fold (1);	0.593939	0.16053	N	0.231870	T	0.11793	0.0287	M	0.69358	2.11	0.09310	N	1	P;P;P	0.46457	0.771;0.812;0.878	B;B;B	0.29267	0.05;0.032;0.1	T	0.32107	-0.9919	10	0.49607	T	0.09	.	14.7506	0.69522	0.0:1.0:0.0:0.0	.	320;340;340	B4DP97;P78324-2;P78324	.;.;SHPS1_HUMAN	V	340	ENSP00000382941:A340V;ENSP00000348307:A340V;ENSP00000351621:A340V	ENSP00000348307:A340V	A	+	2	0	SIRPA	1851223	0.056000	0.20664	0.118000	0.21660	0.077000	0.17291	2.547000	0.45786	2.941000	0.99782	0.655000	0.94253	GCG		0.572	SIRPA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077568.2	NM_080792		15	41	0	0	0	0.004007	0	15	41				
SLC4A11	83959	broad.mit.edu	37	20	3215504	3215504	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr20:3215504G>T	ENST00000380056.3	-	2	220	c.173C>A	c.(172-174)gCc>gAc	p.A58D	SLC4A11_ENST00000539553.2_Missense_Mutation_p.A42D|SLC4A11_ENST00000380059.3_Missense_Mutation_p.A85D	NM_032034.3	NP_114423.1	Q8NBS3	S4A11_HUMAN	solute carrier family 4, sodium borate transporter, member 11	58					bicarbonate transport (GO:0015701)|borate transmembrane transport (GO:0035445)|borate transport (GO:0046713)|cellular cation homeostasis (GO:0030003)|fluid transport (GO:0042044)|proton transport (GO:0015992)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	bicarbonate transmembrane transporter activity (GO:0015106)|borate transmembrane transporter activity (GO:0046715)|hydrogen ion channel activity (GO:0015252)|inorganic anion exchanger activity (GO:0005452)|protein dimerization activity (GO:0046983)|sodium channel activity (GO:0005272)|symporter activity (GO:0015293)	p.A85D(1)|p.A58D(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(4)|soft_tissue(1)|urinary_tract(1)	40						CTCCTCTCGGGCTTCGAAGGT	0.542																																					NSCLC(190;922 2139 10266 10292 38692)	NSCLC(190;922 2139 10266 10292 38692)	uc002wig.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(172-174)GCC>GAC		solute carrier family 4 member 11							110.0	99.0	103.0					20																	3215504		2203	4300	6503	SO:0001583	missense	83959				cellular cation homeostasis|fluid transport|phosphoenolpyruvate-dependent sugar phosphotransferase system	basolateral plasma membrane|integral to membrane	bicarbonate transmembrane transporter activity|borate transmembrane transporter activity|hydrogen ion channel activity|inorganic anion exchanger activity|sodium channel activity|sugar:hydrogen symporter activity	g.chr20:3215504G>T	AF336127	CCDS13052.1, CCDS54445.1, CCDS54446.1	20p13	2014-02-14	2007-08-03		ENSG00000088836	ENSG00000088836		"""Solute carriers"""	16438	protein-coding gene	gene with protein product		610206	"""corneal endothelial dystrophy 2 (autosomal recessive)"", ""solute carrier family 4, sodium bicarbonate transporter-like, member 11"", ""corneal dystrophy and perceptive deafness 1"""	CHED2, CDPD1		10843999, 11302728, 16767101	Standard	NM_001174089		Approved	dJ794I6.2, BTR1, NaBC1, FECD4	uc010zqe.2	Q8NBS3	OTTHUMG00000031740	ENST00000380056.3:c.173C>A	20.37:g.3215504G>T	ENSP00000369396:p.Ala58Asp					SLC4A11_uc010zqe.1_Missense_Mutation_p.A85D|SLC4A11_uc002wih.2_RNA|SLC4A11_uc010zqf.1_Missense_Mutation_p.A42D	p.A58D	NM_032034	NP_114423	Q8NBS3	S4A11_HUMAN			2	221	-			58			Cytoplasmic (Potential).		B4DKC8|B4DKX9|G3V1M3|Q2TB62|Q2TB63|Q9BXF4|Q9NTW9	Missense_Mutation	SNP	ENST00000380056.3	37	c.173C>A	CCDS13052.1	.	.	.	.	.	.	.	.	.	.	G	5.139	0.211192	0.09757	.	.	ENSG00000088836	ENST00000380059;ENST00000380056;ENST00000539553;ENST00000437836	D;D;D;D	0.82619	-1.57;-1.63;-1.55;-1.51	4.04	2.02	0.26589	.	1.713730	0.03009	N	0.149258	T	0.75576	0.3868	L	0.40543	1.245	0.19575	N	0.999966	B;B;B	0.31125	0.001;0.309;0.148	B;B;B	0.23852	0.003;0.049;0.034	T	0.60895	-0.7172	10	0.48119	T	0.1	.	5.2626	0.15582	0.1882:0.0:0.6498:0.162	.	42;85;58	G3V1M3;B4DKC8;Q8NBS3	.;.;S4A11_HUMAN	D	85;58;42;42	ENSP00000369399:A85D;ENSP00000369396:A58D;ENSP00000441370:A42D;ENSP00000404271:A42D	ENSP00000369396:A58D	A	-	2	0	SLC4A11	3163504	0.627000	0.27129	0.123000	0.21794	0.111000	0.19643	1.158000	0.31737	0.421000	0.25980	0.655000	0.94253	GCC		0.542	SLC4A11-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000077728.1			21	46	1	0	7.87624e-14	0.00278	1.17412e-13	21	46				
RASSF2	9770	broad.mit.edu	37	20	4776594	4776594	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr20:4776594C>A	ENST00000379400.3	-	5	349	c.154G>T	c.(154-156)Gtg>Ttg	p.V52L	RASSF2_ENST00000478553.1_5'Flank|RASSF2_ENST00000379376.2_Missense_Mutation_p.V52L	NM_014737.2	NP_055552.1	P50749	RASF2_HUMAN	Ras association (RalGDS/AF-6) domain family member 2	52					bone remodeling (GO:0046849)|cell cycle (GO:0007049)|epidermal growth factor receptor signaling pathway via I-kappaB kinase/NF-kappaB cascade (GO:0038168)|homeostasis of number of cells (GO:0048872)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|ossification (GO:0001503)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.V52L(1)		endometrium(3)|kidney(2)|large_intestine(8)|lung(12)|ovary(3)|pancreas(2)|prostate(2)|skin(2)	34						AGCCCCTCCACAATGAACTCG	0.562																																					Melanoma(158;1891 3343 50738)	Melanoma(158;1891 3343 50738)	uc002wld.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(2)|large_intestine(1)	6						c.(154-156)GTG>TTG		Ras association domain family 2							69.0	67.0	68.0					20																	4776594		2203	4300	6503	SO:0001583	missense	9770				cell cycle|signal transduction	nucleus	protein binding	g.chr20:4776594C>A	D79990	CCDS13083.1	20p13	2011-08-12	2008-02-22		ENSG00000101265	ENSG00000101265			9883	protein-coding gene	gene with protein product	"""centromere protein 34"""	609492				8724849, 15806169	Standard	NM_014737		Approved	KIAA0168, CENP-34	uc002wld.3	P50749	OTTHUMG00000031790	ENST00000379400.3:c.154G>T	20.37:g.4776594C>A	ENSP00000368710:p.Val52Leu					RASSF2_uc002wlc.2_5'Flank|RASSF2_uc002wle.2_RNA|RASSF2_uc002wlf.2_Missense_Mutation_p.V52L	p.V52L	NM_170774	NP_739580	P50749	RASF2_HUMAN			4	208	-			52					A6NIX9|A8K5Z3|Q17S06|Q53HD0|Q6AHZ2|Q8IZA5	Missense_Mutation	SNP	ENST00000379400.3	37	c.154G>T	CCDS13083.1	.	.	.	.	.	.	.	.	.	.	C	12.72	2.022607	0.35701	.	.	ENSG00000101265	ENST00000379400;ENST00000379376	T;T	0.50548	0.74;0.74	4.89	4.89	0.63831	.	0.353894	0.30109	N	0.010400	T	0.40119	0.1104	L	0.41632	1.29	0.44316	D	0.997195	B	0.27380	0.177	B	0.23150	0.044	T	0.19031	-1.0318	10	0.29301	T	0.29	.	16.8063	0.85706	0.0:1.0:0.0:0.0	.	52	P50749	RASF2_HUMAN	L	52	ENSP00000368710:V52L;ENSP00000368684:V52L	ENSP00000368684:V52L	V	-	1	0	RASSF2	4724594	0.997000	0.39634	1.000000	0.80357	0.918000	0.54935	2.138000	0.42140	2.549000	0.85964	0.563000	0.77884	GTG		0.562	RASSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077828.1	NM_014737		17	59	1	0	9.7654e-05	0.007413	0.000110648	17	59				
PLCB1	23236	broad.mit.edu	37	20	8719992	8719992	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr20:8719992C>A	ENST00000338037.6	+	21	2320	c.2293C>A	c.(2293-2295)Caa>Aaa	p.Q765K	PLCB1_ENST00000494924.1_3'UTR|PLCB1_ENST00000378641.3_Missense_Mutation_p.Q765K|PLCB1_ENST00000378637.2_Missense_Mutation_p.Q765K	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	765					activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)	p.Q765K(2)		NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						CTTGCCAGTGCAAGCCATTCG	0.393																																							uc002wnb.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12						c.(2293-2295)CAA>AAA		phosphoinositide-specific phospholipase C beta 1							86.0	83.0	84.0					20																	8719992		2203	4300	6503	SO:0001583	missense	23236				activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity	g.chr20:8719992C>A	AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.2293C>A	20.37:g.8719992C>A	ENSP00000338185:p.Gln765Lys					PLCB1_uc010zrb.1_Missense_Mutation_p.Q664K|PLCB1_uc002wna.2_Missense_Mutation_p.Q765K|PLCB1_uc002wnc.1_Missense_Mutation_p.Q664K|PLCB1_uc002wnd.1_Missense_Mutation_p.Q342K	p.Q765K	NM_015192	NP_056007	Q9NQ66	PLCB1_HUMAN			21	2296	+			765					D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Missense_Mutation	SNP	ENST00000338037.6	37	c.2293C>A	CCDS13102.1	.	.	.	.	.	.	.	.	.	.	C	10.43	1.347459	0.24426	.	.	ENSG00000182621	ENST00000378641;ENST00000338037;ENST00000378637;ENST00000441163;ENST00000535719;ENST00000338061;ENST00000439627	T;T;T;T	0.12879	2.64;2.64;2.64;2.64	5.02	5.02	0.67125	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.239971	0.38837	N	0.001559	T	0.07279	0.0184	N	0.08118	0	0.30327	N	0.786982	B;B	0.19706	0.0;0.038	B;B	0.23018	0.0;0.043	T	0.11036	-1.0604	10	0.31617	T	0.26	.	9.6867	0.40103	0.0:0.8715:0.0:0.1285	.	765;765	Q9NQ66;Q9NQ66-2	PLCB1_HUMAN;.	K	765;765;765;685;685;111;84	ENSP00000367908:Q765K;ENSP00000338185:Q765K;ENSP00000367904:Q765K;ENSP00000391162:Q84K	ENSP00000338185:Q765K	Q	+	1	0	PLCB1	8667992	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	4.924000	0.63418	2.344000	0.79699	0.650000	0.86243	CAA		0.393	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077938.3			5	70	1	0	0.00116845	0.001168	0.00125798	5	70				
PAK7	57144	broad.mit.edu	37	20	9546642	9546642	+	Silent	SNP	G	G	T	rs199678661		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr20:9546642G>T	ENST00000378429.3	-	6	1926	c.1380C>A	c.(1378-1380)acC>acA	p.T460T	PAK7_ENST00000378423.1_Silent_p.T460T|PAK7_ENST00000353224.5_Silent_p.T460T	NM_020341.3	NP_065074.1	Q9P286	PAK7_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 7	460	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|learning (GO:0007612)|locomotory behavior (GO:0007626)|memory (GO:0007613)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.T460T(1)		NS(1)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(44)|ovary(2)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)	81			COAD - Colon adenocarcinoma(9;0.194)			ATACGATGCCGGTTGAGCCTT	0.532																																							uc002wnl.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(11)|skin(5)|central_nervous_system(3)|ovary(2)|large_intestine(1)|stomach(1)	23						c.(1378-1380)ACC>ACA		p21-activated kinase 7							233.0	215.0	221.0					20																	9546642		2203	4300	6503	SO:0001819	synonymous_variant	57144						ATP binding|protein binding|protein serine/threonine kinase activity	g.chr20:9546642G>T	AB033090	CCDS13107.1	20p12	2008-06-17	2008-06-17		ENSG00000101349	ENSG00000101349			15916	protein-coding gene	gene with protein product		608038	"""p21(CDKN1A)-activated kinase 7"""			11756552, 10574462	Standard	NM_020341		Approved	KIAA1264, PAK5	uc002wnk.2	Q9P286	OTTHUMG00000031857	ENST00000378429.3:c.1380C>A	20.37:g.9546642G>T						PAK7_uc002wnk.2_Silent_p.T460T|PAK7_uc002wnj.2_Silent_p.T460T|PAK7_uc010gby.1_Silent_p.T460T	p.T460T	NM_020341	NP_065074	Q9P286	PAK7_HUMAN	COAD - Colon adenocarcinoma(9;0.194)		6	1925	-			460			Protein kinase.|ATP (By similarity).		A8K5T6|D3DW14|Q5W115|Q9BX09|Q9ULF6	Silent	SNP	ENST00000378429.3	37	c.1380C>A	CCDS13107.1																																																																																				0.532	PAK7-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077962.1			8	194	1	0	7.48243e-07	0.006214	9.30337e-07	8	194				
RALGAPA2	57186	broad.mit.edu	37	20	20563737	20563737	+	Silent	SNP	A	A	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr20:20563737A>C	ENST00000202677.7	-	20	2671	c.2664T>G	c.(2662-2664)cgT>cgG	p.R888R		NM_020343.3	NP_065076.2	Q2PPJ7	RGPA2_HUMAN	Ral GTPase activating protein, alpha subunit 2 (catalytic)	888					activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)	p.R888R(2)		endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(25)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	54						GTAACCAATGACGGGCATCAG	0.478																																							uc002wrz.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(2662-2664)CGT>CGG		akt substrate AS250							82.0	81.0	81.0					20																	20563737		1957	4158	6115	SO:0001819	synonymous_variant	57186				activation of Ral GTPase activity	cytosol|nucleus	protein heterodimerization activity|Ral GTPase activator activity	g.chr20:20563737A>C	AL078634, DQ310704	CCDS46584.1	20p11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000188559	ENSG00000188559			16207	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 74"""	C20orf74		16490346, 19520869	Standard	NM_020343		Approved	dJ1049G11.4, AS250, KIAA1272, RapGAPalpha2	uc002wrz.3	Q2PPJ7	OTTHUMG00000032010	ENST00000202677.7:c.2664T>G	20.37:g.20563737A>C						RALGAPA2_uc010gcx.2_Silent_p.R592R|RALGAPA2_uc010zsg.1_Silent_p.R336R	p.R888R	NM_020343	NP_065076	Q2PPJ7	RGPA2_HUMAN			20	2807	-			888					Q4VXU6|Q5JUA3|Q5JUA4|Q5T9K3|Q96CX9|Q9BQT7|Q9H9D9|Q9ULE8	Silent	SNP	ENST00000202677.7	37	c.2664T>G	CCDS46584.1	.	.	.	.	.	.	.	.	.	.	A	0.467	-0.886258	0.02511	.	.	ENSG00000188559	ENST00000430436	.	.	.	6.07	1.4	0.22301	.	.	.	.	.	T	0.23014	0.0556	.	.	.	0.25105	N	0.990753	.	.	.	.	.	.	T	0.21518	-1.0243	4	.	.	.	.	2.6495	0.04994	0.1526:0.0999:0.3988:0.3487	.	.	.	.	G	705	.	.	V	-	2	0	RALGAPA2	20511737	0.571000	0.26659	0.952000	0.39060	0.077000	0.17291	-0.166000	0.09954	0.375000	0.24679	-0.242000	0.12053	GTC		0.478	RALGAPA2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000471941.1	NM_020343		6	65	0	0	0	0.001168	0	6	65				
SEMG1	6406	broad.mit.edu	37	20	43836993	43836993	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr20:43836993G>A	ENST00000372781.3	+	2	1112	c.1055G>A	c.(1054-1056)aGt>aAt	p.S352N	SEMG1_ENST00000244069.6_Missense_Mutation_p.S292N	NM_003007.3	NP_002998.1	P04279	SEMG1_HUMAN	semenogelin I	352	2 X 60 AA tandem repeats, type 1.|Repeat-rich region. {ECO:0000250}.				insemination (GO:0007320)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|secretory granule (GO:0030141)	structural molecule activity (GO:0005198)	p.S352N(1)		cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|prostate(1)|skin(6)|stomach(2)|urinary_tract(1)	32		Myeloproliferative disorder(115;0.0122)				CAATCTTCAAGTACGGAAGAA	0.408																																							uc002xni.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(1054-1056)AGT>AAT		semenogelin I preproprotein							80.0	74.0	76.0					20																	43836993		2203	4300	6503	SO:0001583	missense	6406				insemination|sexual reproduction	extracellular space|stored secretory granule	structural molecule activity	g.chr20:43836993G>A		CCDS13345.1	20q12-q13.2	2009-08-06			ENSG00000124233	ENSG00000124233			10742	protein-coding gene	gene with protein product	"""semen coagulating protein"", ""cancer/testis antigen 103"""	182140		SEMG		2912989, 15563730	Standard	NM_003007		Approved	CT103		P04279	OTTHUMG00000032565	ENST00000372781.3:c.1055G>A	20.37:g.43836993G>A	ENSP00000361867:p.Ser352Asn					SEMG1_uc002xnj.2_Missense_Mutation_p.S292N|SEMG2_uc010ggz.2_Intron|SEMG1_uc002xnh.2_Intron	p.S352N	NM_003007	NP_002998	P04279	SEMG1_HUMAN			2	1112	+		Myeloproliferative disorder(115;0.0122)	352			58 AA repeat 2.		Q53ZV0|Q53ZV1|Q53ZV2|Q6X4I9|Q6Y809|Q6Y822|Q6Y823|Q86U64|Q96QM3	Missense_Mutation	SNP	ENST00000372781.3	37	c.1055G>A	CCDS13345.1	.	.	.	.	.	.	.	.	.	.	G	1.881	-0.457923	0.04508	.	.	ENSG00000124233	ENST00000244069;ENST00000372781	T;T	0.12774	2.65;2.9	1.13	1.13	0.20643	.	.	.	.	.	T	0.27349	0.0671	M	0.71581	2.175	0.09310	N	1	P;D	0.59357	0.763;0.985	B;D	0.67231	0.311;0.95	T	0.12502	-1.0545	9	0.24483	T	0.36	.	5.6029	0.17363	0.0:0.0:1.0:0.0	.	292;352	P04279-2;P04279	.;SEMG1_HUMAN	N	292;352	ENSP00000244069:S292N;ENSP00000361867:S352N	ENSP00000244069:S292N	S	+	2	0	SEMG1	43270407	0.001000	0.12720	0.002000	0.10522	0.013000	0.08279	1.200000	0.32247	0.913000	0.36797	0.404000	0.27445	AGT		0.408	SEMG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079416.3	NM_003007		6	35	0	0	0	0.001168	0	6	35				
ZSWIM3	140831	broad.mit.edu	37	20	44506100	44506100	+	Silent	SNP	C	C	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr20:44506100C>T	ENST00000255152.2	+	2	1112	c.903C>T	c.(901-903)gcC>gcT	p.A301A	ZSWIM3_ENST00000454862.2_Silent_p.A295A	NM_080752.3	NP_542790.2	Q96MP5	ZSWM3_HUMAN	zinc finger, SWIM-type containing 3	301							zinc ion binding (GO:0008270)	p.A301A(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	35		Myeloproliferative disorder(115;0.0122)				TTCCTGCTGCCCGCATCCTCC	0.502																																							uc002xqd.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(901-903)GCC>GCT		zinc finger, SWIM domain containing 3							85.0	84.0	85.0					20																	44506100		2203	4300	6503	SO:0001819	synonymous_variant	140831						zinc ion binding	g.chr20:44506100C>T	AL008726	CCDS13381.1	20q13.12	2014-06-13	2003-12-17	2003-12-19	ENSG00000132801	ENSG00000132801		"""Zinc fingers, SWIM-type"""	16157	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 174"""		"""chromosome 20 open reading frame 164"""	C20orf164			Standard	NM_080752		Approved	dJ337O18.7, PPP1R174	uc002xqd.3	Q96MP5	OTTHUMG00000032627	ENST00000255152.2:c.903C>T	20.37:g.44506100C>T						ZSWIM3_uc010zxg.1_Silent_p.A295A	p.A301A	NM_080752	NP_542790	Q96MP5	ZSWM3_HUMAN			2	1106	+		Myeloproliferative disorder(115;0.0122)	301					Q9BR13	Silent	SNP	ENST00000255152.2	37	c.903C>T	CCDS13381.1																																																																																				0.502	ZSWIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079540.1	NM_080752		12	77	0	0	0	0.000978	0	12	77				
TFAP2C	7022	broad.mit.edu	37	20	55208437	55208437	+	Silent	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr20:55208437G>T	ENST00000201031.2	+	4	858	c.615G>T	c.(613-615)ctG>ctT	p.L205L	TFAP2C_ENST00000544508.1_Silent_p.L36L	NM_003222.3	NP_003213.1	Q92754	AP2C_HUMAN	transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma)	205					cell-cell signaling (GO:0007267)|cerebral cortex development (GO:0021987)|dichotomous subdivision of terminal units involved in mammary gland duct morphogenesis (GO:0060598)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|forebrain neuron fate commitment (GO:0021877)|germ-line stem cell maintenance (GO:0030718)|hair follicle development (GO:0001942)|keratinocyte development (GO:0003334)|male gonad development (GO:0008584)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epidermis development (GO:0045682)|regulation of gene expression, epigenetic (GO:0040029)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sebaceous gland development (GO:0048733)|somatic stem cell maintenance (GO:0035019)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L205L(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	13			Colorectal(105;0.229)			AGAACCCTCTGAACCTCCCCT	0.517																																							uc002xya.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(613-615)CTG>CTT		transcription factor AP-2 gamma							81.0	76.0	77.0					20																	55208437		2203	4300	6503	SO:0001819	synonymous_variant	7022				cell-cell signaling|male gonad development|regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity	g.chr20:55208437G>T		CCDS13454.1	20q13.2	2008-07-17	2001-11-28		ENSG00000087510	ENSG00000087510			11744	protein-coding gene	gene with protein product	"""estrogen receptor factor 1"""	601602	"""transcription factor AP-2 gamma (activating enhancer-binding protein 2 gamma)"""			8661133	Standard	NM_003222		Approved	AP2-GAMMA, ERF1, TFAP2G, hAP-2g	uc002xya.3	Q92754	OTTHUMG00000032805	ENST00000201031.2:c.615G>T	20.37:g.55208437G>T						TFAP2C_uc010zzi.1_Silent_p.L36L	p.L205L	NM_003222	NP_003213	Q92754	AP2C_HUMAN	Colorectal(105;0.229)		4	858	+			205					B4DWK3|O00685|O00730|Q86V30|Q8IVB6|Q9P1X2	Silent	SNP	ENST00000201031.2	37	c.615G>T	CCDS13454.1																																																																																				0.517	TFAP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079823.2	NM_003222		11	70	1	0	6.40141e-05	0.000978	7.32707e-05	11	70				
CDH4	1002	broad.mit.edu	37	20	60499428	60499428	+	Silent	SNP	C	C	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr20:60499428C>T	ENST00000360469.5	+	11	1753	c.1665C>T	c.(1663-1665)caC>caT	p.H555H	CDH4_ENST00000543233.1_Silent_p.H481H	NM_001794.3	NP_001785.2	P55283	CADH4_HUMAN	cadherin 4, type 1, R-cadherin (retinal)	555	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.H555H(1)		NS(2)|breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(2)|lung(25)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			GCTGGCTGCACATCAATGCCA	0.622																																							uc002ybn.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(3)|ovary(2)|skin(1)	6						c.(1663-1665)CAC>CAT		cadherin 4, type 1 preproprotein							112.0	87.0	96.0					20																	60499428		2203	4300	6503	SO:0001819	synonymous_variant	1002				adherens junction organization|cell junction assembly		calcium ion binding	g.chr20:60499428C>T	L34059	CCDS13488.1, CCDS58784.1	20q13.3	2010-01-26			ENSG00000179242	ENSG00000179242		"""Cadherins / Major cadherins"""	1763	protein-coding gene	gene with protein product	"""R-Cadherin"""	603006				10191097, 10516427	Standard	NM_001794		Approved		uc002ybn.2	P55283	OTTHUMG00000032890	ENST00000360469.5:c.1665C>T	20.37:g.60499428C>T						CDH4_uc002ybp.1_Silent_p.H481H	p.H555H	NM_001794	NP_001785	P55283	CADH4_HUMAN	BRCA - Breast invasive adenocarcinoma(19;2.36e-08)		11	1679	+			555			Cadherin 4.|Extracellular (Potential).		B3KWB8|G3V1P8|Q2M208|Q5VZ44|Q9BZ05	Silent	SNP	ENST00000360469.5	37	c.1665C>T	CCDS13488.1																																																																																				0.622	CDH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079965.2	NM_001794		6	65	0	0	0	0.001984	0	6	65				
YTHDF1	54915	broad.mit.edu	37	20	61834123	61834123	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr20:61834123C>G	ENST00000370339.3	-	4	1510	c.1169G>C	c.(1168-1170)cGt>cCt	p.R390P	YTHDF1_ENST00000370333.4_Missense_Mutation_p.R340P|YTHDF1_ENST00000370334.4_Intron	NM_017798.3	NP_060268.2	Q9BYJ9	YTHD1_HUMAN	YTH domain family, member 1	390	YTH. {ECO:0000255|PROSITE- ProRule:PRU00225}.						N6-methyladenosine-containing RNA binding (GO:1990247)|poly(A) RNA binding (GO:0044822)	p.R390P(1)		NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)	24						GATGAACACACGCCCGCTTTT	0.532																																							uc002yeh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1168-1170)CGT>CCT		YTH domain family, member 1							100.0	92.0	95.0					20																	61834123		2203	4300	6503	SO:0001583	missense	54915							g.chr20:61834123C>G	AK000398	CCDS13511.1	20q13.33	2010-03-15	2004-11-16	2004-06-04	ENSG00000149658	ENSG00000149658			15867	protein-coding gene	gene with protein product			"""YTH domain family 1"""	C20orf21			Standard	NM_017798		Approved	FLJ20391	uc002yeh.3	Q9BYJ9	OTTHUMG00000032955	ENST00000370339.3:c.1169G>C	20.37:g.61834123C>G	ENSP00000359364:p.Arg390Pro					YTHDF1_uc011aaq.1_Missense_Mutation_p.R340P	p.R390P	NM_017798	NP_060268	Q9BYJ9	YTHD1_HUMAN			4	1463	-			390			YTH.		Q8N3G5|Q8TBT1|Q96AN4|Q96S57|Q9BTI7|Q9NX79	Missense_Mutation	SNP	ENST00000370339.3	37	c.1169G>C	CCDS13511.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.120602	0.77323	.	.	ENSG00000149658	ENST00000370339;ENST00000370333	T;T	0.37752	1.18;1.18	4.72	4.72	0.59763	YTH domain (2);	0.000000	0.85682	D	0.000000	T	0.72228	0.3434	H	0.95712	3.71	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.82581	-0.0386	10	0.87932	D	0	-20.2762	18.0486	0.89341	0.0:1.0:0.0:0.0	.	390	Q9BYJ9	YTHD1_HUMAN	P	390;340	ENSP00000359364:R390P;ENSP00000359358:R340P	ENSP00000359358:R340P	R	-	2	0	YTHDF1	61304568	1.000000	0.71417	0.621000	0.29145	0.991000	0.79684	7.658000	0.83755	2.339000	0.79563	0.591000	0.81541	CGT		0.532	YTHDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080110.2	NM_017798		51	116	0	0	0	0.00361	0	51	116				
JAM2	58494	broad.mit.edu	37	21	27071084	27071084	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr21:27071084C>A	ENST00000480456.1	+	5	1040	c.490C>A	c.(490-492)Cct>Act	p.P164T	JAM2_ENST00000312957.5_Missense_Mutation_p.P164T|JAM2_ENST00000400532.1_Missense_Mutation_p.P164T|JAM2_ENST00000425221.2_Missense_Mutation_p.P128T	NM_001270407.1|NM_021219.3	NP_001257336.1|NP_067042.1	P57087	JAM2_HUMAN	junctional adhesion molecule 2	164	Ig-like C2-type.				blood coagulation (GO:0007596)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|single organismal cell-cell adhesion (GO:0016337)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|tight junction (GO:0005923)		p.P164T(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(12)|prostate(1)|stomach(1)|urinary_tract(1)	19						GAATCCAGCTCCTGAATACAC	0.463																																							uc002ylp.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(490-492)CCT>ACT		junctional adhesion molecule 2 precursor							118.0	110.0	113.0					21																	27071084		1924	4140	6064	SO:0001583	missense	58494				blood coagulation|cell-cell adhesion|leukocyte migration	integral to plasma membrane|tight junction		g.chr21:27071084C>A	AF255910	CCDS42911.1, CCDS58787.1, CCDS58788.1	21q21.2	2013-01-11			ENSG00000154721	ENSG00000154721		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	14686	protein-coding gene	gene with protein product		606870		C21orf43		10779521, 10945976	Standard	NM_021219		Approved	VE-JAM, JAM-B, JAMB, CD322	uc031rvc.1	P57087	OTTHUMG00000078441	ENST00000480456.1:c.490C>A	21.37:g.27071084C>A	ENSP00000420419:p.Pro164Thr					JAM2_uc011ace.1_Missense_Mutation_p.P164T|JAM2_uc002ylq.1_RNA|JAM2_uc011acf.1_Missense_Mutation_p.P128T|JAM2_uc010glh.1_RNA|JAM2_uc002ylr.1_Missense_Mutation_p.P164T|JAM2_uc010gli.1_Missense_Mutation_p.P164T	p.P164T	NM_021219	NP_067042	P57087	JAM2_HUMAN			5	1035	+			164			Extracellular (Potential).|Ig-like C2-type.		B2R6T9|B4DGT9|Q6UXG6|Q6YNC1	Missense_Mutation	SNP	ENST00000480456.1	37	c.490C>A	CCDS42911.1	.	.	.	.	.	.	.	.	.	.	C	18.04	3.533901	0.64972	.	.	ENSG00000154721	ENST00000480456;ENST00000400533;ENST00000400532;ENST00000400537;ENST00000312957;ENST00000425221	T;T;T;T	0.73258	-0.73;-0.73;-0.73;-0.73	4.63	4.63	0.57726	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.248768	0.42172	D	0.000748	T	0.80555	0.4645	M	0.88842	2.985	0.25878	N	0.983626	P;D;D;D;D	0.59357	0.828;0.97;0.985;0.961;0.967	B;P;P;P;P	0.56278	0.437;0.795;0.795;0.714;0.715	T	0.75139	-0.3423	10	0.56958	D	0.05	.	6.9247	0.24408	0.0:0.8102:0.0:0.1898	.	128;164;164;164;164	B4DGT9;A8MQ45;A8MXS1;A8MTB0;P57087	.;.;.;.;JAM2_HUMAN	T	164;164;164;164;164;128	ENSP00000420419:P164T;ENSP00000383376:P164T;ENSP00000318416:P164T;ENSP00000392611:P128T	ENSP00000318416:P164T	P	+	1	0	JAM2	25992955	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	1.303000	0.33470	2.406000	0.81754	0.485000	0.47835	CCT		0.463	JAM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000171347.1			29	45	1	0	1.04121e-07	0.005443	1.34211e-07	29	45				
KRTAP6-1	337966	broad.mit.edu	37	21	31986019	31986019	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr21:31986019A>T	ENST00000329122.2	-	1	230	c.205T>A	c.(205-207)Tac>Aac	p.Y69N	KRTAP20-1_ENST00000334664.2_5'Flank	NM_181602.1	NP_853633.1	Q3LI64	KRA61_HUMAN	keratin associated protein 6-1	69						cytosol (GO:0005829)|intermediate filament (GO:0005882)		p.Y69N(1)		breast(2)|endometrium(1)|lung(7)	10						CAATAATAGTAGCCAGAGCCA	0.532																																							uc002yop.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(205-207)TAC>AAC		keratin associated protein 6-1							76.0	81.0	79.0					21																	31986019		2203	4300	6503	SO:0001583	missense	337966					cytosol|intermediate filament		g.chr21:31986019A>T	AP001708	CCDS13602.1	21q22.1	2006-03-13			ENSG00000184724	ENSG00000184724		"""Keratin associated proteins"""	18931	protein-coding gene	gene with protein product						12359730	Standard	NM_181602		Approved	KAP6.1, C21orf103	uc002yop.3	Q3LI64	OTTHUMG00000057788	ENST00000329122.2:c.205T>A	21.37:g.31986019A>T	ENSP00000332690:p.Tyr69Asn					KRTAP20-1_uc011ade.1_5'Flank	p.Y69N	NM_181602	NP_853633	Q3LI64	KRA61_HUMAN			1	205	-			69						Missense_Mutation	SNP	ENST00000329122.2	37	c.205T>A	CCDS13602.1	.	.	.	.	.	.	.	.	.	.	A	4.073	0.011471	0.07912	.	.	ENSG00000184724	ENST00000329122	T	0.25085	1.82	5.02	3.85	0.44370	.	0.581844	0.12959	U	0.425217	T	0.21468	0.0517	.	.	.	0.27755	N	0.94403	B	0.02656	0.0	B	0.08055	0.003	T	0.15983	-1.0418	9	0.87932	D	0	.	9.5891	0.39534	0.843:0.0:0.0:0.157	.	69	Q3LI64	KRA61_HUMAN	N	69	ENSP00000332690:Y69N	ENSP00000332690:Y69N	Y	-	1	0	KRTAP6-1	30907890	0.762000	0.28451	0.985000	0.45067	0.008000	0.06430	2.203000	0.42752	1.025000	0.39708	-0.350000	0.07774	TAC		0.532	KRTAP6-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128240.2	NM_181602		24	146	0	0	0	0.00333	0	24	146				
KRTAP11-1	337880	broad.mit.edu	37	21	32253732	32253732	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr21:32253732C>A	ENST00000332378.4	-	1	142	c.112G>T	c.(112-114)Ggc>Tgc	p.G38C		NM_175858.2	NP_787054.1	Q8IUC1	KR111_HUMAN	keratin associated protein 11-1	38						keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.G38C(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(12)|pancreas(1)	18						CAGATGCCGCCCAGGCAGTCA	0.567																																							uc002yov.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(112-114)GGC>TGC		keratin associated protein 11-1							76.0	73.0	74.0					21																	32253732		2203	4300	6503	SO:0001583	missense	337880					keratin filament	structural molecule activity	g.chr21:32253732C>A	AJ457065	CCDS13608.1	21q22.1	2003-03-11			ENSG00000182591	ENSG00000182591		"""Keratin associated proteins"""	18922	protein-coding gene	gene with protein product		600064				12359730	Standard	NM_175858		Approved	KAP11.1	uc002yov.3	Q8IUC1	OTTHUMG00000057773	ENST00000332378.4:c.112G>T	21.37:g.32253732C>A	ENSP00000330720:p.Gly38Cys						p.G38C	NM_175858	NP_787054	Q8IUC1	KR111_HUMAN			1	143	-			38					A1L4I8	Missense_Mutation	SNP	ENST00000332378.4	37	c.112G>T	CCDS13608.1	.	.	.	.	.	.	.	.	.	.	C	15.08	2.728310	0.48833	.	.	ENSG00000182591	ENST00000332378	T	0.03152	4.03	5.39	1.54	0.23209	.	0.366329	0.28021	N	0.016914	T	0.06234	0.0161	L	0.42245	1.32	0.28283	N	0.923874	P	0.51449	0.945	P	0.51582	0.674	T	0.11251	-1.0595	10	0.66056	D	0.02	-5.3129	7.7269	0.28765	0.0:0.2564:0.0:0.7436	.	38	Q8IUC1	KR111_HUMAN	C	38	ENSP00000330720:G38C	ENSP00000330720:G38C	G	-	1	0	KRTAP11-1	31175603	0.173000	0.23056	0.999000	0.59377	0.852000	0.48524	-0.133000	0.10451	0.451000	0.26802	-0.313000	0.08912	GGC		0.567	KRTAP11-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128225.1			35	60	1	0	1.45844e-13	0.002836	2.16264e-13	35	60				
TIAM1	7074	broad.mit.edu	37	21	32639219	32639219	+	Missense_Mutation	SNP	T	T	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr21:32639219T>G	ENST00000286827.3	-	5	541	c.70A>C	c.(70-72)Aag>Cag	p.K24Q	TIAM1_ENST00000541036.1_Missense_Mutation_p.K24Q|TIAM1_ENST00000469412.1_Intron	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	24				KH -> ND (in Ref. 1; AAA98443). {ECO:0000305}.	apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.K24Q(1)|p.N24H(1)		autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						GAAGTGTGCTTGCGCCCCAGG	0.582																																							uc002yow.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(3)|breast(3)|ovary(2)|large_intestine(2)	10						c.(70-72)AAG>CAG		T-cell lymphoma invasion and metastasis 1							47.0	50.0	49.0					21																	32639219		2203	4300	6503	SO:0001583	missense	7074				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity	g.chr21:32639219T>G		CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.70A>C	21.37:g.32639219T>G	ENSP00000286827:p.Lys24Gln					TIAM1_uc011adk.1_Missense_Mutation_p.K24Q|TIAM1_uc011adl.1_Missense_Mutation_p.K24Q|TIAM1_uc002yox.1_Intron	p.K24Q	NM_003253	NP_003244	Q13009	TIAM1_HUMAN			5	542	-			24	KH -> ND (in Ref. 1; AAA98443).				B7ZLR6|F5GZ53|Q17RT7	Missense_Mutation	SNP	ENST00000286827.3	37	c.70A>C	CCDS13609.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.372871	0.82573	.	.	ENSG00000156299	ENST00000286827;ENST00000541036;ENST00000455508	T;T	0.60299	0.32;0.2	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.71702	0.3371	L	0.55481	1.735	0.58432	D	0.999996	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.85130	0.997;0.994;0.994	T	0.75045	-0.3456	10	0.87932	D	0	.	14.8708	0.70456	0.0:0.0:0.0:1.0	.	24;24;24	F5GZ53;B7ZLR6;Q13009	.;.;TIAM1_HUMAN	Q	24	ENSP00000286827:K24Q;ENSP00000441570:K24Q	ENSP00000286827:K24Q	K	-	1	0	TIAM1	31561090	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.454000	0.80714	1.921000	0.55644	0.383000	0.25322	AAG		0.582	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1	NM_003253		10	55	0	0	0	0.000978	0	10	55				
PAXBP1	94104	broad.mit.edu	37	21	34136681	34136681	+	Silent	SNP	A	A	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr21:34136681A>C	ENST00000331923.4	-	3	816	c.627T>G	c.(625-627)tcT>tcG	p.S209S	PAXBP1_ENST00000290178.4_Silent_p.S209S|PAXBP1_ENST00000472588.1_5'UTR	NM_016631.3	NP_057715.2	Q9Y5B6	PAXB1_HUMAN	PAX3 and PAX7 binding protein 1	209					muscle organ development (GO:0007517)|positive regulation of histone methylation (GO:0031062)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of satellite cell proliferation (GO:0014842)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S209S(1)									CATTCAATGAAGATAAAGCAT	0.358																																							uc002yqn.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(625-627)TCT>TCG		GC-rich sequence DNA-binding factor candidate							114.0	104.0	107.0					21																	34136681		2203	4300	6503	SO:0001819	synonymous_variant	94104					cytosol|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr21:34136681A>C	AF231920	CCDS13619.1, CCDS33541.1	21q22.11	2014-01-23	2013-01-08	2013-01-08	ENSG00000159086	ENSG00000159086			13579	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 105"", ""GC-rich sequence DNA-binding factor candidate"""		"""chromosome 21 open reading frame 66"", ""GC-rich sequence DNA-binding factor 1"""	C21orf66, GCFC1		11707072, 22862948	Standard	NM_016631		Approved	GCFC, fSAP105	uc002yqn.3	Q9Y5B6	OTTHUMG00000064980	ENST00000331923.4:c.627T>G	21.37:g.34136681A>C						GCFC1_uc002yqo.2_RNA|GCFC1_uc002yqp.2_Silent_p.S209S|GCFC1_uc002yqr.2_Silent_p.S209S	p.S209S	NM_016631	NP_057715	Q9Y5B6	GCFC1_HUMAN			3	817	-			209					D3DSE7|Q96DU8|Q9NYQ0	Silent	SNP	ENST00000331923.4	37	c.627T>G	CCDS13619.1																																																																																				0.358	PAXBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139563.1	NM_013329		14	67	0	0	0	0.003163	0	14	67				
PI4KA	5297	broad.mit.edu	37	22	21174084	21174084	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr22:21174084T>C	ENST00000572273.1	-	6	690	c.460A>G	c.(460-462)Atc>Gtc	p.I154V	PI4KA_ENST00000255882.6_Missense_Mutation_p.I212V			P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha	154					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi-associated vesicle membrane (GO:0030660)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)	p.I154V(2)		breast(3)|endometrium(8)|kidney(9)|large_intestine(19)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|salivary_gland(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	79	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			TGAGGAGGGATTTTGGGAAAG	0.507																																					GBM(136;1332 1831 3115 23601 50806)	GBM(136;1332 1831 3115 23601 50806)	uc002zsz.3		NA																	2	Substitution - Missense(2)		lung(2)	lung(2)|upper_aerodigestive_tract(1)|salivary_gland(1)	4						c.(460-462)ATC>GTC		phosphatidylinositol 4-kinase type 3 alpha							186.0	165.0	172.0					22																	21174084		2203	4300	6503	SO:0001583	missense	5297				phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|synaptic transmission	Golgi-associated vesicle	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding	g.chr22:21174084T>C	L36151	CCDS33603.1, CCDS33603.2	22q11.21	2011-05-25	2007-08-14	2007-08-02	ENSG00000241973	ENSG00000241973			8983	protein-coding gene	gene with protein product		600286		PIK4CA		7961848, 8662589	Standard	NM_002650		Approved	PI4K-ALPHA, pi4K230	uc002zsz.5	P42356	OTTHUMG00000167440	ENST00000572273.1:c.460A>G	22.37:g.21174084T>C	ENSP00000458238:p.Ile154Val					PI4KA_uc010gsq.1_Missense_Mutation_p.I212V	p.I154V	NM_058004	NP_477352	P42356	PI4KA_HUMAN	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)		6	691	-	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	154					Q7Z625|Q9UPG2	Missense_Mutation	SNP	ENST00000572273.1	37	c.460A>G		.	.	.	.	.	.	.	.	.	.	T	7.151	0.583781	0.13749	.	.	ENSG00000241973	ENST00000255882	.	.	.	5.19	0.414	0.16406	.	0.644189	0.16507	N	0.211411	T	0.22244	0.0536	N	0.02539	-0.55	0.53688	D	0.99997	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.03887	-1.0995	9	0.24483	T	0.36	-22.4589	7.7057	0.28648	0.0:0.5241:0.0:0.4759	.	212;154	D3DX33;P42356	.;PI4KA_HUMAN	V	154	.	ENSP00000255882:I154V	I	-	1	0	PI4KA	19504084	0.964000	0.33143	0.859000	0.33776	0.818000	0.46254	1.092000	0.30927	0.352000	0.24053	-0.321000	0.08615	ATC		0.507	PI4KA-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_058004		70	160	0	0	0	0.00361	0	70	160				
IGLL3P	91353	broad.mit.edu	37	22	25715839	25715839	+	IGR	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr22:25715839G>A								RP3-462D8.2 (37581 upstream) : LRP5L (31548 downstream)														p.G154E(1)									TTCTATCTGGGAATCTTGACG	0.582																																							uc003abr.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(460-462)GGA>GAA		immunoglobulin lambda-like polypeptide 3							145.0	126.0	133.0					22																	25715839		2201	4300	6501	SO:0001628	intergenic_variant	91353							g.chr22:25715839G>A																													22.37:g.25715839G>A							p.G154E	NM_001013618	NP_001013640					2	561	+									Missense_Mutation	SNP		37	c.461G>A																																																																																				0	0.582									7	132	0	0	0	0.00308	0	7	132				
DMC1	11144	broad.mit.edu	37	22	38962738	38962738	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr22:38962738C>T	ENST00000216024.2	-	4	376	c.100G>A	c.(100-102)Gtg>Atg	p.V34M	DMC1_ENST00000428462.2_Missense_Mutation_p.V34M|DMC1_ENST00000464842.1_5'Flank	NM_007068.2	NP_008999.2	Q14565	DMC1_HUMAN	DNA meiotic recombinase 1	34					female gamete generation (GO:0007292)|male meiosis I (GO:0007141)|meiotic nuclear division (GO:0007126)|oocyte maturation (GO:0001556)|ovarian follicle development (GO:0001541)|reciprocal meiotic recombination (GO:0007131)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|synapsis (GO:0007129)	chromosome (GO:0005694)|chromosome, telomeric region (GO:0000781)|condensed nuclear chromosome (GO:0000794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)	p.V34M(2)		large_intestine(5)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	11	Melanoma(58;0.0286)					ATGTCAGCCACGTTCTGTAAA	0.428								Homologous recombination																															uc003avz.1		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)	ovary(1)	1						c.(100-102)GTG>ATG	Homologous_recombination	DMC1 dosage suppressor of mck1 homolog							101.0	83.0	89.0					22																	38962738		2203	4300	6503	SO:0001583	missense	11144				reciprocal meiotic recombination	condensed nuclear chromosome	ATP binding|DNA binding|DNA-dependent ATPase activity|protein binding	g.chr22:38962738C>T	D63882	CCDS13973.1, CCDS63477.1	22q13.1	2013-05-02	2013-05-02		ENSG00000100206	ENSG00000100206			2927	protein-coding gene	gene with protein product		602721	"""DMC1 (dosage suppressor of mck1, yeast homolog) meiosis-specific homologous recombination"", ""DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (yeast)"""			8602360, 8590282, 17541404	Standard	NM_007068		Approved	LIM15	uc003avz.2	Q14565	OTTHUMG00000151088	ENST00000216024.2:c.100G>A	22.37:g.38962738C>T	ENSP00000216024:p.Val34Met					DMC1_uc011anv.1_Missense_Mutation_p.V34M|DMC1_uc003awa.1_Missense_Mutation_p.V34M	p.V34M	NM_007068	NP_008999	Q14565	DMC1_HUMAN			4	275	-	Melanoma(58;0.0286)		34					A8K9A2|B4DMW6|Q08AI1|Q99498|Q9UH11	Missense_Mutation	SNP	ENST00000216024.2	37	c.100G>A	CCDS13973.1	.	.	.	.	.	.	.	.	.	.	C	10.44	1.351895	0.24512	.	.	ENSG00000100206	ENST00000216024;ENST00000428462;ENST00000439567;ENST00000366173;ENST00000415483	T;T;T;T	0.41065	1.01;1.01;1.01;1.01	5.55	3.48	0.39840	DNA repair Rad51/transcription factor NusA, alpha-helical (1);	0.228444	0.47455	N	0.000240	T	0.31918	0.0812	L	0.33753	1.03	0.43214	D	0.995088	B;B;B	0.15473	0.013;0.002;0.013	B;B;B	0.15052	0.012;0.002;0.012	T	0.09530	-1.0670	10	0.48119	T	0.1	-15.9562	11.5963	0.50975	0.0:0.8552:0.0:0.1448	.	34;34;34	B4DMW6;Q8IYL1;Q14565	.;.;DMC1_HUMAN	M	34	ENSP00000216024:V34M;ENSP00000412703:V34M;ENSP00000391385:V34M;ENSP00000410808:V34M	ENSP00000216024:V34M	V	-	1	0	DMC1	37292684	0.821000	0.29204	0.889000	0.34880	0.874000	0.50279	1.464000	0.35288	0.891000	0.36235	-0.137000	0.14449	GTG		0.428	DMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321246.2	NM_007068		4	43	0	0	0	0.009096	0	4	43				
TAB1	10454	broad.mit.edu	37	22	39811578	39811578	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr22:39811578C>G	ENST00000216160.6	+	3	306	c.244C>G	c.(244-246)Cag>Gag	p.Q82E	TAB1_ENST00000331454.3_Missense_Mutation_p.Q82E	NM_006116.2	NP_006107.1	Q15750	TAB1_HUMAN	TGF-beta activated kinase 1/MAP3K7 binding protein 1	82	PP2C-like.				activation of MAPK activity (GO:0000187)|activation of MAPKKK activity (GO:0000185)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart morphogenesis (GO:0003007)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|lung development (GO:0030324)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|protein complex (GO:0043234)	catalytic activity (GO:0003824)|enzyme activator activity (GO:0008047)|kinase activator activity (GO:0019209)	p.Q82E(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(8)|urinary_tract(1)	14						CTTCGTGGCCCAGCGGCTGTC	0.632																																							uc003axt.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(244-246)CAG>GAG		mitogen-activated protein kinase kinase kinase 7							78.0	71.0	74.0					22																	39811578		2203	4300	6503	SO:0001583	missense	10454				activation of MAPK activity|activation of MAPKKK activity|I-kappaB kinase/NF-kappaB cascade|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane	catalytic activity|protein binding	g.chr22:39811578C>G	U49928	CCDS13992.1, CCDS13993.1	22q13.1	2010-02-05	2010-02-05	2010-02-05	ENSG00000100324	ENSG00000100324			18157	protein-coding gene	gene with protein product	"""TAK1-binding protein 1"", ""mitogen-activated protein kinase kinase kinase 7 interacting protein 1"""	602615	"""mitogen-activated protein kinase kinase kinase 7 interacting protein 1"""	MAP3K7IP1		8638164, 10187861	Standard	NM_153497		Approved		uc003axt.3	Q15750	OTTHUMG00000151102	ENST00000216160.6:c.244C>G	22.37:g.39811578C>G	ENSP00000216160:p.Gln82Glu					TAB1_uc003axr.2_Missense_Mutation_p.Q158E|TAB1_uc011aok.1_5'UTR|TAB1_uc003axu.1_Missense_Mutation_p.Q82E	p.Q82E	NM_006116	NP_006107	Q15750	TAB1_HUMAN			3	293	+			82			PP2C-like.		Q2PP09|Q8IZW2	Missense_Mutation	SNP	ENST00000216160.6	37	c.244C>G	CCDS13993.1	.	.	.	.	.	.	.	.	.	.	C	13.51	2.258744	0.39896	.	.	ENSG00000100324	ENST00000216160;ENST00000331454	T;T	0.08720	3.06;3.06	5.47	5.47	0.80525	Protein phosphatase 2C-like (4);	0.000000	0.85682	D	0.000000	T	0.07593	0.0191	L	0.29908	0.895	0.51482	D	0.999921	B;B;B	0.14805	0.011;0.0;0.002	B;B;B	0.20577	0.03;0.002;0.008	T	0.34129	-0.9841	10	0.18710	T	0.47	-27.2957	14.053	0.64749	0.0:0.8496:0.1504:0.0	.	82;82;226	Q15750-2;Q15750;Q59FT7	.;TAB1_HUMAN;.	E	82	ENSP00000216160:Q82E;ENSP00000333049:Q82E	ENSP00000216160:Q82E	Q	+	1	0	TAB1	38141524	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	5.128000	0.64733	2.567000	0.86603	0.655000	0.94253	CAG		0.632	TAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321313.1	NM_153497		25	45	0	0	0	0.00333	0	25	45				
TEF	7008	broad.mit.edu	37	22	41790242	41790242	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr22:41790242C>G	ENST00000266304.4	+	3	734	c.618C>G	c.(616-618)caC>caG	p.H206Q	TEF_ENST00000406644.3_Missense_Mutation_p.H176Q	NM_003216.3	NP_003207.1	Q10587	TEF_HUMAN	thyrotrophic embryonic factor	206	Pro-rich (proline/acidic region (PAR)).				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H206Q(1)		kidney(1)|large_intestine(2)|lung(2)|ovary(1)	6						CTCGGAAGCACAAGTTTGCTG	0.542																																							uc003azy.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(616-618)CAC>CAG		thyrotrophic embryonic factor isoform 1							63.0	61.0	62.0					22																	41790242		2203	4300	6503	SO:0001583	missense	7008				rhythmic process	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr22:41790242C>G		CCDS14014.1, CCDS46716.1	22q13.2	2013-01-10			ENSG00000167074	ENSG00000167074		"""basic leucine zipper proteins"""	11722	protein-coding gene	gene with protein product		188595				7835883, 15665112	Standard	NM_001145398		Approved	KIAA1655	uc003azy.4	Q10587	OTTHUMG00000150968	ENST00000266304.4:c.618C>G	22.37:g.41790242C>G	ENSP00000266304:p.His206Gln					TEF_uc003azx.2_Missense_Mutation_p.H176Q|TEF_uc011apa.1_Missense_Mutation_p.H211Q	p.H206Q	NM_003216	NP_003207	Q10587	TEF_HUMAN			3	704	+			206			Pro-rich (proline/acidic region (PAR)).		B0QYS8|B2RC22|Q15729|Q7Z3J7|Q8IU94|Q96TG4	Missense_Mutation	SNP	ENST00000266304.4	37	c.618C>G	CCDS14014.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.2|22.2	4.263161|4.263161	0.80358|0.80358	.|.	.|.	ENSG00000167074|ENSG00000167074	ENST00000406644;ENST00000433913;ENST00000266304|ENST00000413942	.|.	.|.	.|.	6.08|6.08	5.07|5.07	0.68467|0.68467	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.64371|0.64371	0.2592|0.2592	M|M	0.61703|0.61703	1.905|1.905	0.53688|0.53688	D|D	0.999979|0.999979	D;D;D|.	0.89917|.	0.983;1.0;1.0|.	P;D;D|.	0.97110|.	0.889;0.999;1.0|.	T|T	0.63637|0.63637	-0.6592|-0.6592	9|5	0.56958|.	D|.	0.05|.	-28.2529|-28.2529	11.3864|11.3864	0.49787|0.49787	0.0:0.8627:0.0:0.1373|0.0:0.8627:0.0:0.1373	.|.	211;206;176|.	B4DIH3;Q10587;Q10587-2|.	.;TEF_HUMAN;.|.	Q|R	176;176;206|172	.|.	ENSP00000266304:H206Q|.	H|T	+|+	3|2	2|0	TEF|TEF	40120188|40120188	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	2.486000|2.486000	0.45259|0.45259	1.594000|1.594000	0.50039|0.50039	0.655000|0.655000	0.94253|0.94253	CAC|ACA		0.542	TEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320692.1	NM_003216		14	89	0	0	0	0.001855	0	14	89				
CHL1	10752	broad.mit.edu	37	3	447225	447226	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr3:447225_447226GG>TT	ENST00000256509.2	+	28	4148_4149	c.3506_3507GG>TT	c.(3505-3507)aGG>aTT	p.R1169I	CHL1_ENST00000397491.2_Missense_Mutation_p.R1153I	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	535					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.R1169I(1)		NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		TCCCTTAATAGGGATATGCAGC	0.406																																							uc003bou.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(5)|central_nervous_system(4)|large_intestine(2)|ovary(1)	12						c.(3457-3459)AGG>ATT		cell adhesion molecule with homology to L1CAM																																				SO:0001583	missense	10752				axon guidance|cell adhesion|signal transduction	integral to membrane|plasma membrane|proteinaceous extracellular matrix		g.chr3:447225_447226GG>TT	AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	Exception_encountered	3.37:g.447225_447226delinsTT	ENSP00000256509:p.Arg1169Ile					CHL1_uc003bot.2_Missense_Mutation_p.R1169I|CHL1_uc011asi.1_Missense_Mutation_p.R1116I	p.R1153I	NM_006614	NP_006605	O00533	CHL1_HUMAN		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)	27	3729_3730	+		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)	1153			Cytoplasmic (Potential).		Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	DNP	ENST00000256509.2	37	c.3458_3459GG>TT	CCDS2556.1																																																																																				0.406	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207155.2	NM_006614		10	58	0	0	0	0.004672	0	10	58				
TBC1D5	9779	broad.mit.edu	37	3	17208305	17208305	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr3:17208305C>A	ENST00000253692.7	-	21	3712	c.2048G>T	c.(2047-2049)gGc>gTc	p.G683V	TBC1D5_ENST00000429383.4_Missense_Mutation_p.G683V|TBC1D5_ENST00000414318.2_5'UTR|TBC1D5_ENST00000446818.2_Missense_Mutation_p.G705V	NM_014744.2	NP_055559.1	Q92609	TBCD5_HUMAN	TBC1 domain family, member 5	683						retromer complex (GO:0030904)	Rab GTPase activator activity (GO:0005097)	p.G683V(1)		NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	36						TTGGCCTCGGCCCTGGCCCTG	0.522																																							uc003cbf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2047-2049)GGC>GTC		TBC1 domain family, member 5 isoform b							96.0	87.0	91.0					3																	17208305		2203	4300	6503	SO:0001583	missense	9779					intracellular	protein binding|Rab GTPase activator activity	g.chr3:17208305C>A	D86965	CCDS33714.1, CCDS46770.1	3p24.3	2013-07-09			ENSG00000131374	ENSG00000131374			19166	protein-coding gene	gene with protein product		615740				19531583	Standard	NM_014744		Approved	KIAA0210	uc003cbe.3	Q92609	OTTHUMG00000155488	ENST00000253692.7:c.2048G>T	3.37:g.17208305C>A	ENSP00000253692:p.Gly683Val					TBC1D5_uc010heu.2_Missense_Mutation_p.G270V|TBC1D5_uc010hev.2_Missense_Mutation_p.G705V|TBC1D5_uc003cbe.2_Missense_Mutation_p.G683V	p.G683V	NM_014744	NP_055559	Q92609	TBCD5_HUMAN			21	3713	-			683					A6NP25|C9JP52	Missense_Mutation	SNP	ENST00000253692.7	37	c.2048G>T	CCDS33714.1	.	.	.	.	.	.	.	.	.	.	C	12.26	1.885332	0.33255	.	.	ENSG00000131374	ENST00000253692;ENST00000429383;ENST00000446818	T;T;T	0.29142	1.58;1.58;1.58	3.33	-0.419	0.12340	.	0.367176	0.28182	N	0.016296	T	0.12646	0.0307	N	0.08118	0	0.09310	N	1	B;B;B	0.17038	0.019;0.02;0.02	B;B;B	0.12156	0.004;0.007;0.007	T	0.14896	-1.0456	10	0.59425	D	0.04	-1.2149	5.2012	0.15264	0.0:0.5385:0.2331:0.2285	.	705;683;683	C9JP52;B9A6K1;Q92609	.;.;TBCD5_HUMAN	V	683;683;705	ENSP00000253692:G683V;ENSP00000398127:G683V;ENSP00000402935:G705V	ENSP00000253692:G683V	G	-	2	0	TBC1D5	17183309	0.946000	0.32159	0.006000	0.13384	0.567000	0.35839	1.024000	0.30077	0.066000	0.16515	0.561000	0.74099	GGC		0.522	TBC1D5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340301.3	NM_014744		23	58	1	0	1.9806e-07	0.002299	2.52976e-07	23	58				
TBC1D5	9779	broad.mit.edu	37	3	17299997	17299997	+	Splice_Site	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr3:17299997C>A	ENST00000253692.7	-	16	2996		c.e16+1		TBC1D5_ENST00000429383.4_Splice_Site|TBC1D5_ENST00000414318.2_Splice_Site|TBC1D5_ENST00000429924.2_Splice_Site|TBC1D5_ENST00000446818.2_Splice_Site	NM_014744.2	NP_055559.1	Q92609	TBCD5_HUMAN	TBC1 domain family, member 5							retromer complex (GO:0030904)	Rab GTPase activator activity (GO:0005097)	p.?(1)		NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	36						AGGGGACTTACCGGCTTTTAT	0.333																																							uc003cbf.2		NA																	1	Unknown(1)		lung(1)	ovary(1)	1						c.e16+1		TBC1 domain family, member 5 isoform b							127.0	139.0	135.0					3																	17299997		2203	4300	6503	SO:0001630	splice_region_variant	9779					intracellular	protein binding|Rab GTPase activator activity	g.chr3:17299997C>A	D86965	CCDS33714.1, CCDS46770.1	3p24.3	2013-07-09			ENSG00000131374	ENSG00000131374			19166	protein-coding gene	gene with protein product		615740				19531583	Standard	NM_014744		Approved	KIAA0210	uc003cbe.3	Q92609	OTTHUMG00000155488	ENST00000253692.7:c.1331+1G>T	3.37:g.17299997C>A						TBC1D5_uc010heu.2_Splice_Site_p.R31_splice|TBC1D5_uc010hev.2_Splice_Site_p.R444_splice|TBC1D5_uc003cbe.2_Splice_Site_p.R444_splice|TBC1D5_uc010hew.1_Splice_Site_p.R396_splice	p.R444_splice	NM_014744	NP_055559	Q92609	TBCD5_HUMAN			16	2996	-								A6NP25|C9JP52	Splice_Site	SNP	ENST00000253692.7	37	c.1331_splice	CCDS33714.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.649099	0.87958	.	.	ENSG00000131374	ENST00000253692;ENST00000429383;ENST00000446818;ENST00000429924	.	.	.	5.77	5.77	0.91146	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.9859	0.97351	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TBC1D5	17275001	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	6.168000	0.71908	2.729000	0.93468	0.655000	0.94253	.		0.333	TBC1D5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340301.3	NM_014744	Intron	57	187	1	0	6.60958e-23	0.00361	1.07982e-22	57	187				
KCNH8	131096	broad.mit.edu	37	3	19575253	19575253	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr3:19575253T>A	ENST00000328405.2	+	16	3252	c.2986T>A	c.(2986-2988)Tcc>Acc	p.S996T		NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	996	Ser-rich.				potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)	p.S996T(1)		NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						TTATTCACCTTCCCACTACCA	0.478																																					NSCLC(124;1625 1765 8018 24930 42026)	NSCLC(124;1625 1765 8018 24930 42026)	uc003cbk.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(4)|ovary(1)	5						c.(2986-2988)TCC>ACC		potassium voltage-gated channel, subfamily H,							203.0	201.0	201.0					3																	19575253		2203	4300	6503	SO:0001583	missense	131096					integral to membrane	two-component sensor activity	g.chr3:19575253T>A	AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.2986T>A	3.37:g.19575253T>A	ENSP00000328813:p.Ser996Thr					KCNH8_uc010hex.1_Missense_Mutation_p.S457T	p.S996T	NM_144633	NP_653234	Q96L42	KCNH8_HUMAN			16	3181	+			996			Ser-rich.|Cytoplasmic (Potential).		B7Z2I7|Q59GQ6	Missense_Mutation	SNP	ENST00000328405.2	37	c.2986T>A	CCDS2632.1	.	.	.	.	.	.	.	.	.	.	T	12.94	2.089869	0.36855	.	.	ENSG00000183960	ENST00000328405	D	0.98617	-5.03	5.58	-1.24	0.09435	.	0.576468	0.11892	U	0.519471	D	0.95686	0.8597	L	0.27053	0.805	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	D	0.86404	0.1744	9	.	.	.	.	17.234	0.86992	0.0:0.0:0.6816:0.3184	.	996	Q96L42	KCNH8_HUMAN	T	996	ENSP00000328813:S996T	.	S	+	1	0	KCNH8	19550257	0.806000	0.28996	0.951000	0.38953	0.961000	0.63080	1.084000	0.30828	0.123000	0.18342	0.533000	0.62120	TCC		0.478	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252139.2	NM_144633		14	247	0	0	0	0.00245	0	14	247				
EFHB	151651	broad.mit.edu	37	3	19938246	19938246	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr3:19938246T>C	ENST00000295824.9	-	9	1819	c.1658A>G	c.(1657-1659)cAt>cGt	p.H553R	EFHB_ENST00000498089.1_5'UTR|EFHB_ENST00000344838.4_Missense_Mutation_p.H423R	NM_144715.3	NP_653316.3	Q8N7U6	EFHB_HUMAN	EF-hand domain family, member B	553							calcium ion binding (GO:0005509)	p.H553R(1)|p.H551R(1)		breast(2)|endometrium(4)|kidney(1)|lung(17)|prostate(1)|urinary_tract(1)	26						CTTCAGGTGATGCCGAACTGC	0.458																																							uc003cbl.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1657-1659)CAT>CGT		EF hand domain family, member B							95.0	84.0	88.0					3																	19938246		2203	4300	6503	SO:0001583	missense	151651				signal transduction	proteinaceous extracellular matrix	calcium ion binding	g.chr3:19938246T>C	AK122616	CCDS33715.2	3p24.3	2014-07-18			ENSG00000163576	ENSG00000163576		"""EF-hand domain containing"""	26330	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 21"""					12477932	Standard	NM_144715		Approved	FLJ25200, CFAP21	uc003cbl.4	Q8N7U6	OTTHUMG00000150505	ENST00000295824.9:c.1658A>G	3.37:g.19938246T>C	ENSP00000295824:p.His553Arg					EFHB_uc003cbm.2_Missense_Mutation_p.H423R	p.H553R	NM_144715	NP_653316	Q8N7U6	EFHB_HUMAN			9	1854	-			553					A6ND25|A8MPR3|Q6ZWK9|Q8IV58|Q96LQ6	Missense_Mutation	SNP	ENST00000295824.9	37	c.1658A>G	CCDS33715.2	.	.	.	.	.	.	.	.	.	.	T	8.997	0.979263	0.18812	.	.	ENSG00000163576	ENST00000295824;ENST00000344838;ENST00000389256	T;T;T	0.24151	1.87;1.91;2.19	5.38	5.38	0.77491	SPARC/Testican, calcium-binding domain (1);	0.194186	0.37095	N	0.002244	T	0.26011	0.0634	L	0.46157	1.445	0.39592	D	0.969608	P;B	0.41848	0.763;0.038	B;B	0.39738	0.308;0.032	T	0.04467	-1.0949	9	.	.	.	-13.5173	15.687	0.77418	0.0:0.0:0.0:1.0	.	423;553	Q8N7U6-3;Q8N7U6	.;EFHB_HUMAN	R	553;423;553	ENSP00000295824:H553R;ENSP00000342263:H423R;ENSP00000373908:H553R	.	H	-	2	0	EFHB	19913250	1.000000	0.71417	0.038000	0.18304	0.001000	0.01503	7.478000	0.81082	2.171000	0.68590	0.533000	0.62120	CAT		0.458	EFHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318673.2	NM_144715		21	71	0	0	0	0.00333	0	21	71				
TMPPE	643853	broad.mit.edu	37	3	33134917	33134917	+	Silent	SNP	C	C	T	rs368289263		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr3:33134917C>T	ENST00000342462.4	-	2	961	c.771G>A	c.(769-771)acG>acA	p.T257T	GLB1_ENST00000307377.8_Intron|GLB1_ENST00000399402.3_Intron|GLB1_ENST00000445488.2_Intron|GLB1_ENST00000307363.5_Intron|TMPPE_ENST00000416695.2_Silent_p.T120T	NM_001039770.2	NP_001034859.2	Q6ZT21	TMPPE_HUMAN	transmembrane protein with metallophosphoesterase domain	257						integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)	p.T257T(1)		breast(1)|large_intestine(5)|lung(6)|prostate(1)	13						GAGCGACAGCCGTCCGCAGGA	0.537																																							uc003cfk.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(769-771)ACG>ACA		transmembrane protein with		C	,,,,	2,4404	4.2+/-10.8	0,2,2201	115.0	100.0	105.0		,771,,,360	-10.5	0.0	3		105	0,8600		0,0,4300	no	intron,coding-synonymous,intron,intron,coding-synonymous	GLB1,TMPPE	NM_000404.2,NM_001039770.2,NM_001079811.1,NM_001135602.1,NM_001136238.1	,,,,	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	,,,,	,257/454,,,120/317	33134917	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	643853					integral to membrane	metal ion binding	g.chr3:33134917C>T	AK126979	CCDS33732.1, CCDS46786.1	3p22.3	2014-02-12	2009-02-24		ENSG00000188167	ENSG00000188167			33865	protein-coding gene	gene with protein product							Standard	NM_001039770		Approved	FLJ45032	uc003cfk.2	Q6ZT21	OTTHUMG00000155779	ENST00000342462.4:c.771G>A	3.37:g.33134917C>T						GLB1_uc003cfh.1_Intron|GLB1_uc003cfi.1_Intron|GLB1_uc003cfj.1_Intron|GLB1_uc011axk.1_Intron|TMPPE_uc011axl.1_Silent_p.T120T	p.T257T	NM_001039770	NP_001034859	Q6ZT21	TMPPE_HUMAN			2	962	-			257					B2RNG5|Q6ZRG1	Silent	SNP	ENST00000342462.4	37	c.771G>A	CCDS33732.1																																																																																				0.537	TMPPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341566.1	NM_001039770		6	122	0	0	0	0.00308	0	6	122				
ZNF445	353274	broad.mit.edu	37	3	44496938	44496938	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr3:44496938T>C	ENST00000396077.2	-	3	451	c.104A>G	c.(103-105)tAt>tGt	p.Y35C	ZNF445_ENST00000425708.2_Missense_Mutation_p.Y35C	NM_181489.5	NP_852466.1	P59923	ZN445_HUMAN	zinc finger protein 445	35					transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Y35C(1)		breast(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|skin(3)	31				KIRC - Kidney renal clear cell carcinoma(197;0.0514)|Kidney(197;0.0646)		CACTGGAGTATAGCTTTCATC	0.592																																							uc003cnf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(103-105)TAT>TGT		zinc finger protein 445							88.0	85.0	86.0					3																	44496938		2203	4300	6503	SO:0001583	missense	353274				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr3:44496938T>C	AY262260	CCDS2713.1	3p21.32	2013-01-09	2003-10-07		ENSG00000185219	ENSG00000185219		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	21018	protein-coding gene	gene with protein product			"""zinc finger protein 168"""	ZNF168		7814019	Standard	NM_181489		Approved	ZKSCAN15, ZSCAN47	uc003cnf.2	P59923	OTTHUMG00000133042	ENST00000396077.2:c.104A>G	3.37:g.44496938T>C	ENSP00000379387:p.Tyr35Cys					ZNF445_uc011azv.1_Missense_Mutation_p.Y35C|ZNF445_uc011azw.1_Missense_Mutation_p.Y35C	p.Y35C	NM_181489	NP_852466	P59923	ZN445_HUMAN		KIRC - Kidney renal clear cell carcinoma(197;0.0514)|Kidney(197;0.0646)	3	452	-			35					Q3MJD1	Missense_Mutation	SNP	ENST00000396077.2	37	c.104A>G	CCDS2713.1	.	.	.	.	.	.	.	.	.	.	T	8.630	0.893564	0.17613	.	.	ENSG00000185219	ENST00000425708;ENST00000396077;ENST00000340674;ENST00000430301	T;T	0.05717	3.4;3.4	4.02	1.49	0.22878	.	0.421576	0.17736	N	0.163738	T	0.03959	0.0111	N	0.24115	0.695	0.09310	N	0.999999	B;B	0.14012	0.009;0.009	B;B	0.12156	0.007;0.007	T	0.37911	-0.9685	10	0.48119	T	0.1	.	3.5513	0.07847	0.1933:0.1066:0.0:0.7	.	35;35	B7ZKX2;P59923	.;ZN445_HUMAN	C	35;35;32;34	ENSP00000413073:Y35C;ENSP00000379387:Y35C	ENSP00000342436:Y32C	Y	-	2	0	ZNF445	44471942	0.000000	0.05858	0.095000	0.20976	0.816000	0.46133	-0.619000	0.05572	0.313000	0.23062	0.460000	0.39030	TAT		0.592	ZNF445-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256647.2	NM_181489		33	96	0	0	0	0.002836	0	33	96				
PLXNB1	5364	broad.mit.edu	37	3	48459666	48459666	+	Silent	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr3:48459666C>A	ENST00000358536.4	-	15	3425	c.3156G>T	c.(3154-3156)gtG>gtT	p.V1052V	PLXNB1_ENST00000358459.4_Silent_p.V869V|PLXNB1_ENST00000456774.1_Silent_p.V869V|PLXNB1_ENST00000296440.6_Silent_p.V1052V|PLXNB1_ENST00000448774.2_Intron|PLXNB1_ENST00000465117.1_5'Flank	NM_002673.4	NP_002664.2	O43157	PLXB1_HUMAN	plexin B1	1052					axon guidance (GO:0007411)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast proliferation (GO:0033689)|neuron projection morphogenesis (GO:0048812)|ossification involved in bone maturation (GO:0043931)|positive regulation of axonogenesis (GO:0050772)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	GTPase activating protein binding (GO:0032794)|receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)	p.V1052V(1)		NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		CCTCCCGGGTCACACAACGTG	0.622																																							uc003csw.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|pancreas(1)|breast(1)|skin(1)	5						c.(3154-3156)GTG>GTT		plexin B1 precursor							80.0	57.0	65.0					3																	48459666		2203	4300	6503	SO:0001819	synonymous_variant	5364				axon guidance|cell migration|intracellular signal transduction|regulation of cell shape|regulation of cytoskeleton organization|regulation of small GTPase mediated signal transduction|semaphorin-plexin signaling pathway	extracellular region|integral to plasma membrane|intracellular|semaphorin receptor complex	GTPase activator activity|semaphorin receptor activity|semaphorin receptor binding	g.chr3:48459666C>A	X87904	CCDS2765.1	3p21.31	2008-07-18			ENSG00000164050	ENSG00000164050		"""Plexins"""	9103	protein-coding gene	gene with protein product		601053		PLXN5		8570614, 11035813	Standard	XM_005265234		Approved	SEP, KIAA0407	uc003csw.2	O43157	OTTHUMG00000133527	ENST00000358536.4:c.3156G>T	3.37:g.48459666C>A						PLXNB1_uc003csu.2_Silent_p.V869V|PLXNB1_uc003csx.2_Silent_p.V1052V|PLXNB1_uc010hjx.1_RNA|PLXNB1_uc003csy.1_5'Flank	p.V1052V	NM_002673	NP_002664	O43157	PLXB1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)	15	3426	-			1052			Extracellular (Potential).		A6H8Y2|Q6NY20|Q9UIV7|Q9UJ92|Q9UJ93	Silent	SNP	ENST00000358536.4	37	c.3156G>T	CCDS2765.1																																																																																				0.622	PLXNB1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344454.1	NM_002673		5	23	1	0	1.23904e-05	0.000602	1.45374e-05	5	23				
LAMB2	3913	broad.mit.edu	37	3	49161443	49161443	+	Missense_Mutation	SNP	C	C	A	rs547349180		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr3:49161443C>A	ENST00000418109.1	-	25	3679	c.3515G>T	c.(3514-3516)cGc>cTc	p.R1172L	LAMB2_ENST00000305544.4_Missense_Mutation_p.R1172L|LAMB2_ENST00000464891.1_5'Flank	NM_002292.3	NP_002283.3	P55268	LAMB2_HUMAN	laminin, beta 2 (laminin S)	1172	Laminin EGF-like 13. {ECO:0000255|PROSITE-ProRule:PRU00460}.				astrocyte development (GO:0014002)|axon extension involved in regeneration (GO:0048677)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|metanephric glomerular basement membrane development (GO:0072274)|metanephric glomerular visceral epithelial cell development (GO:0072249)|neuromuscular junction development (GO:0007528)|retina development in camera-type eye (GO:0060041)|Schwann cell development (GO:0014044)|visual perception (GO:0007601)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-11 complex (GO:0043260)|laminin-3 complex (GO:0005608)|synapse (GO:0045202)	structural molecule activity (GO:0005198)	p.R1172L(1)		NS(1)|breast(1)|endometrium(15)|kidney(3)|large_intestine(6)|lung(21)|ovary(4)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CTGGTCACAGCGCACACCAGA	0.582																																							uc003cwe.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(3514-3516)CGC>CTC		laminin, beta 2 precursor							59.0	56.0	57.0					3																	49161443		2203	4300	6503	SO:0001583	missense	3913				cell adhesion	laminin-11 complex|laminin-3 complex	structural molecule activity	g.chr3:49161443C>A		CCDS2789.1	3p21.3-p21.2	2013-03-01			ENSG00000172037	ENSG00000172037		"""Laminins"""	6487	protein-coding gene	gene with protein product	"""laminin S"""	150325		LAMS		2922051, 10393422	Standard	NM_002292		Approved		uc003cwe.3	P55268	OTTHUMG00000156807	ENST00000418109.1:c.3515G>T	3.37:g.49161443C>A	ENSP00000388325:p.Arg1172Leu						p.R1172L	NM_002292	NP_002283	P55268	LAMB2_HUMAN		BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	24	3814	-			1172			Laminin EGF-like 13.		Q16321	Missense_Mutation	SNP	ENST00000418109.1	37	c.3515G>T	CCDS2789.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.686845	0.88639	.	.	ENSG00000172037	ENST00000418109;ENST00000305544	T;T	0.62788	-0.0;-0.0	5.84	5.84	0.93424	EGF-like, laminin (4);EGF-like region, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.82582	0.5068	M	0.85197	2.74	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.83379	0.0011	10	0.56958	D	0.05	.	20.1278	0.97990	0.0:1.0:0.0:0.0	.	1172	P55268	LAMB2_HUMAN	L	1172	ENSP00000388325:R1172L;ENSP00000307156:R1172L	ENSP00000307156:R1172L	R	-	2	0	LAMB2	49136447	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.029000	0.70895	2.768000	0.95171	0.561000	0.74099	CGC		0.582	LAMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345939.1	NM_002292		9	47	1	0	1.58986e-06	0.008291	1.92151e-06	9	47				
VPRBP	9730	broad.mit.edu	37	3	51475837	51475837	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr3:51475837C>A	ENST00000335891.5	-	6	599	c.590G>T	c.(589-591)aGt>aTt	p.S197I				Q9Y4B6	VPRBP_HUMAN	Vpr (HIV-1) binding protein	197	Protein kinase-like.				B cell differentiation (GO:0030183)|cell competition in a multicellular organism (GO:0035212)|histone H2A-T120 phosphorylation (GO:1990245)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone kinase activity (H2A-T120 specific) (GO:1990244)	p.S197I(1)		breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)		CTTCCGTGGACTGGGACGCTT	0.498																																							uc003dbe.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(589-591)AGT>ATT		HIV-1 Vpr binding protein							148.0	149.0	149.0					3																	51475837		1959	4160	6119	SO:0001583	missense	9730				interspecies interaction between organisms	cytoplasm|nucleus	protein binding	g.chr3:51475837C>A	AB018343	CCDS74943.1, CCDS74944.1	3p21.2	2011-06-17			ENSG00000145041	ENSG00000145041		"""DDB1 and CUL4 associated factors"""	30911	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 1"""					8195203, 11223251	Standard	NM_014703		Approved	KIAA0800, MGC102804, DCAF1	uc003dbe.2	Q9Y4B6	OTTHUMG00000156895	ENST00000335891.5:c.590G>T	3.37:g.51475837C>A	ENSP00000338857:p.Ser197Ile					VPRBP_uc003dbg.1_Missense_Mutation_p.S197I	p.S197I	NM_014703	NP_055518	Q9Y4B6	VPRBP_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)	8	758	-			197					Q2YD74|Q8TBD9|Q9HCA1|Q9UG37	Missense_Mutation	SNP	ENST00000335891.5	37	c.590G>T		.	.	.	.	.	.	.	.	.	.	C	23.6	4.440878	0.83993	.	.	ENSG00000145041	ENST00000335891;ENST00000504652	T;T	0.56776	0.44;0.89	5.96	5.96	0.96718	Armadillo-type fold (1);	0.039734	0.85682	D	0.000000	T	0.38719	0.1051	N	0.08118	0	0.28563	N	0.911013	P	0.47191	0.891	B	0.41988	0.372	T	0.32188	-0.9916	10	0.37606	T	0.19	-17.3221	20.422	0.99049	0.0:1.0:0.0:0.0	.	197	Q9Y4B6	VPRBP_HUMAN	I	197	ENSP00000338857:S197I;ENSP00000421724:S197I	ENSP00000338857:S197I	S	-	2	0	VPRBP	51450877	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.737000	0.68606	2.832000	0.97577	0.655000	0.94253	AGT		0.498	VPRBP-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_014703		70	228	1	0	2.40041e-21	0.00361	3.85438e-21	70	228				
ALAS1	211	broad.mit.edu	37	3	52236729	52236729	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr3:52236729G>T	ENST00000394965.2	+	4	766	c.406G>T	c.(406-408)Gaa>Taa	p.E136*	ALAS1_ENST00000310271.2_Nonsense_Mutation_p.E136*|ALAS1_ENST00000469224.1_Nonsense_Mutation_p.E136*|ALAS1_ENST00000484952.1_Nonsense_Mutation_p.E136*	NM_000688.5	NP_000679.1	P13196	HEM1_HUMAN	aminolevulinate, delta-, synthase 1	136					cellular lipid metabolic process (GO:0044255)|heme biosynthetic process (GO:0006783)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	5-aminolevulinate synthase activity (GO:0003870)|pyridoxal phosphate binding (GO:0030170)	p.E136*(1)		endometrium(3)|kidney(3)|large_intestine(7)|liver(2)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	23				BRCA - Breast invasive adenocarcinoma(193;5.13e-05)|Kidney(197;0.000583)|KIRC - Kidney renal clear cell carcinoma(197;0.000751)	Glycine(DB00145)	GGATGTGCAGGAAATGAATGC	0.488																																							uc003dcy.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)	3						c.(406-408)GAA>TAA		5-aminolevulinate synthase 1 precursor	Glycine(DB00145)|Pyridoxal Phosphate(DB00114)						62.0	50.0	54.0					3																	52236729		2203	4300	6503	SO:0001587	stop_gained	211				heme biosynthetic process	mitochondrial matrix	5-aminolevulinate synthase activity|pyridoxal phosphate binding|transferase activity, transferring nitrogenous groups	g.chr3:52236729G>T	X56351	CCDS2847.1	3p21	2004-11-18			ENSG00000023330	ENSG00000023330	2.3.1.37		396	protein-coding gene	gene with protein product		125290		ALAS3, ALAS			Standard	NM_000688		Approved		uc003dcz.2	P13196	OTTHUMG00000158108	ENST00000394965.2:c.406G>T	3.37:g.52236729G>T	ENSP00000378416:p.Glu136*					ALAS1_uc003dcx.1_Nonsense_Mutation_p.E136*|ALAS1_uc003dcz.1_Nonsense_Mutation_p.E136*|ALAS1_uc011bec.1_Nonsense_Mutation_p.E153*	p.E136*	NM_000688	NP_000679	P13196	HEM1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;5.13e-05)|Kidney(197;0.000583)|KIRC - Kidney renal clear cell carcinoma(197;0.000751)	4	743	+			136						Nonsense_Mutation	SNP	ENST00000394965.2	37	c.406G>T	CCDS2847.1	.	.	.	.	.	.	.	.	.	.	G	39	7.412185	0.98269	.	.	ENSG00000023330	ENST00000469224;ENST00000394965;ENST00000310271;ENST00000484952	.	.	.	5.23	5.23	0.72850	.	0.049827	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07990	T	0.79	-21.5274	12.1811	0.54211	0.0783:0.0:0.9217:0.0	.	.	.	.	X	136	.	ENSP00000309259:E136X	E	+	1	0	ALAS1	52211769	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.013000	0.88655	2.445000	0.82738	0.655000	0.94253	GAA		0.488	ALAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350207.1			14	47	1	0	1.5842e-08	0.001855	2.09487e-08	14	47				
ASB14	142686	broad.mit.edu	37	3	57311911	57311911	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr3:57311911A>T	ENST00000389601.3	-	10	1589	c.1469T>A	c.(1468-1470)cTc>cAc	p.L490H	ASB14_ENST00000487349.1_Missense_Mutation_p.L490H	NM_130387.5	NP_569058.1	A6NK59	ASB14_HUMAN	ankyrin repeat and SOCS box containing 14	490					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)			p.L205H(1)|p.L490H(1)		central_nervous_system(1)|large_intestine(1)|lung(1)|skin(2)	5				KIRC - Kidney renal clear cell carcinoma(284;0.011)|Kidney(284;0.0127)		CTTTCCAGAGAGATGTTGCAG	0.383																																							uc003diq.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(976-978)CTC>CAC		ankyrin repeat and SOCS box-containing 14							74.0	68.0	70.0					3																	57311911		2203	4300	6503	SO:0001583	missense	142686				intracellular signal transduction			g.chr3:57311911A>T	AF403032	CCDS46856.1, CCDS46856.2	3p21.1	2013-01-10	2011-01-25			ENSG00000239388		"""Ankyrin repeat domain containing"""	19766	protein-coding gene	gene with protein product			"""ankyrin repeat and SOCS box-containing 14"""			12076535	Standard	NM_130387		Approved	DKFZp313L0121	uc021wzs.1	A6NK59		ENST00000389601.3:c.1469T>A	3.37:g.57311911A>T	ENSP00000374252:p.Leu490His					ASB14_uc003dip.1_Missense_Mutation_p.L205H	p.L326H	NM_001142733	NP_001136205	A6NK59	ASB14_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.011)|Kidney(284;0.0127)	9	1565	-			490					C9JX97|Q8WXK2|Q92816	Missense_Mutation	SNP	ENST00000389601.3	37	c.977T>A		.	.	.	.	.	.	.	.	.	.	A	16.17	3.048619	0.55110	.	.	ENSG00000239388	ENST00000487349;ENST00000389601;ENST00000438870	T;T	0.69685	-0.37;-0.42	5.13	3.97	0.46021	.	.	.	.	.	T	0.65533	0.2700	M	0.61703	1.905	0.45227	D	0.998234	D;P	0.55800	0.973;0.538	B;P	0.45681	0.301;0.49	T	0.66516	-0.5904	9	0.49607	T	0.09	.	11.0203	0.47713	0.9271:0.0:0.0729:0.0	.	490;205	C9JX97;A6NK59-2	.;.	H	490;490;326	ENSP00000419199:L490H;ENSP00000374252:L490H	ENSP00000374252:L490H	L	-	2	0	ASB14	57286951	1.000000	0.71417	0.999000	0.59377	0.875000	0.50365	6.832000	0.75329	0.968000	0.38212	-0.410000	0.06199	CTC		0.383	ASB14-201	KNOWN	basic	protein_coding	protein_coding				12	56	0	0	0	0.000978	0	12	56				
LRIG1	26018	broad.mit.edu	37	3	66502041	66502041	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr3:66502041C>A	ENST00000273261.3	-	3	831	c.307G>T	c.(307-309)Gag>Tag	p.E103*	LRIG1_ENST00000383703.3_Nonsense_Mutation_p.E103*	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	103					innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)		p.E103*(1)		NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		GCTGTCAACTCATTATTATTG	0.438																																							uc003dmx.2		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(3)|ovary(2)	5						c.(307-309)GAG>TAG		leucine-rich repeats and immunoglobulin-like							166.0	148.0	154.0					3																	66502041		2203	4300	6503	SO:0001587	stop_gained	26018					integral to membrane		g.chr3:66502041C>A	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.307G>T	3.37:g.66502041C>A	ENSP00000273261:p.Glu103*					LRIG1_uc010hnz.2_5'UTR|LRIG1_uc010hoa.2_Nonsense_Mutation_p.E103*	p.E103*	NM_015541	NP_056356	Q96JA1	LRIG1_HUMAN		BRCA - Breast invasive adenocarcinoma(55;0.00047)	3	321	-		Lung NSC(201;0.0101)	103			Extracellular (Potential).|LRR 2.		Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Nonsense_Mutation	SNP	ENST00000273261.3	37	c.307G>T	CCDS33783.1	.	.	.	.	.	.	.	.	.	.	C	38	7.034607	0.98017	.	.	ENSG00000144749	ENST00000273261;ENST00000383703;ENST00000383702	.	.	.	5.91	5.03	0.67393	.	0.120855	0.53938	D	0.000057	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	13.0652	0.59030	0.0:0.8389:0.1611:0.0	.	.	.	.	X	103;103;30	.	ENSP00000273261:E103X	E	-	1	0	LRIG1	66584731	1.000000	0.71417	0.993000	0.49108	0.253000	0.25986	2.651000	0.46674	1.494000	0.48533	0.655000	0.94253	GAG		0.438	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541		22	93	1	0	0.00188189	0.001882	0.00202222	22	93				
FOXP1	27086	broad.mit.edu	37	3	71015118	71015118	+	Silent	SNP	T	T	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr3:71015118T>C	ENST00000318789.4	-	20	2337	c.1812A>G	c.(1810-1812)gaA>gaG	p.E604E	FOXP1_ENST00000468577.1_Silent_p.E540E|FOXP1_ENST00000498215.1_Silent_p.E604E|FOXP1_ENST00000484350.1_Silent_p.E528E|FOXP1_ENST00000475937.1_Silent_p.E604E|FOXP1_ENST00000491238.1_Silent_p.E606E|FOXP1_ENST00000493089.1_Silent_p.E603E	NM_001244810.1|NM_001244813.1|NM_032682.5	NP_001231739.1|NP_001231742.1|NP_116071.2	Q9H334	FOXP1_HUMAN	forkhead box P1	604					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E604E(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		Lung NSC(201;4.62e-05)|Prostate(10;0.0181)|Hepatocellular(537;0.186)|Myeloproliferative disorder(1037;0.209)		BRCA - Breast invasive adenocarcinoma(55;1.17e-05)|Epithelial(33;1.39e-05)|LUSC - Lung squamous cell carcinoma(21;2.35e-05)|Lung(16;4.26e-05)		CGTTCAGCTCTTCCCGTATTG	0.517			T	PAX5	ALL																																		uc003dol.2		NA		Dom	yes		3	3p14.1	27086	T	forkhead box P1			L	PAX5		ALL		1	Substitution - coding silent(1)		lung(1)	ovary(1)|lung(1)	2						c.(1810-1812)GAA>GAG		forkhead box P1 isoform 1							263.0	223.0	236.0					3																	71015118		2203	4300	6503	SO:0001819	synonymous_variant	27086				cardiac muscle cell differentiation|embryo development|immunoglobulin V(D)J recombination|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of immunoglobulin production|positive regulation of mesenchymal cell proliferation|pre-B cell differentiation|regulation of sequence-specific DNA binding transcription factor activity|skeletal muscle tissue development|smooth muscle tissue development	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding	g.chr3:71015118T>C	AF146696	CCDS2914.1, CCDS33785.1, CCDS58837.1, CCDS58838.1, CCDS58839.1, CCDS74963.1, CCDS74964.1	3p14.1	2008-07-18			ENSG00000114861	ENSG00000114861		"""Forkhead boxes"""	3823	protein-coding gene	gene with protein product	"""fork head-related protein like B"", ""glutamine-rich factor 1"", ""PAX5/FOXP1 fusion protein"""	605515				8265594, 11751404	Standard	NM_032682		Approved	QRF1, 12CC4, HSPC215, hFKH1B	uc003doj.3	Q9H334	OTTHUMG00000158803	ENST00000318789.4:c.1812A>G	3.37:g.71015118T>C						FOXP1_uc003dom.2_Silent_p.E528E|FOXP1_uc003don.2_RNA|FOXP1_uc003doo.2_Silent_p.E603E|FOXP1_uc003dop.2_Silent_p.E604E|FOXP1_uc003doq.1_Intron|FOXP1_uc003doi.2_Silent_p.E504E|FOXP1_uc003doj.2_Silent_p.E504E|FOXP1_uc003dok.2_Silent_p.E417E	p.E604E	NM_032682	NP_116071	Q9H334	FOXP1_HUMAN		BRCA - Breast invasive adenocarcinoma(55;1.17e-05)|Epithelial(33;1.39e-05)|LUSC - Lung squamous cell carcinoma(21;2.35e-05)|Lung(16;4.26e-05)	16	2135	-		Lung NSC(201;4.62e-05)|Prostate(10;0.0181)|Hepatocellular(537;0.186)|Myeloproliferative disorder(1037;0.209)	604					A3QVP8|B3KV70|G5E9V8|Q8NAN6|Q9BSG9|Q9H332|Q9H333|Q9P0R1	Silent	SNP	ENST00000318789.4	37	c.1812A>G	CCDS2914.1																																																																																				0.517	FOXP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352250.1	NM_032682		13	182	0	0	0	0.001855	0	13	182				
PDZRN3	23024	broad.mit.edu	37	3	73432636	73432636	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr3:73432636C>A	ENST00000263666.4	-	10	3195	c.3081G>T	c.(3079-3081)aaG>aaT	p.K1027N	PDZRN3_ENST00000479530.1_Missense_Mutation_p.K744N|PDZRN3_ENST00000462146.2_Missense_Mutation_p.K684N|PDZRN3_ENST00000466348.1_5'Flank|PDZRN3_ENST00000466780.1_Missense_Mutation_p.K684N|PDZRN3_ENST00000535920.1_Missense_Mutation_p.K749N	NM_015009.1	NP_055824.1	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	1027					neuromuscular junction development (GO:0007528)|protein ubiquitination (GO:0016567)	neuromuscular junction (GO:0031594)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.K1027N(1)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(31)|ovary(4)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		TATTCCTCTTCTTCATCATCT	0.458																																							uc003dpl.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(2)|ovary(2)|skin(2)|large_intestine(1)	7						c.(3079-3081)AAG>AAT		PDZ domain containing ring finger 3							257.0	261.0	260.0					3																	73432636		2203	4300	6503	SO:0001583	missense	23024						ubiquitin-protein ligase activity|zinc ion binding	g.chr3:73432636C>A	AB029018	CCDS33789.1	3p14.1	2013-01-09	2008-08-14		ENSG00000121440	ENSG00000121440		"""RING-type (C3HC4) zinc fingers"""	17704	protein-coding gene	gene with protein product	"""likely ortholog of mouse semaF cytoplasmic domain associated protein 3"""	609729				10470851	Standard	XM_005264718		Approved	KIAA1095, SEMACAP3, LNX3	uc003dpl.1	Q9UPQ7	OTTHUMG00000158865	ENST00000263666.4:c.3081G>T	3.37:g.73432636C>A	ENSP00000263666:p.Lys1027Asn					PDZRN3_uc011bgh.1_Missense_Mutation_p.K684N|PDZRN3_uc010hoe.1_Missense_Mutation_p.K725N|PDZRN3_uc011bgf.1_Missense_Mutation_p.K744N|PDZRN3_uc011bgg.1_Missense_Mutation_p.K747N	p.K1027N	NM_015009	NP_055824	Q9UPQ7	PZRN3_HUMAN		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)	10	3177	-		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)	1027					A7MCZ6|Q8N2N7|Q96CC2|Q9NSQ2	Missense_Mutation	SNP	ENST00000263666.4	37	c.3081G>T	CCDS33789.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.23|13.23	2.176037|2.176037	0.38413|0.38413	.|.	.|.	ENSG00000121440|ENSG00000121440	ENST00000263666;ENST00000535920;ENST00000462146;ENST00000466780;ENST00000479530|ENST00000494559	T;T;T;T;T|.	0.38077|.	1.16;1.16;1.16;1.16;1.16|.	5.66|5.66	5.66|5.66	0.87406|0.87406	.|.	0.097237|.	0.64402|.	D|.	0.000001|.	T|T	0.77552|0.77552	0.4147|0.4147	M|M	0.76328|0.76328	2.33|2.33	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;0.999;1.0;0.999|.	D;D;D;D|.	0.83275|.	0.993;0.996;0.984;0.994|.	T|T	0.76435|0.76435	-0.2960|-0.2960	10|5	0.87932|.	D|.	0|.	.|.	19.3333|19.3333	0.94303|0.94303	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	749;744;744;1027|.	F5H8I9;B7ZAG0;B7Z5X9;Q9UPQ7|.	.;.;.;PZRN3_HUMAN|.	N|I	1027;749;684;684;744|343	ENSP00000263666:K1027N;ENSP00000442026:K749N;ENSP00000418168:K684N;ENSP00000418484:K684N;ENSP00000418624:K744N|.	ENSP00000263666:K1027N|.	K|R	-|-	3|2	2|0	PDZRN3|PDZRN3	73515326|73515326	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.023000|0.023000	0.10783|0.10783	2.533000|2.533000	0.45667|0.45667	2.659000|2.659000	0.90383|0.90383	0.655000|0.655000	0.94253|0.94253	AAG|AGA		0.458	PDZRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352460.1	XM_041363		76	237	1	0	7.97268e-31	0.00361	1.35777e-30	76	237				
ROBO2	6092	broad.mit.edu	37	3	77147283	77147283	+	Silent	SNP	C	C	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr3:77147283C>T	ENST00000461745.1	+	2	1080	c.180C>T	c.(178-180)ccC>ccT	p.P60P	ROBO2_ENST00000487694.3_Silent_p.P76P|ROBO2_ENST00000332191.8_Silent_p.P60P	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	60	Ig-like C2-type 1.				apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)	p.P76P(1)|p.P60P(1)		NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		GGCCAACGCCCACCATTGAGT	0.592																																							uc003dpy.3		NA																	2	Substitution - coding silent(2)		lung(2)	lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11						c.(178-180)CCC>CCT		roundabout, axon guidance receptor, homolog 2							59.0	65.0	63.0					3																	77147283		1988	4174	6162	SO:0001819	synonymous_variant	6092				apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding	g.chr3:77147283C>T	AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.180C>T	3.37:g.77147283C>T						ROBO2_uc003dpz.2_Silent_p.P60P|ROBO2_uc011bgj.1_RNA|ROBO2_uc011bgk.1_Silent_p.P60P	p.P60P	NM_002942	NP_002933	Q9HCK4	ROBO2_HUMAN		Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)	2	823	+			60			Ig-like C2-type 1.|Extracellular (Potential).		O43608|Q19AB4|Q19AB5	Silent	SNP	ENST00000461745.1	37	c.180C>T	CCDS43109.1																																																																																				0.592	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	XM_031246		12	36	0	0	0	0.000978	0	12	36				
ROBO2	6092	broad.mit.edu	37	3	77542523	77542523	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr3:77542523C>G	ENST00000461745.1	+	5	1696	c.796C>G	c.(796-798)Cca>Gca	p.P266A	ROBO2_ENST00000487694.3_Missense_Mutation_p.P282A|ROBO2_ENST00000332191.8_Missense_Mutation_p.P266A	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	266	Ig-like C2-type 3.				apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)	p.P282A(1)|p.P266A(1)		NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		TGCAGACTTGCCAAGAGGAAG	0.418																																							uc003dpy.3		NA																	2	Substitution - Missense(2)		lung(2)	lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11						c.(796-798)CCA>GCA		roundabout, axon guidance receptor, homolog 2							102.0	95.0	98.0					3																	77542523		1913	4145	6058	SO:0001583	missense	6092				apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding	g.chr3:77542523C>G	AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.796C>G	3.37:g.77542523C>G	ENSP00000417164:p.Pro266Ala					ROBO2_uc003dpz.2_Missense_Mutation_p.P266A|ROBO2_uc011bgj.1_RNA|ROBO2_uc011bgk.1_Missense_Mutation_p.P266A	p.P266A	NM_002942	NP_002933	Q9HCK4	ROBO2_HUMAN		Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)	5	1439	+			266			Ig-like C2-type 3.|Extracellular (Potential).		O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	ENST00000461745.1	37	c.796C>G	CCDS43109.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.166841	0.78339	.	.	ENSG00000185008	ENST00000487694;ENST00000403211;ENST00000343019;ENST00000461745;ENST00000332191	T;T;T	0.65364	-0.15;-0.15;-0.15	5.95	5.08	0.68730	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.43747	U	0.000522	T	0.71492	0.3346	L	0.60845	1.875	0.47374	D	0.999406	P;P;P	0.51537	0.946;0.933;0.946	P;P;P	0.55999	0.646;0.514;0.789	T	0.78427	-0.2208	9	0.59425	D	0.04	.	15.1528	0.72713	0.0:0.9325:0.0:0.0675	.	282;266;266	Q19AB5;F8W703;Q9HCK4	.;.;ROBO2_HUMAN	A	282;282;282;266;266	ENSP00000417335:P282A;ENSP00000417164:P266A;ENSP00000327536:P266A	ENSP00000327536:P266A	P	+	1	0	ROBO2	77625213	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	4.819000	0.62664	1.528000	0.49103	0.491000	0.48974	CCA		0.418	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	XM_031246		8	53	0	0	0	0.004482	0	8	53				
OR5K4	403278	broad.mit.edu	37	3	98072805	98072805	+	Silent	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr3:98072805G>T	ENST00000354924.2	+	1	108	c.108G>T	c.(106-108)ctG>ctT	p.L36L	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005517.1	NP_001005517.1	A6NMS3	OR5K4_HUMAN	olfactory receptor, family 5, subfamily K, member 4	36						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L36L(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(13)|upper_aerodigestive_tract(1)	21						CCATCTATCTGGTCACCATGG	0.458																																							uc011bgv.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(106-108)CTG>CTT		olfactory receptor, family 5, subfamily K,							225.0	219.0	221.0					3																	98072805		2203	4300	6503	SO:0001819	synonymous_variant	403278				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr3:98072805G>T		CCDS33802.1	3q11.2	2013-09-23			ENSG00000196098	ENSG00000196098		"""GPCR / Class A : Olfactory receptors"""	31291	protein-coding gene	gene with protein product							Standard	NM_001005517		Approved		uc011bgv.2	A6NMS3	OTTHUMG00000160081	ENST00000354924.2:c.108G>T	3.37:g.98072805G>T							p.L36L	NM_001005517	NP_001005517	A6NMS3	OR5K4_HUMAN			1	108	+			36			Helical; Name=1; (Potential).			Silent	SNP	ENST00000354924.2	37	c.108G>T	CCDS33802.1																																																																																				0.458	OR5K4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359114.1			17	285	1	0	4.14922e-12	0.004007	5.97913e-12	17	285				
OR5K1	26339	broad.mit.edu	37	3	98188738	98188738	+	Silent	SNP	T	T	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr3:98188738T>A	ENST00000332650.5	+	1	415	c.318T>A	c.(316-318)acT>acA	p.T106T		NM_001004736.2	NP_001004736.2	Q8NHB7	OR5K1_HUMAN	olfactory receptor, family 5, subfamily K, member 1	106						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T106T(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(21)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TTCTTTGCACTGTGGAAACTG	0.438																																							uc003dsm.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)	1						c.(316-318)ACT>ACA		olfactory receptor, family 5, subfamily K,							113.0	121.0	118.0					3																	98188738		2203	4297	6500	SO:0001819	synonymous_variant	26339				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr3:98188738T>A	X64984	CCDS43115.1	3q11.2	2013-09-23			ENSG00000232382	ENSG00000232382		"""GPCR / Class A : Olfactory receptors"""	8349	protein-coding gene	gene with protein product						1370859	Standard	NM_001004736		Approved	HTPCRX10, HSHTPCRX10	uc003dsm.3	Q8NHB7	OTTHUMG00000160048	ENST00000332650.5:c.318T>A	3.37:g.98188738T>A							p.T106T	NM_001004736	NP_001004736	Q8NHB7	OR5K1_HUMAN			1	318	+			106			Helical; Name=3; (Potential).		B9EGY5|Q6IF46	Silent	SNP	ENST00000332650.5	37	c.318T>A	CCDS43115.1																																																																																				0.438	OR5K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359019.1			22	219	0	0	0	0.001882	0	22	219				
CPNE4	131034	broad.mit.edu	37	3	131388541	131388542	+	Missense_Mutation	DNP	CC	CC	AA	rs372564382		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr3:131388541_131388542CC>AA	ENST00000512055.1	-	11	2784_2785	c.658_659GG>TT	c.(658-660)GGa>TTa	p.G220L	CPNE4_ENST00000511604.1_Missense_Mutation_p.G220L|CPNE4_ENST00000502818.1_Missense_Mutation_p.G238L|CPNE4_ENST00000429747.1_Missense_Mutation_p.G220L|CPNE4_ENST00000512332.1_Missense_Mutation_p.G238L			Q96A23	CPNE4_HUMAN	copine IV	220	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.					extracellular vesicular exosome (GO:0070062)		p.G220L(1)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|liver(1)|lung(16)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	39						GTCTGGGTCTCCGCTGCATAGA	0.386																																							uc003eok.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						c.(658-660)GGA>TTA		copine IV																																				SO:0001583	missense	131034							g.chr3:131388541_131388542CC>AA	H29499	CCDS3072.1, CCDS75010.1	3q22.1	2014-09-04			ENSG00000196353	ENSG00000196353			2317	protein-coding gene	gene with protein product	"""copine 8"""	604208				9430674, 12670487	Standard	XM_005247107		Approved	COPN4, CPN4	uc003eok.3	Q96A23	OTTHUMG00000159631	ENST00000512055.1:c.658_659delinsAA	3.37:g.131388541_131388542delinsAA	ENSP00000421705:p.Gly220Leu					CPNE4_uc011blq.1_Missense_Mutation_p.G238L|CPNE4_uc003eol.2_Missense_Mutation_p.G238L|CPNE4_uc003eom.2_Missense_Mutation_p.G220L	p.G220L	NM_130808	NP_570720	Q96A23	CPNE4_HUMAN			7	1093_1094	-			220			C2 2.		D3DNC5|Q8TEX1	Missense_Mutation	DNP	ENST00000512055.1	37	c.658_659GG>TT	CCDS3072.1																																																																																				0.386	CPNE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356583.4	NM_130808		67	137	0	0	0	0.004672	0	67	137				
TRIM42	287015	broad.mit.edu	37	3	140401341	140401341	+	Missense_Mutation	SNP	C	C	A	rs149207203	byFrequency	TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr3:140401341C>A	ENST00000286349.3	+	2	570	c.379C>A	c.(379-381)Cag>Aag	p.Q127K		NM_152616.4	NP_689829.3	Q8IWZ5	TRI42_HUMAN	tripartite motif containing 42	127						intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.Q127K(2)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(11)|lung(33)|ovary(2)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						CAGCGATACCCAGGTGGATGA	0.562																																							uc003eto.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(2)|skin(2)|upper_aerodigestive_tract(1)|breast(1)|central_nervous_system(1)	7						c.(379-381)CAG>AAG		tripartite motif-containing 42							91.0	91.0	91.0					3																	140401341		2203	4300	6503	SO:0001583	missense	287015					intracellular	zinc ion binding	g.chr3:140401341C>A	AF521868	CCDS3113.1	3q23	2014-02-17	2011-01-25		ENSG00000155890	ENSG00000155890		"""Tripartite motif containing / Tripartite motif containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	19014	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 40"""		"""tripartite motif-containing 42"""				Standard	NM_152616		Approved	FLJ40097, PPP1R40	uc003eto.2	Q8IWZ5	OTTHUMG00000160170	ENST00000286349.3:c.379C>A	3.37:g.140401341C>A	ENSP00000286349:p.Gln127Lys						p.Q127K	NM_152616	NP_689829	Q8IWZ5	TRI42_HUMAN			2	570	+			127					A1L4B4|Q8N832|Q8NDL3	Missense_Mutation	SNP	ENST00000286349.3	37	c.379C>A	CCDS3113.1	.	.	.	.	.	.	.	.	.	.	C	14.65	2.599872	0.46318	.	.	ENSG00000155890	ENST00000286349	T	0.17370	2.28	5.25	3.29	0.37713	.	2.213330	0.01639	N	0.023932	T	0.14399	0.0348	N	0.22421	0.69	0.09310	N	1	B	0.25667	0.131	B	0.21546	0.035	T	0.23583	-1.0184	10	0.22109	T	0.4	-43.1992	10.1488	0.42780	0.3631:0.6369:0.0:0.0	.	127	Q8IWZ5	TRI42_HUMAN	K	127	ENSP00000286349:Q127K	ENSP00000286349:Q127K	Q	+	1	0	TRIM42	141884031	0.007000	0.16637	0.008000	0.14137	0.475000	0.33008	1.611000	0.36879	1.327000	0.45338	0.561000	0.74099	CAG		0.562	TRIM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359531.2	NM_152616		19	52	1	0	1.2644e-06	0.010504	1.54814e-06	19	52				
CCDC39	339829	broad.mit.edu	37	3	180377471	180377471	+	Missense_Mutation	SNP	G	G	T	rs200422639	byFrequency	TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr3:180377471G>T	ENST00000442201.2	-	5	722	c.603C>A	c.(601-603)agC>agA	p.S201R	CCDC39_ENST00000273654.4_Missense_Mutation_p.S285R	NM_181426.1	NP_852091.1	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	201					axonemal dynein complex assembly (GO:0070286)|cilium-dependent cell motility (GO:0060285)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)		p.S285R(1)|p.S201R(1)		NS(1)|breast(1)|endometrium(4)|large_intestine(9)|lung(22)|ovary(6)|prostate(2)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			TAACCTGTGCGCTTATAGTCT	0.328																																							uc010hxe.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)	4						c.(601-603)AGC>AGA		coiled-coil domain containing 39							184.0	177.0	179.0					3																	180377471		1819	4077	5896	SO:0001583	missense	339829				axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium axoneme|cytoplasm|cytoskeleton		g.chr3:180377471G>T	BC047103	CCDS46964.1	3q26.33	2012-07-27			ENSG00000145075	ENSG00000145075			25244	protein-coding gene	gene with protein product		613798				21131972	Standard	NM_181426		Approved	DKFZp434A128, CILD14, FAP59	uc010hxe.3	Q9UFE4	OTTHUMG00000157857	ENST00000442201.2:c.603C>A	3.37:g.180377471G>T	ENSP00000405708:p.Ser201Arg					CCDC39_uc003fkn.2_RNA	p.S201R	NM_181426	NP_852091	Q9UFE4	CCD39_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)		5	718	-	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		201			Potential.		B4E2H1	Missense_Mutation	SNP	ENST00000442201.2	37	c.603C>A	CCDS46964.1	.	.	.	.	.	.	.	.	.	.	G	14.35	2.509098	0.44660	.	.	ENSG00000145075	ENST00000273654;ENST00000442201	T;T	0.22539	1.95;1.95	5.87	3.47	0.39725	.	0.134693	0.64402	D	0.000003	T	0.32823	0.0842	M	0.64997	1.995	0.31382	N	0.67891	D	0.64830	0.994	D	0.64144	0.922	T	0.25779	-1.0122	10	0.18276	T	0.48	-22.232	6.6025	0.22708	0.7548:0.0:0.1305:0.1147	.	201	Q9UFE4	CCD39_HUMAN	R	285;201	ENSP00000273654:S285R;ENSP00000405708:S201R	ENSP00000273654:S285R	S	-	3	2	CCDC39	181860165	1.000000	0.71417	0.997000	0.53966	0.463000	0.32649	1.173000	0.31920	1.059000	0.40554	-0.324000	0.08512	AGC		0.328	CCDC39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349783.3	XM_291028		7	94	1	0	1.26484e-09	0.00308	1.71701e-09	7	94				
PDE6B	5158	broad.mit.edu	37	4	619514	619514	+	Silent	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr4:619514C>A	ENST00000496514.1	+	1	120	c.99C>A	c.(97-99)gcC>gcA	p.A33A	PDE6B_ENST00000255622.6_Silent_p.A33A			P35913	PDE6B_HUMAN	phosphodiesterase 6B, cGMP-specific, rod, beta	33				AAA -> GRG (in Ref. 1; CAA44569, 2; CAA46932 and 3; AAB22690). {ECO:0000305}.	cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)	p.A33A(2)		NS(1)|breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|urinary_tract(1)	30					Caffeine(DB00201)	AGAATGTGGCCGCGGCCTGCG	0.652																																					GBM(71;463 1194 9848 25922 46834)	GBM(71;463 1194 9848 25922 46834)	uc003gap.2		NA																	2	Substitution - coding silent(2)		lung(1)|prostate(1)		0						c.(97-99)GCC>GCA		phosphodiesterase 6B isoform 1							53.0	57.0	56.0					4																	619514		2203	4300	6503	SO:0001819	synonymous_variant	5158				cytosolic calcium ion homeostasis|GMP metabolic process|phototransduction, visible light|platelet activation|visual perception	cytosol|membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding	g.chr4:619514C>A	BC000249	CCDS33932.1, CCDS46993.1, CCDS54703.1	4p16.3	2014-01-28	2008-07-31		ENSG00000133256	ENSG00000133256	3.1.4.17	"""Phosphodiesterases"""	8786	protein-coding gene	gene with protein product	"""congenital stationary night blindness 3, autosomal dominant"""	180072		PDEB		1313787	Standard	NM_001145292		Approved	CSNB3, rd1, RP40, CSNBAD2	uc003gap.3	P35913	OTTHUMG00000159909	ENST00000496514.1:c.99C>A	4.37:g.619514C>A						PDE6B_uc003gao.3_Silent_p.A33A	p.A33A	NM_000283	NP_000274	P35913	PDE6B_HUMAN			1	152	+			33	AAA -> GRG (in Ref. 1; CAA44569, 2; CAA46932 and 3; AAB22690).				B7Z9T9|E7ETT3|Q53XN5|Q9BWH5|Q9UD49	Silent	SNP	ENST00000496514.1	37	c.99C>A	CCDS33932.1																																																																																				0.652	PDE6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358109.1	NM_000283		14	48	1	0	1.3612e-06	0.003163	1.65584e-06	14	48				
PSAPL1	768239	broad.mit.edu	37	4	7435591	7435591	+	Nonsense_Mutation	SNP	A	A	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr4:7435591A>T	ENST00000319098.4	-	1	1109	c.1016T>A	c.(1015-1017)tTg>tAg	p.L339*	SORCS2_ENST00000511199.1_Intron|SORCS2_ENST00000329016.9_Intron|SORCS2_ENST00000507866.2_Intron	NM_001085382.1	NP_001078851.1	Q6NUJ1	SAPL1_HUMAN	prosaposin-like 1 (gene/pseudogene)	339	Saposin B-type 3. {ECO:0000255|PROSITE- ProRule:PRU00415}.				sphingolipid metabolic process (GO:0006665)	extracellular region (GO:0005576)|lysosome (GO:0005764)		p.L339*(1)|p.L71*(1)		lung(4)	4						GGTGTCCACCAAGATGATGCA	0.582																																							uc011bwj.1		NA																	2	Substitution - Nonsense(2)		lung(2)		0						c.(1015-1017)TTG>TAG		prosaposin-like protein 1							103.0	108.0	107.0					4																	7435591		2174	4271	6445	SO:0001587	stop_gained	768239				sphingolipid metabolic process	extracellular region|lysosome		g.chr4:7435591A>T	DQ991252	CCDS47009.1	4p16.1	2010-03-12	2010-03-12			ENSG00000178597			33131	protein-coding gene	gene with protein product			"""prosaposin-like 1"""				Standard	NM_001085382		Approved		uc011bwj.2	Q6NUJ1		ENST00000319098.4:c.1016T>A	4.37:g.7435591A>T	ENSP00000317445:p.Leu339*					SORCS2_uc003gkb.3_Intron|SORCS2_uc011bwi.1_Intron	p.L339*	NM_001085382	NP_001078851	Q6NUJ1	SAPL1_HUMAN			1	1110	-			339			Saposin B-type 3.		A0A184|Q8N7T4	Nonsense_Mutation	SNP	ENST00000319098.4	37	c.1016T>A	CCDS47009.1	.	.	.	.	.	.	.	.	.	.	A	18.69	3.677738	0.68042	.	.	ENSG00000178597	ENST00000319098	.	.	.	3.8	3.8	0.43715	.	0.269962	0.31772	N	0.007087	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.2988	9.1003	0.36664	1.0:0.0:0.0:0.0	.	.	.	.	X	339	.	ENSP00000317445:L339X	L	-	2	0	PSAPL1	7486492	0.759000	0.28416	0.066000	0.19879	0.051000	0.14879	3.828000	0.55753	1.726000	0.51525	0.459000	0.35465	TTG		0.582	PSAPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358859.1			32	77	0	0	0	0.002096	0	32	77				
BOD1L1	259282	broad.mit.edu	37	4	13605874	13605874	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr4:13605874C>A	ENST00000040738.5	-	10	2785	c.2650G>T	c.(2650-2652)Gat>Tat	p.D884Y		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	884	Lys-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)	p.D884Y(1)									AAATTACTATCCATGTTAGTG	0.373																																							uc003gmz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|breast(1)	6						c.(2650-2652)GAT>TAT		biorientation of chromosomes in cell division							107.0	105.0	105.0					4																	13605874		2203	4299	6502	SO:0001583	missense	259282						DNA binding	g.chr4:13605874C>A	AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.2650G>T	4.37:g.13605874C>A	ENSP00000040738:p.Asp884Tyr					BOD1L_uc010idr.1_Missense_Mutation_p.D221Y	p.D884Y	NM_148894	NP_683692	Q8NFC6	BOD1L_HUMAN			10	2767	-			884			Lys-rich.		Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	ENST00000040738.5	37	c.2650G>T	CCDS3411.2	.	.	.	.	.	.	.	.	.	.	C	10.13	1.265296	0.23136	.	.	ENSG00000038219	ENST00000040738	T	0.12039	2.72	5.53	5.53	0.82687	.	0.128995	0.35407	N	0.003230	T	0.34803	0.0910	M	0.61703	1.905	0.34023	D	0.65288	D	0.76494	0.999	D	0.64595	0.927	T	0.43065	-0.9414	10	0.87932	D	0	-1.9439	17.6339	0.88117	0.0:1.0:0.0:0.0	.	884	Q8NFC6	BOD1L_HUMAN	Y	884	ENSP00000040738:D884Y	ENSP00000040738:D884Y	D	-	1	0	BOD1L	13214972	0.993000	0.37304	0.079000	0.20413	0.003000	0.03518	4.114000	0.57858	2.603000	0.88011	0.650000	0.86243	GAT		0.373	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207321.1	NM_148894		11	71	1	0	3.07112e-06	0.000978	3.6801e-06	11	71				
GPR125	166647	broad.mit.edu	37	4	22390174	22390174	+	Silent	SNP	C	C	G	rs12700	byFrequency	TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr4:22390174C>G	ENST00000334304.5	-	19	3389	c.3120G>C	c.(3118-3120)gcG>gcC	p.A1040A	GPR125_ENST00000282943.5_5'UTR	NM_145290.3	NP_660333.2	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125	1040					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)	p.A1040A(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(33)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	56		Breast(46;0.198)				CCACGAAGAACGCACTGAAGC	0.468																																							uc003gqm.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(3118-3120)GCG>GCC		G protein-coupled receptor 125 precursor							105.0	96.0	99.0					4																	22390174		2203	4300	6503	SO:0001819	synonymous_variant	166647				neuropeptide signaling pathway	integral to membrane	G-protein coupled receptor activity	g.chr4:22390174C>G	AK095866	CCDS33964.1	4p15.31	2014-08-08			ENSG00000152990	ENSG00000152990		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"""	13839	protein-coding gene	gene with protein product		612303				12565841	Standard	NM_145290		Approved	FLJ38547, PGR21	uc003gqm.2	Q8IWK6	OTTHUMG00000160926	ENST00000334304.5:c.3120G>C	4.37:g.22390174C>G						GPR125_uc010ieo.1_Silent_p.A896A|GPR125_uc003gql.1_Silent_p.A167A	p.A1040A	NM_145290	NP_660333	Q8IWK6	GP125_HUMAN			19	3385	-		Breast(46;0.198)	1040			Helical; Name=7; (Potential).		Q6UXK9|Q86SQ5|Q8TC55	Silent	SNP	ENST00000334304.5	37	c.3120G>C	CCDS33964.1																																																																																				0.468	GPR125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362960.3			11	54	0	0	0	0.000978	0	11	54				
PPARGC1A	10891	broad.mit.edu	37	4	23814457	23814457	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr4:23814457C>G	ENST00000264867.2	-	10	2051	c.1932G>C	c.(1930-1932)agG>agC	p.R644S	PPARGC1A_ENST00000509702.1_5'UTR	NM_013261.3	NP_037393.1	Q9UBK2	PRGC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 alpha	644	Mediates interaction with RNF34. {ECO:0000269|PubMed:22064484}.				androgen metabolic process (GO:0008209)|androgen receptor signaling pathway (GO:0030521)|brown fat cell differentiation (GO:0050873)|cellular glucose homeostasis (GO:0001678)|cellular respiration (GO:0045333)|cellular response to fatty acid (GO:0071398)|cellular response to hypoxia (GO:0071456)|cellular response to nitrite (GO:0071250)|cellular response to oxidative stress (GO:0034599)|cellular response to thyroid hormone stimulus (GO:0097067)|cellular response to tumor necrosis factor (GO:0071356)|circadian regulation of gene expression (GO:0032922)|digestion (GO:0007586)|fatty acid oxidation (GO:0019395)|flavone metabolic process (GO:0051552)|galactose metabolic process (GO:0006012)|gluconeogenesis (GO:0006094)|mitochondrion organization (GO:0007005)|mRNA processing (GO:0006397)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of receptor activity (GO:2000272)|positive regulation of ATP biosynthetic process (GO:2001171)|positive regulation of cellular respiration (GO:1901857)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of histone acetylation (GO:0035066)|positive regulation of mitochondrial DNA metabolic process (GO:1901860)|positive regulation of mitochondrion organization (GO:0010822)|positive regulation of muscle tissue development (GO:1901863)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|regulation of circadian rhythm (GO:0042752)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|response to cold (GO:0009409)|response to epinephrine (GO:0071871)|response to leucine (GO:0043201)|response to muscle activity (GO:0014850)|response to norepinephrine (GO:0071873)|response to starvation (GO:0042594)|response to statin (GO:0036273)|RNA splicing (GO:0008380)|temperature homeostasis (GO:0001659)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytosol (GO:0005829)|DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.R644S(1)		central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|liver(1)|lung(24)|ovary(3)|skin(5)	51		Breast(46;0.0503)				CCCTCTTCAGCCTCTCGTGCT	0.448																																					Esophageal Squamous(29;694 744 13796 34866 44181)	Esophageal Squamous(29;694 744 13796 34866 44181)	uc003gqs.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(2)|kidney(2)|skin(2)	8						c.(1930-1932)AGG>AGC		peroxisome proliferator-activated receptor							189.0	176.0	181.0					4																	23814457		2203	4300	6503	SO:0001583	missense	10891				androgen receptor signaling pathway|brown fat cell differentiation|cellular glucose homeostasis|digestion|fatty acid oxidation|gluconeogenesis|mitochondrion organization|mRNA processing|neuron death|positive regulation of fatty acid oxidation|positive regulation of gluconeogenesis|positive regulation of histone acetylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|protein complex assembly|protein stabilization|response to muscle activity|response to starvation|RNA splicing|temperature homeostasis|transcription initiation from RNA polymerase II promoter	DNA-directed RNA polymerase II, core complex	androgen receptor binding|DNA binding|ligand-dependent nuclear receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|RNA binding|RNA polymerase II transcription cofactor activity|transcription factor binding	g.chr4:23814457C>G	AF106698	CCDS3429.1	4p15.1	2013-02-12	2006-10-17	2004-02-04	ENSG00000109819	ENSG00000109819		"""RNA binding motif (RRM) containing"""	9237	protein-coding gene	gene with protein product		604517	"""peroxisome proliferative activated receptor, gamma, coactivator 1"", ""peroxisome proliferative activated receptor, gamma, coactivator 1, alpha"""	PPARGC1		10585775	Standard	NM_013261		Approved	PGC1, PGC1A	uc003gqs.3	Q9UBK2	OTTHUMG00000097747	ENST00000264867.2:c.1932G>C	4.37:g.23814457C>G	ENSP00000264867:p.Arg644Ser					PPARGC1A_uc003gqt.2_RNA	p.R644S	NM_013261	NP_037393	Q9UBK2	PRGC1_HUMAN			10	2052	-		Breast(46;0.0503)	644					B7Z406|G8DM16|I3RTT5|I3RTT6|I3RTT7|I3RTT8|I3RTT9|Q3LIG1|Q4W5M7|Q9UN32	Missense_Mutation	SNP	ENST00000264867.2	37	c.1932G>C	CCDS3429.1	.	.	.	.	.	.	.	.	.	.	C	14.84	2.655072	0.47467	.	.	ENSG00000109819	ENST00000264867	T	0.26518	1.73	5.43	5.43	0.79202	.	0.043334	0.85682	D	0.000000	T	0.33440	0.0863	M	0.68317	2.08	0.80722	D	1	B	0.18013	0.025	B	0.18263	0.021	T	0.10177	-1.0641	10	0.54805	T	0.06	-3.6564	19.2596	0.93962	0.0:1.0:0.0:0.0	.	644	Q9UBK2	PRGC1_HUMAN	S	644	ENSP00000264867:R644S	ENSP00000264867:R644S	R	-	3	2	PPARGC1A	23423555	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.906000	0.39887	2.543000	0.85770	0.655000	0.94253	AGG		0.448	PPARGC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214976.1	NM_013261		25	144	0	0	0	0.003954	0	25	144				
SEPSECS	51091	broad.mit.edu	37	4	25125605	25125605	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr4:25125605G>C	ENST00000382103.2	-	11	1526	c.1454C>G	c.(1453-1455)gCt>gGt	p.A485G	SEPSECS_ENST00000515272.1_5'Flank|SEPSECS_ENST00000302922.3_Missense_Mutation_p.A406G	NM_016955.3	NP_058651.3	Q9HD40	SPCS_HUMAN	Sep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synthase	485	SLA/LP epitope.				selenocysteine incorporation (GO:0001514)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	pyridoxal phosphate binding (GO:0030170)|transferase activity, transferring selenium-containing groups (GO:0016785)|tRNA binding (GO:0000049)	p.A485G(1)|p.A406G(1)		endometrium(1)|large_intestine(4)|lung(2)|stomach(1)	8		Breast(46;0.173)				TAGTTTTAAAGCCATTTCTTC	0.353																																							uc003grg.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1453-1455)GCT>GGT		Sep (O-phosphoserine) tRNA:Sec (selenocysteine)	Pyridoxal Phosphate(DB00114)						243.0	226.0	232.0					4																	25125605		2203	4300	6503	SO:0001583	missense	51091				selenocysteine incorporation	cytoplasm|nucleus	pyridoxal phosphate binding|transferase activity, transferring selenium-containing groups|tRNA binding	g.chr4:25125605G>C	AJ238617	CCDS3432.1, CCDS3432.2	4p15.2	2008-10-27			ENSG00000109618	ENSG00000109618			30605	protein-coding gene	gene with protein product	"""soluble liver antigen/liver pancreas antigen"""	613009				16230358, 10931155, 17142313, 17194211	Standard	NM_016955		Approved	SLA/LP, SLA	uc003grg.3	Q9HD40	OTTHUMG00000128563	ENST00000382103.2:c.1454C>G	4.37:g.25125605G>C	ENSP00000371535:p.Ala485Gly					SEPSECS_uc003gri.2_Missense_Mutation_p.A484G|SEPSECS_uc003grh.2_Missense_Mutation_p.A406G	p.A485G	NM_153825	NP_722547	Q9HD40	SPCS_HUMAN			11	1667	-		Breast(46;0.173)	485			SLA/LP epitope.		A8K8W1|Q0D2P3|Q17RT1|Q9NXZ5|Q9UGM9|Q9Y353	Missense_Mutation	SNP	ENST00000382103.2	37	c.1454C>G	CCDS3432.2	.	.	.	.	.	.	.	.	.	.	G	13.92	2.380174	0.42207	.	.	ENSG00000109618	ENST00000302922;ENST00000382103	D;D	0.83506	-1.73;-1.72	5.42	2.58	0.30949	.	0.599272	0.16077	N	0.230714	T	0.66626	0.2808	N	0.14661	0.345	0.09310	N	0.999995	B;B;B	0.27068	0.167;0.018;0.008	B;B;B	0.24394	0.053;0.016;0.007	T	0.57100	-0.7869	10	0.49607	T	0.09	-16.4569	6.614	0.22766	0.1614:0.0:0.6944:0.1442	.	484;425;485	Q9HD40-3;A1A4F3;Q9HD40	.;.;SPCS_HUMAN	G	406;485	ENSP00000305956:A406G;ENSP00000371535:A485G	ENSP00000305956:A406G	A	-	2	0	SEPSECS	24734703	0.973000	0.33851	0.931000	0.37212	0.972000	0.66771	0.973000	0.29422	0.559000	0.29153	0.591000	0.81541	GCT		0.353	SEPSECS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250414.2	NM_016955		23	88	0	0	0	0.001882	0	23	88				
WDR19	57728	broad.mit.edu	37	4	39207199	39207199	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr4:39207199A>T	ENST00000399820.3	+	9	887	c.733A>T	c.(733-735)Atc>Ttc	p.I245F	WDR19_ENST00000288634.7_Missense_Mutation_p.I85F|WDR19_ENST00000506503.1_Missense_Mutation_p.I245F	NM_025132.3	NP_079408.3	Q8NEZ3	WDR19_HUMAN	WD repeat domain 19	245					ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|cilium assembly (GO:0042384)|digestive system development (GO:0055123)|ear morphogenesis (GO:0042471)|embryonic camera-type eye development (GO:0031076)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic limb morphogenesis (GO:0030326)|in utero embryonic development (GO:0001701)|intraciliary retrograde transport (GO:0035721)|myotome development (GO:0061055)|neurological system process (GO:0050877)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intraciliary transport particle A (GO:0030991)|motile cilium (GO:0031514)|nonmotile primary cilium (GO:0031513)|photoreceptor connecting cilium (GO:0032391)		p.I245F(1)		large_intestine(1)	1						TGATGGCCGCATCATGATTGG	0.378																																							uc003gtv.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(733-735)ATC>TTC		WD repeat domain 19							145.0	125.0	132.0					4																	39207199		1915	4124	6039	SO:0001583	missense	57728				cell projection organization	microtubule basal body|motile cilium|photoreceptor connecting cilium	binding	g.chr4:39207199A>T	AB046858, AY029257	CCDS47042.1	4p14	2014-02-21			ENSG00000157796	ENSG00000157796		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	18340	protein-coding gene	gene with protein product	"""intraflagellar transport 144 homolog (Chlamydomonas)"""	608151				12906858, 22019273	Standard	XM_005262658		Approved	Pwdmp, KIAA1638, FLJ23127, ORF26, DYF-2, Oseg6, IFT144, NPHP13	uc003gtv.3	Q8NEZ3	OTTHUMG00000160466	ENST00000399820.3:c.733A>T	4.37:g.39207199A>T	ENSP00000382717:p.Ile245Phe					WDR19_uc010ifl.1_Missense_Mutation_p.I62F|WDR19_uc003gtu.1_Missense_Mutation_p.I245F|WDR19_uc011byi.1_Missense_Mutation_p.I85F	p.I245F	NM_025132	NP_079408	Q8NEZ3	WDR19_HUMAN			9	887	+			245					B5MEF2|Q8N5B4|Q9H5S0|Q9HCD4	Missense_Mutation	SNP	ENST00000399820.3	37	c.733A>T	CCDS47042.1	.	.	.	.	.	.	.	.	.	.	A	26.8	4.776008	0.90195	.	.	ENSG00000157796	ENST00000399820;ENST00000288634;ENST00000506503;ENST00000399836	T;D;T	0.95656	3.42;-3.77;3.42	5.4	5.4	0.78164	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.97911	0.9313	M	0.88310	2.945	0.80722	D	1	P;D	0.76494	0.907;0.999	P;D	0.74674	0.582;0.984	D	0.98914	1.0781	10	0.87932	D	0	-19.2642	15.4269	0.75059	1.0:0.0:0.0:0.0	.	245;245	Q8NEZ3;D6R9P6	WDR19_HUMAN;.	F	245;85;245;244	ENSP00000382717:I245F;ENSP00000288634:I85F;ENSP00000423491:I245F	ENSP00000288634:I85F	I	+	1	0	WDR19	38883594	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	7.073000	0.76784	2.047000	0.60756	0.460000	0.39030	ATC		0.378	WDR19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360689.1			6	30	0	0	0	0.001168	0	6	30				
GABRA4	2557	broad.mit.edu	37	4	46979500	46979500	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr4:46979500C>T	ENST00000264318.3	-	4	1403	c.421G>A	c.(421-423)Gtc>Atc	p.V141I		NM_000809.3|NM_001204266.1|NM_001204267.1	NP_000800.2|NP_001191195.1|NP_001191196.1	P48169	GBRA4_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 4	141					central nervous system development (GO:0007417)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|regulation of response to drug (GO:2001023)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.V141I(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45					Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	TTATGTGAGACAGATTTCTTT	0.318																																					Ovarian(6;283 369 8234 12290 33402)	Ovarian(6;283 369 8234 12290 33402)	uc003gxg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)|breast(1)	4						c.(421-423)GTC>ATC		gamma-aminobutyric acid A receptor, alpha 4	Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)						86.0	87.0	87.0					4																	46979500		2203	4300	6503	SO:0001583	missense	2557				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity	g.chr4:46979500C>T		CCDS3473.1	4p12	2012-06-22			ENSG00000109158	ENSG00000109158		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4078	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 4"""	137141				7607683	Standard	NM_000809		Approved		uc021xnz.1	P48169	OTTHUMG00000099431	ENST00000264318.3:c.421G>A	4.37:g.46979500C>T	ENSP00000264318:p.Val141Ile						p.V141I	NM_000809	NP_000800	P48169	GBRA4_HUMAN			4	560	-			141			Extracellular (Probable).		Q8IYR7	Missense_Mutation	SNP	ENST00000264318.3	37	c.421G>A	CCDS3473.1	.	.	.	.	.	.	.	.	.	.	C	6.801	0.516846	0.13005	.	.	ENSG00000109158	ENST00000264318	T	0.79033	-1.23	5.34	5.34	0.76211	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	T	0.55114	0.1900	N	0.05554	-0.025	0.43745	D	0.996249	B	0.06786	0.001	B	0.15052	0.012	T	0.52786	-0.8529	10	0.07325	T	0.83	.	11.6037	0.51020	0.0:0.9199:0.0:0.0801	.	141	P48169	GBRA4_HUMAN	I	141	ENSP00000264318:V141I	ENSP00000264318:V141I	V	-	1	0	GABRA4	46674257	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	2.595000	0.46197	2.776000	0.95493	0.650000	0.86243	GTC		0.318	GABRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216893.1			8	47	0	0	0	0.004482	0	8	47				
LPHN3	23284	broad.mit.edu	37	4	62845477	62845477	+	Missense_Mutation	SNP	G	G	A	rs370040630		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr4:62845477G>A	ENST00000514591.1	+	17	3127	c.2798G>A	c.(2797-2799)cGa>cAa	p.R933Q	LPHN3_ENST00000507625.1_Missense_Mutation_p.R1001Q|LPHN3_ENST00000508946.1_Missense_Mutation_p.R933Q|LPHN3_ENST00000511324.1_Missense_Mutation_p.R1001Q|LPHN3_ENST00000506746.1_Missense_Mutation_p.R1001Q|LPHN3_ENST00000504896.1_Missense_Mutation_p.R933Q|LPHN3_ENST00000509896.1_Missense_Mutation_p.R1001Q|LPHN3_ENST00000512091.2_Missense_Mutation_p.R933Q|LPHN3_ENST00000506720.1_Missense_Mutation_p.R1001Q|LPHN3_ENST00000514996.1_Missense_Mutation_p.R933Q|LPHN3_ENST00000507164.1_Missense_Mutation_p.R1001Q|LPHN3_ENST00000514157.1_Missense_Mutation_p.R933Q|LPHN3_ENST00000508693.1_Missense_Mutation_p.R1001Q|LPHN3_ENST00000506700.1_Missense_Mutation_p.R933Q|LPHN3_ENST00000545650.1_Missense_Mutation_p.R933Q			Q9HAR2	LPHN3_HUMAN	latrophilin 3	920					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)	p.R933Q(3)		breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						GGGATCAACCGAACTGACCAA	0.443																																							uc010ihh.2		NA																	3	Substitution - Missense(3)		lung(3)	lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						c.(2797-2799)CGA>CAA		latrophilin 3 precursor		G	GLN/ARG	2,4014		0,2,2006	121.0	116.0	118.0		2798	5.5	1.0	4		118	0,8404		0,0,4202	no	missense	LPHN3	NM_015236.4	43	0,2,6208	AA,AG,GG		0.0,0.0498,0.0161	possibly-damaging	933/1470	62845477	2,12418	2008	4202	6210	SO:0001583	missense	23284				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding	g.chr4:62845477G>A	AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.2798G>A	4.37:g.62845477G>A	ENSP00000422533:p.Arg933Gln					LPHN3_uc003hcq.3_Missense_Mutation_p.R933Q|LPHN3_uc003hct.2_Missense_Mutation_p.R326Q	p.R933Q	NM_015236	NP_056051	Q9HAR2	LPHN3_HUMAN			15	2971	+			920			Extracellular (Potential).		E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	ENST00000514591.1	37	c.2798G>A	CCDS54768.1	.	.	.	.	.	.	.	.	.	.	G	16.03	3.007556	0.54361	4.98E-4	0.0	ENSG00000150471	ENST00000512091;ENST00000514591;ENST00000509896;ENST00000511324;ENST00000506700;ENST00000545650;ENST00000295349;ENST00000280009;ENST00000507164;ENST00000508693;ENST00000507625;ENST00000514157;ENST00000504896;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.37752	1.18;1.18;1.18;1.18;1.18;1.18;1.18;1.18;1.18;1.18;1.18;1.18;1.18;1.18;1.18	5.5	5.5	0.81552	GPCR, family 2-like (1);	0.071229	0.56097	D	0.000022	T	0.29684	0.0741	N	0.05158	-0.105	0.48696	D	0.999696	D;D;D	0.71674	0.996;0.996;0.998	P;P;P	0.60682	0.878;0.878;0.806	T	0.09015	-1.0694	10	0.07644	T	0.81	.	12.3801	0.55301	0.0776:0.0:0.9224:0.0	.	933;920;933	E9PE04;Q9HAR2;Q9HAR2-2	.;LPHN3_HUMAN;.	Q	933;933;1001;1001;933;933;920;933;1001;1001;1001;933;933;933;1001;1001;933	ENSP00000423388:R933Q;ENSP00000422533:R933Q;ENSP00000423787:R1001Q;ENSP00000425033:R1001Q;ENSP00000424120:R933Q;ENSP00000439831:R933Q;ENSP00000421476:R1001Q;ENSP00000424030:R1001Q;ENSP00000421372:R1001Q;ENSP00000425201:R933Q;ENSP00000423434:R933Q;ENSP00000421627:R933Q;ENSP00000420931:R1001Q;ENSP00000425884:R1001Q;ENSP00000424258:R933Q	ENSP00000280009:R933Q	R	+	2	0	LPHN3	62528072	1.000000	0.71417	1.000000	0.80357	0.833000	0.47200	5.830000	0.69324	2.580000	0.87095	0.467000	0.42956	CGA		0.443	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1			14	136	0	0	0	0.004007	0	14	136				
EPHA5	2044	broad.mit.edu	37	4	66467644	66467645	+	Nonsense_Mutation	DNP	CC	CC	AG	rs202165566		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr4:66467644_66467645CC>AG	ENST00000273854.3	-	3	1224_1225	c.624_625GG>CT	c.(622-627)aaGGga>aaCTga	p.208_209KG>N*	EPHA5_ENST00000511294.1_Nonsense_Mutation_p.208_209KG>N*|EPHA5_ENST00000432638.2_Nonsense_Mutation_p.208_209KG>N*|EPHA5_ENST00000354839.4_Nonsense_Mutation_p.208_209KG>N*	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	208	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)	p.K208_G209>N*(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						AGATAAAATCCCTTTTTGCTTA	0.416										TSP Lung(17;0.13)																													uc003hcy.2		NA																	1	Complex - compound substitution(1)		lung(1)	lung(19)|stomach(2)|ovary(2)|central_nervous_system(1)	24						c.(622-627)AAGGGA>AACTGA		ephrin receptor EphA5 isoform a precursor																																				SO:0001587	stop_gained	2044				cAMP-mediated signaling|neuron development	dendrite|external side of plasma membrane|integral to plasma membrane|neuronal cell body|perinuclear region of cytoplasm|rough endoplasmic reticulum	ATP binding|transmembrane-ephrin receptor activity	g.chr4:66467644_66467645CC>AG	L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.624_625delinsAG	4.37:g.66467644_66467645delinsAG	ENSP00000273854:p.K208_G209delinsN*	TSP Lung(17;0.13)				EPHA5_uc003hcx.2_Nonsense_Mutation_p.139_140KG>N*|EPHA5_uc003hcz.2_Nonsense_Mutation_p.208_209KG>N*|EPHA5_uc011cah.1_Nonsense_Mutation_p.208_209KG>N*|EPHA5_uc011cai.1_Nonsense_Mutation_p.208_209KG>N*|EPHA5_uc003hda.2_Nonsense_Mutation_p.208_209KG>N*	p.208_209KG>N*	NM_004439	NP_004430	P54756	EPHA5_HUMAN			3	817_818	-			208_209			Extracellular (Potential).		Q7Z3F2	Nonsense_Mutation	DNP	ENST00000273854.3	37	c.624_625GG>CT	CCDS3513.1																																																																																				0.416	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	NM_004439		5	73	0	0	0	0.004672	0	5	73				
TMPRSS11B	132724	broad.mit.edu	37	4	69107500	69107500	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr4:69107500A>T	ENST00000332644.5	-	2	192	c.31T>A	c.(31-33)Tct>Act	p.S11T		NM_182502.3	NP_872308.2	Q86T26	TM11B_HUMAN	transmembrane protease, serine 11B	11						extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)	p.S11T(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|skin(1)	27						AGTGGCCAAGATCTTTGGGAA	0.403																																							uc003hdw.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(31-33)TCT>ACT		transmembrane protease, serine 11B							77.0	75.0	76.0					4																	69107500		2203	4300	6503	SO:0001583	missense	132724				proteolysis	extracellular region|integral to plasma membrane	serine-type endopeptidase activity	g.chr4:69107500A>T	BX537945	CCDS3521.1	4q13.2	2010-04-13			ENSG00000185873	ENSG00000185873		"""Serine peptidases / Transmembrane"""	25398	protein-coding gene	gene with protein product							Standard	NM_182502		Approved		uc003hdw.4	Q86T26	OTTHUMG00000129301	ENST00000332644.5:c.31T>A	4.37:g.69107500A>T	ENSP00000330475:p.Ser11Thr						p.S11T	NM_182502	NP_872308	Q86T26	TM11B_HUMAN			2	167	-			11			Cytoplasmic (Potential).		A8K4D9	Missense_Mutation	SNP	ENST00000332644.5	37	c.31T>A	CCDS3521.1	.	.	.	.	.	.	.	.	.	.	A	10.31	1.315642	0.23908	.	.	ENSG00000185873	ENST00000332644	D	0.88741	-2.42	4.97	1.12	0.20585	.	0.534852	0.15014	N	0.285403	D	0.83496	0.5267	M	0.84511	2.7	0.09310	N	1	P	0.43094	0.799	B	0.33799	0.17	T	0.70673	-0.4807	10	0.13853	T	0.58	.	3.017	0.06063	0.6138:0.0:0.2062:0.18	.	11	Q86T26	TM11B_HUMAN	T	11	ENSP00000330475:S11T	ENSP00000330475:S11T	S	-	1	0	TMPRSS11B	68790095	0.002000	0.14202	0.002000	0.10522	0.051000	0.14879	0.311000	0.19380	-0.033000	0.13736	-0.326000	0.08463	TCT		0.403	TMPRSS11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251431.2	NM_182502		4	80	0	0	0	0.009096	0	4	80				
TMPRSS11E	28983	broad.mit.edu	37	4	69362415	69362415	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr4:69362415G>T	ENST00000305363.4	+	10	1229	c.1165G>T	c.(1165-1167)Gct>Tct	p.A389S		NM_014058.3	NP_054777.2	Q9UL52	TM11E_HUMAN	transmembrane protease, serine 11E	389	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cognition (GO:0050890)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.A389S(1)		endometrium(1)|lung(19)|pancreas(1)|skin(3)	24						CTGGTACCTTGCTGGAATAGT	0.438																																							uc003hdz.3		NA																	1	Substitution - Missense(1)		lung(1)		NA						c.(1165-1167)GCT>TCT		transmembrane protease, serine 11E							323.0	332.0	329.0					4																	69362415		2203	4296	6499	SO:0001583	missense	0							g.chr4:69362415G>T	AF064819	CCDS33993.1	4q13.2	2010-04-13			ENSG00000087128	ENSG00000087128		"""Serine peptidases / Transmembrane"""	24465	protein-coding gene	gene with protein product		610399	"""transmembrane protease, serine 11E2"""	TMPRSS11E2		15328353	Standard	NM_014058		Approved	DESC1	uc003hdz.4	Q9UL52	OTTHUMG00000160438	ENST00000305363.4:c.1165G>T	4.37:g.69362415G>T	ENSP00000307519:p.Ala389Ser						p.A389S	NM_014058	NP_054777					10	1229	+								A6NL71|Q14DC8|Q6UW31	Missense_Mutation	SNP	ENST00000305363.4	37	c.1165G>T	CCDS33993.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.065322	0.76187	.	.	ENSG00000087128	ENST00000305363	D	0.89343	-2.5	5.48	3.66	0.41972	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.435749	0.16961	N	0.192487	D	0.83566	0.5282	L	0.35341	1.055	0.26954	N	0.965956	B	0.25563	0.129	B	0.36766	0.232	T	0.74740	-0.3563	10	0.66056	D	0.02	.	5.5718	0.17200	0.1622:0.0:0.6664:0.1714	.	389	Q9UL52	TM11E_HUMAN	S	389	ENSP00000307519:A389S	ENSP00000307519:A389S	A	+	1	0	TMPRSS11E	69045010	0.993000	0.37304	1.000000	0.80357	0.954000	0.61252	3.246000	0.51414	2.588000	0.87417	0.655000	0.94253	GCT		0.438	TMPRSS11E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360584.1	NM_014058		76	431	1	0	3.78398e-24	0.00361	6.27315e-24	76	431				
CCNG2	901	broad.mit.edu	37	4	78081897	78081897	+	Silent	SNP	C	C	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr4:78081897C>T	ENST00000316355.5	+	4	656	c.300C>T	c.(298-300)tgC>tgT	p.C100C	CCNG2_ENST00000497512.1_3'UTR|CCNG2_ENST00000354403.5_Silent_p.C100C|CCNG2_ENST00000502280.1_Silent_p.C100C|CCNG2_ENST00000509972.1_Silent_p.C100C|CCNG2_ENST00000395640.1_Silent_p.C100C	NM_004354.2	NP_004345.1	Q16589	CCNG2_HUMAN	cyclin G2	100					cell cycle checkpoint (GO:0000075)|mitotic nuclear division (GO:0007067)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)		p.C100C(1)		breast(1)|kidney(2)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	10						ATTTGTCTTGCATTGGAGTCT	0.363																																							uc003hkq.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|lung(1)	3						c.(298-300)TGC>TGT		cyclin G2							128.0	134.0	132.0					4																	78081897		2202	4300	6502	SO:0001819	synonymous_variant	901				cell cycle checkpoint|cell division|mitosis	cytoplasm		g.chr4:78081897C>T	BC032518	CCDS3581.1	4q21.22	2009-05-07			ENSG00000138764	ENSG00000138764			1593	protein-coding gene	gene with protein product		603203				8806701	Standard	NM_004354		Approved		uc003hkq.4	Q16589	OTTHUMG00000130100	ENST00000316355.5:c.300C>T	4.37:g.78081897C>T						CCNG2_uc003hkn.3_Silent_p.C100C|CCNG2_uc011ccc.1_Silent_p.C100C|CCNG2_uc003hkp.3_Silent_p.C100C	p.C100C	NM_004354	NP_004345	Q16589	CCNG2_HUMAN			4	603	+			100					B4DF25|Q6FGA7|Q6FGC6	Silent	SNP	ENST00000316355.5	37	c.300C>T	CCDS3581.1																																																																																				0.363	CCNG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252404.3	NM_004354		8	160	0	0	0	0.004482	0	8	160				
ANXA3	306	broad.mit.edu	37	4	79512740	79512740	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr4:79512740C>G	ENST00000264908.6	+	7	825	c.446C>G	c.(445-447)tCt>tGt	p.S149C	ANXA3_ENST00000512884.1_Missense_Mutation_p.S110C|ANXA3_ENST00000503570.2_Missense_Mutation_p.S110C	NM_005139.2	NP_005130.1	P12429	ANXA3_HUMAN	annexin A3	149					defense response to bacterium (GO:0042742)|neutrophil degranulation (GO:0043312)|phagocytosis (GO:0006909)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|specific granule (GO:0042581)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|phospholipase A2 inhibitor activity (GO:0019834)	p.S149C(1)		NS(1)|breast(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15						TCCGAAACATCTGGTGACTTC	0.333																																					GBM(2;126 157 27790 28920 42492)	GBM(2;126 157 27790 28920 42492)	uc003hld.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(445-447)TCT>TGT		annexin A3							140.0	143.0	142.0					4																	79512740		2203	4300	6503	SO:0001583	missense	306				defense response to bacterium|neutrophil degranulation|phagocytosis|positive regulation of angiogenesis|positive regulation of endothelial cell migration|positive regulation of sequence-specific DNA binding transcription factor activity	phagocytic vesicle membrane|plasma membrane|specific granule	calcium ion binding|calcium-dependent phospholipid binding|phospholipase A2 inhibitor activity	g.chr4:79512740C>G	M63310	CCDS3584.1	4q21.21	2009-07-10			ENSG00000138772	ENSG00000138772	3.1.4.43	"""Annexins"""	541	protein-coding gene	gene with protein product		106490		ANX3		1830024	Standard	XM_005262973		Approved		uc003hld.3	P12429	OTTHUMG00000130198	ENST00000264908.6:c.446C>G	4.37:g.79512740C>G	ENSP00000264908:p.Ser149Cys					ANXA3_uc003hle.2_Missense_Mutation_p.S110C|ANXA3_uc010ijk.2_Missense_Mutation_p.S110C	p.S149C	NM_005139	NP_005130	P12429	ANXA3_HUMAN			7	756	+			149			Annexin 2.		B2R9W6|Q6LET2	Missense_Mutation	SNP	ENST00000264908.6	37	c.446C>G	CCDS3584.1	.	.	.	.	.	.	.	.	.	.	C	19.30	3.800447	0.70567	.	.	ENSG00000138772	ENST00000264908;ENST00000512884;ENST00000503570;ENST00000514171	T;T;T;T	0.06687	3.27;3.27;3.27;3.27	4.95	4.95	0.65309	Annexin repeat, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.40719	0.1128	H	0.95043	3.615	0.80722	D	1	D	0.76494	0.999	D	0.65573	0.936	T	0.58578	-0.7612	10	0.87932	D	0	.	17.1225	0.86705	0.0:1.0:0.0:0.0	.	149	P12429	ANXA3_HUMAN	C	149;110;110;149	ENSP00000264908:S149C;ENSP00000423068:S110C;ENSP00000421015:S110C;ENSP00000421512:S149C	ENSP00000264908:S149C	S	+	2	0	ANXA3	79731764	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	3.342000	0.52159	2.559000	0.86315	0.585000	0.79938	TCT		0.333	ANXA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252516.3	NM_005139		19	124	0	0	0	0.001882	0	19	124				
SEC31A	22872	broad.mit.edu	37	4	83799966	83799966	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr4:83799966T>A	ENST00000395310.2	-	4	501	c.319A>T	c.(319-321)Ata>Tta	p.I107L	SEC31A_ENST00000432794.1_Missense_Mutation_p.I107L|SEC31A_ENST00000448323.1_Missense_Mutation_p.I107L|SEC31A_ENST00000508502.1_Missense_Mutation_p.I107L|SEC31A_ENST00000513858.1_Missense_Mutation_p.I107L|SEC31A_ENST00000326950.5_Missense_Mutation_p.I107L|SEC31A_ENST00000508479.1_Missense_Mutation_p.I107L|SEC31A_ENST00000509142.1_Missense_Mutation_p.I107L|SEC31A_ENST00000436790.2_5'UTR|SEC31A_ENST00000505984.1_Missense_Mutation_p.I107L|SEC31A_ENST00000348405.4_Missense_Mutation_p.I107L|SEC31A_ENST00000355196.2_Missense_Mutation_p.I107L|SEC31A_ENST00000311785.7_Missense_Mutation_p.I107L|SEC31A_ENST00000443462.2_Missense_Mutation_p.I102L|SEC31A_ENST00000505472.1_Missense_Mutation_p.I107L|SEC31A_ENST00000500777.2_Missense_Mutation_p.I107L	NM_001077207.2|NM_001077208.2|NM_014933.3	NP_001070675.1|NP_001070676.1|NP_055748.2	O94979	SC31A_HUMAN	SEC31 homolog A (S. cerevisiae)	107					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)|response to calcium ion (GO:0051592)	COPII vesicle coat (GO:0030127)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle (GO:0030134)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|vesicle coat (GO:0030120)	calcium-dependent protein binding (GO:0048306)	p.I107L(2)	SEC31A/ALK(3)|SEC31A/JAK2(4)	breast(1)	1		Hepatocellular(203;0.114)				TCTCCAGCTATAATTTTAGAA	0.403																																							uc003hnf.2		NA																SEC31A/JAK2(4)|SEC31A/ALK(3)	2	Substitution - Missense(2)		lung(2)	haematopoietic_and_lymphoid_tissue(4)|soft_tissue(3)|breast(1)	8						c.(319-321)ATA>TTA		SEC31 homolog A isoform 1							92.0	92.0	92.0					4																	83799966		2203	4300	6503	SO:0001583	missense	22872				COPII vesicle coating|post-translational protein modification|protein N-linked glycosylation via asparagine|protein transport|response to calcium ion	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|perinuclear region of cytoplasm	calcium-dependent protein binding	g.chr4:83799966T>A	AB018358	CCDS3596.1, CCDS3597.1, CCDS43244.1, CCDS47088.1, CCDS54773.1, CCDS75155.1, CCDS75156.1	4q21.3	2013-01-10	2006-10-05	2006-09-07	ENSG00000138674	ENSG00000138674		"""WD repeat domain containing"""	17052	protein-coding gene	gene with protein product		610257	"""SEC31-like 1 (S. cerevisiae)"", ""Sec31 homolog A (S. cerevisiae)"""	SEC31L1		10048485, 10788476	Standard	NM_001077206		Approved	KIAA0905, ABP125, ABP130	uc003hnh.3	O94979	OTTHUMG00000130297	ENST00000395310.2:c.319A>T	4.37:g.83799966T>A	ENSP00000378721:p.Ile107Leu					SEC31A_uc011ccl.1_Missense_Mutation_p.I107L|SEC31A_uc003hnl.2_Missense_Mutation_p.I107L|SEC31A_uc003hng.2_Missense_Mutation_p.I107L|SEC31A_uc003hnh.2_Missense_Mutation_p.I107L|SEC31A_uc003hni.2_Missense_Mutation_p.I107L|SEC31A_uc003hnj.2_Missense_Mutation_p.I107L|SEC31A_uc011ccm.1_Missense_Mutation_p.I102L|SEC31A_uc011ccn.1_Missense_Mutation_p.I107L|SEC31A_uc003hnk.2_Missense_Mutation_p.I107L|SEC31A_uc003hnm.2_Missense_Mutation_p.I107L|SEC31A_uc003hnn.1_Missense_Mutation_p.I107L|SEC31A_uc003hno.2_Missense_Mutation_p.I107L	p.I107L	NM_001077207	NP_001070675	O94979	SC31A_HUMAN			4	483	-		Hepatocellular(203;0.114)	107			WD 1.		B4DIW6|B7ZKZ7|B7ZL00|H7C2W3|Q17RR5|Q5H9P6|Q5XG74|Q659G7|Q6ZU90|Q7LCX9|Q86TJ0|Q8IZH4|Q9P048|Q9P0A6|Q9UM05|Q9UM06	Missense_Mutation	SNP	ENST00000395310.2	37	c.319A>T	CCDS3596.1	.	.	.	.	.	.	.	.	.	.	T	5.873	0.345136	0.11126	.	.	ENSG00000138674	ENST00000348405;ENST00000513858;ENST00000395310;ENST00000443462;ENST00000509142;ENST00000432794;ENST00000448323;ENST00000326950;ENST00000311785;ENST00000505472;ENST00000500777;ENST00000508502;ENST00000355196;ENST00000505984;ENST00000508479;ENST00000503058;ENST00000514326;ENST00000513323	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.62639	1.61;1.61;1.61;2.7;1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61;0.06;0.01;0.01	5.21	4.01	0.46588	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.043047	0.85682	D	0.000000	T	0.27241	0.0668	N	0.01257	-0.925	0.58432	D	0.999992	B;B;B;B;B;B;B;B;B	0.09022	0.0;0.0;0.001;0.0;0.001;0.0;0.002;0.001;0.0	B;B;B;B;B;B;B;B;B	0.10450	0.001;0.001;0.002;0.001;0.005;0.001;0.003;0.003;0.001	T	0.29274	-1.0017	10	0.02654	T	1	-13.564	10.0778	0.42370	0.2676:0.0:0.0:0.7324	.	102;107;107;107;107;107;107;107;107	B4DIW6;B7ZL00;O94979-5;D6RHZ5;O94979-6;O94979-4;O94979-3;O94979-2;O94979	.;.;.;.;.;.;.;.;SC31A_HUMAN	L	107;107;107;102;107;107;107;107;107;107;107;107;107;107;107;78;107;107	ENSP00000337602:I107L;ENSP00000426886:I107L;ENSP00000378721:I107L;ENSP00000408027:I102L;ENSP00000426569:I107L;ENSP00000407944:I107L;ENSP00000400926:I107L;ENSP00000325087:I107L;ENSP00000309070:I107L;ENSP00000421633:I107L;ENSP00000421464:I107L;ENSP00000424635:I107L;ENSP00000347329:I107L;ENSP00000424451:I107L;ENSP00000425999:I107L;ENSP00000425056:I78L;ENSP00000425555:I107L;ENSP00000426950:I107L	ENSP00000309070:I107L	I	-	1	0	SEC31A	84018990	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.231000	0.32624	0.979000	0.38497	0.533000	0.62120	ATA		0.403	SEC31A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252640.1	NM_016211		14	65	0	0	0	0.001855	0	14	65				
GRID2	2895	broad.mit.edu	37	4	94690490	94690490	+	Missense_Mutation	SNP	C	C	A	rs377339263		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr4:94690490C>A	ENST00000282020.4	+	15	2748	c.2490C>A	c.(2488-2490)agC>agA	p.S830R	GRID2_ENST00000510992.1_Missense_Mutation_p.S735R	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	830					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)	p.S830R(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		ACATAAAGAGCTTTGCAGGGG	0.532																																							uc011cdt.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)|large_intestine(1)	6						c.(2488-2490)AGC>AGA		glutamate receptor, ionotropic, delta 2	L-Glutamic Acid(DB00142)	C	ARG/SER	2,4404	4.2+/-10.8	0,2,2201	117.0	127.0	123.0		2490	2.5	1.0	4		123	0,8600		0,0,4300	no	missense	GRID2	NM_001510.2	110	0,2,6501	AA,AC,CC		0.0,0.0454,0.0154	possibly-damaging	830/1008	94690490	2,13004	2203	4300	6503	SO:0001583	missense	2895				glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity	g.chr4:94690490C>A	AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.2490C>A	4.37:g.94690490C>A	ENSP00000282020:p.Ser830Arg					GRID2_uc011cdu.1_Missense_Mutation_p.S735R	p.S830R	NM_001510	NP_001501	O43424	GRID2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	15	2748	+		Hepatocellular(203;0.114)|all_hematologic(202;0.177)	830			Extracellular (Potential).		E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Missense_Mutation	SNP	ENST00000282020.4	37	c.2490C>A	CCDS3637.1	.	.	.	.	.	.	.	.	.	.	C	17.86	3.493627	0.64186	4.54E-4	0.0	ENSG00000152208	ENST00000282020;ENST00000510992	T;T	0.55413	0.52;0.52	5.17	2.47	0.30058	Ionotropic glutamate receptor (1);	0.037948	0.85682	D	0.000000	T	0.60534	0.2276	M	0.83774	2.66	0.58432	D	0.999993	P;P	0.37914	0.611;0.611	B;P	0.45449	0.404;0.481	T	0.62923	-0.6751	10	0.87932	D	0	.	8.9267	0.35646	0.0:0.6383:0.0:0.3617	.	735;830	E9PH24;O43424	.;GRID2_HUMAN	R	830;735	ENSP00000282020:S830R;ENSP00000421257:S735R	ENSP00000282020:S830R	S	+	3	2	GRID2	94909513	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.793000	0.26944	0.560000	0.29169	0.650000	0.86243	AGC		0.532	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253588.2			23	69	1	0	3.08376e-08	0.00333	4.03041e-08	23	69				
ANK2	287	broad.mit.edu	37	4	114176923	114176923	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr4:114176923G>T	ENST00000357077.4	+	11	1076	c.1023G>T	c.(1021-1023)caG>caT	p.Q341H	ANK2_ENST00000264366.6_Missense_Mutation_p.Q341H|ANK2_ENST00000394537.3_Missense_Mutation_p.Q341H|ANK2_ENST00000506722.1_Missense_Mutation_p.Q320H	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	341					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.Q341H(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		TGGCTGCCCAGGGAGACCACG	0.458																																							uc003ibe.3		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14						c.(1021-1023)CAG>CAT		ankyrin 2 isoform 1							179.0	156.0	164.0					4																	114176923		2203	4300	6503	SO:0001583	missense	287				axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding	g.chr4:114176923G>T	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.1023G>T	4.37:g.114176923G>T	ENSP00000349588:p.Gln341His					ANK2_uc003ibd.3_Missense_Mutation_p.Q320H|ANK2_uc003ibf.3_Missense_Mutation_p.Q341H|ANK2_uc003ibc.2_Missense_Mutation_p.Q317H|ANK2_uc011cgb.1_Missense_Mutation_p.Q356H	p.Q341H	NM_001148	NP_001139	Q01484	ANK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)	11	1123	+		Ovarian(17;0.0448)|Hepatocellular(203;0.218)	341			ANK 10.		Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	c.1023G>T	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	G	17.13	3.311520	0.60414	.	.	ENSG00000145362	ENST00000503271;ENST00000503423;ENST00000506722;ENST00000504454;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056	T;T;T;T;T;T;T	0.66280	-0.2;-0.17;-0.17;-0.17;-0.17;-0.17;-0.17	5.69	-0.267	0.12938	Ankyrin repeat-containing domain (3);	0.241588	0.28983	N	0.013508	T	0.61850	0.2380	N	0.20357	0.565	0.80722	D	1	P;D;P;D;P	0.58620	0.851;0.983;0.682;0.973;0.951	P;D;P;P;P	0.71184	0.857;0.972;0.715;0.847;0.735	T	0.61312	-0.7088	10	0.66056	D	0.02	.	11.7229	0.51693	0.5024:0.0:0.4976:0.0	.	341;341;341;320;320	Q01484;Q01484-2;Q01484-4;Q01484-5;F8WEF9	ANK2_HUMAN;.;.;.;.	H	320;320;320;356;341;341;341;320	ENSP00000423799:Q320H;ENSP00000421011:Q320H;ENSP00000421067:Q320H;ENSP00000424722:Q356H;ENSP00000378044:Q341H;ENSP00000349588:Q341H;ENSP00000264366:Q341H	ENSP00000264366:Q341H	Q	+	3	2	ANK2	114396372	0.998000	0.40836	0.961000	0.40146	0.987000	0.75469	0.495000	0.22483	-0.166000	0.10890	-0.137000	0.14449	CAG		0.458	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148		28	155	1	0	6.04164e-23	0.002096	9.89914e-23	28	155				
KIAA1109	84162	broad.mit.edu	37	4	123274259	123274259	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr4:123274259G>C	ENST00000264501.4	+	81	14423	c.14050G>C	c.(14050-14052)Gaa>Caa	p.E4684Q	KIAA1109_ENST00000388738.3_Missense_Mutation_p.E4684Q			Q2LD37	K1109_HUMAN	KIAA1109	4684					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)		p.E4684Q(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						TTTTCATTTAGAAGAACCAAA	0.368																																							uc003ieh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						c.(14050-14052)GAA>CAA		fragile site-associated protein							80.0	73.0	75.0					4																	123274259		1823	4081	5904	SO:0001583	missense	84162				regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus		g.chr4:123274259G>C	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.14050G>C	4.37:g.123274259G>C	ENSP00000264501:p.Glu4684Gln					KIAA1109_uc003iem.2_Missense_Mutation_p.E1040Q	p.E4684Q	NM_015312	NP_056127	Q2LD37	K1109_HUMAN			79	14095	+			4684					Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	37	c.14050G>C	CCDS43267.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.33|19.33	3.807549|3.807549	0.70797|0.70797	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000438707;ENST00000431755|ENST00000306802	T;T;T|.	0.44881|.	0.91;0.91;0.91|.	5.83|5.83	5.83|5.83	0.93111|0.93111	Fragile site-associated protein, C-terminal (1);|.	0.101072|.	0.64402|.	D|.	0.000003|.	T|.	0.58722|.	0.2142|.	L|L	0.28274|0.28274	0.84|0.84	0.80722|0.80722	D|D	1|1	D;D|.	0.76494|.	0.996;0.999|.	D;D|.	0.83275|.	0.991;0.996|.	T|.	0.50866|.	-0.8777|.	10|.	0.35671|.	T|.	0.21|.	.|.	20.1232|20.1232	0.97969|0.97969	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	4683;4684|.	Q2LD37-4;Q2LD37|.	.;K1109_HUMAN|.	Q|Y	4684;4684;1353;285|1059	ENSP00000264501:E4684Q;ENSP00000373390:E4684Q;ENSP00000410874:E1353Q|.	ENSP00000264501:E4684Q|.	E|X	+|+	1|3	0|2	KIAA1109|KIAA1109	123493709|123493709	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.869000|9.869000	0.99810|0.99810	2.769000|2.769000	0.95229|0.95229	0.585000|0.585000	0.79938|0.79938	GAA|TAG		0.368	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797		18	48	0	0	0	0.006122	0	18	48				
KIAA1109	84162	broad.mit.edu	37	4	123275152	123275152	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr4:123275152T>C	ENST00000264501.4	+	82	14658	c.14285T>C	c.(14284-14286)gTt>gCt	p.V4762A	KIAA1109_ENST00000388738.3_Missense_Mutation_p.V4762A			Q2LD37	K1109_HUMAN	KIAA1109	4762					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)		p.V4762A(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						TTCAATTATGTTACAGCTACA	0.358																																							uc003ieh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						c.(14284-14286)GTT>GCT		fragile site-associated protein							73.0	69.0	70.0					4																	123275152		1846	4104	5950	SO:0001583	missense	84162				regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus		g.chr4:123275152T>C	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.14285T>C	4.37:g.123275152T>C	ENSP00000264501:p.Val4762Ala					KIAA1109_uc003iem.2_Missense_Mutation_p.V1118A	p.V4762A	NM_015312	NP_056127	Q2LD37	K1109_HUMAN			80	14330	+			4762					Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	37	c.14285T>C	CCDS43267.1	.	.	.	.	.	.	.	.	.	.	T	12.95	2.090289	0.36855	.	.	ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000438707;ENST00000431755	T;T;T	0.38077	1.16;1.16;1.16	6.04	6.04	0.98038	Fragile site-associated protein, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.38957	0.1060	N	0.16066	0.365	0.80722	D	1	D;D	0.69078	0.99;0.997	D;D	0.79108	0.98;0.992	T	0.14896	-1.0456	10	0.02654	T	1	.	16.5838	0.84722	0.0:0.0:0.0:1.0	.	4761;4762	Q2LD37-4;Q2LD37	.;K1109_HUMAN	A	4762;4762;1431;363	ENSP00000264501:V4762A;ENSP00000373390:V4762A;ENSP00000410874:V1431A	ENSP00000264501:V4762A	V	+	2	0	KIAA1109	123494602	1.000000	0.71417	0.993000	0.49108	0.982000	0.71751	8.040000	0.89188	2.319000	0.78375	0.528000	0.53228	GTT		0.358	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797		4	21	0	0	0	0.009096	0	4	21				
FAT4	79633	broad.mit.edu	37	4	126241342	126241342	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr4:126241342C>G	ENST00000394329.3	+	1	3789	c.3776C>G	c.(3775-3777)gCt>gGt	p.A1259G		NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	1259	Cadherin 12. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A1259G(2)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						AGACAGTTTGCTATAGACAGT	0.378																																							uc003ifj.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						c.(3775-3777)GCT>GGT		FAT tumor suppressor homolog 4 precursor							69.0	65.0	66.0					4																	126241342		1852	4104	5956	SO:0001583	missense	79633				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:126241342C>G	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.3776C>G	4.37:g.126241342C>G	ENSP00000377862:p.Ala1259Gly						p.A1259G	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN			1	3776	+			1259			Cadherin 12.|Extracellular (Potential).		A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	c.3776C>G	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	C	7.775	0.708270	0.15239	.	.	ENSG00000196159	ENST00000394329	T	0.03212	4.01	4.81	4.81	0.61882	Cadherin (4);Cadherin-like (1);	0.232356	0.20631	U	0.088589	T	0.04770	0.0129	L	0.43554	1.36	0.80722	D	1	B	0.18610	0.029	B	0.22386	0.039	T	0.44267	-0.9339	10	0.23302	T	0.38	.	13.43	0.61049	0.0:0.9222:0.0:0.0778	.	1259	Q6V0I7	FAT4_HUMAN	G	1259	ENSP00000377862:A1259G	ENSP00000377862:A1259G	A	+	2	0	FAT4	126460792	0.238000	0.23825	0.807000	0.32361	0.848000	0.48234	1.352000	0.34033	2.503000	0.84419	0.561000	0.74099	GCT		0.378	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582		10	61	0	0	0	0.006214	0	10	61				
KIAA0922	23240	broad.mit.edu	37	4	154523459	154523459	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr4:154523459G>T	ENST00000409663.3	+	22	2471	c.2419G>T	c.(2419-2421)Gac>Tac	p.D807Y	KIAA0922_ENST00000409959.3_Missense_Mutation_p.D808Y|KIAA0922_ENST00000440693.1_Missense_Mutation_p.D724Y	NM_015196.3	NP_056011.3	A2VDJ0	T131L_HUMAN	KIAA0922	807						integral component of membrane (GO:0016021)		p.D808Y(1)|p.D660Y(1)		breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(16)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	63	all_hematologic(180;0.093)	Renal(120;0.118)				GTTTTCCCTGGACCCAAACAC	0.408																																							uc003inm.3		NA																	2	Substitution - Missense(2)		lung(2)	upper_aerodigestive_tract(1)|ovary(1)	2						c.(2419-2421)GAC>TAC		hypothetical protein LOC23240 isoform 2							189.0	183.0	185.0					4																	154523459		2203	4300	6503	SO:0001583	missense	23240					integral to membrane		g.chr4:154523459G>T	AK096538	CCDS3783.2, CCDS47148.1	4q31.3	2008-02-05			ENSG00000121210	ENSG00000121210			29146	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_015196		Approved	DKFZp586H1322, TMEM131L	uc010ipp.3	A2VDJ0	OTTHUMG00000153244	ENST00000409663.3:c.2419G>T	4.37:g.154523459G>T	ENSP00000386574:p.Asp807Tyr					KIAA0922_uc010ipp.2_Missense_Mutation_p.D808Y|KIAA0922_uc010ipq.2_Missense_Mutation_p.D576Y	p.D807Y	NM_015196	NP_056011	A2VDJ0	T131L_HUMAN			22	2471	+	all_hematologic(180;0.093)	Renal(120;0.118)	807			Extracellular (Potential).		B3KRV3|Q7LGA7|Q86Y92|Q8WU56|Q9H065|Q9Y2D7	Missense_Mutation	SNP	ENST00000409663.3	37	c.2419G>T	CCDS3783.2	.	.	.	.	.	.	.	.	.	.	G	16.40	3.113715	0.56398	.	.	ENSG00000121210	ENST00000409663;ENST00000440693;ENST00000409959;ENST00000240487	T;T;T;T	0.18338	2.49;2.22;2.48;2.22	5.7	4.8	0.61643	.	0.432004	0.28047	N	0.016804	T	0.23886	0.0578	L	0.47716	1.5	0.39390	D	0.966401	P;D;P	0.53885	0.824;0.963;0.895	P;P;B	0.53102	0.521;0.718;0.423	T	0.02844	-1.1103	10	0.66056	D	0.02	-9.0289	7.781	0.29064	0.2031:0.0:0.7969:0.0	.	724;808;807	A2VDJ0-3;A2VDJ0-5;A2VDJ0	.;.;T131L_HUMAN	Y	807;724;808;585	ENSP00000386574:D807Y;ENSP00000409663:D724Y;ENSP00000386787:D808Y;ENSP00000240487:D585Y	ENSP00000240487:D585Y	D	+	1	0	KIAA0922	154742909	1.000000	0.71417	0.995000	0.50966	0.950000	0.60333	3.827000	0.55745	1.270000	0.44297	0.655000	0.94253	GAC		0.408	KIAA0922-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330370.1	NM_015196		26	137	1	0	8.4185e-14	0.002445	1.25164e-13	26	137				
DCHS2	54798	broad.mit.edu	37	4	155219801	155219801	+	Missense_Mutation	SNP	G	G	T	rs199596538		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr4:155219801G>T	ENST00000357232.4	-	18	4299	c.4300C>A	c.(4300-4302)Cgt>Agt	p.R1434S		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1434	Cadherin 12. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R1434S(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		TCCAAAGCACGAGTGGTTGAG	0.393																																							uc003inw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|pancreas(1)	4						c.(4300-4302)CGT>AGT		dachsous 2 isoform 1							85.0	89.0	88.0					4																	155219801		2203	4300	6503	SO:0001583	missense	54798				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:155219801G>T	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.4300C>A	4.37:g.155219801G>T	ENSP00000349768:p.Arg1434Ser						p.R1434S	NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN		LUSC - Lung squamous cell carcinoma(193;0.107)	18	4300	-	all_hematologic(180;0.208)	Renal(120;0.0854)	1434			Cadherin 12.		B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000357232.4	37	c.4300C>A	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	G	12.35	1.910180	0.33721	.	.	ENSG00000197410	ENST00000357232	T	0.52295	0.67	5.86	3.16	0.36331	Cadherin (4);Cadherin-like (1);	0.246394	0.35320	N	0.003287	T	0.36552	0.0971	L	0.45228	1.405	0.09310	N	1	P	0.39181	0.663	B	0.37508	0.252	T	0.21484	-1.0244	10	0.48119	T	0.1	.	7.9924	0.30248	0.2115:0.0:0.6652:0.1233	.	1434	Q6V1P9	PCD23_HUMAN	S	1434	ENSP00000349768:R1434S	ENSP00000349768:R1434S	R	-	1	0	DCHS2	155439251	0.356000	0.24930	0.123000	0.21794	0.999000	0.98932	1.625000	0.37029	0.920000	0.36970	0.650000	0.86243	CGT		0.393	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552		5	90	1	0	0.000602214	0.000602	0.000658452	5	90				
FGG	2266	broad.mit.edu	37	4	155527940	155527940	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr4:155527940T>A	ENST00000336098.3	-	8	1084	c.1046A>T	c.(1045-1047)gAa>gTa	p.E349V	FGG_ENST00000404648.3_Missense_Mutation_p.E349V|FGG_ENST00000405164.1_Missense_Mutation_p.E357V|FGG_ENST00000407946.1_Missense_Mutation_p.E357V	NM_021870.2	NP_068656.2	P02679	FIBG_HUMAN	fibrinogen gamma chain	349	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|receptor binding (GO:0005102)|structural molecule activity (GO:0005198)	p.E349V(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(9)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	27	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	ACAGTTGCCTTCAAACTTATC	0.423																																							uc003ioj.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1045-1047)GAA>GTA		fibrinogen, gamma chain isoform gamma-B	Sucralfate(DB00364)						233.0	216.0	222.0					4																	155527940		2203	4300	6503	SO:0001583	missense	2266				platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen	eukaryotic cell surface binding|protein binding, bridging|receptor binding	g.chr4:155527940T>A		CCDS3788.1, CCDS47153.1	4q28	2014-09-17			ENSG00000171557	ENSG00000171557		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3694	protein-coding gene	gene with protein product		134850	"""fibrinogen, gamma polypeptide"""				Standard	NM_000509		Approved		uc003ioj.3	P02679	OTTHUMG00000150329	ENST00000336098.3:c.1046A>T	4.37:g.155527940T>A	ENSP00000336829:p.Glu349Val					FGG_uc003iog.2_Missense_Mutation_p.E349V|FGG_uc003ioh.2_Missense_Mutation_p.E357V|FGG_uc010ipx.2_Missense_Mutation_p.E177V|FGG_uc010ipy.2_Missense_Mutation_p.E60V|FGG_uc003ioi.2_Missense_Mutation_p.E60V|FGG_uc003iok.2_Missense_Mutation_p.E357V	p.E349V	NM_021870	NP_068656	P02679	FIBG_HUMAN			8	1187	-	all_hematologic(180;0.215)	Renal(120;0.0458)	349			|Fibrinogen C-terminal.		A8K057|P04469|P04470|Q53Y18|Q96A14|Q96KJ3|Q9UC62|Q9UC63|Q9UCF3	Missense_Mutation	SNP	ENST00000336098.3	37	c.1046A>T	CCDS3788.1	.	.	.	.	.	.	.	.	.	.	T	18.03	3.532183	0.64972	.	.	ENSG00000171557	ENST00000404648;ENST00000405164;ENST00000336098;ENST00000407946	T;T;T;T	0.77229	-1.08;-1.08;-1.08;-1.08	5.8	5.8	0.92144	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 2 (1);	0.488620	0.24683	N	0.036453	T	0.78792	0.4339	L	0.49513	1.565	0.53005	D	0.999962	B;B;B;B;B	0.28512	0.108;0.18;0.108;0.214;0.178	B;B;B;B;B	0.38683	0.144;0.089;0.279;0.279;0.183	T	0.77678	-0.2498	10	0.59425	D	0.04	.	16.1384	0.81506	0.0:0.0:0.0:1.0	.	246;357;349;357;349	D3DP16;C9JC84;P02679;C9JEU5;P02679-2	.;.;FIBG_HUMAN;.;.	V	349;357;349;357	ENSP00000384860:E349V;ENSP00000384101:E357V;ENSP00000336829:E349V;ENSP00000384552:E357V	ENSP00000336829:E349V	E	-	2	0	FGG	155747390	0.996000	0.38824	1.000000	0.80357	0.997000	0.91878	2.625000	0.46452	2.205000	0.71048	0.533000	0.62120	GAA		0.423	FGG-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000317581.1	NM_021870		14	85	0	0	0	0.001855	0	14	85				
GRIA2	2891	broad.mit.edu	37	4	158238855	158238855	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr4:158238855G>A	ENST00000264426.9	+	5	991	c.712G>A	c.(712-714)Gca>Aca	p.A238T	GRIA2_ENST00000449365.1_Missense_Mutation_p.A191T|GRIA2_ENST00000393815.2_Missense_Mutation_p.A191T|GRIA2_ENST00000507898.1_Missense_Mutation_p.A191T|GRIA2_ENST00000296526.7_Missense_Mutation_p.A238T	NM_001083619.1	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2	238					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.A238T(2)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(2)|lung(32)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	79	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	CTACATCATTGCAAATCTGGT	0.254																																							uc003ipm.3		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(3)|ovary(1)	4						c.(712-714)GCA>ACA		glutamate receptor, ionotropic, AMPA 2 isoform 2	L-Glutamic Acid(DB00142)						37.0	39.0	38.0					4																	158238855		2195	4289	6484	SO:0001583	missense	2891				synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|endoplasmic reticulum membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity	g.chr4:158238855G>A		CCDS3797.1, CCDS43274.1, CCDS43275.1	4q32.1	2012-08-29			ENSG00000120251	ENSG00000120251		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4572	protein-coding gene	gene with protein product		138247		GLUR2		1311100	Standard	NM_001083619		Approved	GluA2, GLURB	uc003ipl.4	P42262	OTTHUMG00000133836	ENST00000264426.9:c.712G>A	4.37:g.158238855G>A	ENSP00000264426:p.Ala238Thr					GRIA2_uc011cit.1_Missense_Mutation_p.A191T|GRIA2_uc003ipl.3_Missense_Mutation_p.A238T|GRIA2_uc003ipk.3_Missense_Mutation_p.A191T|GRIA2_uc010iqh.1_RNA	p.A238T	NM_001083619	NP_001077088	P42262	GRIA2_HUMAN		COAD - Colon adenocarcinoma(41;0.0294)	5	1171	+	all_hematologic(180;0.24)	Renal(120;0.0458)	238			Extracellular (Potential).		A8MT92|I6L997|Q96FP6	Missense_Mutation	SNP	ENST00000264426.9	37	c.712G>A	CCDS43274.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.543409	0.86022	.	.	ENSG00000120251	ENST00000507898;ENST00000393815;ENST00000296526;ENST00000264426;ENST00000449365	T;T;T;T;T	0.81078	-1.45;-1.45;-1.45;-1.45;-1.45	5.17	5.17	0.71159	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.83622	0.5294	L	0.52126	1.63	0.80722	D	1	D;P;P	0.61697	0.99;0.897;0.874	P;P;P	0.60415	0.874;0.583;0.529	T	0.78211	-0.2292	10	0.06099	T	0.92	.	19.041	0.92999	0.0:0.0:1.0:0.0	.	238;238;191	P42262;P42262-2;A8MT92	GRIA2_HUMAN;.;.	T	191;191;238;238;191	ENSP00000426845:A191T;ENSP00000377403:A191T;ENSP00000296526:A238T;ENSP00000264426:A238T;ENSP00000389837:A191T	ENSP00000264426:A238T	A	+	1	0	GRIA2	158458305	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.277000	0.95755	2.547000	0.85894	0.563000	0.77884	GCA		0.254	GRIA2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000258367.2			4	16	0	0	0	0.001168	0	4	16				
PALLD	23022	broad.mit.edu	37	4	169837113	169837113	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr4:169837113C>T	ENST00000505667.1	+	17	2958	c.2785C>T	c.(2785-2787)Cac>Tac	p.H929Y	CBR4_ENST00000509108.1_Intron|PALLD_ENST00000261509.6_Missense_Mutation_p.H912Y|PALLD_ENST00000335742.7_Missense_Mutation_p.H754Y|PALLD_ENST00000507735.1_Missense_Mutation_p.H425Y|PALLD_ENST00000512127.1_Missense_Mutation_p.H530Y			Q8WX93	PALLD_HUMAN	palladin, cytoskeletal associated protein	1136					cytoskeleton organization (GO:0007010)	actin filament (GO:0005884)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	muscle alpha-actinin binding (GO:0051371)	p.H754Y(1)|p.H912Y(1)		breast(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(18)|ovary(3)|prostate(3)|skin(4)	48		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		CTTCAGACCTCACTTCTTGCA	0.423									Pancreatic Cancer, Familial Clustering of																												Esophageal Squamous(109;1482 1532 18347 40239 51172)	Esophageal Squamous(109;1482 1532 18347 40239 51172)	uc011cjx.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(2785-2787)CAC>TAC		palladin isoform 2							104.0	108.0	106.0					4																	169837113		2203	4300	6503	SO:0001583	missense	23022	Pancreatic_Cancer_Familial_Clustering_of	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1	cytoskeleton organization	actin filament|focal adhesion|lamellipodium|nucleus|ruffle|sarcomere	actin binding|muscle alpha-actinin binding	g.chr4:169837113C>T	AB023209	CCDS34098.1, CCDS54818.1, CCDS54819.1, CCDS54820.1	4q32.3	2013-01-11			ENSG00000129116	ENSG00000129116		"""Immunoglobulin superfamily / I-set domain containing"""	17068	protein-coding gene	gene with protein product		608092				10231032, 10931874	Standard	NM_001166108		Approved	KIAA0992, SIH002, CGI-151	uc011cjx.2	Q8WX93	OTTHUMG00000161097	ENST00000505667.1:c.2785C>T	4.37:g.169837113C>T	ENSP00000425556:p.His929Tyr					CBR4_uc011cjy.1_Intron|PALLD_uc003iru.2_Missense_Mutation_p.H912Y|PALLD_uc003irv.2_Missense_Mutation_p.H530Y|PALLD_uc003irw.2_Missense_Mutation_p.H414Y|PALLD_uc003irx.2_Missense_Mutation_p.H138Y	p.H929Y	NM_016081	NP_057165	Q8WX93	PALLD_HUMAN		GBM - Glioblastoma multiforme(119;0.204)	17	2996	+		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)	1136			Ig-like C2-type 4.		B3KTG2|B5MD56|B7ZMM5|Q7L3E0|Q7Z3W0|Q86WE8|Q8N1M2|Q9UGA0|Q9UQF5|Q9Y2J6|Q9Y3E9	Missense_Mutation	SNP	ENST00000505667.1	37	c.2785C>T	CCDS54818.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.569783	0.86439	.	.	ENSG00000129116	ENST00000261509;ENST00000335742;ENST00000505667;ENST00000512127;ENST00000507735	T;T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23;-0.23	5.68	5.68	0.88126	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.33496	U	0.004846	T	0.63450	0.2512	N	0.04746	-0.17	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;0.999;1.0	D;D;D;D	0.87578	0.998;0.996;0.996;0.998	T	0.57831	-0.7743	10	0.02654	T	1	.	19.7942	0.96472	0.0:1.0:0.0:0.0	.	929;1136;530;912	B7ZMM5;Q8WX93;B3KTG2;B2RTX2	.;PALLD_HUMAN;.;.	Y	912;754;929;530;425	ENSP00000261509:H912Y;ENSP00000336735:H754Y;ENSP00000425556:H929Y;ENSP00000426947:H530Y;ENSP00000424016:H425Y	ENSP00000261509:H912Y	H	+	1	0	PALLD	170073688	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.818000	0.86416	2.684000	0.91462	0.313000	0.20887	CAC		0.423	PALLD-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000363762.1	NM_016081		15	51	0	0	0	0.004007	0	15	51				
SNX25	83891	broad.mit.edu	37	4	186231802	186231802	+	Silent	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr4:186231802G>T	ENST00000504273.1	+	7	978	c.684G>T	c.(682-684)gcG>gcT	p.A228A	SNX25_ENST00000512853.1_3'UTR|SNX25_ENST00000264694.8_Silent_p.A228A			Q9H3E2	SNX25_HUMAN	sorting nexin 25	228					negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein transport (GO:0015031)|receptor catabolic process (GO:0032801)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)	p.A228A(1)		NS(1)|breast(4)|endometrium(2)|kidney(4)|large_intestine(8)|lung(13)|ovary(2)|pancreas(2)|prostate(2)|urinary_tract(2)	40		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)		AAGAAACTGCGGCAATGAAAG	0.478																																							uc003ixh.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|breast(2)|pancreas(1)	5						c.(682-684)GCG>GCT		sorting nexin 25							75.0	73.0	74.0					4																	186231802		2203	4300	6503	SO:0001819	synonymous_variant	83891				cell communication|protein transport	endosome membrane	phosphatidylinositol binding|signal transducer activity	g.chr4:186231802G>T	AF113223	CCDS34116.1	4q35.1	2011-05-03			ENSG00000109762	ENSG00000109762		"""Sorting nexins"""	21883	protein-coding gene	gene with protein product						12461558	Standard	NM_031953		Approved	SBBI31	uc003ixh.3	Q9H3E2	OTTHUMG00000160475	ENST00000504273.1:c.684G>T	4.37:g.186231802G>T						SNX25_uc010ish.2_5'UTR	p.A228A	NM_031953	NP_114159	Q9H3E2	SNX25_HUMAN		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)	7	873	+		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)	228					Q3ZT30|Q8N6K3	Silent	SNP	ENST00000504273.1	37	c.684G>T	CCDS34116.1																																																																																				0.478	SNX25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360756.1	NM_031953		12	56	1	0	1.61879e-10	0.001368	2.23528e-10	12	56				
FAT1	2195	broad.mit.edu	37	4	187524791	187524791	+	Missense_Mutation	SNP	T	T	C	rs372958192		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr4:187524791T>C	ENST00000441802.2	-	19	11098	c.10889A>G	c.(10888-10890)cAt>cGt	p.H3630R		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	3630	Cadherin 33. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.H3630R(1)|p.H3633R(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						TTGTCTGATATGCACTGTGAT	0.502										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)	Colon(197;1040 2055 4143 4984 49344)	uc003izf.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(10)|central_nervous_system(1)|pancreas(1)	12						c.(10888-10890)CAT>CGT		FAT tumor suppressor 1 precursor		T	ARG/HIS	2,4378	4.2+/-10.8	0,2,2188	99.0	103.0	102.0		10889	5.2	0.9	4		102	0,8574		0,0,4287	no	missense	FAT1	NM_005245.3	29	0,2,6475	CC,CT,TT		0.0,0.0457,0.0154	benign	3630/4589	187524791	2,12952	2190	4287	6477	SO:0001583	missense	2195				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding	g.chr4:187524791T>C	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.10889A>G	4.37:g.187524791T>C	ENSP00000406229:p.His3630Arg	HNSCC(5;0.00058)					p.H3630R	NM_005245	NP_005236	Q14517	FAT1_HUMAN			19	11077	-			3630			Extracellular (Potential).|Cadherin 33.			Missense_Mutation	SNP	ENST00000441802.2	37	c.10889A>G	CCDS47177.1	.	.	.	.	.	.	.	.	.	.	T	10.78	1.447775	0.26074	4.57E-4	0.0	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.41400	1.0	5.21	5.21	0.72293	Cadherin (3);Cadherin-like (1);	0.096982	0.64402	D	0.000001	T	0.34716	0.0907	N	0.25992	0.78	0.80722	D	1	B	0.26400	0.148	B	0.34991	0.193	T	0.12502	-1.0545	10	0.19590	T	0.45	.	15.254	0.73571	0.0:0.0:0.0:1.0	.	3630	Q14517	FAT1_HUMAN	R	3630;3632	ENSP00000406229:H3630R	ENSP00000260147:H3632R	H	-	2	0	FAT1	187761785	1.000000	0.71417	0.913000	0.36048	0.020000	0.10135	6.127000	0.71642	2.193000	0.70182	0.460000	0.39030	CAT		0.502	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245		13	39	0	0	0	0.00245	0	13	39				
NKD2	85409	broad.mit.edu	37	5	1037955	1037955	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr5:1037955G>T	ENST00000296849.5	+	10	1052	c.823G>T	c.(823-825)Ggc>Tgc	p.G275C	NKD2_ENST00000274150.4_3'UTR|NKD2_ENST00000382730.2_Intron	NM_033120.3	NP_149111.1	Q969F2	NKD2_HUMAN	naked cuticle homolog 2 (Drosophila)	275					exocytosis (GO:0006887)|Golgi vesicle fusion to target membrane (GO:0048210)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein processing (GO:0010954)|protein targeting to plasma membrane (GO:0072661)|Wnt signaling pathway (GO:0016055)	basolateral plasma membrane (GO:0016323)|cell periphery (GO:0071944)|cytoplasmic vesicle (GO:0031410)	calcium ion binding (GO:0005509)|growth factor binding (GO:0019838)|ubiquitin protein ligase binding (GO:0031625)	p.G275C(1)		breast(1)|central_nervous_system(3)|large_intestine(1)|lung(8)|pancreas(1)	14	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;3.28e-09)		Epithelial(17;0.00093)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00417)|Lung(60;0.165)			GGAGCCCCAGGGCAGGGCCTC	0.652																																							uc003jbt.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(823-825)GGC>TGC		naked cuticle homolog 2							19.0	22.0	21.0					5																	1037955		2188	4274	6462	SO:0001583	missense	85409				exocytosis|Wnt receptor signaling pathway	cytoplasmic membrane-bounded vesicle|plasma membrane	calcium ion binding|ubiquitin protein ligase binding	g.chr5:1037955G>T	AF358137	CCDS3859.1, CCDS59486.1	5p15.3	2013-01-10			ENSG00000145506	ENSG00000145506		"""EF-hand domain containing"""	17046	protein-coding gene	gene with protein product	"""naked cuticle-2"", ""Dvl-binding protein NKD2"""	607852				11356022, 11604995	Standard	NM_033120		Approved	Naked2	uc003jbt.2	Q969F2	OTTHUMG00000090348	ENST00000296849.5:c.823G>T	5.37:g.1037955G>T	ENSP00000296849:p.Gly275Cys					NKD2_uc010itf.1_3'UTR	p.G275C	NM_033120	NP_149111	Q969F2	NKD2_HUMAN	Epithelial(17;0.00093)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00417)|Lung(60;0.165)		10	828	+	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;3.28e-09)		275					Q96EK8|Q9BSN0	Missense_Mutation	SNP	ENST00000296849.5	37	c.823G>T	CCDS3859.1	.	.	.	.	.	.	.	.	.	.	G	9.912	1.209824	0.22289	.	.	ENSG00000145506	ENST00000296849	T	0.47177	0.85	3.85	2.97	0.34412	.	0.343217	0.25750	N	0.028554	T	0.57592	0.2064	L	0.59436	1.845	0.22601	N	0.998942	D	0.76494	0.999	D	0.65874	0.939	T	0.46952	-0.9154	10	0.59425	D	0.04	-1.9197	7.2021	0.25887	0.1302:0.0:0.8698:0.0	.	275	Q969F2	NKD2_HUMAN	C	275	ENSP00000296849:G275C	ENSP00000296849:G275C	G	+	1	0	NKD2	1090955	0.018000	0.18449	0.124000	0.21820	0.198000	0.23893	1.322000	0.33689	0.592000	0.29728	0.305000	0.20034	GGC		0.652	NKD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206720.2	NM_033120		22	53	1	0	7.41877e-09	0.001882	9.85662e-09	22	53				
DNAH5	1767	broad.mit.edu	37	5	13820510	13820510	+	Silent	SNP	C	C	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr5:13820510C>G	ENST00000265104.4	-	41	6890	c.6786G>C	c.(6784-6786)ggG>ggC	p.G2262G		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2262	AAA 2. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.G2262G(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					CCCCACTGGGCCCCAGAGTCA	0.532									Kartagener syndrome																														uc003jfd.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31						c.(6784-6786)GGG>GGC		dynein, axonemal, heavy chain 5							106.0	87.0	93.0					5																	13820510		2203	4300	6503	SO:0001819	synonymous_variant	1767	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr5:13820510C>G	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.6786G>C	5.37:g.13820510C>G							p.G2262G	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN			41	6828	-	Lung NSC(4;0.00476)		2262			AAA 2 (By similarity).|ATP (Potential).		Q92860|Q96L74|Q9H5S7|Q9HCG9	Silent	SNP	ENST00000265104.4	37	c.6786G>C	CCDS3882.1																																																																																				0.532	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369		20	46	0	0	0	0.010504	0	20	46				
PRDM9	56979	broad.mit.edu	37	5	23510114	23510114	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr5:23510114A>T	ENST00000296682.3	+	4	461	c.279A>T	c.(277-279)gaA>gaT	p.E93D		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	93					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)	p.E93D(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						ATTCTGATGAAGAATGGACCC	0.453										HNSCC(3;0.000094)																													uc003jgo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(2)|pancreas(1)	6						c.(277-279)GAA>GAT		PR domain containing 9							94.0	90.0	91.0					5																	23510114		1881	4116	5997	SO:0001583	missense	56979				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding	g.chr5:23510114A>T	AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.279A>T	5.37:g.23510114A>T	ENSP00000296682:p.Glu93Asp	HNSCC(3;0.000094)					p.E93D	NM_020227	NP_064612	Q9NQV7	PRDM9_HUMAN			4	461	+			93					B4DX22|Q27Q50	Missense_Mutation	SNP	ENST00000296682.3	37	c.279A>T	CCDS43307.1	.	.	.	.	.	.	.	.	.	.	A	16.18	3.050915	0.55218	.	.	ENSG00000164256	ENST00000502755;ENST00000296682	T;T	0.11604	2.76;2.92	3.79	0.925	0.19424	.	.	.	.	.	T	0.21186	0.0510	L	0.59436	1.845	0.22292	N	0.999222	D	0.58970	0.984	D	0.65443	0.935	T	0.11518	-1.0584	9	0.87932	D	0	-3.0239	3.2071	0.06670	0.5977:0.2337:0.1686:0.0	.	93	Q9NQV7	PRDM9_HUMAN	D	93	ENSP00000425471:E93D;ENSP00000296682:E93D	ENSP00000296682:E93D	E	+	3	2	PRDM9	23545871	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	1.319000	0.33655	0.104000	0.17725	0.496000	0.49642	GAA		0.453	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227		22	99	0	0	0	0.001882	0	22	99				
CDH10	1008	broad.mit.edu	37	5	24487878	24487878	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr5:24487878C>A	ENST00000264463.4	-	12	2768	c.2261G>T	c.(2260-2262)gGt>gTt	p.G754V	CDH10_ENST00000502921.1_5'UTR	NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	754					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G754V(1)		NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		TTCAGTAGTACCTGATTCTAA	0.468										HNSCC(23;0.051)																													uc003jgr.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|pancreas(4)|breast(2)	12						c.(2260-2262)GGT>GTT		cadherin 10, type 2 preproprotein							156.0	155.0	155.0					5																	24487878		2203	4300	6503	SO:0001583	missense	1008				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:24487878C>A	AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.2261G>T	5.37:g.24487878C>A	ENSP00000264463:p.Gly754Val	HNSCC(23;0.051)				CDH10_uc011cnu.1_RNA	p.G754V	NM_006727	NP_006718	Q9Y6N8	CAD10_HUMAN		STAD - Stomach adenocarcinoma(35;0.0556)	12	2593	-			754			Cytoplasmic (Potential).		Q9ULB3	Missense_Mutation	SNP	ENST00000264463.4	37	c.2261G>T	CCDS3892.1	.	.	.	.	.	.	.	.	.	.	C	3.280	-0.147173	0.06627	.	.	ENSG00000040731	ENST00000264463	T	0.77098	-1.07	5.81	5.81	0.92471	Cadherin, cytoplasmic domain (1);	0.592142	0.19513	N	0.112479	T	0.61198	0.2328	N	0.04959	-0.14	0.58432	D	0.999996	B	0.06786	0.001	B	0.09377	0.004	T	0.56257	-0.8009	10	0.16896	T	0.51	.	19.0503	0.93041	0.0:1.0:0.0:0.0	.	754	Q9Y6N8	CAD10_HUMAN	V	754	ENSP00000264463:G754V	ENSP00000264463:G754V	G	-	2	0	CDH10	24523635	0.060000	0.20803	1.000000	0.80357	0.999000	0.98932	1.063000	0.30567	2.750000	0.94351	0.655000	0.94253	GGT		0.468	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207345.2	NM_006727		48	165	1	0	1.00776e-21	0.00361	1.62747e-21	48	165				
CDH6	1004	broad.mit.edu	37	5	31299613	31299613	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr5:31299613G>A	ENST00000265071.2	+	5	951	c.686G>A	c.(685-687)aGg>aAg	p.R229K	CDH6_ENST00000514738.1_Missense_Mutation_p.R174K	NM_004932.3	NP_004923.1	P55285	CADH6_HUMAN	cadherin 6, type 2, K-cadherin (fetal kidney)	229	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R229K(1)		NS(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(42)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						CGAGAAAACAGGGAGCAGTAC	0.448																																							uc003jhe.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)|large_intestine(1)	7						c.(685-687)AGG>AAG		cadherin 6, type 2 preproprotein							149.0	140.0	143.0					5																	31299613		2203	4300	6503	SO:0001583	missense	1004				adherens junction organization|cell junction assembly|homophilic cell adhesion	cytoplasm|integral to membrane|nucleus|plasma membrane	calcium ion binding	g.chr5:31299613G>A	D31784	CCDS3894.1	5p13.3	2010-01-26			ENSG00000113361	ENSG00000113361		"""Cadherins / Major cadherins"""	1765	protein-coding gene	gene with protein product	"""K-Cadherin"""	603007				7743525, 10191097	Standard	NM_004932		Approved		uc003jhe.2	P55285	OTTHUMG00000090673	ENST00000265071.2:c.686G>A	5.37:g.31299613G>A	ENSP00000265071:p.Arg229Lys					CDH6_uc003jhd.1_Missense_Mutation_p.R229K	p.R229K	NM_004932	NP_004923	P55285	CADH6_HUMAN			5	1012	+			229			Extracellular (Potential).|Cadherin 2.		A8K5H5|Q9BWS0	Missense_Mutation	SNP	ENST00000265071.2	37	c.686G>A	CCDS3894.1	.	.	.	.	.	.	.	.	.	.	G	8.119	0.780553	0.16120	.	.	ENSG00000113361	ENST00000514738;ENST00000265071	T;T	0.52526	0.66;0.66	6.07	4.3	0.51218	Cadherin (4);Cadherin-like (1);	0.129681	0.64402	N	0.000002	T	0.21227	0.0511	N	0.03177	-0.4	0.39189	D	0.962925	B;B	0.02656	0.0;0.0	B;B	0.09377	0.004;0.004	T	0.18116	-1.0347	10	0.02654	T	1	.	12.8116	0.57643	0.1318:0.0:0.8682:0.0	.	229;229	P55285;P55285-2	CADH6_HUMAN;.	K	174;229	ENSP00000424843:R174K;ENSP00000265071:R229K	ENSP00000265071:R229K	R	+	2	0	CDH6	31335370	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.519000	0.60517	0.894000	0.36317	0.655000	0.94253	AGG		0.448	CDH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207355.2	NM_004932		25	120	0	0	0	0.005443	0	25	120				
ADAMTS12	81792	broad.mit.edu	37	5	33658393	33658393	+	Silent	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr5:33658393G>T	ENST00000504830.1	-	7	1421	c.1086C>A	c.(1084-1086)ggC>ggA	p.G362G	ADAMTS12_ENST00000352040.3_Silent_p.G362G|ADAMTS12_ENST00000504582.1_5'UTR	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	362	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.G362G(1)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						GGTGAGACAGGCCCAGGGTCT	0.507										HNSCC(64;0.19)																													uc003jia.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						c.(1084-1086)GGC>GGA		ADAM metallopeptidase with thrombospondin type 1							136.0	138.0	137.0					5																	33658393		2203	4300	6503	SO:0001819	synonymous_variant	81792				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:33658393G>T	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.1086C>A	5.37:g.33658393G>T		HNSCC(64;0.19)				ADAMTS12_uc010iuq.1_Silent_p.G362G	p.G362G	NM_030955	NP_112217	P58397	ATS12_HUMAN			7	1249	-			362			Peptidase M12B.		A2RRN9|A5D6V6|Q6UWL3	Silent	SNP	ENST00000504830.1	37	c.1086C>A	CCDS34140.1																																																																																				0.507	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955		38	185	1	0	1.59361e-14	0.006999	2.40109e-14	38	185				
RXFP3	51289	broad.mit.edu	37	5	33937505	33937505	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr5:33937505G>C	ENST00000330120.3	+	1	1015	c.660G>C	c.(658-660)tgG>tgC	p.W220C		NM_016568.3	NP_057652.1	Q9NSD7	RL3R1_HUMAN	relaxin/insulin-like family peptide receptor 3	220					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled peptide receptor activity (GO:0008528)|G-protein coupled receptor activity (GO:0004930)	p.W220C(1)		endometrium(4)|large_intestine(9)|lung(24)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)	42						TGTGTGTGTGGATCTGGGCTT	0.677																																							uc003jic.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)	1						c.(658-660)TGG>TGC		relaxin/insulin-like family peptide receptor 3							30.0	31.0	31.0					5																	33937505		2203	4300	6503	SO:0001583	missense	51289					integral to plasma membrane	N-formyl peptide receptor activity	g.chr5:33937505G>C	D88437	CCDS3900.1	5p15.1-p14	2012-08-08	2006-05-09	2006-03-15	ENSG00000182631	ENSG00000182631		"""GPCR / Class A : Relaxin family peptide receptors"""	24883	protein-coding gene	gene with protein product		609445	"""relaxin 3 receptor 1"", ""relaxin family peptide receptor 3"""	RLN3R1		15956688, 16507880	Standard	NM_016568		Approved	SALPR, GPCR135, RXFPR3	uc003jic.2	Q9NSD7	OTTHUMG00000090685	ENST00000330120.3:c.660G>C	5.37:g.33937505G>C	ENSP00000328708:p.Trp220Cys						p.W220C	NM_016568	NP_057652	Q9NSD7	RL3R1_HUMAN			1	1017	+			220			Helical; Name=4; (Potential).		Q14DA5	Missense_Mutation	SNP	ENST00000330120.3	37	c.660G>C	CCDS3900.1	.	.	.	.	.	.	.	.	.	.	G	3.174	-0.169442	0.06461	.	.	ENSG00000182631	ENST00000330120	T	0.36340	1.26	5.44	-0.0239	0.13941	GPCR, rhodopsin-like superfamily (1);	0.730927	0.12421	N	0.470417	T	0.18467	0.0443	N	0.01631	-0.79	0.39533	D	0.968692	B	0.02656	0.0	B	0.01281	0.0	T	0.08351	-1.0726	10	0.34782	T	0.22	-3.3044	22.006	0.99965	0.0:0.671:0.329:0.0	.	220	Q9NSD7	RL3R1_HUMAN	C	220	ENSP00000328708:W220C	ENSP00000328708:W220C	W	+	3	0	RXFP3	33973262	0.309000	0.24518	0.114000	0.21550	0.398000	0.30690	0.148000	0.16224	-0.265000	0.09352	-0.795000	0.03280	TGG		0.677	RXFP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207369.1	NM_016568		8	41	0	0	0	0.00308	0	8	41				
SLC45A2	51151	broad.mit.edu	37	5	33964062	33964062	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr5:33964062C>A	ENST00000296589.4	-	3	768	c.622G>T	c.(622-624)Gga>Tga	p.G208*	SLC45A2_ENST00000382102.3_Nonsense_Mutation_p.G208*|SLC45A2_ENST00000345083.5_Intron|SLC45A2_ENST00000342059.3_Nonsense_Mutation_p.G149*|SLC45A2_ENST00000509381.1_Intron	NM_016180.3	NP_057264	Q9UMX9	S45A2_HUMAN	solute carrier family 45, member 2	208					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)		p.G208*(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(25)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48						AACAGTCTTCCCAGCTCCAGA	0.458																																					Ovarian(31;380 859 8490 22203 49048)	Ovarian(31;380 859 8490 22203 49048)	uc003jid.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3						c.(622-624)GGA>TGA		membrane-associated transporter protein isoform							85.0	81.0	82.0					5																	33964062		2203	4300	6503	SO:0001587	stop_gained	51151				melanin biosynthetic process|response to stimulus|transmembrane transport|visual perception	integral to membrane|melanosome membrane		g.chr5:33964062C>A	AF172849	CCDS3901.1, CCDS43308.1, CCDS75232.1	5p13.3	2013-08-06	2005-10-06	2005-10-06	ENSG00000164175	ENSG00000164175		"""Solute carriers"""	16472	protein-coding gene	gene with protein product		606202	"""membrane associated transporter"""	MATP		11916009, 11574907	Standard	NM_001012509		Approved	AIM-1, OCA4	uc003jid.3	Q9UMX9	OTTHUMG00000090719	ENST00000296589.4:c.622G>T	5.37:g.33964062C>A	ENSP00000296589:p.Gly208*					SLC45A2_uc003jie.2_Nonsense_Mutation_p.G208*|SLC45A2_uc003jif.3_Intron|SLC45A2_uc011coe.1_Intron	p.G208*	NM_016180	NP_057264	Q9UMX9	S45A2_HUMAN			3	714	-			208			Extracellular (Potential).		Q6P2P0|Q9BTM3	Nonsense_Mutation	SNP	ENST00000296589.4	37	c.622G>T	CCDS3901.1	.	.	.	.	.	.	.	.	.	.	C	36	5.633932	0.96682	.	.	ENSG00000164175	ENST00000296589;ENST00000342059;ENST00000382102;ENST00000510600	.	.	.	5.93	5.06	0.68205	.	0.048778	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	-23.3892	13.9248	0.63955	0.0:0.9259:0.0:0.0741	.	.	.	.	X	208;149;208;33	.	ENSP00000296589:G208X	G	-	1	0	SLC45A2	33999819	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	5.065000	0.64344	1.506000	0.48736	0.563000	0.77884	GGA		0.458	SLC45A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207443.2	NM_016180		18	69	1	0	8.00594e-06	0.007413	9.51234e-06	18	69				
RANBP3L	202151	broad.mit.edu	37	5	36251594	36251594	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr5:36251594G>T	ENST00000296604.3	-	13	1660	c.1175C>A	c.(1174-1176)gCc>gAc	p.A392D	RANBP3L_ENST00000502994.1_Missense_Mutation_p.A417D	NM_145000.3	NP_659437.3	Q86VV4	RNB3L_HUMAN	RAN binding protein 3-like	392	RanBD1. {ECO:0000255|PROSITE- ProRule:PRU00164}.				intracellular transport (GO:0046907)			p.A392D(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|urinary_tract(1)	16	all_lung(31;4.52e-05)		Epithelial(62;0.0543)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.149)|Colorectal(62;0.202)			TGTATCTTGGGCACTGGCCTG	0.348																																							uc003jkh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1174-1176)GCC>GAC		RAN binding protein 3-like isoform 2							85.0	76.0	79.0					5																	36251594		2203	4300	6503	SO:0001583	missense	202151				intracellular transport			g.chr5:36251594G>T	BC047660	CCDS3918.1, CCDS54843.1	5p13.2	2008-02-05			ENSG00000164188	ENSG00000164188			26353	protein-coding gene	gene with protein product						12477932	Standard	NM_145000		Approved	FLJ25422	uc011cow.2	Q86VV4	OTTHUMG00000131110	ENST00000296604.3:c.1175C>A	5.37:g.36251594G>T	ENSP00000296604:p.Ala392Asp					RANBP3L_uc011cow.1_Missense_Mutation_p.A417D	p.A392D	NM_145000	NP_659437	Q86VV4	RNB3L_HUMAN	Epithelial(62;0.0543)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.149)|Colorectal(62;0.202)		13	1668	-	all_lung(31;4.52e-05)		392			RanBD1.		B7Z866|E9PGP9|Q96LK2	Missense_Mutation	SNP	ENST00000296604.3	37	c.1175C>A	CCDS3918.1	.	.	.	.	.	.	.	.	.	.	G	18.08	3.542946	0.65198	.	.	ENSG00000164188	ENST00000296604;ENST00000502994	T;T	0.24908	1.84;1.83	5.78	1.95	0.26073	Pleckstrin homology-type (1);Ran binding protein 1 (1);	0.276082	0.31660	N	0.007267	T	0.37210	0.0995	M	0.62723	1.935	0.80722	D	1	P;P	0.49783	0.813;0.928	P;P	0.54965	0.681;0.765	T	0.07501	-1.0769	10	0.59425	D	0.04	-0.5139	9.6391	0.39828	0.2977:0.0:0.7023:0.0	.	417;392	E9PGP9;Q86VV4	.;RNB3L_HUMAN	D	392;417	ENSP00000296604:A392D;ENSP00000421853:A417D	ENSP00000296604:A392D	A	-	2	0	RANBP3L	36287351	1.000000	0.71417	0.998000	0.56505	0.673000	0.39480	3.506000	0.53364	0.137000	0.18759	-0.137000	0.14449	GCC		0.348	RANBP3L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253773.2	NM_145000		13	48	1	0	9.05144e-12	0.001855	1.28783e-11	13	48				
MAP1B	4131	broad.mit.edu	37	5	71491553	71491553	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr5:71491553G>T	ENST00000296755.7	+	5	2669	c.2371G>T	c.(2371-2373)Gcc>Tcc	p.A791S		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	791					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)	p.A791S(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		GGAAGGCAAGGCCGCAGAGGC	0.527																																					Melanoma(17;367 822 11631 31730 47712)	Melanoma(17;367 822 11631 31730 47712)	uc003kbw.3		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5						c.(2371-2373)GCC>TCC		microtubule-associated protein 1B							46.0	51.0	49.0					5																	71491553		2203	4299	6502	SO:0001583	missense	4131					microtubule|microtubule associated complex	structural molecule activity	g.chr5:71491553G>T	L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.2371G>T	5.37:g.71491553G>T	ENSP00000296755:p.Ala791Ser					MAP1B_uc010iyw.1_Missense_Mutation_p.A808S|MAP1B_uc010iyx.1_Missense_Mutation_p.A665S|MAP1B_uc010iyy.1_Missense_Mutation_p.A665S	p.A791S	NM_005909	NP_005900	P46821	MAP1B_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)	5	2612	+		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)	791					A2BDK5	Missense_Mutation	SNP	ENST00000296755.7	37	c.2371G>T	CCDS4012.1	.	.	.	.	.	.	.	.	.	.	G	7.296	0.611991	0.14066	.	.	ENSG00000131711	ENST00000296755	T	0.03065	4.06	5.63	-9.47	0.00594	.	1.163690	0.06157	N	0.675294	T	0.02688	0.0081	N	0.22421	0.69	0.09310	N	0.999999	B;B	0.17038	0.02;0.006	B;B	0.14023	0.01;0.01	T	0.47598	-0.9105	10	0.49607	T	0.09	-0.0257	11.6131	0.51072	0.1332:0.3129:0.5539:0.0	.	665;791	A2BDK6;P46821	.;MAP1B_HUMAN	S	791	ENSP00000296755:A791S	ENSP00000296755:A791S	A	+	1	0	MAP1B	71527309	0.015000	0.18098	0.007000	0.13788	0.126000	0.20510	0.266000	0.18534	-1.180000	0.02734	-1.058000	0.02302	GCC		0.527	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218561.6	NM_005909		10	97	1	0	2.17888e-05	0.006214	2.53002e-05	10	97				
SV2C	22987	broad.mit.edu	37	5	75597285	75597285	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr5:75597285A>T	ENST00000502798.2	+	12	2357	c.1915A>T	c.(1915-1917)Atg>Ttg	p.M639L	SV2C_ENST00000322285.7_Missense_Mutation_p.M639L|RP11-466P24.6_ENST00000502589.1_RNA	NM_014979.1	NP_055794.1	Q496J9	SV2C_HUMAN	synaptic vesicle glycoprotein 2C	639					neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	transmembrane transporter activity (GO:0022857)	p.M639L(1)		NS(1)|breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)		GATGATAGGCATGCTGTGTCT	0.507																																							uc003kei.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1915-1917)ATG>TTG		synaptic vesicle glycoprotein 2C							275.0	264.0	268.0					5																	75597285		2064	4204	6268	SO:0001583	missense	22987				neurotransmitter transport	cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity	g.chr5:75597285A>T	AB028977	CCDS43331.1, CCDS75261.1	5q13	2008-02-05			ENSG00000122012	ENSG00000122012			30670	protein-coding gene	gene with protein product		610291				10470851, 9801366	Standard	XM_005248470		Approved		uc003kei.1	Q496J9	OTTHUMG00000162384	ENST00000502798.2:c.1915A>T	5.37:g.75597285A>T	ENSP00000423541:p.Met639Leu						p.M639L	NM_014979	NP_055794	Q496J9	SV2C_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)	12	2049	+		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)	639			Helical; (Potential).		Q496K1|Q9UPU8	Missense_Mutation	SNP	ENST00000502798.2	37	c.1915A>T	CCDS43331.1	.	.	.	.	.	.	.	.	.	.	A	9.030	0.986979	0.18889	.	.	ENSG00000122012	ENST00000502798;ENST00000322285	T;T	0.35973	1.28;1.28	5.67	4.5	0.54988	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.036678	0.85682	D	0.000000	T	0.13030	0.0316	N	0.02315	-0.6	0.58432	D	0.99999	B	0.02656	0.0	B	0.04013	0.001	T	0.15350	-1.0440	10	0.02654	T	1	-23.9897	11.1592	0.48505	0.9249:0.0:0.075:0.0	.	639	Q496J9	SV2C_HUMAN	L	639	ENSP00000423541:M639L;ENSP00000316983:M639L	ENSP00000316983:M639L	M	+	1	0	SV2C	75633041	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.235000	0.72332	1.067000	0.40740	0.533000	0.62120	ATG		0.507	SV2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368700.4			9	164	0	0	0	0.006214	0	9	164				
RGMB	285704	broad.mit.edu	37	5	98128880	98128880	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr5:98128880G>A	ENST00000513185.1	+	3	1173	c.737G>A	c.(736-738)gGc>gAc	p.G246D	RGMB_ENST00000308234.7_Missense_Mutation_p.G287D			Q6NW40	RGMB_HUMAN	repulsive guidance molecule family member b	246					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|cell adhesion (GO:0007155)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)	anchored component of plasma membrane (GO:0046658)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)	identical protein binding (GO:0042802)	p.G287D(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	10		all_cancers(142;2.76e-08)|all_epithelial(76;2.98e-11)|all_lung(232;0.000485)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0587)		TTTGTGGATGGCACCACCAGT	0.542																																							uc003knc.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(859-861)GGC>GAC		RGM domain family, member B							45.0	46.0	46.0					5																	98128880		2068	4213	6281	SO:0001583	missense	285704				axon guidance|BMP signaling pathway|cell adhesion|positive regulation of transcription, DNA-dependent	anchored to plasma membrane|ER-Golgi intermediate compartment|membrane raft	identical protein binding	g.chr5:98128880G>A	AK074887	CCDS47251.1	5q21.1	2013-11-06	2013-11-06		ENSG00000174136	ENSG00000174136			26896	protein-coding gene	gene with protein product		612687	"""RGM domain family, member B"""			19324014	Standard	NM_001012761		Approved	FLJ90406, DRAGON	uc003knc.3	Q6NW40	OTTHUMG00000162745	ENST00000513185.1:c.737G>A	5.37:g.98128880G>A	ENSP00000423256:p.Gly246Asp						p.G287D	NM_001012761	NP_001012779	Q6NW40	RGMB_HUMAN		COAD - Colon adenocarcinoma(37;0.0587)	5	1262	+		all_cancers(142;2.76e-08)|all_epithelial(76;2.98e-11)|all_lung(232;0.000485)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|Ovarian(225;0.024)|Colorectal(57;0.117)	246					D6R9A0|Q8NC92	Missense_Mutation	SNP	ENST00000513185.1	37	c.860G>A		.	.	.	.	.	.	.	.	.	.	G	28.8	4.949456	0.92660	.	.	ENSG00000174136	ENST00000308234;ENST00000513185	D;D	0.97455	-4.39;-4.39	5.75	5.75	0.90469	Repulsive guidance molecule, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98642	0.9545	M	0.85197	2.74	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99410	1.0930	10	0.87932	D	0	-29.0386	19.9165	0.97064	0.0:0.0:1.0:0.0	.	246	Q6NW40	RGMB_HUMAN	D	287;246	ENSP00000308219:G287D;ENSP00000423256:G246D	ENSP00000308219:G287D	G	+	2	0	RGMB	98156780	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.818000	0.99354	2.705000	0.92388	0.563000	0.77884	GGC		0.542	RGMB-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000370308.1	NM_173670		3	42	0	0	0	0.004672	0	3	42				
FBN2	2201	broad.mit.edu	37	5	127681130	127681130	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr5:127681130T>C	ENST00000508053.1	-	30	4110	c.3136A>G	c.(3136-3138)Aag>Gag	p.K1046E	FBN2_ENST00000262464.4_Missense_Mutation_p.K1046E|FBN2_ENST00000508989.1_Missense_Mutation_p.K1013E			P35556	FBN2_HUMAN	fibrillin 2	1046	TB 5.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.K1046E(2)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		TCGTATTCCTTGGTGCCAGGT	0.622																																							uc003kuu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15						c.(3136-3138)AAG>GAG		fibrillin 2 precursor							83.0	85.0	85.0					5																	127681130		2203	4300	6503	SO:0001583	missense	2201				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent	g.chr5:127681130T>C	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.3136A>G	5.37:g.127681130T>C	ENSP00000424571:p.Lys1046Glu					FBN2_uc003kuv.2_Missense_Mutation_p.K1013E	p.K1046E	NM_001999	NP_001990	P35556	FBN2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)	24	3575	-		all_cancers(142;0.0216)|Prostate(80;0.0551)	1046			TB 5.		B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	c.3136A>G	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	T	8.377	0.836602	0.16891	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000508989	D;D;D	0.91894	-2.93;-2.93;-2.93	4.22	4.22	0.49857	Matrix fibril-associated (3);TGF-beta binding (1);	0.087235	0.45867	D	0.000331	T	0.79347	0.4430	N	0.02539	-0.55	0.26243	N	0.97884	B;B	0.20459	0.045;0.017	B;B	0.33568	0.166;0.016	T	0.64715	-0.6342	10	0.06236	T	0.91	.	10.8137	0.46562	0.0:0.0:0.2801:0.7199	.	1013;1046	D6RJI3;P35556	.;FBN2_HUMAN	E	1046;1046;1013	ENSP00000262464:K1046E;ENSP00000424571:K1046E;ENSP00000425596:K1013E	ENSP00000262464:K1046E	K	-	1	0	FBN2	127709029	0.013000	0.17824	1.000000	0.80357	0.727000	0.41649	0.642000	0.24735	2.144000	0.66660	0.460000	0.39030	AAG		0.622	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999		11	118	0	0	0	0.001855	0	11	118				
PCDHB6	56130	broad.mit.edu	37	5	140531776	140531776	+	Silent	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr5:140531776C>A	ENST00000231136.1	+	1	1938	c.1938C>A	c.(1936-1938)ggC>ggA	p.G646G	PCDHB6_ENST00000543635.1_Silent_p.G510G	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	646	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.G646G(1)		cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGGACAATGGCGAGCCTCCGC	0.706																																							uc003lir.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(1936-1938)GGC>GGA		protocadherin beta 6 precursor							22.0	25.0	24.0					5																	140531776		2095	4118	6213	SO:0001819	synonymous_variant	56130				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140531776C>A	AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.1938C>A	5.37:g.140531776C>A						PCDHB6_uc011dah.1_Silent_p.G510G	p.G646G	NM_018939	NP_061762	Q9Y5E3	PCDB6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1938	+			646			Cadherin 6.|Extracellular (Potential).		B2R8R9	Silent	SNP	ENST00000231136.1	37	c.1938C>A	CCDS4248.1																																																																																				0.706	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251818.2	NM_018939		17	59	1	0	1.55795e-14	0.001882	2.35367e-14	17	59				
PCDHB16	57717	broad.mit.edu	37	5	140562573	140562573	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr5:140562573C>A	ENST00000361016.2	+	1	1594	c.439C>A	c.(439-441)Cct>Act	p.P147T		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	147	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P147T(1)		breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGAAAACAGTCCTCTAGGAAC	0.388																																							uc003liv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(439-441)CCT>ACT		protocadherin beta 16 precursor							39.0	42.0	41.0					5																	140562573		2202	4300	6502	SO:0001583	missense	57717				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140562573C>A	AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.439C>A	5.37:g.140562573C>A	ENSP00000354293:p.Pro147Thr					PCDHB16_uc010jfw.1_Intron	p.P147T	NM_020957	NP_066008	Q9NRJ7	PCDBG_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1594	+			147			Extracellular (Potential).|Cadherin 2.		B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Missense_Mutation	SNP	ENST00000361016.2	37	c.439C>A	CCDS4251.1	.	.	.	.	.	.	.	.	.	.	C	0.809	-0.752855	0.03041	.	.	ENSG00000196963	ENST00000361016	T	0.54675	0.56	4.69	0.305	0.15801	Cadherin (3);Cadherin-like (1);	0.820851	0.09943	N	0.735674	T	0.37598	0.1009	L	0.43923	1.385	0.09310	N	1	B	0.16166	0.016	B	0.16289	0.015	T	0.27088	-1.0084	10	0.15066	T	0.55	.	5.0343	0.14426	0.1141:0.286:0.4664:0.1335	.	147	Q9NRJ7	PCDBG_HUMAN	T	147	ENSP00000354293:P147T	ENSP00000354293:P147T	P	+	1	0	PCDHB16	140542757	0.000000	0.05858	0.027000	0.17364	0.272000	0.26649	-2.300000	0.01138	0.021000	0.15133	0.655000	0.94253	CCT		0.388	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957		15	32	1	0	2.32078e-09	0.003163	3.13529e-09	15	32				
PCDHB12	56124	broad.mit.edu	37	5	140589769	140589769	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr5:140589769G>T	ENST00000239450.2	+	1	1479	c.1290G>T	c.(1288-1290)agG>agT	p.R430S	PCDHB12_ENST00000541609.1_Missense_Mutation_p.R93S	NM_018932.3	NP_061755.1	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12	430	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.R430S(1)		NS(1)|breast(3)|endometrium(10)|large_intestine(17)|lung(38)|ovary(3)|pancreas(1)|prostate(2)|skin(7)|stomach(1)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGACCCCCAGGCTAAAAACCG	0.537																																							uc003liz.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(1288-1290)AGG>AGT		protocadherin beta 12 precursor							95.0	92.0	93.0					5																	140589769		2203	4300	6503	SO:0001583	missense	56124				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding	g.chr5:140589769G>T	AF152491	CCDS4254.1	5q31	2010-01-26			ENSG00000120328	ENSG00000120328		"""Cadherins / Protocadherins : Clustered"""	8683	other	protocadherin		606338				10380929	Standard	NM_018932		Approved	PCDH-BETA12	uc003liz.3	Q9Y5F1	OTTHUMG00000129620	ENST00000239450.2:c.1290G>T	5.37:g.140589769G>T	ENSP00000239450:p.Arg430Ser					PCDHB12_uc011dak.1_Missense_Mutation_p.R93S	p.R430S	NM_018932	NP_061755	Q9Y5F1	PCDBC_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1479	+			430			Extracellular (Potential).|Cadherin 4.		B4DDU1	Missense_Mutation	SNP	ENST00000239450.2	37	c.1290G>T	CCDS4254.1	.	.	.	.	.	.	.	.	.	.	G	5.435	0.265403	0.10294	.	.	ENSG00000120328	ENST00000541609;ENST00000239450;ENST00000507840	T;T	0.50001	0.76;0.76	3.83	-0.133	0.13485	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.49695	0.1572	L	0.43598	1.365	0.09310	N	1	D	0.76494	0.999	D	0.71656	0.974	T	0.34850	-0.9812	9	0.39692	T	0.17	.	1.0606	0.01600	0.311:0.1523:0.382:0.1548	.	430	Q9Y5F1	PCDBC_HUMAN	S	93;430;50	ENSP00000440199:R93S;ENSP00000239450:R430S	ENSP00000239450:R430S	R	+	3	2	PCDHB12	140569953	0.000000	0.05858	0.011000	0.14972	0.041000	0.13682	-2.088000	0.01359	0.052000	0.16007	0.485000	0.47835	AGG		0.537	PCDHB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251815.2	NM_018932		14	121	1	0	2.61681e-11	0.00245	3.67662e-11	14	121				
PCDHGA1	56114	broad.mit.edu	37	5	140711266	140711266	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr5:140711266G>A	ENST00000517417.1	+	1	1015	c.1015G>A	c.(1015-1017)Gat>Aat	p.D339N	AC005618.6_ENST00000606901.1_lincRNA|PCDHGA1_ENST00000378105.3_Missense_Mutation_p.D339N	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1	339	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D339N(2)		breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAAAGTTTTGGATGTAAATGA	0.433																																							uc003lji.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|breast(1)|pancreas(1)	3						c.(1015-1017)GAT>AAT		protocadherin gamma subfamily A, 1 isoform 1							69.0	68.0	68.0					5																	140711266		2203	4300	6503	SO:0001583	missense	56114				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140711266G>A	AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.1015G>A	5.37:g.140711266G>A	ENSP00000431083:p.Asp339Asn					PCDHGA1_uc011dan.1_Missense_Mutation_p.D339N	p.D339N	NM_018912	NP_061735	Q9Y5H4	PCDG1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1015	+			339			Cadherin 3.|Extracellular (Potential).		Q2M273|Q9Y5D6	Missense_Mutation	SNP	ENST00000517417.1	37	c.1015G>A	CCDS54922.1	.	.	.	.	.	.	.	.	.	.	G	16.69	3.193033	0.58017	.	.	ENSG00000204956	ENST00000517417;ENST00000378105	T;T	0.74209	-0.82;-0.82	3.99	3.99	0.46301	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	0.000000	0.46442	U	0.000294	D	0.88847	0.6548	H	0.95079	3.62	0.38827	D	0.955762	P;P	0.48694	0.914;0.86	P;P	0.58873	0.847;0.634	D	0.93230	0.6616	10	0.87932	D	0	.	16.2627	0.82553	0.0:0.0:1.0:0.0	.	339;339	Q9Y5H4-2;Q9Y5H4	.;PCDG1_HUMAN	N	339	ENSP00000431083:D339N;ENSP00000367345:D339N	ENSP00000367345:D339N	D	+	1	0	PCDHGA1	140691450	1.000000	0.71417	0.996000	0.52242	0.375000	0.29983	9.601000	0.98297	2.237000	0.73441	0.650000	0.86243	GAT		0.433	PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374737.1	NM_018912		7	42	0	0	0	0.00308	0	7	42				
PCDHGB1	56104	broad.mit.edu	37	5	140730903	140730903	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr5:140730903G>T	ENST00000523390.1	+	1	1076	c.1076G>T	c.(1075-1077)gGa>gTa	p.G359V	PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018922.2|NM_032095.1	NP_061745.1|NP_115266.1	Q9Y5G3	PCDGD_HUMAN	protocadherin gamma subfamily B, 1	359	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G359V(1)		central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCAGACCTTGGAACTGTAATA	0.418																																							uc003ljo.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1075-1077)GGA>GTA		protocadherin gamma subfamily B, 1 isoform 1							42.0	42.0	42.0					5																	140730903		1902	4124	6026	SO:0001583	missense	56104				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140730903G>T	AF152517	CCDS54923.1, CCDS75330.1	5q31	2010-01-26				ENSG00000254221		"""Cadherins / Protocadherins : Clustered"""	8708	other	protocadherin	"""protocadherin gamma subfamily B, 1, isoform 2"""	606299				10380929	Standard	NM_018922		Approved	PCDH-GAMMA-B1		Q9Y5G3		ENST00000523390.1:c.1076G>T	5.37:g.140730903G>T	ENSP00000429273:p.Gly359Val					PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc011daq.1_Missense_Mutation_p.G359V	p.G359V	NM_018922	NP_061745	Q9Y5G3	PCDGD_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1076	+			359			Extracellular (Potential).|Cadherin 4.		Q3SY75|Q9Y5C8	Missense_Mutation	SNP	ENST00000523390.1	37	c.1076G>T	CCDS54923.1	.	.	.	.	.	.	.	.	.	.	.	16.61	3.171422	0.57584	.	.	ENSG00000254221	ENST00000523390	T	0.32988	1.43	5.49	5.49	0.81192	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.75824	0.3902	H	0.99498	4.595	0.52501	D	0.999958	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.86760	0.1966	9	0.87932	D	0	.	19.3497	0.94378	0.0:0.0:1.0:0.0	.	359;359	Q9Y5G3-2;Q9Y5G3	.;PCDGD_HUMAN	V	359	ENSP00000429273:G359V	ENSP00000429273:G359V	G	+	2	0	PCDHGB1	140711087	1.000000	0.71417	0.963000	0.40424	0.883000	0.51084	7.843000	0.86859	2.740000	0.93945	0.563000	0.77884	GGA		0.418	PCDHGB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374740.1	NM_018922		14	15	1	0	1.3612e-06	0.003163	1.65584e-06	14	15				
SPINK5	11005	broad.mit.edu	37	5	147493975	147493975	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr5:147493975C>A	ENST00000256084.7	+	21	1980	c.1938C>A	c.(1936-1938)tgC>tgA	p.C646*	SPINK5_ENST00000359874.3_Nonsense_Mutation_p.C646*|SPINK5_ENST00000398454.1_Nonsense_Mutation_p.C646*	NM_006846.3	NP_006837.2	Q9NQ38	ISK5_HUMAN	serine peptidase inhibitor, Kazal type 5	646	Kazal-like 10. {ECO:0000255|PROSITE- ProRule:PRU00798}.				anagen (GO:0042640)|epidermal cell differentiation (GO:0009913)|epithelial cell differentiation (GO:0030855)|extracellular matrix organization (GO:0030198)|hair cell differentiation (GO:0035315)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of immune response (GO:0050777)|negative regulation of proteolysis (GO:0045861)|negative regulation of serine-type peptidase activity (GO:1902572)|regulation of cell adhesion (GO:0030155)|regulation of T cell differentiation (GO:0045580)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|epidermal lamellar body (GO:0097209)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.C646*(4)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(8)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AACTTTTCTGCACAAGAGAAA	0.428																																							uc003lox.2		NA																	4	Substitution - Nonsense(4)		large_intestine(2)|lung(2)	skin(2)|ovary(1)|breast(1)	4						c.(1936-1938)TGC>TGA		serine peptidase inhibitor, Kazal type 5 isoform							78.0	75.0	76.0					5																	147493975		1866	4107	5973	SO:0001587	stop_gained	11005				anagen|epithelial cell differentiation|extracellular matrix organization|hair cell differentiation|negative regulation of angiogenesis|negative regulation of immune response|regulation of T cell differentiation	cell cortex|cytosol|endoplasmic reticulum membrane|extracellular region|lamellar body|perinuclear region of cytoplasm	serine-type endopeptidase inhibitor activity	g.chr5:147493975C>A	AJ228139	CCDS43382.1, CCDS47300.1, CCDS47301.1	5q31-q32	2014-09-17	2005-08-17		ENSG00000133710	ENSG00000133710		"""Serine peptidase inhibitors, Kazal type"""	15464	protein-coding gene	gene with protein product	"""lymphoepithelial Kazal-type-related inhibitor"""	605010	"""serine protease inhibitor, Kazal type 5"""			10419450	Standard	NM_001127698		Approved	VAKTI, LEKTI, LETKI, NETS, NS, FLJ21544, FLJ97536, FLJ97596, FLJ99794, DKFZp686K19184	uc003loy.2	Q9NQ38	OTTHUMG00000134305	ENST00000256084.7:c.1938C>A	5.37:g.147493975C>A	ENSP00000256084:p.Cys646*					SPINK5_uc010jgs.1_Nonsense_Mutation_p.C618*|SPINK5_uc010jgr.2_Nonsense_Mutation_p.C627*|SPINK5_uc003low.2_Nonsense_Mutation_p.C646*|SPINK5_uc003loy.2_Nonsense_Mutation_p.C646*	p.C646*	NM_006846	NP_006837	Q9NQ38	ISK5_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		21	2011	+			646			Kazal-like 10.		A8MYE8|B7WPB7|D6REN5|O75770|Q3LX95|Q3LX96|Q3LX97|Q96PP2|Q96PP3	Nonsense_Mutation	SNP	ENST00000256084.7	37	c.1938C>A	CCDS43382.1	.	.	.	.	.	.	.	.	.	.	C	37	6.605553	0.97701	.	.	ENSG00000133710	ENST00000398454;ENST00000359874;ENST00000508733;ENST00000256084	.	.	.	5.42	4.53	0.55603	.	0.183721	0.38837	N	0.001557	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.7038	10.7148	0.46006	0.0:0.9073:0.0:0.0927	.	.	.	.	X	646;646;627;646	.	ENSP00000256084:C646X	C	+	3	2	SPINK5	147474168	0.999000	0.42202	1.000000	0.80357	0.956000	0.61745	0.405000	0.21015	2.703000	0.92315	0.655000	0.94253	TGC		0.428	SPINK5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000259215.2	NM_001127698		7	59	1	0	0.00198382	0.001984	0.00212768	7	59				
SPARC	6678	broad.mit.edu	37	5	151051154	151051154	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr5:151051154G>T	ENST00000231061.4	-	5	623	c.310C>A	c.(310-312)Ccc>Acc	p.P104T		NM_003118.3	NP_003109.1	P09486	SPRC_HUMAN	secreted protein, acidic, cysteine-rich (osteonectin)	104	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				blood coagulation (GO:0007596)|bone development (GO:0060348)|cellular response to growth factor stimulus (GO:0071363)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|inner ear development (GO:0048839)|lung development (GO:0030324)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|ossification (GO:0001503)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of endothelial cell migration (GO:0010595)|regulation of cell morphogenesis (GO:0022604)|response to cadmium ion (GO:0046686)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to gravity (GO:0009629)|response to L-ascorbic acid (GO:0033591)|response to lead ion (GO:0010288)|response to lipopolysaccharide (GO:0032496)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	basement membrane (GO:0005604)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nuclear matrix (GO:0016363)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|platelet alpha granule membrane (GO:0031092)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix binding (GO:0050840)	p.P104T(1)		central_nervous_system(3)|large_intestine(5)|lung(5)|ovary(1)|urinary_tract(1)	15		Medulloblastoma(196;0.109)|all_hematologic(541;0.122)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)	OV - Ovarian serous cystadenocarcinoma(192;0.00118)		TCGCCAATGGGGGCTGGGCAG	0.597																																							uc003luh.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(310-312)CCC>ACC		secreted protein, acidic, cysteine-rich	Becaplermin(DB00102)						147.0	146.0	146.0					5																	151051154		2203	4300	6503	SO:0001583	missense	6678				ossification|platelet activation|platelet degranulation|signal transduction	basement membrane|extracellular space|platelet alpha granule lumen	calcium ion binding|collagen binding	g.chr5:151051154G>T		CCDS4318.1	5q31-q33	2012-10-02			ENSG00000113140	ENSG00000113140			11219	protein-coding gene	gene with protein product	"""cysteine-rich protein"", ""osteonectin"""	182120		ON		2838412, 3410046	Standard	NM_003118		Approved		uc003lui.4	P09486	OTTHUMG00000130122	ENST00000231061.4:c.310C>A	5.37:g.151051154G>T	ENSP00000231061:p.Pro104Thr					GM2A_uc011dcs.1_Intron|SPARC_uc003lug.2_Intron|SPARC_uc003lui.2_Missense_Mutation_p.P104T	p.P104T	NM_003118	NP_003109	P09486	SPRC_HUMAN	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)	OV - Ovarian serous cystadenocarcinoma(192;0.00118)	4	334	-		Medulloblastoma(196;0.109)|all_hematologic(541;0.122)	104			Kazal-like.		D3DQH9|Q6IBK4	Missense_Mutation	SNP	ENST00000231061.4	37	c.310C>A	CCDS4318.1	.	.	.	.	.	.	.	.	.	.	G	12.65	2.002617	0.35320	.	.	ENSG00000113140	ENST00000231061;ENST00000538026;ENST00000521569;ENST00000539687	T;T;T;T	0.29655	1.56;1.56;1.56;1.59	5.39	5.39	0.77823	Proteinase inhibitor I1, Kazal (2);	0.212863	0.49916	D	0.000134	T	0.27278	0.0669	L	0.42245	1.32	0.38252	D	0.941644	B	0.02656	0.0	B	0.06405	0.002	T	0.08066	-1.0740	10	0.45353	T	0.12	-21.1278	12.3111	0.54929	0.0:0.0:0.714:0.286	.	104	P09486	SPRC_HUMAN	T	104;13;13;104	ENSP00000231061:P104T;ENSP00000440127:P13T;ENSP00000428119:P13T;ENSP00000444998:P104T	ENSP00000231061:P104T	P	-	1	0	SPARC	151031347	1.000000	0.71417	0.983000	0.44433	0.802000	0.45316	3.376000	0.52417	2.517000	0.84864	0.561000	0.74099	CCC		0.597	SPARC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252430.1	NM_003118		8	198	1	0	7.48243e-07	0.006214	9.30337e-07	8	198				
DOCK2	1794	broad.mit.edu	37	5	169141163	169141163	+	Silent	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr5:169141163G>T	ENST00000256935.8	+	18	1871	c.1791G>T	c.(1789-1791)cgG>cgT	p.R597R	DOCK2_ENST00000520908.1_Silent_p.R89R|DOCK2_ENST00000540750.1_5'UTR	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	597	DHR-1.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TCAGCTCCCGGGATGTGTTCT	0.547																																							uc003maf.2		NA																	0				ovary(5)|pancreas(2)	7						c.(1789-1791)CGG>CGT		dedicator of cytokinesis 2							64.0	60.0	61.0					5																	169141163		2203	4300	6503	SO:0001819	synonymous_variant	1794				actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding	g.chr5:169141163G>T	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.1791G>T	5.37:g.169141163G>T						DOCK2_uc011der.1_RNA|DOCK2_uc010jjm.2_Silent_p.R89R|DOCK2_uc010jjl.1_Silent_p.R115R	p.R597R	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		18	1871	+	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	597			DHR-1.		Q2M3I0|Q96AK7	Silent	SNP	ENST00000256935.8	37	c.1791G>T	CCDS4371.1																																																																																				0.547	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946		15	47	1	0	7.93312e-07	0.00245	9.77722e-07	15	47				
DOCK2	1794	broad.mit.edu	37	5	169509853	169509853	+	Silent	SNP	G	G	A	rs140198889	byFrequency	TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr5:169509853G>A	ENST00000256935.8	+	52	5564	c.5484G>A	c.(5482-5484)acG>acA	p.T1828T	DOCK2_ENST00000520908.1_Silent_p.T1320T|DOCK2_ENST00000540750.1_Silent_p.T889T|DOCK2_ENST00000523351.1_3'UTR	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1828					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)	p.T1828T(1)		NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CGCTGTCCACGGACCTGTGAG	0.522													G|||	6	0.00119808	0.0038	0.0014	5008	,	,		21803	0.0		0.0	False		,,,				2504	0.0						uc003maf.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|pancreas(2)	7						c.(5482-5484)ACG>ACA		dedicator of cytokinesis 2		G		20,4386	26.2+/-53.5	0,20,2183	74.0	71.0	72.0		5484	-9.1	0.0	5	dbSNP_134	72	0,8600		0,0,4300	no	coding-synonymous	DOCK2	NM_004946.2		0,20,6483	AA,AG,GG		0.0,0.4539,0.1538		1828/1831	169509853	20,12986	2203	4300	6503	SO:0001819	synonymous_variant	1794				actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding	g.chr5:169509853G>A	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.5484G>A	5.37:g.169509853G>A						DOCK2_uc011der.1_RNA|DOCK2_uc010jjm.2_Silent_p.T1320T|DOCK2_uc003mah.2_Silent_p.T384T	p.T1828T	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		52	5564	+	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	1828					Q2M3I0|Q96AK7	Silent	SNP	ENST00000256935.8	37	c.5484G>A	CCDS4371.1																																																																																				0.522	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946		12	40	0	0	0	0.001368	0	12	40				
KIF13A	63971	broad.mit.edu	37	6	17837141	17837141	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr6:17837141C>T	ENST00000259711.6	-	11	1228	c.1123G>A	c.(1123-1125)Gag>Aag	p.E375K	KIF13A_ENST00000378826.2_Missense_Mutation_p.E375K|KIF13A_ENST00000378816.5_Missense_Mutation_p.E375K|KIF13A_ENST00000378814.5_Missense_Mutation_p.E375K|KIF13A_ENST00000378843.2_Missense_Mutation_p.E375K	NM_022113.5	NP_071396.4	Q9H1H9	KI13A_HUMAN	kinesin family member 13A	375					ATP catabolic process (GO:0006200)|cargo loading into vesicle (GO:0035459)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|Golgi to plasma membrane protein transport (GO:0043001)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)	centrosome (GO:0005813)|endosome membrane (GO:0010008)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|trans-Golgi network membrane (GO:0032588)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.E375K(2)		breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	64	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			CTCAGTTTCTCGACTTCCTCC	0.517																																							uc003ncg.3		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(2)|ovary(2)	4						c.(1123-1125)GAG>AAG		kinesin family member 13A isoform a							225.0	221.0	222.0					6																	17837141		1946	4149	6095	SO:0001583	missense	63971				cargo loading into vesicle|cell cycle|cytokinesis|endosome to lysosome transport|Golgi to plasma membrane protein transport|melanosome organization|plus-end-directed vesicle transport along microtubule	centrosome|endosome membrane|microtubule|midbody|trans-Golgi network membrane	ATP binding|microtubule motor activity|protein binding	g.chr6:17837141C>T	AJ291578	CCDS47380.1, CCDS47381.1, CCDS54967.1, CCDS54968.1, CCDS58998.1	6p23	2008-10-21			ENSG00000137177	ENSG00000137177		"""Kinesins"""	14566	protein-coding gene	gene with protein product		605433				11106728	Standard	NM_022113		Approved	bA500C11.2	uc003ncg.4	Q9H1H9	OTTHUMG00000014313	ENST00000259711.6:c.1123G>A	6.37:g.17837141C>T	ENSP00000259711:p.Glu375Lys					KIF13A_uc003ncf.2_Missense_Mutation_p.E375K|KIF13A_uc003nch.3_Missense_Mutation_p.E375K|KIF13A_uc003nci.3_Missense_Mutation_p.E375K|KIF13A_uc003ncj.2_Missense_Mutation_p.E51K	p.E375K	NM_022113	NP_071396	Q9H1H9	KI13A_HUMAN	all cancers(50;0.0865)|Epithelial(50;0.0974)		11	1228	-	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	375			Potential.		A0JP21|A0JP22|F2Z382|Q5THQ2|Q5THQ3|Q9H193|Q9H194|Q9H1H8	Missense_Mutation	SNP	ENST00000259711.6	37	c.1123G>A	CCDS47381.1	.	.	.	.	.	.	.	.	.	.	C	35	5.536005	0.96460	.	.	ENSG00000137177	ENST00000378814;ENST00000259711;ENST00000378826;ENST00000378843;ENST00000378816	T;T;T;T;T	0.73469	-0.74;-0.75;-0.73;-0.73;-0.74	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	D	0.87688	0.6240	M	0.87547	2.89	0.80722	D	1	D;P;D;D;D	0.89917	1.0;0.929;1.0;0.999;1.0	D;P;D;P;D	0.80764	0.973;0.454;0.926;0.899;0.994	D	0.87978	0.2741	10	0.72032	D	0.01	.	20.5753	0.99366	0.0:1.0:0.0:0.0	.	346;375;375;375;375	E7ER65;Q9H1H9-4;Q9H1H9-2;Q9H1H9;Q9H1H9-3	.;.;.;KI13A_HUMAN;.	K	375	ENSP00000368091:E375K;ENSP00000259711:E375K;ENSP00000368103:E375K;ENSP00000368120:E375K;ENSP00000368093:E375K	ENSP00000259711:E375K	E	-	1	0	KIF13A	17945120	1.000000	0.71417	0.990000	0.47175	0.869000	0.49853	7.776000	0.85560	2.868000	0.98415	0.557000	0.71058	GAG		0.517	KIF13A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039954.4			30	353	0	0	0	0.008361	0	30	353				
Unknown	0	broad.mit.edu	37	6	28240024	28240024	+	IGR	SNP	C	C	T	rs550613662	byFrequency	TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr6:28240024C>T								NKAPL (11288 upstream) : PGBD1 (9289 downstream)																							GCTCCAGGCCCGGGTGCAGGA	0.567													C|||	2	0.000399361	0.0	0.0014	5008	,	,		18562	0.0		0.001	False		,,,				2504	0.0						uc011dld.1		NA																	0					0						c.(328-330)CGG>TGG		zinc finger protein 187 isoform b							22.0	22.0	22.0					6																	28240024		692	1591	2283	SO:0001628	intergenic_variant	7741				viral reproduction	nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr6:28240024C>T																													6.37:g.28240024C>T						ZNF187_uc011dlc.1_Missense_Mutation_p.R110W|ZNF187_uc003nku.3_Intron|ZNF187_uc003nkw.3_5'UTR|ZNF187_uc011dle.1_5'UTR|ZNF187_uc011dlf.1_Intron|ZNF187_uc011dlg.1_5'UTR	p.R110W	NM_001111039	NP_001104509	Q16670	ZN187_HUMAN			3	598	+			110			SCAN box.			Missense_Mutation	SNP		37	c.328C>T																																																																																				0	0.567									4	27	0	0	0	0.009096	0	4	27				
HLA-DRA	3122	broad.mit.edu	37	6	32411567	32411567	+	Silent	SNP	A	A	T	rs58547911	byFrequency	TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr6:32411567A>T	ENST00000374982.5	+	4	643	c.570A>T	c.(568-570)acA>acT	p.T190T	HLA-DRA_ENST00000395388.2_Silent_p.T215T			P01903	DRA_HUMAN	major histocompatibility complex, class II, DR alpha	215	Alpha-2.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide or polysaccharide antigen via MHC class II (GO:0002504)|cognition (GO:0050890)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|peptide antigen assembly with MHC class II protein complex (GO:0002503)|polysaccharide assembly with MHC class II protein complex (GO:0002506)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of plasma membrane (GO:0005887)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II protein complex binding (GO:0023026)|MHC class II receptor activity (GO:0032395)|peptide antigen binding (GO:0042605)	p.T215T(1)		NS(1)|breast(1)|large_intestine(6)|lung(5)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	19						CAGAGACTACAGAGAACGTGG	0.502									T-cell Lymphoma, (Cutaneous) , Familial Clustering of;Kaposi Sarcoma, Familial Clustering of																														uc003obh.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(643-645)ACA>ACT		major histocompatibility complex, class II, DR							181.0	189.0	186.0					6																	32411567		1510	2709	4219	SO:0001819	synonymous_variant	3122	T-cell_Lymphoma_(Cutaneous)__Familial_Clustering_of|KaposSarcoma_Familial_Clustering_of	Familial Cancer Database	incl.: Mycosis Fungoides, Sezary syndrome, Adult T-cell Lymphoma;	antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endoplasmic reticulum membrane|Golgi apparatus|integral to plasma membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex	MHC class II receptor activity	g.chr6:32411567A>T		CCDS4750.1	6p21.3	2013-01-11			ENSG00000204287	ENSG00000204287		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4947	protein-coding gene	gene with protein product		142860		HLA-DRA1			Standard	NM_019111		Approved		uc003obh.3	P01903	OTTHUMG00000031269	ENST00000374982.5:c.570A>T	6.37:g.32411567A>T						HLA-DRA_uc003obi.2_Silent_p.T190T	p.T215T	NM_019111	NP_061984	P01903	DRA_HUMAN			4	726	+			215			Connecting peptide.|Extracellular (Potential).		A2BET4|Q30160|Q6IAZ1|Q861I2|Q9TP70	Silent	SNP	ENST00000374982.5	37	c.645A>T																																																																																					0.502	HLA-DRA-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000076587.3	NM_019111		7	235	0	0	0	0.00308	0	7	235				
ZNF76	7629	broad.mit.edu	37	6	35260373	35260373	+	Missense_Mutation	SNP	G	G	A	rs368273976		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr6:35260373G>A	ENST00000373953.3	+	10	1240	c.974G>A	c.(973-975)cGc>cAc	p.R325H	ZNF76_ENST00000339411.5_Missense_Mutation_p.R325H|ZNF76_ENST00000440666.2_Missense_Mutation_p.R299H	NM_003427.3	NP_003418.2	P36508	ZNF76_HUMAN	zinc finger protein 76	325					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R325H(1)		breast(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)	16						TGCGGGAAACGCTTCACCGAG	0.617																																					Esophageal Squamous(52;92 1039 20612 23956 34676)	Esophageal Squamous(52;92 1039 20612 23956 34676)	uc003oki.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(973-975)CGC>CAC		zinc finger protein 76 (expressed in testis)		G	HIS/ARG	0,4406		0,0,2203	86.0	64.0	71.0		974	4.3	1.0	6		71	2,8598	2.2+/-6.3	0,2,4298	no	missense	ZNF76	NM_003427.3	29	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging	325/571	35260373	2,13004	2203	4300	6503	SO:0001583	missense	7629				regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr6:35260373G>A	M91592	CCDS4801.1, CCDS75435.1	6p21.31	2013-01-08	2011-02-25		ENSG00000065029	ENSG00000065029		"""Zinc fingers, C2H2-type"""	13149	protein-coding gene	gene with protein product		194549	"""zinc finger protein 76 (expressed in testis)"""	D6S229E		1427894	Standard	XM_005249364		Approved	Zfp523, ZNF523	uc003oki.1	P36508	OTTHUMG00000014564	ENST00000373953.3:c.974G>A	6.37:g.35260373G>A	ENSP00000363064:p.Arg325His					ZNF76_uc011dsz.1_Missense_Mutation_p.R325H|ZNF76_uc003okj.1_Missense_Mutation_p.R325H	p.R325H	NM_003427	NP_003418	P36508	ZNF76_HUMAN			10	1179	+			325			C2H2-type 6.		Q9BQB2	Missense_Mutation	SNP	ENST00000373953.3	37	c.974G>A	CCDS4801.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.626643	0.87560	0.0	2.33E-4	ENSG00000065029	ENST00000469195;ENST00000448999;ENST00000373953;ENST00000417184;ENST00000440666;ENST00000339411	T;T;T;T	0.53640	0.61;0.61;0.61;0.61	5.15	4.27	0.50696	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.45867	D	0.000339	T	0.44180	0.1281	L	0.48935	1.535	0.39955	D	0.974595	D;D	0.64830	0.994;0.983	P;P	0.54706	0.759;0.685	T	0.50642	-0.8804	10	0.66056	D	0.02	.	14.7715	0.69681	0.0:0.1451:0.8549:0.0	.	325;325	P36508-2;P36508	.;ZNF76_HUMAN	H	325;325;325;325;299;325	ENSP00000419106:R325H;ENSP00000363064:R325H;ENSP00000392243:R299H;ENSP00000344097:R325H	ENSP00000344097:R325H	R	+	2	0	ZNF76	35368351	1.000000	0.71417	0.998000	0.56505	0.969000	0.65631	7.644000	0.83416	1.367000	0.46095	0.491000	0.48974	CGC		0.617	ZNF76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040279.2	NM_003427		10	49	0	0	0	0.000978	0	10	49				
LRFN2	57497	broad.mit.edu	37	6	40399507	40399507	+	Missense_Mutation	SNP	A	A	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr6:40399507A>C	ENST00000338305.6	-	2	1888	c.1346T>G	c.(1345-1347)gTg>gGg	p.V449G		NM_020737.1	NP_065788.1	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III domain containing 2	449	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.					cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)		p.V449G(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	58	Ovarian(28;0.0418)|Colorectal(47;0.196)					GTACATCTTCACCCGGGGTGC	0.597																																							uc003oph.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(1345-1347)GTG>GGG		leucine rich repeat and fibronectin type III							62.0	62.0	62.0					6																	40399507		2203	4300	6503	SO:0001583	missense	57497					cell junction|integral to membrane|postsynaptic membrane		g.chr6:40399507A>C	AB033072	CCDS34443.1	6p21.2-p21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000156564	ENSG00000156564		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	21226	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 2"""	612808	"""KIAA1246"""	KIAA1246, SALM1		16495444, 16828986	Standard	NM_020737		Approved	FIGLER2	uc003oph.1	Q9ULH4	OTTHUMG00000014662	ENST00000338305.6:c.1346T>G	6.37:g.40399507A>C	ENSP00000345985:p.Val449Gly						p.V449G	NM_020737	NP_065788	Q9ULH4	LRFN2_HUMAN			2	1811	-	Ovarian(28;0.0418)|Colorectal(47;0.196)		449			Fibronectin type-III.|Extracellular (Potential).		A5PKU3|Q5SYP9	Missense_Mutation	SNP	ENST00000338305.6	37	c.1346T>G	CCDS34443.1	.	.	.	.	.	.	.	.	.	.	A	14.76	2.631376	0.46944	.	.	ENSG00000156564	ENST00000338305	T	0.59638	0.25	5.51	5.51	0.81932	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.54334	0.1852	M	0.80982	2.52	0.80722	D	1	B	0.21309	0.054	B	0.33295	0.161	T	0.62234	-0.6897	10	0.87932	D	0	.	14.4539	0.67404	1.0:0.0:0.0:0.0	.	449	Q9ULH4	LRFN2_HUMAN	G	449	ENSP00000345985:V449G	ENSP00000345985:V449G	V	-	2	0	LRFN2	40507485	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.518000	0.81795	2.097000	0.63578	0.533000	0.62120	GTG		0.597	LRFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040488.1	XM_166372		20	41	0	0	0	0.008871	0	20	41				
MEP1A	4224	broad.mit.edu	37	6	46794188	46794188	+	Silent	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr6:46794188G>A	ENST00000230588.4	+	9	885	c.876G>A	c.(874-876)caG>caA	p.Q292Q		NM_005588.2	NP_005579.2	Q16819	MEP1A_HUMAN	meprin A, alpha (PABA peptide hydrolase)	292	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.				digestion (GO:0007586)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|meprin A complex (GO:0017090)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.Q292Q(1)		NS(1)|breast(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42			Lung(136;0.192)			GGGCCCATCAGGACAGTGCTC	0.493																																							uc010jzh.1		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(2)|ovary(1)	3						c.(874-876)CAG>CAA		meprin A alpha precursor							144.0	132.0	136.0					6																	46794188		2203	4300	6503	SO:0001819	synonymous_variant	4224				digestion|proteolysis	extracellular space|integral to plasma membrane|soluble fraction	metalloendopeptidase activity|zinc ion binding	g.chr6:46794188G>A		CCDS4918.1	6p12-p11	2010-10-18			ENSG00000112818	ENSG00000112818	3.4.24.18		7015	protein-coding gene	gene with protein product		600388				7774936	Standard	NM_005588		Approved	PPHA	uc010jzh.1	Q16819	OTTHUMG00000014790	ENST00000230588.4:c.876G>A	6.37:g.46794188G>A						MEP1A_uc011dwg.1_Silent_p.Q14Q|MEP1A_uc011dwh.1_Silent_p.Q320Q|MEP1A_uc011dwi.1_Silent_p.Q192Q	p.Q292Q	NM_005588	NP_005579	Q16819	MEP1A_HUMAN	Lung(136;0.192)		9	918	+			292			Extracellular (Potential).|MAM.		A2RRM4|B0AZP9|B2RCS2|Q8TDC9|Q9H1R1	Silent	SNP	ENST00000230588.4	37	c.876G>A	CCDS4918.1																																																																																				0.493	MEP1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040803.1	NM_005588		20	83	0	0	0	0.008871	0	20	83				
TFAP2D	83741	broad.mit.edu	37	6	50718973	50718973	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr6:50718973C>A	ENST00000008391.3	+	7	1303	c.1075C>A	c.(1075-1077)Ctg>Atg	p.L359M	TFAP2D_ENST00000492804.1_3'UTR	NM_172238.3	NP_758438.2			transcription factor AP-2 delta (activating enhancer binding protein 2 delta)									p.L359M(1)		NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(26)|ovary(6)|pancreas(1)|prostate(5)|stomach(1)	60	Lung NSC(77;0.0334)					TAGATCACCACTGGGATCCTC	0.348																																							uc003paf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|breast(1)	7						c.(1075-1077)CTG>ATG		transcription factor AP-2 beta-like 1							106.0	97.0	100.0					6																	50718973		2203	4299	6502	SO:0001583	missense	83741						DNA binding|sequence-specific DNA binding transcription factor activity	g.chr6:50718973C>A	AY028376	CCDS4933.1	6p12.3	2008-02-05	2004-10-26	2004-10-27		ENSG00000008197			15581	protein-coding gene	gene with protein product		610161	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)-like 1"""	TFAP2BL1		11733187	Standard	NM_172238		Approved		uc003paf.3	Q7Z6R9		ENST00000008391.3:c.1075C>A	6.37:g.50718973C>A	ENSP00000008391:p.Leu359Met					TFAP2D_uc011dwt.1_RNA	p.L359M	NM_172238	NP_758438	Q7Z6R9	AP2D_HUMAN			7	1587	+	Lung NSC(77;0.0334)		359			H-S-H (helix-span-helix), dimerization.			Missense_Mutation	SNP	ENST00000008391.3	37	c.1075C>A	CCDS4933.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.989482	0.74589	.	.	ENSG00000008197	ENST00000008391	D	0.97256	-4.31	5.48	4.61	0.57282	Transcription factor AP-2, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98093	0.9371	M	0.88105	2.93	0.80722	D	1	D	0.69078	0.997	D	0.72982	0.979	D	0.98543	1.0633	10	0.62326	D	0.03	-5.8083	11.2311	0.48912	0.0:0.8526:0.0:0.1474	.	359	Q7Z6R9	AP2D_HUMAN	M	359	ENSP00000008391:L359M	ENSP00000008391:L359M	L	+	1	2	TFAP2D	50826932	0.987000	0.35691	0.950000	0.38849	0.991000	0.79684	2.765000	0.47621	1.311000	0.45024	0.484000	0.47621	CTG		0.348	TFAP2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040881.1	NM_172238		29	36	1	0	2.80507e-11	0.002445	3.9313e-11	29	36				
COL12A1	1303	broad.mit.edu	37	6	75898142	75898142	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr6:75898142C>A	ENST00000322507.8	-	8	1242	c.933G>T	c.(931-933)gaG>gaT	p.E311D	COL12A1_ENST00000483888.2_Missense_Mutation_p.E311D|COL12A1_ENST00000345356.6_Intron|COL12A1_ENST00000416123.2_Missense_Mutation_p.E311D	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	311	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)	p.E311D(1)		breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						GGGAGATGATCTCATTCTGAA	0.433																																							uc003phs.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						c.(931-933)GAG>GAT		collagen, type XII, alpha 1 long isoform							216.0	197.0	203.0					6																	75898142		1975	4163	6138	SO:0001583	missense	1303				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength	g.chr6:75898142C>A	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.933G>T	6.37:g.75898142C>A	ENSP00000325146:p.Glu311Asp					COL12A1_uc003pht.2_Intron|COL12A1_uc003phu.1_5'UTR	p.E311D	NM_004370	NP_004361	Q99715	COCA1_HUMAN			8	1099	-			311			VWFA 1.		O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	ENST00000322507.8	37	c.933G>T	CCDS43482.1	.	.	.	.	.	.	.	.	.	.	C	15.54	2.863626	0.51482	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000416123;ENST00000483888	D;D;D	0.83755	-1.76;-1.76;-1.76	6.06	5.1	0.69264	von Willebrand factor, type A (3);	0.000000	0.64402	D	0.000001	T	0.59555	0.2202	N	0.21282	0.65	0.34678	D	0.72439	P	0.44090	0.826	P	0.47603	0.551	T	0.62144	-0.6916	10	0.22109	T	0.4	.	3.1704	0.06550	0.0:0.4573:0.0:0.5427	.	311	Q99715	COCA1_HUMAN	D	311	ENSP00000325146:E311D;ENSP00000412864:E311D;ENSP00000421216:E311D	ENSP00000325146:E311D	E	-	3	2	COL12A1	75954862	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.969000	0.49232	1.468000	0.48064	0.655000	0.94253	GAG		0.433	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370		28	69	1	0	2.65835e-16	0.007291	4.08194e-16	28	69				
UBE3D	90025	broad.mit.edu	37	6	83748197	83748197	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr6:83748197T>A	ENST00000369747.3	-	5	727	c.605A>T	c.(604-606)aAg>aTg	p.K202M		NM_198920.1	NP_944602.1	Q7Z6J8	UBE3D_HUMAN	ubiquitin protein ligase E3D	202					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)	p.K202M(1)									GGTATTTGCCTTTGGTTCCTG	0.338																																							uc003pjp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(604-606)AAG>ATG		ubiquitin-conjugating enzyme E2C binding							151.0	155.0	154.0					6																	83748197		2203	4300	6503	SO:0001583	missense	90025					cytoplasm	ligase activity	g.chr6:83748197T>A	AL137544	CCDS34491.1	6q15	2012-02-24	2012-02-24	2012-02-24	ENSG00000118420	ENSG00000118420			21381	protein-coding gene	gene with protein product	"""UBCH10 binding protein with a hect-like domain"""	612495	"""chromosome 6 open reading frame 157"", ""ubiquitin-conjugating enzyme E2C binding protein"""	C6orf157, UBE2CBP		15749827	Standard	NM_198920		Approved	DKFZp434A1520, H10BH, YJR141W	uc003pjp.2	Q7Z6J8	OTTHUMG00000015108	ENST00000369747.3:c.605A>T	6.37:g.83748197T>A	ENSP00000358762:p.Lys202Met					UBE2CBP_uc011dyx.1_RNA|UBE2CBP_uc003pjr.2_Missense_Mutation_p.K170M	p.K202M	NM_198920	NP_944602	Q7Z6J8	UB2CB_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.0944)	5	713	-		all_cancers(76;0.000374)|Acute lymphoblastic leukemia(125;3.85e-06)|all_hematologic(105;0.0017)|all_epithelial(107;0.0548)	202					B4DP63|Q5T4W2|Q6IPR4|Q75UG0|Q9NT42	Missense_Mutation	SNP	ENST00000369747.3	37	c.605A>T	CCDS34491.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.167351	0.78339	.	.	ENSG00000118420	ENST00000369747	T	0.35048	1.33	5.58	5.58	0.84498	.	0.129299	0.64402	D	0.000013	T	0.51702	0.1690	M	0.72118	2.19	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.74348	0.975;0.983	T	0.55730	-0.8095	10	0.59425	D	0.04	-19.85	16.0556	0.80801	0.0:0.0:0.0:1.0	.	202;202	D6RD24;Q7Z6J8	.;UB2CB_HUMAN	M	202	ENSP00000358762:K202M	ENSP00000358762:K202M	K	-	2	0	UBE2CBP	83804916	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.562000	0.67346	2.239000	0.73571	0.533000	0.62120	AAG		0.338	UBE3D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041347.7	NM_198920		18	55	0	0	0	0.007413	0	18	55				
UBE2J1	51465	broad.mit.edu	37	6	90039587	90039587	+	Silent	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr6:90039587C>A	ENST00000435041.2	-	8	1046	c.768G>T	c.(766-768)cgG>cgT	p.R256R		NM_016021.2	NP_057105.2	Q9Y385	UB2J1_HUMAN	ubiquitin-conjugating enzyme E2, J1	256					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)	p.R256R(1)		NS(1)|breast(2)|kidney(1)|large_intestine(2)|lung(11)|stomach(1)	18		all_cancers(76;1.65e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;2.5e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0139)		GCTGCTGGGCCCGGCGCTGTC	0.522																																							uc010kcb.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(766-768)CGG>CGT		ubiquitin-conjugating enzyme E2, J1							110.0	99.0	103.0					6																	90039587		2203	4300	6503	SO:0001819	synonymous_variant	51465					endoplasmic reticulum membrane|integral to membrane	ATP binding|ubiquitin-protein ligase activity	g.chr6:90039587C>A	AJ245898	CCDS5021.1	6q15	2014-01-28	2012-06-08		ENSG00000198833	ENSG00000198833		"""Ubiquitin-conjugating enzymes E2"""	17598	protein-coding gene	gene with protein product			"""ubiquitin-conjugating enzyme E2, J1 (UBC6 homolog, yeast)"""			10708578	Standard	NM_016021		Approved	HSPC153, CGI-76, NCUBE1, UBC6	uc003pnc.3	Q9Y385	OTTHUMG00000016337	ENST00000435041.2:c.768G>T	6.37:g.90039587C>A						UBE2J1_uc003pnc.2_Silent_p.R256R	p.R256R	NM_016021	NP_057105	Q9Y385	UB2J1_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0139)	9	941	-		all_cancers(76;1.65e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;2.5e-05)|Lung NSC(302;0.238)	256			Cytoplasmic (Potential).		A8K3F9|Q53F25|Q5W0N4|Q9BZ32|Q9NQL3|Q9NY66|Q9P011|Q9P0S0|Q9UF10	Silent	SNP	ENST00000435041.2	37	c.768G>T	CCDS5021.1																																																																																				0.522	UBE2J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043742.2	NM_016021		30	42	1	0	2.47511e-08	0.008361	3.25763e-08	30	42				
ZUFSP	221302	broad.mit.edu	37	6	116988239	116988239	+	Silent	SNP	C	C	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr6:116988239C>G	ENST00000368576.3	-	2	360	c.117G>C	c.(115-117)gtG>gtC	p.V39V	ZUFSP_ENST00000368573.1_Silent_p.V39V|ZUFSP_ENST00000471919.1_Intron	NM_145062.2	NP_659499.2	Q96AP4	ZUFSP_HUMAN	zinc finger with UFM1-specific peptidase domain	39							metal ion binding (GO:0046872)	p.V39V(1)		NS(1)|endometrium(2)|kidney(6)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	21				GBM - Glioblastoma multiforme(226;0.0258)|all cancers(137;0.0368)|OV - Ovarian serous cystadenocarcinoma(136;0.0464)|Epithelial(106;0.186)		CATCATAATTCACACCTGACA	0.343																																							uc003pxf.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(115-117)GTG>GTC		zinc finger with UFM1-specific peptidase domain							119.0	113.0	115.0					6																	116988239		2202	4300	6502	SO:0001819	synonymous_variant	221302					intracellular	zinc ion binding	g.chr6:116988239C>G	AK054582	CCDS5110.1	6q22.31	2013-01-28	2008-03-25	2008-03-25	ENSG00000153975	ENSG00000153975		"""Zinc fingers, C2H2-type"""	21224	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 113"""	C6orf113			Standard	NM_145062		Approved	dJ412I7.3	uc003pxf.2	Q96AP4	OTTHUMG00000015445	ENST00000368576.3:c.117G>C	6.37:g.116988239C>G						ZUFSP_uc010kef.1_Intron	p.V39V	NM_145062	NP_659499	Q96AP4	ZUFSP_HUMAN		GBM - Glioblastoma multiforme(226;0.0258)|all cancers(137;0.0368)|OV - Ovarian serous cystadenocarcinoma(136;0.0464)|Epithelial(106;0.186)	2	363	-			39					Q5TD92|Q6PJH7|Q96NV6	Silent	SNP	ENST00000368576.3	37	c.117G>C	CCDS5110.1																																																																																				0.343	ZUFSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041961.1	NM_145062		26	50	0	0	0	0.00333	0	26	50				
DCBLD1	285761	broad.mit.edu	37	6	117861841	117861841	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr6:117861841G>T	ENST00000338728.5	+	10	1232	c.1112G>T	c.(1111-1113)gGt>gTt	p.G371V	DCBLD1_ENST00000368503.4_Intron|DCBLD1_ENST00000296955.8_Missense_Mutation_p.G371V|GOPC_ENST00000467125.1_Intron|DCBLD1_ENST00000534777.1_3'UTR			Q8N8Z6	DCBD1_HUMAN	discoidin, CUB and LCCL domain containing 1	371	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.G371V(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(15)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	26		all_cancers(87;0.171)		GBM - Glioblastoma multiforme(226;0.0447)|OV - Ovarian serous cystadenocarcinoma(136;0.0921)|all cancers(137;0.125)		GTGTTTCAGGGTAACTCTAAC	0.428																																							uc003pxs.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1111-1113)GGT>GTT		discoidin, CUB and LCCL domain containing 1							105.0	106.0	106.0					6																	117861841		2203	4300	6503	SO:0001583	missense	285761				cell adhesion	integral to membrane		g.chr6:117861841G>T	AK055462	CCDS34522.1	6q22.31	2003-06-20			ENSG00000164465	ENSG00000164465			21479	protein-coding gene	gene with protein product							Standard	NM_173674		Approved	MGC46341, dJ94G16.1	uc003pxs.3	Q8N8Z6	OTTHUMG00000015455	ENST00000338728.5:c.1112G>T	6.37:g.117861841G>T	ENSP00000342422:p.Gly371Val					GOPC_uc003pxq.1_Intron|DCBLD1_uc003pxr.1_Missense_Mutation_p.G371V|DCBLD1_uc003pxt.1_Missense_Mutation_p.G26V	p.G371V	NM_173674	NP_775945	Q8N8Z6	DCBD1_HUMAN		GBM - Glioblastoma multiforme(226;0.0447)|OV - Ovarian serous cystadenocarcinoma(136;0.0921)|all cancers(137;0.125)	10	1237	+		all_cancers(87;0.171)	371			F5/8 type C.|Extracellular (Potential).		Q5H992|Q8IYK5|Q8N7L9|Q96NH2	Missense_Mutation	SNP	ENST00000338728.5	37	c.1112G>T		.	.	.	.	.	.	.	.	.	.	G	19.30	3.800570	0.70567	.	.	ENSG00000164465	ENST00000296955;ENST00000392504;ENST00000338728	D;D	0.99466	-5.95;-5.95	4.54	4.54	0.55810	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.122893	0.53938	D	0.000053	D	0.99697	0.9885	H	0.96748	3.875	0.80722	D	1	D;D	0.76494	0.999;0.993	D;D	0.80764	0.994;0.964	D	0.97418	1.0007	10	0.87932	D	0	-17.2658	14.047	0.64710	0.0:0.1518:0.8482:0.0	.	371;371	Q8N8Z6-2;Q8N8Z6	.;DCBD1_HUMAN	V	371;26;371	ENSP00000296955:G371V;ENSP00000342422:G371V	ENSP00000296955:G371V	G	+	2	0	DCBLD1	117968534	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.317000	0.72862	2.364000	0.80123	0.561000	0.74099	GGT		0.428	DCBLD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000041979.2	NM_173674		12	100	1	0	2.27111e-07	0.001368	2.8877e-07	12	100				
ENPP1	5167	broad.mit.edu	37	6	132211593	132211593	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr6:132211593C>T	ENST00000360971.2	+	25	2740	c.2720C>T	c.(2719-2721)cCa>cTa	p.P907L		NM_006208.2	NP_006199.2	P22413	ENPP1_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 1	907	Nuclease.				3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|ATP catabolic process (GO:0006200)|biomineral tissue development (GO:0031214)|bone remodeling (GO:0046849)|cellular phosphate ion homeostasis (GO:0030643)|cellular response to insulin stimulus (GO:0032869)|generation of precursor metabolites and energy (GO:0006091)|immune response (GO:0006955)|inorganic diphosphate transport (GO:0030505)|negative regulation of cell growth (GO:0030308)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of ossification (GO:0030279)|negative regulation of protein autophosphorylation (GO:0031953)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)|regulation of bone mineralization (GO:0030500)|riboflavin metabolic process (GO:0006771)|sequestering of triglyceride (GO:0030730)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|insulin receptor binding (GO:0005158)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|protein homodimerization activity (GO:0042803)|scavenger receptor activity (GO:0005044)|zinc ion binding (GO:0008270)	p.P855L(1)		autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(22)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	46	Breast(56;0.0505)			GBM - Glioblastoma multiforme(226;0.0216)|OV - Ovarian serous cystadenocarcinoma(155;0.022)	Amifostine(DB01143)|Ribavirin(DB00811)	AGAAAAGAGCCAGTTTCAGAC	0.383																																					Colon(104;336 1535 5856 11019 33782)	Colon(104;336 1535 5856 11019 33782)	uc011ecf.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(2)|ovary(2)	4						c.(2719-2721)CCA>CTA		ectonucleotide pyrophosphatase/phosphodiesterase	Amifostine(DB01143)|Ribavirin(DB00811)						106.0	99.0	102.0					6																	132211593		2203	4300	6503	SO:0001583	missense	5167				3'-phosphoadenosine 5'-phosphosulfate metabolic process|biomineral tissue development|cellular phosphate ion homeostasis|cellular response to insulin stimulus|generation of precursor metabolites and energy|immune response|inorganic diphosphate transport|negative regulation of cell growth|negative regulation of fat cell differentiation|negative regulation of glucose import|negative regulation of glycogen biosynthetic process|negative regulation of insulin receptor signaling pathway|negative regulation of protein autophosphorylation|nucleoside triphosphate catabolic process|phosphate metabolic process|sequestering of triglyceride|water-soluble vitamin metabolic process	basolateral plasma membrane|cell surface|extracellular space|integral to membrane	ATP binding|insulin receptor binding|metal ion binding|nucleic acid binding|nucleoside-triphosphate diphosphatase activity|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|protein homodimerization activity|scavenger receptor activity	g.chr6:132211593C>T	M57736	CCDS5150.2	6q22-q23	2008-02-07			ENSG00000197594	ENSG00000197594	3.1.4.1, 3.6.1.9		3356	protein-coding gene	gene with protein product		173335		NPPS, M6S1, PDNP1		1315502	Standard	NM_006208		Approved	PC-1, PCA1	uc011ecf.2	P22413	OTTHUMG00000015572	ENST00000360971.2:c.2720C>T	6.37:g.132211593C>T	ENSP00000354238:p.Pro907Leu						p.P907L	NM_006208	NP_006199	P22413	ENPP1_HUMAN		GBM - Glioblastoma multiforme(226;0.0216)|OV - Ovarian serous cystadenocarcinoma(155;0.022)	25	2740	+	Breast(56;0.0505)		907			Nuclease.|Extracellular (Potential).		Q5T9R6|Q9NPZ3|Q9P1P6|Q9UP61|Q9Y6K3	Missense_Mutation	SNP	ENST00000360971.2	37	c.2720C>T	CCDS5150.2	.	.	.	.	.	.	.	.	.	.	C	19.52	3.843548	0.71488	.	.	ENSG00000197594	ENST00000360971	T	0.68331	-0.32	5.82	5.82	0.92795	Extracellular Endonuclease, subunit A (2);	0.268201	0.38605	N	0.001634	T	0.62417	0.2426	M	0.69823	2.125	0.51012	D	0.999903	B	0.18310	0.027	B	0.27608	0.081	T	0.61671	-0.7015	10	0.62326	D	0.03	-3.7056	19.6917	0.96005	0.0:1.0:0.0:0.0	.	907	P22413	ENPP1_HUMAN	L	907	ENSP00000354238:P907L	ENSP00000354238:P907L	P	+	2	0	ENPP1	132253286	0.978000	0.34361	1.000000	0.80357	0.998000	0.95712	3.848000	0.55903	2.751000	0.94390	0.650000	0.86243	CCA		0.383	ENPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042238.2			23	49	0	0	0	0.00333	0	23	49				
BCLAF1	9774	broad.mit.edu	37	6	136599628	136599628	+	Missense_Mutation	SNP	G	G	A	rs201753704		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr6:136599628G>A	ENST00000531224.1	-	4	643	c.391C>T	c.(391-393)Cgg>Tgg	p.R131W	BCLAF1_ENST00000530767.1_Missense_Mutation_p.R131W|BCLAF1_ENST00000392348.2_Missense_Mutation_p.R129W|BCLAF1_ENST00000353331.4_Missense_Mutation_p.R129W|BCLAF1_ENST00000527536.1_Missense_Mutation_p.R131W|BCLAF1_ENST00000527759.1_Missense_Mutation_p.R129W	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	131					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.R131W(1)		haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		CTATATGACCGGCGAGATCTG	0.453																																					Colon(142;1534 1789 5427 7063 28491)	Colon(142;1534 1789 5427 7063 28491)	uc003qgx.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(391-393)CGG>TGG		BCL2-associated transcription factor 1 isoform		G	TRP/ARG,TRP/ARG,TRP/ARG	0,4406		0,0,2203	188.0	202.0	197.0		385,391,391	5.6	1.0	6		197	1,8599		0,1,4299	yes	missense,missense,missense	BCLAF1	NM_001077440.1,NM_001077441.1,NM_014739.2	101,101,101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	129/870,131/748,131/921	136599628	1,13005	2203	4300	6503	SO:0001583	missense	9774				induction of apoptosis|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding	g.chr6:136599628G>A	AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.391C>T	6.37:g.136599628G>A	ENSP00000435210:p.Arg131Trp					BCLAF1_uc003qgw.1_Missense_Mutation_p.R131W|BCLAF1_uc003qgy.1_Missense_Mutation_p.R129W|BCLAF1_uc011edc.1_RNA|BCLAF1_uc011edd.1_RNA|BCLAF1_uc011ede.1_Missense_Mutation_p.R129W	p.R131W	NM_014739	NP_055554	Q9NYF8	BCLF1_HUMAN		GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)	4	644	-	Colorectal(23;0.24)		131					A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Missense_Mutation	SNP	ENST00000531224.1	37	c.391C>T	CCDS5177.1	.	.	.	.	.	.	.	.	.	.	G	17.05	3.289587	0.59976	0.0	1.16E-4	ENSG00000029363	ENST00000531224;ENST00000353331;ENST00000527536;ENST00000530767;ENST00000527759;ENST00000392348;ENST00000529826	T;T;T;T;T;T;T	0.14022	2.54;2.54;2.54;2.54;2.54;2.54;2.54	5.64	5.64	0.86602	.	0.213045	0.33346	N	0.005007	T	0.17959	0.0431	N	0.24115	0.695	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.999;0.999	D;D;D;D	0.67725	0.916;0.953;0.916;0.916	T	0.04930	-1.0917	10	0.66056	D	0.02	-4.8627	19.6986	0.96043	0.0:0.0:1.0:0.0	.	129;129;131;131	Q9NYF8-2;Q9NYF8-3;Q9NYF8;Q9NYF8-4	.;.;BCLF1_HUMAN;.	W	131;129;131;131;129;129;131	ENSP00000435210:R131W;ENSP00000229446:R129W;ENSP00000435441:R131W;ENSP00000436501:R131W;ENSP00000434826:R129W;ENSP00000376159:R129W;ENSP00000431734:R131W	ENSP00000229446:R129W	R	-	1	2	BCLAF1	136641321	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.074000	0.76791	2.660000	0.90430	0.557000	0.71058	CGG		0.453	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2	NM_014739		50	356	0	0	0	0.00361	0	50	356				
TNFAIP3	7128	broad.mit.edu	37	6	138199923	138199923	+	Silent	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr6:138199923G>T	ENST00000237289.4	+	7	1407	c.1341G>T	c.(1339-1341)gcG>gcT	p.A447A		NM_001270507.1|NM_001270508.1|NM_006290.3	NP_001257436.1|NP_001257437.1|NP_006281.1	P21580	TNAP3_HUMAN	tumor necrosis factor, alpha-induced protein 3	447	Interaction with RIPK1.|Interaction with TNIP1. {ECO:0000250}.				apoptotic process (GO:0006915)|B-1 B cell homeostasis (GO:0001922)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of B cell activation (GO:0050869)|negative regulation of bone resorption (GO:0045779)|negative regulation of CD40 signaling pathway (GO:2000349)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast proliferation (GO:0090291)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 3 signaling pathway (GO:0034140)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon production (GO:0032480)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of protein catabolic process (GO:0045732)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked deubiquitination (GO:0070536)|protein oligomerization (GO:0051259)|regulation of defense response to virus by host (GO:0050691)|regulation of germinal center formation (GO:0002634)|regulation of vascular wound healing (GO:0061043)|response to molecule of bacterial origin (GO:0002237)|tolerance induction to lipopolysaccharide (GO:0072573)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|protease binding (GO:0002020)|protein self-association (GO:0043621)|ubiquitin binding (GO:0043130)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.0?(25)|p.A447A(1)		breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(196)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	225	Breast(32;0.135)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)		AGCCCTTGGCGTGGAACCCTG	0.627			"""D, N, F"""		"""marginal zone B-cell lymphomas, Hodgkin's lymphoma, primary mediastinal B cell lymphoma"""																																GBM(130;153 1739 22295 28918 47987)	GBM(130;153 1739 22295 28918 47987)	uc003qhr.2		NA		Rec	yes		6	6q23	7128	D|N|F	"""tumor necrosis factor, alpha-induced protein 3"""			L			marginal zone B-cell lymphomas|Hodgkin's lymphoma|primary mediastinal B cell lymphoma		26	Whole gene deletion(25)|Substitution - coding silent(1)	p.0?(22)	haematopoietic_and_lymphoid_tissue(25)|lung(1)	haematopoietic_and_lymphoid_tissue(133)|lung(3)|ovary(1)	137						c.(1339-1341)GCG>GCT		tumor necrosis factor, alpha-induced protein 3							23.0	27.0	26.0					6																	138199923		2203	4300	6503	SO:0001819	synonymous_variant	7128				anti-apoptosis|apoptosis|B-1 B cell homeostasis|negative regulation of B cell activation|negative regulation of bone resorption|negative regulation of CD40 signaling pathway|negative regulation of endothelial cell apoptosis|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of inflammatory response|negative regulation of interleukin-2 production|negative regulation of interleukin-6 production|negative regulation of NF-kappaB transcription factor activity|negative regulation of osteoclast proliferation|negative regulation of protein ubiquitination|negative regulation of smooth muscle cell proliferation|negative regulation of toll-like receptor 2 signaling pathway|negative regulation of toll-like receptor 3 signaling pathway|negative regulation of tumor necrosis factor production|negative regulation of type I interferon production|positive regulation of protein catabolic process|protein K48-linked ubiquitination|protein K63-linked deubiquitination|protein oligomerization|regulation of defense response to virus by host|regulation of germinal center formation|regulation of vascular wound healing|tolerance induction to lipopolysaccharide	centrosome|cytosol|nucleus	caspase inhibitor activity|DNA binding|protease binding|protein self-association|ubiquitin binding|ubiquitin thiolesterase activity|ubiquitin-protein ligase activity|ubiquitin-specific protease activity|zinc ion binding	g.chr6:138199923G>T	M59465	CCDS5187.1	6q23-q25	2013-01-21			ENSG00000118503	ENSG00000118503		"""OTU domain containing"""	11896	protein-coding gene	gene with protein product		191163				2118515	Standard	NM_006290		Approved	A20, OTUD7C	uc031spw.1	P21580	OTTHUMG00000015664	ENST00000237289.4:c.1341G>T	6.37:g.138199923G>T						TNFAIP3_uc003qhs.2_Silent_p.A447A	p.A447A	NM_006290	NP_006281	P21580	TNAP3_HUMAN		GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)	7	1407	+	Breast(32;0.135)|Colorectal(23;0.24)		447			Interaction with NAF1 (By similarity).		B2R767|E1P588|Q2HIX9|Q5VXQ7|Q9NSR6	Silent	SNP	ENST00000237289.4	37	c.1341G>T	CCDS5187.1																																																																																				0.627	TNFAIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042414.1			17	34	1	0	4.14922e-12	0.004007	5.97913e-12	17	34				
ECT2L	345930	broad.mit.edu	37	6	139167715	139167715	+	Silent	SNP	A	A	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr6:139167715A>G	ENST00000423192.1	+	7	965	c.804A>G	c.(802-804)tcA>tcG	p.S268S	ECT2L_ENST00000367682.2_Silent_p.S268S|ECT2L_ENST00000541398.1_Silent_p.S199S			Q008S8	ECT2L_HUMAN	epithelial cell transforming 2 like	268							Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.S268S(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(7)|lung(12)|skin(1)|upper_aerodigestive_tract(1)	30						CTTTATTATCAAAGAAAAATT	0.368			"""N, Splice, Mis"""		ETP ALL																																		uc003qif.1		NA		Rec	yes		6	6q24.1	345930		epithelial cell transforming sequence 2 oncogene-like			L					1	Substitution - coding silent(1)		lung(1)		0						c.(802-804)TCA>TCG		epithelial cell transforming sequence 2							134.0	127.0	129.0					6																	139167715		1846	4094	5940	SO:0001819	synonymous_variant	345930				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity	g.chr6:139167715A>G		CCDS43508.1	6q24.1	2014-03-11	2014-03-11		ENSG00000203734	ENSG00000203734		"""Rho guanine nucleotide exchange factors"", ""F-boxes /  ""other"""""	21118	protein-coding gene	gene with protein product	"""lung specific F-box and DH domain containing protein"", ""F-box protein 49"""		"""chromosome 6 open reading frame 91"", ""epithelial cell transforming sequence 2 oncogene-like"""	C6orf91			Standard	NM_001077706		Approved	ARHGEF32, FBXO49, LFDH	uc021zfx.1	Q008S8	OTTHUMG00000015679	ENST00000423192.1:c.804A>G	6.37:g.139167715A>G						ECT2L_uc011edq.1_Silent_p.S199S	p.S268S	NM_001077706	NP_001071174	Q008S8	ECT2L_HUMAN			6	907	+			268					B2RUV6|Q5JWK2|Q5JWK3|Q5JWK4	Silent	SNP	ENST00000423192.1	37	c.804A>G	CCDS43508.1																																																																																				0.368	ECT2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042441.3	NM_001077706		10	148	0	0	0	0.006214	0	10	148				
IGF2R	3482	broad.mit.edu	37	6	160494947	160494947	+	Silent	SNP	C	C	T	rs140485195		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr6:160494947C>T	ENST00000356956.1	+	35	5254	c.5106C>T	c.(5104-5106)caC>caT	p.H1702H		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	1702					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)	p.H1702H(1)		breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	ATCCCATGCACGGAGTGCCCT	0.478																																							uc003qta.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)	3						c.(5104-5106)CAC>CAT		insulin-like growth factor 2 receptor precursor		C		0,4406		0,0,2203	84.0	75.0	78.0		5106	-3.9	0.7	6	dbSNP_134	78	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	IGF2R	NM_000876.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		1702/2492	160494947	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	3482				receptor-mediated endocytosis	cell surface|endocytic vesicle|endosome|integral to plasma membrane|lysosomal membrane|trans-Golgi network transport vesicle	glycoprotein binding|insulin-like growth factor receptor activity|phosphoprotein binding|transporter activity	g.chr6:160494947C>T	J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.5106C>T	6.37:g.160494947C>T							p.H1702H	NM_000876	NP_000867	P11717	MPRI_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	35	5254	+		Breast(66;0.000777)|Ovarian(120;0.0305)	1702			Lumenal (Potential).|12.		Q7Z7G9|Q96PT5	Silent	SNP	ENST00000356956.1	37	c.5106C>T	CCDS5273.1																																																																																				0.478	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042931.1	NM_000876		7	39	0	0	0	0.001984	0	7	39				
PDE10A	10846	broad.mit.edu	37	6	165827065	165827065	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr6:165827065C>G	ENST00000366882.1	-	14	1326	c.1172G>C	c.(1171-1173)aGt>aCt	p.S391T	PDE10A_ENST00000539869.2_Missense_Mutation_p.S401T|PDE10A_ENST00000354448.4_Missense_Mutation_p.S391T			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A	391	GAF 2.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)	p.S391T(1)		breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	AGAGAAGGCACTGCCACTGAT	0.443																																					Esophageal Squamous(22;308 615 5753 12038 40624)	Esophageal Squamous(22;308 615 5753 12038 40624)	uc003qun.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)	5						c.(1171-1173)AGT>ACT		phosphodiesterase 10A isoform 2	Dipyridamole(DB00975)						118.0	103.0	108.0					6																	165827065		2203	4300	6503	SO:0001583	missense	10846				platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cAMP binding|cGMP binding|metal ion binding	g.chr6:165827065C>G	AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000366882.1:c.1172G>C	6.37:g.165827065C>G	ENSP00000355847:p.Ser391Thr					PDE10A_uc011egj.1_RNA|PDE10A_uc011egk.1_Missense_Mutation_p.S321T|PDE10A_uc003quo.2_Missense_Mutation_p.S401T	p.S391T	NM_006661	NP_006652	Q9Y233	PDE10_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	14	1413	-		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)	391			GAF 2.		Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	Missense_Mutation	SNP	ENST00000366882.1	37	c.1172G>C		.	.	.	.	.	.	.	.	.	.	C	12.06	1.823488	0.32237	.	.	ENSG00000112541	ENST00000366882;ENST00000539869;ENST00000343842;ENST00000354448;ENST00000392126	T;T	0.66815	-0.23;-0.23	5.63	4.75	0.60458	GAF (2);	0.074371	0.85682	N	0.000000	T	0.38134	0.1029	N	0.13098	0.295	0.53688	D	0.999979	B;B	0.23540	0.012;0.087	B;B	0.35073	0.026;0.195	T	0.33650	-0.9860	10	0.17369	T	0.5	.	16.4911	0.84201	0.0:0.8691:0.1309:0.0	.	401;391	Q9ULW9;Q9Y233	.;PDE10_HUMAN	T	391;419;401;391;390	ENSP00000355847:S391T;ENSP00000346435:S391T	ENSP00000341187:S401T	S	-	2	0	PDE10A	165747055	1.000000	0.71417	0.992000	0.48379	0.928000	0.56348	5.605000	0.67634	1.341000	0.45600	0.655000	0.94253	AGT		0.443	PDE10A-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000043031.1			18	43	0	0	0	0.006122	0	18	43				
DGKB	1607	broad.mit.edu	37	7	14188795	14188795	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr7:14188795G>T	ENST00000403951.2	-	26	2795	c.2376C>A	c.(2374-2376)tgC>tgA	p.C792*	DGKB_ENST00000407950.1_Nonsense_Mutation_p.C784*|DGKB_ENST00000258767.5_Nonsense_Mutation_p.C792*|DGKB_ENST00000399322.3_Nonsense_Mutation_p.C792*|DGKB_ENST00000402815.1_Nonsense_Mutation_p.C791*|DGKB_ENST00000444700.2_Nonsense_Mutation_p.C773*			Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta 90kDa	792					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)	p.C792*(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(34)|ovary(4)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72						TGACGAGGGAGCAGAATAAAC	0.418																																							uc003ssz.2		NA																	1	Substitution - Nonsense(1)		lung(1)	lung(5)|ovary(4)|breast(2)|skin(1)	12						c.(2374-2376)TGC>TGA		diacylglycerol kinase, beta isoform 1	Phosphatidylserine(DB00144)						137.0	131.0	133.0					7																	14188795		1835	4092	5927	SO:0001587	stop_gained	1607				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity|protein binding	g.chr7:14188795G>T	AB018261	CCDS47547.1, CCDS47548.1	7p21.2	2013-01-10	2002-08-29		ENSG00000136267	ENSG00000136267	2.7.1.107	"""EF-hand domain containing"""	2850	protein-coding gene	gene with protein product		604070	"""diacylglycerol kinase, beta (90kD)"""	DAGK2		7689223	Standard	NM_004080		Approved	KIAA0718, DGK, DGK-BETA	uc003ssz.3	Q9Y6T7	OTTHUMG00000152477	ENST00000403951.2:c.2376C>A	7.37:g.14188795G>T	ENSP00000385780:p.Cys792*					DGKB_uc011jxt.1_Nonsense_Mutation_p.C773*	p.C792*	NM_004080	NP_004071	Q9Y6T7	DGKB_HUMAN			25	2563	-			792					A4D116|A4D117|A8MXU2|O75241|Q2M377|Q75MF9|Q75MU7|Q86UI5|Q86UM9|Q9UQ29	Nonsense_Mutation	SNP	ENST00000403951.2	37	c.2376C>A	CCDS47547.1	.	.	.	.	.	.	.	.	.	.	G	39	7.879757	0.98539	.	.	ENSG00000136267	ENST00000403951;ENST00000399322;ENST00000258767;ENST00000402815;ENST00000407950;ENST00000444700	.	.	.	5.82	5.82	0.92795	.	0.125473	0.53938	D	0.000049	.	.	.	.	.	.	0.58432	D	0.999996	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	.	9.7997	0.40757	0.1885:0.0:0.8115:0.0	.	.	.	.	X	792;792;792;791;784;773	.	ENSP00000258767:C792X	C	-	3	2	DGKB	14155320	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.976000	0.40579	2.765000	0.95021	0.650000	0.86243	TGC		0.418	DGKB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000326356.2	NM_004080		62	140	1	0	2.26907e-38	0.00361	3.89974e-38	62	140				
FKBP9	11328	broad.mit.edu	37	7	33014277	33014277	+	Silent	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr7:33014277G>A	ENST00000242209.4	+	2	439	c.270G>A	c.(268-270)ctG>ctA	p.L90L	FKBP9_ENST00000538443.1_Intron|FKBP9_ENST00000538336.1_Silent_p.L143L|AVL9_ENST00000404479.1_Intron	NM_001284343.1|NM_007270.3	NP_001271272.1|NP_009201.2	O95302	FKBP9_HUMAN	FK506 binding protein 9, 63 kDa	90	PPIase FKBP-type 1. {ECO:0000255|PROSITE- ProRule:PRU00277}.				chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)	p.L90L(1)		central_nervous_system(13)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	39			GBM - Glioblastoma multiforme(11;0.0156)			AAGGACAGCTGATCACAGGGA	0.463																																							uc003tdh.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(13)|ovary(1)	14						c.(268-270)CTG>CTA		FK506 binding protein 9 precursor							148.0	142.0	144.0					7																	33014277		2203	4300	6503	SO:0001819	synonymous_variant	11328				protein folding	endoplasmic reticulum|membrane	calcium ion binding|FK506 binding|peptidyl-prolyl cis-trans isomerase activity	g.chr7:33014277G>A	AF089745	CCDS5439.1, CCDS64622.1, CCDS64623.1	7p11.1	2013-01-10	2002-08-29		ENSG00000122642	ENSG00000122642		"""EF-hand domain containing"""	3725	protein-coding gene	gene with protein product			"""FK506-binding protein 9 (63 kD)"""			12036304	Standard	NM_007270		Approved	FKBP60, FKBP63	uc003tdh.3	O95302	OTTHUMG00000097847	ENST00000242209.4:c.270G>A	7.37:g.33014277G>A						AVL9_uc011kai.1_Intron|FKBP9_uc011kak.1_Intron|FKBP9_uc011kal.1_Silent_p.L143L|FKBP9_uc003tdg.2_Silent_p.L90L|FKBP9_uc010kwm.2_5'UTR	p.L90L	NM_007270	NP_009201	O95302	FKBP9_HUMAN	GBM - Glioblastoma multiforme(11;0.0156)		2	451	+			90			PPIase FKBP-type 1.		B3KY35|B7Z1G9|B7Z6H3|Q2M2A1|Q3MIR7|Q6IN76|Q6P2N1|Q96EX5|Q96IJ9	Silent	SNP	ENST00000242209.4	37	c.270G>A	CCDS5439.1																																																																																				0.463	FKBP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215137.1	NM_007270		21	406	0	0	0	0.002445	0	21	406				
TBX20	57057	broad.mit.edu	37	7	35271187	35271187	+	Silent	SNP	C	C	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr7:35271187C>T	ENST00000408931.3	-	6	1345	c.819G>A	c.(817-819)acG>acA	p.T273T		NM_001077653.2|NM_001166220.1	NP_001071121.1|NP_001159692.1	Q9UMR3	TBX20_HUMAN	T-box 20	273					aortic valve morphogenesis (GO:0003180)|atrial septum morphogenesis (GO:0060413)|blood circulation (GO:0008015)|cardiac chamber formation (GO:0003207)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|dorsal/ventral pattern formation (GO:0009953)|embryonic heart tube elongation (GO:0036306)|embryonic heart tube morphogenesis (GO:0003143)|endocardial cushion formation (GO:0003272)|endocardial cushion morphogenesis (GO:0003203)|endoderm formation (GO:0001706)|foramen ovale closure (GO:0035922)|heart looping (GO:0001947)|lateral mesoderm formation (GO:0048370)|muscle contraction (GO:0006936)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron migration (GO:0001764)|outflow tract septum morphogenesis (GO:0003148)|patterning of blood vessels (GO:0001569)|pericardium morphogenesis (GO:0003344)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary valve formation (GO:0003193)|pulmonary vein morphogenesis (GO:0060577)|tricuspid valve development (GO:0003175)|visceral motor neuron differentiation (GO:0021524)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T273T(2)		central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(1)|lung(9)|prostate(1)|skin(1)|stomach(1)	18						TTTTCAGCTTCGTTATCTGGA	0.373																																							uc011kas.1		NA																	2	Substitution - coding silent(2)		lung(2)	central_nervous_system(1)	1						c.(817-819)ACG>ACA		T-box transcription factor TBX20							66.0	61.0	62.0					7																	35271187		2203	4300	6503	SO:0001819	synonymous_variant	57057					nucleus	DNA binding	g.chr7:35271187C>T	AJ237589	CCDS43568.1	7p14.3	2014-09-17			ENSG00000164532	ENSG00000164532		"""T-boxes"""	11598	protein-coding gene	gene with protein product		606061				10936053	Standard	NM_001077653		Approved		uc011kas.2	Q9UMR3	OTTHUMG00000099411	ENST00000408931.3:c.819G>A	7.37:g.35271187C>T							p.T273T	NM_001077653	NP_001071121	Q9UMR3	TBX20_HUMAN			6	830	-			273			T-box.		A4D1Y6|Q000T4|Q0IJ70|Q0VAS1|Q9Y2N5	Silent	SNP	ENST00000408931.3	37	c.819G>A	CCDS43568.1																																																																																				0.373	TBX20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216870.2	NM_020417		14	41	0	0	0	0.003163	0	14	41				
HECW1	23072	broad.mit.edu	37	7	43590144	43590144	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr7:43590144G>A	ENST00000395891.2	+	27	4954	c.4349G>A	c.(4348-4350)cGc>cAc	p.R1450H	HECW1_ENST00000453890.1_Missense_Mutation_p.R1416H	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	1450	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.R1450H(1)|p.R1429H(1)		NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						CGGGTGGAGCGCGGCGTGGTA	0.627																																							uc003tid.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						c.(4348-4350)CGC>CAC		NEDD4-like ubiquitin-protein ligase 1							59.0	67.0	64.0					7																	43590144		2178	4282	6460	SO:0001583	missense	23072				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity	g.chr7:43590144G>A	AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.4349G>A	7.37:g.43590144G>A	ENSP00000379228:p.Arg1450His					HECW1_uc011kbi.1_Missense_Mutation_p.R1416H	p.R1450H	NM_015052	NP_055867	Q76N89	HECW1_HUMAN			27	4954	+			1450			HECT.		A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Missense_Mutation	SNP	ENST00000395891.2	37	c.4349G>A	CCDS5469.2	.	.	.	.	.	.	.	.	.	.	G	35	5.581426	0.96565	.	.	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	T;T	0.58210	0.35;0.35	5.62	5.62	0.85841	HECT (4);	0.000000	0.85682	D	0.000000	T	0.75968	0.3922	M	0.80616	2.505	0.80722	D	1	D;D	0.89917	1.0;0.991	D;P	0.85130	0.997;0.703	T	0.78633	-0.2128	10	0.87932	D	0	.	19.6632	0.95882	0.0:0.0:1.0:0.0	.	1416;1450	B4DH42;Q76N89	.;HECW1_HUMAN	H	1450;1416;1450	ENSP00000379228:R1450H;ENSP00000407774:R1416H	ENSP00000265522:R1450H	R	+	2	0	HECW1	43556669	1.000000	0.71417	0.714000	0.30535	0.921000	0.55340	9.476000	0.97823	2.625000	0.88918	0.655000	0.94253	CGC		0.627	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2	NM_015052		9	20	0	0	0	0.004482	0	9	20				
HECW1	23072	broad.mit.edu	37	7	43594285	43594285	+	Silent	SNP	G	G	A	rs373576994		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr7:43594285G>A	ENST00000395891.2	+	29	5210	c.4605G>A	c.(4603-4605)acG>acA	p.T1535T	HECW1_ENST00000453890.1_Silent_p.T1501T	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	1535	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.T1535T(1)|p.T1514T(1)		NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						AGTTTGTCACGGGAACATCCA	0.557																																							uc003tid.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						c.(4603-4605)ACG>ACA		NEDD4-like ubiquitin-protein ligase 1		G		1,4003		0,1,2001	53.0	52.0	52.0		4605	-10.3	0.6	7		52	0,8338		0,0,4169	no	coding-synonymous	HECW1	NM_015052.3		0,1,6170	AA,AG,GG		0.0,0.025,0.0081		1535/1607	43594285	1,12341	2002	4169	6171	SO:0001819	synonymous_variant	23072				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity	g.chr7:43594285G>A	AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.4605G>A	7.37:g.43594285G>A						HECW1_uc011kbi.1_Silent_p.T1501T	p.T1535T	NM_015052	NP_055867	Q76N89	HECW1_HUMAN			29	5210	+			1535			HECT.		A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Silent	SNP	ENST00000395891.2	37	c.4605G>A	CCDS5469.2																																																																																				0.557	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2	NM_015052		22	41	0	0	0	0.00278	0	22	41				
TBRG4	9238	broad.mit.edu	37	7	45145176	45145176	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr7:45145176G>T	ENST00000258770.3	-	3	720	c.599C>A	c.(598-600)tCg>tAg	p.S200*	TBRG4_ENST00000494076.1_Nonsense_Mutation_p.S200*|TBRG4_ENST00000361278.3_Nonsense_Mutation_p.S200*|TBRG4_ENST00000471142.1_5'Flank|SNORA5A_ENST00000384111.1_RNA|SNORA5C_ENST00000364902.1_RNA|SNORA5B_ENST00000363786.1_RNA|TBRG4_ENST00000395655.4_Nonsense_Mutation_p.S200*	NM_004749.3	NP_004740.2	Q969Z0	TBRG4_HUMAN	transforming growth factor beta regulator 4	200					cell cycle arrest (GO:0007050)|cellular respiration (GO:0045333)|positive regulation of cell proliferation (GO:0008284)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)	p.S200*(1)		cervix(1)|endometrium(3)|large_intestine(2)|lung(8)|skin(1)|stomach(2)	17						CAGCTCCTGCGAGTGCTGCTC	0.582																																							uc003tmv.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(598-600)TCG>TAG		cell cycle progression 2 protein isoform 1							106.0	108.0	107.0					7																	45145176		2203	4300	6503	SO:0001587	stop_gained	9238				apoptosis|cell cycle arrest|cellular respiration|G1 phase of mitotic cell cycle|positive regulation of cell proliferation	mitochondrion	ATP binding|protein binding|protein kinase activity	g.chr7:45145176G>T	AB023165	CCDS5501.1, CCDS5502.1	7p13	2006-07-07			ENSG00000136270	ENSG00000136270			17443	protein-coding gene	gene with protein product	"""FAST kinase domains 4"", ""cell cycle progression 2 protein"""	611325				9383053	Standard	NM_004749		Approved	Cpr2, KIAA0948, H_TD2522F11.8, FASTKD4	uc011kcd.3	Q969Z0	OTTHUMG00000129247	ENST00000258770.3:c.599C>A	7.37:g.45145176G>T	ENSP00000258770:p.Ser200*					TBRG4_uc003tmu.2_Nonsense_Mutation_p.S25*|TBRG4_uc003tmw.2_Nonsense_Mutation_p.S200*|TBRG4_uc003tmx.2_Nonsense_Mutation_p.S200*|TBRG4_uc011kcd.1_Nonsense_Mutation_p.S211*|SNORA5A_uc003tmy.2_5'Flank|SNORA5C_uc003tmz.1_5'Flank	p.S200*	NM_004749	NP_004740	Q969Z0	TBRG4_HUMAN			3	725	-			200					A4D2L2|A4D2L3|D3DVL5|D3DVL6|O14710|Q53GI8|Q8NDM4|Q9BUC6|Q9Y2F6	Nonsense_Mutation	SNP	ENST00000258770.3	37	c.599C>A	CCDS5501.1	.	.	.	.	.	.	.	.	.	.	G	18.93	3.728496	0.69074	.	.	ENSG00000136270	ENST00000258770;ENST00000361278;ENST00000395655;ENST00000494076;ENST00000478532;ENST00000461363	.	.	.	5.76	5.76	0.90799	.	0.451841	0.25109	N	0.033080	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	.	15.4665	0.75406	0.0:0.0:1.0:0.0	.	.	.	.	X	200;200;200;200;165;146	.	ENSP00000258770:S200X	S	-	2	0	TBRG4	45111701	0.898000	0.30612	0.032000	0.17829	0.011000	0.07611	4.878000	0.63093	2.718000	0.92993	0.655000	0.94253	TCG		0.582	TBRG4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251351.1	NM_030900		13	254	1	0	7.03913e-09	0.001368	9.37438e-09	13	254				
ZNF733P	643955	broad.mit.edu	37	7	62753165	62753165	+	RNA	SNP	T	T	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr7:62753165T>C	ENST00000331425.6	-	0	270					NR_003952.1				zinc finger protein 733, pseudogene																		GATGCCCTGCTCTGGCTGAAG	0.368																																							uc011kdj.1		NA																	0					0						c.(202-204)GAG>GGG		Homo sapiens cDNA clone IMAGE:30377995, containing frame-shift errors.																																						643955							g.chr7:62753165T>C			7q11.21	2012-04-20	2012-04-20	2012-04-20	ENSG00000185037	ENSG00000185037			32473	pseudogene	pseudogene			"""zinc finger protein 733"""	ZNF733			Standard	NR_003952		Approved		uc011kdj.2		OTTHUMG00000156270		7.37:g.62753165T>C							p.E68G	NR_003952						3	271	-									Missense_Mutation	SNP	ENST00000331425.6	37	c.203A>G																																																																																					0.368	ZNF733P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000343679.1			7	284	0	0	0	0.000978	0	7	284				
AUTS2	26053	broad.mit.edu	37	7	70231185	70231185	+	Silent	SNP	C	C	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr7:70231185C>G	ENST00000342771.4	+	9	1875	c.1554C>G	c.(1552-1554)ccC>ccG	p.P518P	AUTS2_ENST00000406775.2_Silent_p.P518P	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	518								p.P518P(1)		breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		GCCCTCCGCCCTACCTGCGGA	0.617																																							uc003tvw.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(1552-1554)CCC>CCG		autism susceptibility candidate 2 isoform 1							206.0	199.0	201.0					7																	70231185		2203	4300	6503	SO:0001819	synonymous_variant	26053							g.chr7:70231185C>G	AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.1554C>G	7.37:g.70231185C>G						AUTS2_uc003tvx.3_Silent_p.P518P|AUTS2_uc011keg.1_5'Flank	p.P518P	NM_015570	NP_056385	Q8WXX7	AUTS2_HUMAN		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)	9	2297	+		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)	518					A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Silent	SNP	ENST00000342771.4	37	c.1554C>G	CCDS5539.1	.	.	.	.	.	.	.	.	.	.	C	10.17	1.276898	0.23307	.	.	ENSG00000158321	ENST00000443672	T	0.46451	0.87	5.77	3.94	0.45596	.	0.103854	0.64402	D	0.000002	T	0.41650	0.1168	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.18555	-1.0333	6	.	.	.	-21.8201	6.1279	0.20189	0.1288:0.5542:0.2493:0.0677	.	.	.	.	R	60	ENSP00000393548:P60R	.	P	+	2	0	AUTS2	69869121	0.713000	0.27926	1.000000	0.80357	0.997000	0.91878	-0.097000	0.11042	0.760000	0.33108	0.561000	0.74099	CCT		0.617	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251971.2			19	65	0	0	0	0.001882	0	19	65				
POM121C	100101267	broad.mit.edu	37	7	75052311	75052311	+	Silent	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr7:75052311G>A	ENST00000257665.5	-	11	1949	c.1950C>T	c.(1948-1950)gcC>gcT	p.A650A	POM121C_ENST00000453279.2_Silent_p.A408A|POM121C_ENST00000473168.1_5'Flank			A8CG34	P121C_HUMAN	POM121 transmembrane nucleoporin C	650	Pore side. {ECO:0000255}.				mRNA transport (GO:0051028)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|nuclear pore (GO:0005643)		p.A408A(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	14						TGGTGTCAGTGGCTGGTACCA	0.627																																							uc003udk.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1222-1224)GCC>GCT		POM121 membrane glycoprotein (rat)-like							38.0	39.0	39.0					7																	75052311		2187	4265	6452	SO:0001819	synonymous_variant	100101267				mRNA transport|protein transport|transmembrane transport	endoplasmic reticulum membrane|nuclear membrane|nuclear pore	protein binding	g.chr7:75052311G>A		CCDS47617.1	7q11.23	2012-03-13	2012-03-13		ENSG00000135213	ENSG00000272391			34005	protein-coding gene	gene with protein product		615754	"""POM121 membrane glycoprotein C"""			17900573	Standard	NM_001099415		Approved		uc003udk.4	A8CG34	OTTHUMG00000156238	ENST00000257665.5:c.1950C>T	7.37:g.75052311G>A							p.A408A	NM_001099415	NP_001092885	A8CG34	P121C_HUMAN			13	2109	-			650			Pore side (Potential).		O75115|Q9Y2N3|Q9Y4S7	Silent	SNP	ENST00000257665.5	37	c.1224C>T																																																																																					0.627	POM121C-003	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000343919.2	NM_001099415		20	53	0	0	0	0.005443	0	20	53				
CROT	54677	broad.mit.edu	37	7	87011309	87011309	+	Splice_Site	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr7:87011309G>T	ENST00000331536.3	+	11	1247	c.1062G>T	c.(1060-1062)aaG>aaT	p.K354N	CROT_ENST00000419147.2_Splice_Site_p.K382N|CROT_ENST00000442291.1_Splice_Site_p.K354N	NM_021151.3	NP_066974.2	Q9UKG9	OCTC_HUMAN	carnitine O-octanoyltransferase	354					carnitine metabolic process (GO:0009437)|cellular lipid metabolic process (GO:0044255)|coenzyme A metabolic process (GO:0015936)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|fatty acid metabolic process (GO:0006631)|fatty acid transport (GO:0015908)|generation of precursor metabolites and energy (GO:0006091)|medium-chain fatty acid metabolic process (GO:0051791)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carnitine O-octanoyltransferase activity (GO:0008458)|receptor binding (GO:0005102)	p.K354N(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				L-Carnitine(DB00583)	GAAGATGGAAGGTATGTTTGA	0.313																																							uc003uit.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(1)	3						c.(1060-1062)AAG>AAT		peroxisomal carnitine O-octanoyltransferase	L-Carnitine(DB00583)						91.0	88.0	89.0					7																	87011309		2203	4297	6500	SO:0001630	splice_region_variant	54677				fatty acid beta-oxidation using acyl-CoA oxidase|generation of precursor metabolites and energy|transport	peroxisomal matrix	carnitine O-octanoyltransferase activity	g.chr7:87011309G>T		CCDS5604.1, CCDS47634.1, CCDS59062.1	7q21.1	2010-02-26			ENSG00000005469	ENSG00000005469			2366	protein-coding gene	gene with protein product		606090				10486279	Standard	NM_021151		Approved	COT	uc003uit.3	Q9UKG9	OTTHUMG00000023653	ENST00000331536.3:c.1062+1G>T	7.37:g.87011309G>T						CROT_uc003uiu.2_Missense_Mutation_p.K382N	p.K354N	NM_021151	NP_066974	Q9UKG9	OCTC_HUMAN			11	1307	+	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)		354					A4D1D6|E7EQF2|Q86V17|Q8IUW9|Q9Y6I2	Missense_Mutation	SNP	ENST00000331536.3	37	c.1062G>T	CCDS5604.1	.	.	.	.	.	.	.	.	.	.	G	18.00	3.525823	0.64860	.	.	ENSG00000005469	ENST00000419147;ENST00000331536;ENST00000442291	D;D;D	0.89343	-2.5;-2.5;-2.5	5.35	5.35	0.76521	.	0.137201	0.64402	D	0.000004	D	0.90971	0.7161	M	0.81614	2.55	0.80722	D	1	P;B	0.41008	0.735;0.327	B;B	0.44224	0.444;0.236	D	0.88962	0.3394	10	0.21014	T	0.42	-9.6311	19.4212	0.94721	0.0:0.0:1.0:0.0	.	382;354	E7EQF2;Q9UKG9	.;OCTC_HUMAN	N	382;354;354	ENSP00000413575:K382N;ENSP00000331981:K354N;ENSP00000411983:K354N	ENSP00000331981:K354N	K	+	3	2	CROT	86849245	1.000000	0.71417	1.000000	0.80357	0.737000	0.42083	9.160000	0.94734	2.674000	0.91012	0.467000	0.42956	AAG		0.313	CROT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253485.1	NM_021151	Missense_Mutation	12	40	1	0	2.80697e-09	0.000978	3.78302e-09	12	40				
COL1A2	1278	broad.mit.edu	37	7	94054501	94054501	+	Nonsense_Mutation	SNP	G	G	T	rs72659308		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr7:94054501G>T	ENST00000297268.6	+	42	3217	c.2746G>T	c.(2746-2748)Gga>Tga	p.G916*		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	916					blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)	p.G916*(1)	COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	GGGTAGTCCTGGAGTCAACGG	0.507										HNSCC(75;0.22)																													uc003ung.1		NA																COL1A2/PLAG1(3)	1	Substitution - Nonsense(1)		lung(1)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	GRCh37	CM070851	COL1A2	M	rs72659308	c.(2746-2748)GGA>TGA		alpha 2 type I collagen precursor	Collagenase(DB00048)						148.0	141.0	143.0					7																	94054501		2203	4300	6503	SO:0001587	stop_gained	1278				axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging	g.chr7:94054501G>T	Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.2746G>T	7.37:g.94054501G>T	ENSP00000297268:p.Gly916*	HNSCC(75;0.22)				COL1A2_uc011kib.1_Intron	p.G916*	NM_000089	NP_000080	P08123	CO1A2_HUMAN	STAD - Stomach adenocarcinoma(171;0.0031)		42	3217	+	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		916					P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Nonsense_Mutation	SNP	ENST00000297268.6	37	c.2746G>T	CCDS34682.1	.	.	.	.	.	.	.	.	.	.	G	46	12.814138	0.99698	.	.	ENSG00000164692	ENST00000297268;ENST00000545487	.	.	.	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.7567	0.96296	0.0:0.0:1.0:0.0	.	.	.	.	X	916;917	.	ENSP00000297268:G916X	G	+	1	0	COL1A2	93892437	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	9.750000	0.98875	2.765000	0.95021	0.591000	0.81541	GGA		0.507	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309045.2	NM_000089		22	67	1	0	2.21704e-12	0.00278	3.2363e-12	22	67				
COL1A2	1278	broad.mit.edu	37	7	94057055	94057055	+	Silent	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr7:94057055C>A	ENST00000297268.6	+	49	3855	c.3384C>A	c.(3382-3384)ctC>ctA	p.L1128L		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	1128					blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)	p.L1128L(1)	COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	CACCTTCTCTCAGACCCAAGG	0.522										HNSCC(75;0.22)																													uc003ung.1		NA																COL1A2/PLAG1(3)	1	Substitution - coding silent(1)		lung(1)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9						c.(3382-3384)CTC>CTA		alpha 2 type I collagen precursor	Collagenase(DB00048)						99.0	97.0	98.0					7																	94057055		2203	4300	6503	SO:0001819	synonymous_variant	1278				axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging	g.chr7:94057055C>A	Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.3384C>A	7.37:g.94057055C>A		HNSCC(75;0.22)				COL1A2_uc011kib.1_Intron	p.L1128L	NM_000089	NP_000080	P08123	CO1A2_HUMAN	STAD - Stomach adenocarcinoma(171;0.0031)		49	3855	+	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		1128					P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Silent	SNP	ENST00000297268.6	37	c.3384C>A	CCDS34682.1																																																																																				0.522	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309045.2	NM_000089		27	100	1	0	7.07758e-08	0.004656	9.16498e-08	27	100				
ASNS	440	broad.mit.edu	37	7	97481664	97481664	+	Silent	SNP	G	G	A	rs201432154		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr7:97481664G>A	ENST00000394309.3	-	13	2064	c.1593C>T	c.(1591-1593)gaC>gaT	p.D531D	ASNS_ENST00000422745.1_Silent_p.D510D|ASNS_ENST00000175506.4_Silent_p.D531D|ASNS_ENST00000444334.1_Silent_p.D510D|ASNS_ENST00000437628.1_Silent_p.D448D|ASNS_ENST00000455086.1_Silent_p.D448D|ASNS_ENST00000394308.3_Silent_p.D531D	NM_133436.3	NP_597680.2	P08243	ASNS_HUMAN	asparagine synthetase (glutamine-hydrolyzing)	531	Asparagine synthetase.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|asparagine biosynthetic process (GO:0006529)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|cellular protein metabolic process (GO:0044267)|cellular response to glucose starvation (GO:0042149)|cellular response to hormone stimulus (GO:0032870)|endoplasmic reticulum unfolded protein response (GO:0030968)|glutamine metabolic process (GO:0006541)|L-asparagine biosynthetic process (GO:0070981)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|positive regulation of mitotic cell cycle (GO:0045931)|response to amino acid (GO:0043200)|response to follicle-stimulating hormone (GO:0032354)|response to light stimulus (GO:0009416)|response to mechanical stimulus (GO:0009612)|response to methotrexate (GO:0031427)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	asparagine synthase (glutamine-hydrolyzing) activity (GO:0004066)|ATP binding (GO:0005524)|cofactor binding (GO:0048037)	p.D531D(1)		ovary(1)	1	all_cancers(62;6.64e-09)|all_epithelial(64;1.58e-09)|Esophageal squamous(72;0.00448)|Lung NSC(181;0.0342)|all_lung(186;0.0369)				Adenosine triphosphate(DB00171)|L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)	GGCTCAGCCAGTCAGCCCGGC	0.507																																					Melanoma(70;6 1280 3108 3799 51123)|GBM(6;275 291 425 9929 27738)	Melanoma(70;6 1280 3108 3799 51123)|GBM(6;275 291 425 9929 27738)	uc003uot.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1591-1593)GAC>GAT		asparagine synthetase	Adenosine triphosphate(DB00171)|L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)|L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)						113.0	106.0	109.0					7																	97481664		2203	4300	6503	SO:0001819	synonymous_variant	440				cellular response to glucose starvation|glutamine metabolic process|negative regulation of apoptosis|positive regulation of mitotic cell cycle	cytosol|soluble fraction	asparagine synthase (glutamine-hydrolyzing) activity|ATP binding	g.chr7:97481664G>A	M27396	CCDS5652.1, CCDS55131.1, CCDS55132.1	7q21.3	2012-10-02	2010-05-07		ENSG00000070669	ENSG00000070669	6.3.5.4		753	protein-coding gene	gene with protein product		108370	"""asparagine synthetase"""				Standard	NM_001673		Approved		uc003uov.4	P08243	OTTHUMG00000022892	ENST00000394309.3:c.1593C>T	7.37:g.97481664G>A						ASNS_uc011kin.1_Silent_p.D448D|ASNS_uc003uou.3_Silent_p.D531D|ASNS_uc003uov.3_Silent_p.D531D|ASNS_uc011kio.1_Silent_p.D510D|ASNS_uc003uow.3_Silent_p.D510D|ASNS_uc003uox.3_Silent_p.D448D	p.D531D	NM_133436	NP_597680	P08243	ASNS_HUMAN			13	2099	-	all_cancers(62;6.64e-09)|all_epithelial(64;1.58e-09)|Esophageal squamous(72;0.00448)|Lung NSC(181;0.0342)|all_lung(186;0.0369)		531			Asparagine synthetase.		A4D1I8|B4DXZ1|B7ZAA9|D6W5R3|E9PCI3|E9PCX6|P08184|Q15666|Q549T9|Q96HD0	Silent	SNP	ENST00000394309.3	37	c.1593C>T	CCDS5652.1																																																																																				0.507	ASNS-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333645.1	NM_001673, NM_183356		22	72	0	0	0	0.001882	0	22	72				
TRRAP	8295	broad.mit.edu	37	7	98602013	98602013	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr7:98602013A>T	ENST00000359863.4	+	67	10677	c.10468A>T	c.(10468-10470)Acg>Tcg	p.T3490S	TRRAP_ENST00000355540.3_Missense_Mutation_p.T3461S|TRRAP_ENST00000446306.3_Missense_Mutation_p.T3479S	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	3490					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)	p.T3461S(1)|p.T3490S(1)		NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			GCCAAAGCCAACGCATTATTA	0.532																																							uc003upp.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37						c.(10468-10470)ACG>TCG		transformation/transcription domain-associated							71.0	75.0	73.0					7																	98602013		2203	4300	6503	SO:0001583	missense	8295				histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity	g.chr7:98602013A>T	AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.10468A>T	7.37:g.98602013A>T	ENSP00000352925:p.Thr3490Ser					TRRAP_uc011kis.1_Missense_Mutation_p.T3461S|TRRAP_uc003upr.2_Missense_Mutation_p.T3196S	p.T3490S	NM_003496	NP_003487	Q9Y4A5	TRRAP_HUMAN	STAD - Stomach adenocarcinoma(171;0.215)		67	10677	+	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		3490					A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	ENST00000359863.4	37	c.10468A>T	CCDS59066.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	4.448|4.448	0.082901|0.082901	0.08533|0.08533	.|.	.|.	ENSG00000196367|ENSG00000196367	ENST00000456197|ENST00000359863;ENST00000355540;ENST00000446306	.|T;T	.|0.80214	.|-1.35;-1.35	5.62|5.62	5.62|5.62	0.85841|0.85841	.|Protein kinase-like domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.58977|0.58977	0.2160|0.2160	N|N	0.03253|0.03253	-0.375|-0.375	0.80722|0.80722	D|D	1|1	.|B;B;B	.|0.21309	.|0.054;0.0;0.0	.|B;B;B	.|0.19666	.|0.026;0.0;0.001	T|T	0.60000|0.60000	-0.7348|-0.7348	5|10	.|0.05620	.|T	.|0.96	.|.	15.8271|15.8271	0.78718|0.78718	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|3461;3218;3490	.|Q9Y4A5-2;Q59FH1;Q9Y4A5	.|.;.;TRRAP_HUMAN	H|S	3218|3490;3461;3478	.|ENSP00000352925:T3490S;ENSP00000347733:T3461S	.|ENSP00000347733:T3461S	Q|T	+|+	3|1	2|0	TRRAP|TRRAP	98439949|98439949	1.000000|1.000000	0.71417|0.71417	0.504000|0.504000	0.27639|0.27639	0.107000|0.107000	0.19398|0.19398	9.339000|9.339000	0.96797|0.96797	2.149000|2.149000	0.67028|0.67028	0.533000|0.533000	0.62120|0.62120	CAA|ACG		0.532	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317978.1	NM_003496		26	93	0	0	0	0.005443	0	26	93				
PILRB	29990	broad.mit.edu	37	7	99956683	99956683	+	Silent	SNP	C	C	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr7:99956683C>T	ENST00000452089.1	+	7	1494	c.435C>T	c.(433-435)acC>acT	p.T145T	PILRB_ENST00000609309.1_Silent_p.T145T|STAG3L5P-PVRIG2P-PILRB_ENST00000310771.4_RNA|PILRB_ENST00000448382.1_Nonsense_Mutation_p.Q198*|PILRB_ENST00000610247.1_Silent_p.T145T|PILRB_ENST00000444073.1_Silent_p.T145T			Q9UKJ0	PILRB_HUMAN	paired immunoglobin-like type 2 receptor beta	145					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)		p.T145T(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	13	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TCAAGGGGACCAAACTCACCA	0.567																																							uc003uuk.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(433-435)ACC>ACT		paired immunoglobulin-like type 2 receptor beta							57.0	57.0	57.0					7																	99956683		2203	4300	6503	SO:0001819	synonymous_variant	29990				activation of transmembrane receptor protein tyrosine kinase activity	integral to plasma membrane	protein binding|receptor activity	g.chr7:99956683C>T	AF161081, AJ400845	CCDS43622.1	7q22.1	2014-05-16			ENSG00000121716	ENSG00000121716		"""Immunoglobulin superfamily / V-set domain containing"""	18297	protein-coding gene	gene with protein product		605342				10660620	Standard	NM_178238		Approved	FDFACT1, FDFACT2	uc022ail.1	Q9UKJ0	OTTHUMG00000155363	ENST00000452089.1:c.435C>T	7.37:g.99956683C>T						PILRB_uc003uul.2_Nonsense_Mutation_p.Q76*|PILRB_uc003uum.1_RNA|PILRB_uc003uun.2_Silent_p.T145T	p.T145T	NM_013440	NP_038468	Q9UKJ0	PILRB_HUMAN			16	2931	+	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)		145			Extracellular (Potential).		Q69YF9|Q9HBS0	Silent	SNP	ENST00000452089.1	37	c.435C>T	CCDS43622.1	.	.	.	.	.	.	.	.	.	.	C	48	14.440765	0.99795	.	.	ENSG00000121716	ENST00000444874;ENST00000448382	.	.	.	2.5	2.5	0.30297	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.0429	0.36329	0.0:1.0:0.0:0.0	.	.	.	.	X	76;198	.	.	Q	+	1	0	PILRB	99794619	0.976000	0.34144	0.278000	0.24718	0.043000	0.13939	2.650000	0.46665	1.333000	0.45449	0.603000	0.83216	CAA		0.567	PILRB-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339923.2	NM_178238		20	48	0	0	0	0.007413	0	20	48				
ZAN	7455	broad.mit.edu	37	7	100364781	100364781	+	RNA	SNP	C	C	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr7:100364781C>T	ENST00000348028.3	+	0	4926				ZAN_ENST00000427578.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000449052.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.N1587N(2)		NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			GCGCCACCAACGAGAACCGCG	0.577																																							uc003uwj.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11						c.(4759-4761)AAC>AAT		zonadhesin isoform 3							50.0	53.0	52.0					7																	100364781		2076	4210	6286			7455				binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane		g.chr7:100364781C>T	U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100364781C>T						ZAN_uc003uwk.2_Silent_p.N1587N|ZAN_uc003uwl.2_RNA|ZAN_uc010lhh.2_RNA|ZAN_uc010lhi.2_RNA|ZAN_uc011kkd.1_Silent_p.N164N	p.N1587N	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	STAD - Stomach adenocarcinoma(171;0.19)		25	4926	+	Lung NSC(181;0.041)|all_lung(186;0.0581)		1587			Extracellular (Potential).|VWFD 2.		A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Silent	SNP	ENST00000348028.3	37	c.4761C>T																																																																																					0.577	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347214.1	NM_003386		5	79	0	0	0	0.000602	0	5	79				
CDHR3	222256	broad.mit.edu	37	7	105662683	105662683	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr7:105662683G>T	ENST00000317716.9	+	14	1945	c.1865G>T	c.(1864-1866)gGt>gTt	p.G622V	CDHR3_ENST00000478080.1_Missense_Mutation_p.G534V|CDHR3_ENST00000542731.1_Missense_Mutation_p.G622V|CDHR3_ENST00000470188.1_Intron|CDHR3_ENST00000343407.5_Intron	NM_152750.4	NP_689963.2	Q6ZTQ4	CDHR3_HUMAN	cadherin-related family member 3	622	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G622V(2)		breast(1)|cervix(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(15)|ovary(1)	23						CCCAATGCTGGTTCCAATGTC	0.428																																							uc003vdl.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1864-1866)GGT>GTT		hypothetical protein LOC222256 precursor							185.0	171.0	175.0					7																	105662683		2016	4183	6199	SO:0001583	missense	222256				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr7:105662683G>T	AK126338	CCDS47684.1, CCDS75651.1	7q22.2	2011-07-01			ENSG00000128536	ENSG00000128536		"""Cadherins / Cadherin-related"""	26308	protein-coding gene	gene with protein product		615610					Standard	NM_152750		Approved	FLJ44366, FLJ23834, CDH28	uc003vdl.4	Q6ZTQ4	OTTHUMG00000157520	ENST00000317716.9:c.1865G>T	7.37:g.105662683G>T	ENSP00000325954:p.Gly622Val					CDHR3_uc003vdk.2_Intron|CDHR3_uc003vdm.3_Missense_Mutation_p.G609V|CDHR3_uc011klt.1_Missense_Mutation_p.G534V|CDHR3_uc003vdn.2_Intron	p.G622V	NM_152750	NP_689963	Q6ZTQ4	CDHR3_HUMAN			14	1973	+			622			Cadherin 6.|Extracellular (Potential).		Q8TCI7	Missense_Mutation	SNP	ENST00000317716.9	37	c.1865G>T	CCDS47684.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.5|20.5	4.001670|4.001670	0.74932|0.74932	.|.	.|.	ENSG00000128536|ENSG00000128536	ENST00000542731;ENST00000317716;ENST00000478080|ENST00000468477	T;T;T|.	0.69306|.	-0.39;-0.39;0.45|.	5.23|5.23	5.23|5.23	0.72850|0.72850	Cadherin (2);Cadherin-like (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.77942|0.77942	0.4206|0.4206	M|M	0.77103|0.77103	2.36|2.36	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.999;0.999|.	T|T	0.77822|0.77822	-0.2445|-0.2445	10|5	0.62326|.	D|.	0.03|.	-24.229|-24.229	19.1588|19.1588	0.93522|0.93522	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	609;622|.	B3KYA0;Q6ZTQ4|.	.;CDHR3_HUMAN|.	V|F	622;622;534|91	ENSP00000439766:G622V;ENSP00000325954:G622V;ENSP00000417771:G534V|.	ENSP00000325954:G622V|.	G|V	+|+	2|1	0|0	CDHR3|CDHR3	105449919|105449919	1.000000|1.000000	0.71417|0.71417	0.975000|0.975000	0.42487|0.42487	0.749000|0.749000	0.42624|0.42624	7.103000|7.103000	0.77014|0.77014	2.613000|2.613000	0.88420|0.88420	0.655000|0.655000	0.94253|0.94253	GGT|GTT		0.428	CDHR3-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349025.2	NM_152750		43	141	1	0	1.15505e-17	0.009718	1.7932e-17	43	141				
LAMB4	22798	broad.mit.edu	37	7	107752392	107752392	+	Splice_Site	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr7:107752392C>A	ENST00000388781.3	-	4	276		c.e4-1		LAMB4_ENST00000418464.1_Splice_Site|LAMB4_ENST00000414450.2_Splice_Site|LAMB4_ENST00000388780.3_Splice_Site|LAMB4_ENST00000205386.4_Splice_Site	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4						cell adhesion (GO:0007155)	basement membrane (GO:0005604)		p.?(1)		NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						TTTGTTCCCCCTGGAAAACAC	0.338																																							uc010ljo.1		NA																	1	Unknown(1)		lung(1)	ovary(4)|breast(2)|large_intestine(1)|skin(1)	8						c.e4-1		laminin, beta 4 precursor							112.0	109.0	110.0					7																	107752392		2203	4300	6503	SO:0001630	splice_region_variant	22798				cell adhesion	basement membrane		g.chr7:107752392C>A	AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.193-1G>T	7.37:g.107752392C>A						LAMB4_uc003vey.2_Splice_Site_p.G65_splice	p.G65_splice	NM_007356	NP_031382	A4D0S4	LAMB4_HUMAN			4	277	-								A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Splice_Site	SNP	ENST00000388781.3	37	c.193_splice	CCDS34732.1	.	.	.	.	.	.	.	.	.	.	C	19.52	3.842482	0.71488	.	.	ENSG00000091128	ENST00000205386;ENST00000388781;ENST00000388780;ENST00000418464;ENST00000414450	.	.	.	5.24	4.36	0.52297	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6253	0.68616	0.0:0.9297:0.0:0.0703	.	.	.	.	.	-1	.	.	.	-	.	.	LAMB4	107539628	1.000000	0.71417	0.958000	0.39756	0.935000	0.57460	4.449000	0.60034	1.593000	0.50029	0.650000	0.86243	.		0.338	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337442.1	XM_209857	Intron	18	71	1	0	0.00074312	0.006122	0.000809367	18	71				
LAMB4	22798	broad.mit.edu	37	7	107756565	107756565	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr7:107756565C>A	ENST00000388781.3	-	3	159	c.76G>T	c.(76-78)Ggt>Tgt	p.G26C	LAMB4_ENST00000418464.1_Missense_Mutation_p.G26C|LAMB4_ENST00000414450.2_Missense_Mutation_p.G26C|LAMB4_ENST00000388780.3_Missense_Mutation_p.G26C|LAMB4_ENST00000205386.4_Missense_Mutation_p.G26C	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	26	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				cell adhesion (GO:0007155)	basement membrane (GO:0005604)		p.G26C(1)		NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						TGACAGGCACCCCTGTTGCAG	0.532																																							uc010ljo.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|breast(2)|large_intestine(1)|skin(1)	8						c.(76-78)GGT>TGT		laminin, beta 4 precursor							128.0	119.0	122.0					7																	107756565		2203	4300	6503	SO:0001583	missense	22798				cell adhesion	basement membrane		g.chr7:107756565C>A	AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.76G>T	7.37:g.107756565C>A	ENSP00000373433:p.Gly26Cys					LAMB4_uc003vey.2_Missense_Mutation_p.G26C	p.G26C	NM_007356	NP_031382	A4D0S4	LAMB4_HUMAN			3	160	-			26			Laminin N-terminal.		A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Missense_Mutation	SNP	ENST00000388781.3	37	c.76G>T	CCDS34732.1	.	.	.	.	.	.	.	.	.	.	C	17.24	3.338470	0.60963	.	.	ENSG00000091128	ENST00000205386;ENST00000388781;ENST00000388780;ENST00000418464;ENST00000414450	T;T;T;T;T	0.34667	1.35;1.35;1.37;1.39;1.43	5.45	2.68	0.31781	Laminin, N-terminal (2);	0.135863	0.33180	N	0.005199	T	0.47002	0.1422	M	0.84082	2.675	0.32035	N	0.599041	P	0.51449	0.945	P	0.50440	0.641	T	0.58956	-0.7544	10	0.87932	D	0	.	6.5085	0.22208	0.0:0.6612:0.13:0.2087	.	26	A4D0S4	LAMB4_HUMAN	C	26	ENSP00000205386:G26C;ENSP00000373433:G26C;ENSP00000373432:G26C;ENSP00000402353:G26C;ENSP00000402265:G26C	ENSP00000205386:G26C	G	-	1	0	LAMB4	107543801	0.004000	0.15560	0.058000	0.19502	0.129000	0.20672	0.536000	0.23129	0.280000	0.22209	-0.126000	0.14955	GGT		0.532	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337442.1	XM_209857		25	109	1	0	2.44723e-14	0.004656	3.67739e-14	25	109				
CPED1	79974	broad.mit.edu	37	7	120704291	120704291	+	Splice_Site	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr7:120704291G>T	ENST00000310396.5	+	5	1007		c.e5-1		CPED1_ENST00000450913.2_Splice_Site|CPED1_ENST00000423795.1_Splice_Site	NM_024913.4	NP_079189.4	A4D0V7	CPED1_HUMAN	cadherin-like and PC-esterase domain containing 1							endoplasmic reticulum (GO:0005783)		p.?(1)									ATTCCTTTCAGGCAAACAGAT	0.393																																							uc003vjq.3		NA																	1	Unknown(1)		lung(1)	ovary(4)|large_intestine(2)|skin(2)|pancreas(1)	9						c.e5-1		hypothetical protein LOC79974 isoform 1							91.0	91.0	91.0					7																	120704291		2203	4300	6503	SO:0001630	splice_region_variant	79974					endoplasmic reticulum		g.chr7:120704291G>T		CCDS34739.1, CCDS47690.1	7q31.31	2012-06-12	2012-06-12	2012-06-12	ENSG00000106034	ENSG00000106034			26159	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 58"""	C7orf58		20056006	Standard	NM_024913		Approved	FLJ21986	uc003vjq.4	A4D0V7	OTTHUMG00000156982	ENST00000310396.5:c.541-1G>T	7.37:g.120704291G>T						C7orf58_uc003vjr.1_Splice_Site_p.A181_splice|C7orf58_uc003vjs.3_Splice_Site_p.A181_splice|C7orf58_uc003vjt.3_Splice_Site	p.A181_splice	NM_024913	NP_079189	A4D0V7	CG058_HUMAN			5	988	+	all_neural(327;0.117)							A8K1R3|Q6UXT1|Q86T76|Q86T84|Q8N2T5|Q96NC9	Splice_Site	SNP	ENST00000310396.5	37	c.541_splice	CCDS34739.1	.	.	.	.	.	.	.	.	.	.	G	12.31	1.899540	0.33535	.	.	ENSG00000106034	ENST00000310396;ENST00000428526;ENST00000450913	.	.	.	5.68	5.68	0.88126	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2861	0.73828	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C7orf58	120491527	1.000000	0.71417	1.000000	0.80357	0.275000	0.26752	5.449000	0.66619	2.676000	0.91093	0.563000	0.77884	.		0.393	CPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346959.1	NM_024913	Intron	30	94	1	0	5.8336e-16	0.003271	8.88478e-16	30	94				
ZYX	7791	broad.mit.edu	37	7	143080351	143080351	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr7:143080351G>T	ENST00000322764.5	+	5	1304	c.959G>T	c.(958-960)aGg>aTg	p.R320M	ZYX_ENST00000392910.2_Missense_Mutation_p.R163M|ZYX_ENST00000449423.2_Missense_Mutation_p.R233M|AC093673.5_ENST00000429630.1_RNA	NM_001010972.1|NM_003461.4	NP_001010972.1|NP_003452.1	Q15942	ZYX_HUMAN	zyxin	320					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|integrin-mediated signaling pathway (GO:0007229)|regulation of inflammatory response (GO:0050727)|signal transduction (GO:0007165)|stress fiber assembly (GO:0043149)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.R320M(1)		breast(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)	17	Melanoma(164;0.205)					GCCCAGCAGAGGGAGAAGCCC	0.592																																							uc003wcw.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(958-960)AGG>ATG		zyxin							36.0	41.0	40.0					7																	143080351		2203	4300	6503	SO:0001583	missense	7791				cell adhesion|cell-cell signaling|interspecies interaction between organisms|signal transduction	cell-cell adherens junction|cytoplasm|focal adhesion|integral to plasma membrane|nucleus|stress fiber	protein binding|zinc ion binding	g.chr7:143080351G>T	X95735	CCDS5883.1	7q32	2010-02-26			ENSG00000159840	ENSG00000159840			13200	protein-coding gene	gene with protein product		602002				8917469, 8940160	Standard	XM_005250052		Approved		uc003wcx.3	Q15942	OTTHUMG00000023822	ENST00000322764.5:c.959G>T	7.37:g.143080351G>T	ENSP00000324422:p.Arg320Met					ZYX_uc011ktd.1_Missense_Mutation_p.R163M|ZYX_uc003wcx.2_Missense_Mutation_p.R320M|ZYX_uc011kte.1_Missense_Mutation_p.R289M|ZYX_uc011ktf.1_Missense_Mutation_p.R163M	p.R320M	NM_001010972	NP_001010972	Q15942	ZYX_HUMAN			5	1114	+	Melanoma(164;0.205)		320					A4D2G6|Q6I9S4	Missense_Mutation	SNP	ENST00000322764.5	37	c.959G>T	CCDS5883.1	.	.	.	.	.	.	.	.	.	.	G	16.34	3.094609	0.56075	.	.	ENSG00000159840	ENST00000322764;ENST00000354434;ENST00000449423;ENST00000392910	T;T;T;T	0.55234	0.62;0.56;0.53;0.55	4.12	-1.31	0.09230	.	2.115160	0.02493	U	0.089620	T	0.57975	0.2090	L	0.48642	1.525	0.22226	N	0.999277	D;D	0.62365	0.976;0.991	P;P	0.54270	0.628;0.747	T	0.50171	-0.8859	10	0.46703	T	0.11	.	7.8555	0.29480	0.4778:0.0:0.5222:0.0	.	233;320	B4DQR8;Q15942	.;ZYX_HUMAN	M	320;288;233;163	ENSP00000324422:R320M;ENSP00000346417:R288M;ENSP00000394158:R233M;ENSP00000376642:R163M	ENSP00000324422:R320M	R	+	2	0	ZYX	142790473	1.000000	0.71417	0.960000	0.40013	0.939000	0.58152	0.909000	0.28558	-0.795000	0.04462	-0.251000	0.11542	AGG		0.592	ZYX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000156296.2	NM_003461		29	73	1	0	1.32181e-22	0.007291	2.14698e-22	29	73				
ZYX	7791	broad.mit.edu	37	7	143080397	143080397	+	Silent	SNP	G	G	C	rs199901565		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr7:143080397G>C	ENST00000322764.5	+	5	1350	c.1005G>C	c.(1003-1005)ccG>ccC	p.P335P	ZYX_ENST00000392910.2_Silent_p.P178P|ZYX_ENST00000449423.2_Silent_p.P248P|AC093673.5_ENST00000429630.1_RNA	NM_001010972.1|NM_003461.4	NP_001010972.1|NP_003452.1	Q15942	ZYX_HUMAN	zyxin	335					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|integrin-mediated signaling pathway (GO:0007229)|regulation of inflammatory response (GO:0050727)|signal transduction (GO:0007165)|stress fiber assembly (GO:0043149)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.P335P(1)		breast(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)	17	Melanoma(164;0.205)					TGCCCCCACCGGCTCAGAACC	0.617																																							uc003wcw.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1003-1005)CCG>CCC		zyxin							23.0	26.0	25.0					7																	143080397		2202	4300	6502	SO:0001819	synonymous_variant	7791				cell adhesion|cell-cell signaling|interspecies interaction between organisms|signal transduction	cell-cell adherens junction|cytoplasm|focal adhesion|integral to plasma membrane|nucleus|stress fiber	protein binding|zinc ion binding	g.chr7:143080397G>C	X95735	CCDS5883.1	7q32	2010-02-26			ENSG00000159840	ENSG00000159840			13200	protein-coding gene	gene with protein product		602002				8917469, 8940160	Standard	XM_005250052		Approved		uc003wcx.3	Q15942	OTTHUMG00000023822	ENST00000322764.5:c.1005G>C	7.37:g.143080397G>C						ZYX_uc011ktd.1_Silent_p.P178P|ZYX_uc003wcx.2_Silent_p.P335P|ZYX_uc011kte.1_Silent_p.P304P|ZYX_uc011ktf.1_Silent_p.P178P	p.P335P	NM_001010972	NP_001010972	Q15942	ZYX_HUMAN			5	1160	+	Melanoma(164;0.205)		335					A4D2G6|Q6I9S4	Silent	SNP	ENST00000322764.5	37	c.1005G>C	CCDS5883.1																																																																																				0.617	ZYX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000156296.2	NM_003461		15	48	0	0	0	0.00245	0	15	48				
OR2A12	346525	broad.mit.edu	37	7	143792543	143792543	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr7:143792543G>T	ENST00000408949.2	+	1	403	c.343G>T	c.(343-345)Gtg>Ttg	p.V115L		NM_001004135.1	NP_001004135.1	Q8NGT7	O2A12_HUMAN	olfactory receptor, family 2, subfamily A, member 12	115						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V115L(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(14)|ovary(2)	25	Melanoma(164;0.0783)					TCTGATTTTGGTGATGATGTG	0.433																																							uc011kty.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(343-345)GTG>TTG		olfactory receptor, family 2, subfamily A,							170.0	157.0	162.0					7																	143792543		2038	4207	6245	SO:0001583	missense	346525				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:143792543G>T		CCDS43670.1	7q35	2013-09-20	2002-11-13	2002-11-13	ENSG00000221858	ENSG00000221858		"""GPCR / Class A : Olfactory receptors"""	15082	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily A, member 12 pseudogene"""	OR2A12P			Standard	NM_001004135		Approved		uc011kty.2	Q8NGT7	OTTHUMG00000157996	ENST00000408949.2:c.343G>T	7.37:g.143792543G>T	ENSP00000386174:p.Val115Leu						p.V115L	NM_001004135	NP_001004135	Q8NGT7	O2A12_HUMAN			1	343	+	Melanoma(164;0.0783)		115			Helical; Name=3; (Potential).		Q6IF43	Missense_Mutation	SNP	ENST00000408949.2	37	c.343G>T	CCDS43670.1	.	.	.	.	.	.	.	.	.	.	G	4.440	0.081487	0.08533	.	.	ENSG00000221858	ENST00000408949	T	0.00493	7.0	4.27	2.39	0.29439	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00468	0.0015	L	0.44542	1.39	0.09310	N	1	B	0.14012	0.009	B	0.21151	0.033	T	0.43442	-0.9391	9	0.59425	D	0.04	-16.0552	6.3606	0.21427	0.3178:0.0:0.6822:0.0	.	115	Q8NGT7	O2A12_HUMAN	L	115	ENSP00000386174:V115L	ENSP00000386174:V115L	V	+	1	0	OR2A12	143423476	0.007000	0.16637	0.626000	0.29213	0.012000	0.07955	1.289000	0.33307	1.007000	0.39238	0.505000	0.49811	GTG		0.433	OR2A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349969.1			49	116	1	0	1.61004e-24	0.00361	2.68499e-24	49	116				
OR2A14	135941	broad.mit.edu	37	7	143826593	143826593	+	Missense_Mutation	SNP	C	C	T	rs375928210		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr7:143826593C>T	ENST00000408899.2	+	1	443	c.388C>T	c.(388-390)Cgt>Tgt	p.R130C		NM_001001659.1	NP_001001659.1	Q96R47	O2A14_HUMAN	olfactory receptor, family 2, subfamily A, member 14	130						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R130C(1)		large_intestine(4)|lung(17)|skin(1)	22	Melanoma(164;0.0783)					CCACCCCTTACGTTACAATAG	0.498																																							uc011kua.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(388-390)CGT>TGT		olfactory receptor, family 2, subfamily A,		C	CYS/ARG	0,4314		0,0,2157	198.0	202.0	201.0		388	2.1	0.0	7		201	1,8523		0,1,4261	no	missense	OR2A14	NM_001001659.1	180	0,1,6418	TT,TC,CC		0.0117,0.0,0.0078	probably-damaging	130/311	143826593	1,12837	2157	4262	6419	SO:0001583	missense	135941				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:143826593C>T		CCDS43672.1	7q35	2013-09-20		2004-03-08	ENSG00000221938	ENSG00000221938		"""GPCR / Class A : Olfactory receptors"""	15084	protein-coding gene	gene with protein product				OR2A14P, OR2A6			Standard	NM_001001659		Approved	OST182	uc011kua.2	Q96R47	OTTHUMG00000158003	ENST00000408899.2:c.388C>T	7.37:g.143826593C>T	ENSP00000386137:p.Arg130Cys						p.R130C	NM_001001659	NP_001001659	Q96R47	O2A14_HUMAN			1	388	+	Melanoma(164;0.0783)		130			Cytoplasmic (Potential).		Q6IF41|Q8NGT8	Missense_Mutation	SNP	ENST00000408899.2	37	c.388C>T	CCDS43672.1	.	.	.	.	.	.	.	.	.	.	C	11.26	1.585908	0.28268	0.0	1.17E-4	ENSG00000221938	ENST00000408899	T	0.00922	5.54	4.18	2.13	0.27403	GPCR, rhodopsin-like superfamily (1);	0.877251	0.09042	U	0.857256	T	0.03390	0.0098	M	0.80422	2.495	0.09310	N	1	D	0.65815	0.995	P	0.51701	0.677	T	0.41342	-0.9514	10	0.87932	D	0	0.0367	10.4463	0.44497	0.3452:0.6548:0.0:0.0	.	130	Q96R47	O2A14_HUMAN	C	130	ENSP00000386137:R130C	ENSP00000386137:R130C	R	+	1	0	OR2A14	143457526	0.000000	0.05858	0.001000	0.08648	0.109000	0.19521	1.363000	0.34159	1.044000	0.40200	0.561000	0.74099	CGT		0.498	OR2A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349980.1			12	268	0	0	0	0.000978	0	12	268				
ARHGEF5	7984	broad.mit.edu	37	7	144077006	144077006	+	Missense_Mutation	SNP	G	G	T	rs182264437		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr7:144077006G>T	ENST00000056217.5	+	15	4825	c.4651G>T	c.(4651-4653)Gtg>Ttg	p.V1551L	ARHGEF5_ENST00000471847.2_Missense_Mutation_p.V473L	NM_005435.3	NP_005426.2	Q12774	ARHG5_HUMAN	Rho guanine nucleotide exchange factor (GEF) 5	1551	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)|myeloid dendritic cell chemotaxis (GO:0002408)|positive regulation of podosome assembly (GO:0071803)|regulation of Rho GTPase activity (GO:0032319)		GTP binding (GO:0005525)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.V1551L(1)		breast(1)|endometrium(6)|kidney(8)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Melanoma(164;0.14)					GCTGGAGGGCGTGAGGCTCTC	0.567																																							uc003wel.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(4651-4653)GTG>TTG		rho guanine nucleotide exchange factor 5							115.0	124.0	121.0					7																	144077006		2203	4300	6503	SO:0001583	missense	7984				intracellular signal transduction|regulation of Rho protein signal transduction	intracellular	GTP binding|protein binding|Rho guanyl-nucleotide exchange factor activity	g.chr7:144077006G>T	U02082	CCDS34771.1	7q35	2012-09-20			ENSG00000050327	ENSG00000050327		"""Rho guanine nucleotide exchange factors"""	13209	protein-coding gene	gene with protein product	"""transforming immortalized mammary oncogene"", ""guanine nucleotide regulatory protein TIM"""	600888				8134109, 7656213	Standard	NM_005435		Approved	TIM, TIM1, GEF5, P60	uc003wel.3	Q12774	OTTHUMG00000158004	ENST00000056217.5:c.4651G>T	7.37:g.144077006G>T	ENSP00000056217:p.Val1551Leu					ARHGEF5_uc003wem.2_Missense_Mutation_p.V352L	p.V1551L	NM_005435	NP_005426	Q12774	ARHG5_HUMAN			15	4769	+	Melanoma(164;0.14)		1551			SH3.		A6NNJ2|Q6ZML7	Missense_Mutation	SNP	ENST00000056217.5	37	c.4651G>T	CCDS34771.1	.	.	.	.	.	.	.	.	.	.	G	13.24	2.177702	0.38413	.	.	ENSG00000050327	ENST00000056217;ENST00000344879;ENST00000471847	T;T	0.29142	1.58;1.58	5.22	-5.25	0.02781	Src homology-3 domain (4);	0.556482	0.18988	N	0.125676	T	0.21674	0.0522	L	0.49571	1.57	0.26211	N	0.979292	B;B	0.22080	0.001;0.064	B;B	0.22601	0.005;0.04	T	0.11397	-1.0589	10	0.40728	T	0.16	-4.3058	8.9755	0.35932	0.6048:0.1073:0.2879:0.0	.	352;1551	B3KQX6;Q12774	.;ARHG5_HUMAN	L	1551;352;473	ENSP00000056217:V1551L;ENSP00000418227:V473L	ENSP00000056217:V1551L	V	+	1	0	ARHGEF5	143707939	0.247000	0.23920	0.176000	0.23000	0.960000	0.62799	0.425000	0.21346	-1.057000	0.03201	-0.253000	0.11424	GTG		0.567	ARHGEF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349981.1	NM_005435		7	241	1	0	1.12685e-05	0.004482	1.33324e-05	7	241				
GIMAP8	155038	broad.mit.edu	37	7	150163825	150163825	+	Silent	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr7:150163825C>A	ENST00000307271.3	+	2	613	c.39C>A	c.(37-39)ctC>ctA	p.L13L		NM_175571.2	NP_783161.1	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	13	AIG1-type G 1.|Poly-Leu.					cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)	p.L13L(1)		breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(26)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)		AACTGCGGCTCCTCCTCCTGG	0.498																																							uc003whj.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7						c.(37-39)CTC>CTA		GTPase, IMAP family member 8							53.0	55.0	54.0					7																	150163825		2203	4300	6503	SO:0001819	synonymous_variant	155038					endoplasmic reticulum|Golgi apparatus|mitochondrion	GTP binding	g.chr7:150163825C>A	AL834361	CCDS34777.1	7q36.1	2014-04-04			ENSG00000171115	ENSG00000171115		"""GTPases, IMAP"""	21792	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 9"""					15474311	Standard	XM_005249951		Approved	DKFZp667I133, hIAN6, IAN9	uc003whj.3	Q8ND71	OTTHUMG00000158327	ENST00000307271.3:c.39C>A	7.37:g.150163825C>A							p.L13L	NM_175571	NP_783161	Q8ND71	GIMA8_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)	2	369	+			13			Poly-Leu.			Silent	SNP	ENST00000307271.3	37	c.39C>A	CCDS34777.1																																																																																				0.498	GIMAP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350701.1	NM_175571		32	70	1	0	1.74807e-11	0.002096	2.4746e-11	32	70				
NCAPG2	54892	broad.mit.edu	37	7	158468339	158468339	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr7:158468339C>A	ENST00000409423.1	-	13	1328	c.1156G>T	c.(1156-1158)Gaa>Taa	p.E386*	NCAPG2_ENST00000275830.10_Nonsense_Mutation_p.E178*|NCAPG2_ENST00000356309.3_Nonsense_Mutation_p.E386*|NCAPG2_ENST00000409339.3_Nonsense_Mutation_p.E386*|NCAPG2_ENST00000449727.2_Nonsense_Mutation_p.E386*	NM_001281932.1	NP_001268861.1	Q86XI2	CNDG2_HUMAN	non-SMC condensin II complex, subunit G2	386					chromosome condensation (GO:0030261)|inner cell mass cell proliferation (GO:0001833)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	methylated histone binding (GO:0035064)	p.E386*(1)		NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	39	Ovarian(565;0.152)	all_cancers(7;3.44e-11)|all_epithelial(9;3.05e-05)|all_hematologic(28;0.014)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.187)|STAD - Stomach adenocarcinoma(7;0.18)		TAAGGATCTTCTAAAAGGCTC	0.443																																							uc003wnv.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|breast(1)|kidney(1)	3						c.(1156-1158)GAA>TAA		leucine zipper protein 5							58.0	54.0	55.0					7																	158468339		1852	4097	5949	SO:0001587	stop_gained	54892				cell division|chromosome condensation|mitosis	nucleus	methylated histone residue binding	g.chr7:158468339C>A	BC043404	CCDS43686.1, CCDS64816.1	7q36.3	2006-09-04	2006-09-04	2006-09-04	ENSG00000146918	ENSG00000146918			21904	protein-coding gene	gene with protein product		608532	"""leucine zipper protein 5"""	LUZP5		14532007	Standard	NM_001281933		Approved	FLJ20311, MTB, CAP-G2, hCAP-G2	uc003wnv.1	Q86XI2	OTTHUMG00000151438	ENST00000409423.1:c.1156G>T	7.37:g.158468339C>A	ENSP00000386569:p.Glu386*					NCAPG2_uc010lqu.1_Nonsense_Mutation_p.E178*|NCAPG2_uc003wnw.1_Intron|NCAPG2_uc003wnx.1_Nonsense_Mutation_p.E386*|NCAPG2_uc011kwe.1_Nonsense_Mutation_p.E386*	p.E386*	NM_017760	NP_060230	Q86XI2	CNDG2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.187)|STAD - Stomach adenocarcinoma(7;0.18)	12	1301	-	Ovarian(565;0.152)	all_cancers(7;3.44e-11)|all_epithelial(9;3.05e-05)|all_hematologic(28;0.014)	386					A4D228|Q7Z3J9|Q8WUG8|Q9BRX6|Q9H8S2|Q9H9K6	Nonsense_Mutation	SNP	ENST00000409423.1	37	c.1156G>T	CCDS43686.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	37|37	6.588654|6.588654	0.97688|0.97688	.|.	.|.	ENSG00000146918|ENSG00000146918	ENST00000356309;ENST00000409423;ENST00000275830;ENST00000409339;ENST00000449727|ENST00000441982	.|.	.|.	.|.	5.5|5.5	5.5|5.5	0.81552|0.81552	.|.	0.087519|.	0.85682|.	D|.	0.000000|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	-25.9509|-25.9509	19.383|19.383	0.94545|0.94545	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|Y	386;386;178;386;386|187	.|.	.|.	E|X	-|-	1|3	0|2	NCAPG2|NCAPG2	158161100|158161100	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.978000|0.978000	0.69477|0.69477	4.730000|4.730000	0.62015|0.62015	2.587000|2.587000	0.87381|0.87381	0.655000|0.655000	0.94253|0.94253	GAA|TAG		0.443	NCAPG2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327111.1	NM_017760		14	47	1	0	3.27435e-08	0.00245	4.26957e-08	14	47				
ZNF596	169270	broad.mit.edu	37	8	195623	195623	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr8:195623C>A	ENST00000398612.1	+	6	1159	c.776C>A	c.(775-777)gCc>gAc	p.A259D	ZNF596_ENST00000308811.4_Missense_Mutation_p.A259D|ZNF596_ENST00000320552.2_Missense_Mutation_p.A189D	NM_001042415.1|NM_001042416.1	NP_001035880.1|NP_001035881.1	Q8TC21	ZN596_HUMAN	zinc finger protein 596	259					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A259D(1)		autonomic_ganglia(1)|endometrium(2)|large_intestine(6)|lung(5)	14		all_cancers(2;4.81e-29)|all_epithelial(2;5.03e-19)|Lung NSC(2;8.68e-08)|all_lung(2;1.52e-07)|Ovarian(12;0.00965)|Colorectal(14;0.0367)|all_neural(12;0.0837)|Myeloproliferative disorder(644;0.116)|all_hematologic(2;0.138)|Acute lymphoblastic leukemia(644;0.242)		Epithelial(5;3.77e-18)|all cancers(2;5.2e-17)|OV - Ovarian serous cystadenocarcinoma(5;5.37e-09)|BRCA - Breast invasive adenocarcinoma(11;1.7e-06)|Colorectal(2;6.51e-05)|READ - Rectum adenocarcinoma(2;0.0276)|COAD - Colon adenocarcinoma(149;0.0702)		TGTGGGAAAGCCTTCAGTAAA	0.418																																							uc003wot.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(775-777)GCC>GAC		zinc finger protein 596							74.0	74.0	74.0					8																	195623		2203	4300	6503	SO:0001583	missense	169270				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr8:195623C>A	BC026190	CCDS5951.2	8p23.3	2013-01-08			ENSG00000172748	ENSG00000172748		"""Zinc fingers, C2H2-type"", ""-"""	27268	protein-coding gene	gene with protein product						12477932	Standard	NM_001287256		Approved		uc003wot.3	Q8TC21	OTTHUMG00000086931	ENST00000398612.1:c.776C>A	8.37:g.195623C>A	ENSP00000381613:p.Ala259Asp					ZNF596_uc003wou.2_Missense_Mutation_p.A158D|ZNF596_uc003wov.2_Missense_Mutation_p.A259D|ZNF596_uc003wow.2_Missense_Mutation_p.A259D	p.A259D	NM_173539	NP_775810	Q8TC21	ZN596_HUMAN		Epithelial(5;3.77e-18)|all cancers(2;5.2e-17)|OV - Ovarian serous cystadenocarcinoma(5;5.37e-09)|BRCA - Breast invasive adenocarcinoma(11;1.7e-06)|Colorectal(2;6.51e-05)|READ - Rectum adenocarcinoma(2;0.0276)|COAD - Colon adenocarcinoma(149;0.0702)	6	1064	+		all_cancers(2;4.81e-29)|all_epithelial(2;5.03e-19)|Lung NSC(2;8.68e-08)|all_lung(2;1.52e-07)|Ovarian(12;0.00965)|Colorectal(14;0.0367)|all_neural(12;0.0837)|Myeloproliferative disorder(644;0.116)|all_hematologic(2;0.138)|Acute lymphoblastic leukemia(644;0.242)	259			C2H2-type 3.		B2R8P4|O95015|Q8N9X0	Missense_Mutation	SNP	ENST00000398612.1	37	c.776C>A	CCDS5951.2	.	.	.	.	.	.	.	.	.	.	.	16.03	3.006692	0.54361	.	.	ENSG00000172748	ENST00000308811;ENST00000320552;ENST00000398612	T;T;T	0.14266	2.52;2.52;2.52	2.62	0.793	0.18632	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.31358	0.0794	M	0.80332	2.49	0.23865	N	0.996624	D	0.71674	0.998	D	0.66602	0.945	T	0.08207	-1.0733	9	0.87932	D	0	.	5.0469	0.14488	0.0:0.5736:0.0:0.4264	.	259	Q8TC21	ZN596_HUMAN	D	259;189;259	ENSP00000310033:A259D;ENSP00000318719:A189D;ENSP00000381613:A259D	ENSP00000310033:A259D	A	+	2	0	ZNF596	185623	0.000000	0.05858	0.978000	0.43139	0.989000	0.77384	-0.473000	0.06615	0.202000	0.20498	0.585000	0.79938	GCC		0.418	ZNF596-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195858.4	NM_173539		10	75	1	0	0.000442599	0.006214	0.000487727	10	75				
DLGAP2	9228	broad.mit.edu	37	8	1497404	1497404	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr8:1497404G>C	ENST00000421627.2	+	2	679	c.545G>C	c.(544-546)cGg>cCg	p.R182P		NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	261					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)		p.R226P(1)|p.R204P(1)		breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		GCGGACGGCCGGGCGGACGAC	0.667																																							uc003wpl.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(544-546)CGG>CCG		discs large-associated protein 2							15.0	23.0	20.0					8																	1497404		2174	4284	6458	SO:0001583	missense	9228				neuron-neuron synaptic transmission	cell junction|neurofilament|postsynaptic density|postsynaptic membrane	protein binding	g.chr8:1497404G>C	AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.545G>C	8.37:g.1497404G>C	ENSP00000400258:p.Arg182Pro					DLGAP2_uc003wpm.2_Missense_Mutation_p.R182P	p.R182P	NM_004745	NP_004736	Q9P1A6	DLGP2_HUMAN		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)	2	642	+		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)	261					A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Missense_Mutation	SNP	ENST00000421627.2	37	c.545G>C	CCDS47760.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.20|15.20	2.763131|2.763131	0.49574|0.49574	.|.	.|.	ENSG00000198010|ENSG00000198010	ENST00000520901|ENST00000356067;ENST00000421627	.|T	.|0.17370	.|2.28	5.57|5.57	5.57|5.57	0.84162|0.84162	.|.	.|0.190648	.|0.46145	.|D	.|0.000304	T|T	0.41811|0.41811	0.1175|0.1175	M|M	0.77616|0.77616	2.38|2.38	0.40481|0.40481	D|D	0.980445|0.980445	.|D;D	.|0.65815	.|0.995;0.992	.|P;P	.|0.61132	.|0.884;0.769	T|T	0.15694|0.15694	-1.0428|-1.0428	5|10	.|0.31617	.|T	.|0.26	-15.3881|-15.3881	19.5381|19.5381	0.95262|0.95262	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|261;261	.|Q9P1A6-2;Q9P1A6	.|.;DLGP2_HUMAN	R|P	199|227;182	.|ENSP00000400258:R182P	.|ENSP00000348366:R227P	G|R	+|+	1|2	0|0	DLGAP2|DLGAP2	1484811|1484811	0.997000|0.997000	0.39634|0.39634	0.084000|0.084000	0.20598|0.20598	0.090000|0.090000	0.18270|0.18270	6.020000|6.020000	0.70826|0.70826	2.611000|2.611000	0.88343|0.88343	0.655000|0.655000	0.94253|0.94253	GGG|CGG		0.667	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374478.1	NM_004745		3	20	0	0	0	0.004672	0	3	20				
DLGAP2	9228	broad.mit.edu	37	8	1616686	1616686	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr8:1616686G>T	ENST00000421627.2	+	6	1896	c.1762G>T	c.(1762-1764)Gac>Tac	p.D588Y		NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	667					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)		p.D610Y(1)|p.D632Y(1)		breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		GGACAGCCTGGACAGCAACAA	0.667																																							uc003wpl.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1762-1764)GAC>TAC		discs large-associated protein 2							17.0	23.0	21.0					8																	1616686		2089	4198	6287	SO:0001583	missense	9228				neuron-neuron synaptic transmission	cell junction|neurofilament|postsynaptic density|postsynaptic membrane	protein binding	g.chr8:1616686G>T	AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.1762G>T	8.37:g.1616686G>T	ENSP00000400258:p.Asp588Tyr					DLGAP2_uc003wpm.2_Missense_Mutation_p.D588Y	p.D588Y	NM_004745	NP_004736	Q9P1A6	DLGP2_HUMAN		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)	6	1859	+		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)	667					A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Missense_Mutation	SNP	ENST00000421627.2	37	c.1762G>T	CCDS47760.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.1|24.1	4.496549|4.496549	0.85069|0.85069	.|.	.|.	ENSG00000198010|ENSG00000198010	ENST00000356067;ENST00000421627|ENST00000520901	T|.	0.15834|.	2.39|.	5.52|5.52	5.52|5.52	0.82312|0.82312	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.82398|0.82398	0.5028|0.5028	M|M	0.82823|0.82823	2.61|2.61	0.47778|0.47778	D|D	0.999514|0.999514	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.87578|.	0.998;0.996|.	T|T	0.83218|0.83218	-0.0070|-0.0070	10|5	0.87932|.	D|.	0|.	-13.4821|-13.4821	19.4384|19.4384	0.94807|0.94807	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	667;667|.	Q9P1A6-2;Q9P1A6|.	.;DLGP2_HUMAN|.	Y|C	633;588|604	ENSP00000400258:D588Y|.	ENSP00000348366:D633Y|.	D|W	+|+	1|3	0|0	DLGAP2|DLGAP2	1604093|1604093	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	7.487000|7.487000	0.81328|0.81328	2.589000|2.589000	0.87451|0.87451	0.650000|0.650000	0.86243|0.86243	GAC|TGG		0.667	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374478.1	NM_004745		7	5	1	0	2.7689e-08	0.001984	3.62732e-08	7	5				
MYOM2	9172	broad.mit.edu	37	8	2026987	2026987	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr8:2026987G>C	ENST00000262113.4	+	12	1576	c.1435G>C	c.(1435-1437)Gac>Cac	p.D479H	MYOM2_ENST00000523438.1_Intron	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	479	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)	p.D479H(1)		autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		GGCTGCACTTGACCCCTTGGA	0.527																																							uc003wpx.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(1)|skin(1)	6						c.(1435-1437)GAC>CAC		myomesin 2							119.0	121.0	120.0					8																	2026987		2203	4300	6503	SO:0001583	missense	9172				muscle contraction	myosin filament	structural constituent of muscle	g.chr8:2026987G>C		CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.1435G>C	8.37:g.2026987G>C	ENSP00000262113:p.Asp479His					MYOM2_uc011kwi.1_Intron	p.D479H	NM_003970	NP_003961	P54296	MYOM2_HUMAN		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)	12	1573	+		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)	479					Q7Z3Y2	Missense_Mutation	SNP	ENST00000262113.4	37	c.1435G>C	CCDS5957.1	.	.	.	.	.	.	.	.	.	.	G	15.76	2.929633	0.52759	.	.	ENSG00000036448	ENST00000262113	T	0.60920	0.15	4.71	4.71	0.59529	Fibronectin, type III (1);	0.000000	0.85682	D	0.000000	T	0.77791	0.4183	M	0.81802	2.56	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.81957	-0.0695	10	0.87932	D	0	.	18.0367	0.89305	0.0:0.0:1.0:0.0	.	479	P54296	MYOM2_HUMAN	H	479	ENSP00000262113:D479H	ENSP00000262113:D479H	D	+	1	0	MYOM2	2014394	1.000000	0.71417	0.690000	0.30148	0.003000	0.03518	8.842000	0.92136	2.308000	0.77769	0.561000	0.74099	GAC		0.527	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251249.1	NM_003970		8	210	0	0	0	0.00308	0	8	210				
GATA4	2626	broad.mit.edu	37	8	11606502	11606502	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr8:11606502G>T	ENST00000335135.4	+	3	1249	c.691G>T	c.(691-693)Gat>Tat	p.D231Y	GATA4_ENST00000532059.1_Missense_Mutation_p.D232Y|GATA4_ENST00000528712.1_Missense_Mutation_p.D25Y	NM_002052.3	NP_002043.2	P43694	GATA4_HUMAN	GATA binding protein 4	231					atrial septum morphogenesis (GO:0060413)|atrial septum primum morphogenesis (GO:0003289)|atrial septum secundum morphogenesis (GO:0003290)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac ventricle morphogenesis (GO:0003208)|cell growth involved in cardiac muscle cell development (GO:0061049)|cell-cell signaling (GO:0007267)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to glucose stimulus (GO:0071333)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic foregut morphogenesis (GO:0048617)|embryonic heart tube anterior/posterior pattern specification (GO:0035054)|endocardial cushion development (GO:0003197)|endoderm development (GO:0007492)|endoderm formation (GO:0001706)|epithelial cell fate commitment (GO:0072148)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|intestinal epithelial cell differentiation (GO:0060575)|lung lobe formation (GO:0060464)|male gonad development (GO:0008584)|negative regulation of autophagy (GO:0010507)|positive regulation of angiogenesis (GO:0045766)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to mechanical stimulus (GO:0009612)|seminiferous tubule development (GO:0072520)|Sertoli cell differentiation (GO:0060008)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular cardiac muscle tissue development (GO:0003229)|ventricular septum development (GO:0003281)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|co-SMAD binding (GO:0070410)|DNA binding (GO:0003677)|enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.D231Y(1)		central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(10)	13	all_epithelial(15;0.0839)		STAD - Stomach adenocarcinoma(15;0.00225)	COAD - Colon adenocarcinoma(149;0.199)		CTGGAGGCGAGATGGGACGGG	0.577																																							uc003wuc.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(691-693)GAT>TAT		GATA binding protein 4							122.0	114.0	117.0					8																	11606502		2203	4300	6503	SO:0001583	missense	2626				atrial septum primum morphogenesis|atrial septum secundum morphogenesis|blood coagulation|cardiac right ventricle morphogenesis|cell-cell signaling|embryonic foregut morphogenesis|embryonic heart tube anterior/posterior pattern formation|endocardial cushion development|endoderm development|heart looping|intestinal epithelial cell differentiation|male gonad development|positive regulation of angiogenesis|positive regulation of cardioblast differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation vascular endothelial growth factor production|response to drug|transcription from RNA polymerase II promoter|ventricular septum development	nucleoplasm	activating transcription factor binding|sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding	g.chr8:11606502G>T	AK097060	CCDS5983.1	8p23.1-p22	2013-01-25	2001-11-28		ENSG00000136574	ENSG00000136574		"""GATA zinc finger domain containing"""	4173	protein-coding gene	gene with protein product		600576	"""GATA-binding protein 4"""			7665171	Standard	NM_002052		Approved		uc003wuc.2	P43694	OTTHUMG00000090800	ENST00000335135.4:c.691G>T	8.37:g.11606502G>T	ENSP00000334458:p.Asp231Tyr					GATA4_uc003wub.1_Missense_Mutation_p.D25Y|GATA4_uc011kxc.1_Missense_Mutation_p.D232Y	p.D231Y	NM_002052	NP_002043	P43694	GATA4_HUMAN	STAD - Stomach adenocarcinoma(15;0.00225)	COAD - Colon adenocarcinoma(149;0.199)	3	1245	+	all_epithelial(15;0.0839)		231			GATA-type 1.		B7ZKX0|B7ZKZ4|Q3MJ45|Q5IFM8	Missense_Mutation	SNP	ENST00000335135.4	37	c.691G>T	CCDS5983.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.799806	0.90538	.	.	ENSG00000136574	ENST00000528712;ENST00000526716;ENST00000335135;ENST00000259090;ENST00000532059	D;D;D;D	0.99523	-6.08;-6.08;-6.08;-6.08	5.61	5.61	0.85477	Zinc finger, NHR/GATA-type (1);Zinc finger, GATA-type (5);	0.000000	0.85682	D	0.000000	D	0.99708	0.9888	H	0.95402	3.665	0.80722	D	1	D;D	0.89917	1.0;0.994	D;D	0.91635	0.999;0.962	D	0.97646	1.0151	10	0.87932	D	0	-23.2376	18.9896	0.92786	0.0:0.0:1.0:0.0	.	232;231	B7ZKZ4;P43694	.;GATA4_HUMAN	Y	25;25;231;230;232	ENSP00000435043:D25Y;ENSP00000435347:D25Y;ENSP00000334458:D231Y;ENSP00000435712:D232Y	ENSP00000259090:D230Y	D	+	1	0	GATA4	11643911	1.000000	0.71417	0.668000	0.29813	0.855000	0.48748	9.515000	0.98015	2.793000	0.96121	0.655000	0.94253	GAT		0.577	GATA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000207587.2	NM_002052		12	143	1	0	0.00010058	0.001368	0.000113506	12	143				
NUGGC	389643	broad.mit.edu	37	8	27922222	27922222	+	Silent	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr8:27922222G>A	ENST00000413272.2	-	7	880	c.738C>T	c.(736-738)gaC>gaT	p.D246D	NUGGC_ENST00000341513.6_Silent_p.D246D	NM_001010906.1	NP_001010906.1	Q68CJ6	SLIP_HUMAN	nuclear GTPase, germinal center associated	246					cellular response to DNA damage stimulus (GO:0006974)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.D246D(2)									GGATGTAGGGGTCCAGCTTGA	0.562																																							uc003xgm.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)|central_nervous_system(1)	2						c.(736-738)GAC>GAT		speckled-like pattern in the germinal center							65.0	68.0	67.0					8																	27922222		2178	4268	6446	SO:0001819	synonymous_variant	389643					nucleus	GTP binding|GTPase activity	g.chr8:27922222G>A	AB075870	CCDS47833.1	8p21.1	2012-06-07	2012-06-07	2012-06-07	ENSG00000189233	ENSG00000189233			33550	protein-coding gene	gene with protein product	"""speckled-like pattern in the germinal center"""		"""chromosome 8 open reading frame 80"""	C8orf80		19734146	Standard	NM_001010906		Approved	HMFN0672, SLIP-GC	uc003xgm.4	Q68CJ6	OTTHUMG00000155970	ENST00000413272.2:c.738C>T	8.37:g.27922222G>A							p.D246D	NM_001010906	NP_001010906	Q68CJ6	SLIP_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|KIRC - Kidney renal clear cell carcinoma(542;0.126)|Kidney(114;0.15)|Colorectal(74;0.181)	7	881	-		Ovarian(32;0.0218)	246					Q6ZP73	Silent	SNP	ENST00000413272.2	37	c.738C>T	CCDS47833.1																																																																																				0.562	NUGGC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000342494.1	NM_001010906		27	30	0	0	0	0.005443	0	27	30				
PPP2CB	5516	broad.mit.edu	37	8	30669865	30669865	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr8:30669865C>G	ENST00000221138.4	-	1	523	c.73G>C	c.(73-75)Gag>Cag	p.E25Q	PPP2CB_ENST00000518564.1_Missense_Mutation_p.E25Q|PPP2CB_ENST00000520500.1_Intron	NM_001009552.1	NP_001009552.1	P62714	PP2AB_HUMAN	protein phosphatase 2, catalytic subunit, beta isozyme	25					apoptotic mitochondrial changes (GO:0008637)|fibroblast growth factor receptor signaling pathway (GO:0008543)|negative regulation of Ras protein signal transduction (GO:0046580)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|regulation of gene expression (GO:0010468)|response to antibiotic (GO:0046677)|response to endoplasmic reticulum stress (GO:0034976)|response to hydrogen peroxide (GO:0042542)	chromosome, centromeric region (GO:0000775)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)	p.E25Q(1)		breast(1)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	9				KIRC - Kidney renal clear cell carcinoma(542;0.095)|Kidney(114;0.114)	Vitamin E(DB00163)	ACTTGGTTCTCGTTCAGCTGC	0.697																																							uc003xik.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(73-75)GAG>CAG		protein phosphatase 2, catalytic subunit, beta	Vitamin E(DB00163)						70.0	54.0	60.0					8																	30669865		2203	4300	6503	SO:0001583	missense	5516				protein dephosphorylation	chromosome, centromeric region|cytoplasm|nucleus|protein phosphatase type 2A complex|spindle pole	metal ion binding	g.chr8:30669865C>G		CCDS6079.1	8p12	2011-05-24	2010-03-05		ENSG00000104695	ENSG00000104695	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9300	protein-coding gene	gene with protein product	"""protein phosphatase 2A catalytic subunit, beta isoform"""	176916	"""protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform"""			8383590	Standard	NM_001009552		Approved	PP2Abeta	uc003xik.3	P62714	OTTHUMG00000163949	ENST00000221138.4:c.73G>C	8.37:g.30669865C>G	ENSP00000221138:p.Glu25Gln						p.E25Q	NM_004156	NP_004147	P62714	PP2AB_HUMAN		KIRC - Kidney renal clear cell carcinoma(542;0.095)|Kidney(114;0.114)	2	308	-			25					D3DSV4|P11082|Q6FHK5	Missense_Mutation	SNP	ENST00000221138.4	37	c.73G>C	CCDS6079.1	.	.	.	.	.	.	.	.	.	.	C	28.7	4.942221	0.92526	.	.	ENSG00000104695	ENST00000221138;ENST00000518564;ENST00000406655	T;T	0.48201	0.82;3.28	3.28	3.28	0.37604	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (1);	0.000000	0.64402	D	0.000002	T	0.74906	0.3778	H	0.97940	4.11	0.80722	D	1	D	0.69078	0.997	P	0.55824	0.785	D	0.86244	0.1645	10	0.87932	D	0	-3.0134	14.6545	0.68823	0.0:1.0:0.0:0.0	.	25	P62714	PP2AB_HUMAN	Q	25	ENSP00000221138:E25Q;ENSP00000428142:E25Q	ENSP00000221138:E25Q	E	-	1	0	PPP2CB	30789407	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	4.673000	0.61604	1.801000	0.52704	0.313000	0.20887	GAG		0.697	PPP2CB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376527.2	NM_001009552		3	16	0	0	0	0.009096	0	3	16				
TEX15	56154	broad.mit.edu	37	8	30706087	30706087	+	Nonsense_Mutation	SNP	A	A	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr8:30706087A>T	ENST00000256246.2	-	1	521	c.447T>A	c.(445-447)tgT>tgA	p.C149*	TEX15_ENST00000523186.1_5'Flank	NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	149					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)			p.C149*(1)		NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		CTTGGTCCTTACATTGCCCTG	0.433																																							uc003xil.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7						c.(445-447)TGT>TGA		testis expressed 15							102.0	98.0	100.0					8																	30706087		2203	4300	6503	SO:0001587	stop_gained	56154							g.chr8:30706087A>T	AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.447T>A	8.37:g.30706087A>T	ENSP00000256246:p.Cys149*						p.C149*	NM_031271	NP_112561	Q9BXT5	TEX15_HUMAN		KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)	1	447	-			149						Nonsense_Mutation	SNP	ENST00000256246.2	37	c.447T>A	CCDS6080.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.150620	0.78001	.	.	ENSG00000133863	ENST00000256246	.	.	.	5.4	2.85	0.33270	.	0.662303	0.14218	N	0.333606	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	7.0046	0.24830	0.6958:0.1655:0.0:0.1387	.	.	.	.	X	149	.	ENSP00000256246:C149X	C	-	3	2	TEX15	30825629	0.002000	0.14202	0.001000	0.08648	0.362000	0.29581	1.463000	0.35277	0.982000	0.38575	0.533000	0.62120	TGT		0.433	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376193.1			35	63	0	0	0	0.002836	0	35	63				
DUSP26	78986	broad.mit.edu	37	8	33451145	33451145	+	Silent	SNP	C	C	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr8:33451145C>G	ENST00000256261.4	-	3	859	c.342G>C	c.(340-342)ctG>ctC	p.L114L	DUSP26_ENST00000523956.1_Silent_p.L114L	NM_024025.1	NP_076930.1	Q9BV47	DUS26_HUMAN	dual specificity phosphatase 26 (putative)	114	Tyrosine-protein phosphatase.				negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of cell adhesion (GO:0045785)|positive regulation of peptidyl-serine dephosphorylation (GO:1902310)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	p53 binding (GO:0002039)|phosphoprotein phosphatase activity (GO:0004721)|phosphoserine phosphatase activity (GO:0004647)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|RNA polymerase II activating transcription factor binding (GO:0001102)	p.L114L(1)		NS(1)|breast(1)|kidney(1)|large_intestine(4)|lung(7)|skin(1)	15				KIRC - Kidney renal clear cell carcinoma(67;0.0918)|Kidney(114;0.111)		CCTCAACACCCAGGTAGCGGA	0.662																																							uc003xjp.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(340-342)CTG>CTC		dual specificity phosphatase 26							60.0	52.0	55.0					8																	33451145		2203	4300	6503	SO:0001819	synonymous_variant	78986					Golgi apparatus|nucleus	protein binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr8:33451145C>G	AY902194	CCDS6092.1	8p12	2014-09-09			ENSG00000133878	ENSG00000133878		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	28161	protein-coding gene	gene with protein product							Standard	NM_024025		Approved	MGC1136, DUSP24	uc003xjp.3	Q9BV47	OTTHUMG00000163961	ENST00000256261.4:c.342G>C	8.37:g.33451145C>G						DUSP26_uc003xjq.2_Silent_p.L114L	p.L114L	NM_024025	NP_076930	Q9BV47	DUS26_HUMAN		KIRC - Kidney renal clear cell carcinoma(67;0.0918)|Kidney(114;0.111)	3	675	-			114			Tyrosine-protein phosphatase.		D3DSV8|Q9BTW0	Silent	SNP	ENST00000256261.4	37	c.342G>C	CCDS6092.1																																																																																				0.662	DUSP26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376564.1	NM_024025		21	39	0	0	0	0.008871	0	21	39				
UNC5D	137970	broad.mit.edu	37	8	35631950	35631950	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr8:35631950A>G	ENST00000404895.2	+	16	2940	c.2612A>G	c.(2611-2613)aAa>aGa	p.K871R	UNC5D_ENST00000420357.1_Missense_Mutation_p.K804R|UNC5D_ENST00000449677.1_Missense_Mutation_p.K447R|UNC5D_ENST00000453357.2_Missense_Mutation_p.K866R|UNC5D_ENST00000416672.1_Missense_Mutation_p.K876R|UNC5D_ENST00000287272.2_Missense_Mutation_p.K802R	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	871	Death.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)		p.K866R(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		CCCAATGCCAAAGGCAAGGAC	0.468																																							uc003xjr.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6						c.(2611-2613)AAA>AGA		unc-5 homolog D precursor							118.0	110.0	112.0					8																	35631950		2203	4300	6503	SO:0001583	missense	137970				apoptosis|axon guidance	integral to membrane	receptor activity	g.chr8:35631950A>G	AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.2612A>G	8.37:g.35631950A>G	ENSP00000385143:p.Lys871Arg					UNC5D_uc003xjs.1_Missense_Mutation_p.K866R|UNC5D_uc003xju.1_Missense_Mutation_p.K447R	p.K871R	NM_080872	NP_543148	Q6UXZ4	UNC5D_HUMAN		READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)	16	2940	+			871			Death.|Cytoplasmic (Potential).		Q8WYP7	Missense_Mutation	SNP	ENST00000404895.2	37	c.2612A>G	CCDS6093.2	.	.	.	.	.	.	.	.	.	.	A	12.35	1.910665	0.33721	.	.	ENSG00000156687	ENST00000404895;ENST00000420357;ENST00000287272;ENST00000416672;ENST00000453357;ENST00000449677	D;D;D;D;D;D	0.85171	-1.95;-1.95;-1.95;-1.95;-1.95;-1.95	5.95	5.95	0.96441	Death (2);DEATH-like (2);	0.000000	0.85682	D	0.000000	T	0.80199	0.4579	N	0.21545	0.675	0.49915	D	0.999834	D;P;P	0.52996	0.957;0.731;0.773	P;B;P	0.50896	0.653;0.43;0.566	T	0.77284	-0.2645	10	0.02654	T	1	-26.391	16.4323	0.83853	1.0:0.0:0.0:0.0	.	447;866;871	E9PDS8;Q6UXZ4-2;Q6UXZ4	.;.;UNC5D_HUMAN	R	871;804;802;876;866;447	ENSP00000385143:K871R;ENSP00000392739:K804R;ENSP00000287272:K802R;ENSP00000412652:K876R;ENSP00000394303:K866R;ENSP00000397211:K447R	ENSP00000287272:K802R	K	+	2	0	UNC5D	35751492	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.572000	0.82409	2.281000	0.76405	0.528000	0.53228	AAA		0.468	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347586.2			9	63	0	0	0	0.004482	0	9	63				
PRDM14	63978	broad.mit.edu	37	8	70971045	70971045	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr8:70971045C>A	ENST00000276594.2	-	6	1417	c.1216G>T	c.(1216-1218)Ggg>Tgg	p.G406W		NM_024504.3	NP_078780.1	Q9GZV8	PRD14_HUMAN	PR domain containing 14	406					cell fate specification (GO:0001708)|cell morphogenesis (GO:0000902)|fertilization (GO:0009566)|germ cell development (GO:0007281)|germ-line stem cell maintenance (GO:0030718)|histone H3-R26 methylation (GO:0034972)|homeostasis of number of cells within a tissue (GO:0048873)|inner cell mass cell fate commitment (GO:0001827)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|regulation of DNA methylation (GO:0044030)|regulation of gene expression, epigenetic (GO:0040029)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)	p.G406W(1)		NS(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Breast(64;0.193)		Epithelial(68;0.00508)|all cancers(69;0.0259)|OV - Ovarian serous cystadenocarcinoma(28;0.0405)			AATACCTTCCCACATCTTTCA	0.438																																					NSCLC(129;99 1813 5906 40656 46114)	NSCLC(129;99 1813 5906 40656 46114)	uc003xym.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(1216-1218)GGG>TGG		PR domain containing 14							104.0	93.0	97.0					8																	70971045		2203	4300	6503	SO:0001583	missense	63978				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr8:70971045C>A	AF319458	CCDS6206.1	8q13.3	2013-01-08			ENSG00000147596	ENSG00000147596		"""Zinc fingers, C2H2-type"""	14001	protein-coding gene	gene with protein product		611781					Standard	NM_024504		Approved		uc003xym.3	Q9GZV8	OTTHUMG00000150495	ENST00000276594.2:c.1216G>T	8.37:g.70971045C>A	ENSP00000276594:p.Gly406Trp						p.G406W	NM_024504	NP_078780	Q9GZV8	PRD14_HUMAN	Epithelial(68;0.00508)|all cancers(69;0.0259)|OV - Ovarian serous cystadenocarcinoma(28;0.0405)		6	1418	-	Breast(64;0.193)		406			C2H2-type 1; atypical.		Q86UX9	Missense_Mutation	SNP	ENST00000276594.2	37	c.1216G>T	CCDS6206.1	.	.	.	.	.	.	.	.	.	.	C	19.59	3.856313	0.71834	.	.	ENSG00000147596	ENST00000276594	T	0.54479	0.57	5.73	5.73	0.89815	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.85682	D	0.000000	T	0.75384	0.3842	M	0.79475	2.455	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.77302	-0.2638	10	0.87932	D	0	-19.7638	19.9036	0.96999	0.0:1.0:0.0:0.0	.	406	Q9GZV8	PRD14_HUMAN	W	406	ENSP00000276594:G406W	ENSP00000276594:G406W	G	-	1	0	PRDM14	71133599	1.000000	0.71417	0.999000	0.59377	0.333000	0.28666	7.343000	0.79319	2.706000	0.92434	0.655000	0.94253	GGG		0.438	PRDM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318505.1			13	71	1	0	0.00244969	0.00245	0.00262234	13	71				
ZFHX4	79776	broad.mit.edu	37	8	77765759	77765759	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr8:77765759C>T	ENST00000521891.2	+	10	7050	c.6602C>T	c.(6601-6603)aCg>aTg	p.T2201M	ZFHX4_ENST00000050961.6_Missense_Mutation_p.T2156M|ZFHX4_ENST00000518282.1_Missense_Mutation_p.T2175M|ZFHX4_ENST00000455469.2_Missense_Mutation_p.T2156M	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2156					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.T2185M(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CCTCCTATAACGGTTTTAGAA	0.358										HNSCC(33;0.089)																													uc003yav.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(6466-6468)ACG>ATG		zinc finger homeodomain 4							133.0	128.0	129.0					8																	77765759		1859	4099	5958	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77765759C>T		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.6602C>T	8.37:g.77765759C>T	ENSP00000430497:p.Thr2201Met	HNSCC(33;0.089)				ZFHX4_uc003yau.1_Missense_Mutation_p.T2201M|ZFHX4_uc003yaw.1_Missense_Mutation_p.T2156M	p.T2156M	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		10	6854	+			2156					G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.6467C>T	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	C	15.29	2.788786	0.49997	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.56941	0.43;0.5;0.46;0.45	4.05	4.05	0.47172	Homeodomain-like (1);	0.000000	0.45867	U	0.000338	T	0.68229	0.2978	L	0.54323	1.7	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.996;0.998;0.998	T	0.72656	-0.4227	10	0.72032	D	0.01	.	16.7528	0.85490	0.0:1.0:0.0:0.0	.	2156;2156;2201	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	M	2201;2185;2156;2156;2175	ENSP00000430497:T2201M;ENSP00000399605:T2156M;ENSP00000050961:T2156M;ENSP00000430848:T2175M	ENSP00000050961:T2156M	T	+	2	0	ZFHX4	77928314	1.000000	0.71417	0.699000	0.30290	0.822000	0.46500	7.548000	0.82154	2.270000	0.75569	0.555000	0.69702	ACG		0.358	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		10	229	0	0	0	0.001368	0	10	229				
ZFHX4	79776	broad.mit.edu	37	8	77776250	77776250	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr8:77776250G>T	ENST00000521891.2	+	11	10748	c.10300G>T	c.(10300-10302)Gac>Tac	p.D3434Y	ZFHX4_ENST00000050961.6_Missense_Mutation_p.D3385Y|ZFHX4_ENST00000518282.1_Missense_Mutation_p.D3408Y|ZFHX4_ENST00000455469.2_Missense_Mutation_p.D3389Y	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	3385					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.D3418Y(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GCCTTTGATTGACCCACAAGA	0.448										HNSCC(33;0.089)																													uc003yav.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(10165-10167)GAC>TAC		zinc finger homeodomain 4							70.0	65.0	66.0					8																	77776250		1963	4165	6128	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77776250G>T		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.10300G>T	8.37:g.77776250G>T	ENSP00000430497:p.Asp3434Tyr	HNSCC(33;0.089)					p.D3389Y	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		11	10552	+			3385					G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.10165G>T	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	G	11.61	1.689059	0.29962	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	4.65	4.65	0.58169	.	0.000000	0.47093	U	0.000256	T	0.60741	0.2292	L	0.60455	1.87	0.58432	D	0.999993	D	0.71674	0.998	D	0.66847	0.947	T	0.64719	-0.6341	10	0.72032	D	0.01	.	17.725	0.88362	0.0:0.0:1.0:0.0	.	3389	Q86UP3-4	.	Y	3434;3418;3389;3385;3408	ENSP00000430497:D3434Y;ENSP00000399605:D3389Y;ENSP00000050961:D3385Y;ENSP00000430848:D3408Y	ENSP00000050961:D3385Y	D	+	1	0	ZFHX4	77938805	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.483000	0.73617	2.427000	0.82271	0.655000	0.94253	GAC		0.448	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		10	35	1	0	3.07112e-06	0.000978	3.6801e-06	10	35				
SLC10A5	347051	broad.mit.edu	37	8	82606414	82606415	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr8:82606414_82606415CC>AA	ENST00000518568.1	-	1	1994_1995	c.793_794GG>TT	c.(793-795)GGt>TTt	p.G265F		NM_001010893.2	NP_001010893.1	Q5PT55	NTCP5_HUMAN	solute carrier family 10, member 5	265						integral component of membrane (GO:0016021)	bile acid:sodium symporter activity (GO:0008508)	p.G265F(1)		autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)	15						ATGGAATGTACCTGACAACCCT	0.351																																							uc011lfs.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(793-795)GGT>TTT		solute carrier family 10 (sodium/bile acid																																				SO:0001583	missense	347051					integral to membrane	bile acid:sodium symporter activity	g.chr8:82606414_82606415CC>AA		CCDS34915.1	8q21.13	2013-07-18	2013-07-18		ENSG00000253598	ENSG00000253598		"""Solute carriers"""	22981	protein-coding gene	gene with protein product							Standard	NM_001010893		Approved		uc011lfs.2	Q5PT55	OTTHUMG00000164683	ENST00000518568.1:c.793_794delinsAA	8.37:g.82606414_82606415delinsAA	ENSP00000428612:p.Gly265Phe						p.G265F	NM_001010893	NP_001010893	Q5PT55	NTCP5_HUMAN			1	793_794	-			265			Extracellular (Potential).		B2RN26	Missense_Mutation	DNP	ENST00000518568.1	37	c.793_794GG>TT	CCDS34915.1																																																																																				0.351	SLC10A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379736.1	XM_294493		18	85	0	0	0	0.004672	0	18	85				
REXO1L1P	254958	broad.mit.edu	37	8	86573790	86573790	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr8:86573790C>A	ENST00000379010.2	-	1	1936	c.1937G>T	c.(1936-1938)tGc>tTc	p.C646F		NM_172239.4	NP_758439.4												p.C646F(2)		endometrium(1)|lung(4)	5						CAGCTGCAGGCAGGCGCTTGC	0.682																																							uc011lfw.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1432-1434)TGC>TTC		exonuclease GOR							5.0	5.0	5.0					8																	86573790		1856	3775	5631	SO:0001583	missense	254958					cytoplasm|nucleus	exonuclease activity|nucleic acid binding	g.chr8:86573790C>A																												ENST00000379010.2:c.1937G>T	8.37:g.86573790C>A	ENSP00000368295:p.Cys646Phe						p.C478F	NM_172239	NP_758439	Q8IX06	GOR_HUMAN			1	1479	-			646						Missense_Mutation	SNP	ENST00000379010.2	37	c.1433G>T		.	.	.	.	.	.	.	.	.	.	C	10.61	1.397716	0.25205	.	.	ENSG00000205176	ENST00000379010	T	0.22743	1.94	0.793	0.793	0.18632	Exonuclease (1);Exonuclease, RNase T/DNA polymerase III (1);Ribonuclease H-like (1);	0.000000	0.85682	U	0.000000	T	0.50837	0.1639	H	0.96518	3.835	0.09310	N	1	D	0.69078	0.997	D	0.77557	0.99	T	0.41752	-0.9491	10	0.87932	D	0	.	4.7632	0.13118	0.0:1.0:0.0:0.0	.	646	Q8IX06	GOR_HUMAN	F	646	ENSP00000368295:C646F	ENSP00000368295:C646F	C	-	2	0	REXO1L1	86761042	0.902000	0.30710	0.061000	0.19648	0.062000	0.15995	0.816000	0.27267	0.191000	0.20236	0.194000	0.17425	TGC		0.682	REXO1L1-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000381106.1			7	134	1	0	8.12818e-05	0.001984	9.24704e-05	7	134				
SPAG1	6674	broad.mit.edu	37	8	101196189	101196189	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr8:101196189A>T	ENST00000388798.2	+	6	685	c.494A>T	c.(493-495)gAc>gTc	p.D165V	SPAG1_ENST00000520643.1_Missense_Mutation_p.D165V|SPAG1_ENST00000251809.3_Missense_Mutation_p.D165V|Y_RNA_ENST00000362797.1_RNA|SPAG1_ENST00000520508.1_Missense_Mutation_p.D165V	NM_003114.4	NP_003105.2	Q07617	SPAG1_HUMAN	sperm associated antigen 1	165					axonemal dynein complex assembly (GO:0070286)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	GTP binding (GO:0005525)|hydrolase activity (GO:0016787)	p.D165V(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	30	all_cancers(14;2.35e-05)|all_epithelial(15;5.2e-08)|Lung NSC(17;0.000283)|all_lung(17;0.000823)	Breast(495;0.195)	Epithelial(11;1.12e-09)|all cancers(13;1.26e-07)|OV - Ovarian serous cystadenocarcinoma(57;4.37e-05)|STAD - Stomach adenocarcinoma(118;0.0525)	KIRC - Kidney renal clear cell carcinoma(542;0.00178)|READ - Rectum adenocarcinoma(644;0.236)		TTAAGATTTGACGTGGAGAAG	0.279																																							uc003yjh.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(493-495)GAC>GTC		sperm associated antigen 1							52.0	53.0	53.0					8																	101196189		2199	4290	6489	SO:0001583	missense	6674				single fertilization	cytoplasm	GTP binding|hydrolase activity	g.chr8:101196189A>T	AF311312	CCDS34930.1	8q22	2014-01-21			ENSG00000104450	ENSG00000104450		"""Tetratricopeptide (TTC) repeat domain containing"""	11212	protein-coding gene	gene with protein product		603395				16368546	Standard	NM_172218		Approved	SP75, FLJ32920, HSD-3.8, TPIS, CT140	uc003yjh.2	Q07617	OTTHUMG00000164706	ENST00000388798.2:c.494A>T	8.37:g.101196189A>T	ENSP00000373450:p.Asp165Val					SPAG1_uc003yjg.1_Missense_Mutation_p.D165V|SPAG1_uc003yji.1_Missense_Mutation_p.D165V	p.D165V	NM_172218	NP_757367	Q07617	SPAG1_HUMAN	Epithelial(11;1.12e-09)|all cancers(13;1.26e-07)|OV - Ovarian serous cystadenocarcinoma(57;4.37e-05)|STAD - Stomach adenocarcinoma(118;0.0525)	KIRC - Kidney renal clear cell carcinoma(542;0.00178)|READ - Rectum adenocarcinoma(644;0.236)	6	580	+	all_cancers(14;2.35e-05)|all_epithelial(15;5.2e-08)|Lung NSC(17;0.000283)|all_lung(17;0.000823)	Breast(495;0.195)	165					A6NP70|B3KQ58|G3XAM3|Q7Z5G1	Missense_Mutation	SNP	ENST00000388798.2	37	c.494A>T	CCDS34930.1	.	.	.	.	.	.	.	.	.	.	A	19.68	3.872225	0.72180	.	.	ENSG00000104450	ENST00000520643;ENST00000251809;ENST00000520508;ENST00000388798	T;T;T;T	0.14640	2.49;2.49;2.49;2.49	5.66	5.66	0.87406	.	2.172620	0.01498	N	0.017365	T	0.50292	0.1607	M	0.86028	2.79	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.00759	-1.1578	10	0.87932	D	0	-33.6562	14.8721	0.70465	1.0:0.0:0.0:0.0	.	165;165	Q07617;G3XAM3	SPAG1_HUMAN;.	V	165	ENSP00000427716:D165V;ENSP00000251809:D165V;ENSP00000428070:D165V;ENSP00000373450:D165V	ENSP00000251809:D165V	D	+	2	0	SPAG1	101265365	1.000000	0.71417	0.997000	0.53966	0.889000	0.51656	7.301000	0.78850	2.153000	0.67306	0.459000	0.35465	GAC		0.279	SPAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379853.2	NM_172218		20	51	0	0	0	0.010504	0	20	51				
SNX31	169166	broad.mit.edu	37	8	101612589	101612589	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr8:101612589G>T	ENST00000311812.2	-	9	912	c.762C>A	c.(760-762)gaC>gaA	p.D254E	SNX31_ENST00000428383.2_Missense_Mutation_p.D155E	NM_152628.3	NP_689841.3	Q8N9S9	SNX31_HUMAN	sorting nexin 31	254					protein transport (GO:0015031)	protein complex (GO:0043234)	phosphatidylinositol binding (GO:0035091)	p.D254E(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|prostate(1)|skin(3)|urinary_tract(1)	26	all_cancers(14;4.01e-05)|all_epithelial(15;1.26e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;1.21e-11)|all cancers(13;2.62e-09)|OV - Ovarian serous cystadenocarcinoma(57;3.22e-06)|STAD - Stomach adenocarcinoma(118;0.206)			TTGTTTGACTGTCTTCTTTCT	0.368																																							uc003yjr.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(760-762)GAC>GAA		sorting nexin 31							214.0	197.0	203.0					8																	101612589		2202	4300	6502	SO:0001583	missense	169166				cell communication|protein transport		phosphatidylinositol binding	g.chr8:101612589G>T		CCDS6288.1	8q22.3	2011-05-03			ENSG00000174226	ENSG00000174226		"""Sorting nexins"""	28605	protein-coding gene	gene with protein product						16782399	Standard	NM_152628		Approved	MGC39715	uc003yjr.3	Q8N9S9	OTTHUMG00000164725	ENST00000311812.2:c.762C>A	8.37:g.101612589G>T	ENSP00000312368:p.Asp254Glu					SNX31_uc011lha.1_Missense_Mutation_p.D49E|SNX31_uc011lhb.1_Missense_Mutation_p.D155E	p.D254E	NM_152628	NP_689841	Q8N9S9	SNX31_HUMAN	Epithelial(11;1.21e-11)|all cancers(13;2.62e-09)|OV - Ovarian serous cystadenocarcinoma(57;3.22e-06)|STAD - Stomach adenocarcinoma(118;0.206)		9	913	-	all_cancers(14;4.01e-05)|all_epithelial(15;1.26e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		254					C9J6L9|Q8N0U9	Missense_Mutation	SNP	ENST00000311812.2	37	c.762C>A	CCDS6288.1	.	.	.	.	.	.	.	.	.	.	G	1.814	-0.473903	0.04414	.	.	ENSG00000174226	ENST00000311812;ENST00000428383	T;T	0.20598	2.4;2.06	4.85	0.415	0.16411	.	0.824102	0.10823	N	0.630209	T	0.08670	0.0215	N	0.17723	0.515	0.25006	N	0.991439	B;B	0.06786	0.001;0.0	B;B	0.09377	0.004;0.001	T	0.38802	-0.9644	10	0.02654	T	1	-2.4578	2.226	0.03984	0.0972:0.2598:0.3407:0.3022	.	155;254	Q8N9S9-2;Q8N9S9	.;SNX31_HUMAN	E	254;155	ENSP00000312368:D254E;ENSP00000405024:D155E	ENSP00000312368:D254E	D	-	3	2	SNX31	101681765	1.000000	0.71417	0.957000	0.39632	0.957000	0.61999	1.439000	0.35013	0.208000	0.20626	0.557000	0.71058	GAC		0.368	SNX31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379910.1	NM_152628		6	132	1	0	3.59834e-05	0.001168	4.16104e-05	6	132				
PKHD1L1	93035	broad.mit.edu	37	8	110431379	110431379	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr8:110431379G>T	ENST00000378402.5	+	22	2518	c.2414G>T	c.(2413-2415)gGg>gTg	p.G805V		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	805					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.G807V(1)		NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			AAATACACTGGGACAAATGTT	0.378										HNSCC(38;0.096)																													uc003yne.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14						c.(2413-2415)GGG>GTG		fibrocystin L precursor							123.0	116.0	118.0					8																	110431379		1887	4104	5991	SO:0001583	missense	93035				immune response	cytosol|extracellular space|integral to membrane	receptor activity	g.chr8:110431379G>T	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.2414G>T	8.37:g.110431379G>T	ENSP00000367655:p.Gly805Val	HNSCC(38;0.096)					p.G805V	NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)		22	2518	+			805			Extracellular (Potential).		Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	37	c.2414G>T	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	G	11.32	1.603052	0.28534	.	.	ENSG00000205038	ENST00000378402	D	0.87412	-2.25	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	D	0.86243	0.5886	M	0.71581	2.175	0.53688	D	0.999977	P	0.44946	0.846	B	0.38842	0.283	D	0.87327	0.2322	10	0.52906	T	0.07	.	15.8207	0.78638	0.0:0.0:1.0:0.0	.	805	Q86WI1	PKHL1_HUMAN	V	805	ENSP00000367655:G805V	ENSP00000367655:G805V	G	+	2	0	PKHD1L1	110500555	0.999000	0.42202	0.804000	0.32291	0.085000	0.17905	4.858000	0.62947	2.809000	0.96659	0.655000	0.94253	GGG		0.378	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531		10	60	1	0	1.61879e-10	0.001368	2.23528e-10	10	60				
CSMD3	114788	broad.mit.edu	37	8	113668560	113668560	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr8:113668560C>A	ENST00000297405.5	-	18	3071	c.2827G>T	c.(2827-2829)Gaa>Taa	p.E943*	CSMD3_ENST00000455883.2_Nonsense_Mutation_p.E839*|CSMD3_ENST00000343508.3_Nonsense_Mutation_p.E903*|CSMD3_ENST00000352409.3_Nonsense_Mutation_p.E943*	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	943	CUB 5. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.E903*(1)|p.E943*(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TAATTCAGTTCAGTCTGAAAT	0.338										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(2827-2829)GAA>TAA		CUB and Sushi multiple domains 3 isoform 1							55.0	59.0	58.0					8																	113668560		2203	4300	6503	SO:0001587	stop_gained	114788					integral to membrane|plasma membrane		g.chr8:113668560C>A	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.2827G>T	8.37:g.113668560C>A	ENSP00000297405:p.Glu943*	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)				CSMD3_uc003yns.2_Nonsense_Mutation_p.E215*|CSMD3_uc003ynt.2_Nonsense_Mutation_p.E903*|CSMD3_uc011lhx.1_Nonsense_Mutation_p.E839*	p.E943*	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN			18	2986	-			943			Extracellular (Potential).|CUB 5.		Q96PZ3	Nonsense_Mutation	SNP	ENST00000297405.5	37	c.2827G>T	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	C	40	8.188613	0.98696	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	.	.	.	5.13	4.25	0.50352	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	.	13.8825	0.63689	0.0:0.9258:0.0:0.0742	.	.	.	.	X	903;943;283;839;943	.	ENSP00000297405:E943X	E	-	1	0	CSMD3	113737736	1.000000	0.71417	1.000000	0.80357	0.106000	0.19336	7.776000	0.85560	1.295000	0.44724	-0.229000	0.12294	GAA		0.338	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		10	67	1	0	7.48243e-07	0.006214	9.30337e-07	10	67				
FER1L6	654463	broad.mit.edu	37	8	125076699	125076699	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr8:125076699C>A	ENST00000522917.1	+	26	3646	c.3440C>A	c.(3439-3441)cCc>cAc	p.P1147H	FER1L6-AS2_ENST00000520031.1_RNA|FER1L6_ENST00000399018.1_Missense_Mutation_p.P1147H	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	1147						integral component of membrane (GO:0016021)		p.P1147H(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			ACAGTGGTGCCCGACTCTGCC	0.607																																							uc003yqw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(5)|central_nervous_system(1)	11						c.(3439-3441)CCC>CAC		fer-1-like 6							79.0	86.0	84.0					8																	125076699		2027	4178	6205	SO:0001583	missense	654463					integral to membrane		g.chr8:125076699C>A	AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.3440C>A	8.37:g.125076699C>A	ENSP00000428280:p.Pro1147His					uc003yqy.1_Intron	p.P1147H	NM_001039112	NP_001034201	Q2WGJ9	FR1L6_HUMAN	STAD - Stomach adenocarcinoma(47;0.00186)		26	3646	+	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		1147			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000522917.1	37	c.3440C>A	CCDS43767.1	.	.	.	.	.	.	.	.	.	.	C	9.749	1.166847	0.21621	.	.	ENSG00000214814	ENST00000522917;ENST00000399018	T;T	0.80994	-1.44;-1.44	5.14	4.26	0.50523	.	2.733070	0.01611	U	0.022554	T	0.76941	0.4058	L	0.33485	1.01	0.09310	N	1	P	0.41748	0.761	B	0.43916	0.436	T	0.63857	-0.6542	10	0.15499	T	0.54	0.1924	9.964	0.41712	0.0:0.9035:0.0:0.0965	.	1147	Q2WGJ9	FR1L6_HUMAN	H	1147	ENSP00000428280:P1147H;ENSP00000381982:P1147H	ENSP00000381982:P1147H	P	+	2	0	FER1L6	125145880	0.007000	0.16637	0.154000	0.22540	0.128000	0.20619	1.583000	0.36579	2.396000	0.81511	0.462000	0.41574	CCC		0.607	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	NM_001039112		46	71	1	0	4.75955e-12	0.00361	6.84109e-12	46	71				
FAM49B	51571	broad.mit.edu	37	8	130891660	130891660	+	Silent	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr8:130891660C>A	ENST00000519824.2	-	3	321	c.48G>T	c.(46-48)ggG>ggT	p.G16G	FAM49B_ENST00000517654.1_Silent_p.G16G|FAM49B_ENST00000401979.2_Silent_p.G16G|FAM49B_ENST00000518879.1_Intron|FAM49B_ENST00000522941.1_Intron|FAM49B_ENST00000519110.1_Silent_p.G16G|FAM49B_ENST00000522250.1_Intron|FAM49B_ENST00000523509.1_Silent_p.G16G|FAM49B_ENST00000519540.1_Silent_p.G16G|FAM49B_ENST00000522746.1_Silent_p.G16G	NM_016623.4	NP_057707.3	Q9NUQ9	FA49B_HUMAN	family with sequence similarity 49, member B	16						cilium (GO:0005929)|extracellular vesicular exosome (GO:0070062)		p.G16G(1)		kidney(1)|large_intestine(6)|lung(4)|prostate(1)	12	Ovarian(5;0.000567)|Esophageal squamous(12;0.00693)|Acute lymphoblastic leukemia(118;0.155)		LUAD - Lung adenocarcinoma(14;0.0989)			AAAAATTTGGCCCCTGCTCAA	0.358																																							uc003yss.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(46-48)GGG>GGT		hypothetical protein LOC51571							77.0	79.0	78.0					8																	130891660		2203	4300	6503	SO:0001819	synonymous_variant	51571							g.chr8:130891660C>A	AF208851	CCDS6361.1	8q24	2004-08-20				ENSG00000153310			25216	protein-coding gene	gene with protein product							Standard	NM_001256763		Approved	BM-009	uc003ysu.4	Q9NUQ9		ENST00000519824.2:c.48G>T	8.37:g.130891660C>A						FAM49B_uc003yst.2_Silent_p.G16G|FAM49B_uc003ysu.2_Silent_p.G16G|FAM49B_uc003ysv.2_Intron|FAM49B_uc003ysw.2_Silent_p.G16G|FAM49B_uc003ysx.2_Silent_p.G16G|FAM49B_uc003ysy.1_Silent_p.G16G	p.G16G	NM_016623	NP_057707	Q9NUQ9	FA49B_HUMAN	LUAD - Lung adenocarcinoma(14;0.0989)		6	597	-	Ovarian(5;0.000567)|Esophageal squamous(12;0.00693)|Acute lymphoblastic leukemia(118;0.155)		16					Q96AZ5|Q9NW21|Q9NZE7	Silent	SNP	ENST00000519824.2	37	c.48G>T	CCDS6361.1																																																																																				0.358	FAM49B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380390.2	NM_016623		9	66	1	0	2.17888e-05	0.006214	2.53002e-05	9	66				
LRRC6	23639	broad.mit.edu	37	8	133650267	133650267	+	Silent	SNP	G	G	A	rs555621946		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr8:133650267G>A	ENST00000519595.1	-	4	441	c.343C>T	c.(343-345)Ctg>Ttg	p.L115L	LRRC6_ENST00000518642.1_Silent_p.L115L|LRRC6_ENST00000520446.1_5'UTR|LRRC6_ENST00000250173.1_Silent_p.L115L			Q86X45	TILB_HUMAN	leucine rich repeat containing 6	115					cilium movement (GO:0003341)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|inner dynein arm assembly (GO:0036159)|male gonad development (GO:0008584)|motile cilium assembly (GO:0044458)|outer dynein arm assembly (GO:0036158)|reproductive system development (GO:0061458)|sperm motility (GO:0030317)	cilium (GO:0005929)|cytoplasm (GO:0005737)		p.L115L(1)		breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|prostate(1)|urinary_tract(2)	34	Ovarian(258;0.00352)|Esophageal squamous(12;0.00507)|all_neural(3;0.0052)|Medulloblastoma(3;0.0922)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			AGCTCCTTCAGATGGATATTG	0.423																																							uc003ytk.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|kidney(1)	2						c.(343-345)CTG>TTG		leucine rich repeat containing 6							110.0	98.0	102.0					8																	133650267		2203	4300	6503	SO:0001819	synonymous_variant	23639					cytoplasm		g.chr8:133650267G>A	U60666	CCDS6365.1	8q24	2013-02-22			ENSG00000129295	ENSG00000129295			16725	protein-coding gene	gene with protein product	"""leucine rich testes protein"""	614930				10775177, 23122586	Standard	NM_012472		Approved	TSLRP, LRTP, CILD19	uc003ytk.4	Q86X45	OTTHUMG00000164646	ENST00000519595.1:c.343C>T	8.37:g.133650267G>A						LRRC6_uc003ytl.2_RNA	p.L115L	NM_012472	NP_036604	Q86X45	LRRC6_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.000311)		4	417	-	Ovarian(258;0.00352)|Esophageal squamous(12;0.00507)|all_neural(3;0.0052)|Medulloblastoma(3;0.0922)|Acute lymphoblastic leukemia(118;0.155)		115					Q13648|Q4G183	Silent	SNP	ENST00000519595.1	37	c.343C>T																																																																																					0.423	LRRC6-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379578.1	NM_012472		27	64	0	0	0	0.004656	0	27	64				
FAM83H	286077	broad.mit.edu	37	8	144811484	144811484	+	Missense_Mutation	SNP	C	C	T	rs202111118		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr8:144811484C>T	ENST00000388913.3	-	3	582	c.457G>A	c.(457-459)Gtg>Atg	p.V153M		NM_198488.3	NP_940890	Q6ZRV2	FA83H_HUMAN	family with sequence similarity 83, member H	153					biomineral tissue development (GO:0031214)			p.V153M(1)		central_nervous_system(2)|endometrium(1)|large_intestine(1)|lung(12)|pancreas(1)|prostate(3)|urinary_tract(1)	21	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			TCCATCACCACGGCCACCACC	0.647													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19270	0.0		0.0	False		,,,				2504	0.0						uc003yzk.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|central_nervous_system(1)|pancreas(1)	3						c.(457-459)GTG>ATG		FAM83H		C	MET/VAL	0,4188		0,0,2094	36.0	41.0	39.0		457	2.9	1.0	8		39	3,8439		0,3,4218	yes	missense	FAM83H	NM_198488.3	21	0,3,6312	TT,TC,CC		0.0355,0.0,0.0238	probably-damaging	153/1180	144811484	3,12627	2094	4221	6315	SO:0001583	missense	286077				biomineral tissue development			g.chr8:144811484C>T	AK127960	CCDS6410.2	8q24.3	2014-03-13			ENSG00000180921	ENSG00000180921			24797	protein-coding gene	gene with protein product		611927				18252228	Standard	NM_198488		Approved	FLJ46072	uc003yzk.3	Q6ZRV2	OTTHUMG00000133559	ENST00000388913.3:c.457G>A	8.37:g.144811484C>T	ENSP00000373565:p.Val153Met					FAM83H_uc010mfk.1_5'Flank	p.V153M	NM_198488	NP_940890	Q6ZRV2	FA83H_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)		3	526	-	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		153					A0JLS2|Q8N4W0	Missense_Mutation	SNP	ENST00000388913.3	37	c.457G>A	CCDS6410.2	.	.	.	.	.	.	.	.	.	.	c	13.01	2.108695	0.37242	0.0	3.55E-4	ENSG00000180921	ENST00000388913	T	0.18960	2.18	5.11	2.86	0.33363	.	0.400623	0.24762	N	0.035807	T	0.34978	0.0916	M	0.78916	2.43	0.32171	N	0.581641	D	0.64830	0.994	P	0.60286	0.872	T	0.48917	-0.8992	10	0.87932	D	0	.	2.159	0.03820	0.2826:0.4695:0.0:0.2479	.	153	Q6ZRV2	FA83H_HUMAN	M	153	ENSP00000373565:V153M	ENSP00000373565:V153M	V	-	1	0	FAM83H	144883472	0.917000	0.31117	0.997000	0.53966	0.057000	0.15508	1.717000	0.37991	1.264000	0.44198	-0.314000	0.08810	GTG		0.647	FAM83H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257632.2	NM_198488		5	61	0	0	0	0.000602	0	5	61				
AQP7	364	broad.mit.edu	37	9	33386153	33386153	+	Silent	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr9:33386153G>A	ENST00000537089.1	-	5	489	c.171C>T	c.(169-171)acC>acT	p.T57T	AQP7_ENST00000539936.1_Silent_p.T149T|AQP7_ENST00000541274.1_Intron|AQP7_ENST00000377425.4_Silent_p.T92T			O14520	AQP7_HUMAN	aquaporin 7	149					excretion (GO:0007588)|generation of precursor metabolites and energy (GO:0006091)|glycerol transport (GO:0015793)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glycerol channel activity (GO:0015254)|water channel activity (GO:0015250)	p.T149T(1)		NS(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(4)|skin(2)|stomach(1)	17			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		CGACGGGACCGGTCACCATCA	0.577																																							uc003zst.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(445-447)ACC>ACT		aquaporin 7							84.0	79.0	80.0					9																	33386153		2203	4300	6503	SO:0001819	synonymous_variant	364				excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity	g.chr9:33386153G>A	AB006190	CCDS6541.1	9p13	2008-02-05			ENSG00000165269	ENSG00000165269		"""Ion channels / Aquaporins"""	640	protein-coding gene	gene with protein product		602974		AQP7L		9252401	Standard	NM_001170		Approved	AQP9, AQPap	uc003zst.3	O14520	OTTHUMG00000019773	ENST00000537089.1:c.171C>T	9.37:g.33386153G>A						SUGT1P1_uc010mjq.1_Intron|AQP7_uc003zsu.1_Silent_p.T92T|AQP7_uc010mjs.2_Silent_p.T57T|AQP7_uc010mjt.2_Silent_p.T57T|AQP7_uc011lnx.1_Silent_p.T149T|AQP7_uc011lny.1_Silent_p.T148T|AQP7_uc003zss.3_Silent_p.T57T|AQP7_uc011lnz.1_Silent_p.T57T|AQP7_uc011loa.1_Intron	p.T149T	NM_001170	NP_001161	O14520	AQP7_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)	6	619	-			149			Extracellular (Potential).		Q08E94|Q5T5L9|Q8NHM3	Silent	SNP	ENST00000537089.1	37	c.447C>T																																																																																					0.577	AQP7-202	KNOWN	basic	protein_coding	protein_coding		NM_001170		12	87	0	0	0	0.00245	0	12	87				
ARID3C	138715	broad.mit.edu	37	9	34627776	34627776	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr9:34627776C>A	ENST00000378909.2	-	1	328	c.236G>T	c.(235-237)gGg>gTg	p.G79V		NM_001017363.1	NP_001017363.1	A6NKF2	ARI3C_HUMAN	AT rich interactive domain 3C (BRIGHT-like)	79					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane raft (GO:0045121)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.G79V(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)	14	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.175)		GCCCTGGGCCCCTGGACGGCT	0.622																																							uc011lon.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(235-237)GGG>GTG		AT rich interactive domain 3C (BRIGHT- like)							47.0	44.0	45.0					9																	34627776		2203	4300	6503	SO:0001583	missense	138715				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr9:34627776C>A		CCDS35006.1	9p13.2	2013-02-07	2006-11-08		ENSG00000205143	ENSG00000205143		"""-"""	21209	protein-coding gene	gene with protein product			"""AT rich interactive domain 3C (BRIGHT- like)"""				Standard	NM_001017363		Approved		uc011lon.2	A6NKF2	OTTHUMG00000000445	ENST00000378909.2:c.236G>T	9.37:g.34627776C>A	ENSP00000368189:p.Gly79Val						p.G79V	NM_001017363	NP_001017363	A6NKF2	ARI3C_HUMAN	STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.175)	1	236	-	all_epithelial(49;0.102)		79						Missense_Mutation	SNP	ENST00000378909.2	37	c.236G>T	CCDS35006.1	.	.	.	.	.	.	.	.	.	.	c	8.305	0.820727	0.16678	.	.	ENSG00000205143	ENST00000378909	T	0.48201	0.82	4.99	2.01	0.26516	.	1.640960	0.03357	N	0.197074	T	0.35393	0.0930	L	0.29908	0.895	0.51233	D	0.999912	B	0.32968	0.392	B	0.30029	0.11	T	0.14392	-1.0474	10	0.23891	T	0.37	-8.392	6.9572	0.24578	0.0:0.6656:0.1561:0.1783	.	79	A6NKF2	ARI3C_HUMAN	V	79	ENSP00000368189:G79V	ENSP00000368189:G79V	G	-	2	0	ARID3C	34617776	0.037000	0.19845	0.463000	0.27130	0.054000	0.15201	0.044000	0.13992	0.700000	0.31782	0.306000	0.20318	GGG		0.622	ARID3C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348265.1	XM_071061		17	29	1	0	1.67942e-08	0.006122	2.21557e-08	17	29				
SPATA31A6	389730	broad.mit.edu	37	9	43627706	43627706	+	Silent	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr9:43627706G>A	ENST00000332857.6	-	4	1009	c.981C>T	c.(979-981)gtC>gtT	p.V327V	SPATA31A6_ENST00000496386.1_5'Flank	NM_001145196.1	NP_001138668.1	Q5VVP1	S31A6_HUMAN	SPATA31 subfamily A, member 6	327					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.V327V(1)									GTATCCCCACGACATTCTGGC	0.458																																							uc011lrb.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(979-981)GTC>GTT		hypothetical protein LOC389730							1.0	1.0	1.0					9																	43627706		22	70	92	SO:0001819	synonymous_variant	389730					integral to membrane		g.chr9:43627706G>A		CCDS75837.1	9p11.2	2012-10-15	2012-10-12	2012-10-12	ENSG00000185775	ENSG00000185775			32006	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A6"""	FAM75A6		20850414	Standard	NM_001145196		Approved	OTTHUMG00000013224	uc011lrb.2	Q5VVP1	OTTHUMG00000013224	ENST00000332857.6:c.981C>T	9.37:g.43627706G>A							p.V327V	NM_001145196	NP_001138668	Q5VVP1	F75A6_HUMAN			4	1010	-			327						Silent	SNP	ENST00000332857.6	37	c.981C>T	CCDS47973.1																																																																																				0.458	SPATA31A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036987.1	NM_001145196		24	342	0	0	0	0.002299	0	24	342				
TRPM6	140803	broad.mit.edu	37	9	77377953	77377953	+	Nonsense_Mutation	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr9:77377953G>A	ENST00000360774.1	-	26	3871	c.3634C>T	c.(3634-3636)Cag>Tag	p.Q1212*	TRPM6_ENST00000449912.2_Nonsense_Mutation_p.Q1207*|TRPM6_ENST00000451710.3_Nonsense_Mutation_p.Q1212*|TRPM6_ENST00000376871.3_Intron|TRPM6_ENST00000376864.4_Nonsense_Mutation_p.Q1212*|TRPM6_ENST00000376872.3_Intron|TRPM6_ENST00000361255.3_Nonsense_Mutation_p.Q1207*	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	1212					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.Q1212*(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						GAGAGATCCTGCAGGTGTCCC	0.468																																							uc004ajl.1		NA																	1	Substitution - Nonsense(1)		lung(1)	lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						c.(3634-3636)CAG>TAG		transient receptor potential cation channel,							79.0	82.0	81.0					9																	77377953		2203	4300	6503	SO:0001587	stop_gained	140803				response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity	g.chr9:77377953G>A	AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.3634C>T	9.37:g.77377953G>A	ENSP00000354006:p.Gln1212*					TRPM6_uc004ajk.1_Nonsense_Mutation_p.Q1207*|TRPM6_uc010mpb.1_RNA|TRPM6_uc010mpc.1_Intron|TRPM6_uc010mpd.1_Intron|TRPM6_uc010mpe.1_Intron|TRPM6_uc004ajj.1_Nonsense_Mutation_p.Q168*	p.Q1212*	NM_017662	NP_060132	Q9BX84	TRPM6_HUMAN			26	3872	-			1212			Cytoplasmic (Potential).		Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Nonsense_Mutation	SNP	ENST00000360774.1	37	c.3634C>T	CCDS6647.1	.	.	.	.	.	.	.	.	.	.	G	42	9.753941	0.99255	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000449912;ENST00000361255;ENST00000376864;ENST00000312449;ENST00000448641	.	.	.	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.3736	0.98901	0.0:0.0:1.0:0.0	.	.	.	.	X	1212;1212;1207;1207;1212;875;875	.	ENSP00000309693:Q875X	Q	-	1	0	TRPM6	76567773	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.444000	0.97578	2.820000	0.97059	0.650000	0.86243	CAG		0.468	TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052693.1	NM_017662		24	114	0	0	0	0.004656	0	24	114				
SPATA31D1	389763	broad.mit.edu	37	9	84605870	84605870	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr9:84605870C>T	ENST00000344803.2	+	4	532	c.485C>T	c.(484-486)tCg>tTg	p.S162L		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	162					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.S162L(2)									TTGGCTTCTTCGGCTTCTGCG	0.562																																							uc004amn.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(484-486)TCG>TTG		hypothetical protein LOC389763							124.0	121.0	122.0					9																	84605870		1994	4163	6157	SO:0001583	missense	389763					integral to membrane		g.chr9:84605870C>T		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.485C>T	9.37:g.84605870C>T	ENSP00000341988:p.Ser162Leu						p.S162L	NM_001001670	NP_001001670	Q6ZQQ2	F75D1_HUMAN			4	532	+			162						Missense_Mutation	SNP	ENST00000344803.2	37	c.485C>T	CCDS47986.1	.	.	.	.	.	.	.	.	.	.	C	11.55	1.673386	0.29693	.	.	ENSG00000214929	ENST00000344803	T	0.04862	3.54	2.76	2.76	0.32466	.	1.670880	0.03478	N	0.214727	T	0.04952	0.0133	N	0.11427	0.14	0.09310	N	1	B	0.26935	0.164	B	0.20384	0.029	T	0.20706	-1.0267	10	0.54805	T	0.06	-5.495	9.2656	0.37639	0.0:1.0:0.0:0.0	.	162	Q6ZQQ2	F75D1_HUMAN	L	162	ENSP00000341988:S162L	ENSP00000341988:S162L	S	+	2	0	FAM75D1	83795690	0.000000	0.05858	0.003000	0.11579	0.000000	0.00434	0.499000	0.22546	1.884000	0.54569	0.597000	0.82753	TCG		0.562	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1	NM_001001670		17	69	0	0	0	0.006122	0	17	69				
SPATA31D1	389763	broad.mit.edu	37	9	84609108	84609108	+	Silent	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr9:84609108C>A	ENST00000344803.2	+	4	3770	c.3723C>A	c.(3721-3723)tcC>tcA	p.S1241S		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	1241					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.S1241S(2)									TGACTAATTCCCAGGGCATCT	0.522																																							uc004amn.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(3721-3723)TCC>TCA		hypothetical protein LOC389763							196.0	189.0	191.0					9																	84609108		1968	4154	6122	SO:0001819	synonymous_variant	389763					integral to membrane		g.chr9:84609108C>A		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.3723C>A	9.37:g.84609108C>A							p.S1241S	NM_001001670	NP_001001670	Q6ZQQ2	F75D1_HUMAN			4	3770	+			1241						Silent	SNP	ENST00000344803.2	37	c.3723C>A	CCDS47986.1																																																																																				0.522	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1	NM_001001670		55	258	1	0	1.78197e-24	0.00361	2.96291e-24	55	258				
CCDC180	100499483	broad.mit.edu	37	9	100056343	100056343	+	Silent	SNP	C	C	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr9:100056343C>T	ENST00000357054.1	+	13	1136	c.201C>T	c.(199-201)gcC>gcT	p.A67A	CCDC180_ENST00000395220.1_Silent_p.A67A|CCDC180_ENST00000375205.2_Silent_p.A107A|RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000375202.2_5'UTR|CCDC180_ENST00000411667.2_5'UTR|RP11-23J9.5_ENST00000375204.2_RNA			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	67						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.A67A(1)									GGCTGATTGCCCGCATCGACA	0.572																																							uc011lut.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|large_intestine(2)|skin(1)	7						c.(199-201)GCC>GCT		hypothetical protein LOC57653							110.0	97.0	101.0					9																	100056343		2203	4300	6503	SO:0001819	synonymous_variant	57653							g.chr9:100056343C>T	AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.201C>T	9.37:g.100056343C>T						KIAA1529_uc011lur.1_RNA|KIAA1529_uc004axe.1_Silent_p.A67A|KIAA1529_uc011lus.1_Intron|KIAA1529_uc010msm.1_RNA	p.A67A	NM_020893	NP_065944					11	974	+		Acute lymphoblastic leukemia(62;0.154)						Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Silent	SNP	ENST00000357054.1	37	c.201C>T																																																																																					0.572	CCDC180-201	KNOWN	basic	protein_coding	protein_coding		NM_020893		6	119	0	0	0	0.001168	0	6	119				
GABBR2	9568	broad.mit.edu	37	9	101148007	101148007	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr9:101148007C>T	ENST00000259455.2	-	11	2036	c.1577G>A	c.(1576-1578)gGa>gAa	p.G526E		NM_005458.7	NP_005449.5	O75899	GABR2_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 2	526					G-protein coupled receptor signaling pathway (GO:0007186)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled GABA receptor activity (GO:0004965)	p.G526E(1)	NOTCH1_ENST00000277541/GABBR2(2)	breast(4)|endometrium(4)|large_intestine(12)|lung(21)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	49		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)	GAGCATCCCTCCAAGGATGAT	0.393																																							uc004ays.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)	4						c.(1576-1578)GGA>GAA		G protein-coupled receptor 51 precursor	Baclofen(DB00181)						164.0	147.0	153.0					9																	101148007		2203	4300	6503	SO:0001583	missense	9568				negative regulation of adenylate cyclase activity|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	G-protein coupled receptor activity|GABA-B receptor activity	g.chr9:101148007C>T	AF069755	CCDS6736.1	9q22.1-q22.3	2012-08-29	2006-02-16	2006-02-16	ENSG00000136928	ENSG00000136928		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4507	protein-coding gene	gene with protein product		607340	"""G protein-coupled receptor 51"""	GPR51		10087195	Standard	NM_005458		Approved	HG20, GABABR2, GPRC3B	uc004ays.3	O75899	OTTHUMG00000020345	ENST00000259455.2:c.1577G>A	9.37:g.101148007C>T	ENSP00000259455:p.Gly526Glu						p.G526E	NM_005458	NP_005449	O75899	GABR2_HUMAN			11	1733	-		Acute lymphoblastic leukemia(62;0.0527)	526			Helical; Name=2; (Potential).		O75974|O75975|Q5VXZ2|Q8WX04|Q9P1R2|Q9UNR1|Q9UNS9	Missense_Mutation	SNP	ENST00000259455.2	37	c.1577G>A	CCDS6736.1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.043237	0.93685	.	.	ENSG00000136928	ENST00000259455	D	0.90197	-2.63	5.74	5.74	0.90152	GPCR, family 3, C-terminal (2);	0.052610	0.85682	N	0.000000	D	0.96950	0.9004	H	0.95850	3.73	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	D	0.97882	1.0292	10	0.87932	D	0	-11.6268	17.4112	0.87486	0.0:1.0:0.0:0.0	.	526	O75899	GABR2_HUMAN	E	526	ENSP00000259455:G526E	ENSP00000259455:G526E	G	-	2	0	GABBR2	100187828	1.000000	0.71417	0.935000	0.37517	0.996000	0.88848	7.818000	0.86416	2.707000	0.92482	0.563000	0.77884	GGA		0.393	GABBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053373.1			6	71	0	0	0	0.001168	0	6	71				
COL15A1	1306	broad.mit.edu	37	9	101797356	101797356	+	Missense_Mutation	SNP	C	C	T	rs142089094	byFrequency	TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr9:101797356C>T	ENST00000375001.3	+	18	2563	c.2140C>T	c.(2140-2142)Cct>Tct	p.P714S		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	714	Collagen-like 2.|Triple-helical region 2 (COL2).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)	p.P714S(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				AGCTGGCCCTCCTGGGGTCAT	0.612													C|||	16	0.00319489	0.0106	0.0029	5008	,	,		17727	0.0		0.0	False		,,,				2504	0.0						uc004azb.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)	6						c.(2140-2142)CCT>TCT		alpha 1 type XV collagen precursor		C	SER/PRO	26,4378		0,26,2176	47.0	48.0	47.0		2140	5.0	0.9	9	dbSNP_134	47	2,8594		0,2,4296	yes	missense	COL15A1	NM_001855.3	74	0,28,6472	TT,TC,CC		0.0233,0.5904,0.2154	probably-damaging	714/1389	101797356	28,12972	2202	4298	6500	SO:0001583	missense	1306				angiogenesis|cell differentiation|signal transduction	collagen type XV|extracellular space|integral to membrane	binding	g.chr9:101797356C>T	L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.2140C>T	9.37:g.101797356C>T	ENSP00000364140:p.Pro714Ser						p.P714S	NM_001855	NP_001846	P39059	COFA1_HUMAN			18	2346	+		Acute lymphoblastic leukemia(62;0.0562)	714			Triple-helical region 2 (COL2).		Q5T6J4|Q9UDC5|Q9Y4W4	Missense_Mutation	SNP	ENST00000375001.3	37	c.2140C>T	CCDS35081.1	6	0.0027472527472527475	4	0.008130081300813009	2	0.0055248618784530384	0	0.0	0	0.0	C	11.45	1.643722	0.29246	0.005904	2.33E-4	ENSG00000204291	ENST00000375001;ENST00000536083	D	0.98649	-5.05	4.96	4.96	0.65561	.	0.462013	0.24740	N	0.035987	D	0.98349	0.9452	M	0.74258	2.255	0.43798	D	0.996349	D	0.89917	1.0	D	0.91635	0.999	D	0.95947	0.8951	10	0.25751	T	0.34	-11.5328	14.4357	0.67279	0.0:1.0:0.0:0.0	.	714	P39059	COFA1_HUMAN	S	714;684	ENSP00000364140:P714S	ENSP00000364140:P714S	P	+	1	0	COL15A1	100837177	0.985000	0.35326	0.903000	0.35520	0.073000	0.16967	2.752000	0.47516	2.676000	0.91093	0.655000	0.94253	CCT		0.612	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053386.3	NM_001855		12	102	0	0	0	0.001855	0	12	102				
TGFBR1	7046	broad.mit.edu	37	9	101907147	101907147	+	Silent	SNP	A	A	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr9:101907147A>G	ENST00000374994.4	+	6	1224	c.1107A>G	c.(1105-1107)ccA>ccG	p.P369P	TGFBR1_ENST00000552516.1_Silent_p.P373P|TGFBR1_ENST00000550253.1_Silent_p.P300P|RNA5SP290_ENST00000517133.1_RNA|TGFBR1_ENST00000374990.2_Silent_p.P292P	NM_004612.2	NP_004603.1	P36897	TGFR1_HUMAN	transforming growth factor, beta receptor 1	369	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|artery morphogenesis (GO:0048844)|blastocyst development (GO:0001824)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen fibril organization (GO:0030199)|embryonic cranial skeleton morphogenesis (GO:0048701)|endothelial cell migration (GO:0043542)|epithelial to mesenchymal transition (GO:0001837)|extracellular structure organization (GO:0043062)|germ cell migration (GO:0008354)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|mesenchymal cell differentiation (GO:0048762)|negative regulation of apoptotic process (GO:0043066)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|parathyroid gland development (GO:0060017)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|pharyngeal system development (GO:0060037)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of protein binding (GO:0043393)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|response to cholesterol (GO:0070723)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|thymus development (GO:0048538)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	endosome (GO:0005768)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|tight junction (GO:0005923)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transforming growth factor beta-activated receptor activity (GO:0005024)|type II transforming growth factor beta receptor binding (GO:0005114)	p.P369P(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	27		Acute lymphoblastic leukemia(62;0.0559)				ATATTGCTCCAAACCACAGAG	0.343																																							uc004azc.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(2)|ovary(1)	3						c.(1105-1107)CCA>CCG		transforming growth factor, beta receptor I							109.0	100.0	103.0					9																	101907147		2203	4300	6503	SO:0001819	synonymous_variant	7046				activation of MAPKK activity|anterior/posterior pattern formation|artery morphogenesis|collagen fibril organization|embryonic cranial skeleton morphogenesis|germ cell migration|heart development|kidney development|neuron fate commitment|palate development|parathyroid gland development|pathway-restricted SMAD protein phosphorylation|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|pharyngeal system development|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of cellular component movement|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of SMAD protein import into nucleus|positive regulation of survival gene product expression|positive regulation of transcription, DNA-dependent|response to cholesterol|thymus development|transforming growth factor beta receptor signaling pathway		ATP binding|I-SMAD binding|metal ion binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type I|type II transforming growth factor beta receptor binding	g.chr9:101907147A>G		CCDS6738.1, CCDS47998.1	9q22	2014-01-30	2008-07-31		ENSG00000106799	ENSG00000106799			11772	protein-coding gene	gene with protein product	"""activin A receptor type II-like kinase, 53kDa"""	190181	"""transforming growth factor, beta receptor I (activin A receptor type II-like kinase, 53kD)"", ""multiple self-healing squamous epithelioma"""	MSSE, ESS1		1319842, 8530052, 21358634	Standard	NM_001130916		Approved	ALK-5, ACVRLK4	uc004azc.3	P36897	OTTHUMG00000020353	ENST00000374994.4:c.1107A>G	9.37:g.101907147A>G						TGFBR1_uc004azd.2_Silent_p.P292P|TGFBR1_uc011lvc.1_Silent_p.P300P	p.P369P	NM_004612	NP_004603	P36897	TGFR1_HUMAN			6	1183	+		Acute lymphoblastic leukemia(62;0.0559)	369			Protein kinase.|Cytoplasmic (Potential).		Q6IR47|Q706C0|Q706C1	Silent	SNP	ENST00000374994.4	37	c.1107A>G	CCDS6738.1																																																																																				0.343	TGFBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053390.3			7	79	0	0	0	0.001984	0	7	79				
ALDOB	229	broad.mit.edu	37	9	104189909	104189909	+	Nonsense_Mutation	SNP	G	G	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr9:104189909G>C	ENST00000374855.4	-	5	519	c.395C>G	c.(394-396)tCa>tGa	p.S132*	ALDOB_ENST00000468981.3_Intron	NM_000035.3	NP_000026.2	P05062	ALDOB_HUMAN	aldolase B, fructose-bisphosphate	132					carbohydrate metabolic process (GO:0005975)|fructose 1,6-bisphosphate metabolic process (GO:0030388)|fructose catabolic process (GO:0006001)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|NADH oxidation (GO:0006116)|positive regulation of ATPase activity (GO:0032781)|small molecule metabolic process (GO:0044281)|vacuolar proton-transporting V-type ATPase complex assembly (GO:0070072)	centriolar satellite (GO:0034451)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)	ATPase binding (GO:0051117)|cytoskeletal protein binding (GO:0008092)|fructose binding (GO:0070061)|fructose-1-phosphate aldolase activity (GO:0061609)|fructose-bisphosphate aldolase activity (GO:0004332)|identical protein binding (GO:0042802)	p.S132*(1)		central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(5)|prostate(2)|skin(4)|urinary_tract(1)	24		Acute lymphoblastic leukemia(62;0.0559)				ACAGCGCTCTGAGAGGCCATC	0.512																																							uc004bbk.2		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(1)	1						c.(394-396)TCA>TGA		aldolase B, fructose-bisphosphate							111.0	92.0	98.0					9																	104189909		2203	4300	6503	SO:0001587	stop_gained	229				fructose 1,6-bisphosphate metabolic process|fructose catabolic process|gluconeogenesis|glycolysis|NADH oxidation|positive regulation of ATPase activity|vacuolar proton-transporting V-type ATPase complex assembly	centriolar satellite|cytosol	ATPase binding|cytoskeletal protein binding|fructose binding|fructose-bisphosphate aldolase activity|identical protein binding	g.chr9:104189909G>C	X01098	CCDS6756.1	9q21.3-q22.2	2008-02-05			ENSG00000136872	ENSG00000136872	4.1.2.13		417	protein-coding gene	gene with protein product		612724					Standard	NM_000035		Approved		uc004bbk.2	P05062	OTTHUMG00000020378	ENST00000374855.4:c.395C>G	9.37:g.104189909G>C	ENSP00000363988:p.Ser132*						p.S132*	NM_000035	NP_000026	P05062	ALDOB_HUMAN			5	477	-		Acute lymphoblastic leukemia(62;0.0559)	132					Q13741|Q13742|Q5T7D6	Nonsense_Mutation	SNP	ENST00000374855.4	37	c.395C>G	CCDS6756.1	.	.	.	.	.	.	.	.	.	.	G	37	6.422868	0.97555	.	.	ENSG00000136872	ENST00000374855;ENST00000374853;ENST00000430164	.	.	.	6.17	6.17	0.99709	.	0.226055	0.47093	D	0.000252	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-13.5991	19.8676	0.96824	0.0:0.0:1.0:0.0	.	.	.	.	X	132;59;132	.	ENSP00000363986:S59X	S	-	2	0	ALDOB	103229730	1.000000	0.71417	0.954000	0.39281	0.999000	0.98932	7.961000	0.87903	2.941000	0.99782	0.655000	0.94253	TCA		0.512	ALDOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053434.2			13	52	0	0	0	0.001855	0	13	52				
ABCA1	19	broad.mit.edu	37	9	107589339	107589339	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr9:107589339C>T	ENST00000374736.3	-	16	2621	c.2227G>A	c.(2227-2229)Gcc>Acc	p.A743T	ABCA1_ENST00000494467.1_5'UTR	NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	743					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)	p.A743T(1)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	GCCAGGTTGGCTCTGGAGAAG	0.562																																							uc004bcl.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(4)|lung(4)|ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	17						c.(2227-2229)GCC>ACC		ATP-binding cassette, sub-family A member 1	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)						143.0	119.0	127.0					9																	107589339		2203	4300	6503	SO:0001583	missense	19				Cdc42 protein signal transduction|cellular lipid metabolic process|cholesterol efflux|cholesterol homeostasis|cholesterol metabolic process|endosome transport|G-protein coupled receptor protein signaling pathway|high-density lipoprotein particle assembly|interleukin-1 beta secretion|intracellular cholesterol transport|lysosome organization|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|phospholipid efflux|phospholipid homeostasis|platelet dense granule organization|positive regulation of cAMP biosynthetic process|reverse cholesterol transport	integral to plasma membrane|membrane fraction|membrane raft|phagocytic vesicle	anion transmembrane transporter activity|apolipoprotein A-I receptor activity|ATP binding|ATPase activity|cholesterol transporter activity|phospholipid transporter activity|small GTPase binding|syntaxin-13 binding	g.chr9:107589339C>T	AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.2227G>A	9.37:g.107589339C>T	ENSP00000363868:p.Ala743Thr						p.A743T	NM_005502	NP_005493	O95477	ABCA1_HUMAN		OV - Ovarian serous cystadenocarcinoma(323;0.023)	16	2540	-			743					Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Missense_Mutation	SNP	ENST00000374736.3	37	c.2227G>A	CCDS6762.1	.	.	.	.	.	.	.	.	.	.	C	28.3	4.904394	0.92035	.	.	ENSG00000165029	ENST00000374736	T	0.75938	-0.98	5.3	4.39	0.52855	.	0.169966	0.51477	N	0.000086	D	0.83788	0.5330	M	0.77712	2.385	0.80722	D	1	B	0.31077	0.307	P	0.49953	0.627	T	0.82959	-0.0198	10	0.44086	T	0.13	.	14.2933	0.66295	0.0:0.9271:0.0:0.0729	.	743	O95477	ABCA1_HUMAN	T	743	ENSP00000363868:A743T	ENSP00000363868:A743T	A	-	1	0	ABCA1	106629160	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.972000	0.63756	1.196000	0.43129	0.655000	0.94253	GCC		0.562	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053491.1	NM_005502		15	65	0	0	0	0.004007	0	15	65				
OR1N2	138882	broad.mit.edu	37	9	125315473	125315473	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr9:125315473T>A	ENST00000373688.2	+	1	83	c.25T>A	c.(25-27)Tca>Aca	p.S9T		NM_001004457.1	NP_001004457.1	Q8NGR9	OR1N2_HUMAN	olfactory receptor, family 1, subfamily N, member 2	9						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S9T(1)		breast(2)|large_intestine(6)|lung(10)|ovary(2)|skin(3)|stomach(3)	26						TCTGCGCAGATCACACGAACT	0.448																																							uc011lyx.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)	4						c.(25-27)TCA>ACA		olfactory receptor, family 1, subfamily N,							91.0	92.0	92.0					9																	125315473		2203	4300	6503	SO:0001583	missense	138882				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:125315473T>A		CCDS35123.1	9q33.2	2013-09-20			ENSG00000171501	ENSG00000171501		"""GPCR / Class A : Olfactory receptors"""	15111	protein-coding gene	gene with protein product							Standard	NM_001004457		Approved		uc011lyx.2	Q8NGR9	OTTHUMG00000020607	ENST00000373688.2:c.25T>A	9.37:g.125315473T>A	ENSP00000362792:p.Ser9Thr						p.S9T	NM_001004457	NP_001004457	Q8NGR9	OR1N2_HUMAN			1	25	+			9			Extracellular (Potential).		A3KFM2|B2RNY4|Q6IF17|Q96RA3	Missense_Mutation	SNP	ENST00000373688.2	37	c.25T>A	CCDS35123.1	.	.	.	.	.	.	.	.	.	.	T	0.283	-0.984990	0.02180	.	.	ENSG00000171501	ENST00000373688	T	0.01474	4.85	3.7	-0.0501	0.13832	.	.	.	.	.	T	0.00906	0.0030	N	0.08118	0	0.20074	N	0.999939	B	0.15719	0.014	B	0.06405	0.002	T	0.49031	-0.8981	9	0.17369	T	0.5	.	2.1725	0.03853	0.2289:0.2697:0.0:0.5014	.	9	Q8NGR9	OR1N2_HUMAN	T	9	ENSP00000362792:S9T	ENSP00000362792:S9T	S	+	1	0	OR1N2	124355294	.	.	0.470000	0.27216	0.361000	0.29550	.	.	0.135000	0.18707	0.519000	0.50382	TCA		0.448	OR1N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053937.2			34	92	0	0	0	0.002445	0	34	92				
FIBCD1	84929	broad.mit.edu	37	9	133799190	133799190	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr9:133799190G>T	ENST00000372338.4	-	4	1032	c.790C>A	c.(790-792)Cac>Aac	p.H264N	FIBCD1_ENST00000253018.4_Missense_Mutation_p.H106N|FIBCD1_ENST00000448616.1_Missense_Mutation_p.H264N|FIBCD1_ENST00000372337.2_Missense_Mutation_p.H106N	NM_032843.4	NP_116232.3	Q8N539	FBCD1_HUMAN	fibrinogen C domain containing 1	264	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.					integral component of membrane (GO:0016021)|membrane (GO:0016020)	chitin binding (GO:0008061)|metal ion binding (GO:0046872)	p.H264N(1)		kidney(1)|large_intestine(3)|lung(2)|prostate(5)|urinary_tract(1)	12	all_hematologic(7;0.0028)			OV - Ovarian serous cystadenocarcinoma(145;3.52e-05)|Epithelial(140;0.00019)		GCCGGGTAGTGGGTGGGAAAG	0.687																																							uc004bzz.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(790-792)CAC>AAC		fibrinogen C domain containing 1							86.0	74.0	78.0					9																	133799190		2203	4299	6502	SO:0001583	missense	84929				signal transduction	extracellular space|integral to membrane	chitin binding|metal ion binding|receptor binding	g.chr9:133799190G>T	AK027716	CCDS6937.1	9q34.2	2013-02-06			ENSG00000130720	ENSG00000130720		"""Fibrinogen C domain containing"""	25922	protein-coding gene	gene with protein product		613357				12975309	Standard	NM_001145106		Approved	FLJ14810	uc004bzz.3	Q8N539	OTTHUMG00000020814	ENST00000372338.4:c.790C>A	9.37:g.133799190G>T	ENSP00000361413:p.His264Asn					FIBCD1_uc011mcc.1_Missense_Mutation_p.H264N	p.H264N	NM_032843	NP_116232	Q8N539	FBCD1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;3.52e-05)|Epithelial(140;0.00019)	4	1035	-	all_hematologic(7;0.0028)		264			Fibrinogen C-terminal.|Extracellular (Potential).		A3KFK0|Q6UXK6|Q96SJ7	Missense_Mutation	SNP	ENST00000372338.4	37	c.790C>A	CCDS6937.1	.	.	.	.	.	.	.	.	.	.	G	13.80	2.343890	0.41498	.	.	ENSG00000130720	ENST00000448616;ENST00000372338;ENST00000372337;ENST00000253018;ENST00000451466	T;T;T;T;T	0.79940	-1.32;-1.32;-1.32;-1.0;-1.32	5.54	5.54	0.83059	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.526191	0.17911	U	0.157854	T	0.65760	0.2722	N	0.12422	0.21	0.58432	D	0.999999	B	0.19331	0.035	B	0.24006	0.05	T	0.61187	-0.7113	10	0.02654	T	1	.	18.0563	0.89365	0.0:0.0:1.0:0.0	.	264	Q8N539	FBCD1_HUMAN	N	264;264;106;106;264	ENSP00000414501:H264N;ENSP00000361413:H264N;ENSP00000361412:H106N;ENSP00000253018:H106N;ENSP00000393894:H264N	ENSP00000253018:H106N	H	-	1	0	FIBCD1	132789011	1.000000	0.71417	0.971000	0.41717	0.150000	0.21749	8.828000	0.92047	2.598000	0.87819	0.462000	0.41574	CAC		0.687	FIBCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054687.2	NM_032843		15	57	1	0	2.31682e-05	0.003163	2.68465e-05	15	57				
LAMC3	10319	broad.mit.edu	37	9	133962991	133962991	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr9:133962991G>C	ENST00000361069.4	+	26	4492	c.4359G>C	c.(4357-4359)gaG>gaC	p.E1453D	LAMC3_ENST00000480883.1_Intron	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	1453	Domain II and I.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)	p.E1453D(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		GCAGACAGGAGCTGGAGGAAG	0.662																																							uc004caa.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(4357-4359)GAG>GAC		laminin, gamma 3 precursor							64.0	70.0	68.0					9																	133962991		2203	4300	6503	SO:0001583	missense	10319				cell adhesion	basement membrane|membrane	structural molecule activity	g.chr9:133962991G>C	AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.4359G>C	9.37:g.133962991G>C	ENSP00000354360:p.Glu1453Asp					LAMC3_uc010mze.1_Missense_Mutation_p.E141D	p.E1453D	NM_006059	NP_006050	Q9Y6N6	LAMC3_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)	26	4457	+	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)	1453			Domain II and I.|Potential.		B1APX9|B1APY0|Q59H72	Missense_Mutation	SNP	ENST00000361069.4	37	c.4359G>C	CCDS6938.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.31|11.31	1.599759|1.599759	0.28534|0.28534	.|.	.|.	ENSG00000050555|ENSG00000050555	ENST00000361069;ENST00000355048|ENST00000355452	T|.	0.28069|.	1.63|.	4.62|4.62	3.72|3.72	0.42706|0.42706	.|.	0.393674|.	0.25711|.	N|.	0.028809|.	T|T	0.52451|0.52451	0.1735|0.1735	M|M	0.68317|0.68317	2.08|2.08	0.26560|0.26560	N|N	0.973746|0.973746	P;B|.	0.49961|.	0.93;0.002|.	P;B|.	0.52646|.	0.705;0.008|.	T|T	0.45498|0.45498	-0.9257|-0.9257	10|5	0.08381|.	T|.	0.77|.	.|.	8.5058|8.5058	0.33186|0.33186	0.1057:0.0:0.8943:0.0|0.1057:0.0:0.8943:0.0	.|.	134;1453|.	Q9UF61;Q9Y6N6|.	.;LAMC3_HUMAN|.	D|T	1453;1465|135	ENSP00000354360:E1453D|.	ENSP00000347156:E1465D|.	E|S	+|+	3|2	2|0	LAMC3|LAMC3	132952812|132952812	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.241000|0.241000	0.25554|0.25554	0.932000|0.932000	0.28884|0.28884	1.163000|1.163000	0.42636|0.42636	0.467000|0.467000	0.42956|0.42956	GAG|AGC		0.662	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054717.3	NM_006059		17	55	0	0	0	0.00499	0	17	55				
C9orf171	389799	broad.mit.edu	37	9	135357700	135357700	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr9:135357700G>T	ENST00000343036.2	+	2	247	c.199G>T	c.(199-201)Gcc>Tcc	p.A67S	C9orf171_ENST00000393216.2_Intron|C9orf171_ENST00000393215.3_Intron	NM_207417.1	NP_997300.1	Q6ZQR2	CI171_HUMAN	chromosome 9 open reading frame 171	67								p.A67S(1)		large_intestine(7)|lung(9)|ovary(4)|prostate(3)	23						TTCGTAGGCTGCCGGCCCGGC	0.512																																							uc004cbn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|large_intestine(1)	5						c.(199-201)GCC>TCC		hypothetical protein LOC389799							90.0	84.0	86.0					9																	135357700		2203	4300	6503	SO:0001583	missense	389799							g.chr9:135357700G>T	AK128819	CCDS6949.1, CCDS65167.1	9q34.13	2012-04-03			ENSG00000188523	ENSG00000188523			33776	protein-coding gene	gene with protein product							Standard	NM_207417		Approved	FLJ46082	uc004cbn.3	Q6ZQR2	OTTHUMG00000131684	ENST00000343036.2:c.199G>T	9.37:g.135357700G>T	ENSP00000343290:p.Ala67Ser					C9orf171_uc004cbo.2_Intron	p.A67S	NM_207417	NP_997300	Q6ZQR2	CI171_HUMAN			2	247	+			67					Q147X1	Missense_Mutation	SNP	ENST00000343036.2	37	c.199G>T	CCDS6949.1	.	.	.	.	.	.	.	.	.	.	G	3.888	-0.024570	0.07589	.	.	ENSG00000188523	ENST00000343036	T	0.18502	2.21	4.69	-5.13	0.02884	.	3.429510	0.01270	N	0.009439	T	0.04363	0.0120	N	0.01352	-0.895	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.34925	-0.9809	10	0.02654	T	1	.	5.2575	0.15555	0.5883:0.0:0.1517:0.26	.	67	Q6ZQR2	CI171_HUMAN	S	67	ENSP00000343290:A67S	ENSP00000343290:A67S	A	+	1	0	C9orf171	134347521	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.634000	0.02020	-1.110000	0.02992	0.655000	0.94253	GCC		0.512	C9orf171-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254589.1	NM_207417		21	68	1	0	1.2644e-06	0.010504	1.54814e-06	21	68				
C9orf171	389799	broad.mit.edu	37	9	135374112	135374112	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr9:135374112T>A	ENST00000343036.2	+	3	382	c.334T>A	c.(334-336)Tac>Aac	p.Y112N	C9orf171_ENST00000393216.2_Missense_Mutation_p.Y76N|C9orf171_ENST00000393215.3_Missense_Mutation_p.Y76N	NM_207417.1	NP_997300.1	Q6ZQR2	CI171_HUMAN	chromosome 9 open reading frame 171	112								p.Y112N(1)		large_intestine(7)|lung(9)|ovary(4)|prostate(3)	23						GGAAAGAAGCTACAGTCTGCC	0.547																																							uc004cbn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|large_intestine(1)	5						c.(334-336)TAC>AAC		hypothetical protein LOC389799							31.0	32.0	32.0					9																	135374112		2203	4300	6503	SO:0001583	missense	389799							g.chr9:135374112T>A	AK128819	CCDS6949.1, CCDS65167.1	9q34.13	2012-04-03			ENSG00000188523	ENSG00000188523			33776	protein-coding gene	gene with protein product							Standard	NM_207417		Approved	FLJ46082	uc004cbn.3	Q6ZQR2	OTTHUMG00000131684	ENST00000343036.2:c.334T>A	9.37:g.135374112T>A	ENSP00000343290:p.Tyr112Asn					C9orf171_uc004cbo.2_Missense_Mutation_p.Y76N	p.Y112N	NM_207417	NP_997300	Q6ZQR2	CI171_HUMAN			3	382	+			112					Q147X1	Missense_Mutation	SNP	ENST00000343036.2	37	c.334T>A	CCDS6949.1	.	.	.	.	.	.	.	.	.	.	T	13.49	2.253374	0.39797	.	.	ENSG00000188523	ENST00000393215;ENST00000343036;ENST00000393216	T;T;T	0.26373	1.74;1.74;1.74	5.14	3.85	0.44370	.	0.488040	0.22633	N	0.057545	T	0.17831	0.0428	L	0.27053	0.805	0.25289	N	0.989374	B;B	0.33919	0.432;0.432	B;B	0.35550	0.039;0.205	T	0.12889	-1.0530	10	0.30078	T	0.28	.	10.6249	0.45502	0.184:0.0:0.0:0.816	.	76;112	Q6ZQR2-2;Q6ZQR2	.;CI171_HUMAN	N	76;112;76	ENSP00000376908:Y76N;ENSP00000343290:Y112N;ENSP00000376909:Y76N	ENSP00000343290:Y112N	Y	+	1	0	C9orf171	134363933	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	2.403000	0.44530	2.058000	0.61347	0.533000	0.62120	TAC		0.547	C9orf171-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254589.1	NM_207417		7	20	0	0	0	0.001984	0	7	20				
SARDH	1757	broad.mit.edu	37	9	136582532	136582532	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr9:136582532C>A	ENST00000371872.4	-	8	1323	c.1066G>T	c.(1066-1068)Gtg>Ttg	p.V356L	SARDH_ENST00000422262.2_Missense_Mutation_p.V188L|SARDH_ENST00000439388.1_Missense_Mutation_p.V356L	NM_007101.3	NP_009032.2	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase	356					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|sarcosine dehydrogenase activity (GO:0008480)	p.V356L(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(13)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	44				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		TGGGTGAACACCTCCCAGTCC	0.597																																							uc004cep.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1066-1068)GTG>TTG		sarcosine dehydrogenase precursor							104.0	90.0	95.0					9																	136582532		2203	4300	6503	SO:0001583	missense	1757				glycine catabolic process	mitochondrial matrix	aminomethyltransferase activity|sarcosine dehydrogenase activity	g.chr9:136582532C>A		CCDS6978.1	9q33-q34	2008-02-05			ENSG00000123453	ENSG00000123453	1.5.99.2		10536	protein-coding gene	gene with protein product		604455		DMGDHL1		10444331	Standard	NM_007101		Approved	SDH	uc004cep.4	Q9UL12	OTTHUMG00000020879	ENST00000371872.4:c.1066G>T	9.37:g.136582532C>A	ENSP00000360938:p.Val356Leu					SARDH_uc004ceo.2_Missense_Mutation_p.V356L|SARDH_uc011mdn.1_Missense_Mutation_p.V356L|SARDH_uc011mdo.1_Missense_Mutation_p.V188L	p.V356L	NM_001134707	NP_001128179	Q9UL12	SARDH_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)	8	1200	-			356					B2RMR5|B4DPI2|B7ZLT6|Q5SYV0|Q9Y280|Q9Y2Y3	Missense_Mutation	SNP	ENST00000371872.4	37	c.1066G>T	CCDS6978.1	.	.	.	.	.	.	.	.	.	.	C	17.01	3.278765	0.59758	.	.	ENSG00000123453	ENST00000371872;ENST00000439388;ENST00000422262;ENST00000427237;ENST00000539227;ENST00000535281	T;T;T	0.29655	1.56;1.56;1.56	3.95	3.03	0.35002	FAD dependent oxidoreductase (1);	0.235739	0.34088	N	0.004279	T	0.31199	0.0789	L	0.60455	1.87	0.80722	D	1	B	0.24675	0.109	B	0.37989	0.262	T	0.04242	-1.0966	10	0.08179	T	0.78	-24.3028	10.8241	0.46622	0.0:0.9065:0.0:0.0935	.	356	Q9UL12	SARDH_HUMAN	L	356;356;188;356;356;356	ENSP00000360938:V356L;ENSP00000403084:V356L;ENSP00000415537:V188L	ENSP00000360938:V356L	V	-	1	0	SARDH	135572353	1.000000	0.71417	0.963000	0.40424	0.847000	0.48162	5.973000	0.70456	1.760000	0.52011	0.462000	0.41574	GTG		0.597	SARDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054931.1			11	57	1	0	6.40141e-05	0.000978	7.32707e-05	11	57				
EHMT1	79813	broad.mit.edu	37	9	140638453	140638453	+	Missense_Mutation	SNP	G	G	T	rs143891279		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr9:140638453G>T	ENST00000460843.1	+	6	1108	c.1081G>T	c.(1081-1083)Ggc>Tgc	p.G361C	EHMT1_ENST00000462484.1_Missense_Mutation_p.G361C|EHMT1_ENST00000371394.2_3'UTR|EHMT1_ENST00000334856.6_Missense_Mutation_p.G330C	NM_024757.4	NP_079033.4	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1	361					chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|embryo development (GO:0009790)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|methyltransferase activity (GO:0008168)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)	p.G361C(1)|p.G330C(1)		breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		GGAGGACGACGGCCATGGTGC	0.642																																							uc011mfc.1		NA																	2	Substitution - Missense(2)		lung(2)	breast(2)|pancreas(1)	3						c.(1081-1083)GGC>TGC		euchromatic histone-lysine N-methyltransferase 1							69.0	65.0	66.0					9																	140638453		2203	4300	6503	SO:0001583	missense	79813				DNA methylation|embryo development|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding	g.chr9:140638453G>T	AY083210	CCDS7050.1, CCDS7050.2, CCDS56595.1	9q34.3	2013-09-20			ENSG00000181090	ENSG00000181090	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	24650	protein-coding gene	gene with protein product		607001	"""euchromatic histone methyltransferase 1"""			11347906, 12004135	Standard	NM_024757		Approved	Eu-HMTase1, FLJ12879, KIAA1876, bA188C12.1, KMT1D	uc011mfc.2	Q9H9B1	OTTHUMG00000020995	ENST00000460843.1:c.1081G>T	9.37:g.140638453G>T	ENSP00000417980:p.Gly361Cys					EHMT1_uc004coa.2_Missense_Mutation_p.G361C|EHMT1_uc004cob.1_Missense_Mutation_p.G330C	p.G361C	NM_024757	NP_079033	Q9H9B1	EHMT1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)	6	1118	+	all_cancers(76;0.164)		361					B1AQ58|B1AQ59|Q86X08|Q8TCN7|Q96F53|Q96JF1|Q96KH4	Missense_Mutation	SNP	ENST00000460843.1	37	c.1081G>T	CCDS7050.2	.	.	.	.	.	.	.	.	.	.	g	8.873	0.949819	0.18431	.	.	ENSG00000181090	ENST00000334856;ENST00000371400;ENST00000462484;ENST00000460843	T;T;T	0.47177	0.85;0.85;0.85	5.42	3.61	0.41365	.	0.504403	0.22643	N	0.057431	T	0.21761	0.0524	N	0.08118	0	0.22601	N	0.998941	B;P;P	0.40107	0.35;0.703;0.703	B;B;B	0.31337	0.034;0.128;0.128	T	0.07908	-1.0748	10	0.51188	T	0.08	.	7.2459	0.26121	0.1415:0.0:0.7224:0.1362	.	361;330;361	Q9H9B1;Q9H9B1-2;Q9H9B1-4	EHMT1_HUMAN;.;.	C	330;330;361;361	ENSP00000334476:G330C;ENSP00000417328:G361C;ENSP00000417980:G361C	ENSP00000334476:G330C	G	+	1	0	EHMT1	139758274	1.000000	0.71417	0.058000	0.19502	0.006000	0.05464	3.872000	0.56085	0.679000	0.31345	-0.993000	0.02533	GGC		0.642	EHMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055371.2	NM_024757		15	57	1	0	0.000308642	0.003163	0.00034145	15	57				
MXRA5	25878	broad.mit.edu	37	X	3235264	3235264	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:3235264G>T	ENST00000217939.6	-	6	6612	c.6458C>A	c.(6457-6459)cCg>cAg	p.P2153Q		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	2153	Ig-like C2-type 6.					extracellular vesicular exosome (GO:0070062)		p.P2153Q(2)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				CGTCCTCCGCGGGGAGGTGCC	0.697																																							uc004crg.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8						c.(6457-6459)CCG>CAG		adlican precursor							28.0	23.0	24.0					X																	3235264		2203	4298	6501	SO:0001583	missense	25878					extracellular region		g.chrX:3235264G>T	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.6458C>A	X.37:g.3235264G>T	ENSP00000217939:p.Pro2153Gln						p.P2153Q	NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN			6	6615	-		all_lung(23;0.00031)|Lung NSC(23;0.000946)	2153			Ig-like C2-type 6.		Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	ENST00000217939.6	37	c.6458C>A	CCDS14124.1	.	.	.	.	.	.	.	.	.	.	G	14.66	2.601591	0.46423	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.81415	-1.49	3.48	3.48	0.39840	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.213199	0.23332	U	0.049340	D	0.85969	0.5821	L	0.49571	1.57	0.49915	D	0.999836	D	0.89917	1.0	D	0.91635	0.999	D	0.85426	0.1146	10	0.40728	T	0.16	.	14.7878	0.69816	0.0:0.0:1.0:0.0	.	2153	Q9NR99	MXRA5_HUMAN	Q	2153	ENSP00000217939:P2153Q	ENSP00000217939:P2153Q	P	-	2	0	MXRA5	3245264	1.000000	0.71417	0.004000	0.12327	0.001000	0.01503	6.490000	0.73645	1.354000	0.45846	0.597000	0.82753	CCG		0.697	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419		3	22	1	0	0.00024832	0.009096	0.000275802	3	22				
AMELX	265	broad.mit.edu	37	X	11316980	11316980	+	Missense_Mutation	SNP	C	C	G	rs372332800		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:11316980C>G	ENST00000380714.3	+	5	525	c.457C>G	c.(457-459)Ccg>Gcg	p.P153A	ARHGAP6_ENST00000380736.1_Intron|ARHGAP6_ENST00000337414.4_Intron|ARHGAP6_ENST00000380732.3_Intron|AMELX_ENST00000380712.3_Missense_Mutation_p.P167A|AMELX_ENST00000348912.4_Missense_Mutation_p.P137A|ARHGAP6_ENST00000413512.3_Intron|ARHGAP6_ENST00000380718.1_Intron	NM_001142.2	NP_001133.1	Q99217	AMELX_HUMAN	amelogenin, X-linked	153					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|chondrocyte differentiation (GO:0002062)|enamel mineralization (GO:0070166)|epithelial to mesenchymal transition (GO:0001837)|ion homeostasis (GO:0050801)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of tooth mineralization (GO:0070172)|signal transduction (GO:0007165)|tooth mineralization (GO:0034505)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	growth factor activity (GO:0008083)|hydroxyapatite binding (GO:0046848)|identical protein binding (GO:0042802)|structural constituent of tooth enamel (GO:0030345)	p.P167A(1)		endometrium(3)|kidney(2)|large_intestine(1)|lung(9)	15						GCAGCCCCTGCCGCCACAGCC	0.657																																							uc004cut.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(457-459)CCG>GCG		amelogenin (X chromosome) isoform 1 precursor							46.0	40.0	42.0					X																	11316980		2203	4300	6503	SO:0001583	missense	265				cell adhesion|cell proliferation|chondrocyte differentiation|enamel mineralization|epithelial to mesenchymal transition|ion homeostasis|odontogenesis of dentine-containing tooth|osteoblast differentiation|positive regulation of collagen biosynthetic process|positive regulation of tooth mineralization|signal transduction	proteinaceous extracellular matrix	cell surface binding|growth factor activity|hydroxyapatite binding|identical protein binding|structural constituent of tooth enamel	g.chrX:11316980C>G		CCDS14144.1, CCDS14145.1, CCDS14146.1	Xp22.31-p22.1	2010-04-20	2010-04-20		ENSG00000125363	ENSG00000125363			461	protein-coding gene	gene with protein product	"""amelogenesis imperfecta 1"""	300391	"""amelogenin (X chromosome, amelogenesis imperfecta 1)"""	AMG, AIH1		1734713	Standard	NM_182680		Approved		uc004cus.3	Q99217	OTTHUMG00000021130	ENST00000380714.3:c.457C>G	X.37:g.11316980C>G	ENSP00000370090:p.Pro153Ala					ARHGAP6_uc004cup.1_Intron|ARHGAP6_uc004cuo.1_Intron|ARHGAP6_uc004cur.1_Intron|ARHGAP6_uc004cun.1_Intron|ARHGAP6_uc011mif.1_Intron|AMELX_uc004cus.2_Missense_Mutation_p.P167A|AMELX_uc004cuu.2_Missense_Mutation_p.P137A	p.P153A	NM_001142	NP_001133	Q99217	AMELX_HUMAN			5	525	+			153					Q96NW6|Q9UCA7	Missense_Mutation	SNP	ENST00000380714.3	37	c.457C>G	CCDS14144.1	.	.	.	.	.	.	.	.	.	.	C	0.860	-0.735617	0.03111	.	.	ENSG00000125363	ENST00000380714;ENST00000380712;ENST00000348912	D;D;D	0.87729	-2.29;-2.29;-2.29	4.79	2.77	0.32553	.	0.231557	0.30575	N	0.009340	T	0.76513	0.3998	L	0.51914	1.62	0.09310	N	0.999999	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.002;0.003;0.002	T	0.55256	-0.8169	10	0.06494	T	0.89	0.2352	3.4082	0.07348	0.1603:0.53:0.2107:0.099	.	137;153;167	Q99217-2;Q99217;Q99217-3	.;AMELX_HUMAN;.	A	153;167;137	ENSP00000370090:P153A;ENSP00000370088:P167A;ENSP00000335312:P137A	ENSP00000335312:P137A	P	+	1	0	AMELX	11226901	0.975000	0.34042	0.997000	0.53966	0.977000	0.68977	1.503000	0.35715	0.864000	0.35578	0.415000	0.27848	CCG		0.657	AMELX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055746.1	NM_001142		8	23	0	0	0	0.00308	0	8	23				
MBTPS2	51360	broad.mit.edu	37	X	21887655	21887655	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:21887655G>A	ENST00000379484.5	+	7	928	c.829G>A	c.(829-831)Gac>Aac	p.D277N	MBTPS2_ENST00000365779.2_Missense_Mutation_p.D277N	NM_015884.3	NP_056968.1	O43462	MBTP2_HUMAN	membrane-bound transcription factor peptidase, site 2	277					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cholesterol metabolic process (GO:0008203)|endoplasmic reticulum unfolded protein response (GO:0030968)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.D277N(1)		breast(2)|endometrium(3)|large_intestine(3)|lung(13)|ovary(1)|skin(2)	24						TTTTGTGGGAGACCTTGTCAC	0.428																																							uc004dae.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(829-831)GAC>AAC		membrane-bound transcription factor peptidase,							136.0	118.0	124.0					X																	21887655		2203	4300	6503	SO:0001583	missense	51360				cholesterol metabolic process|proteolysis	Golgi membrane|integral to membrane	metal ion binding|metalloendopeptidase activity	g.chrX:21887655G>A	AF019612	CCDS14201.1	Xp22.12-p22.11	2014-02-03	2005-08-17		ENSG00000012174	ENSG00000012174			15455	protein-coding gene	gene with protein product		300294	"""membrane-bound transcription factor protease, site 2"", ""keratosis follicularis spinulosa decalvans"""	KFSD		9847074, 9659902, 20672378	Standard	NM_015884		Approved	S2P	uc004dae.3	O43462	OTTHUMG00000021237	ENST00000379484.5:c.829G>A	X.37:g.21887655G>A	ENSP00000368798:p.Asp277Asn					MBTPS2_uc010nfr.2_5'UTR|MBTPS2_uc004dab.2_Missense_Mutation_p.D277N	p.D277N	NM_015884	NP_056968	O43462	MBTP2_HUMAN			7	1026	+			277			Lumenal (Probable).		Q9UM70|Q9UMD3	Missense_Mutation	SNP	ENST00000379484.5	37	c.829G>A	CCDS14201.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.785172	0.90282	.	.	ENSG00000012174	ENST00000379484;ENST00000365779	D;D	0.94758	-3.51;-2.34	4.84	4.84	0.62591	Peptidase M50 (1);	0.000000	0.85682	D	0.000000	D	0.96975	0.9012	M	0.74389	2.26	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.996;0.997	D	0.97324	0.9946	10	0.59425	D	0.04	-19.1696	17.4296	0.87536	0.0:0.0:1.0:0.0	.	277;277	O43462;B9ZVQ3	MBTP2_HUMAN;.	N	277	ENSP00000368798:D277N;ENSP00000368796:D277N	ENSP00000368796:D277N	D	+	1	0	MBTPS2	21797576	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.258000	0.78371	2.386000	0.81285	0.600000	0.82982	GAC		0.428	MBTPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056026.1			8	147	0	0	0	0.004482	0	8	147				
DMD	1756	broad.mit.edu	37	X	32834589	32834589	+	Missense_Mutation	SNP	G	G	T	rs141028860		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:32834589G>T	ENST00000357033.4	-	6	732	c.526C>A	c.(526-528)Cat>Aat	p.H176N	DMD_ENST00000378677.2_Missense_Mutation_p.H172N|DMD_ENST00000288447.4_Missense_Mutation_p.H168N	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	176	Actin-binding.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.H176N(2)|p.H171N(2)|p.H172N(2)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TCTTACCTATGACTATGGATG	0.403																																							uc004dda.1		NA																	6	Substitution - Missense(6)		lung(3)|endometrium(3)	ovary(3)|pancreas(2)|large_intestine(1)	6						c.(526-528)CAT>AAT		dystrophin Dp427m isoform		G	ASN/HIS,ASN/HIS,ASN/HIS,ASN/HIS,ASN/HIS	0,3833		0,0,1631,571	106.0	91.0	96.0		502,526,157,514,157	4.5	1.0	X	dbSNP_134	96	1,6727		0,1,2427,1872	no	missense,missense,missense,missense,missense	DMD	NM_000109.3,NM_004006.2,NM_004007.2,NM_004009.3,NM_004010.3	68,68,68,68,68	0,1,4058,2443	TT,TG,GG,G		0.0149,0.0,0.0095	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	168/3678,176/3686,53/3563,172/3682,53/3563	32834589	1,10560	2202	4300	6502	SO:0001583	missense	1756				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding	g.chrX:32834589G>T	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.526C>A	X.37:g.32834589G>T	ENSP00000354923:p.His176Asn					DMD_uc004dcz.2_Missense_Mutation_p.H53N|DMD_uc004dcy.1_Missense_Mutation_p.H172N|DMD_uc004ddb.1_Missense_Mutation_p.H168N|DMD_uc010ngo.1_Intron|DMD_uc004ddf.2_Missense_Mutation_p.H168N|DMD_uc010ngp.1_Missense_Mutation_p.H53N|DMD_uc010ngq.1_Intron|DMD_uc010ngr.1_Intron	p.H176N	NM_004006	NP_003997	P11532	DMD_HUMAN			6	770	-		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)	176			CH 2.|Actin-binding.		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	37	c.526C>A	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	G	17.44	3.389632	0.61956	0.0	1.49E-4	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280;ENST00000288447	D;D;D	0.95001	-3.58;-3.58;-3.58	5.36	4.49	0.54785	Calponin homology domain (5);	0.000000	0.38663	U	0.001615	D	0.95680	0.8595	M	0.74647	2.275	0.80722	D	1	P;P;P;B;P	0.46142	0.873;0.722;0.494;0.204;0.55	P;P;B;B;P	0.54460	0.723;0.753;0.324;0.311;0.452	D	0.95822	0.8850	10	0.72032	D	0.01	.	12.0387	0.53440	0.1473:0.0:0.8527:0.0	.	176;168;168;176;172	F5H6K1;Q4G0X0;P11532-4;P11532;E9PDN5	.;.;.;DMD_HUMAN;.	N	168;172;176;176;53;168	ENSP00000367948:H172N;ENSP00000354923:H176N;ENSP00000288447:H168N	ENSP00000288447:H168N	H	-	1	0	DMD	32744510	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	3.285000	0.51716	2.219000	0.72066	0.600000	0.82982	CAT		0.403	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006		13	74	1	0	1.61879e-10	0.001368	2.23528e-10	13	74				
FAM47A	158724	broad.mit.edu	37	X	34149137	34149137	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:34149137T>A	ENST00000346193.3	-	1	1310	c.1259A>T	c.(1258-1260)cAg>cTg	p.Q420L		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	420								p.Q420L(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						ATTGGACACCTGACTAGTGTC	0.552																																							uc004ddg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(1)	5						c.(1258-1260)CAG>CTG		hypothetical protein LOC158724							40.0	41.0	40.0					X																	34149137		2184	4289	6473	SO:0001583	missense	158724							g.chrX:34149137T>A	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.1259A>T	X.37:g.34149137T>A	ENSP00000345029:p.Gln420Leu						p.Q420L	NM_203408	NP_981953	Q5JRC9	FA47A_HUMAN			1	1292	-			420					A8K8I9|Q8TAA0	Missense_Mutation	SNP	ENST00000346193.3	37	c.1259A>T	CCDS43926.1	.	.	.	.	.	.	.	.	.	.	t	0.104	-1.147529	0.01714	.	.	ENSG00000185448	ENST00000346193	T	0.17054	2.3	0.226	-0.452	0.12205	.	.	.	.	.	T	0.08403	0.0209	N	0.24115	0.695	0.09310	N	1	B	0.25169	0.119	B	0.21546	0.035	T	0.33929	-0.9849	8	0.27082	T	0.32	.	.	.	.	.	420	Q5JRC9	FA47A_HUMAN	L	420	ENSP00000345029:Q420L	ENSP00000345029:Q420L	Q	-	2	0	FAM47A	34059058	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	-4.742000	0.00191	-3.869000	0.00097	-3.920000	0.00016	CAG		0.552	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408		4	60	0	0	0	0.009096	0	4	60				
FAM47C	442444	broad.mit.edu	37	X	37028233	37028233	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:37028233C>A	ENST00000358047.3	+	1	1802	c.1750C>A	c.(1750-1752)Cca>Aca	p.P584T		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	584								p.P584T(2)		breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						CCATCTCTGCCCAGAGCCTCC	0.642																																							uc004ddl.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)	3						c.(1750-1752)CCA>ACA		hypothetical protein LOC442444							41.0	46.0	44.0					X																	37028233		2202	4299	6501	SO:0001583	missense	442444							g.chrX:37028233C>A	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.1750C>A	X.37:g.37028233C>A	ENSP00000367913:p.Pro584Thr						p.P584T	NM_001013736	NP_001013758	Q5HY64	FA47C_HUMAN			1	1764	+			584					Q6ZU46	Missense_Mutation	SNP	ENST00000358047.3	37	c.1750C>A	CCDS35227.1	.	.	.	.	.	.	.	.	.	.	-	10.69	1.422565	0.25639	.	.	ENSG00000198173	ENST00000358047	T	0.22539	1.95	1.74	-1.11	0.09840	.	.	.	.	.	T	0.19127	0.0459	M	0.76328	2.33	0.09310	N	1	B	0.18968	0.032	B	0.08055	0.003	T	0.31223	-0.9951	9	0.32370	T	0.25	.	3.0917	0.06296	0.2542:0.5441:0.0:0.2017	.	584	Q5HY64	FA47C_HUMAN	T	584	ENSP00000367913:P584T	ENSP00000367913:P584T	P	+	1	0	FAM47C	36938154	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.138000	0.10374	-0.020000	0.14032	0.452000	0.29995	CCA		0.642	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736		12	88	1	0	6.94344e-10	0.006122	9.49444e-10	12	88				
FAM47C	442444	broad.mit.edu	37	X	37028467	37028467	+	Silent	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:37028467C>A	ENST00000358047.3	+	1	2036	c.1984C>A	c.(1984-1986)Cgg>Agg	p.R662R		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	662								p.R662R(2)		breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						TCCCAAGACTCGGGTGTCCAG	0.652																																							uc004ddl.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)	3						c.(1984-1986)CGG>AGG		hypothetical protein LOC442444							29.0	33.0	31.0					X																	37028467		2190	4281	6471	SO:0001819	synonymous_variant	442444							g.chrX:37028467C>A	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.1984C>A	X.37:g.37028467C>A							p.R662R	NM_001013736	NP_001013758	Q5HY64	FA47C_HUMAN			1	1998	+			662					Q6ZU46	Silent	SNP	ENST00000358047.3	37	c.1984C>A	CCDS35227.1																																																																																				0.652	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736		17	70	1	0	8.34094e-07	0.008871	1.02573e-06	17	70				
USP11	8237	broad.mit.edu	37	X	47107228	47107228	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:47107228G>A	ENST00000218348.3	+	21	2791	c.2791G>A	c.(2791-2793)Gac>Aac	p.D931N	USP11_ENST00000377107.2_Missense_Mutation_p.D888N	NM_004651.3	NP_004642.2	P51784	UBP11_HUMAN	ubiquitin specific peptidase 11	931					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)	p.D931N(1)		breast(2)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(14)|ovary(3)|pancreas(1)|stomach(1)	40						CCAACGCCAGGACGTGGCGCG	0.622																																							uc004dhp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)|central_nervous_system(1)	3						c.(2791-2793)GAC>AAC		ubiquitin specific peptidase 11							64.0	50.0	55.0					X																	47107228		2203	4300	6503	SO:0001583	missense	8237				protein deubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chrX:47107228G>A	U44839	CCDS14277.1	Xp11.23	2008-02-05	2005-08-08		ENSG00000102226	ENSG00000102226		"""Ubiquitin-specific peptidases"""	12609	protein-coding gene	gene with protein product		300050	"""ubiquitin specific protease 11"""			12838346	Standard	XM_005272674		Approved	UHX1	uc004dhp.3	P51784	OTTHUMG00000021437	ENST00000218348.3:c.2791G>A	X.37:g.47107228G>A	ENSP00000218348:p.Asp931Asn					USP11_uc004dhq.2_Missense_Mutation_p.D657N	p.D931N	NM_004651	NP_004642	P51784	UBP11_HUMAN			21	2791	+			931					B2RTX1|Q8IUG6|Q9BWE1	Missense_Mutation	SNP	ENST00000218348.3	37	c.2791G>A	CCDS14277.1	.	.	.	.	.	.	.	.	.	.	g	16.87	3.242635	0.58995	.	.	ENSG00000102226	ENST00000377107;ENST00000218348	T;T	0.23950	1.9;1.88	4.89	4.89	0.63831	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (1);	0.000000	0.46758	D	0.000263	T	0.37812	0.1017	L	0.27053	0.805	0.48341	D	0.999632	P;D	0.76494	0.834;0.999	B;D	0.75020	0.406;0.985	T	0.18053	-1.0349	10	0.49607	T	0.09	-22.7968	15.8219	0.78662	0.0:0.0:1.0:0.0	.	657;931	B3KP28;P51784	.;UBP11_HUMAN	N	888;931	ENSP00000366311:D888N;ENSP00000218348:D931N	ENSP00000218348:D931N	D	+	1	0	USP11	46992172	1.000000	0.71417	0.991000	0.47740	0.303000	0.27691	5.448000	0.66612	2.247000	0.74100	0.431000	0.28591	GAC		0.622	USP11-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_004651		7	46	0	0	0	0.00308	0	7	46				
HDAC6	10013	broad.mit.edu	37	X	48682427	48682427	+	Nonsense_Mutation	SNP	T	T	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:48682427T>A	ENST00000334136.5	+	27	3577	c.3399T>A	c.(3397-3399)tgT>tgA	p.C1133*	HDAC6_ENST00000376619.2_Nonsense_Mutation_p.C1133*|HDAC6_ENST00000444343.2_Nonsense_Mutation_p.C1147*			Q9UBN7	HDAC6_HUMAN	histone deacetylase 6	1133					aggresome assembly (GO:0070842)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to misfolded protein (GO:0071218)|cellular response to topologically incorrect protein (GO:0035967)|histone deacetylation (GO:0016575)|Hsp90 deacetylation (GO:0070846)|intracellular protein transport (GO:0006886)|lysosome localization (GO:0032418)|macroautophagy (GO:0016236)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of oxidoreductase activity (GO:0051354)|negative regulation of protein complex disassembly (GO:0043242)|negative regulation of proteolysis (GO:0045861)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine deacetylation (GO:0034983)|polyubiquitinated misfolded protein transport (GO:0070845)|positive regulation of chaperone-mediated protein complex assembly (GO:0090035)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of hydrogen peroxide-mediated programmed cell death (GO:1901300)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of signal transduction (GO:0009967)|protein complex disassembly (GO:0043241)|protein deacetylation (GO:0006476)|protein polyubiquitination (GO:0000209)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of establishment of protein localization (GO:0070201)|regulation of gene expression, epigenetic (GO:0040029)|regulation of microtubule-based movement (GO:0060632)|regulation of receptor activity (GO:0010469)|response to growth factor (GO:0070848)|response to misfolded protein (GO:0051788)|response to organic substance (GO:0010033)|response to toxic substance (GO:0009636)|transcription, DNA-templated (GO:0006351)|tubulin deacetylation (GO:0090042)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	aggresome (GO:0016235)|axon (GO:0030424)|caveola (GO:0005901)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|dendrite (GO:0030425)|histone deacetylase complex (GO:0000118)|inclusion body (GO:0016234)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)	alpha-tubulin binding (GO:0043014)|beta-catenin binding (GO:0008013)|core promoter binding (GO:0001047)|dynein complex binding (GO:0070840)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|Hsp90 protein binding (GO:0051879)|microtubule binding (GO:0008017)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|polyubiquitin binding (GO:0031593)|tau protein binding (GO:0048156)|tubulin deacetylase activity (GO:0042903)|zinc ion binding (GO:0008270)	p.C1133*(1)		breast(2)|endometrium(6)|kidney(5)|large_intestine(8)|lung(9)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	40					Vorinostat(DB02546)	CCCAACCTTGTGGGGACTGTG	0.562																																					Pancreas(112;205 1675 2305 8976 15959)	Pancreas(112;205 1675 2305 8976 15959)	uc011mmi.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(1)	4						c.(3397-3399)TGT>TGA		histone deacetylase 6	Vorinostat(DB02546)						90.0	81.0	84.0					X																	48682427		2203	4299	6502	SO:0001587	stop_gained	10013				aggresome assembly|cellular response to hydrogen peroxide|Hsp90 deacetylation|lysosome localization|macroautophagy|misfolded or incompletely synthesized protein catabolic process|negative regulation of proteolysis|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|polyubiquitinated misfolded protein transport|positive regulation of apoptosis|positive regulation of cellular chaperone-mediated protein complex assembly|positive regulation of epithelial cell migration|positive regulation of receptor biosynthetic process|positive regulation of signal transduction|regulation of androgen receptor signaling pathway|regulation of receptor activity|response to growth factor stimulus|response to toxin|transcription, DNA-dependent|tubulin deacetylation	aggresome|caveola|cell leading edge|cytosol|histone deacetylase complex|microtubule associated complex|perinuclear region of cytoplasm	actin binding|alpha-tubulin binding|beta-catenin binding|dynein complex binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|Hsp90 protein binding|microtubule binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|polyubiquitin binding|tau protein binding|tubulin deacetylase activity|zinc ion binding	g.chrX:48682427T>A	AF132609	CCDS14306.1	Xp11.23	2014-06-12			ENSG00000094631	ENSG00000094631			14064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 90"""	300272				10220385, 10048485	Standard	NM_006044		Approved	KIAA0901, JM21, HD6, FLJ16239, PPP1R90	uc004dks.1	Q9UBN7	OTTHUMG00000034496	ENST00000334136.5:c.3399T>A	X.37:g.48682427T>A	ENSP00000334061:p.Cys1133*					HDAC6_uc004dks.1_Nonsense_Mutation_p.C1133*|HDAC6_uc010nig.1_Nonsense_Mutation_p.C981*|HDAC6_uc004dkt.1_Nonsense_Mutation_p.C1133*|HDAC6_uc011mmk.1_Nonsense_Mutation_p.C1114*|HDAC6_uc004dkv.1_Nonsense_Mutation_p.C781*|HDAC6_uc004dkw.1_Nonsense_Mutation_p.C781*|HDAC6_uc004dkx.1_Nonsense_Mutation_p.C496*	p.C1133*	NM_006044	NP_006035	Q9UBN7	HDAC6_HUMAN			27	3494	+			1133			UBP-type.	Zinc 3.	O94975|Q6NT75|Q7L3E5|Q96CY0	Nonsense_Mutation	SNP	ENST00000334136.5	37	c.3399T>A	CCDS14306.1	.	.	.	.	.	.	.	.	.	.	t	42	9.643182	0.99227	.	.	ENSG00000094631	ENST00000444343;ENST00000334136;ENST00000376619	.	.	.	5.18	-0.273	0.12915	.	0.119036	0.56097	D	0.000025	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.6084	8.3839	0.32488	0.0:0.468:0.0:0.532	.	.	.	.	X	1147;1133;1133	.	ENSP00000334061:C1133X	C	+	3	2	HDAC6	48567371	0.174000	0.23070	0.427000	0.26684	0.984000	0.73092	0.403000	0.20982	-0.020000	0.14032	0.352000	0.21897	TGT		0.562	HDAC6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083394.2	NM_006044		7	41	0	0	0	0.00308	0	7	41				
PQBP1	10084	broad.mit.edu	37	X	48759733	48759733	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:48759733G>C	ENST00000376563.1	+	5	716	c.516G>C	c.(514-516)gaG>gaC	p.E172D	PQBP1_ENST00000376566.4_Intron|PQBP1_ENST00000473764.1_3'UTR|PQBP1_ENST00000218224.4_Missense_Mutation_p.E172D|PQBP1_ENST00000247140.4_Intron|PQBP1_ENST00000447146.2_Missense_Mutation_p.E172D|PQBP1_ENST00000396763.1_Missense_Mutation_p.E172D	NM_001032381.1|NM_001032382.1|NM_001032383.1|NM_001167989.1	NP_001027553.1|NP_001027554.1|NP_001027555.1|NP_001161461.1	O60828	PQBP1_HUMAN	polyglutamine binding protein 1	172	Arg-rich.|Intrinsically disordered.				alternative mRNA splicing, via spliceosome (GO:0000380)|neuron projection development (GO:0031175)|regulation of dendrite morphogenesis (GO:0048814)|regulation of RNA splicing (GO:0043484)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|neuronal ribonucleoprotein granule (GO:0071598)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ribonucleoprotein complex binding (GO:0043021)|transcription coactivator activity (GO:0003713)	p.E172D(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(2)	11						ACCGGGAAGAGGGCAAAGAAC	0.607																																							uc004dle.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(514-516)GAG>GAC		polyglutamine binding protein 1							37.0	27.0	30.0					X																	48759733		2201	4299	6500	SO:0001583	missense	10084				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|transcription coactivator activity	g.chrX:48759733G>C	AJ005893	CCDS14309.1, CCDS55412.1	Xp11.23	2014-01-31			ENSG00000102103	ENSG00000102103			9330	protein-coding gene	gene with protein product		300463	"""Sutherland-Haan X-linked mental retardation syndrome"", ""mental retardation, X-linked 55"", ""mental retardation, X-linked 2 (non-dysmorphic)"""	RENS1, MRXS8, SHS, MRX55, MRX2		9875212, 15024694, 14634649	Standard	NM_144495		Approved		uc004dlg.3	O60828	OTTHUMG00000024128	ENST00000376563.1:c.516G>C	X.37:g.48759733G>C	ENSP00000365747:p.Glu172Asp					PQBP1_uc004dlf.2_Missense_Mutation_p.E172D|PQBP1_uc004dlg.2_Missense_Mutation_p.E172D|PQBP1_uc004dld.2_Intron|PQBP1_uc004dlh.2_Missense_Mutation_p.E172D|PQBP1_uc004dli.2_Missense_Mutation_p.E172D|PQBP1_uc004dlj.1_Missense_Mutation_p.E172D|PQBP1_uc004dln.2_Missense_Mutation_p.E172D|PQBP1_uc010nih.2_RNA|PQBP1_uc010nii.2_Missense_Mutation_p.E130D|PQBP1_uc004dlk.2_Intron|PQBP1_uc004dll.2_Intron|PQBP1_uc004dlm.2_Missense_Mutation_p.E130D|PQBP1_uc010nij.2_Missense_Mutation_p.E72D	p.E172D	NM_001032382	NP_001027554	O60828	PQBP1_HUMAN			5	705	+			172			Arg-rich.		Q4VY25|Q4VY26|Q4VY27|Q4VY29|Q4VY30|Q4VY34|Q4VY35|Q4VY36|Q4VY37|Q4VY38|Q9GZP2|Q9GZU4|Q9GZZ4	Missense_Mutation	SNP	ENST00000376563.1	37	c.516G>C	CCDS14309.1	.	.	.	.	.	.	.	.	.	.	G	12.17	1.858175	0.32791	.	.	ENSG00000102103	ENST00000376563;ENST00000447146;ENST00000218224;ENST00000396763;ENST00000443648	T;T;T;T;T	0.77750	-1.08;-1.08;-1.08;-1.08;-1.12	5.45	1.59	0.23543	.	0.232106	0.36854	N	0.002362	T	0.56717	0.2004	N	0.25647	0.755	0.36647	D	0.877154	B;B;B;B;B	0.10296	0.0;0.0;0.001;0.003;0.0	B;B;B;B;B	0.11329	0.0;0.002;0.002;0.006;0.001	T	0.36625	-0.9740	10	0.22706	T	0.39	-23.6539	1.5486	0.02570	0.1667:0.1374:0.4092:0.2866	.	72;172;172;172;172	O60828-5;O60828-2;C9JQA1;O60828-3;O60828	.;.;.;.;PQBP1_HUMAN	D	172	ENSP00000365747:E172D;ENSP00000391759:E172D;ENSP00000218224:E172D;ENSP00000379985:E172D;ENSP00000414861:E172D	ENSP00000218224:E172D	E	+	3	2	PQBP1	48644677	0.682000	0.27624	0.841000	0.33234	0.961000	0.63080	0.209000	0.17435	-0.038000	0.13624	-0.191000	0.12829	GAG		0.607	PQBP1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060777.1	NM_001032381.1		12	24	0	0	0	0.001368	0	12	24				
CCNB3	85417	broad.mit.edu	37	X	50053795	50053795	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:50053795C>G	ENST00000376042.1	+	6	2924	c.2626C>G	c.(2626-2628)Cga>Gga	p.R876G	CCNB3_ENST00000376038.1_Intron|CCNB3_ENST00000348603.2_Intron|CCNB3_ENST00000276014.7_Missense_Mutation_p.R876G			Q8WWL7	CCNB3_HUMAN	cyclin B3	876					meiotic nuclear division (GO:0007126)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)	nucleus (GO:0005634)		p.R876G(2)		breast(3)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Ovarian(276;0.236)					CCTCTTTAAGCGACACTCAGC	0.517																																							uc004dox.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|lung(3)|large_intestine(1)|pancreas(1)	9						c.(2626-2628)CGA>GGA		cyclin B3 isoform 3							51.0	44.0	46.0					X																	50053795		2203	4300	6503	SO:0001583	missense	85417				cell division|meiosis|regulation of cyclin-dependent protein kinase activity|regulation of G2/M transition of mitotic cell cycle	nucleus	protein kinase binding	g.chrX:50053795C>G	AJ314764	CCDS14331.1, CCDS14332.1	Xp11	2008-07-03			ENSG00000147082	ENSG00000147082			18709	protein-coding gene	gene with protein product		300456				11846420, 12185076	Standard	XM_006724610		Approved		uc004doy.3	Q8WWL7	OTTHUMG00000021519	ENST00000376042.1:c.2626C>G	X.37:g.50053795C>G	ENSP00000365210:p.Arg876Gly					CCNB3_uc004doy.2_Missense_Mutation_p.R876G|CCNB3_uc004doz.2_Intron|CCNB3_uc010njq.2_Intron	p.R876G	NM_033031	NP_149020	Q8WWL7	CCNB3_HUMAN			6	2924	+	Ovarian(276;0.236)		876					B1AQI5|B1AQI6|Q96SB5|Q96SB6|Q96SB7|Q9NT38	Missense_Mutation	SNP	ENST00000376042.1	37	c.2626C>G	CCDS14331.1	.	.	.	.	.	.	.	.	.	.	C	7.042	0.562760	0.13498	.	.	ENSG00000147082	ENST00000376042;ENST00000276014	T;T	0.34275	1.37;1.37	3.22	1.43	0.22495	.	11.366800	0.00166	N	0.000012	T	0.16981	0.0408	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.15263	-1.0443	9	.	.	.	.	3.8442	0.08928	0.1533:0.2674:0.5793:0.0	.	876	Q8WWL7	CCNB3_HUMAN	G	876	ENSP00000365210:R876G;ENSP00000276014:R876G	.	R	+	1	2	CCNB3	50070535	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.429000	0.06982	0.244000	0.21351	-0.347000	0.07816	CGA		0.517	CCNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056558.1			7	51	0	0	0	0.001984	0	7	51				
TSPYL2	64061	broad.mit.edu	37	X	53115108	53115108	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:53115108G>A	ENST00000375442.4	+	6	1666	c.1534G>A	c.(1534-1536)Gat>Aat	p.D512N		NM_022117.3	NP_071400.1	Q9H2G4	TSYL2_HUMAN	TSPY-like 2	512	Asn-rich.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell cycle (GO:0007049)|cellular protein metabolic process (GO:0044267)|chromatin modification (GO:0016568)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA replication (GO:0008156)|nucleosome assembly (GO:0006334)|regulation of protein kinase activity (GO:0045859)|regulation of signal transduction (GO:0009966)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	rDNA binding (GO:0000182)	p.D512N(1)		central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(1)	19						tgagagtgcagatgacaacaa	0.453																																							uc004drw.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1534-1536)GAT>AAT		TSPY-like 2							244.0	175.0	198.0					X																	53115108		2203	4300	6503	SO:0001583	missense	64061				cell cycle|chromatin modification|negative regulation of cell cycle|negative regulation of cell growth|negative regulation of DNA replication|nucleosome assembly|regulation of protein kinase activity|regulation of signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	protein binding|rDNA binding	g.chrX:53115108G>A	AF273046	CCDS14350.1	Xp11	2014-06-09			ENSG00000184205	ENSG00000184205			24358	protein-coding gene	gene with protein product		300564				11318608, 11395479	Standard	NM_022117		Approved	SE20-4, HRIHFB2216, CTCL, DENTT, CDA1, CINAP, TSPX	uc004drw.3	Q9H2G4	OTTHUMG00000021597	ENST00000375442.4:c.1534G>A	X.37:g.53115108G>A	ENSP00000364591:p.Asp512Asn					TSPYL2_uc004drv.2_3'UTR|TSPYL2_uc004drx.1_Missense_Mutation_p.D117N	p.D512N	NM_022117	NP_071400	Q9H2G4	TSYL2_HUMAN			6	1666	+			512			Asn-rich.		O94799|Q96DG7|Q9BZW6	Missense_Mutation	SNP	ENST00000375442.4	37	c.1534G>A	CCDS14350.1	.	.	.	.	.	.	.	.	.	.	G	15.44	2.834682	0.50951	.	.	ENSG00000184205	ENST00000375442	T	0.32753	1.44	2.2	0.319	0.15873	.	.	.	.	.	T	0.15219	0.0367	N	0.08118	0	0.09310	N	1	P;B	0.40578	0.722;0.198	B;B	0.40477	0.33;0.012	T	0.13764	-1.0497	9	0.87932	D	0	-0.4501	4.8136	0.13356	0.3008:0.0:0.6992:0.0	.	152;512	Q59GC7;Q9H2G4	.;TSYL2_HUMAN	N	512	ENSP00000364591:D512N	ENSP00000364591:D512N	D	+	1	0	TSPYL2	53131833	0.113000	0.22115	0.000000	0.03702	0.373000	0.29922	0.837000	0.27558	-0.024000	0.13941	0.287000	0.19450	GAT		0.453	TSPYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056718.1	NM_022117		9	48	0	0	0	0.004482	0	9	48				
PHF8	23133	broad.mit.edu	37	X	54012298	54012298	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:54012298G>T	ENST00000357988.5	-	17	2546	c.2188C>A	c.(2188-2190)Ctg>Atg	p.L730M	PHF8_ENST00000338154.6_Missense_Mutation_p.L694M|PHF8_ENST00000322659.8_Intron|PHF8_ENST00000338946.6_Missense_Mutation_p.L593M	NM_001184896.1	NP_001171825.1	Q9UPP1	PHF8_HUMAN	PHD finger protein 8	730					brain development (GO:0007420)|G1/S transition of mitotic cell cycle (GO:0000082)|histone H3-K27 demethylation (GO:0071557)|histone H3-K36 demethylation (GO:0070544)|histone H3-K9 demethylation (GO:0033169)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of chromatin silencing at rDNA (GO:0061188)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K27 specific) (GO:0071558)|histone demethylase activity (H3-K36 specific) (GO:0051864)|histone demethylase activity (H3-K9 specific) (GO:0032454)|histone demethylase activity (H4-K20 specific) (GO:0035575)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)	p.L694M(1)		endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	40						GCCTTGAGCAGATCAAGAATG	0.552																																							uc004dsu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(2188-2190)CTG>ATG		PHD finger protein 8							266.0	174.0	205.0					X																	54012298		2203	4300	6503	SO:0001583	missense	23133				brain development|G1/S transition of mitotic cell cycle|negative regulation of chromatin silencing at rDNA|positive regulation of transcription from RNA polymerase I promoter|transcription, DNA-dependent	nucleolus	chromatin binding|histone demethylase activity (H3-K27 specific)|histone demethylase activity (H3-K36 specific)|histone demethylase activity (H3-K9 specific)|histone demethylase activity (H4-K20 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding	g.chrX:54012298G>T	AB029034	CCDS14355.1, CCDS55418.1, CCDS55419.1, CCDS55420.1	Xp11.22	2013-01-28			ENSG00000172943	ENSG00000172943		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	20672	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1F"""	300560				10470851, 20023638, 20644565	Standard	NM_015107		Approved	ZNF422, KIAA1111, JHDM1F	uc004dsu.3	Q9UPP1	OTTHUMG00000021622	ENST00000357988.5:c.2188C>A	X.37:g.54012298G>T	ENSP00000350676:p.Leu730Met					PHF8_uc004dst.2_Missense_Mutation_p.L694M|PHF8_uc004dsv.2_Missense_Mutation_p.L560M|PHF8_uc004dsw.2_Missense_Mutation_p.L593M|PHF8_uc004dsx.2_Missense_Mutation_p.L458M|PHF8_uc004dsy.2_Intron	p.L730M	NM_015107	NP_055922	Q9UPP1	PHF8_HUMAN			17	2261	-			730					B3KMV4|B7Z911|Q5H9U5|Q5JPR9|Q5JPS0|Q5JPS2|Q5JPS3|Q5VUJ4|Q7Z6D4|Q9HAH2	Missense_Mutation	SNP	ENST00000357988.5	37	c.2188C>A	CCDS55420.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.43|18.43	3.622295|3.622295	0.66787|0.66787	.|.	.|.	ENSG00000172943|ENSG00000172943	ENST00000357988;ENST00000338154;ENST00000338946;ENST00000396277|ENST00000443302	T;T;T|.	0.38077|.	1.39;1.16;1.17|.	5.48|5.48	5.48|5.48	0.80851|0.80851	.|.	0.139826|.	0.48286|.	D|.	0.000198|.	T|T	0.57888|0.57888	0.2084|0.2084	L|L	0.60067|0.60067	1.865|1.865	0.26387|0.26387	N|N	0.976641|0.976641	D;D;D;D|.	0.76494|.	0.999;0.998;0.999;0.998|.	D;D;D;D|.	0.87578|.	0.998;0.994;0.998;0.996|.	T|T	0.53365|0.53365	-0.8449|-0.8449	10|5	0.41790|.	T|.	0.15|.	-1.9363|-1.9363	17.0522|17.0522	0.86523|0.86523	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	694;593;629;730|.	Q9UPP1-2;B7Z911;Q9UPP1-3;Q9UPP1|.	.;.;.;PHF8_HUMAN|.	M|Y	730;694;593;623|457	ENSP00000350676:L730M;ENSP00000338868:L694M;ENSP00000340051:L593M|.	ENSP00000338868:L694M|.	L|S	-|-	1|2	2|0	PHF8|PHF8	54029023|54029023	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	3.818000|3.818000	0.55678|0.55678	2.291000|2.291000	0.77112|0.77112	0.600000|0.600000	0.82982|0.82982	CTG|TCT		0.552	PHF8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056784.2	NM_015107		15	94	1	0	4.93089e-13	0.00245	7.23541e-13	15	94				
OPHN1	4983	broad.mit.edu	37	X	67417059	67417059	+	Missense_Mutation	SNP	A	A	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:67417059A>C	ENST00000355520.5	-	12	1714	c.1073T>G	c.(1072-1074)cTa>cGa	p.L358R	OPHN1_ENST00000540071.1_Missense_Mutation_p.L358R	NM_002547.2	NP_002538.1	O60890	OPHN1_HUMAN	oligophrenin 1	358	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|negative regulation of proteasomal protein catabolic process (GO:1901799)|nervous system development (GO:0007399)|regulation of endocytosis (GO:0030100)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of synaptic transmission, glutamatergic (GO:0051966)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|substrate-dependent cell migration, cell extension (GO:0006930)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|terminal bouton (GO:0043195)	phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)	p.L358R(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(3)|skin(2)	31						TTCCATCCATAGCCTTCTGTT	0.473																																							uc004dww.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1072-1074)CTA>CGA		oligophrenin 1							134.0	105.0	115.0					X																	67417059		2203	4300	6503	SO:0001583	missense	4983				axon guidance|endocytosis|filopodium assembly|small GTPase mediated signal transduction|substrate-dependent cell migration, cell extension	axon|cell junction|cytosol|dendritic spine|synapse	cytoskeletal adaptor activity|Rho GTPase activator activity|SH3 domain binding	g.chrX:67417059A>C	AJ001189	CCDS14388.1	Xq12	2011-07-04			ENSG00000079482	ENSG00000079482		"""Rho GTPase activating proteins"""	8148	protein-coding gene	gene with protein product		300127	"""mental retardation, X-linked 60"""	MRX60		9195162, 9582072	Standard	NM_002547		Approved	OPN1, ARHGAP41	uc004dww.4	O60890	OTTHUMG00000021744	ENST00000355520.5:c.1073T>G	X.37:g.67417059A>C	ENSP00000347710:p.Leu358Arg					OPHN1_uc011mpg.1_Missense_Mutation_p.L358R	p.L358R	NM_002547	NP_002538	O60890	OPHN1_HUMAN			12	1367	-			358			PH.		B9EIP8|Q5JQ81|Q6PCC1|Q8WX47	Missense_Mutation	SNP	ENST00000355520.5	37	c.1073T>G	CCDS14388.1	.	.	.	.	.	.	.	.	.	.	A	18.69	3.677102	0.68042	.	.	ENSG00000079482	ENST00000355520;ENST00000540071	T;T	0.41400	1.0;1.0	4.79	4.79	0.61399	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.079189	0.52532	D	0.000077	T	0.63165	0.2488	M	0.77103	2.36	0.46478	D	0.999068	D;D	0.69078	0.997;0.987	D;P	0.78314	0.991;0.706	T	0.67577	-0.5635	10	0.72032	D	0.01	.	11.3478	0.49571	1.0:0.0:0.0:0.0	.	358;358	F5H2E3;O60890	.;OPHN1_HUMAN	R	358	ENSP00000347710:L358R;ENSP00000438617:L358R	ENSP00000347710:L358R	L	-	2	0	OPHN1	67333784	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.218000	0.65257	1.881000	0.54492	0.486000	0.48141	CTA		0.473	OPHN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057011.1	NM_002547		16	86	0	0	0	0.004007	0	16	86				
KIAA2022	340533	broad.mit.edu	37	X	73962484	73962484	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:73962484G>T	ENST00000055682.6	-	3	2519	c.1908C>A	c.(1906-1908)caC>caA	p.H636Q		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	636					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)	p.H636Q(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						TTTGAATCCTGTGCCTGTTGC	0.403																																							uc004eby.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|large_intestine(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15						c.(1906-1908)CAC>CAA		hypothetical protein LOC340533							63.0	51.0	55.0					X																	73962484		2203	4300	6503	SO:0001583	missense	340533				base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|S phase of mitotic cell cycle	delta DNA polymerase complex	3'-5'-exodeoxyribonuclease activity|DNA-directed DNA polymerase activity	g.chrX:73962484G>T		CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.1908C>A	X.37:g.73962484G>T	ENSP00000055682:p.His636Gln						p.H636Q	NM_001008537	NP_001008537	Q5QGS0	K2022_HUMAN			3	2525	-			636					A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	ENST00000055682.6	37	c.1908C>A	CCDS35337.1	.	.	.	.	.	.	.	.	.	.	G	9.453	1.091186	0.20471	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.34072	1.38;1.38	5.88	2.19	0.27852	.	0.114825	0.64402	D	0.000017	T	0.46795	0.1411	L	0.44542	1.39	0.37030	D	0.896612	D	0.76494	0.999	D	0.71656	0.974	T	0.47142	-0.9140	10	0.46703	T	0.11	-8.9636	10.4525	0.44531	0.273:0.0:0.727:0.0	.	636	Q5QGS0	K2022_HUMAN	Q	636	ENSP00000362567:H636Q;ENSP00000055682:H636Q	ENSP00000055682:H636Q	H	-	3	2	KIAA2022	73879209	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	2.011000	0.40922	0.264000	0.21851	-0.296000	0.09543	CAC		0.403	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057270.2	NM_001008537		4	29	1	0	0.00024832	0.009096	0.000275802	4	29				
ZCCHC5	203430	broad.mit.edu	37	X	77912693	77912693	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:77912693C>A	ENST00000321110.1	-	2	1520	c.1225G>T	c.(1225-1227)Gga>Tga	p.G409*		NM_152694.2	NP_689907.1	Q8N8U3	ZCHC5_HUMAN	zinc finger, CCHC domain containing 5	409							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.G409*(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)|prostate(1)|skin(1)	37						GGTCCATCTCCCTCTGCAGAG	0.527																																							uc004edc.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(1225-1227)GGA>TGA		zinc finger, CCHC domain containing 5							141.0	119.0	126.0					X																	77912693		2203	4300	6503	SO:0001587	stop_gained	203430						nucleic acid binding|zinc ion binding	g.chrX:77912693C>A	AK096184	CCDS14440.1	Xq13.3	2008-02-05			ENSG00000179300	ENSG00000179300		"""Zinc fingers, CCHC domain containing"""	22997	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_152694		Approved	FLJ38865, Mar3, Mart3, ZHC5	uc004edc.1	Q8N8U3	OTTHUMG00000021892	ENST00000321110.1:c.1225G>T	X.37:g.77912693C>A	ENSP00000316794:p.Gly409*						p.G409*	NM_152694	NP_689907	Q8N8U3	ZCHC5_HUMAN			2	1521	-			409					B2RMZ0|Q5JQE9	Nonsense_Mutation	SNP	ENST00000321110.1	37	c.1225G>T	CCDS14440.1	.	.	.	.	.	.	.	.	.	.	C	15.85	2.953484	0.53293	.	.	ENSG00000179300	ENST00000321110	.	.	.	3.1	-2.08	0.07254	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	.	4.2417	0.10650	0.0:0.457:0.2169:0.3261	.	.	.	.	X	409	.	ENSP00000316794:G409X	G	-	1	0	ZCCHC5	77799349	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.679000	0.05203	-0.628000	0.05582	-0.503000	0.04515	GGA		0.527	ZCCHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057319.1	NM_152694		14	98	1	0	7.93312e-07	0.00245	9.77722e-07	14	98				
ZCCHC5	203430	broad.mit.edu	37	X	77913149	77913149	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:77913149G>T	ENST00000321110.1	-	2	1064	c.769C>A	c.(769-771)Cag>Aag	p.Q257K		NM_152694.2	NP_689907.1	Q8N8U3	ZCHC5_HUMAN	zinc finger, CCHC domain containing 5	257							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.Q257K(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)|prostate(1)|skin(1)	37						CTATACAGCTGAACCAGGAAC	0.507																																							uc004edc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(769-771)CAG>AAG		zinc finger, CCHC domain containing 5							28.0	26.0	27.0					X																	77913149		2203	4300	6503	SO:0001583	missense	203430						nucleic acid binding|zinc ion binding	g.chrX:77913149G>T	AK096184	CCDS14440.1	Xq13.3	2008-02-05			ENSG00000179300	ENSG00000179300		"""Zinc fingers, CCHC domain containing"""	22997	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_152694		Approved	FLJ38865, Mar3, Mart3, ZHC5	uc004edc.1	Q8N8U3	OTTHUMG00000021892	ENST00000321110.1:c.769C>A	X.37:g.77913149G>T	ENSP00000316794:p.Gln257Lys						p.Q257K	NM_152694	NP_689907	Q8N8U3	ZCHC5_HUMAN			2	1065	-			257					B2RMZ0|Q5JQE9	Missense_Mutation	SNP	ENST00000321110.1	37	c.769C>A	CCDS14440.1	.	.	.	.	.	.	.	.	.	.	G	6.534	0.466689	0.12402	.	.	ENSG00000179300	ENST00000321110	T	0.24908	1.83	3.29	1.38	0.22167	.	0.786894	0.10223	U	0.700668	T	0.18964	0.0455	L	0.52573	1.65	0.09310	N	1	B	0.33528	0.416	B	0.23018	0.043	T	0.18871	-1.0323	10	0.62326	D	0.03	.	4.9624	0.14072	0.0:0.2352:0.5191:0.2457	.	257	Q8N8U3	ZCHC5_HUMAN	K	257	ENSP00000316794:Q257K	ENSP00000316794:Q257K	Q	-	1	0	ZCCHC5	77799805	0.018000	0.18449	0.014000	0.15608	0.013000	0.08279	0.959000	0.29240	0.221000	0.20879	0.513000	0.50165	CAG		0.507	ZCCHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057319.1	NM_152694		9	16	1	0	2.17888e-05	0.006214	2.53002e-05	9	16				
GPR174	84636	broad.mit.edu	37	X	78426624	78426624	+	Silent	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:78426624C>A	ENST00000276077.1	+	1	156	c.120C>A	c.(118-120)gcC>gcA	p.A40A		NM_032553.1	NP_115942.1	Q9BXC1	GP174_HUMAN	G protein-coupled receptor 174	40						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.A40A(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(19)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	38						ATATATTAGCCCTGTGGGTAT	0.383										HNSCC(63;0.18)																													uc004edg.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(1)|central_nervous_system(1)	2						c.(118-120)GCC>GCA		putative purinergic receptor FKSG79							89.0	76.0	80.0					X																	78426624		2203	4300	6503	SO:0001819	synonymous_variant	84636					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled	g.chrX:78426624C>A	AF345567	CCDS14443.1	Xq13.3	2012-08-21			ENSG00000147138	ENSG00000147138		"""GPCR / Class A : Orphans"""	30245	protein-coding gene	gene with protein product		300903					Standard	NM_032553		Approved	FKSG79	uc004edg.1	Q9BXC1	OTTHUMG00000021898	ENST00000276077.1:c.120C>A	X.37:g.78426624C>A		HNSCC(63;0.18)					p.A40A	NM_032553	NP_115942	Q9BXC1	GP174_HUMAN			1	156	+			40			Helical; Name=1; (Potential).		Q2M3F7	Silent	SNP	ENST00000276077.1	37	c.120C>A	CCDS14443.1																																																																																				0.383	GPR174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057327.1	NM_032553		7	26	1	0	2.7689e-08	0.001984	3.62732e-08	7	26				
GPR174	84636	broad.mit.edu	37	X	78426925	78426925	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:78426925G>T	ENST00000276077.1	+	1	457	c.421G>T	c.(421-423)Ggc>Tgc	p.G141C		NM_032553.1	NP_115942.1	Q9BXC1	GP174_HUMAN	G protein-coupled receptor 174	141						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.G141C(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(19)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	38						CAGCATTGCTGGCTGGCTGAT	0.473										HNSCC(63;0.18)																													uc004edg.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|central_nervous_system(1)	2						c.(421-423)GGC>TGC		putative purinergic receptor FKSG79							197.0	171.0	180.0					X																	78426925		2203	4300	6503	SO:0001583	missense	84636					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled	g.chrX:78426925G>T	AF345567	CCDS14443.1	Xq13.3	2012-08-21			ENSG00000147138	ENSG00000147138		"""GPCR / Class A : Orphans"""	30245	protein-coding gene	gene with protein product		300903					Standard	NM_032553		Approved	FKSG79	uc004edg.1	Q9BXC1	OTTHUMG00000021898	ENST00000276077.1:c.421G>T	X.37:g.78426925G>T	ENSP00000276077:p.Gly141Cys	HNSCC(63;0.18)					p.G141C	NM_032553	NP_115942	Q9BXC1	GP174_HUMAN			1	457	+			141			Helical; Name=4; (Potential).		Q2M3F7	Missense_Mutation	SNP	ENST00000276077.1	37	c.421G>T	CCDS14443.1	.	.	.	.	.	.	.	.	.	.	g	19.04	3.750117	0.69533	.	.	ENSG00000147138	ENST00000276077	T	0.71579	-0.58	5.06	5.06	0.68205	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.81494	0.4834	L	0.60455	1.87	0.58432	D	0.999999	D	0.76494	0.999	D	0.77557	0.99	T	0.83076	-0.0140	10	0.59425	D	0.04	.	15.9995	0.80280	0.0:0.0:1.0:0.0	.	141	Q9BXC1	GP174_HUMAN	C	141	ENSP00000276077:G141C	ENSP00000276077:G141C	G	+	1	0	GPR174	78313581	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	5.482000	0.66833	2.082000	0.62665	0.488000	0.48403	GGC		0.473	GPR174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057327.1	NM_032553		17	193	1	0	1.45105e-14	0.006122	2.19809e-14	17	193				
KLHL4	56062	broad.mit.edu	37	X	86888896	86888896	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:86888896T>A	ENST00000373119.4	+	8	1842	c.1697T>A	c.(1696-1698)gTt>gAt	p.V566D	KLHL4_ENST00000373114.4_Missense_Mutation_p.V566D	NM_019117.4	NP_061990.2	Q9C0H6	KLHL4_HUMAN	kelch-like family member 4	566						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.V566D(2)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(29)|ovary(2)|prostate(1)|skin(1)	67						GTTGGTGTTGTTGCATTAAAC	0.423																																							uc004efb.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						c.(1696-1698)GTT>GAT		kelch-like 4 isoform 1							147.0	118.0	128.0					X																	86888896		2203	4300	6503	SO:0001583	missense	56062					cytoplasm|microtubule cytoskeleton|nucleolus	actin binding	g.chrX:86888896T>A	AF284765	CCDS14456.1, CCDS14457.1	Xq21.3	2013-01-30	2013-01-30		ENSG00000102271	ENSG00000102271		"""Kelch-like"", ""BTB/POZ domain containing"""	6355	protein-coding gene	gene with protein product		300348	"""kelch (Drosophila)-like 4"", ""kelch-like 4 (Drosophila)"""			11401425	Standard	NM_019117		Approved	KIAA1687, DKELCHL, KHL4	uc004efa.2	Q9C0H6	OTTHUMG00000021946	ENST00000373119.4:c.1697T>A	X.37:g.86888896T>A	ENSP00000362211:p.Val566Asp					KLHL4_uc004efa.2_Missense_Mutation_p.V566D	p.V566D	NM_019117	NP_061990	Q9C0H6	KLHL4_HUMAN			8	1879	+			566			Kelch 3.		B2RTW2|Q9Y3J5	Missense_Mutation	SNP	ENST00000373119.4	37	c.1697T>A	CCDS14457.1	.	.	.	.	.	.	.	.	.	.	T	14.86	2.661328	0.47572	.	.	ENSG00000102271	ENST00000373119;ENST00000373114	T;T	0.81330	-1.48;-1.48	4.72	1.16	0.20824	Galactose oxidase, beta-propeller (1);	0.310486	0.34338	N	0.004049	D	0.84678	0.5525	M	0.89030	3	0.48762	D	0.999705	B;B	0.28419	0.14;0.211	B;B	0.41236	0.351;0.139	T	0.80652	-0.1287	10	0.87932	D	0	.	8.6252	0.33886	0.0:0.715:0.0:0.285	.	566;566	Q9C0H6;Q9C0H6-2	KLHL4_HUMAN;.	D	566	ENSP00000362211:V566D;ENSP00000362206:V566D	ENSP00000362206:V566D	V	+	2	0	KLHL4	86775552	0.987000	0.35691	0.979000	0.43373	0.988000	0.76386	2.176000	0.42500	-0.135000	0.11495	0.412000	0.27726	GTT		0.423	KLHL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057413.1			36	63	0	0	0	0.009718	0	36	63				
PCDH11X	27328	broad.mit.edu	37	X	91873455	91873455	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:91873455C>A	ENST00000373094.1	+	7	4405	c.3560C>A	c.(3559-3561)cCa>cAa	p.P1187Q	PCDH11X_ENST00000361655.2_Missense_Mutation_p.P1169Q|PCDH11X_ENST00000406881.1_Missense_Mutation_p.P1179Q|PCDH11X_ENST00000373088.1_Missense_Mutation_p.P1150Q|PCDH11X_ENST00000504220.2_3'UTR|PCDH11X_ENST00000298274.8_Missense_Mutation_p.P1150Q|PCDH11X_ENST00000373097.1_Missense_Mutation_p.P1177Q	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	1187					homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P1187Q(1)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						CACCACAGCCCACGAGTGACA	0.587																																					NSCLC(38;925 1092 2571 38200 45895)	NSCLC(38;925 1092 2571 38200 45895)	uc004efk.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)	2						c.(3559-3561)CCA>CAA		protocadherin 11 X-linked isoform c							235.0	178.0	198.0					X																	91873455		2203	4300	6503	SO:0001583	missense	27328				homophilic cell adhesion	integral to plasma membrane	calcium ion binding	g.chrX:91873455C>A	AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.3560C>A	X.37:g.91873455C>A	ENSP00000362186:p.Pro1187Gln					PCDH11X_uc004efl.1_Missense_Mutation_p.P1177Q|PCDH11X_uc004efo.1_Missense_Mutation_p.P1150Q|PCDH11X_uc010nmv.1_3'UTR|PCDH11X_uc004efm.1_Missense_Mutation_p.P1179Q|PCDH11X_uc004efn.1_Missense_Mutation_p.P1169Q	p.P1187Q	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN			7	4405	+			1187			Cytoplasmic (Potential).		A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	ENST00000373094.1	37	c.3560C>A	CCDS14461.1	.	.	.	.	.	.	.	.	.	.	C	9.967	1.224292	0.22457	.	.	ENSG00000102290	ENST00000373094;ENST00000373097;ENST00000373088;ENST00000361655;ENST00000406881;ENST00000356934;ENST00000298274	T;T;T;T;T;T	0.50548	0.74;0.75;0.74;0.74;0.76;0.74	3.27	3.27	0.37495	.	.	.	.	.	T	0.38268	0.1034	L	0.36672	1.1	0.09310	N	1	P;P;P;P;P	0.49090	0.919;0.919;0.919;0.919;0.868	B;B;B;B;B	0.43536	0.423;0.423;0.423;0.423;0.243	T	0.26052	-1.0114	9	0.87932	D	0	.	7.0392	0.25010	0.2695:0.7304:0.0:0.0	.	1150;1169;1179;1177;1187	Q9BZA7-5;Q9BZA7-4;Q9BZA7-8;Q9BZA7-3;Q9BZA7	.;.;.;.;PC11X_HUMAN	Q	1187;1177;1150;1169;1179;1187;1150	ENSP00000362186:P1187Q;ENSP00000362189:P1177Q;ENSP00000362180:P1150Q;ENSP00000355105:P1169Q;ENSP00000384758:P1179Q;ENSP00000298274:P1150Q	ENSP00000298274:P1150Q	P	+	2	0	PCDH11X	91760111	0.211000	0.23529	0.257000	0.24404	0.269000	0.26545	2.639000	0.46570	1.885000	0.54596	0.370000	0.22315	CCA		0.587	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057436.1	NM_032969		55	111	1	0	6.4308e-24	0.00361	1.06297e-23	55	111				
CENPI	2491	broad.mit.edu	37	X	100403107	100403107	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:100403107A>T	ENST00000372927.1	+	19	2328	c.2051A>T	c.(2050-2052)cAt>cTt	p.H684L	CENPI_ENST00000423383.1_Missense_Mutation_p.H684L|CENPI_ENST00000218507.5_Missense_Mutation_p.H684L	NM_006733.2	NP_006724.2	Q92674	CENPI_HUMAN	centromere protein I	684					CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)|sex differentiation (GO:0007548)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)		p.H684L(1)		breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(19)|prostate(1)|skin(2)	30						AATGTAGTCCATCATCCTTCT	0.353																																							uc004egx.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(2050-2052)CAT>CTT		centromere protein I							111.0	106.0	108.0					X																	100403107		2203	4300	6503	SO:0001583	missense	2491				CenH3-containing nucleosome assembly at centromere|mitotic prometaphase	cytosol|kinetochore|nucleoplasm	protein binding	g.chrX:100403107A>T	X97249	CCDS14479.1	Xq22.1	2013-11-05	2006-06-15	2006-06-15	ENSG00000102384	ENSG00000102384			3968	protein-coding gene	gene with protein product		300065	"""FSH primary response (LRPR1, rat) homolog 1"", ""FSH primary response (LRPR1 homolog, rat) 1"""	FSHPRH1		16622420	Standard	NM_006733		Approved	LRPR1, CENP-I, Mis6	uc004egx.3	Q92674	OTTHUMG00000022018	ENST00000372927.1:c.2051A>T	X.37:g.100403107A>T	ENSP00000362018:p.His684Leu					CENPI_uc011mrg.1_Missense_Mutation_p.H684L	p.H684L	NM_006733	NP_006724	Q92674	CENPI_HUMAN			19	2321	+			684					Q5JWZ9|Q96ED0	Missense_Mutation	SNP	ENST00000372927.1	37	c.2051A>T	CCDS14479.1	.	.	.	.	.	.	.	.	.	.	A	6.795	0.515734	0.12944	.	.	ENSG00000102384	ENST00000423383;ENST00000218507;ENST00000372927	.	.	.	5.58	3.13	0.36017	.	0.525168	0.22258	N	0.062460	T	0.31358	0.0794	L	0.50333	1.59	0.09310	N	1	B;B	0.29862	0.259;0.259	B;B	0.26969	0.075;0.051	T	0.17440	-1.0369	9	0.23302	T	0.38	0.848	6.8453	0.23984	0.7898:0.0:0.0742:0.136	.	684;684	B4DZL4;Q92674	.;CENPI_HUMAN	L	684	.	ENSP00000218507:H684L	H	+	2	0	CENPI	100289763	0.527000	0.26306	0.003000	0.11579	0.020000	0.10135	2.551000	0.45820	0.228000	0.21019	0.345000	0.21793	CAT		0.353	CENPI-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057519.1	NM_006733		6	204	0	0	0	0.00308	0	6	204				
ZMAT1	84460	broad.mit.edu	37	X	101152922	101152922	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:101152922C>T	ENST00000372782.3	-	5	471	c.424G>A	c.(424-426)Gga>Aga	p.G142R	ZMAT1_ENST00000540921.1_Missense_Mutation_p.G142R|ZMAT1_ENST00000458570.1_5'UTR	NM_001011657.3	NP_001011657	Q5H9K5	ZMAT1_HUMAN	zinc finger, matrin-type 1	142						nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.G142R(1)		endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	22						TGGACCTTTCCCACATAGTGA	0.413																																							uc011mrl.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(424-426)GGA>AGA		zinc finger, matrin type 1 isoform 1							153.0	118.0	130.0					X																	101152922		2203	4300	6503	SO:0001583	missense	84460					nucleus	zinc ion binding	g.chrX:101152922C>T	Z69304	CCDS35348.1	Xq21	2012-10-05	2010-09-15		ENSG00000166432	ENSG00000166432		"""Zinc fingers, matrin-type"""	29377	protein-coding gene	gene with protein product							Standard	NM_001011657		Approved	KIAA1789	uc011mrl.2	Q5H9K5	OTTHUMG00000022044	ENST00000372782.3:c.424G>A	X.37:g.101152922C>T	ENSP00000361868:p.Gly142Arg					ZMAT1_uc004ein.2_5'UTR|ZMAT1_uc011mrm.1_5'UTR	p.G142R	NM_001011657	NP_001011657	Q5H9K5	ZMAT1_HUMAN			5	735	-			Error:Variant_position_missing_in_A7MD47_after_alignment					Q8NDS3|Q96JN6	Missense_Mutation	SNP	ENST00000372782.3	37	c.424G>A	CCDS35348.1	.	.	.	.	.	.	.	.	.	.	C	13.63	2.293235	0.40594	.	.	ENSG00000166432	ENST00000372782;ENST00000540921	T;T	0.71461	-0.57;-0.57	4.59	4.59	0.56863	Zinc finger, C2H2-like (1);Zinc finger, U1-type (1);Zinc finger, C2H2 (1);	0.414357	0.17855	N	0.159712	D	0.84188	0.5417	M	0.80616	2.505	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86052	0.1526	10	0.87932	D	0	-12.7792	14.107	0.65096	0.0:1.0:0.0:0.0	.	142	Q5H9K5	ZMAT1_HUMAN	R	142	ENSP00000361868:G142R;ENSP00000437529:G142R	ENSP00000361868:G142R	G	-	1	0	ZMAT1	101039578	0.954000	0.32549	0.539000	0.28077	0.080000	0.17528	2.908000	0.48750	2.293000	0.77203	0.502000	0.49764	GGA		0.413	ZMAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057598.1			21	97	0	0	0	0.001882	0	21	97				
GPRASP1	9737	broad.mit.edu	37	X	101912716	101912716	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:101912716C>A	ENST00000361600.5	+	5	4676	c.3875C>A	c.(3874-3876)aCa>aAa	p.T1292K	GPRASP1_ENST00000415986.1_Missense_Mutation_p.T1292K|GPRASP1_ENST00000444152.1_Missense_Mutation_p.T1292K|RP4-769N13.7_ENST00000602441.1_RNA|GPRASP1_ENST00000537097.1_Missense_Mutation_p.T1292K	NM_014710.4	NP_055525.3	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting protein 1	1292	OPRD1-binding.				endosome to lysosome transport (GO:0008333)|G-protein coupled receptor catabolic process (GO:1990172)	cytoplasm (GO:0005737)		p.T1292K(1)		NS(1)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						AATGCCAAAACAAGGTTTCAT	0.378																																							uc004ejj.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)	2						c.(3874-3876)ACA>AAA		G protein-coupled receptor associated sorting							71.0	62.0	65.0					X																	101912716		2203	4300	6503	SO:0001583	missense	9737					cytoplasm	protein binding	g.chrX:101912716C>A	AB007903	CCDS35352.1	Xq22.1	2014-03-21			ENSG00000198932	ENSG00000198932		"""Armadillo repeat containing"""	24834	protein-coding gene	gene with protein product		300417				9455477, 15086532, 16221301	Standard	NM_014710		Approved	GASP, GASP1	uc010nod.3	Q5JY77	OTTHUMG00000022061	ENST00000361600.5:c.3875C>A	X.37:g.101912716C>A	ENSP00000355146:p.Thr1292Lys					GPRASP1_uc004eji.3_Missense_Mutation_p.T1292K|GPRASP1_uc010nod.2_Missense_Mutation_p.T1292K	p.T1292K	NM_014710	NP_055525	Q5JY77	GASP1_HUMAN			5	4676	+			1292			OPRD1-binding.		O43168|Q96LA1	Missense_Mutation	SNP	ENST00000361600.5	37	c.3875C>A	CCDS35352.1	.	.	.	.	.	.	.	.	.	.	C	11.93	1.786284	0.31593	.	.	ENSG00000198932	ENST00000415986;ENST00000444152;ENST00000361600;ENST00000537097	T;T;T;T	0.32023	1.47;1.47;1.47;1.47	2.9	2.9	0.33743	Armadillo-like helical (1);Armadillo-type fold (1);	.	.	.	.	T	0.53818	0.1820	M	0.79926	2.475	0.28514	N	0.913411	D	0.89917	1.0	D	0.91635	0.999	T	0.44081	-0.9351	9	0.87932	D	0	-4.7502	8.4937	0.33115	0.0:1.0:0.0:0.0	.	1292	Q5JY77	GASP1_HUMAN	K	1292	ENSP00000393691:T1292K;ENSP00000409420:T1292K;ENSP00000355146:T1292K;ENSP00000445683:T1292K	ENSP00000355146:T1292K	T	+	2	0	GPRASP1	101799372	1.000000	0.71417	0.751000	0.31187	0.944000	0.59088	1.588000	0.36633	1.728000	0.51552	0.462000	0.41574	ACA		0.378	GPRASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057634.2	NM_014710		7	107	1	0	1.6384e-10	0.001984	2.25682e-10	7	107				
CLDN2	9075	broad.mit.edu	37	X	106171887	106171887	+	Silent	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:106171887C>A	ENST00000541806.1	+	2	948	c.429C>A	c.(427-429)atC>atA	p.I143I	CLDN2_ENST00000336803.1_Silent_p.I143I|CLDN2_ENST00000540876.1_Silent_p.I143I	NM_001171092.1	NP_001164563.1	P57739	CLD2_HUMAN	claudin 2	143					calcium-independent cell-cell adhesion (GO:0016338)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)	p.I143I(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(1)	9						TTCATGGGATCCTACGGGACT	0.498																																							uc004emq.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(427-429)ATC>ATA		claudin 2							160.0	150.0	154.0					X																	106171887		2203	4300	6503	SO:0001819	synonymous_variant	9075				calcium-independent cell-cell adhesion	integral to membrane|tight junction	identical protein binding|structural molecule activity	g.chrX:106171887C>A	AK075405	CCDS14524.1	Xq22.3-q23	2008-05-14			ENSG00000165376	ENSG00000165376		"""Claudins"""	2041	protein-coding gene	gene with protein product		300520				9892664	Standard	NM_020384		Approved		uc022ccc.1	P57739	OTTHUMG00000022154	ENST00000541806.1:c.429C>A	X.37:g.106171887C>A						MORC4_uc004emp.3_Intron|CLDN2_uc004emt.1_Silent_p.I143I	p.I143I	NM_020384	NP_065117	P57739	CLD2_HUMAN			2	948	+			143			Extracellular (Potential).		B2R6B9	Silent	SNP	ENST00000541806.1	37	c.429C>A	CCDS14524.1																																																																																				0.498	CLDN2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057815.1			34	234	1	0	1.22384e-17	0.002836	1.89475e-17	34	234				
IRS4	8471	broad.mit.edu	37	X	107976663	107976663	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:107976663G>A	ENST00000372129.2	-	1	2988	c.2912C>T	c.(2911-2913)cCa>cTa	p.P971L	RP6-24A23.3_ENST00000608811.1_RNA|RP6-24A23.6_ENST00000563887.1_5'Flank	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	971					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)	p.P971L(2)		NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						GTCGTTTGCTGGATTTGGAAA	0.483																																							uc004eoc.2		NA																	2	Substitution - Missense(2)	p.P971L(1)	ovary(1)|lung(1)	ovary(4)|large_intestine(2)|lung(1)|breast(1)|skin(1)|pancreas(1)	10						c.(2911-2913)CCA>CTA		insulin receptor substrate 4							152.0	139.0	143.0					X																	107976663		2203	4300	6503	SO:0001583	missense	8471					plasma membrane	insulin receptor binding|SH3/SH2 adaptor activity|signal transducer activity	g.chrX:107976663G>A	AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.2912C>T	X.37:g.107976663G>A	ENSP00000361202:p.Pro971Leu						p.P971L	NM_003604	NP_003595	O14654	IRS4_HUMAN			1	2945	-			971						Missense_Mutation	SNP	ENST00000372129.2	37	c.2912C>T	CCDS14544.1	.	.	.	.	.	.	.	.	.	.	G	10.87	1.473876	0.26423	.	.	ENSG00000133124	ENST00000372129	T	0.35973	1.28	5.16	4.27	0.50696	.	0.367155	0.25683	N	0.028995	T	0.24586	0.0596	L	0.29908	0.895	0.09310	N	0.999999	B	0.28128	0.201	B	0.22386	0.039	T	0.14448	-1.0472	10	0.42905	T	0.14	-1.6166	9.2734	0.37686	0.0791:0.0:0.7755:0.1454	.	971	O14654	IRS4_HUMAN	L	971	ENSP00000361202:P971L	ENSP00000361202:P971L	P	-	2	0	IRS4	107863319	0.008000	0.16893	0.006000	0.13384	0.194000	0.23727	0.472000	0.22116	1.084000	0.41184	0.600000	0.82982	CCA		0.483	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1	NM_003604		28	268	0	0	0	0.00632	0	28	268				
ALG13	79868	broad.mit.edu	37	X	110987964	110987964	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:110987964C>A	ENST00000394780.3	+	24	2776	c.2764C>A	c.(2764-2766)Cca>Aca	p.P922T	ALG13_ENST00000470971.1_3'UTR|ALG13_ENST00000251943.4_Intron	NM_001099922.2|NM_001257231.1	NP_001093392.1|NP_001244160.1	Q9NP73	ALG13_HUMAN	ALG13, UDP-N-acetylglucosaminyltransferase subunit	922	Pro-rich.				cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|lipid glycosylation (GO:0030259)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)	carbohydrate binding (GO:0030246)|cysteine-type peptidase activity (GO:0008234)|N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase activity (GO:0004577)|poly(A) RNA binding (GO:0044822)	p.P922T(1)		endometrium(2)|lung(10)|skin(1)	13						accaccaccaccaccaccacc	0.517																																							uc011msy.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)	1						c.(2764-2766)CCA>ACA		SubName: Full=Asparagine-linked glycosylation 13 homolog (S. cerevisiae);							41.0	28.0	32.0					X																	110987964		1548	3535	5083	SO:0001583	missense	79868				dolichol-linked oligosaccharide biosynthetic process|lipid glycosylation|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane	carbohydrate binding|N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase activity	g.chrX:110987964C>A	AF220051	CCDS14559.1, CCDS55477.1, CCDS59173.1, CCDS76011.1, CCDS76012.1, CCDS76013.1	Xq23	2014-02-24	2013-02-21	2006-11-07	ENSG00000101901	ENSG00000101901	2.4.1.141	"""Tudor domain containing"", ""OTU domain containing"""	30881	protein-coding gene	gene with protein product	"""tudor domain containing 13"", ""N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase"""	300776	"""glycosyltransferase 28 domain containing 1"", ""chromosome X open reading frame 45"", ""asparagine-linked glycosylation 13 homolog (S. cerevisiae)"""	GLT28D1, CXorf45		12477932	Standard	NM_018466		Approved	MDS031, YGL047W, FLJ23018, TDRD13	uc011msy.2	Q9NP73	OTTHUMG00000022209	ENST00000394780.3:c.2764C>A	X.37:g.110987964C>A	ENSP00000378260:p.Pro922Thr					ALG13_uc011msx.1_Intron|ALG13_uc011msz.1_Missense_Mutation_p.P844T|ALG13_uc011mta.1_Intron|ALG13_uc011mtb.1_Intron	p.P922T			Q9NP73	ALG13_HUMAN			24	2798	+			922			Pro-rich.		B1AKD6|B1AKM1|B2R5L5|B7Z6J0|B7Z804|B7Z847|B7Z9A8|B7ZAJ1|B7ZB57|Q17RC3|Q5JXY9|Q9H5U8	Missense_Mutation	SNP	ENST00000394780.3	37	c.2764C>A	CCDS55477.1	.	.	.	.	.	.	.	.	.	.	c	9.151	1.016347	0.19355	.	.	ENSG00000101901	ENST00000394780	T	0.81330	-1.48	4.69	4.69	0.59074	.	.	.	.	.	T	0.80417	0.4619	L	0.36672	1.1	0.46654	D	0.999148	D;D	0.61080	0.989;0.982	P;P	0.58928	0.848;0.709	T	0.75932	-0.3143	9	0.20046	T	0.44	.	11.9474	0.52936	0.0:1.0:0.0:0.0	.	844;922	Q9NP73-3;Q9NP73	.;ALG13_HUMAN	T	922	ENSP00000378260:P922T	ENSP00000378260:P922T	P	+	1	0	ALG13	110874620	0.001000	0.12720	0.018000	0.16275	0.032000	0.12392	0.669000	0.25142	2.305000	0.77605	0.585000	0.79938	CCA		0.517	ALG13-011	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272895.1	NM_018466		3	7	1	0	0.004672	0.004672	0.00497285	3	7				
TRPC5	7224	broad.mit.edu	37	X	111195495	111195495	+	Missense_Mutation	SNP	G	G	A	rs35024852		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:111195495G>A	ENST00000262839.2	-	2	1072	c.154C>T	c.(154-156)Ctt>Ttt	p.L52F		NM_012471.2	NP_036603.1	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel, subfamily C, member 5	52					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|nervous system development (GO:0007399)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.L52F(1)		biliary_tract(1)|breast(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(38)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						GCCTCCTGAAGGGCCTGCTTC	0.542																																							uc004epl.1		NA																	1	Substitution - Missense(1)		lung(1)	urinary_tract(1)	1						c.(154-156)CTT>TTT		transient receptor potential cation channel,							115.0	91.0	99.0					X																	111195495		2203	4300	6503	SO:0001583	missense	7224				axon guidance	calcium channel complex|integral to plasma membrane	protein binding|store-operated calcium channel activity	g.chrX:111195495G>A	AF054568	CCDS14561.1	Xq23	2014-06-13			ENSG00000072315	ENSG00000072315		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12337	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 159"""	300334				10493832, 16382100	Standard	NM_012471		Approved	PPP1R159	uc004epl.1	Q9UL62	OTTHUMG00000022212	ENST00000262839.2:c.154C>T	X.37:g.111195495G>A	ENSP00000262839:p.Leu52Phe					TRPC5_uc004epm.1_Missense_Mutation_p.L52F	p.L52F	NM_012471	NP_036603	Q9UL62	TRPC5_HUMAN			2	1073	-			52			Cytoplasmic (Potential).|ANK 1.		B2RP53|O75233|Q5JXY8|Q9Y514	Missense_Mutation	SNP	ENST00000262839.2	37	c.154C>T	CCDS14561.1	.	.	.	.	.	.	.	.	.	.	G	18.32	3.598681	0.66332	.	.	ENSG00000072315	ENST00000262839	T	0.72167	-0.63	5.63	4.78	0.61160	Ankyrin repeat-containing domain (3);	0.070624	0.56097	D	0.000023	D	0.84261	0.5433	M	0.90814	3.15	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.84677	0.0715	10	0.87932	D	0	-23.2404	6.3665	0.21457	0.3381:0.0:0.6619:0.0	.	53;52	Q59G51;Q9UL62	.;TRPC5_HUMAN	F	52	ENSP00000262839:L52F	ENSP00000262839:L52F	L	-	1	0	TRPC5	111082151	1.000000	0.71417	0.997000	0.53966	0.982000	0.71751	2.229000	0.42990	1.148000	0.42385	0.600000	0.82982	CTT		0.542	TRPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057945.1	NM_012471		9	130	0	0	0	0.006214	0	9	130				
LRCH2	57631	broad.mit.edu	37	X	114422812	114422812	+	Silent	SNP	C	C	T	rs200518310		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:114422812C>T	ENST00000317135.8	-	2	501	c.471G>A	c.(469-471)caG>caA	p.Q157Q	RBMXL3_ENST00000424776.3_5'Flank|LRCH2_ENST00000538422.1_Silent_p.Q157Q	NM_020871.3	NP_065922.3	Q5VUJ6	LRCH2_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 2	157								p.Q157Q(2)		breast(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	19						ATGTTAACATCTGCAGATTTT	0.289																																							uc010nqe.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(469-471)CAG>CAA		leucine-rich repeats and calponin homology (CH)							39.0	33.0	34.0					X																	114422812		1787	4048	5835	SO:0001819	synonymous_variant	57631							g.chrX:114422812C>T	AB040928	CCDS48155.1, CCDS59175.1	Xq24	2008-02-05			ENSG00000130224	ENSG00000130224			29292	protein-coding gene	gene with protein product						10819331	Standard	NM_020871		Approved	KIAA1495	uc010nqe.3	Q5VUJ6	OTTHUMG00000022233	ENST00000317135.8:c.471G>A	X.37:g.114422812C>T						LRCH2_uc004epz.2_Silent_p.Q157Q|RBMXL3_uc011mte.1_5'Flank	p.Q157Q	NM_020871	NP_065922	Q5VUJ6	LRCH2_HUMAN			2	502	-			157					F5H2T1|Q08AD5|Q9HA88|Q9P233	Silent	SNP	ENST00000317135.8	37	c.471G>A	CCDS48155.1																																																																																				0.289	LRCH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057971.2	NM_020871		4	15	0	0	0	0.009096	0	4	15				
DOCK11	139818	broad.mit.edu	37	X	117677516	117677516	+	Nonsense_Mutation	SNP	A	A	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:117677516A>T	ENST00000276202.7	+	4	415	c.352A>T	c.(352-354)Aag>Tag	p.K118*	DOCK11_ENST00000276204.6_Nonsense_Mutation_p.K118*	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	118	Interaction with activated CDC42. {ECO:0000250}.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.K118*(1)		breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						GGTAAACTACAAGTATGAGGA	0.353																																							uc004eqp.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)	3						c.(352-354)AAG>TAG		dedicator of cytokinesis 11							172.0	151.0	158.0					X																	117677516		2203	4300	6503	SO:0001587	stop_gained	139818				blood coagulation	cytosol	GTP binding	g.chrX:117677516A>T	AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.352A>T	X.37:g.117677516A>T	ENSP00000276202:p.Lys118*						p.K118*	NM_144658	NP_653259	Q5JSL3	DOC11_HUMAN			4	415	+			118			Interaction with activated CDC42 (By similarity).		A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Nonsense_Mutation	SNP	ENST00000276202.7	37	c.352A>T	CCDS35373.1	.	.	.	.	.	.	.	.	.	.	A	38	6.813129	0.97857	.	.	ENSG00000147251	ENST00000276204;ENST00000276202	.	.	.	5.79	5.79	0.91817	.	0.049922	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-22.6531	13.9573	0.64157	1.0:0.0:0.0:0.0	.	.	.	.	X	118	.	ENSP00000276202:K118X	K	+	1	0	DOCK11	117561544	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	6.556000	0.73932	1.941000	0.56285	0.441000	0.28932	AAG		0.353	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000356002.1	NM_144658		28	130	0	0	0	0.008361	0	28	130				
DOCK11	139818	broad.mit.edu	37	X	117742200	117742200	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:117742200T>A	ENST00000276202.7	+	26	2821	c.2758T>A	c.(2758-2760)Ttc>Atc	p.F920I	DOCK11_ENST00000276204.6_Missense_Mutation_p.F920I	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	920					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.F920I(1)		breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						GTAGTATAGCTTCCGACCTGA	0.358																																							uc004eqp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(2758-2760)TTC>ATC		dedicator of cytokinesis 11							60.0	59.0	59.0					X																	117742200		2203	4300	6503	SO:0001583	missense	139818				blood coagulation	cytosol	GTP binding	g.chrX:117742200T>A	AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.2758T>A	X.37:g.117742200T>A	ENSP00000276202:p.Phe920Ile					DOCK11_uc004eqq.2_Missense_Mutation_p.F686I	p.F920I	NM_144658	NP_653259	Q5JSL3	DOC11_HUMAN			26	2821	+			920					A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Missense_Mutation	SNP	ENST00000276202.7	37	c.2758T>A	CCDS35373.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.985366	0.74474	.	.	ENSG00000147251	ENST00000276204;ENST00000276202	T;T	0.03801	3.8;3.8	5.72	4.54	0.55810	.	0.000000	0.85682	D	0.000000	T	0.16300	0.0392	M	0.84683	2.71	0.54753	D	0.999988	P;D	0.55172	0.948;0.97	P;P	0.53006	0.49;0.715	T	0.00662	-1.1621	10	0.56958	D	0.05	-6.7636	11.585	0.50912	0.1356:0.0:0.0:0.8644	.	920;920	A6NIW2;Q5JSL3	.;DOC11_HUMAN	I	920	ENSP00000276204:F920I;ENSP00000276202:F920I	ENSP00000276202:F920I	F	+	1	0	DOCK11	117626228	1.000000	0.71417	1.000000	0.80357	0.581000	0.36288	5.559000	0.67326	0.863000	0.35553	-0.396000	0.06452	TTC		0.358	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000356002.1	NM_144658		9	129	0	0	0	0.008291	0	9	129				
TENM1	10178	broad.mit.edu	37	X	123615651	123615651	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:123615651G>A	ENST00000371130.3	-	21	3922	c.3859C>T	c.(3859-3861)Ctt>Ttt	p.L1287F	TENM1_ENST00000461429.1_5'UTR|TENM1_ENST00000422452.2_Missense_Mutation_p.L1294F	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	1287					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.L1289F(1)									TCAAAGGGAAGGCACTGATCA	0.408																																							uc004euj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						c.(3859-3861)CTT>TTT		odz, odd Oz/ten-m homolog 1 isoform 3							118.0	95.0	103.0					X																	123615651		2203	4300	6503	SO:0001583	missense	10178				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding	g.chrX:123615651G>A	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.3859C>T	X.37:g.123615651G>A	ENSP00000360171:p.Leu1287Phe					ODZ1_uc011muj.1_Missense_Mutation_p.L1293F|ODZ1_uc010nqy.2_Missense_Mutation_p.L1294F	p.L1287F	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN			21	3923	-			1287			Extracellular (Potential).		B2RTR5|Q5JZ17	Missense_Mutation	SNP	ENST00000371130.3	37	c.3859C>T	CCDS14609.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.292352	0.80914	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.87029	-2.2;-2.18	5.1	5.1	0.69264	Six-bladed beta-propeller, TolB-like (1);	0.154798	0.45606	D	0.000358	D	0.90820	0.7117	L	0.60957	1.885	0.58432	D	0.999992	D;P;D	0.71674	0.998;0.949;0.967	P;B;P	0.58077	0.832;0.36;0.547	D	0.91469	0.5195	10	0.56958	D	0.05	.	17.8797	0.88837	0.0:0.0:1.0:0.0	.	1293;1294;1287	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	F	1287;1294	ENSP00000360171:L1287F;ENSP00000403954:L1294F	ENSP00000360171:L1287F	L	-	1	0	ODZ1	123443332	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.441000	0.66569	2.242000	0.73789	0.600000	0.82982	CTT		0.408	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253		10	165	0	0	0	0.000978	0	10	165				
TENM1	10178	broad.mit.edu	37	X	124097540	124097540	+	Silent	SNP	T	T	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:124097540T>C	ENST00000371130.3	-	1	126	c.63A>G	c.(61-63)ctA>ctG	p.L21L	TENM1_ENST00000422452.2_Silent_p.L21L	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	21	Teneurin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00694}.				immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.L21L(1)									TGGTGTAAGCTAGATCCATTT	0.443																																							uc004euj.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						c.(61-63)CTA>CTG		odz, odd Oz/ten-m homolog 1 isoform 3							266.0	237.0	247.0					X																	124097540		2203	4300	6503	SO:0001819	synonymous_variant	10178				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding	g.chrX:124097540T>C	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.63A>G	X.37:g.124097540T>C						ODZ1_uc011muj.1_Silent_p.L21L|ODZ1_uc010nqy.2_Silent_p.L21L	p.L21L	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN			1	127	-			21			Teneurin N-terminal.|Cytoplasmic (Potential).		B2RTR5|Q5JZ17	Silent	SNP	ENST00000371130.3	37	c.63A>G	CCDS14609.1																																																																																				0.443	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253		42	339	0	0	0	0.009718	0	42	339				
DCAF12L2	340578	broad.mit.edu	37	X	125298847	125298847	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:125298847C>A	ENST00000360028.2	-	1	1087	c.1061G>T	c.(1060-1062)cGg>cTg	p.R354L	DCAF12L2_ENST00000538699.1_Missense_Mutation_p.R354L			Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	354								p.R354L(2)		NS(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(36)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(3)	64						GCTCAGCGACCGCACGCCTGT	0.637																																							uc004euk.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(2)|skin(2)|large_intestine(1)|pancreas(1)|ovary(1)	7						c.(1060-1062)CGG>CTG		DDB1 and CUL4 associated factor 12-like 2							48.0	52.0	50.0					X																	125298847		2203	4300	6503	SO:0001583	missense	340578							g.chrX:125298847C>A	AL445072	CCDS43991.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198354	ENSG00000198354		"""WD repeat domain containing"""	32950	protein-coding gene	gene with protein product			"""WD repeat domain 40C"""	WDR40C			Standard	NM_001013628		Approved		uc004euk.2	Q5VW00	OTTHUMG00000022348	ENST00000360028.2:c.1061G>T	X.37:g.125298847C>A	ENSP00000353128:p.Arg354Leu						p.R354L	NM_001013628	NP_001013650	Q5VW00	DC122_HUMAN			1	1088	-			354			WD 4.		B2RN42	Missense_Mutation	SNP	ENST00000360028.2	37	c.1061G>T	CCDS43991.1	.	.	.	.	.	.	.	.	.	.	C	12.16	1.854061	0.32791	.	.	ENSG00000198354	ENST00000538699;ENST00000360028	T;T	0.62788	-0.0;-0.0	4.05	3.18	0.36537	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.36591	N	0.002511	T	0.58090	0.2098	M	0.84082	2.675	0.43787	D	0.996323	P	0.48407	0.91	B	0.38056	0.264	T	0.59553	-0.7433	10	0.31617	T	0.26	.	8.8156	0.34993	0.0:0.8841:0.0:0.1159	.	354	Q5VW00	DC122_HUMAN	L	354	ENSP00000441489:R354L;ENSP00000353128:R354L	ENSP00000353128:R354L	R	-	2	0	DCAF12L2	125126528	0.996000	0.38824	0.895000	0.35142	0.136000	0.21042	3.447000	0.52936	1.051000	0.40369	0.544000	0.68410	CGG		0.637	DCAF12L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058181.1	NM_001013628		43	85	1	0	1.57945e-13	0.002852	2.33593e-13	43	85				
XPNPEP2	7512	broad.mit.edu	37	X	128901653	128901653	+	Silent	SNP	G	G	A	rs200683833		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:128901653G>A	ENST00000371106.3	+	20	2007	c.1815G>A	c.(1813-1815)ctG>ctA	p.L605L		NM_003399.5	NP_003390.4	O43895	XPP2_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound	605						anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)	p.L605L(1)		endometrium(3)|kidney(3)|large_intestine(5)|liver(1)|lung(20)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	37						ATGTCAGCCTGCTGTCTCCCG	0.587													G|||	1	0.000264901	0.0	0.0	3775	,	,		15349	0.001		0.0	False		,,,				2504	0.0						uc004eut.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1813-1815)CTG>CTA		X-prolyl aminopeptidase 2, membrane-bound							247.0	165.0	193.0					X																	128901653		2203	4300	6503	SO:0001819	synonymous_variant	7512				cellular process|proteolysis	anchored to membrane|plasma membrane	aminopeptidase activity|metal ion binding|metalloexopeptidase activity	g.chrX:128901653G>A	U90724	CCDS14613.1	Xq25	2008-02-05			ENSG00000122121	ENSG00000122121	3.4.11.9		12823	protein-coding gene	gene with protein product		300145				9375790, 9628831	Standard	NM_003399		Approved		uc004eut.1	O43895	OTTHUMG00000022373	ENST00000371106.3:c.1815G>A	X.37:g.128901653G>A							p.L605L	NM_003399	NP_003390	O43895	XPP2_HUMAN			20	2059	+			605					A0AV16|O75994	Silent	SNP	ENST00000371106.3	37	c.1815G>A	CCDS14613.1																																																																																				0.587	XPNPEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058210.1	NM_003399		6	173	0	0	0	0.001984	0	6	173				
UTP14A	10813	broad.mit.edu	37	X	129054695	129054695	+	Silent	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:129054695G>A	ENST00000394422.3	+	10	949	c.921G>A	c.(919-921)aaG>aaA	p.K307K	UTP14A_ENST00000371051.5_Silent_p.K253K|UTP14A_ENST00000425117.2_Silent_p.K255K|UTP14A_ENST00000498179.1_3'UTR|RP4-537K23.4_ENST00000432062.1_RNA|UTP14A_ENST00000371042.3_Silent_p.K139K	NM_006649.3	NP_006640.2	Q9BVJ6	UT14A_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)	307					rRNA processing (GO:0006364)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)	p.K307K(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(16)|ovary(3)|urinary_tract(1)	32						AATGGGCCAAGTCAAAGGCAA	0.458																																							uc004euz.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(919-921)AAG>AAA		UTP14, U3 small nucleolar ribonucleoprotein,							108.0	102.0	104.0					X																	129054695		2203	4300	6503	SO:0001819	synonymous_variant	10813				rRNA processing	nucleolus|small-subunit processome	protein binding	g.chrX:129054695G>A	AF039694	CCDS14615.1, CCDS55489.1	Xq26.1	2009-01-15	2004-06-01	2004-06-01	ENSG00000156697	ENSG00000156697			10665	protein-coding gene	gene with protein product		300508	"""serologically defined colon cancer antigen 16"""	SDCCAG16		9610721, 16354793	Standard	NM_006649		Approved	NY-CO-16	uc004euz.3	Q9BVJ6	OTTHUMG00000022378	ENST00000394422.3:c.921G>A	X.37:g.129054695G>A						UTP14A_uc011mup.1_Silent_p.K255K|UTP14A_uc011muq.1_Silent_p.K253K|UTP14A_uc004eva.1_Silent_p.K13K	p.K307K	NM_006649	NP_006640	Q9BVJ6	UT14A_HUMAN			10	949	+			307					A8K7A3|A8MVQ1|B4DQ08|E9PEL7|Q5JYF1	Silent	SNP	ENST00000394422.3	37	c.921G>A	CCDS14615.1																																																																																				0.458	UTP14A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058221.1	NM_006649		13	166	0	0	0	0.00245	0	13	166				
ENOX2	10495	broad.mit.edu	37	X	129771317	129771317	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:129771317G>T	ENST00000370927.1	-	9	1305	c.1284C>A	c.(1282-1284)taC>taA	p.Y428*	ENOX2_ENST00000370935.1_Nonsense_Mutation_p.Y399*|ENOX2_ENST00000338144.3_Nonsense_Mutation_p.Y428*|ENOX2_ENST00000394363.1_Nonsense_Mutation_p.Y399*			Q16206	ENOX2_HUMAN	ecto-NOX disulfide-thiol exchanger 2	428					cell growth (GO:0016049)|oxidation-reduction process (GO:0055114)|regulation of growth (GO:0040008)|ultradian rhythm (GO:0007624)	cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)	nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|protein disulfide oxidoreductase activity (GO:0015035)	p.Y428*(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(3)	33						CTTCATTCCGGTAGGCATCGA	0.443																																					Ovarian(101;828 1506 2951 9500 35258)	Ovarian(101;828 1506 2951 9500 35258)	uc004evw.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(1282-1284)TAC>TAA		ecto-NOX disulfide-thiol exchanger 2 isoform b							272.0	213.0	233.0					X																	129771317		2203	4300	6503	SO:0001587	stop_gained	10495				cell growth|electron transport chain|regulation of growth|transport|ultradian rhythm	cytosol|external side of plasma membrane|extracellular space	nucleic acid binding|nucleotide binding|protein disulfide oxidoreductase activity	g.chrX:129771317G>T	AF207881	CCDS14626.1, CCDS14627.1	Xq25	2013-02-12	2007-03-23	2007-03-23	ENSG00000165675	ENSG00000165675		"""RNA binding motif (RRM) containing"""	2259	protein-coding gene	gene with protein product		300282	"""cytosolic ovarian carcinoma antigen 1"""	COVA1		8150545, 11888291	Standard	NM_006375		Approved	APK1, tNOX	uc004evw.3	Q16206	OTTHUMG00000022401	ENST00000370927.1:c.1284C>A	X.37:g.129771317G>T	ENSP00000359965:p.Tyr428*					ENOX2_uc004evx.2_Nonsense_Mutation_p.Y399*|ENOX2_uc004evy.2_Nonsense_Mutation_p.Y399*|ENOX2_uc004evv.2_Nonsense_Mutation_p.Y253*	p.Y428*	NM_182314	NP_872114	Q16206	ENOX2_HUMAN			12	1702	-			428			Potential.		A8K197|A8K1C2|Q5VTJ1|Q5VTJ2|Q8WUX0|Q9NTP6|Q9UH82	Nonsense_Mutation	SNP	ENST00000370927.1	37	c.1284C>A	CCDS14626.1	.	.	.	.	.	.	.	.	.	.	G	34	5.293122	0.95546	.	.	ENSG00000165675	ENST00000538435;ENST00000370935;ENST00000338144;ENST00000394363;ENST00000350369;ENST00000370927	.	.	.	5.09	-2.97	0.05530	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-10.9496	14.3098	0.66407	0.2099:0.0:0.7901:0.0	.	.	.	.	X	399;399;428;399;456;428	.	.	Y	-	3	2	ENOX2	129598998	1.000000	0.71417	0.984000	0.44739	0.994000	0.84299	1.428000	0.34892	-0.565000	0.06061	-0.191000	0.12829	TAC		0.443	ENOX2-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058277.1	NM_182314		37	299	1	0	1.57351e-24	0.003755	2.63189e-24	37	299				
USP26	83844	broad.mit.edu	37	X	132162134	132162134	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:132162134C>A	ENST00000511190.1	-	6	584	c.115G>T	c.(115-117)Gtg>Ttg	p.V39L	USP26_ENST00000370832.1_Missense_Mutation_p.V39L|USP26_ENST00000406273.1_Missense_Mutation_p.V39L	NM_031907.1	NP_114113.1	Q9BXU7	UBP26_HUMAN	ubiquitin specific peptidase 26	39					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)	p.V39L(1)		breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(11)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	60	Acute lymphoblastic leukemia(192;0.000127)					AAATACAGCACCAGTCTATCT	0.368																																					NSCLC(104;342 1621 36940 47097 52632)	NSCLC(104;342 1621 36940 47097 52632)	uc010nrm.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|central_nervous_system(3)|kidney(1)|liver(1)	8						c.(115-117)GTG>TTG		ubiquitin-specific protease 26							66.0	66.0	66.0					X																	132162134		2203	4296	6499	SO:0001583	missense	83844				protein deubiquitination|ubiquitin-dependent protein catabolic process	nucleus	cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity	g.chrX:132162134C>A	AF285593	CCDS14635.1	Xq26.2	2012-07-13	2005-08-08		ENSG00000134588	ENSG00000134588	3.4.19.12	"""Ubiquitin-specific peptidases"""	13485	protein-coding gene	gene with protein product		300309	"""ubiquitin specific protease 26"""			12838346	Standard	NM_031907		Approved		uc011mvf.2	Q9BXU7	OTTHUMG00000022429	ENST00000511190.1:c.115G>T	X.37:g.132162134C>A	ENSP00000423390:p.Val39Leu					USP26_uc011mvf.1_Missense_Mutation_p.V39L	p.V39L	NM_031907	NP_114113	Q9BXU7	UBP26_HUMAN			6	585	-	Acute lymphoblastic leukemia(192;0.000127)		39					B9WRT6|Q5H9H4	Missense_Mutation	SNP	ENST00000511190.1	37	c.115G>T	CCDS14635.1	.	.	.	.	.	.	.	.	.	.	C	11.40	1.626491	0.28978	.	.	ENSG00000134588	ENST00000370832;ENST00000511190;ENST00000406273	T;T;T	0.57752	0.38;0.38;0.38	4.28	-0.895	0.10560	.	1.203510	0.06420	N	0.722157	T	0.47358	0.1441	M	0.76328	2.33	0.09310	N	1	P	0.36683	0.565	B	0.36092	0.217	T	0.38286	-0.9668	10	0.42905	T	0.14	-1.3631	1.3415	0.02155	0.1642:0.3305:0.3176:0.1877	.	39	Q9BXU7	UBP26_HUMAN	L	39	ENSP00000359869:V39L;ENSP00000423390:V39L;ENSP00000384360:V39L	ENSP00000359869:V39L	V	-	1	0	USP26	131989800	0.005000	0.15991	0.000000	0.03702	0.004000	0.04260	-0.062000	0.11674	-0.338000	0.08413	0.600000	0.82982	GTG		0.368	USP26-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359441.1	NM_031907		18	132	1	0	1.99824e-07	0.00499	2.5465e-07	18	132				
GPC4	2239	broad.mit.edu	37	X	132548853	132548853	+	Silent	SNP	G	G	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:132548853G>A	ENST00000370828.3	-	1	665	c.141C>T	c.(139-141)gcC>gcT	p.A47A	GPC4_ENST00000535467.1_5'Flank	NM_001448.2	NP_001439.2	O75487	GPC4_HUMAN	glypican 4	47					anatomical structure morphogenesis (GO:0009653)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.A47A(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(16)|skin(1)|upper_aerodigestive_tract(1)	28	Acute lymphoblastic leukemia(192;0.000127)					CGTGGAGGGGGGCATCGTTCT	0.637																																							uc004exc.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(139-141)GCC>GCT		glypican 4 precursor							86.0	79.0	81.0					X																	132548853		2203	4300	6503	SO:0001819	synonymous_variant	2239				anatomical structure morphogenesis|cell proliferation	anchored to membrane|external side of plasma membrane|extracellular space|insoluble fraction|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding	g.chrX:132548853G>A	AF030186	CCDS14637.1	Xq26.1	2008-02-05			ENSG00000076716	ENSG00000076716		"""Proteoglycans / Cell Surface : Glypicans"""	4452	protein-coding gene	gene with protein product	"""glypican proteoglycan 4"""	300168				9787072	Standard	NM_001448		Approved	K-glypican	uc004exc.1	O75487	OTTHUMG00000022434	ENST00000370828.3:c.141C>T	X.37:g.132548853G>A						GPC4_uc011mvg.1_5'Flank	p.A47A	NM_001448	NP_001439	O75487	GPC4_HUMAN			1	353	-	Acute lymphoblastic leukemia(192;0.000127)		47					B2R6J7|B4E2C0|Q6ZMA6|Q96L43|Q9NU08|Q9UJN1|Q9UPD9	Silent	SNP	ENST00000370828.3	37	c.141C>T	CCDS14637.1																																																																																				0.637	GPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058338.1	NM_001448		13	188	0	0	0	0.003163	0	13	188				
GPR112	139378	broad.mit.edu	37	X	135430448	135430448	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:135430448T>A	ENST00000394143.1	+	6	4874	c.4583T>A	c.(4582-4584)gTt>gAt	p.V1528D	GPR112_ENST00000412101.1_Missense_Mutation_p.V1323D|GPR112_ENST00000287534.4_Missense_Mutation_p.V1465D|GPR112_ENST00000394141.1_Missense_Mutation_p.V1323D|GPR112_ENST00000370652.1_Missense_Mutation_p.V1528D	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	1528					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.V1528D(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					TCCAAAAAAGTTTCTGACACT	0.433																																							uc004ezu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12						c.(4582-4584)GTT>GAT		G-protein coupled receptor 112							80.0	78.0	79.0					X																	135430448		2203	4299	6502	SO:0001583	missense	139378				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chrX:135430448T>A	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.4583T>A	X.37:g.135430448T>A	ENSP00000377699:p.Val1528Asp					GPR112_uc010nsb.1_Missense_Mutation_p.V1323D|GPR112_uc010nsc.1_Missense_Mutation_p.V1295D	p.V1528D	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN			6	4874	+	Acute lymphoblastic leukemia(192;0.000127)		1528			Extracellular (Potential).		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	37	c.4583T>A	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	t	13.42	2.231488	0.39399	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.42131	1.01;1.01;0.98;1.09;0.98	3.02	3.02	0.34903	.	.	.	.	.	T	0.47820	0.1466	L	0.32530	0.975	0.09310	N	1	D;D;D	0.71674	0.998;0.998;0.997	D;D;P	0.66351	0.943;0.943;0.879	T	0.22312	-1.0220	9	0.72032	D	0.01	.	7.4801	0.27400	0.0:0.0:0.0:1.0	.	1465;1323;1528	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	D	1528;1528;1323;1465;1323	ENSP00000377699:V1528D;ENSP00000359686:V1528D;ENSP00000416526:V1323D;ENSP00000287534:V1465D;ENSP00000377697:V1323D	ENSP00000287534:V1465D	V	+	2	0	GPR112	135258114	0.226000	0.23696	0.008000	0.14137	0.017000	0.09413	0.462000	0.21956	1.195000	0.43115	0.378000	0.23410	GTT		0.433	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1			10	195	0	0	0	0.006214	0	10	195				
GPR112	139378	broad.mit.edu	37	X	135430861	135430861	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:135430861G>T	ENST00000394143.1	+	6	5287	c.4996G>T	c.(4996-4998)Ggg>Tgg	p.G1666W	GPR112_ENST00000412101.1_Missense_Mutation_p.G1461W|GPR112_ENST00000287534.4_Missense_Mutation_p.G1603W|GPR112_ENST00000394141.1_Missense_Mutation_p.G1461W|GPR112_ENST00000370652.1_Missense_Mutation_p.G1666W	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	1666					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.G1666W(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					CATTATGGCTGGGATAGTGAC	0.473																																							uc004ezu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12						c.(4996-4998)GGG>TGG		G-protein coupled receptor 112							153.0	152.0	152.0					X																	135430861		2203	4300	6503	SO:0001583	missense	139378				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chrX:135430861G>T	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.4996G>T	X.37:g.135430861G>T	ENSP00000377699:p.Gly1666Trp					GPR112_uc010nsb.1_Missense_Mutation_p.G1461W|GPR112_uc010nsc.1_Missense_Mutation_p.G1433W	p.G1666W	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN			6	5287	+	Acute lymphoblastic leukemia(192;0.000127)		1666			Extracellular (Potential).		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	37	c.4996G>T	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	g	16.69	3.193189	0.58017	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.55760	0.54;0.54;0.5;0.59;0.5	3.39	1.33	0.21861	.	.	.	.	.	T	0.55178	0.1904	L	0.34521	1.04	0.09310	N	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.83275	0.996;0.993;0.985	T	0.39840	-0.9594	9	0.87932	D	0	.	3.2239	0.06725	0.1536:0.0:0.5898:0.2566	.	1603;1461;1666	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	W	1666;1666;1461;1603;1461	ENSP00000377699:G1666W;ENSP00000359686:G1666W;ENSP00000416526:G1461W;ENSP00000287534:G1603W;ENSP00000377697:G1461W	ENSP00000287534:G1603W	G	+	1	0	GPR112	135258527	0.453000	0.25721	0.001000	0.08648	0.785000	0.44390	0.945000	0.29056	0.409000	0.25649	0.425000	0.28330	GGG		0.473	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1			45	345	1	0	1.32667e-27	0.00361	2.25253e-27	45	345				
GPR112	139378	broad.mit.edu	37	X	135445641	135445641	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:135445641T>A	ENST00000394143.1	+	13	7574	c.7283T>A	c.(7282-7284)aTc>aAc	p.I2428N	GPR112_ENST00000412101.1_Missense_Mutation_p.I2223N|GPR112_ENST00000287534.4_Missense_Mutation_p.I2226N|GPR112_ENST00000394141.1_Missense_Mutation_p.I2223N|GPR112_ENST00000370652.1_Missense_Mutation_p.I2428N	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	2428					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.I2428N(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					TTCAGTTCAATCAGCATCAAC	0.403																																							uc004ezu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12						c.(7282-7284)ATC>AAC		G-protein coupled receptor 112							105.0	93.0	97.0					X																	135445641		2203	4300	6503	SO:0001583	missense	139378				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chrX:135445641T>A	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.7283T>A	X.37:g.135445641T>A	ENSP00000377699:p.Ile2428Asn					GPR112_uc010nsb.1_Missense_Mutation_p.I2223N	p.I2428N	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN			13	7574	+	Acute lymphoblastic leukemia(192;0.000127)		2428			Extracellular (Potential).		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	37	c.7283T>A	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	T	14.40	2.523027	0.44866	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.30182	1.58;1.58;1.54;1.7;1.54	5.67	5.67	0.87782	.	.	.	.	.	T	0.27765	0.0683	N	0.19112	0.55	0.18873	N	0.999982	P;B	0.46064	0.872;0.393	P;B	0.46796	0.527;0.271	T	0.13737	-1.0498	9	0.72032	D	0.01	.	11.1109	0.48232	0.0:0.0:0.0:1.0	.	2223;2428	Q8IZF6-3;Q8IZF6	.;GP112_HUMAN	N	2428;2428;2223;2226;2223	ENSP00000377699:I2428N;ENSP00000359686:I2428N;ENSP00000416526:I2223N;ENSP00000287534:I2226N;ENSP00000377697:I2223N	ENSP00000287534:I2226N	I	+	2	0	GPR112	135273307	0.927000	0.31430	0.991000	0.47740	0.932000	0.56968	2.574000	0.46016	1.895000	0.54865	0.486000	0.48141	ATC		0.403	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1			14	109	0	0	0	0.003163	0	14	109				
HAUS7	55559	broad.mit.edu	37	X	152734677	152734677	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:152734677G>T	ENST00000370211.4	-	2	224	c.181C>A	c.(181-183)Cca>Aca	p.P61T	HAUS7_ENST00000421080.2_5'UTR|HAUS7_ENST00000370210.1_Missense_Mutation_p.P51T|TREX2_ENST00000338525.2_5'UTR|TREX2_ENST00000370232.1_5'UTR|HAUS7_ENST00000370212.3_Missense_Mutation_p.P61T|TREX2_ENST00000334497.2_5'UTR|TREX2_ENST00000330912.2_5'UTR	NM_017518.7	NP_059988.3	Q99871	HAUS7_HUMAN	HAUS augmin-like complex, subunit 7	61					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	thioesterase binding (GO:0031996)	p.P61T(1)		endometrium(1)|kidney(3)|large_intestine(1)|lung(10)|prostate(1)|skin(3)	19						ATTGTCTTTGGCTCTGTGATA	0.478																																							uc004fho.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(181-183)CCA>ACA		HAUS augmin-like complex subunit 7							169.0	145.0	153.0					X																	152734677		2203	4300	6503	SO:0001583	missense	55559				cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|nucleolus|plasma membrane|spindle	thioesterase binding	g.chrX:152734677G>T	AF267739	CCDS35438.1	Xq28	2011-10-24	2009-04-20	2009-04-20		ENSG00000213397		"""HAUS augmin-like complex subunits"""	32979	protein-coding gene	gene with protein product	"""UCH37 interacting protein 1"", ""26S proteasome-associated UCH interacting protein 1"""	300540	"""UCHL5 interacting protein"""	UCHL5IP		11163772, 16395595, 19427217	Standard	NM_017518		Approved	UIP1	uc004fho.2	Q99871		ENST00000370211.4:c.181C>A	X.37:g.152734677G>T	ENSP00000359230:p.Pro61Thr					HAUS7_uc004fhl.2_RNA|HAUS7_uc004fhm.2_RNA|HAUS7_uc004fhn.1_Missense_Mutation_p.P61T|HAUS7_uc004fhp.1_RNA|HAUS7_uc011myq.1_RNA	p.P61T	NM_017518	NP_059988	Q99871	HAUS7_HUMAN			2	739	-			61					B4DUH6|D3DWT9|Q96HS8|Q9NP54|Q9UFH9	Missense_Mutation	SNP	ENST00000370211.4	37	c.181C>A	CCDS35438.1	.	.	.	.	.	.	.	.	.	.	G	15.92	2.976451	0.53720	.	.	ENSG00000213397	ENST00000370211;ENST00000370219;ENST00000370212;ENST00000453918;ENST00000370210	T;T;T;T	0.77229	-1.08;-1.08;-1.08;-1.08	4.96	4.96	0.65561	.	0.224858	0.37393	N	0.002103	D	0.86130	0.5859	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.983	D	0.87048	0.2145	10	0.62326	D	0.03	-14.9653	12.2717	0.54710	0.0:0.0:1.0:0.0	.	61;61	Q99871;Q99871-2	HAUS7_HUMAN;.	T	51;61;61;120;51	ENSP00000359230:P51T;ENSP00000359239:P61T;ENSP00000359231:P61T;ENSP00000359229:P51T	ENSP00000359229:P51T	P	-	1	0	HAUS7	152387871	0.945000	0.32115	0.056000	0.19401	0.896000	0.52359	4.153000	0.58118	2.287000	0.76781	0.600000	0.82982	CCA		0.478	HAUS7-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060963.2	NM_017518		18	167	1	0	2.35188e-11	0.006122	3.321e-11	18	167				
BGN	633	broad.mit.edu	37	X	152770113	152770114	+	Missense_Mutation	DNP	GT	GT	TA			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	GT	GT	-	-	GT	GT	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:152770113_152770114GT>TA	ENST00000331595.4	+	2	210_211	c.24_25GT>TA	c.(22-27)gtGTct>gtTAct	p.S9T	BGN_ENST00000480756.1_3'UTR	NM_001711.4	NP_001702.1	P21810	PGS1_HUMAN	biglycan	9					blood vessel remodeling (GO:0001974)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|small molecule metabolic process (GO:0044281)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|transport vesicle (GO:0030133)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|glycosaminoglycan binding (GO:0005539)	p.S9T(1)		breast(2)|endometrium(3)|large_intestine(1)|lung(9)|ovary(1)	16	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GGCGCCTCGTGTCTCTGCTGGC	0.629																																							uc004fhr.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)	2						c.(22-27)GTGTCT>GTTACT		biglycan preproprotein																																				SO:0001583	missense	633					proteinaceous extracellular matrix|transport vesicle	extracellular matrix structural constituent	g.chrX:152770113_152770114GT>TA	AK092954	CCDS14721.1	Xq28	2008-02-05			ENSG00000182492	ENSG00000182492		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	1044	protein-coding gene	gene with protein product	"""biglycan proteoglycan"""	301870				1612609	Standard	NM_001711		Approved	DSPG1, SLRR1A	uc004fhr.2	P21810	OTTHUMG00000024205	Exception_encountered	X.37:g.152770113_152770114delinsTA	ENSP00000327336:p.Ser9Thr					BGN_uc004fhq.1_RNA	p.S9T	NM_001711	NP_001702	P21810	PGS1_HUMAN			2	196_197	+	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		9					D3DWU3|P13247	Missense_Mutation	DNP	ENST00000331595.4	37	c.24_25GT>TA	CCDS14721.1																																																																																				0.629	BGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060981.1	NM_001711		24	42	0	0	0	0.004672	0	24	42				
ATP2B3	492	broad.mit.edu	37	X	152806953	152806953	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:152806953G>T	ENST00000349466.2	+	3	671	c.345G>T	c.(343-345)gaG>gaT	p.E115D	ATP2B3_ENST00000393842.1_Missense_Mutation_p.E115D|ATP2B3_ENST00000359149.3_Missense_Mutation_p.E115D|ATP2B3_ENST00000263519.4_Missense_Mutation_p.E115D|ATP2B3_ENST00000370186.1_Missense_Mutation_p.E115D|ATP2B3_ENST00000370181.2_Missense_Mutation_p.E115D			Q16720	AT2B3_HUMAN	ATPase, Ca++ transporting, plasma membrane 3	115					blood coagulation (GO:0007596)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)	p.E115D(4)		NS(2)|breast(5)|endometrium(7)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(3)	50	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TCATCCTGGAGGTGGCTGCCA	0.622																																							uc004fht.1		NA																	4	Substitution - Missense(4)		lung(4)	pancreas(1)	1						c.(343-345)GAG>GAT		plasma membrane calcium ATPase 3 isoform 3b							136.0	108.0	118.0					X																	152806953		2203	4300	6503	SO:0001583	missense	492				ATP biosynthetic process|platelet activation	integral to membrane|plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding	g.chrX:152806953G>T	U60414	CCDS14722.1, CCDS35440.1	Xq28	2014-07-18			ENSG00000067842	ENSG00000067842	3.6.3.8	"""ATPases / P-type"""	816	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 3"", ""cilia and flagella associated protein 39"""	300014	"""spinocerebellar ataxia, X-linked 1"", ""cerebellar ataxia 2 (X-linked)"""	SCAX1, CLA2		8187550, 22912398	Standard	NM_021949		Approved	PMCA3, CFAP39	uc004fht.1	Q16720	OTTHUMG00000024202	ENST00000349466.2:c.345G>T	X.37:g.152806953G>T	ENSP00000343886:p.Glu115Asp					ATP2B3_uc004fhs.1_Missense_Mutation_p.E115D	p.E115D	NM_001001344	NP_001001344	Q16720	AT2B3_HUMAN			2	471	+	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		115			Helical; (Potential).		B7WNR8|B7WNY5|Q12995|Q16858	Missense_Mutation	SNP	ENST00000349466.2	37	c.345G>T	CCDS35440.1	.	.	.	.	.	.	.	.	.	.	G	19.02	3.745453	0.69418	.	.	ENSG00000067842	ENST00000370186;ENST00000349466;ENST00000393842;ENST00000359149;ENST00000263519;ENST00000370181	T;T;T;T;T;T	0.79247	-1.25;-1.25;-1.25;-1.25;-1.25;-1.25	5.69	2.98	0.34508	ATPase, P-type cation-transporter, N-terminal (2);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.056172	0.64402	D	0.000002	D	0.86410	0.5926	M	0.89968	3.075	0.38011	D	0.934525	D;D	0.56968	0.978;0.973	P;P	0.62184	0.899;0.837	D	0.86091	0.1550	10	0.62326	D	0.03	-14.1093	6.375	0.21503	0.4523:0.0:0.5477:0.0	.	115;115	Q16720;Q16720-2	AT2B3_HUMAN;.	D	115	ENSP00000359205:E115D;ENSP00000343886:E115D;ENSP00000377425:E115D;ENSP00000352062:E115D;ENSP00000263519:E115D;ENSP00000359200:E115D	ENSP00000263519:E115D	E	+	3	2	ATP2B3	152460147	0.998000	0.40836	1.000000	0.80357	0.989000	0.77384	0.491000	0.22419	0.569000	0.29329	0.600000	0.82982	GAG		0.622	ATP2B3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060957.1	NM_021949		20	45	1	0	2.89027e-11	0.002299	4.04062e-11	20	45				
IDH3G	3421	broad.mit.edu	37	X	153051701	153051701	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:153051701C>A	ENST00000217901.5	-	12	1242	c.1046G>T	c.(1045-1047)cGt>cTt	p.R349L	IDH3G_ENST00000370092.3_Missense_Mutation_p.R349L|IDH3G_ENST00000427365.2_Missense_Mutation_p.R291L|IDH3G_ENST00000370093.1_3'UTR|IDH3G_ENST00000497043.1_5'Flank	NM_004135.3	NP_004126.1	P51553	IDH3G_HUMAN	isocitrate dehydrogenase 3 (NAD+) gamma	349					carbohydrate metabolic process (GO:0005975)|cellular metabolic process (GO:0044237)|isocitrate metabolic process (GO:0006102)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|isocitrate dehydrogenase (NAD+) activity (GO:0004449)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)	p.R349L(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|prostate(1)	17	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					GACAGCCTTACGGATGGAGGT	0.662																																							uc004fip.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1045-1047)CGT>CTT		isocitrate dehydrogenase 3 (NAD+) gamma isoform	NADH(DB00157)						89.0	75.0	80.0					X																	153051701		2202	4300	6502	SO:0001583	missense	3421				carbohydrate metabolic process|isocitrate metabolic process|tricarboxylic acid cycle	mitochondrial matrix|nucleolus	ATP binding|isocitrate dehydrogenase (NAD+) activity|magnesium ion binding|NAD binding	g.chrX:153051701C>A		CCDS14730.1, CCDS44019.1	Xq28	2008-02-05			ENSG00000067829	ENSG00000067829	1.1.1.41		5386	protein-coding gene	gene with protein product		300089				9286695	Standard	NM_004135		Approved		uc004fip.4	P51553	OTTHUMG00000024219	ENST00000217901.5:c.1046G>T	X.37:g.153051701C>A	ENSP00000217901:p.Arg349Leu					IDH3G_uc004fio.2_Missense_Mutation_p.R291L|IDH3G_uc004fiq.2_Missense_Mutation_p.R349L|IDH3G_uc010num.2_Missense_Mutation_p.R291L|IDH3G_uc004fir.2_Missense_Mutation_p.R291L|IDH3G_uc004fit.1_3'UTR|IDH3G_uc004fis.2_Missense_Mutation_p.R291L|IDH3G_uc004fiu.2_Missense_Mutation_p.R125L	p.R349L	NM_004135	NP_004126	P51553	IDH3G_HUMAN			12	1232	-	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)		349					E9PDD5|Q9BUU5	Missense_Mutation	SNP	ENST00000217901.5	37	c.1046G>T	CCDS14730.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	17.26|17.26	3.344983|3.344983	0.61073|0.61073	.|.	.|.	ENSG00000067829|ENSG00000067829	ENST00000370092;ENST00000217901;ENST00000427365;ENST00000393771|ENST00000424541	T;T;T|.	0.68181|.	-0.31;-0.31;-0.31|.	5.46|5.46	4.59|4.59	0.56863|0.56863	Isopropylmalate dehydrogenase-like domain (2);|.	0.115150|.	0.64402|.	D|.	0.000012|.	T|T	0.71600|0.71600	0.3359|0.3359	M|M	0.75884|0.75884	2.315|2.315	0.45791|0.45791	D|D	0.998679|0.998679	B;D;P|.	0.54397|.	0.265;0.966;0.929|.	B;P;P|.	0.54590|.	0.266;0.672;0.756|.	T|T	0.72276|0.72276	-0.4341|-0.4341	10|5	0.54805|.	T|.	0.06|.	.|.	10.9737|10.9737	0.47454|0.47454	0.0:0.9069:0.0:0.0931|0.0:0.9069:0.0:0.0931	.|.	245;349;349|.	E9PCL6;E9PDD5;P51553|.	.;.;IDH3G_HUMAN|.	L|L	349;349;291;245|111	ENSP00000359110:R349L;ENSP00000217901:R349L;ENSP00000408529:R291L|.	ENSP00000217901:R349L|.	R|V	-|-	2|1	0|0	IDH3G|IDH3G	152704895|152704895	0.993000|0.993000	0.37304|0.37304	1.000000|1.000000	0.80357|0.80357	0.384000|0.384000	0.30261|0.30261	2.654000|2.654000	0.46699|0.46699	2.285000|2.285000	0.76669|0.76669	0.431000|0.431000	0.28591|0.28591	CGT|GTA		0.662	IDH3G-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061084.27			14	130	1	0	0.000308642	0.003163	0.00034145	14	130				
L1CAM	3897	broad.mit.edu	37	X	153128312	153128312	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:153128312A>T	ENST00000370060.1	-	29	3769	c.3580T>A	c.(3580-3582)Tcg>Acg	p.S1194T	L1CAM_ENST00000361981.3_Missense_Mutation_p.S1185T|L1CAM_ENST00000543994.1_Missense_Mutation_p.S1196T|L1CAM_ENST00000370057.3_Missense_Mutation_p.S1194T|L1CAM_ENST00000361699.4_Missense_Mutation_p.S1190T|L1CAM_ENST00000370055.1_Missense_Mutation_p.S1185T|L1CAM_ENST00000538883.1_Missense_Mutation_p.S1192T	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	1194			S -> L (in HSAS and MASA). {ECO:0000269|PubMed:7881431, ECO:0000269|PubMed:8556302}.		axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)	p.S1194T(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CCGTTGAGCGATGGCTGGCTG	0.622																																							uc004fjb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|central_nervous_system(1)	9						c.(3580-3582)TCG>ACG		L1 cell adhesion molecule isoform 1 precursor							61.0	45.0	50.0					X																	153128312		2203	4300	6503	SO:0001583	missense	3897				axon guidance|blood coagulation|cell death|leukocyte migration	integral to membrane		g.chrX:153128312A>T	M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.3580T>A	X.37:g.153128312A>T	ENSP00000359077:p.Ser1194Thr					L1CAM_uc004fjc.2_Missense_Mutation_p.S1190T|L1CAM_uc010nuo.2_Missense_Mutation_p.S1185T	p.S1194T	NM_000425	NP_000416	P32004	L1CAM_HUMAN			28	3688	-	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		1194		S -> L (in HSAS and MASA).	Cytoplasmic (Potential).		A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Missense_Mutation	SNP	ENST00000370060.1	37	c.3580T>A	CCDS14733.1	.	.	.	.	.	.	.	.	.	.	A	15.66	2.899487	0.52227	.	.	ENSG00000198910	ENST00000370060;ENST00000543994;ENST00000370057;ENST00000538883;ENST00000361981;ENST00000370055;ENST00000370058;ENST00000361699	D;D;D;D;D;D;D;D	0.87179	-2.22;-2.22;-2.22;-2.22;-2.22;-2.22;-2.22;-2.22	4.71	4.71	0.59529	.	0.000000	0.52532	D	0.000076	D	0.93210	0.7837	M	0.86502	2.82	0.58432	D	0.999996	D;D;D	0.65815	0.973;0.959;0.995	P;P;D	0.66716	0.843;0.835;0.946	D	0.93646	0.6969	10	0.54805	T	0.06	.	12.2882	0.54803	1.0:0.0:0.0:0.0	.	1185;1190;1194	G3XAF4;P32004-2;P32004	.;.;L1CAM_HUMAN	T	1194;1196;1194;1192;1185;1185;90;1190	ENSP00000359077:S1194T;ENSP00000438430:S1196T;ENSP00000359074:S1194T;ENSP00000439645:S1192T;ENSP00000354712:S1185T;ENSP00000359072:S1185T;ENSP00000359075:S90T;ENSP00000355380:S1190T	ENSP00000355380:S1190T	S	-	1	0	L1CAM	152781506	1.000000	0.71417	0.262000	0.24481	0.155000	0.21991	4.713000	0.61895	1.743000	0.51761	0.430000	0.28490	TCG		0.622	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061094.2	NM_024003		8	49	0	0	0	0.00308	0	8	49				
L1CAM	3897	broad.mit.edu	37	X	153130448	153130448	+	Splice_Site	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:153130448C>A	ENST00000370060.1	-	23	3063	c.2874G>T	c.(2872-2874)ctG>ctT	p.L958L	L1CAM_ENST00000361981.3_Splice_Site_p.L953L|L1CAM_ENST00000543994.1_Splice_Site_p.L960L|L1CAM_ENST00000370057.3_Splice_Site_p.L958L|L1CAM_ENST00000361699.4_Splice_Site_p.L958L|L1CAM_ENST00000370055.1_Splice_Site_p.L953L|L1CAM_ENST00000538883.1_Splice_Site_p.L960L	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	958	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.		L -> V (in dbSNP:rs35902890).		axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)	p.L958L(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CCCCCTCATCCACTGTGGGGA	0.682																																							uc004fjb.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(8)|central_nervous_system(1)	9						c.(2872-2874)CTG>CTT		L1 cell adhesion molecule isoform 1 precursor							95.0	79.0	84.0					X																	153130448		2203	4300	6503	SO:0001630	splice_region_variant	3897				axon guidance|blood coagulation|cell death|leukocyte migration	integral to membrane		g.chrX:153130448C>A	M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.2873-1G>T	X.37:g.153130448C>A						L1CAM_uc004fjc.2_Silent_p.L958L|L1CAM_uc010nuo.2_Silent_p.L953L	p.L958L	NM_000425	NP_000416	P32004	L1CAM_HUMAN			22	2982	-	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		958			Extracellular (Potential).|Fibronectin type-III 4.		A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Silent	SNP	ENST00000370060.1	37	c.2874G>T	CCDS14733.1																																																																																				0.682	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061094.2	NM_024003	Silent	9	157	1	0	3.09899e-07	0.004482	3.93144e-07	9	157				
L1CAM	3897	broad.mit.edu	37	X	153132929	153132929	+	Silent	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:153132929G>T	ENST00000370060.1	-	17	2208	c.2019C>A	c.(2017-2019)acC>acA	p.T673T	L1CAM_ENST00000361981.3_Silent_p.T668T|L1CAM_ENST00000543994.1_Silent_p.T675T|L1CAM_ENST00000370057.3_Silent_p.T673T|L1CAM_ENST00000361699.4_Silent_p.T673T|L1CAM_ENST00000370055.1_Silent_p.T668T|L1CAM_ENST00000538883.1_Silent_p.T675T	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	673	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)	p.T673T(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GGGTGGTAGAGGTCTGGTTCC	0.512																																							uc004fjb.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(8)|central_nervous_system(1)	9						c.(2017-2019)ACC>ACA		L1 cell adhesion molecule isoform 1 precursor							159.0	143.0	149.0					X																	153132929		2203	4300	6503	SO:0001819	synonymous_variant	3897				axon guidance|blood coagulation|cell death|leukocyte migration	integral to membrane		g.chrX:153132929G>T	M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.2019C>A	X.37:g.153132929G>T						L1CAM_uc004fjc.2_Silent_p.T673T|L1CAM_uc010nuo.2_Silent_p.T668T	p.T673T	NM_000425	NP_000416	P32004	L1CAM_HUMAN			16	2127	-	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		673			Fibronectin type-III 1.|Extracellular (Potential).		A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Silent	SNP	ENST00000370060.1	37	c.2019C>A	CCDS14733.1	.	.	.	.	.	.	.	.	.	.	G	8.817	0.936740	0.18206	.	.	ENSG00000198910	ENST00000455590	.	.	.	5.42	2.67	0.31697	.	.	.	.	.	T	0.51618	0.1685	.	.	.	0.42623	D	0.993351	.	.	.	.	.	.	T	0.38908	-0.9639	4	.	.	.	.	4.598	0.12340	0.2785:0.1712:0.5503:0.0	.	.	.	.	H	94	.	.	P	-	2	0	L1CAM	152786123	0.567000	0.26626	0.996000	0.52242	0.983000	0.72400	0.081000	0.14823	0.129000	0.18514	0.529000	0.55759	CCT		0.512	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061094.2	NM_024003		24	261	1	0	3.6726e-16	0.003954	5.62398e-16	24	261				
L1CAM	3897	broad.mit.edu	37	X	153136381	153136381	+	Silent	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:153136381C>A	ENST00000370060.1	-	7	747	c.558G>T	c.(556-558)acG>acT	p.T186T	L1CAM_ENST00000361981.3_Silent_p.T181T|L1CAM_ENST00000543994.1_Silent_p.T188T|L1CAM_ENST00000370057.3_Silent_p.T186T|L1CAM_ENST00000361699.4_Silent_p.T186T|L1CAM_ENST00000370055.1_Silent_p.T181T|L1CAM_ENST00000538883.1_Silent_p.T188T	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	186	Ig-like C2-type 2.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)	p.T186T(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TCTGGCCCATCGTCACCCGCT	0.602																																							uc004fjb.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(8)|central_nervous_system(1)	9						c.(556-558)ACG>ACT		L1 cell adhesion molecule isoform 1 precursor							236.0	161.0	186.0					X																	153136381		2203	4300	6503	SO:0001819	synonymous_variant	3897				axon guidance|blood coagulation|cell death|leukocyte migration	integral to membrane		g.chrX:153136381C>A	M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.558G>T	X.37:g.153136381C>A						L1CAM_uc004fjc.2_Silent_p.T186T|L1CAM_uc010nuo.2_Silent_p.T181T|L1CAM_uc004fjd.1_5'UTR|L1CAM_uc004fje.1_Silent_p.T181T	p.T186T	NM_000425	NP_000416	P32004	L1CAM_HUMAN			6	666	-	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		186			Extracellular (Potential).|Ig-like C2-type 2.		A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Silent	SNP	ENST00000370060.1	37	c.558G>T	CCDS14733.1																																																																																				0.602	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061094.2	NM_024003		19	145	1	0	7.45023e-12	0.010504	1.06812e-11	19	145				
OPN1LW	5956	broad.mit.edu	37	X	153420135	153420135	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:153420135T>A	ENST00000369951.4	+	4	725	c.665T>A	c.(664-666)gTc>gAc	p.V222D	OPN1LW_ENST00000463296.1_Intron	NM_020061.4	NP_064445.2	P04000	OPSR_HUMAN	opsin 1 (cone pigments), long-wave-sensitive	222					phototransduction, visible light (GO:0007603)|positive regulation of cytokinesis (GO:0032467)|protein-chromophore linkage (GO:0018298)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)	p.V222D(2)		endometrium(3)|large_intestine(2)|lung(8)|ovary(1)|skin(1)	15	all_cancers(53;1.83e-16)|all_epithelial(53;2.73e-10)|all_lung(58;6.39e-07)|Lung NSC(58;8.37e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TACATGATTGTCCTCATGGTC	0.602																																							uc004fjz.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(664-666)GTC>GAC		opsin 1 (cone pigments), long-wave-sensitive							253.0	178.0	203.0					X																	153420135		2184	4247	6431	SO:0001583	missense	5956				phototransduction|protein-chromophore linkage|visual perception	integral to plasma membrane	G-protein coupled receptor activity|photoreceptor activity	g.chrX:153420135T>A	Z68193	CCDS14742.1	Xq28	2013-01-08	2008-04-16		ENSG00000102076	ENSG00000102076		"""GPCR / Class A : Opsin receptors"""	9936	protein-coding gene	gene with protein product	"""cone dystrophy 5 (X-linked)"""	300822	"""color blindness, protan"", ""red cone photoreceptor pigment"""	CBBM, RCP, CBP			Standard	NM_020061		Approved	COD5	uc004fjz.4	P04000	OTTHUMG00000034295	ENST00000369951.4:c.665T>A	X.37:g.153420135T>A	ENSP00000358967:p.Val222Asp						p.V222D	NM_020061	NP_064445	P04000	OPSR_HUMAN			4	698	+	all_cancers(53;1.83e-16)|all_epithelial(53;2.73e-10)|all_lung(58;6.39e-07)|Lung NSC(58;8.37e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)		222			Helical; Name=5; (Potential).			Missense_Mutation	SNP	ENST00000369951.4	37	c.665T>A	CCDS14742.1	.	.	.	.	.	.	.	.	.	.	T	14.14	2.445106	0.43429	.	.	ENSG00000102076	ENST00000369951;ENST00000442922	T;T	0.39592	1.07;1.07	4.27	3.06	0.35304	GPCR, rhodopsin-like superfamily (1);	0.059642	0.64402	D	0.000002	T	0.61726	0.2370	M	0.86268	2.805	0.80722	D	1	D	0.56287	0.975	P	0.62885	0.908	T	0.62950	-0.6745	10	0.87932	D	0	.	8.5945	0.33707	0.0:0.0983:0.0:0.9017	.	222	P04000	OPSR_HUMAN	D	222;85	ENSP00000358967:V222D;ENSP00000402493:V85D	ENSP00000358967:V222D	V	+	2	0	OPN1LW	153073329	0.042000	0.20092	0.079000	0.20413	0.041000	0.13682	1.658000	0.37376	0.457000	0.26962	0.304000	0.19853	GTC		0.602	OPN1LW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082839.2	NM_020061		18	311	0	0	0	0.008871	0	18	311				
FAM50A	9130	broad.mit.edu	37	X	153678642	153678642	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:153678642C>A	ENST00000393600.3	+	12	1096	c.986C>A	c.(985-987)cCt>cAt	p.P329H		NM_004699.3	NP_004690.1	Q14320	FA50A_HUMAN	family with sequence similarity 50, member A	329					spermatogenesis (GO:0007283)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.P329H(1)		breast(2)|central_nervous_system(1)|lung(9)|ovary(2)|skin(1)	15	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CCCTACGACCCTGAAAAGAAG	0.612																																							uc004fll.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(985-987)CCT>CAT		XAP-5 protein							76.0	68.0	71.0					X																	153678642		2203	4300	6503	SO:0001583	missense	9130				spermatogenesis	nucleus		g.chrX:153678642C>A	BC000028	CCDS14751.1	Xq28	2008-02-05			ENSG00000071859	ENSG00000071859			18786	protein-coding gene	gene with protein product	"""DNA segment on chromosome X (unique) 9928 expressed sequence"""	300453				9339379, 9039504	Standard	NM_004699		Approved	DXS9928E, XAP5, HXC-26, 9F	uc004fll.4	Q14320	OTTHUMG00000033292	ENST00000393600.3:c.986C>A	X.37:g.153678642C>A	ENSP00000377225:p.Pro329His						p.P329H	NM_004699	NP_004690	Q14320	FA50A_HUMAN			12	1084	+	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)		329					A8KAQ4|B2R997|Q5HY37|Q6PJH5	Missense_Mutation	SNP	ENST00000393600.3	37	c.986C>A	CCDS14751.1	.	.	.	.	.	.	.	.	.	.	C	17.23	3.335555	0.60853	.	.	ENSG00000071859	ENST00000393600	.	.	.	4.78	4.78	0.61160	.	0.000000	0.85682	D	0.000000	D	0.86957	0.6058	H	0.95611	3.695	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91205	0.4994	9	0.87932	D	0	-9.3168	15.8586	0.79005	0.0:1.0:0.0:0.0	.	329	Q14320	FA50A_HUMAN	H	329	.	ENSP00000377225:P329H	P	+	2	0	FAM50A	153331836	1.000000	0.71417	0.765000	0.31456	0.172000	0.22775	7.329000	0.79170	2.078000	0.62432	0.544000	0.68410	CCT		0.612	FAM50A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081643.2	NM_004699		13	98	1	0	9.31168e-06	0.001855	1.10404e-05	13	98				
MPP1	4354	broad.mit.edu	37	X	154014665	154014665	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:154014665C>A	ENST00000369534.3	-	6	638	c.491G>T	c.(490-492)aGa>aTa	p.R164I	MPP1_ENST00000393531.1_Intron|MPP1_ENST00000413259.3_Missense_Mutation_p.R134I|MPP1_ENST00000462825.1_5'UTR	NM_001166460.1|NM_001166461.1|NM_002436.3	NP_001159932.1|NP_001159933.1|NP_002427.1	Q00013	EM55_HUMAN	membrane protein, palmitoylated 1, 55kDa	164	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				nucleotide phosphorylation (GO:0046939)|regulation of neutrophil chemotaxis (GO:0090022)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cortical cytoskeleton (GO:0030863)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(9)|ovary(2)|prostate(1)	21	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					AAACTGCGCTCTCATGAACAT	0.463																																							uc004fmp.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(490-492)AGA>ATA		palmitoylated membrane protein 1							227.0	217.0	221.0					X																	154014665		2203	4300	6503	SO:0001583	missense	4354				regulation of neutrophil chemotaxis|signal transduction	integral to plasma membrane|membrane fraction|stereocilium	guanylate kinase activity|protein binding	g.chrX:154014665C>A		CCDS14762.1, CCDS55544.1, CCDS55545.1	Xq28	2008-03-04	2002-08-29		ENSG00000130830	ENSG00000130830			7219	protein-coding gene	gene with protein product		305360	"""membrane protein, palmitoylated 1 (55kD)"""	DXS552E		1713685	Standard	NM_002436		Approved	PEMP	uc004fmp.2	Q00013	OTTHUMG00000024244	ENST00000369534.3:c.491G>T	X.37:g.154014665C>A	ENSP00000358547:p.Arg164Ile					MPP1_uc010nvg.1_Intron|MPP1_uc011mzv.1_Missense_Mutation_p.R134I|MPP1_uc004fmq.1_Missense_Mutation_p.R118I|MPP1_uc011mzw.1_Missense_Mutation_p.R147I|MPP1_uc010nvh.1_Missense_Mutation_p.R38I	p.R164I	NM_002436	NP_002427	Q00013	EM55_HUMAN			6	606	-	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)		164			SH3.		B4DZV5|G3XAI1|Q2TSB6|Q5J7V5	Missense_Mutation	SNP	ENST00000369534.3	37	c.491G>T	CCDS14762.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.404220	0.83230	.	.	ENSG00000130830	ENST00000369534;ENST00000413259;ENST00000453245;ENST00000393529;ENST00000428488	T;T;T;T;T	0.10960	2.82;2.82;2.82;2.82;2.82	5.46	4.6	0.57074	Src homology-3 domain (3);PDZ/DHR/GLGF (1);Variant SH3 (1);	0.000000	0.85682	D	0.000000	T	0.29783	0.0744	M	0.67517	2.055	0.80722	D	1	D;D;P;D	0.76494	0.991;0.999;0.876;0.999	D;D;P;D	0.76071	0.93;0.987;0.559;0.987	T	0.01621	-1.1310	10	0.87932	D	0	.	12.0476	0.53489	0.0:0.9135:0.0:0.0865	.	147;134;38;164	B4E325;B4DZV5;C9J9J4;Q00013	.;.;.;EM55_HUMAN	I	164;134;38;118;61	ENSP00000358547:R164I;ENSP00000400155:R134I;ENSP00000410888:R38I;ENSP00000377163:R118I;ENSP00000391701:R61I	ENSP00000358547:R164I	R	-	2	0	MPP1	153667859	1.000000	0.71417	0.994000	0.49952	0.980000	0.70556	4.943000	0.63554	1.065000	0.40693	0.513000	0.50165	AGA		0.463	MPP1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061191.3	NM_002436		27	543	1	0	4.87955e-14	0.005443	7.31283e-14	27	543				
F8	2157	broad.mit.edu	37	X	154157322	154157322	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:154157322C>A	ENST00000360256.4	-	14	4943	c.4743G>T	c.(4741-4743)ttG>ttT	p.L1581F		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	1581	B.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)	p.L1581F(2)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	CAAGAGGATCCAATAGCTTGG	0.433																																							uc004fmt.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	11						c.(4741-4743)TTG>TTT		coagulation factor VIII isoform a precursor	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)						160.0	157.0	158.0					X																	154157322		2203	4300	6503	SO:0001583	missense	2157				acute-phase response|blood coagulation, intrinsic pathway|cell adhesion|platelet activation|platelet degranulation	extracellular space|plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity|protein binding	g.chrX:154157322C>A	M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.4743G>T	X.37:g.154157322C>A	ENSP00000353393:p.Leu1581Phe						p.L1581F	NM_000132	NP_000123	P00451	FA8_HUMAN			14	4914	-	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)		1581			B.		Q14286|Q5HY69	Missense_Mutation	SNP	ENST00000360256.4	37	c.4743G>T	CCDS35457.1	.	.	.	.	.	.	.	.	.	.	c	5.685	0.310993	0.10733	.	.	ENSG00000185010	ENST00000360256	D	0.99429	-5.89	4.64	-3.23	0.05109	.	1.194510	0.06073	N	0.660516	D	0.98040	0.9354	M	0.69823	2.125	0.09310	N	1	P	0.50272	0.933	B	0.42555	0.391	D	0.95692	0.8741	10	0.44086	T	0.13	-0.3109	1.3693	0.02207	0.1615:0.2502:0.1348:0.4536	.	1581	P00451	FA8_HUMAN	F	1581	ENSP00000353393:L1581F	ENSP00000353393:L1581F	L	-	3	2	F8	153810516	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.832000	0.04400	-0.698000	0.05085	-0.302000	0.09304	TTG		0.433	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058869.4			161	240	1	0	4.58859e-59	0.00361	8.00866e-59	161	240				
RAB39B	116442	broad.mit.edu	37	X	154493532	154493532	+	Silent	SNP	G	G	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:154493532G>T	ENST00000369454.3	-	1	342	c.42C>A	c.(40-42)atC>atA	p.I14I		NM_171998.2	NP_741995.1	Q96DA2	RB39B_HUMAN	RAB39B, member RAS oncogene family	14					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|synapse organization (GO:0050808)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	GTP binding (GO:0005525)|myosin V binding (GO:0031489)	p.I14I(1)		breast(1)|central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(12)	19	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					TGGAATCCCCGATGACAATGA	0.667																																							uc004fne.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(40-42)ATC>ATA		RAB39B, member RAS oncogene family							85.0	85.0	85.0					X																	154493532		2203	4300	6503	SO:0001819	synonymous_variant	116442				protein transport|small GTPase mediated signal transduction|synapse organization|vesicle-mediated transport	Golgi apparatus|plasma membrane	GTP binding	g.chrX:154493532G>T	AY052478	CCDS14766.1	Xq28	2014-01-31			ENSG00000155961	ENSG00000155961		"""RAB, member RAS oncogene"""	16499	protein-coding gene	gene with protein product		300774	"""mental retardation, X-linked 72"""	MRX72		12438742, 20159109	Standard	NM_171998		Approved		uc004fne.3	Q96DA2	OTTHUMG00000022659	ENST00000369454.3:c.42C>A	X.37:g.154493532G>T							p.I14I	NM_171998	NP_741995	Q96DA2	RB39B_HUMAN			1	321	-	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)		14					Q5JT79|Q8NEX3	Silent	SNP	ENST00000369454.3	37	c.42C>A	CCDS14766.1																																																																																				0.667	RAB39B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058792.1	NM_171998		10	172	1	0	1.08611e-07	0.000978	1.39678e-07	10	172				
RAB39B	116442	broad.mit.edu	37	X	154493561	154493561	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:154493561A>T	ENST00000369454.3	-	1	313	c.13T>A	c.(13-15)Tgg>Agg	p.W5R		NM_171998.2	NP_741995.1	Q96DA2	RB39B_HUMAN	RAB39B, member RAS oncogene family	5					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|synapse organization (GO:0050808)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	GTP binding (GO:0005525)|myosin V binding (GO:0031489)	p.W5R(1)		breast(1)|central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(12)	19	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					TGGTACAGCCAGATGGCCTCC	0.687																																							uc004fne.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(13-15)TGG>AGG		RAB39B, member RAS oncogene family							62.0	65.0	64.0					X																	154493561		2203	4300	6503	SO:0001583	missense	116442				protein transport|small GTPase mediated signal transduction|synapse organization|vesicle-mediated transport	Golgi apparatus|plasma membrane	GTP binding	g.chrX:154493561A>T	AY052478	CCDS14766.1	Xq28	2014-01-31			ENSG00000155961	ENSG00000155961		"""RAB, member RAS oncogene"""	16499	protein-coding gene	gene with protein product		300774	"""mental retardation, X-linked 72"""	MRX72		12438742, 20159109	Standard	NM_171998		Approved		uc004fne.3	Q96DA2	OTTHUMG00000022659	ENST00000369454.3:c.13T>A	X.37:g.154493561A>T	ENSP00000358466:p.Trp5Arg						p.W5R	NM_171998	NP_741995	Q96DA2	RB39B_HUMAN			1	292	-	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)		5					Q5JT79|Q8NEX3	Missense_Mutation	SNP	ENST00000369454.3	37	c.13T>A	CCDS14766.1	.	.	.	.	.	.	.	.	.	.	A	17.72	3.459635	0.63401	.	.	ENSG00000155961	ENST00000369454	T	0.68025	-0.3	5.12	5.12	0.69794	.	0.156720	0.45606	D	0.000346	T	0.53594	0.1806	N	0.19112	0.55	0.58432	D	0.999997	P	0.42123	0.771	B	0.41088	0.347	T	0.60994	-0.7152	10	0.87932	D	0	.	12.0569	0.53540	1.0:0.0:0.0:0.0	.	5	Q96DA2	RB39B_HUMAN	R	5	ENSP00000358466:W5R	ENSP00000358466:W5R	W	-	1	0	RAB39B	154146755	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.435000	0.80391	1.820000	0.53075	0.486000	0.48141	TGG		0.687	RAB39B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058792.1	NM_171998		7	135	0	0	0	0.006214	0	7	135				
SPSB1	80176	broad.mit.edu	37	1	9416498	9416499	+	Frame_Shift_Ins	INS	-	-	G			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:9416498_9416499insG	ENST00000328089.6	+	2	889_890	c.548_549insG	c.(547-552)atggacfs	p.D184fs	SPSB1_ENST00000377399.2_Frame_Shift_Ins_p.D184fs|SPSB1_ENST00000357898.3_Frame_Shift_Ins_p.D184fs	NM_025106.3	NP_079382.2	Q96BD6	SPSB1_HUMAN	splA/ryanodine receptor domain and SOCS box containing 1	184	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				breast(1)|endometrium(3)|kidney(2)|lung(5)|prostate(2)	13	all_lung(157;0.194)	all_epithelial(116;4.38e-15)|all_lung(118;0.000156)|Lung NSC(185;0.000446)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;2.72e-07)|COAD - Colon adenocarcinoma(227;9.12e-05)|Kidney(185;0.000296)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00193)|BRCA - Breast invasive adenocarcinoma(304;0.00202)|READ - Rectum adenocarcinoma(331;0.0419)		GCCCTGGACATGGACGACGGGA	0.515																																							uc010oae.1		NA																	0					0						c.(547-549)ATGfs		splA/ryanodine receptor domain and SOCS box																																				SO:0001589	frameshift_variant	80176				intracellular signal transduction	cytoplasm		g.chr1:9416498_9416499insG		CCDS102.1	1p36.22	2008-02-05			ENSG00000171621	ENSG00000171621			30628	protein-coding gene	gene with protein product		611657				15713673, 12076535	Standard	NM_025106		Approved	SSB-1	uc010oae.2	Q96BD6	OTTHUMG00000001279	ENST00000328089.6:c.550dupG	1.37:g.9416500_9416500dupG	ENSP00000330221:p.Asp184fs					SPSB1_uc001apv.2_Frame_Shift_Ins_p.M183fs	p.M183fs	NM_025106	NP_079382	Q96BD6	SPSB1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;2.72e-07)|COAD - Colon adenocarcinoma(227;9.12e-05)|Kidney(185;0.000296)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00193)|BRCA - Breast invasive adenocarcinoma(304;0.00202)|READ - Rectum adenocarcinoma(331;0.0419)	2	887_888	+	all_lung(157;0.194)	all_epithelial(116;4.38e-15)|all_lung(118;0.000156)|Lung NSC(185;0.000446)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)	183			B30.2/SPRY.		A2A275|Q59FA1|Q5TIH9|Q9BRY9|Q9H6C5	Frame_Shift_Ins	INS	ENST00000328089.6	37	c.548_549insG	CCDS102.1																																																																																				0.515	SPSB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003727.2	NM_025106		25	181	NA	NA	NA	NA	NA	25	181	---	---	---	---
ESRRG	2104	broad.mit.edu	37	1	216850615	216850615	+	Frame_Shift_Del	DEL	C	C	-			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:216850615delC	ENST00000408911.3	-	2	428	c.275delG	c.(274-276)ggafs	p.G93fs	ESRRG_ENST00000361395.2_Frame_Shift_Del_p.G70fs|ESRRG_ENST00000360012.3_Frame_Shift_Del_p.G70fs|ESRRG_ENST00000493748.1_Frame_Shift_Del_p.G70fs|ESRRG_ENST00000361525.3_Frame_Shift_Del_p.G70fs|ESRRG_ENST00000366937.1_Frame_Shift_Del_p.G98fs|ESRRG_ENST00000487276.1_Frame_Shift_Del_p.G70fs|ESRRG_ENST00000391890.3_Frame_Shift_Del_p.G70fs|ESRRG_ENST00000359162.2_Frame_Shift_Del_p.G70fs|ESRRG_ENST00000366940.2_Frame_Shift_Del_p.G70fs|ESRRG_ENST00000366938.2_Frame_Shift_Del_p.G70fs|ESRRG_ENST00000463665.1_Frame_Shift_Del_p.G70fs|ESRRG_ENST00000493603.1_Frame_Shift_Del_p.G70fs	NM_001438.3	NP_001429.2	P62508	ERR3_HUMAN	estrogen-related receptor gamma	93					gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	AF-2 domain binding (GO:0050682)|retinoic acid receptor activity (GO:0003708)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(1)|large_intestine(8)|liver(1)|lung(29)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	CCCACTACCTCCCAGGATAGG	0.532																																							uc001hkw.1		NA																	0				ovary(1)|kidney(1)	2						c.(274-276)GGAfs		estrogen-related receptor gamma isoform 1	Diethylstilbestrol(DB00255)						183.0	162.0	170.0					1																	216850615		2203	4300	6503	SO:0001589	frameshift_variant	2104				positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding	g.chr1:216850615delC	AF058291	CCDS1517.1, CCDS41468.1, CCDS58060.1, CCDS58061.1	1q41	2014-02-18			ENSG00000196482	ENSG00000196482		"""Nuclear hormone receptors"""	3474	protein-coding gene	gene with protein product		602969				9676434, 10072763	Standard	NM_001243505		Approved	NR3B3	uc001hkw.2	P62508	OTTHUMG00000037025	ENST00000408911.3:c.275delG	1.37:g.216850615delC	ENSP00000386171:p.Gly93fs					ESRRG_uc001hky.1_Frame_Shift_Del_p.G69fs|ESRRG_uc009xdp.1_Frame_Shift_Del_p.G69fs|ESRRG_uc001hkz.1_Frame_Shift_Del_p.G69fs|ESRRG_uc010puc.1_Frame_Shift_Del_p.G69fs|ESRRG_uc001hla.1_Frame_Shift_Del_p.G69fs|ESRRG_uc001hlb.1_Frame_Shift_Del_p.G69fs|ESRRG_uc010pud.1_Intron|ESRRG_uc001hlc.1_Frame_Shift_Del_p.G69fs|ESRRG_uc001hld.1_Frame_Shift_Del_p.G69fs|ESRRG_uc001hkx.1_Frame_Shift_Del_p.G97fs|ESRRG_uc009xdo.1_Frame_Shift_Del_p.G69fs|ESRRG_uc001hle.1_Frame_Shift_Del_p.G69fs	p.G92fs	NM_001438	NP_001429	P62508	ERR3_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	2	441	-			92					A8K4I0|A8K6I2|B3KY84|E9PGB7|F8W8J3|O75454|O96021|Q68DA0|Q6P274|Q6PK28|Q6TS38|Q9R1F3|Q9UNJ4	Frame_Shift_Del	DEL	ENST00000408911.3	37	c.275delG	CCDS41468.1																																																																																				0.532	ESRRG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000089882.2	NM_206595		68	157	NA	NA	NA	NA	NA	68	157	---	---	---	---
LYST	1130	broad.mit.edu	37	1	235922575	235922575	+	Frame_Shift_Del	DEL	C	C	-			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr1:235922575delC	ENST00000389794.3	-	23	6752	c.6578delG	c.(6577-6579)ggafs	p.G2193fs	LYST_ENST00000389793.2_Frame_Shift_Del_p.G2193fs|LYST_ENST00000536965.1_3'UTR			Q99698	LYST_HUMAN	lysosomal trafficking regulator	2193					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			TCCCAGCACTCCCTTTGGGAC	0.512																																							uc001hxj.2		NA																	0				ovary(6)|breast(4)|central_nervous_system(2)	12						c.(6577-6579)GGAfs		lysosomal trafficking regulator							146.0	141.0	143.0					1																	235922575		2203	4300	6503	SO:0001589	frameshift_variant	1130	Chediak-Higashsyndrome			defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding	g.chr1:235922575delC	U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.6578delG	1.37:g.235922575delC	ENSP00000374444:p.Gly2193fs					LYST_uc009xgb.1_RNA|LYST_uc010pxs.1_RNA	p.G2193fs	NM_000081	NP_000072	Q99698	LYST_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.000674)		23	6753	-	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	2193					O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Frame_Shift_Del	DEL	ENST00000389794.3	37	c.6578delG	CCDS31062.1																																																																																				0.512	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5			69	176	NA	NA	NA	NA	NA	69	176	---	---	---	---
IQSEC3	440073	broad.mit.edu	37	12	247477	247478	+	Frame_Shift_Del	DEL	GC	GC	-			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	GC	GC	-	-	GC	GC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr12:247477_247478delGC	ENST00000538872.1	+	4	1066_1067	c.948_949delGC	c.(946-951)cggcgcfs	p.RR316fs	RP11-598F7.4_ENST00000505893.2_RNA|RP11-598F7.4_ENST00000508953.2_RNA|IQSEC3_ENST00000326261.4_Frame_Shift_Del_p.RR316fs|IQSEC3_ENST00000382841.2_Frame_Shift_Del_p.RR13fs			Q9UPP2	IQEC3_HUMAN	IQ motif and Sec7 domain 3	316	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|inhibitory synapse (GO:0060077)|postsynaptic membrane (GO:0045211)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)		TGGTGTCCCGGCGCGCCGCTTG	0.599																																							uc001qhw.1		NA																	0				central_nervous_system(2)|large_intestine(1)|skin(1)	4						c.(37-42)CGGCGCfs		IQ motif and Sec7 domain 3																																				SO:0001589	frameshift_variant	440073				regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity	g.chr12:247477_247478delGC	AB029033	CCDS31725.1, CCDS53728.1	12p13.33	2014-03-18			ENSG00000120645	ENSG00000120645			29193	protein-coding gene	gene with protein product		612118				10470851	Standard	NM_001170738		Approved	KIAA1110, MGC30156	uc001qhw.2	Q9UPP2	OTTHUMG00000167975	ENST00000538872.1:c.948_949delGC	12.37:g.247481_247482delGC	ENSP00000437554:p.Arg316fs					IQSEC3_uc001qhu.1_Frame_Shift_Del_p.R13fs|IQSEC3_uc001qht.1_Frame_Shift_Del_p.R98fs|uc001qhv.1_RNA	p.R13fs	NM_015232	NP_056047	Q9UPP2	IQEC3_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)	1	45_46	+	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		316_317			IQ.		A6NIF2|A6NKV9|Q8TB43	Frame_Shift_Del	DEL	ENST00000538872.1	37	c.39_40delGC	CCDS53728.1																																																																																				0.599	IQSEC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397382.3	XM_495902		8	33	NA	NA	NA	NA	NA	8	33	---	---	---	---
MGA	23269	broad.mit.edu	37	15	42028569	42028569	+	Frame_Shift_Del	DEL	G	G	-			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr15:42028569delG	ENST00000570161.1	+	12	4107	c.4107delG	c.(4105-4107)gtgfs	p.V1369fs	MGA_ENST00000566586.1_Frame_Shift_Del_p.V1369fs|MGA_ENST00000219905.7_Frame_Shift_Del_p.V1369fs|MGA_ENST00000545763.1_Frame_Shift_Del_p.V1369fs|MGA_ENST00000389936.4_Frame_Shift_Del_p.V1369fs			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0	Glucoamylase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	CACTTAAGGTGGGCAGCTTCA	0.458																																							uc010ucy.1		NA																	0				ovary(6)|kidney(3)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	12						c.(4105-4107)GTGfs		MAX-interacting protein isoform 1							136.0	129.0	131.0					15																	42028569		1957	4167	6124	SO:0001589	frameshift_variant	23269					MLL1 complex	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr15:42028569delG	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.4107delG	15.37:g.42028569delG	ENSP00000457035:p.Val1369fs					MGA_uc010ucz.1_Frame_Shift_Del_p.V1369fs|MGA_uc010uda.1_Intron	p.V1369fs	NM_001164273	NP_001157745	Q8IWI9	MGAP_HUMAN		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	13	4288	+		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)	1369					Q0VAX6|Q75ME7|Q86UM5	Frame_Shift_Del	DEL	ENST00000570161.1	37	c.4107delG	CCDS55959.1																																																																																				0.458	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1		40	89	NA	NA	NA	NA	NA	40	89	---	---	---	---
SIN3A	25942	broad.mit.edu	37	15	75715034	75715034	+	Frame_Shift_Del	DEL	G	G	-			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr15:75715034delG	ENST00000394947.3	-	3	634	c.320delC	c.(319-321)ccafs	p.P108fs	SIN3A_ENST00000360439.4_Frame_Shift_Del_p.P108fs|SIN3A_ENST00000567289.1_Frame_Shift_Del_p.P108fs|SIN3A_ENST00000394949.4_Frame_Shift_Del_p.P108fs	NM_001145358.1	NP_001138830.1			SIN3 transcription regulator family member A											breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	63						TGCAACTGGTGGGGCTGGATG	0.527																																							uc002bai.2		NA																	0				skin(3)|ovary(1)|lung(1)	5						c.(319-321)CCAfs		transcriptional co-repressor Sin3A							104.0	100.0	101.0					15																	75715034		2197	4294	6491	SO:0001589	frameshift_variant	25942				blood coagulation|cellular lipid metabolic process|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus|Sin3 complex	protein binding	g.chr15:75715034delG	AK027559	CCDS10279.1	15q22.33	2013-08-21	2013-08-21		ENSG00000169375	ENSG00000169375			19353	protein-coding gene	gene with protein product		607776	"""SIN3 homolog A, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog A (yeast)"""			10773092, 7601471	Standard	NM_001145357		Approved	KIAA0700, DKFZP434K2235	uc002bai.3	Q96ST3	OTTHUMG00000142834	ENST00000394947.3:c.320delC	15.37:g.75715034delG	ENSP00000378402:p.Pro108fs					SIN3A_uc002baj.2_Frame_Shift_Del_p.P107fs|SIN3A_uc010uml.1_Frame_Shift_Del_p.P107fs|SIN3A_uc002bak.3_Frame_Shift_Del_p.P107fs	p.P107fs	NM_015477	NP_056292	Q96ST3	SIN3A_HUMAN			3	579	-			107						Frame_Shift_Del	DEL	ENST00000394947.3	37	c.320delC	CCDS10279.1																																																																																				0.527	SIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286469.1	NM_015477		43	96	NA	NA	NA	NA	NA	43	96	---	---	---	---
SLC7A9	11136	broad.mit.edu	37	19	33355102	33355103	+	Frame_Shift_Ins	INS	-	-	C			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr19:33355102_33355103insC	ENST00000023064.4	-	4	568_569	c.377_378insG	c.(376-378)gccfs	p.A126fs	SLC7A9_ENST00000587772.1_Frame_Shift_Ins_p.A126fs|RN7SKP22_ENST00000365097.1_RNA|SLC7A9_ENST00000590341.1_Frame_Shift_Ins_p.A126fs	NM_001126335.1|NM_001243036.1|NM_014270.4	NP_001119807.1|NP_001229965.1|NP_055085.1	P82251	BAT1_HUMAN	solute carrier family 7 (amino acid transporter light chain, bo,+ system), member 9	126			A -> T (in CSNU). {ECO:0000269|PubMed:11157794}.		amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|L-cystine transport (GO:0015811)|leukocyte migration (GO:0050900)|neutral amino acid transport (GO:0015804)|protein complex assembly (GO:0006461)|transmembrane transport (GO:0055085)|transport (GO:0006810)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-cystine transmembrane transporter activity (GO:0015184)|neutral amino acid transmembrane transporter activity (GO:0015175)|peptide antigen binding (GO:0042605)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	32	Esophageal squamous(110;0.137)				L-Cystine(DB00138)	GGCAGATGATGGCGAAGGACGT	0.599																																					GBM(181;1335 2108 9644 44178 46689)	GBM(181;1335 2108 9644 44178 46689)	uc002ntv.3		NA																	0				skin(1)	1						c.(376-378)GCCfs		solute carrier family 7, member 9	L-Cystine(DB00138)																																			SO:0001589	frameshift_variant	11136				blood coagulation|cellular amino acid metabolic process|ion transport|leukocyte migration|protein complex assembly	integral to plasma membrane	L-cystine transmembrane transporter activity|neutral amino acid transmembrane transporter activity|peptide antigen binding	g.chr19:33355102_33355103insC	AF141289	CCDS12425.1	19q13.11	2013-07-19	2013-07-19		ENSG00000021488	ENSG00000021488		"""Solute carriers"""	11067	protein-coding gene	gene with protein product		604144		CSNU3		10471498	Standard	NM_014270		Approved		uc021usa.1	P82251	OTTHUMG00000180287	ENST00000023064.4:c.377_378insG	19.37:g.33355102_33355103insC	ENSP00000023064:p.Ala126fs					SLC7A9_uc002ntt.3_RNA|SLC7A9_uc002ntu.3_Frame_Shift_Ins_p.A126fs|SLC7A9_uc002ntw.3_5'UTR	p.A126fs	NM_001126335	NP_001119807	P82251	BAT1_HUMAN			4	494_495	-	Esophageal squamous(110;0.137)		126		A -> T (in CSNU).	Extracellular (Potential).		B2R9A6	Frame_Shift_Ins	INS	ENST00000023064.4	37	c.377_378insG	CCDS12425.1																																																																																				0.599	SLC7A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450585.1			7	49	NA	NA	NA	NA	NA	7	49	---	---	---	---
ZIM2	23619	broad.mit.edu	37	19	57286803	57286804	+	Frame_Shift_Ins	INS	-	-	A	rs191866455|rs149106731		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr19:57286803_57286804insA	ENST00000391708.3	-	12	1378_1379	c.836_837insT	c.(835-837)ccgfs	p.P279fs	ZIM2_ENST00000593711.1_Frame_Shift_Ins_p.P279fs|ZIM2_ENST00000221722.5_Frame_Shift_Ins_p.P279fs|AC006115.3_ENST00000595954.1_RNA|AC006115.3_ENST00000594400.1_RNA|AC006115.3_ENST00000597946.1_RNA|ZIM2_ENST00000601070.1_Frame_Shift_Ins_p.P279fs|ZIM2_ENST00000599935.1_Frame_Shift_Ins_p.P279fs	NM_001146326.1|NM_001146327.1	NP_001139798.1|NP_001139799.1	Q9NZV7	ZIM2_HUMAN	zinc finger, imprinted 2	279					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.P279P(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0314)		AGCTTCTTTCCGGAGTGAGGGT	0.46																																							uc002qnr.2		NA																	1	Substitution - coding silent(1)		endometrium(1)	ovary(3)	3						c.(835-837)CCGfs		zinc finger, imprinted 2																																				SO:0001589	frameshift_variant	23619				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:57286803_57286804insA	AF166122	CCDS33123.1	19q13.4	2012-10-31				ENSG00000269699		"""Zinc fingers, C2H2-type"""	12875	protein-coding gene	gene with protein product							Standard	NM_015363		Approved	ZNF656		Q9NZV7		ENST00000391708.3:c.836_837insT	19.37:g.57286803_57286804insA	ENSP00000375589:p.Pro279fs					uc010ygp.1_Intron|uc002qnp.1_Intron|ZIM2_uc010ygq.1_Frame_Shift_Ins_p.P75fs|ZIM2_uc010ygr.1_Frame_Shift_Ins_p.P75fs|ZIM2_uc002qnq.2_Frame_Shift_Ins_p.P279fs|ZIM2_uc010etp.2_Frame_Shift_Ins_p.P279fs|ZIM2_uc010ygs.1_Frame_Shift_Ins_p.P279fs	p.P279fs	NM_015363	NP_056178	Q9NZV7	ZIM2_HUMAN		GBM - Glioblastoma multiforme(193;0.0314)	11	1218_1219	-		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)	279					Q2M3K1	Frame_Shift_Ins	INS	ENST00000391708.3	37	c.836_837insT	CCDS33123.1																																																																																				0.460	ZIM2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416094.2			41	125	NA	NA	NA	NA	NA	41	125	---	---	---	---
NPFFR2	10886	broad.mit.edu	37	4	72897699	72897699	+	Frame_Shift_Del	DEL	G	G	-	rs569440022|rs201446563	byFrequency	TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr4:72897699delG	ENST00000308744.6	+	1	179	c.81delG	c.(79-81)gcgfs	p.A27fs	NPFFR2_ENST00000344413.5_Frame_Shift_Del_p.A27fs	NM_004885.2	NP_004876.2	Q9Y5X5	NPFF2_HUMAN	neuropeptide FF receptor 2	27					detection of abiotic stimulus (GO:0009582)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of adenylate cyclase activity (GO:0045761)|regulation of cAMP-dependent protein kinase activity (GO:2000479)|regulation of MAPK cascade (GO:0043408)	actin cytoskeleton (GO:0015629)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(24)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43			Lung(101;0.0935)|LUSC - Lung squamous cell carcinoma(112;0.138)			ACAAGGAGGCGGGGAGGGAGC	0.672													GGGG|GGGG|GGG|deletion	3	0.000599042	0.0	0.0014	5008	,	,		16063	0.0		0.002	False		,,,				2504	0.0						uc003hgg.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(79-81)GCGfs		neuropeptide FF receptor 2 isoform 1				6,4254		2,2,2126	33.0	39.0	37.0			0.3	0.0	4		37	16,8234		4,8,4113	no	frameshift	NPFFR2	NM_004885.2		6,10,6239	A1A1,A1R,RR		0.1939,0.1408,0.1759			72897699	22,12488	2200	4300	6500	SO:0001589	frameshift_variant	10886				detection of abiotic stimulus	actin cytoskeleton|integral to plasma membrane	neuropeptide receptor activity	g.chr4:72897699delG	AF236083	CCDS3551.1, CCDS3552.1, CCDS47072.1	4q21	2012-08-10	2006-02-15	2006-02-15	ENSG00000056291	ENSG00000056291		"""GPCR / Class A :  Neuropeptide receptors : FF/AF"", ""GPCR / Class A : RF amide peptide receptors"""	4525	protein-coding gene	gene with protein product	"""neuropeptide FF 2"""	607449	"""G protein-coupled receptor 74"""	GPR74		10079187, 10851242	Standard	NM_001144756		Approved	NPFF2, NPGPR	uc003hgg.2	Q9Y5X5	OTTHUMG00000129918	ENST00000308744.6:c.81delG	4.37:g.72897699delG	ENSP00000307822:p.Ala27fs					NPFFR2_uc010iig.1_5'UTR	p.A27fs	NM_004885	NP_004876	Q9Y5X5	NPFF2_HUMAN	Lung(101;0.0935)|LUSC - Lung squamous cell carcinoma(112;0.138)		1	179	+			27			Extracellular (Potential).		Q96RV1|Q9NR49	Frame_Shift_Del	DEL	ENST00000308744.6	37	c.81delG	CCDS3551.1																																																																																				0.672	NPFFR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252170.2	NM_004885		7	84	NA	NA	NA	NA	NA	7	84	---	---	---	---
LMTK2	22853	broad.mit.edu	37	7	97800896	97800896	+	Frame_Shift_Del	DEL	G	G	-			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr7:97800896delG	ENST00000297293.5	+	7	994	c.701delG	c.(700-702)cggfs	p.R234fs		NM_014916.3	NP_055731.2	Q8IWU2	LMTK2_HUMAN	lemur tyrosine kinase 2	234	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				early endosome to late endosome transport (GO:0045022)|endocytic recycling (GO:0032456)|negative regulation of catalytic activity (GO:0043086)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor recycling (GO:0001881)|transferrin transport (GO:0033572)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|myosin VI binding (GO:0070853)|protein phosphatase inhibitor activity (GO:0004864)|protein serine/threonine kinase activity (GO:0004674)	p.R234L(1)		NS(2)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|pancreas(2)|skin(2)|stomach(3)	59	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)					GAGCACATGCGGGGGGACTCA	0.617																																							uc003upd.1		NA																	1	Substitution - Missense(1)	p.R234L(1)	lung(1)	lung(9)|stomach(3)|pancreas(2)|large_intestine(1)|breast(1)	16						c.(700-702)CGGfs		lemur tyrosine kinase 2 precursor							56.0	57.0	56.0					7																	97800896		2203	4300	6503	SO:0001589	frameshift_variant	22853				early endosome to late endosome transport|endocytic recycling|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|protein autophosphorylation|receptor recycling|transferrin transport	early endosome|Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|recycling endosome	ATP binding|myosin VI binding|protein phosphatase inhibitor activity|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr7:97800896delG	AB029002	CCDS5654.1	7q22.1	2014-06-12			ENSG00000164715	ENSG00000164715			17880	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 100"""	610989				15005709	Standard	NM_014916		Approved	KIAA1079, KPI2, KPI-2, cprk, LMR2, BREK, AATYK2, PPP1R100	uc003upd.2	Q8IWU2	OTTHUMG00000154256	ENST00000297293.5:c.701delG	7.37:g.97800896delG	ENSP00000297293:p.Arg234fs						p.R234fs	NM_014916	NP_055731	Q8IWU2	LMTK2_HUMAN			7	994	+	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)		234			Protein kinase.		A4D272|Q75MG7|Q9UPS3	Frame_Shift_Del	DEL	ENST00000297293.5	37	c.701delG	CCDS5654.1																																																																																				0.617	LMTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334560.1	NM_014916		25	104	NA	NA	NA	NA	NA	25	104	---	---	---	---
SERPINE1	5054	broad.mit.edu	37	7	100773778	100773779	+	Frame_Shift_Del	DEL	CA	CA	-	rs149070955		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	CA	CA	-	-	CA	CA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr7:100773778_100773779delCA	ENST00000223095.4	+	3	505_506	c.348_349delCA	c.(346-351)accacafs	p.TT116fs	SERPINE1_ENST00000445463.2_Frame_Shift_Del_p.TT101fs	NM_000602.4	NP_000593.1	P05121	PAI1_HUMAN	serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1	116					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to lipopolysaccharide (GO:0071222)|chronological cell aging (GO:0001300)|defense response to Gram-negative bacterium (GO:0050829)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|gene expression (GO:0010467)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell migration (GO:0030336)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of plasminogen activation (GO:0010757)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell-matrix adhesion (GO:2000098)|negative regulation of vascular wound healing (GO:0061044)|negative regulation of wound healing (GO:0061045)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of leukotriene production involved in inflammatory response (GO:0035491)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of receptor activity (GO:0010469)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(3)	20	Lung NSC(181;0.136)|all_lung(186;0.182)				Alteplase(DB00009)|Anistreplase(DB00029)|Drotrecogin alfa(DB00055)|Reteplase(DB00015)|Tenecteplase(DB00031)|Urokinase(DB00013)	AGATCAGCACCACAGACGCGAT	0.599																																							uc003uxt.2		NA																	0				ovary(1)|lung(1)|central_nervous_system(1)	3						c.(346-351)ACCACAfs		plasminogen activator inhibitor-1 isoform 1	Atorvastatin(DB01076)|Dimethyl sulfoxide(DB01093)|Drotrecogin alfa(DB00055)|Simvastatin(DB00641)|Tenecteplase(DB00031)|Troglitazone(DB00197)|Urokinase(DB00013)																																			SO:0001589	frameshift_variant	5054				angiogenesis|cellular response to chemical stimulus|cellular response to lipopolysaccharide|chronological cell aging|defense response to Gram-negative bacterium|fibrinolysis|negative regulation of apoptosis|negative regulation of cell adhesion mediated by integrin|negative regulation of fibrinolysis|negative regulation of plasminogen activation|negative regulation of smooth muscle cell migration|negative regulation of smooth muscle cell-matrix adhesion|negative regulation of vascular wound healing|platelet activation|platelet degranulation|positive regulation of angiogenesis|positive regulation of interleukin-8 production|positive regulation of leukotriene production involved in inflammatory response|positive regulation of monocyte chemotaxis|positive regulation of receptor-mediated endocytosis|regulation of receptor activity	extracellular matrix|extracellular space|plasma membrane|platelet alpha granule lumen	protease binding|serine-type endopeptidase inhibitor activity	g.chr7:100773778_100773779delCA	M16006	CCDS5711.1	7q22.1	2014-02-18	2005-08-18		ENSG00000106366	ENSG00000106366		"""Serine (or cysteine) peptidase inhibitors"""	8583	protein-coding gene	gene with protein product	"""plasminogen activator inhibitor, type I"""	173360	"""serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1"""	PLANH1, PAI1		3097076, 2891140, 24172014	Standard	NM_000602		Approved	PAI	uc003uxt.4	P05121	OTTHUMG00000157107	ENST00000223095.4:c.348_349delCA	7.37:g.100773780_100773781delCA	ENSP00000223095:p.Thr116fs					SERPINE1_uc011kkj.1_Frame_Shift_Del_p.T101fs|SERPINE1_uc003uxu.1_5'Flank	p.T116fs	NM_000602	NP_000593	P05121	PAI1_HUMAN			3	496_497	+	Lung NSC(181;0.136)|all_lung(186;0.182)		116_117					B7Z4S0|F8WD53	Frame_Shift_Del	DEL	ENST00000223095.4	37	c.348_349delCA	CCDS5711.1																																																																																				0.599	SERPINE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347458.1	NM_000602		110	207	NA	NA	NA	NA	NA	110	207	---	---	---	---
ADCY8	114	broad.mit.edu	37	8	131848677	131848677	+	Frame_Shift_Del	DEL	C	C	-			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr8:131848677delC	ENST00000286355.5	-	12	4613	c.2521delG	c.(2521-2523)gtgfs	p.V841fs	ADCY8_ENST00000377928.3_Frame_Shift_Del_p.V710fs	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	841					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			ATGGCCAACACCCCCGTGAAG	0.532										HNSCC(32;0.087)																													uc003ytd.3		NA																	0				skin(4)|large_intestine(1)|central_nervous_system(1)	6						c.(2521-2523)GTGfs		adenylate cyclase 8							117.0	97.0	104.0					8																	131848677		2203	4300	6503	SO:0001589	frameshift_variant	114				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding	g.chr8:131848677delC	Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.2521delG	8.37:g.131848677delC	ENSP00000286355:p.Val841fs	HNSCC(32;0.087)				ADCY8_uc010mds.2_Frame_Shift_Del_p.V710fs	p.V841fs	NM_001115	NP_001106	P40145	ADCY8_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.000538)		12	2777	-	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		841			Helical; (Potential).			Frame_Shift_Del	DEL	ENST00000286355.5	37	c.2521delG	CCDS6363.1																																																																																				0.532	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380080.1			7	61	NA	NA	NA	NA	NA	7	61	---	---	---	---
SLITRK2	84631	broad.mit.edu	37	X	144904509	144904509	+	Frame_Shift_Del	DEL	G	G	-			TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chrX:144904509delG	ENST00000370490.1	+	1	4821	c.566delG	c.(565-567)aggfs	p.R189fs	SLITRK2_ENST00000434188.2_Frame_Shift_Del_p.R189fs|SLITRK2_ENST00000428560.2_Frame_Shift_Del_p.R189fs|SLITRK2_ENST00000447897.2_Frame_Shift_Del_p.R189fs|SLITRK2_ENST00000413937.2_Frame_Shift_Del_p.R189fs			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	189					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					TTAGACCTCAGGGGGAATAGG	0.463																																							uc004fcd.2		NA																	0				ovary(5)|central_nervous_system(1)|pancreas(1)	7						c.(565-567)AGGfs		SLIT and NTRK-like family, member 2 precursor							145.0	123.0	131.0					X																	144904509		2203	4300	6503	SO:0001589	frameshift_variant	84631					integral to membrane		g.chrX:144904509delG	Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.566delG	X.37:g.144904509delG	ENSP00000359521:p.Arg189fs					SLITRK2_uc010nsp.2_Frame_Shift_Del_p.R189fs|SLITRK2_uc010nso.2_Frame_Shift_Del_p.R189fs|SLITRK2_uc011mwq.1_Frame_Shift_Del_p.R189fs|SLITRK2_uc011mwr.1_Frame_Shift_Del_p.R189fs|SLITRK2_uc011mws.1_Frame_Shift_Del_p.R189fs|SLITRK2_uc004fcg.2_Frame_Shift_Del_p.R189fs|SLITRK2_uc011mwt.1_Frame_Shift_Del_p.R189fs	p.R189fs	NM_032539	NP_115928	Q9H156	SLIK2_HUMAN			5	1556	+	Acute lymphoblastic leukemia(192;6.56e-05)		189			Extracellular (Potential).|LRR 6.		A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Frame_Shift_Del	DEL	ENST00000370490.1	37	c.566delG	CCDS14680.1																																																																																				0.463	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058633.1	NM_032539		27	210	NA	NA	NA	NA	NA	27	210	---	---	---	---
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	A	rs121913530		TCGA-05-4405-01A-21D-1855-08	TCGA-05-4405-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3ef10eb8-d713-4fda-9e03-bc594b356d77	78d03ee6-4bd7-427a-8b57-ed7d0877f545	g.chr12:25398285C>A	ENST00000256078.4	-	2	97	c.34G>T	c.(34-36)Ggt>Tgt	p.G12C	KRAS_ENST00000556131.1_Missense_Mutation_p.G12C|KRAS_ENST00000311936.3_Missense_Mutation_p.G12C|KRAS_ENST00000557334.1_Missense_Mutation_p.G12C	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1	G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12C(CALU1_LUNG)|G12C(NCIH2030_LUNG)|G12C(LU99_LUNG)|G12C(NCIH1792_LUNG)|G12R(KP2_PANCREAS)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(NCIH2122_LUNG)|G12C(NCIH358_LUNG)|G12R(PSN1_PANCREAS)|G12C(KYSE410_OESOPHAGUS)|G12S(A549_LUNG)|G12R(HUPT3_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12C(HCC44_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(SW1463_LARGE_INTESTINE)|G12C(NCIH23_LUNG)|G12C(LU65_LUNG)|G12C(NCIH1373_LUNG)|G12C(MIAPACA2_PANCREAS)|G12R(HS274T_BREAST)|G12S(LS123_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(OV56_OVARY)|G12C(IALM_LUNG)	119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		5144	Substitution - Missense(5142)|Insertion - In frame(2)	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12G(6)|p.G12N(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)GGT>TGT		c-K-ras2 protein isoform a precursor							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25398285C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>T	12.37:g.25398285C>A	ENSP00000256078:p.Gly12Cys	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_uc001rgq.1_Missense_Mutation_p.G12C|KRAS_uc001rgr.2_RNA	p.G12C	NM_033360	NP_203524	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		2	215	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		12		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).	GTP.		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	c.34G>T	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676185	0.88445	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90466	0.7014	M	0.90650	3.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	D	0.91833	0.5477	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	C	12	ENSP00000308495:G12C;ENSP00000452512:G12C;ENSP00000256078:G12C;ENSP00000451856:G12C	ENSP00000256078:G12C	G	-	1	0	KRAS	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		5	12	1	1	0.184627	0.000602	0.188656	5	12	NA	NA	NA	NA
