#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
NPHP4	261734	broad.mit.edu	37	1	5925161	5925161	+	Splice_Site	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr1:5925161C>A	ENST00000378156.4	-	27	4082		c.e27+1		MIR4689_ENST00000582517.1_RNA|NPHP4_ENST00000478423.2_Splice_Site	NM_015102.3	NP_055917.1	O75161	NPHP4_HUMAN	nephronophthisis 4						actin cytoskeleton organization (GO:0030036)|hippo signaling (GO:0035329)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|visual behavior (GO:0007632)	cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)	p.?(1)		NS(1)|breast(2)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(4)	47	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)		AGAGGCCGTACCTTCAGCTCC	0.637																																							uc001alq.1		NA																	1	Unknown(1)		lung(1)	pancreas(1)	1						c.e27+1		nephroretinin							40.0	48.0	45.0					1																	5925161		2022	4183	6205	SO:0001630	splice_region_variant	261734				actin cytoskeleton organization|cell-cell adhesion|signal transduction|visual behavior	cell-cell junction|centrosome|cilium|microtubule basal body	protein binding|structural molecule activity	g.chr1:5925161C>A	AB014573	CCDS44052.1	1p36	2010-03-26			ENSG00000131697	ENSG00000131697			19104	protein-coding gene	gene with protein product	"""nephroretinin"", ""nephrocystin-4"", ""POC10 centriolar protein homolog (Chlamydomonas)"""	607215				11920287, 12205563	Standard	XR_244787		Approved	SLSN4, KIAA0673, POC10	uc001alq.2	O75161	OTTHUMG00000000701	ENST00000378156.4:c.3816+1G>T	1.37:g.5925161C>A						NPHP4_uc001alr.1_3'UTR	p.K1272_splice	NM_015102	NP_055917	O75161	NPHP4_HUMAN		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)	27	4082	-	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)						Q8IWC0	Splice_Site	SNP	ENST00000378156.4	37	c.3816_splice	CCDS44052.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.397849	0.83120	.	.	ENSG00000131697	ENST00000378156	.	.	.	5.06	5.06	0.68205	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.4208	0.87514	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NPHP4	5847748	1.000000	0.71417	0.994000	0.49952	0.971000	0.66376	7.082000	0.76851	2.347000	0.79759	0.655000	0.94253	.		0.637	NPHP4-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001715.2		Intron	4	31	1	0	5.9392e-07	0.001168	7.13212e-07	4	31				
KAZN	23254	broad.mit.edu	37	1	14925597	14925597	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr1:14925597G>A	ENST00000376030.2	+	1	398	c.104G>A	c.(103-105)cGg>cAg	p.R35Q	KAZN_ENST00000422387.2_Missense_Mutation_p.R35Q|KAZN_ENST00000503743.1_Missense_Mutation_p.R35Q	NM_201628.2	NP_963922.2	Q674X7	KAZRN_HUMAN	kazrin, periplakin interacting protein	35					keratinization (GO:0031424)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|desmosome (GO:0030057)|nucleus (GO:0005634)		p.R35Q(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(6)|ovary(1)|prostate(2)	25						GCCACCAACCGGAGACTGGCG	0.731																																							uc001avm.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(103-105)CGG>CAG		kazrin isoform E							20.0	23.0	22.0					1																	14925597		1862	4073	5935	SO:0001583	missense	23254				keratinization	cornified envelope|cytoplasm|desmosome|nucleus		g.chr1:14925597G>A	AY505119	CCDS30604.1, CCDS41267.1, CCDS152.2, CCDS41268.1	1p36.21	2014-02-12	2011-01-31		ENSG00000189337	ENSG00000189337		"""Sterile alpha motif (SAM) domain containing"""	29173	protein-coding gene	gene with protein product						15337775, 18840647	Standard	NM_015209		Approved	KIAA1026, KAZRIN, FLJ43806	uc001avm.4	Q674X7	OTTHUMG00000002042	ENST00000376030.2:c.104G>A	1.37:g.14925597G>A	ENSP00000365198:p.Arg35Gln					KAZ_uc009vog.1_Missense_Mutation_p.R35Q|KAZ_uc010obj.1_Missense_Mutation_p.R35Q	p.R35Q	NM_201628	NP_963922	Q674X7	KAZRN_HUMAN			1	385	+			35					B0QYQ0|B1AK78|Q5TGF1|Q674X4|Q674X6|Q6ZUD1|Q8IYN7|Q8N409|Q9UIL2|Q9UPX4	Missense_Mutation	SNP	ENST00000376030.2	37	c.104G>A	CCDS152.2	.	.	.	.	.	.	.	.	.	.	G	14.93	2.683729	0.47991	.	.	ENSG00000189337	ENST00000376030;ENST00000503743;ENST00000422387	T;T;T	0.53206	0.63;0.63;0.63	3.81	3.81	0.43845	.	0.128507	0.29861	U	0.011013	T	0.47229	0.1434	N	0.25647	0.755	0.80722	D	1	B;D	0.69078	0.248;0.997	B;D	0.67725	0.016;0.953	T	0.38845	-0.9642	10	0.02654	T	1	-11.5167	13.1297	0.59373	0.0:0.0:1.0:0.0	.	35;35	Q674X7-2;Q674X7	.;KAZRN_HUMAN	Q	35	ENSP00000365198:R35Q;ENSP00000426015:R35Q;ENSP00000391728:R35Q	ENSP00000365198:R35Q	R	+	2	0	KAZN	14798184	1.000000	0.71417	1.000000	0.80357	0.825000	0.46686	6.071000	0.71229	1.653000	0.50694	0.313000	0.20887	CGG		0.731	KAZN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005690.2	NM_001017999		3	51	0	0	0	0.004672	0	3	51				
HTR6	3362	broad.mit.edu	37	1	19992913	19992913	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr1:19992913G>T	ENST00000289753.1	+	1	1134	c.667G>T	c.(667-669)Gcc>Tcc	p.A223S		NM_000871.1	NP_000862.1	P50406	5HT6R_HUMAN	5-hydroxytryptamine (serotonin) receptor 6, G protein-coupled	223					brain development (GO:0007420)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|learning (GO:0007612)|long-term synaptic potentiation (GO:0060291)|negative regulation of acetylcholine secretion, neurotransmission (GO:0014058)|negative regulation of gamma-aminobutyric acid secretion (GO:0014053)|negative regulation of glutamate secretion (GO:0014050)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|synaptic transmission (GO:0007268)	cilium (GO:0005929)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	histamine receptor activity (GO:0004969)|serotonin receptor activity (GO:0004993)	p.A223S(1)		endometrium(1)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00519)|Breast(348;0.00526)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;5.81e-05)|Kidney(64;0.00017)|GBM - Glioblastoma multiforme(114;0.00117)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)	Amitriptyline(DB00321)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Asenapine(DB06216)|Chlorpromazine(DB00477)|Clozapine(DB00363)|Doxepin(DB01142)|Ergoloid mesylate(DB01049)|Iloperidone(DB04946)|Imipramine(DB00458)|Loxapine(DB00408)|Mianserin(DB06148)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Quetiapine(DB01224)|Sertindole(DB06144)|Ziprasidone(DB00246)	CGTGCAGGTGGCCTCCCTCAC	0.657																																					Esophageal Squamous(168;1879 2619 6848 21062)	Esophageal Squamous(168;1879 2619 6848 21062)	uc001bcl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(667-669)GCC>TCC		5-hydroxytryptamine (serotonin) receptor 6	Granisetron(DB00889)|Ondansetron(DB00904)|Sertindole(DB06144)						22.0	23.0	23.0					1																	19992913		2202	4299	6501	SO:0001583	missense	3362				G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane	histamine receptor activity|protein binding	g.chr1:19992913G>T	L41147	CCDS197.1	1p36-p35	2012-08-08	2012-02-03		ENSG00000158748	ENSG00000158748		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5301	protein-coding gene	gene with protein product		601109	"""5-hydroxytryptamine (serotonin) receptor 6"""			8522988	Standard	NM_000871		Approved	5-HT6, 5-HT6R	uc001bcl.3	P50406	OTTHUMG00000002713	ENST00000289753.1:c.667G>T	1.37:g.19992913G>T	ENSP00000289753:p.Ala223Ser						p.A223S	NM_000871	NP_000862	P50406	5HT6R_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;5.81e-05)|Kidney(64;0.00017)|GBM - Glioblastoma multiforme(114;0.00117)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)	1	1134	+		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00519)|Breast(348;0.00526)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)	223			Cytoplasmic (By similarity).		Q13640|Q5TGZ1	Missense_Mutation	SNP	ENST00000289753.1	37	c.667G>T	CCDS197.1	.	.	.	.	.	.	.	.	.	.	G	12.58	1.980386	0.34942	.	.	ENSG00000158748	ENST00000289753	T	0.72942	-0.7	4.07	3.15	0.36227	GPCR, rhodopsin-like superfamily (1);	0.124773	0.53938	D	0.000051	T	0.72510	0.3469	L	0.33792	1.035	0.26822	N	0.968775	D	0.71674	0.998	D	0.67548	0.952	T	0.63633	-0.6593	9	.	.	.	.	10.725	0.46064	0.0967:0.0:0.9033:0.0	.	223	P50406	5HT6R_HUMAN	S	223	ENSP00000289753:A223S	.	A	+	1	0	HTR6	19865500	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	7.781000	0.85668	0.850000	0.35239	0.491000	0.48974	GCC		0.657	HTR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007704.1	NM_000871		12	25	1	0	6.42651e-13	0.010729	8.76626e-13	12	25				
COL24A1	255631	broad.mit.edu	37	1	86590968	86590968	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr1:86590968C>A	ENST00000370571.2	-	3	1417	c.1051G>T	c.(1051-1053)Gtg>Ttg	p.V351L	COL24A1_ENST00000436319.1_Missense_Mutation_p.V351L	NM_152890.5	NP_690850.2	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1	351					extracellular matrix organization (GO:0030198)|hematopoietic progenitor cell differentiation (GO:0002244)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)	p.V351L(1)		NS(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(9)|liver(1)|lung(56)|ovary(4)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	101				all cancers(265;0.0627)|Epithelial(280;0.0689)		TGAGTGGTCACTGACAGGCTG	0.413																																							uc001dlj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(1)|skin(1)	5						c.(1051-1053)GTG>TTG		collagen, type XXIV, alpha 1 precursor							136.0	120.0	125.0					1																	86590968		1936	4135	6071	SO:0001583	missense	255631				cell adhesion	collagen	extracellular matrix structural constituent	g.chr1:86590968C>A	AF410793	CCDS41353.1	1p22.3-p22.2	2013-01-16			ENSG00000171502	ENSG00000171502		"""Collagens"""	20821	protein-coding gene	gene with protein product		610025					Standard	NM_152890		Approved		uc001dlj.3	Q17RW2	OTTHUMG00000010629	ENST00000370571.2:c.1051G>T	1.37:g.86590968C>A	ENSP00000359603:p.Val351Leu					COL24A1_uc010osd.1_5'UTR|COL24A1_uc001dlk.2_RNA|COL24A1_uc010ose.1_RNA|COL24A1_uc010osf.1_RNA|COL24A1_uc009wcq.2_Missense_Mutation_p.V351L	p.V351L	NM_152890	NP_690850	Q17RW2	COOA1_HUMAN		all cancers(265;0.0627)|Epithelial(280;0.0689)	3	1093	-			351					C9J1X6|Q14BD7|Q59EX5|Q5VY50|Q7Z5L5	Missense_Mutation	SNP	ENST00000370571.2	37	c.1051G>T	CCDS41353.1	.	.	.	.	.	.	.	.	.	.	C	0.131	-1.113802	0.01799	.	.	ENSG00000171502	ENST00000370571;ENST00000436319	T;T	0.17691	2.26;2.26	5.35	-3.25	0.05079	.	0.915280	0.08955	N	0.869576	T	0.02380	0.0073	L	0.27053	0.805	0.09310	N	1	B;B	0.14012	0.009;0.001	B;B	0.10450	0.005;0.001	T	0.46345	-0.9198	10	0.16420	T	0.52	.	4.951	0.14013	0.0883:0.4511:0.0879:0.3726	.	351;351	F8WDM8;Q17RW2	.;COOA1_HUMAN	L	351	ENSP00000359603:V351L;ENSP00000392531:V351L	ENSP00000359603:V351L	V	-	1	0	COL24A1	86363556	0.000000	0.05858	0.002000	0.10522	0.055000	0.15305	-2.256000	0.01181	-1.103000	0.03019	0.563000	0.77884	GTG		0.413	COL24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029335.4	NM_152890		46	48	1	0	3.77016e-25	0.013114	6.30604e-25	46	48				
GBP4	115361	broad.mit.edu	37	1	89658733	89658733	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr1:89658733G>T	ENST00000355754.6	-	5	621	c.524C>A	c.(523-525)cCt>cAt	p.P175H		NM_052941.4	NP_443173.2	Q96PP9	GBP4_HUMAN	guanylate binding protein 4	175	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.P175H(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(19)|skin(1)|stomach(2)|urinary_tract(1)	33				all cancers(265;0.00723)|Epithelial(280;0.0291)		AGCTTCATCAGGTCTGGGGCA	0.478																																							uc001dnb.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(523-525)CCT>CAT		guanylate binding protein 4							130.0	122.0	125.0					1																	89658733		2203	4300	6503	SO:0001583	missense	115361					cytoplasm	GTP binding|GTPase activity	g.chr1:89658733G>T	AF288814	CCDS721.1	1p22.2	2008-02-05			ENSG00000162654	ENSG00000162654			20480	protein-coding gene	gene with protein product		612466				16689661	Standard	NM_052941		Approved	Mpa2	uc001dnb.3	Q96PP9	OTTHUMG00000010663	ENST00000355754.6:c.524C>A	1.37:g.89658733G>T	ENSP00000359490:p.Pro175His						p.P175H	NM_052941	NP_443173	Q96PP9	GBP4_HUMAN		all cancers(265;0.00723)|Epithelial(280;0.0291)	5	640	-			175					B2R630|Q05D63|Q6NSL0|Q86T99	Missense_Mutation	SNP	ENST00000355754.6	37	c.524C>A	CCDS721.1	.	.	.	.	.	.	.	.	.	.	G	13.00	2.106327	0.37145	.	.	ENSG00000162654	ENST00000355754	T	0.74106	-0.81	4.92	3.04	0.35103	Guanylate-binding protein, N-terminal (1);	1.445070	0.03945	N	0.287506	T	0.58977	0.2160	M	0.68593	2.085	0.09310	N	1	B	0.23128	0.08	B	0.34385	0.181	T	0.51116	-0.8746	10	0.40728	T	0.16	.	3.9255	0.09262	0.1933:0.0:0.6156:0.1911	.	175	Q96PP9	GBP4_HUMAN	H	175	ENSP00000359490:P175H	ENSP00000359490:P175H	P	-	2	0	GBP4	89431321	0.000000	0.05858	0.003000	0.11579	0.001000	0.01503	-0.168000	0.09925	1.434000	0.47414	0.650000	0.86243	CCT		0.478	GBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029409.1	NM_052941		22	71	1	0	2.89027e-11	0.002299	3.79516e-11	22	71				
PDE4DIP	9659	broad.mit.edu	37	1	145075718	145075718	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr1:145075718G>A	ENST00000530740.1	-	1	183	c.145C>T	c.(145-147)Cgg>Tgg	p.R49W	PDE4DIP_ENST00000369359.4_Missense_Mutation_p.R49W|PDE4DIP_ENST00000369348.3_Missense_Mutation_p.R49W|PDE4DIP_ENST00000369345.4_Missense_Mutation_p.R49W			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	0			I -> T (in dbSNP:rs573724). {ECO:0000269|PubMed:11374908, ECO:0000269|PubMed:15489334}.		cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)	p.R49W(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CGTCTTTCCCGGCTCGGGGTC	0.716			T	PDGFRB	MPD																																		uc001emh.2		NA		Dom	yes		1	1q12	9659	T	phosphodiesterase 4D interacting protein (myomegalin)			L	PDGFRB		MPD		1	Substitution - Missense(1)		lung(1)	ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5						c.(145-147)CGG>TGG		phosphodiesterase 4D interacting protein isoform							34.0	46.0	42.0					1																	145075718		2193	4286	6479	SO:0001583	missense	9659				cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding	g.chr1:145075718G>A	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000530740.1:c.145C>T	1.37:g.145075718G>A	ENSP00000435654:p.Arg49Trp					NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elo.2_Missense_Mutation_p.R49W|PDE4DIP_uc001emk.2_Missense_Mutation_p.R49W	p.R49W	NM_022359	NP_071754	Q5VU43	MYOME_HUMAN		Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)	1	362	-			723					A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	ENST00000530740.1	37	c.145C>T		.	.	.	.	.	.	.	.	.	.	G	13.69	2.312286	0.40895	.	.	ENSG00000178104	ENST00000530740;ENST00000369359;ENST00000369348;ENST00000369345	T;T;T	0.11385	4.42;4.42;2.78	3.6	0.524	0.17066	.	.	.	.	.	T	0.01489	0.0048	N	0.24115	0.695	0.09310	N	1	P;B	0.37276	0.589;0.002	B;B	0.24394	0.053;0.001	T	0.44697	-0.9311	9	0.87932	D	0	.	2.1701	0.03847	0.1148:0.1959:0.4877:0.2016	.	49;49	Q5TB27;E9PJ64	.;.	W	49	ENSP00000435654:R49W;ENSP00000358366:R49W;ENSP00000358354:R49W	ENSP00000358351:R49W	R	-	1	2	PDE4DIP	143787075	0.000000	0.05858	0.002000	0.10522	0.060000	0.15804	0.016000	0.13377	0.004000	0.14682	0.561000	0.74099	CGG		0.716	PDE4DIP-036	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000384663.2	NM_022359		36	108	0	0	0	0.003755	0	36	108				
NBPF10	100132406	broad.mit.edu	37	1	145367739	145367739	+	Silent	SNP	A	A	G			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr1:145367739A>G	ENST00000342960.5	+	83	10370	c.10335A>G	c.(10333-10335)aaA>aaG	p.K3445K	NBPF10_ENST00000369338.1_Intron|NBPF10_ENST00000369339.3_Intron	NM_001039703.4	NP_001034792.4	Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	750						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.K3445K(4)		NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		ggaaggggaaaaaaagaaggg	0.413																																							uc001end.3		NA																	4	Substitution - coding silent(4)		prostate(3)|kidney(1)		0						c.(10558-10560)AAA>AAG		hypothetical protein LOC100132406																																				SO:0001819	synonymous_variant	100132406							g.chr1:145367739A>G	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000342960.5:c.10335A>G	1.37:g.145367739A>G						NBPF9_uc010oye.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Intron|NBPF10_uc010oyk.1_Intron|NBPF10_uc010oyl.1_Intron	p.K3520K	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN		Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)	85	10595	+	all_hematologic(923;0.032)		3445					Q5RHC0|Q9NWN6	Silent	SNP	ENST00000342960.5	37	c.10560A>G	CCDS53355.1																																																																																				0.413	NBPF10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001039703		8	115	0	0	0	0.00308	0	8	115				
HRNR	388697	broad.mit.edu	37	1	152187539	152187540	+	Missense_Mutation	DNP	CC	CC	AT	rs376617048|rs369558991		TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr1:152187539_152187540CC>AT	ENST00000368801.2	-	3	6640_6641	c.6565_6566GG>AT	c.(6565-6567)GGg>ATg	p.G2189M	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	2189					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.G2189M(1)|p.G2189W(1)		autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CGAACCGGACCCATGTCGGCCG	0.644																																							uc001ezt.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(2)|ovary(1)	3						c.(6565-6567)GGG>ATG		hornerin																																				SO:0001583	missense	388697				keratinization		calcium ion binding|protein binding	g.chr1:152187539_152187540CC>AT	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.6565_6566delinsAT	1.37:g.152187539_152187540delinsAT	ENSP00000357791:p.Gly2189Met						p.G2189M	NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	6641_6642	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		2189			24.		Q5DT20|Q5U1F4	Missense_Mutation	DNP	ENST00000368801.2	37	c.6565_6566GG>AT	CCDS30859.1																																																																																				0.644	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868		11	406	0	0	0	0.004672	0	11	406				
ASH1L	55870	broad.mit.edu	37	1	155449990	155449990	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr1:155449990C>T	ENST00000368346.3	-	3	3310	c.2671G>A	c.(2671-2673)Ggc>Agc	p.G891S	ASH1L_ENST00000392403.3_Missense_Mutation_p.G891S			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	891					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)	p.G891S(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			TTAGGCCTGCCTCTCTTTTTT	0.453																																							uc009wqq.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(5)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	11						c.(2671-2673)GGC>AGC		absent, small, or homeotic 1-like							112.0	113.0	113.0					1																	155449990		2203	4300	6503	SO:0001583	missense	55870				cell-cell signaling|DNA packaging|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|Golgi apparatus|nucleus|tight junction	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding	g.chr1:155449990C>T	AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.2671G>A	1.37:g.155449990C>T	ENSP00000357330:p.Gly891Ser					ASH1L_uc001fkt.2_Missense_Mutation_p.G891S|ASH1L_uc009wqr.1_Missense_Mutation_p.G891S	p.G891S	NM_018489	NP_060959	Q9NR48	ASH1L_HUMAN	Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)		3	3151	-	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		891			A.T hook 1.		Q59GP1|Q5T714|Q5T715|Q9P2C7	Missense_Mutation	SNP	ENST00000368346.3	37	c.2671G>A		.	.	.	.	.	.	.	.	.	.	C	19.79	3.893607	0.72639	.	.	ENSG00000116539	ENST00000368346;ENST00000392403	D;D	0.96802	-4.13;-4.13	5.31	5.31	0.75309	AT hook, DNA-binding motif (1);	0.000000	0.85682	D	0.000000	D	0.95815	0.8638	N	0.19112	0.55	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.96222	0.9161	10	0.51188	T	0.08	.	18.7713	0.91893	0.0:1.0:0.0:0.0	.	891;891	Q9NR48;Q9NR48-2	ASH1L_HUMAN;.	S	891	ENSP00000357330:G891S;ENSP00000376204:G891S	ENSP00000357330:G891S	G	-	1	0	ASH1L	153716614	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.485000	0.53208	2.768000	0.95171	0.650000	0.86243	GGC		0.453	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039400.1	NM_018489		135	78	0	0	0	0.00361	0	135	78				
OR10X1	128367	broad.mit.edu	37	1	158549146	158549146	+	Missense_Mutation	SNP	C	C	A	rs267598098		TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr1:158549146C>A	ENST00000368150.1	-	1	543	c.544G>T	c.(544-546)Gac>Tac	p.D182Y		NM_001004477.1	NP_001004477.1	Q8NGY0	O10X1_HUMAN	olfactory receptor, family 10, subfamily X, member 1 (gene/pseudogene)	182						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.D182Y(1)		breast(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(22)|ovary(2)|skin(2)|urinary_tract(1)	37	all_hematologic(112;0.0378)					CAGAAAGAGTCCCTGAATATC	0.438																																							uc010pin.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(544-546)GAC>TAC		olfactory receptor, family 10, subfamily X,							65.0	66.0	66.0					1																	158549146		2203	4300	6503	SO:0001583	missense	128367				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158549146C>A	BK004194	CCDS30900.1	1q23.1	2013-10-10	2013-10-10	2004-03-10	ENSG00000186400	ENSG00000186400		"""GPCR / Class A : Olfactory receptors"""	14995	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily X, member 1"""	OR10X1P			Standard	NM_001004477		Approved		uc010pin.2	Q8NGY0	OTTHUMG00000019635	ENST00000368150.1:c.544G>T	1.37:g.158549146C>A	ENSP00000357132:p.Asp182Tyr						p.D182Y	NM_001004477	NP_001004477	Q8NGY0	O10X1_HUMAN			1	544	-	all_hematologic(112;0.0378)		182			Extracellular (Potential).		Q6IFR8	Missense_Mutation	SNP	ENST00000368150.1	37	c.544G>T	CCDS30900.1	.	.	.	.	.	.	.	.	.	.	C	10.90	1.480259	0.26598	.	.	ENSG00000186400	ENST00000368150	T	0.35973	1.28	5.0	0.886	0.19194	GPCR, rhodopsin-like superfamily (1);	0.580257	0.15417	N	0.263439	T	0.07999	0.0200	N	0.02916	-0.46	0.09310	N	1	P	0.39071	0.658	P	0.45449	0.481	T	0.09930	-1.0652	10	0.66056	D	0.02	.	5.937	0.19171	0.0:0.4616:0.2872:0.2511	.	182	Q8NGY0	O10X1_HUMAN	Y	182	ENSP00000357132:D182Y	ENSP00000357132:D182Y	D	-	1	0	OR10X1	156815770	0.000000	0.05858	0.003000	0.11579	0.548000	0.35241	-0.661000	0.05311	0.300000	0.22699	-0.252000	0.11476	GAC		0.438	OR10X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051850.2	NM_001004477		51	38	1	0	1.81118e-26	0.00361	3.12235e-26	51	38				
OR10J3	441911	broad.mit.edu	37	1	159283997	159283997	+	Silent	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr1:159283997C>A	ENST00000332217.5	-	1	452	c.453G>T	c.(451-453)ggG>ggT	p.G151G		NM_001004467.1	NP_001004467.1	Q5JRS4	O10J3_HUMAN	olfactory receptor, family 10, subfamily J, member 3	151						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G151G(1)		breast(2)|endometrium(7)|kidney(4)|large_intestine(7)|lung(19)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	47	all_hematologic(112;0.0429)					CAAGGCCAATCCCCAGTGATC	0.512																																							uc010piu.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(451-453)GGG>GGT		olfactory receptor, family 10, subfamily J,							69.0	63.0	65.0					1																	159283997		2203	4300	6503	SO:0001819	synonymous_variant	441911				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:159283997C>A		CCDS30909.1	1q23.2	2012-08-09		2004-03-10	ENSG00000196266	ENSG00000196266		"""GPCR / Class A : Olfactory receptors"""	14992	protein-coding gene	gene with protein product				OR10J3P			Standard	NM_001004467		Approved		uc010piu.2	Q5JRS4	OTTHUMG00000037233	ENST00000332217.5:c.453G>T	1.37:g.159283997C>A							p.G151G	NM_001004467	NP_001004467	Q5JRS4	O10J3_HUMAN			1	453	-	all_hematologic(112;0.0429)		151			Helical; Name=4; (Potential).			Silent	SNP	ENST00000332217.5	37	c.453G>T	CCDS30909.1																																																																																				0.512	OR10J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090629.1			55	36	1	0	3.13117e-07	0.00361	3.82547e-07	55	36				
ATP1A4	480	broad.mit.edu	37	1	160124868	160124868	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr1:160124868A>T	ENST00000368081.4	+	3	712	c.241A>T	c.(241-243)Act>Tct	p.T81S		NM_144699.3	NP_653300.2	Q13733	AT1A4_HUMAN	ATPase, Na+/K+ transporting, alpha 4 polypeptide	81					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|fertilization (GO:0009566)|ion transmembrane transport (GO:0034220)|potassium ion transport (GO:0006813)|regulation of cellular pH (GO:0030641)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)	p.T81S(1)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(34)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	75	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GGAAATCCTGACTCGAGGTGG	0.507																																							uc001fve.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)	4						c.(241-243)ACT>TCT		Na+/K+ -ATPase alpha 4 subunit isoform 1							136.0	137.0	137.0					1																	160124868		2203	4300	6503	SO:0001583	missense	480				ATP biosynthetic process|ATP hydrolysis coupled proton transport|regulation of cellular pH|sperm motility	sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity	g.chr1:160124868A>T	BC028297	CCDS1197.1, CCDS44255.1	1q23.2	2012-10-22	2002-02-25		ENSG00000132681	ENSG00000132681		"""ATPases / P-type"""	14073	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-4"", ""sodium pump subunit alpha-4"", ""sodium-potassium ATPase catalytic subunit alpha-4"""	607321	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 2"""	ATP1AL2		1981991, 3035563	Standard	NM_144699		Approved		uc001fve.4	Q13733	OTTHUMG00000031609	ENST00000368081.4:c.241A>T	1.37:g.160124868A>T	ENSP00000357060:p.Thr81Ser					ATP1A4_uc001fvf.3_RNA	p.T81S	NM_144699	NP_653300	Q13733	AT1A4_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.111)		3	720	+	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		81			Cytoplasmic (Potential).		Q504T2|Q7Z4I9|Q8TBN8|Q8WXA7|Q8WXH7|Q8WY13	Missense_Mutation	SNP	ENST00000368081.4	37	c.241A>T	CCDS1197.1	.	.	.	.	.	.	.	.	.	.	A	11.66	1.703408	0.30232	.	.	ENSG00000132681	ENST00000368081	T	0.77877	-1.13	4.48	-8.96	0.00761	ATPase, P-type cation-transporter, N-terminal (2);ATPase,  P-type, cytoplasmic transduction domain A (1);	4.695080	0.01390	N	0.013216	T	0.35364	0.0929	N	0.16656	0.425	0.22330	N	0.9992	B	0.06786	0.001	B	0.15870	0.014	T	0.37126	-0.9719	10	0.72032	D	0.01	.	4.254	0.10708	0.13:0.3223:0.4484:0.0993	.	81	Q13733	AT1A4_HUMAN	S	81	ENSP00000357060:T81S	ENSP00000357060:T81S	T	+	1	0	ATP1A4	158391492	0.030000	0.19436	0.000000	0.03702	0.067000	0.16453	0.258000	0.18387	-1.691000	0.01430	-0.316000	0.08728	ACT		0.507	ATP1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077415.1	NM_144699		30	201	0	0	0	0.009535	0	30	201				
TNN	63923	broad.mit.edu	37	1	175092666	175092666	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr1:175092666G>T	ENST00000239462.4	+	12	2894	c.2781G>T	c.(2779-2781)agG>agT	p.R927S		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	927	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)		p.R927S(1)		NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		GAGAGACCAGGGAGGTTCCGG	0.622																																							uc001gkl.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(5)|ovary(3)|central_nervous_system(1)	9						c.(2779-2781)AGG>AGT		tenascin N precursor							95.0	80.0	85.0					1																	175092666		2203	4300	6503	SO:0001583	missense	63923				cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix		g.chr1:175092666G>T	AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.2781G>T	1.37:g.175092666G>T	ENSP00000239462:p.Arg927Ser						p.R927S	NM_022093	NP_071376	Q9UQP3	TENN_HUMAN		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)	12	2894	+		Breast(1374;0.000962)	927			Fibronectin type-III 8.		B9EGP3|Q5R360	Missense_Mutation	SNP	ENST00000239462.4	37	c.2781G>T	CCDS30943.1	.	.	.	.	.	.	.	.	.	.	G	10.39	1.336003	0.24253	.	.	ENSG00000120332	ENST00000239462;ENST00000539081	T	0.52295	0.67	4.98	4.06	0.47325	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.977933	0.08448	N	0.944400	T	0.39682	0.1087	L	0.45285	1.41	0.29649	N	0.844115	B	0.19073	0.033	B	0.26416	0.069	T	0.39820	-0.9595	10	0.09590	T	0.72	.	9.0662	0.36465	0.1731:0.0:0.8269:0.0	.	927	Q9UQP3	TENN_HUMAN	S	927;750	ENSP00000239462:R927S	ENSP00000239462:R927S	R	+	3	2	TNN	173359289	0.957000	0.32711	0.580000	0.28601	0.177000	0.22998	1.494000	0.35616	1.211000	0.43351	0.462000	0.41574	AGG		0.622	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527		61	27	1	0	1.74971e-23	0.00361	2.85854e-23	61	27				
PAPPA2	60676	broad.mit.edu	37	1	176564316	176564316	+	Missense_Mutation	SNP	C	C	T	rs200777009		TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr1:176564316C>T	ENST00000367662.3	+	3	2740	c.1576C>T	c.(1576-1578)Cgc>Tgc	p.R526C	PAPPA2_ENST00000367661.3_Missense_Mutation_p.R526C	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	526	Metalloprotease.				bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.R526C(2)		NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						GAAGGTGATACGCTACCAGGT	0.537																																							uc001gkz.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						c.(1576-1578)CGC>TGC		pappalysin 2 isoform 1							52.0	54.0	54.0					1																	176564316		2082	4209	6291	SO:0001583	missense	60676				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding	g.chr1:176564316C>T	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.1576C>T	1.37:g.176564316C>T	ENSP00000356634:p.Arg526Cys					PAPPA2_uc001gky.1_Missense_Mutation_p.R526C|PAPPA2_uc009www.2_RNA	p.R526C	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN			3	2740	+			526			Metalloprotease.		A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	37	c.1576C>T	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	C	15.02	2.707802	0.48412	.	.	ENSG00000116183	ENST00000367662;ENST00000367661	T;T	0.59083	0.29;0.29	5.24	4.33	0.51752	.	0.055111	0.64402	D	0.000001	T	0.76821	0.4041	M	0.82716	2.605	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.986	T	0.80625	-0.1299	10	0.87932	D	0	-21.444	13.4971	0.61432	0.0:0.9241:0.0:0.0759	.	526;526	Q9BXP8;A9Z1Y8	PAPP2_HUMAN;.	C	526	ENSP00000356634:R526C;ENSP00000356633:R526C	ENSP00000356633:R526C	R	+	1	0	PAPPA2	174830939	1.000000	0.71417	0.992000	0.48379	0.166000	0.22503	7.679000	0.84048	1.207000	0.43291	-0.145000	0.13849	CGC		0.537	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1			13	51	0	0	0	0.001368	0	13	51				
CACNA1E	777	broad.mit.edu	37	1	181620507	181620507	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr1:181620507C>A	ENST00000367573.2	+	7	985	c.985C>A	c.(985-987)Ctg>Atg	p.L329M	CACNA1E_ENST00000360108.3_Missense_Mutation_p.L329M|CACNA1E_ENST00000367567.4_5'UTR|CACNA1E_ENST00000526775.1_Missense_Mutation_p.L329M|CACNA1E_ENST00000357570.5_Missense_Mutation_p.L280M|CACNA1E_ENST00000367570.1_Missense_Mutation_p.L329M|CACNA1E_ENST00000358338.5_Missense_Mutation_p.L280M	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	329					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)	p.L329M(2)		NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						CTGGAATTGGCTGTACTTCAT	0.428																																							uc001gow.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|central_nervous_system(2)|pancreas(1)	6						c.(985-987)CTG>ATG		calcium channel, voltage-dependent, R type,							185.0	177.0	179.0					1																	181620507		1921	4137	6058	SO:0001583	missense	777				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity	g.chr1:181620507C>A	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.985C>A	1.37:g.181620507C>A	ENSP00000356545:p.Leu329Met					CACNA1E_uc009wxr.2_Missense_Mutation_p.L236M|CACNA1E_uc009wxs.2_Missense_Mutation_p.L236M	p.L329M	NM_000721	NP_000712	Q15878	CAC1E_HUMAN			7	1150	+			329			I.|Helical; Name=S6 of repeat I.		B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	37	c.985C>A	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	C	19.18	3.777983	0.70107	.	.	ENSG00000198216	ENST00000524607;ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.98807	-5.15;-5.15;-5.15;-5.15;-5.15;-5.15;-5.15	5.12	5.12	0.69794	.	0.431684	0.22968	N	0.053477	D	0.97461	0.9169	M	0.68952	2.095	0.80722	D	1	P;P	0.46912	0.886;0.886	B;B	0.38428	0.273;0.273	D	0.97962	1.0338	10	0.45353	T	0.12	.	18.5282	0.90981	0.0:1.0:0.0:0.0	.	329;329	Q15878-2;Q15878-3	.;.	M	329;329;329;280;280;329;329	ENSP00000432038:L329M;ENSP00000356542:L329M;ENSP00000434814:L329M;ENSP00000350183:L280M;ENSP00000351101:L280M;ENSP00000353222:L329M;ENSP00000356545:L329M	ENSP00000350183:L280M	L	+	1	2	CACNA1E	179887130	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.629000	0.37071	2.549000	0.85964	0.563000	0.77884	CTG		0.428	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721		135	74	1	0	1.26737e-53	0.00361	2.61861e-53	135	74				
HMCN1	83872	broad.mit.edu	37	1	186026523	186026523	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr1:186026523G>T	ENST00000271588.4	+	46	7531	c.7302G>T	c.(7300-7302)agG>agT	p.R2434S	HMCN1_ENST00000367492.2_Missense_Mutation_p.R2434S	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	2434	Ig-like C2-type 22.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.R2434S(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						ATTCTGTGAGGATTCTTTCAG	0.393																																							uc001grq.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(22)|skin(1)	23						c.(7300-7302)AGG>AGT		hemicentin 1 precursor							104.0	103.0	103.0					1																	186026523		2203	4300	6503	SO:0001583	missense	83872				response to stimulus|visual perception	basement membrane	calcium ion binding	g.chr1:186026523G>T	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.7302G>T	1.37:g.186026523G>T	ENSP00000271588:p.Arg2434Ser						p.R2434S	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN			46	7531	+			2434			Ig-like C2-type 22.		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	c.7302G>T	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	G	14.44	2.536865	0.45176	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.28454	1.61;1.61	5.8	1.21	0.21127	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.265450	0.43747	D	0.000528	T	0.15782	0.0380	N	0.12853	0.265	0.28004	N	0.935163	P	0.38395	0.629	B	0.37198	0.243	T	0.10989	-1.0606	10	0.38643	T	0.18	.	9.9802	0.41809	0.6909:0.0:0.3091:0.0	.	2434	Q96RW7	HMCN1_HUMAN	S	2434	ENSP00000271588:R2434S;ENSP00000356462:R2434S	ENSP00000271588:R2434S	R	+	3	2	HMCN1	184293146	1.000000	0.71417	0.937000	0.37676	0.927000	0.56198	0.815000	0.27253	-0.020000	0.14032	0.650000	0.86243	AGG		0.393	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935		61	46	1	0	1.84395e-34	0.00361	3.47752e-34	61	46				
OCLM	10896	broad.mit.edu	37	1	186370265	186370265	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr1:186370265G>T	ENST00000574641.1	+	1	562	c.88G>T	c.(88-90)Ggt>Tgt	p.G30C	C1orf27_ENST00000419367.3_Intron|C1orf27_ENST00000287859.6_Intron|C1orf27_ENST00000432021.3_Intron|C1orf27_ENST00000367470.3_Intron	NM_022375.3	NP_071770.1	Q9Y5M6	TISR_HUMAN	oculomedin	30					visual perception (GO:0007601)												TTATAAAAGTGGTATTATATG	0.318																																							uc001gry.2		NA																	0					0						c.(88-90)GGT>TGT		oculomedin							113.0	106.0	108.0					1																	186370265		1801	4068	5869	SO:0001583	missense	10896				visual perception			g.chr1:186370265G>T	AF142063	CCDS58051.1	1q31.1	2013-09-24			ENSG00000262180	ENSG00000262180			8103	protein-coding gene	gene with protein product		604301				10362512	Standard	NM_022375		Approved		uc001gry.3	Q9Y5M6	OTTHUMG00000177601	ENST00000574641.1:c.88G>T	1.37:g.186370265G>T	ENSP00000460371:p.Gly30Cys					C1orf27_uc001grw.2_Intron|C1orf27_uc010poq.1_Intron|C1orf27_uc010por.1_Intron	p.G30C	NM_022375	NP_071770	Q9Y5M6	TISR_HUMAN			1	562	+			30					Q4G0F9	Missense_Mutation	SNP	ENST00000574641.1	37	c.88G>T	CCDS58051.1																																																																																				0.318	OCLM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438012.1	NM_022375		21	107	1	0	2.39187e-15	0.008871	3.50601e-15	21	107				
BRINP3	339479	broad.mit.edu	37	1	190067405	190067405	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr1:190067405C>G	ENST00000367462.3	-	8	2275	c.2044G>C	c.(2044-2046)Gac>Cac	p.D682H	BRINP3_ENST00000534846.1_Missense_Mutation_p.D580H	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	682					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)		p.D682H(1)									AAAATCAGGTCCCGAATTGCT	0.458																																							uc001gse.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|ovary(1)|kidney(1)|skin(1)	5						c.(2044-2046)GAC>CAC		family with sequence similarity 5, member C							110.0	109.0	109.0					1																	190067405		2203	4300	6503	SO:0001583	missense	339479					extracellular region		g.chr1:190067405C>G	AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.2044G>C	1.37:g.190067405C>G	ENSP00000356432:p.Asp682His					FAM5C_uc010pot.1_Missense_Mutation_p.D580H	p.D682H	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN			8	2276	-	Prostate(682;0.198)		682					B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	ENST00000367462.3	37	c.2044G>C	CCDS1373.1	.	.	.	.	.	.	.	.	.	.	C	16.10	3.025986	0.54683	.	.	ENSG00000162670	ENST00000367462;ENST00000534846	T;T	0.22134	2.22;1.97	5.62	4.72	0.59763	.	0.049143	0.85682	D	0.000000	T	0.40247	0.1109	M	0.68952	2.095	0.58432	D	0.999999	D;D	0.76494	0.999;0.998	P;P	0.61592	0.891;0.78	T	0.31558	-0.9939	10	0.87932	D	0	.	12.1876	0.54247	0.0:0.9171:0.0:0.0829	.	580;682	B7Z260;Q76B58	.;FAM5C_HUMAN	H	682;580	ENSP00000356432:D682H;ENSP00000438022:D580H	ENSP00000356432:D682H	D	-	1	0	FAM5C	188334028	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.734000	0.84928	1.382000	0.46385	0.650000	0.86243	GAC		0.458	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051		28	108	0	0	0	0.007291	0	28	108				
TROVE2	6738	broad.mit.edu	37	1	193051691	193051691	+	Splice_Site	SNP	G	G	C			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr1:193051691G>C	ENST00000367446.3	+	8	1527		c.e8-1		TROVE2_ENST00000367444.3_Splice_Site|TROVE2_ENST00000432079.1_Splice_Site|TROVE2_ENST00000400968.2_Splice_Site|TROVE2_ENST00000416058.2_Splice_Site|TROVE2_ENST00000367441.1_Splice_Site|TROVE2_ENST00000367445.3_Splice_Site|TROVE2_ENST00000367443.1_Splice_Site|TROVE2_ENST00000460715.2_Splice_Site	NM_004600.5	NP_004591.2	P10155	RO60_HUMAN	TROVE domain family, member 2						cilium morphogenesis (GO:0060271)|immune system development (GO:0002520)|response to UV (GO:0009411)|smoothened signaling pathway (GO:0007224)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	metal ion binding (GO:0046872)|RNA binding (GO:0003723)|U2 snRNA binding (GO:0030620)	p.?(1)		biliary_tract(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|urinary_tract(1)	21						TTCCGAATTAGATCCCAGCAG	0.363																																							uc001gss.2		NA																	1	Unknown(1)		lung(1)		0						c.e8-1		TROVE domain family, member 2 isoform 2							64.0	58.0	60.0					1																	193051691		1838	4078	5916	SO:0001630	splice_region_variant	6738				transcription from RNA polymerase III promoter	cytoplasm|nucleus|ribonucleoprotein complex	protein binding|RNA binding	g.chr1:193051691G>C	BC036658	CCDS41449.1, CCDS1379.1, CCDS41450.1, CCDS41450.2, CCDS53451.1	1q31	2014-08-06	2005-06-14	2005-06-14	ENSG00000116747	ENSG00000116747			11313	protein-coding gene	gene with protein product		600063	"""Sjogren syndrome antigen A2 (60kDa, ribonucleoprotein autoantigen SS-A/Ro)"""	SSA2		8188321	Standard	NM_001042369		Approved	Ro60	uc001gss.3	P10155	OTTHUMG00000035675	ENST00000367446.3:c.1318-1G>C	1.37:g.193051691G>C						TROVE2_uc001gst.1_Splice_Site_p.I165_splice|TROVE2_uc001gsu.1_Splice_Site_p.I165_splice|TROVE2_uc001gsv.1_Splice_Site_p.I440_splice|TROVE2_uc001gsw.2_Splice_Site_p.I440_splice|TROVE2_uc009wyp.2_Splice_Site_p.I440_splice|TROVE2_uc009wyq.2_Splice_Site_p.I440_splice|TROVE2_uc001gsx.1_Splice_Site_p.I440_splice	p.I440_splice	NM_004600	NP_004591	P10155	RO60_HUMAN			8	1493	+								B2RBB9|Q5LJ98|Q5LJ99|Q5LJA0|Q86WL3|Q86WL4|Q92787|Q9H1W6	Splice_Site	SNP	ENST00000367446.3	37	c.1318_splice	CCDS1379.1	.	.	.	.	.	.	.	.	.	.	G	19.50	3.839136	0.71373	.	.	ENSG00000116747	ENST00000400968;ENST00000416058;ENST00000367446;ENST00000367443;ENST00000367445;ENST00000367444;ENST00000367441	.	.	.	5.49	5.49	0.81192	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7303	0.96180	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TROVE2	191318314	1.000000	0.71417	1.000000	0.80357	0.813000	0.45954	7.836000	0.86788	2.724000	0.93272	0.557000	0.71058	.		0.363	TROVE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086688.1	NM_004600	Intron	40	21	0	0	0	0.005524	0	40	21				
CRB1	23418	broad.mit.edu	37	1	197396716	197396716	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr1:197396716C>A	ENST00000367400.3	+	7	2396	c.2261C>A	c.(2260-2262)gCt>gAt	p.A754D	CRB1_ENST00000367397.1_Missense_Mutation_p.A135D|CRB1_ENST00000535699.1_Missense_Mutation_p.A685D|CRB1_ENST00000538660.1_Intron|CRB1_ENST00000543483.1_3'UTR|CRB1_ENST00000367399.2_Missense_Mutation_p.A642D|CRB1_ENST00000544212.1_Missense_Mutation_p.A235D	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	754	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A754D(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						TTACTTCTAGCTTTGGAAAAC	0.438																																							uc001gtz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(3)|large_intestine(1)	9						c.(2260-2262)GCT>GAT		crumbs homolog 1 precursor							74.0	68.0	70.0					1																	197396716		2203	4300	6503	SO:0001583	missense	23418				cell-cell signaling|establishment or maintenance of cell polarity	apical plasma membrane|extracellular region|integral to membrane	calcium ion binding|protein binding	g.chr1:197396716C>A		CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.2261C>A	1.37:g.197396716C>A	ENSP00000356370:p.Ala754Asp					CRB1_uc010poz.1_Missense_Mutation_p.A685D|CRB1_uc010ppa.1_RNA|CRB1_uc009wza.2_Missense_Mutation_p.A642D|CRB1_uc010ppb.1_Intron|CRB1_uc010ppc.1_RNA|CRB1_uc010ppd.1_Missense_Mutation_p.A235D|CRB1_uc001gub.1_Missense_Mutation_p.A403D	p.A754D	NM_201253	NP_957705	P82279	CRUM1_HUMAN			7	2396	+			754			Extracellular (Potential).|Laminin G-like 2.		A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	ENST00000367400.3	37	c.2261C>A	CCDS1390.1	.	.	.	.	.	.	.	.	.	.	C	15.38	2.817819	0.50633	.	.	ENSG00000134376	ENST00000535699;ENST00000367400;ENST00000367399;ENST00000544212;ENST00000367397;ENST00000367401	T;T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19;-1.19	5.75	4.85	0.62838	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	.	.	.	.	D	0.85839	0.5790	M	0.76838	2.35	0.44745	D	0.997743	D;D;D;D	0.63880	0.993;0.989;0.973;0.993	D;P;P;D	0.65874	0.926;0.787;0.859;0.939	D	0.83917	0.0299	9	0.17369	T	0.5	.	14.8532	0.70313	0.0:0.9313:0.0:0.0687	.	685;642;403;754	F5H0L2;P82279-3;P82279-4;P82279	.;.;.;CRUM1_HUMAN	D	685;754;642;235;135;403	ENSP00000438786:A685D;ENSP00000356370:A754D;ENSP00000356369:A642D;ENSP00000444556:A235D;ENSP00000356367:A135D	ENSP00000356367:A135D	A	+	2	0	CRB1	195663339	0.017000	0.18338	0.131000	0.22000	0.086000	0.17979	1.263000	0.33004	1.431000	0.47355	0.650000	0.86243	GCT		0.438	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086565.2	NM_201253		12	59	1	0	5.50884e-06	0.001368	6.2168e-06	12	59				
ZP4	57829	broad.mit.edu	37	1	238048146	238048146	+	Splice_Site	SNP	A	A	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr1:238048146A>T	ENST00000366570.4	-	10	1471	c.1313T>A	c.(1312-1314)gTg>gAg	p.V438E	RP11-193H5.1_ENST00000450451.1_RNA	NM_021186.3	NP_067009.1	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4	438	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				acrosomal vesicle exocytosis (GO:0060478)|binding of sperm to zona pellucida (GO:0007339)|intracellular signal transduction (GO:0035556)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of humoral immune response (GO:0002922)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of T cell proliferation (GO:0042102)|protein kinase A signaling (GO:0010737)|protein kinase C signaling (GO:0070528)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	acrosin binding (GO:0032190)|signal transducer activity (GO:0004871)	p.V438E(1)		breast(6)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(42)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	73	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			GTGCAGATGCACCTGGGAGCC	0.512																																					NSCLC(166;160 2029 11600 18754 19936)	NSCLC(166;160 2029 11600 18754 19936)	uc001hym.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(1312-1314)GTG>GAG		zona pellucida glycoprotein 4 preproprotein							69.0	62.0	64.0					1																	238048146		2203	4300	6503	SO:0001630	splice_region_variant	57829				acrosomal vesicle exocytosis|negative regulation of binding of sperm to zona pellucida|positive regulation of acrosome reaction|positive regulation of humoral immune response|positive regulation of protein kinase activity|positive regulation of T cell proliferation|protein kinase A signaling cascade|protein kinase C signaling cascade	integral to membrane|intracellular|plasma membrane|proteinaceous extracellular matrix	acrosin binding|receptor activity	g.chr1:238048146A>T	U05781	CCDS1615.1	1q43	2013-01-17			ENSG00000116996	ENSG00000116996		"""Zona pellucida glycoproteins"""	15770	protein-coding gene	gene with protein product		613514				7841460	Standard	NM_021186		Approved	ZPB	uc001hym.3	Q12836	OTTHUMG00000039586	ENST00000366570.4:c.1312-1T>A	1.37:g.238048146A>T						LOC100130331_uc010pyc.1_Intron	p.V438E	NM_021186	NP_067009	Q12836	ZP4_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		10	1313	-	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	438			ZP.|Extracellular (Potential).		B2RAE1	Missense_Mutation	SNP	ENST00000366570.4	37	c.1313T>A	CCDS1615.1	.	.	.	.	.	.	.	.	.	.	A	19.69	3.873775	0.72180	.	.	ENSG00000116996	ENST00000366570	D	0.86694	-2.16	5.08	5.08	0.68730	Endoglin/CD105 antigen subgroup (1);Zona pellucida sperm-binding protein (3);	0.070349	0.56097	D	0.000030	D	0.94608	0.8262	M	0.93106	3.38	0.58432	D	0.999996	D	0.89917	1.0	D	0.83275	0.996	D	0.95583	0.8648	10	0.87932	D	0	-12.9271	13.0994	0.59212	1.0:0.0:0.0:0.0	.	438	Q12836	ZP4_HUMAN	E	438	ENSP00000355529:V438E	ENSP00000355529:V438E	V	-	2	0	ZP4	236114769	1.000000	0.71417	0.852000	0.33557	0.693000	0.40251	6.527000	0.73803	2.038000	0.60285	0.533000	0.62120	GTG		0.512	ZP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095476.1		Missense_Mutation	4	32	0	0	0	0.000602	0	4	32				
OR2G3	81469	broad.mit.edu	37	1	247769300	247769300	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr1:247769300C>T	ENST00000320002.2	+	1	445	c.413C>T	c.(412-414)cCa>cTa	p.P138L	RP11-978I15.10_ENST00000435333.1_RNA|RNU6-691P_ENST00000516585.1_RNA|RP11-978I15.10_ENST00000446347.1_RNA	NM_001001914.1	NP_001001914.1	Q8NGZ4	OR2G3_HUMAN	olfactory receptor, family 2, subfamily G, member 3	138						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P138L(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(31)|skin(5)	50	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			ATCATGAACCCACGGCTTTGC	0.512																																							uc010pyz.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(412-414)CCA>CTA		olfactory receptor, family 2, subfamily G,							194.0	178.0	183.0					1																	247769300		2203	4300	6503	SO:0001583	missense	81469				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247769300C>T	BK004417	CCDS31093.1	1q44	2012-08-09			ENSG00000177476	ENSG00000177476		"""GPCR / Class A : Olfactory receptors"""	15008	protein-coding gene	gene with protein product							Standard	NM_001001914		Approved		uc010pyz.2	Q8NGZ4	OTTHUMG00000040576	ENST00000320002.2:c.413C>T	1.37:g.247769300C>T	ENSP00000326301:p.Pro138Leu						p.P138L	NM_001001914	NP_001001914	Q8NGZ4	OR2G3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.017)		1	413	+	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		138			Cytoplasmic (Potential).		B2RN64|Q5JQT1|Q6IF45	Missense_Mutation	SNP	ENST00000320002.2	37	c.413C>T	CCDS31093.1	.	.	.	.	.	.	.	.	.	.	C	4.294	0.053693	0.08291	.	.	ENSG00000177476	ENST00000320002	T	0.38560	1.13	3.8	0.569	0.17340	GPCR, rhodopsin-like superfamily (1);	0.209202	0.23151	U	0.051350	T	0.38506	0.1043	M	0.81802	2.56	0.09310	N	1	B	0.15473	0.013	B	0.17979	0.02	T	0.43491	-0.9388	10	0.72032	D	0.01	.	2.9248	0.05780	0.1962:0.4672:0.0:0.3366	.	138	Q8NGZ4	OR2G3_HUMAN	L	138	ENSP00000326301:P138L	ENSP00000326301:P138L	P	+	2	0	OR2G3	245835923	0.000000	0.05858	0.001000	0.08648	0.010000	0.07245	-3.047000	0.00630	0.393000	0.25203	0.492000	0.49549	CCA		0.512	OR2G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097624.1			147	97	0	0	0	0.00361	0	147	97				
OR2T33	391195	broad.mit.edu	37	1	248436974	248436975	+	Missense_Mutation	DNP	TG	TG	GA	rs150221634		TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	TG	TG	-	-	TG	TG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr1:248436974_248436975TG>GA	ENST00000318021.2	-	1	163_164	c.142_143CA>TC	c.(142-144)CAc>TCc	p.H48S		NM_001004695.1	NP_001004695.1	Q8NG76	O2T33_HUMAN	olfactory receptor, family 2, subfamily T, member 33	48						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H48S(1)		NS(2)|breast(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(41)|ovary(1)|prostate(1)|skin(4)	67	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			GTGGTCCCAGTGAATCAGGAGA	0.52																																							uc010pzi.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(142-144)CAC>TCC		olfactory receptor, family 2, subfamily T,																																				SO:0001583	missense	391195				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248436974_248436975TG>GA		CCDS31109.1	1q44	2012-08-09			ENSG00000177212	ENSG00000177212		"""GPCR / Class A : Olfactory receptors"""	31255	protein-coding gene	gene with protein product							Standard	NM_001004695		Approved		uc010pzi.2	Q8NG76	OTTHUMG00000040458	ENST00000318021.2:c.142_143delinsGA	1.37:g.248436974_248436975delinsGA	ENSP00000324687:p.His48Ser						p.H48S	NM_001004695	NP_001004695	Q8NG76	O2T33_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0245)		1	142_143	-	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		48			Cytoplasmic (Potential).		B2RNN0	Missense_Mutation	DNP	ENST00000318021.2	37	c.142_143CA>TC	CCDS31109.1																																																																																				0.520	OR2T33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097354.1	NM_001004695		95	65	0	0	0	0.004672	0	95	65				
KIAA1217	56243	broad.mit.edu	37	10	24832238	24832238	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr10:24832238C>G	ENST00000376454.3	+	19	4069	c.4039C>G	c.(4039-4041)Caa>Gaa	p.Q1347E	KIAA1217_ENST00000376462.1_Intron|KIAA1217_ENST00000376451.2_Missense_Mutation_p.Q1030E|KIAA1217_ENST00000458595.1_Intron|KIAA1217_ENST00000307544.6_Intron|KIAA1217_ENST00000396445.1_Intron|KIAA1217_ENST00000396446.1_Intron|KIAA1217_ENST00000376452.3_Intron	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	1347					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)		p.Q1347E(1)		breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						AGATTTTGGCCAAGTTGTTCT	0.433																																							uc001iru.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(2)	7						c.(4039-4041)CAA>GAA		sickle tail isoform 1							157.0	140.0	146.0					10																	24832238		2203	4300	6503	SO:0001583	missense	56243				embryonic skeletal system development	cytoplasm		g.chr10:24832238C>G	BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.4039C>G	10.37:g.24832238C>G	ENSP00000365637:p.Gln1347Glu					KIAA1217_uc001irs.2_Intron|KIAA1217_uc001irt.3_Intron|KIAA1217_uc010qcy.1_Intron|KIAA1217_uc010qcz.1_Intron|KIAA1217_uc001irw.2_Intron|KIAA1217_uc001irz.2_Intron|KIAA1217_uc001irx.2_Missense_Mutation_p.Q1030E|KIAA1217_uc001iry.2_Intron|KIAA1217_uc001isa.1_Missense_Mutation_p.Q183E	p.Q1347E	NM_019590	NP_062536	Q5T5P2	SKT_HUMAN			19	4442	+			1347					A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Missense_Mutation	SNP	ENST00000376454.3	37	c.4039C>G	CCDS31165.1	.	.	.	.	.	.	.	.	.	.	C	15.12	2.740333	0.49045	.	.	ENSG00000120549	ENST00000442879;ENST00000376454;ENST00000450158;ENST00000376451	T;T	0.30714	1.94;1.52	5.66	5.66	0.87406	.	0.427204	0.25329	N	0.031447	T	0.34803	0.0910	L	0.59436	1.845	0.80722	D	1	P;P;P	0.44429	0.835;0.835;0.739	B;B;B	0.43889	0.435;0.435;0.266	T	0.12528	-1.0544	10	0.06757	T	0.87	.	19.7465	0.96253	0.0:1.0:0.0:0.0	.	1030;1030;1347	C9JRK3;Q5T5P2-3;Q5T5P2	.;.;SKT_HUMAN	E	1030;1347;1030;1030	ENSP00000365637:Q1347E;ENSP00000365634:Q1030E	ENSP00000365634:Q1030E	Q	+	1	0	KIAA1217	24872244	0.997000	0.39634	0.440000	0.26846	0.004000	0.04260	4.487000	0.60293	2.680000	0.91292	0.561000	0.74099	CAA		0.433	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047223.2	NM_019590		50	84	0	0	0	0.00361	0	50	84				
PCDH15	65217	broad.mit.edu	37	10	55755478	55755478	+	Silent	SNP	C	C	A	rs139853291	byFrequency	TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr10:55755478C>A	ENST00000320301.6	-	21	3193	c.2799G>T	c.(2797-2799)ggG>ggT	p.G933G	PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000373955.1_Silent_p.G933G|PCDH15_ENST00000373965.2_Silent_p.G940G|PCDH15_ENST00000361849.3_Silent_p.G933G|PCDH15_ENST00000409834.1_Silent_p.G544G|PCDH15_ENST00000395445.1_Silent_p.G940G|PCDH15_ENST00000414778.1_Silent_p.G938G|PCDH15_ENST00000395432.2_Silent_p.G896G|PCDH15_ENST00000437009.1_Silent_p.G862G|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000395438.1_Silent_p.G933G|PCDH15_ENST00000395430.1_Silent_p.G933G|PCDH15_ENST00000395433.1_Silent_p.G911G	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	933	Cadherin 9. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)	p.G933G(2)|p.G938G(2)		NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				GAGCCACCATCCCTTTGTATA	0.393										HNSCC(58;0.16)																													uc001jju.1		NA																	4	Substitution - coding silent(4)		lung(4)	pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13						c.(2797-2799)GGG>GGT		protocadherin 15 isoform CD1-4 precursor							137.0	122.0	127.0					10																	55755478		2203	4300	6503	SO:0001819	synonymous_variant	65217				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding	g.chr10:55755478C>A	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.2799G>T	10.37:g.55755478C>A		HNSCC(58;0.16)				PCDH15_uc010qhq.1_Silent_p.G938G|PCDH15_uc010qhr.1_Silent_p.G933G|PCDH15_uc010qhs.1_Silent_p.G945G|PCDH15_uc010qht.1_Silent_p.G940G|PCDH15_uc010qhu.1_Silent_p.G933G|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Silent_p.G933G|PCDH15_uc010qhw.1_Silent_p.G896G|PCDH15_uc010qhx.1_Silent_p.G862G|PCDH15_uc010qhy.1_Silent_p.G938G|PCDH15_uc010qhz.1_Silent_p.G933G|PCDH15_uc010qia.1_Silent_p.G911G|PCDH15_uc010qib.1_Silent_p.G911G|PCDH15_uc001jjw.2_Silent_p.G933G	p.G933G	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN			21	3194	-		Melanoma(3;0.117)|Lung SC(717;0.238)	933			Extracellular (Potential).|Cadherin 9.		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Silent	SNP	ENST00000320301.6	37	c.2799G>T	CCDS7248.1																																																																																				0.393	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056		25	30	1	0	8.24728e-16	0.004656	1.23271e-15	25	30				
KCNMA1	3778	broad.mit.edu	37	10	78771774	78771774	+	Silent	SNP	A	A	G	rs146803262		TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr10:78771774A>G	ENST00000286628.8	-	18	2042	c.2043T>C	c.(2041-2043)caT>caC	p.H681H	KCNMA1_ENST00000406533.3_Silent_p.H685H|KCNMA1_ENST00000404857.1_Silent_p.H681H|KCNMA1_ENST00000354353.5_Silent_p.H681H|KCNMA1_ENST00000286627.5_Silent_p.H681H|KCNMA1_ENST00000372443.1_Silent_p.H681H|KCNMA1_ENST00000404771.3_Silent_p.H681H|KCNMA1_ENST00000372440.1_Silent_p.H681H	NM_001161352.1	NP_001154824.1	Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1	681	Heme-binding motif.				blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|micturition (GO:0060073)|negative regulation of cell volume (GO:0045794)|positive regulation of apoptotic process (GO:0043065)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|response to calcium ion (GO:0051592)|response to carbon monoxide (GO:0034465)|response to hypoxia (GO:0001666)|response to osmotic stress (GO:0006970)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	actin binding (GO:0003779)|calcium-activated potassium channel activity (GO:0015269)|large conductance calcium-activated potassium channel activity (GO:0060072)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)	p.H685H(1)|p.H681H(1)		breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)	TGATGTCATCATGACAGGCCT	0.428																																							uc001jxn.2		NA																	2	Substitution - coding silent(2)		lung(2)	pancreas(2)|ovary(1)	3						c.(2041-2043)CAT>CAC		large conductance calcium-activated potassium	Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)	A	,,,	0,4406		0,0,2203	129.0	122.0	124.0		2055,2043,2043,2043	3.3	1.0	10	dbSNP_134	124	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	KCNMA1	NM_001014797.2,NM_001161352.1,NM_001161353.1,NM_002247.3	,,,	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	,,,	685/1183,681/1237,681/1220,681/1179	78771774	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	3778				cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity	g.chr10:78771774A>G	U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO		7987297, 16382103	Standard	NM_002247		Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000286628.8:c.2043T>C	10.37:g.78771774A>G						KCNMA1_uc001jxj.2_Silent_p.H685H|KCNMA1_uc001jxk.1_Silent_p.H296H|KCNMA1_uc009xrt.1_Silent_p.H501H|KCNMA1_uc001jxl.1_Silent_p.H335H|KCNMA1_uc001jxo.2_Silent_p.H681H|KCNMA1_uc001jxm.2_Silent_p.H681H|KCNMA1_uc001jxq.2_Silent_p.H681H	p.H681H	NM_001161352	NP_001154824	Q12791	KCMA1_HUMAN	OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		18	2220	-	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		681	H->R: Loss of heme-induced channel inhibition.		Heme-binding motif.|Cytoplasmic (Potential).		F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	Silent	SNP	ENST00000286628.8	37	c.2043T>C		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.061|9.061	0.994489|0.994489	0.19043|0.19043	0.0|0.0	1.16E-4|1.16E-4	ENSG00000156113|ENSG00000156113	ENST00000372403|ENST00000372421;ENST00000434208;ENST00000450795	.|.	.|.	.|.	5.69|5.69	3.35|3.35	0.38373|0.38373	.|.	.|.	.|.	.|.	.|.	T|.	0.57829|.	0.2080|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.50816|.	-0.8783|.	4|.	.|.	.|.	.|.	-11.8909|-11.8909	8.3922|8.3922	0.32535|0.32535	0.7865:0.0:0.2135:0.0|0.7865:0.0:0.2135:0.0	.|.	.|.	.|.	.|.	T|R	632|670;360;174	.|.	.|.	M|X	-|-	2|1	0|0	KCNMA1|KCNMA1	78441780|78441780	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	1.436000|1.436000	0.34980|0.34980	0.428000|0.428000	0.26173|0.26173	0.533000|0.533000	0.62120|0.62120	ATG|TGA		0.428	KCNMA1-009	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000048885.3	NM_002247		35	61	0	0	0	0.003755	0	35	61				
CDHR1	92211	broad.mit.edu	37	10	85961609	85961609	+	Missense_Mutation	SNP	G	G	C	rs142631189		TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr10:85961609G>C	ENST00000372117.3	+	7	675	c.572G>C	c.(571-573)cGc>cCc	p.R191P	CDHR1_ENST00000332904.3_Missense_Mutation_p.R191P|CDHR1_ENST00000440770.2_5'Flank	NM_033100.2	NP_149091.1	Q96JP9	CDHR1_HUMAN	cadherin-related family member 1	191	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cellular process (GO:0009987)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	calcium ion binding (GO:0005509)	p.R191P(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(21)|ovary(1)|prostate(1)|skin(1)	36						GGTGTGCTGCGCCTCCAGGCT	0.622																																							uc001kcv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(571-573)CGC>CCC		protocadherin 21 precursor							59.0	61.0	60.0					10																	85961609		2203	4300	6503	SO:0001583	missense	92211				homophilic cell adhesion		calcium ion binding|receptor activity	g.chr10:85961609G>C	AB053448	CCDS7372.1, CCDS53548.1	10q23.1	2014-01-28	2010-01-25	2010-01-25	ENSG00000148600	ENSG00000148600		"""Cadherins / Cadherin-related"""	14550	protein-coding gene	gene with protein product		609502	"""protocadherin 21"""	PCDH21		11597768	Standard	NM_001171971		Approved	KIAA1775, CORD15, RP65	uc001kcv.3	Q96JP9	OTTHUMG00000018634	ENST00000372117.3:c.572G>C	10.37:g.85961609G>C	ENSP00000361189:p.Arg191Pro					CDHR1_uc001kcw.2_Missense_Mutation_p.R191P|CDHR1_uc009xst.2_5'UTR	p.R191P	NM_033100	NP_149091	Q96JP9	CDHR1_HUMAN			7	572	+			191			Cadherin 2.|Extracellular (Potential).		Q69YZ8|Q8IXY5	Missense_Mutation	SNP	ENST00000372117.3	37	c.572G>C	CCDS7372.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.980864	0.74474	.	.	ENSG00000148600	ENST00000332904;ENST00000372117	T;T	0.01745	4.66;4.66	5.25	3.4	0.38934	Cadherin (4);Cadherin-like (1);	0.105923	0.64402	D	0.000009	T	0.11153	0.0272	M	0.92923	3.36	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.79108	0.968;0.992	T	0.10291	-1.0636	10	0.23302	T	0.38	-11.5333	9.3257	0.37990	0.1704:0.0:0.8296:0.0	.	191;191	Q96JP9-2;Q96JP9	.;CDHR1_HUMAN	P	191	ENSP00000331063:R191P;ENSP00000361189:R191P	ENSP00000331063:R191P	R	+	2	0	CDHR1	85951589	1.000000	0.71417	1.000000	0.80357	0.808000	0.45660	4.933000	0.63484	0.722000	0.32252	0.655000	0.94253	CGC		0.622	CDHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049111.1	NM_033100		11	22	0	0	0	0.010729	0	11	22				
ATRNL1	26033	broad.mit.edu	37	10	117185778	117185778	+	Silent	SNP	C	C	T	rs370258383		TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr10:117185778C>T	ENST00000355044.3	+	21	3414	c.3288C>T	c.(3286-3288)cgC>cgT	p.R1096R	ATRNL1_ENST00000303745.7_5'UTR|ATRNL1_ENST00000423111.2_Silent_p.R147R	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	1096	Laminin EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00460}.				G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)	p.R1096R(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		CTGAAAATCGCTATGTTGGTA	0.284																																							uc001lcg.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|lung(1)|central_nervous_system(1)	7						c.(3286-3288)CGC>CGT		attractin-like 1 precursor							176.0	180.0	178.0					10																	117185778		2203	4299	6502	SO:0001819	synonymous_variant	26033					integral to membrane	sugar binding	g.chr10:117185778C>T	AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.3288C>T	10.37:g.117185778C>T						ATRNL1_uc010qsm.1_Silent_p.R225R|ATRNL1_uc010qsn.1_RNA	p.R1096R	NM_207303	NP_997186	Q5VV63	ATRN1_HUMAN		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)	21	3674	+		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)	1096			Laminin EGF-like 2.|Extracellular (Potential).		O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Silent	SNP	ENST00000355044.3	37	c.3288C>T	CCDS7592.1																																																																																				0.284	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050507.3	XM_049349		45	74	0	0	0	0.00361	0	45	74				
DMBT1	1755	broad.mit.edu	37	10	124336238	124336238	+	Splice_Site	SNP	G	G	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr10:124336238G>A	ENST00000338354.3	+	7	713	c.607G>A	c.(607-609)Gct>Act	p.A203T	DMBT1_ENST00000330163.4_Splice_Site_p.A203T|DMBT1_ENST00000368956.2_Splice_Site_p.A203T|DMBT1_ENST00000359586.6_Splice_Site_p.A203T|DMBT1_ENST00000368955.3_Splice_Site_p.A203T|DMBT1_ENST00000344338.3_Splice_Site_p.A203T|DMBT1_ENST00000368909.3_Splice_Site_p.A203T			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	203					defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)	p.A203T(3)		breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				TATCTGCTCAGGTAGGCATCC	0.562																																					Ovarian(182;93 2026 18125 22222 38972)	Ovarian(182;93 2026 18125 22222 38972)	uc001lgk.1		NA																	3	Substitution - Missense(3)		lung(3)	central_nervous_system(7)	7						c.(607-609)GCT>ACT		deleted in malignant brain tumors 1 isoform b							102.0	100.0	100.0					10																	124336238		2040	4193	6233	SO:0001630	splice_region_variant	1755				epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding	g.chr10:124336238G>A		CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.607+1G>A	10.37:g.124336238G>A						DMBT1_uc001lgl.1_Missense_Mutation_p.A203T|DMBT1_uc001lgm.1_Missense_Mutation_p.A203T|DMBT1_uc009xzz.1_Missense_Mutation_p.A203T|DMBT1_uc010qtx.1_Missense_Mutation_p.A203T|DMBT1_uc009yaa.1_Missense_Mutation_p.A55T	p.A203T	NM_007329	NP_015568	Q9UGM3	DMBT1_HUMAN			7	713	+		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)	203					A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Missense_Mutation	SNP	ENST00000338354.3	37	c.607G>A		.	.	.	.	.	.	.	.	.	.	g	12.44	1.938130	0.34189	.	.	ENSG00000187908	ENST00000338354;ENST00000368915;ENST00000341278;ENST00000368953;ENST00000339871;ENST00000368942;ENST00000327438;ENST00000344338;ENST00000339712;ENST00000330163;ENST00000368909;ENST00000368955;ENST00000368956;ENST00000359586	T;T;T;T;T;T;T	0.28255	1.62;1.62;1.62;1.62;1.62;1.62;1.62	4.63	2.72	0.32119	Speract/scavenger receptor-related (1);	.	.	.	.	T	0.22781	0.0550	N	0.08118	0	0.80722	D	1	P;B;B;B;D;P	0.57899	0.759;0.218;0.022;0.017;0.981;0.791	B;B;B;B;P;P	0.54100	0.438;0.075;0.054;0.005;0.742;0.468	T	0.02391	-1.1166	9	0.25106	T	0.35	.	9.4463	0.38699	0.0765:0.0:0.7804:0.143	.	203;203;203;203;203;203	F8WEF7;Q9UGM3-4;Q9UGM3-6;Q9UGM3-2;Q9UGM3-3;Q9UGM3	.;.;.;.;.;DMBT1_HUMAN	T	203	ENSP00000342210:A203T;ENSP00000343175:A203T;ENSP00000327747:A203T;ENSP00000357905:A203T;ENSP00000357951:A203T;ENSP00000357952:A203T;ENSP00000352593:A203T	ENSP00000331522:A203T	A	+	1	0	DMBT1	124326228	1.000000	0.71417	0.973000	0.42090	0.465000	0.32709	4.420000	0.59841	0.464000	0.27142	0.655000	0.94253	GCT		0.562	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050792.2	NM_004406	Missense_Mutation	32	52	0	0	0	0.008361	0	32	52				
OR51E2	81285	broad.mit.edu	37	11	4703755	4703755	+	Missense_Mutation	SNP	A	A	C			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr11:4703755A>C	ENST00000396950.3	-	2	426	c.187T>G	c.(187-189)Tgc>Ggc	p.C63G		NM_030774.3	NP_110401.1	Q9H255	O51E2_HUMAN	olfactory receptor, family 51, subfamily E, member 2	63					cellular response to fatty acid (GO:0071398)|detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|positive regulation of blood pressure (GO:0045777)|positive regulation of renin secretion into blood stream (GO:1900135)|steroid hormone mediated signaling pathway (GO:0043401)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)|signaling receptor activity (GO:0038023)|steroid hormone receptor activity (GO:0003707)	p.C63G(1)		NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(3)	23		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;3e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00476)|LUSC - Lung squamous cell carcinoma(625;0.2)		GCAAGCATGCAGAGAAAGAGG	0.507																																							uc001lzk.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|ovary(2)	5						c.(187-189)TGC>GGC		olfactory receptor, family 51, subfamily E,							113.0	94.0	100.0					11																	4703755		2201	4298	6499	SO:0001583	missense	81285				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4703755A>C	AY033942	CCDS7751.1	11p15	2012-08-09			ENSG00000167332	ENSG00000167332		"""GPCR / Class A : Olfactory receptors"""	15195	protein-coding gene	gene with protein product		611268				11118034	Standard	NM_030774		Approved	PSGR	uc001lzk.2	Q9H255	OTTHUMG00000133362	ENST00000396950.3:c.187T>G	11.37:g.4703755A>C	ENSP00000380153:p.Cys63Gly						p.C63G	NM_030774	NP_110401	Q9H255	O51E2_HUMAN		Epithelial(150;3e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00476)|LUSC - Lung squamous cell carcinoma(625;0.2)	2	431	-		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)	63			Helical; Name=2; (Potential).		B2RA63|Q6IF94	Missense_Mutation	SNP	ENST00000396950.3	37	c.187T>G	CCDS7751.1	.	.	.	.	.	.	.	.	.	.	A	12.17	1.856198	0.32791	.	.	ENSG00000167332	ENST00000396950;ENST00000532598	T;T	0.00542	8.04;6.69	5.0	5.0	0.66597	GPCR, rhodopsin-like superfamily (1);	0.000000	0.50627	D	0.000102	T	0.00356	0.0011	N	0.10916	0.065	0.39931	D	0.974287	B	0.12630	0.006	B	0.10450	0.005	T	0.67197	-0.5731	10	0.51188	T	0.08	.	5.1971	0.15245	0.7272:0.1826:0.0902:0.0	.	63	Q9H255	O51E2_HUMAN	G	63	ENSP00000380153:C63G;ENSP00000432644:C63G	ENSP00000380153:C63G	C	-	1	0	OR51E2	4660331	0.996000	0.38824	1.000000	0.80357	0.998000	0.95712	3.029000	0.49712	2.112000	0.64535	0.533000	0.62120	TGC		0.507	OR51E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257198.1	NM_030774		22	56	0	0	0	0.00278	0	22	56				
OR51G2	81282	broad.mit.edu	37	11	4936863	4936863	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr11:4936863T>A	ENST00000322013.3	-	1	59	c.31A>T	c.(31-33)Agc>Tgc	p.S11C	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001005238.1	NP_001005238.1	Q8NGK0	O51G2_HUMAN	olfactory receptor, family 51, subfamily G, member 2	11						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S11C(1)		autonomic_ganglia(1)|endometrium(1)|large_intestine(9)|lung(12)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		GAAACGCTGCTGCTGCTGTTT	0.542																																							uc001lzr.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(31-33)AGC>TGC		olfactory receptor, family 51, subfamily G,							43.0	42.0	42.0					11																	4936863		2201	4298	6499	SO:0001583	missense	81282				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4936863T>A	AB065794	CCDS31365.1	11p15.4	2012-08-09			ENSG00000176893	ENSG00000176893		"""GPCR / Class A : Olfactory receptors"""	15198	protein-coding gene	gene with protein product							Standard	NM_001005238		Approved		uc001lzr.1	Q8NGK0	OTTHUMG00000066501	ENST00000322013.3:c.31A>T	11.37:g.4936863T>A	ENSP00000322593:p.Ser11Cys						p.S11C	NM_001005238	NP_001005238	Q8NGK0	O51G2_HUMAN		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	31	-		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)	11			Extracellular (Potential).		Q6IFH7	Missense_Mutation	SNP	ENST00000322013.3	37	c.31A>T	CCDS31365.1	.	.	.	.	.	.	.	.	.	.	T	14.51	2.556340	0.45487	.	.	ENSG00000176893	ENST00000322013	T	0.37411	1.2	4.88	3.77	0.43336	.	0.404280	0.21291	N	0.076963	T	0.35128	0.0921	M	0.77712	2.385	0.09310	N	1	P	0.46327	0.876	B	0.39419	0.299	T	0.42916	-0.9423	10	0.49607	T	0.09	.	6.7278	0.23367	0.0:0.1031:0.0:0.8969	.	11	Q8NGK0	O51G2_HUMAN	C	11	ENSP00000322593:S11C	ENSP00000322593:S11C	S	-	1	0	OR51G2	4893439	0.990000	0.36364	0.901000	0.35422	0.202000	0.24057	2.173000	0.42472	2.185000	0.69588	0.533000	0.62120	AGC		0.542	OR51G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142174.1	NM_001005238		17	47	0	0	0	0.006122	0	17	47				
OR56A3	390083	broad.mit.edu	37	11	5968810	5968810	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr11:5968810C>A	ENST00000329564.6	+	1	241	c.234C>A	c.(232-234)tgC>tgA	p.C78*	AC025016.1_ENST00000528915.1_lincRNA	NM_001003443.2	NP_001003443.2	Q8NH54	O56A3_HUMAN	olfactory receptor, family 56, subfamily A, member 3	78						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C78*(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(27)|stomach(1)|upper_aerodigestive_tract(1)	41		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;9.41e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCGTGCTCTGCCTCACTGTCA	0.572																																							uc010qzt.1		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(232-234)TGC>TGA		olfactory receptor, family 56, subfamily A,							149.0	142.0	144.0					11																	5968810		2201	4296	6497	SO:0001587	stop_gained	390083				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5968810C>A		CCDS41614.1	11p15.4	2012-08-09		2004-03-10	ENSG00000184478	ENSG00000184478		"""GPCR / Class A : Olfactory receptors"""	14786	protein-coding gene	gene with protein product				OR56A6, OR56A3P			Standard	NM_001003443		Approved		uc010qzt.2	Q8NH54	OTTHUMG00000165373	ENST00000329564.6:c.234C>A	11.37:g.5968810C>A	ENSP00000331572:p.Cys78*						p.C78*	NM_001003443	NP_001003443	Q8NH54	O56A3_HUMAN		Epithelial(150;9.41e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	234	+		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)	78			Helical; Name=2; (Potential).		A6NN77|Q6IFF7	Nonsense_Mutation	SNP	ENST00000329564.6	37	c.234C>A	CCDS41614.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.353115	0.82132	.	.	ENSG00000184478	ENST00000329564	.	.	.	5.13	0.116	0.14647	.	0.087685	0.50627	D	0.000113	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	-17.817	4.3198	0.11011	0.1517:0.4101:0.0:0.4382	.	.	.	.	X	78	.	ENSP00000331572:C78X	C	+	3	2	OR56A3	5925386	0.000000	0.05858	0.998000	0.56505	0.985000	0.73830	-1.264000	0.02847	-0.020000	0.14032	0.650000	0.86243	TGC		0.572	OR56A3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383753.1	NM_001003443		78	127	1	0	1.15098e-32	0.00361	2.11388e-32	78	127				
PTH	5741	broad.mit.edu	37	11	13514029	13514029	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr11:13514029C>A	ENST00000282091.1	-	3	385	c.271G>T	c.(271-273)Gtt>Ttt	p.V91F	PTH_ENST00000529816.1_Missense_Mutation_p.V91F	NM_000315.2	NP_000306.1	P01270	PTHY_HUMAN	parathyroid hormone	91					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|bone resorption (GO:0045453)|cAMP metabolic process (GO:0046058)|cell-cell signaling (GO:0007267)|cellular calcium ion homeostasis (GO:0006874)|cellular macromolecule biosynthetic process (GO:0034645)|G-protein coupled receptor signaling pathway (GO:0007186)|hormone-mediated apoptotic signaling pathway (GO:0008628)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of signal transduction (GO:0009967)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of gene expression (GO:0010468)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to lead ion (GO:0010288)|response to parathyroid hormone (GO:0071107)|response to vitamin D (GO:0033280)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)|peptide hormone receptor binding (GO:0051428)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)	p.V91F(1)		endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)	10				BRCA - Breast invasive adenocarcinoma(625;0.00116)|Epithelial(150;0.0357)|LUSC - Lung squamous cell carcinoma(625;0.0836)		TGGCTCTCAACCAAGACATTG	0.443																																							uc001mlb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(271-273)GTT>TTT		parathyroid hormone preproprotein							122.0	113.0	116.0					11																	13514029		2200	4294	6494	SO:0001583	missense	5741				bone resorption|cAMP metabolic process|cell-cell signaling|cellular calcium ion homeostasis|cellular macromolecule biosynthetic process|induction of apoptosis by hormones|positive regulation of cAMP biosynthetic process|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|skeletal system development		hormone activity|peptide hormone receptor binding	g.chr11:13514029C>A	J00301	CCDS7812.1	11p15.3-p15.1	2013-02-28				ENSG00000152266		"""Endogenous ligands"""	9606	protein-coding gene	gene with protein product	"""parathyrin"", ""parathormone"", ""parathyroid hormone 1"", ""preproparathyroid hormone"", ""prepro-PTH"""	168450				1672845	Standard	NM_000315		Approved	PTH1	uc001mlb.3	P01270		ENST00000282091.1:c.271G>T	11.37:g.13514029C>A	ENSP00000282091:p.Val91Phe						p.V91F	NM_000315	NP_000306	P01270	PTHY_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00116)|Epithelial(150;0.0357)|LUSC - Lung squamous cell carcinoma(625;0.0836)	3	386	-			91					Q4VB48|Q9UD38	Missense_Mutation	SNP	ENST00000282091.1	37	c.271G>T	CCDS7812.1	.	.	.	.	.	.	.	.	.	.	C	11.25	1.584245	0.28268	.	.	ENSG00000152266	ENST00000282091;ENST00000529816	D;D	0.82803	-1.65;-1.65	5.95	-0.886	0.10590	.	0.954509	0.08710	N	0.905151	T	0.81250	0.4783	L	0.57536	1.79	0.09310	N	0.999997	P	0.41393	0.748	P	0.47673	0.554	T	0.67726	-0.5596	10	0.31617	T	0.26	-6.8988	5.8625	0.18757	0.0:0.4958:0.1236:0.3806	.	91	P01270	PTHY_HUMAN	F	91	ENSP00000282091:V91F;ENSP00000433208:V91F	ENSP00000282091:V91F	V	-	1	0	PTH	13470605	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-0.083000	0.11286	-0.441000	0.07201	0.650000	0.86243	GTT		0.443	PTH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386198.1	NM_000315		36	133	1	0	3.76114e-14	0.004289	5.36487e-14	36	133				
C11orf74	119710	broad.mit.edu	37	11	36669581	36669581	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr11:36669581C>G	ENST00000334307.5	+	5	489	c.374C>G	c.(373-375)cCa>cGa	p.P125R	C11orf74_ENST00000347206.4_Missense_Mutation_p.P51R|C11orf74_ENST00000534635.1_Missense_Mutation_p.P51R|C11orf74_ENST00000446510.2_Missense_Mutation_p.P125R	NM_138787.2	NP_620142.2	Q86VG3	CK074_HUMAN	chromosome 11 open reading frame 74	125								p.P125R(1)		breast(1)|kidney(1)|large_intestine(1)|lung(5)	8	all_lung(20;0.226)	all_hematologic(20;0.0118)				CTGCTGCTTCCAGGAGAAGTG	0.443																																							uc001mwy.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(373-375)CCA>CGA		hypothetical protein LOC119710							174.0	163.0	167.0					11																	36669581		2202	4298	6500	SO:0001583	missense	119710							g.chr11:36669581C>G	AK095997, BC009561	CCDS7904.1, CCDS60762.1	11p12	2012-08-10			ENSG00000166352	ENSG00000166352			25142	protein-coding gene	gene with protein product						12477932	Standard	NM_001276722		Approved	FLJ38678, HEPIS	uc031pzr.1	Q86VG3	OTTHUMG00000166397	ENST00000334307.5:c.374C>G	11.37:g.36669581C>G	ENSP00000334848:p.Pro125Arg					C11orf74_uc010rfd.1_RNA|C11orf74_uc001mww.1_Missense_Mutation_p.P51R|C11orf74_uc001mwx.1_RNA|C11orf74_uc001mwz.1_Missense_Mutation_p.P51R|C11orf74_uc010rfe.1_RNA	p.P125R	NM_138787	NP_620142	Q86VG3	CK074_HUMAN			5	447	+	all_lung(20;0.226)	all_hematologic(20;0.0118)	125					D3DR18|Q96DD6	Missense_Mutation	SNP	ENST00000334307.5	37	c.374C>G	CCDS7904.1	.	.	.	.	.	.	.	.	.	.	C	11.50	1.655811	0.29425	.	.	ENSG00000166352	ENST00000334307;ENST00000531554;ENST00000347206;ENST00000534635;ENST00000446510;ENST00000527108	.	.	.	5.8	5.8	0.92144	.	0.000000	0.64402	D	0.000001	T	0.79947	0.4534	M	0.78801	2.425	0.51767	D	0.999934	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.79806	-0.1648	8	.	.	.	-7.3603	17.2104	0.86929	0.0:1.0:0.0:0.0	.	125;51	Q86VG3;Q86VG3-2	CK074_HUMAN;.	R	125;125;51;51;125;51	.	.	P	+	2	0	C11orf74	36626157	1.000000	0.71417	1.000000	0.80357	0.106000	0.19336	4.295000	0.59049	2.748000	0.94277	0.655000	0.94253	CCA		0.443	C11orf74-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389567.1	NM_138787		59	156	0	0	0	0.00361	0	59	156				
C11orf74	119710	broad.mit.edu	37	11	36669586	36669586	+	Missense_Mutation	SNP	G	G	A	rs536943516	byFrequency	TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr11:36669586G>A	ENST00000334307.5	+	5	494	c.379G>A	c.(379-381)Gaa>Aaa	p.E127K	C11orf74_ENST00000347206.4_Missense_Mutation_p.E53K|C11orf74_ENST00000534635.1_Missense_Mutation_p.E53K|C11orf74_ENST00000446510.2_Missense_Mutation_p.E127K	NM_138787.2	NP_620142.2	Q86VG3	CK074_HUMAN	chromosome 11 open reading frame 74	127								p.E127K(1)		breast(1)|kidney(1)|large_intestine(1)|lung(5)	8	all_lung(20;0.226)	all_hematologic(20;0.0118)				GCTTCCAGGAGAAGTGGAGCA	0.443													G|||	3	0.000599042	0.0	0.0	5008	,	,		19531	0.0		0.0	False		,,,				2504	0.0031						uc001mwy.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(379-381)GAA>AAA		hypothetical protein LOC119710							174.0	163.0	167.0					11																	36669586		2202	4298	6500	SO:0001583	missense	119710							g.chr11:36669586G>A	AK095997, BC009561	CCDS7904.1, CCDS60762.1	11p12	2012-08-10			ENSG00000166352	ENSG00000166352			25142	protein-coding gene	gene with protein product						12477932	Standard	NM_001276722		Approved	FLJ38678, HEPIS	uc031pzr.1	Q86VG3	OTTHUMG00000166397	ENST00000334307.5:c.379G>A	11.37:g.36669586G>A	ENSP00000334848:p.Glu127Lys					C11orf74_uc010rfd.1_RNA|C11orf74_uc001mww.1_Missense_Mutation_p.E53K|C11orf74_uc001mwx.1_RNA|C11orf74_uc001mwz.1_Missense_Mutation_p.E53K|C11orf74_uc010rfe.1_RNA	p.E127K	NM_138787	NP_620142	Q86VG3	CK074_HUMAN			5	452	+	all_lung(20;0.226)	all_hematologic(20;0.0118)	127					D3DR18|Q96DD6	Missense_Mutation	SNP	ENST00000334307.5	37	c.379G>A	CCDS7904.1	.	.	.	.	.	.	.	.	.	.	G	12.89	2.072115	0.36566	.	.	ENSG00000166352	ENST00000334307;ENST00000531554;ENST00000347206;ENST00000534635;ENST00000446510;ENST00000527108	.	.	.	5.8	3.9	0.45041	.	0.156920	0.44902	D	0.000408	T	0.75273	0.3827	M	0.72894	2.215	0.41978	D	0.990784	D;D	0.76494	0.999;0.999	D;D	0.64595	0.927;0.927	T	0.76030	-0.3108	8	.	.	.	-12.1188	14.1848	0.65598	0.0:0.2851:0.7149:0.0	.	127;53	Q86VG3;Q86VG3-2	CK074_HUMAN;.	K	127;127;53;53;127;53	.	.	E	+	1	0	C11orf74	36626162	1.000000	0.71417	1.000000	0.80357	0.096000	0.18686	2.891000	0.48617	0.775000	0.33450	0.655000	0.94253	GAA		0.443	C11orf74-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389567.1	NM_138787		59	157	0	0	0	0.00361	0	59	157				
DGKZ	8525	broad.mit.edu	37	11	46388906	46388906	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr11:46388906G>T	ENST00000454345.1	+	3	919	c.794G>T	c.(793-795)tGc>tTc	p.C265F	DGKZ_ENST00000421244.2_Missense_Mutation_p.C76F|DGKZ_ENST00000456247.2_Missense_Mutation_p.C76F|DGKZ_ENST00000532868.2_Missense_Mutation_p.C81F|DGKZ_ENST00000343674.6_Missense_Mutation_p.C93F|DGKZ_ENST00000395574.3_Missense_Mutation_p.C42F|DGKZ_ENST00000528615.1_Intron|DGKZ_ENST00000318201.8_Missense_Mutation_p.C76F|DGKZ_ENST00000543978.1_Intron|DGKZ_ENST00000525434.1_3'UTR|DGKZ_ENST00000527911.1_Missense_Mutation_p.C76F	NM_001105540.1	NP_001099010.1	Q13574	DGKZ_HUMAN	diacylglycerol kinase, zeta	265					blood coagulation (GO:0007596)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|lipid phosphorylation (GO:0046834)|mitotic G1 DNA damage checkpoint (GO:0031571)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of Ras protein signal transduction (GO:0046580)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|enzyme inhibitor activity (GO:0004857)|lipid kinase activity (GO:0001727)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein C-terminus binding (GO:0008022)	p.C265F(1)|p.C76F(1)|p.C93F(1)		central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(12)|pancreas(1)|prostate(1)|skin(1)	25				GBM - Glioblastoma multiforme(35;0.0259)|Lung(87;0.141)		GGGGCCCCGTGCAGCGAGTCA	0.672																																							uc001ncn.1		NA																	3	Substitution - Missense(3)		lung(3)	pancreas(1)|central_nervous_system(1)|skin(1)	3						c.(793-795)TGC>TTC		diacylglycerol kinase zeta isoform 4							28.0	31.0	30.0					11																	46388906		2194	4299	6493	SO:0001583	missense	8525				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell migration|intracellular signal transduction|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of mitotic cell cycle|platelet activation	cytoplasm|lamellipodium|nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|diacylglycerol kinase activity|lipid kinase activity|metal ion binding|protein binding|protein C-terminus binding	g.chr11:46388906G>T	U51477	CCDS7918.1, CCDS41640.1, CCDS44579.1, CCDS44580.1, CCDS55757.1, CCDS55758.1, CCDS55759.1, CCDS44579.2	11p11.2	2010-11-24	2010-11-24		ENSG00000149091	ENSG00000149091	2.7.1.107		2857	protein-coding gene	gene with protein product		601441	"""diacylglycerol kinase, zeta 104kDa"""			8626588	Standard	NM_003646		Approved	DAGK5, hDGKzeta, DGK-ZETA, DAGK6	uc001ncn.1	Q13574	OTTHUMG00000166437	ENST00000454345.1:c.794G>T	11.37:g.46388906G>T	ENSP00000412178:p.Cys265Phe					DGKZ_uc001nch.1_Missense_Mutation_p.C93F|DGKZ_uc010rgq.1_Missense_Mutation_p.C42F|DGKZ_uc001ncj.1_Missense_Mutation_p.C42F|DGKZ_uc010rgr.1_Missense_Mutation_p.C42F|DGKZ_uc001nck.1_5'UTR|DGKZ_uc001ncl.2_Missense_Mutation_p.C76F|DGKZ_uc001ncm.2_Missense_Mutation_p.C76F|DGKZ_uc009yky.1_Missense_Mutation_p.C76F|DGKZ_uc010rgs.1_Missense_Mutation_p.C76F|DGKZ_uc001nci.1_Missense_Mutation_p.C42F	p.C265F	NM_001105540	NP_001099010	Q13574	DGKZ_HUMAN		GBM - Glioblastoma multiforme(35;0.0259)|Lung(87;0.141)	3	919	+			265					B7Z2M9|B7Z6M3|E9PPW4|F6UCU9|G3V0F6|J3KNJ6|O00542|Q6ZVG7|Q8IVW9	Missense_Mutation	SNP	ENST00000454345.1	37	c.794G>T	CCDS41640.1	.	.	.	.	.	.	.	.	.	.	G	8.798	0.932190	0.18131	.	.	ENSG00000149091	ENST00000343674;ENST00000395574;ENST00000532868;ENST00000527911;ENST00000456247;ENST00000421244;ENST00000318201;ENST00000454345	T;T;T;T;T;T;T;T	0.21734	2.51;2.71;2.76;3.71;2.53;2.59;2.68;1.99	5.04	4.11	0.48088	.	0.774584	0.12541	N	0.459884	T	0.18882	0.0453	L	0.39898	1.24	0.09310	N	1	B;B;B;B;P;B;B;B;P;B	0.46457	0.022;0.07;0.07;0.07;0.509;0.115;0.115;0.07;0.878;0.022	B;B;B;B;B;B;B;B;B;B	0.41510	0.028;0.045;0.065;0.065;0.096;0.138;0.138;0.045;0.359;0.045	T	0.10497	-1.0627	10	0.72032	D	0.01	.	9.0359	0.36287	0.0785:0.1492:0.7723:0.0	.	76;42;42;76;265;76;76;42;42;93	B7Z2M9;B7Z6M3;B7Z8F6;E9PPW4;Q13574;Q13574-2;G3V0F6;A8MVN1;Q6ZWA5;Q6ZVG7	.;.;.;.;DGKZ_HUMAN;.;.;.;.;.	F	93;42;42;76;76;76;76;265	ENSP00000343065:C93F;ENSP00000378941:C42F;ENSP00000436273:C42F;ENSP00000436291:C76F;ENSP00000395684:C76F;ENSP00000391021:C76F;ENSP00000320340:C76F;ENSP00000412178:C265F	ENSP00000320340:C76F	C	+	2	0	DGKZ	46345482	0.002000	0.14202	0.370000	0.25965	0.924000	0.55760	1.296000	0.33389	2.513000	0.84729	0.555000	0.69702	TGC		0.672	DGKZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389772.1	NM_001105540		20	36	1	0	1.40151e-16	0.010504	2.11733e-16	20	36				
OR5L2	26338	broad.mit.edu	37	11	55595361	55595361	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr11:55595361A>G	ENST00000378397.1	+	1	667	c.667A>G	c.(667-669)Acc>Gcc	p.T223A		NM_001004739.1	NP_001004739.1	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L, member 2	223						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T223A(1)		breast(2)|kidney(1)|large_intestine(1)|lung(42)|ovary(1)|prostate(3)|skin(1)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	59		all_epithelial(135;0.208)				GCTAATTCTCACCACTATCCT	0.498										HNSCC(27;0.073)																													uc001nhy.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(667-669)ACC>GCC		olfactory receptor, family 5, subfamily L,							198.0	164.0	175.0					11																	55595361		2200	4296	6496	SO:0001583	missense	26338				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55595361A>G	AB065782	CCDS31511.1	11q11	2012-08-09			ENSG00000205030	ENSG00000205030		"""GPCR / Class A : Olfactory receptors"""	8351	protein-coding gene	gene with protein product						1370859	Standard	NM_001004739		Approved	HTPCRX16, HSHTPCRX16	uc001nhy.1	Q8NGL0	OTTHUMG00000166812	ENST00000378397.1:c.667A>G	11.37:g.55595361A>G	ENSP00000367650:p.Thr223Ala	HNSCC(27;0.073)					p.T223A	NM_001004739	NP_001004739	Q8NGL0	OR5L2_HUMAN			1	667	+		all_epithelial(135;0.208)	223			Cytoplasmic (Potential).		Q6IF66|Q96RB2	Missense_Mutation	SNP	ENST00000378397.1	37	c.667A>G	CCDS31511.1	.	.	.	.	.	.	.	.	.	.	.	3.127	-0.179261	0.06380	.	.	ENSG00000205030	ENST00000378397	T	0.36520	1.25	5.24	-3.28	0.05033	GPCR, rhodopsin-like superfamily (1);	0.511841	0.17966	N	0.156011	T	0.10078	0.0247	N	0.01640	-0.785	0.09310	N	1	B	0.25272	0.122	B	0.29524	0.103	T	0.29701	-1.0003	10	0.21014	T	0.42	-22.3253	4.3597	0.11196	0.2856:0.1276:0.4628:0.124	.	223	Q8NGL0	OR5L2_HUMAN	A	223	ENSP00000367650:T223A	ENSP00000367650:T223A	T	+	1	0	OR5L2	55351937	0.000000	0.05858	0.366000	0.25914	0.015000	0.08874	-2.817000	0.00751	-0.399000	0.07668	-0.283000	0.09986	ACC		0.498	OR5L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391516.1	NM_001004739		52	91	0	0	0	0.00361	0	52	91				
TRIM51	84767	broad.mit.edu	37	11	55653690	55653690	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr11:55653690G>T	ENST00000449290.2	+	3	595	c.503G>T	c.(502-504)tGg>tTg	p.W168L	TRIM51_ENST00000244891.3_Missense_Mutation_p.W25L	NM_032681.3	NP_116070.2	Q9BSJ1	TRI51_HUMAN	tripartite motif-containing 51	168						intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.W9L(1)|p.W168L(1)									ACCAGATGCTGGAAGGTTAGT	0.398																																							uc010rip.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(502-504)TGG>TTG		SPRY domain containing 5							91.0	91.0	91.0					11																	55653690		2201	4296	6497	SO:0001583	missense	84767					intracellular	zinc ion binding	g.chr11:55653690G>T	BC005014		11p11	2013-01-09	2012-05-18	2012-05-18	ENSG00000124900	ENSG00000124900		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19023	protein-coding gene	gene with protein product			"""SPRY domain containing 5"""	SPRYD5			Standard	NM_032681		Approved	TRIM51A	uc010rip.2	Q9BSJ1	OTTHUMG00000156437	ENST00000449290.2:c.503G>T	11.37:g.55653690G>T	ENSP00000395086:p.Trp168Leu					SPRYD5_uc010riq.1_Missense_Mutation_p.W25L	p.W168L	NM_032681	NP_116070	Q9BSJ1	SPRY5_HUMAN			3	595	+		all_epithelial(135;0.226)	168					A6NMG2	Missense_Mutation	SNP	ENST00000449290.2	37	c.503G>T		.	.	.	.	.	.	.	.	.	.	.	0.567	-0.842616	0.02671	.	.	ENSG00000124900	ENST00000449290;ENST00000244891	T;T	0.03124	4.04;4.04	.	.	.	.	.	.	.	.	T	0.03783	0.0107	L	0.43554	1.36	0.09310	N	1	B	0.22080	0.064	B	0.27170	0.077	T	0.45542	-0.9254	7	0.25751	T	0.34	.	.	.	.	.	168	Q9BSJ1	SPRY5_HUMAN	L	168;25	ENSP00000395086:W168L;ENSP00000244891:W25L	ENSP00000244891:W25L	W	+	2	0	SPRYD5	55410266	0.887000	0.30362	0.109000	0.21407	0.119000	0.20118	0.793000	0.26944	0.149000	0.19098	0.152000	0.16155	TGG		0.398	TRIM51-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000391522.1	NM_032681		30	41	1	0	8.4185e-14	0.012213	1.1828e-13	30	41				
OR5W2	390148	broad.mit.edu	37	11	55681357	55681357	+	Missense_Mutation	SNP	C	C	A	rs375899233		TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr11:55681357C>A	ENST00000344514.1	-	1	701	c.702G>T	c.(700-702)agG>agT	p.R234S		NM_001001960.1	NP_001001960.1	Q8NH69	OR5W2_HUMAN	olfactory receptor, family 5, subfamily W, member 2	234						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R234S(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(28)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						GAGCTTTGAACCTCCCCTCAG	0.418																																					Melanoma(48;171 1190 15239 43886 49348)	Melanoma(48;171 1190 15239 43886 49348)	uc010rir.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(700-702)AGG>AGT		olfactory receptor, family 5, subfamily W,							77.0	87.0	84.0					11																	55681357		2201	4296	6497	SO:0001583	missense	390148				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55681357C>A	BK004398	CCDS31513.1	11q11	2012-08-09		2004-03-10	ENSG00000187612	ENSG00000187612		"""GPCR / Class A : Olfactory receptors"""	15299	protein-coding gene	gene with protein product				OR5W2P, OR5W3P			Standard	NM_001001960		Approved		uc010rir.2	Q8NH69	OTTHUMG00000166818	ENST00000344514.1:c.702G>T	11.37:g.55681357C>A	ENSP00000342448:p.Arg234Ser						p.R234S	NM_001001960	NP_001001960	Q8NH69	OR5W2_HUMAN			1	702	-			234			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000344514.1	37	c.702G>T	CCDS31513.1	.	.	.	.	.	.	.	.	.	.	C	10.06	1.246729	0.22796	.	.	ENSG00000187612	ENST00000344514	T	0.00311	8.15	5.0	-2.4	0.06583	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44483	D	0.000449	T	0.00384	0.0012	M	0.89840	3.065	0.09310	N	0.999998	B	0.31153	0.31	B	0.41813	0.367	T	0.40496	-0.9560	10	0.87932	D	0	.	5.261	0.15573	0.1607:0.2324:0.0:0.6069	.	234	Q8NH69	OR5W2_HUMAN	S	234	ENSP00000342448:R234S	ENSP00000342448:R234S	R	-	3	2	OR5W2	55437933	0.000000	0.05858	0.571000	0.28486	0.296000	0.27459	-1.089000	0.03376	-0.317000	0.08677	-0.284000	0.09977	AGG		0.418	OR5W2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391523.1	NM_001001960		37	55	1	0	6.53348e-20	0.003755	1.01995e-19	37	55				
B3GAT3	26229	broad.mit.edu	37	11	62384573	62384573	+	Silent	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr11:62384573G>T	ENST00000265471.5	-	3	731	c.504C>A	c.(502-504)ctC>ctA	p.L168L	B3GAT3_ENST00000534026.1_Silent_p.L168L|B3GAT3_ENST00000531383.1_Silent_p.L168L	NM_012200.3	NP_036332.2	O94766	B3GA3_HUMAN	beta-1,3-glucuronyltransferase 3	168					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	cis-Golgi network (GO:0005801)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity (GO:0015018)|glucuronosyltransferase activity (GO:0015020)|metal ion binding (GO:0046872)	p.L168L(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(2)|urinary_tract(1)	12						CTCTGCCCCGGAGCCAGTCCA	0.662																																							uc001ntw.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(502-504)CTC>CTA		beta-1,3-glucuronyltransferase 3							56.0	59.0	58.0					11																	62384573		2202	4299	6501	SO:0001819	synonymous_variant	26229				glycosaminoglycan biosynthetic process	Golgi membrane|integral to membrane	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity|manganese ion binding	g.chr11:62384573G>T	AB009598	CCDS8025.1	11q12	2014-07-08	2014-07-08		ENSG00000149541	ENSG00000149541	2.4.1.135	"""Beta-1,3-glucuronyltransferases"""	923	protein-coding gene	gene with protein product	"""glucuronosyltransferase I"", ""galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 3"""	606374	"""beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)"""			9506957	Standard	NM_012200		Approved	GlcAT-I	uc001ntw.3	O94766	OTTHUMG00000167685	ENST00000265471.5:c.504C>A	11.37:g.62384573G>T						B3GAT3_uc009ynz.2_Silent_p.L161L|B3GAT3_uc001ntx.2_RNA|B3GAT3_uc010rlz.1_Silent_p.L168L	p.L168L	NM_012200	NP_036332	O94766	B3GA3_HUMAN			3	533	-			168			Lumenal (Potential).		B7ZAB3|Q96I06|Q9UEP0	Silent	SNP	ENST00000265471.5	37	c.504C>A	CCDS8025.1																																																																																				0.662	B3GAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395588.1	NM_012200		38	56	1	0	3.21399e-22	0.004878	5.16076e-22	38	56				
SNX15	29907	broad.mit.edu	37	11	64806226	64806226	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr11:64806226G>A	ENST00000377244.3	+	7	977	c.847G>A	c.(847-849)Gag>Aag	p.E283K	RP11-399J13.3_ENST00000301886.3_3'UTR|SAC3D1_ENST00000398846.1_5'Flank|SNX15_ENST00000352068.5_Intron|SAC3D1_ENST00000531072.1_5'Flank	NM_013306.4|NM_147777.3	NP_037438.2|NP_680086.2	Q9NRS6	SNX15_HUMAN	sorting nexin 15	283	MIT.				intracellular protein transport (GO:0006886)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)	phosphatidylinositol binding (GO:0035091)	p.E283K(1)		endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	14						CCTGCGGGATGAGAAGGCAGG	0.652																																					Esophageal Squamous(56;269 1304 3324 8253)	Esophageal Squamous(56;269 1304 3324 8253)	uc001oci.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(847-849)GAG>AAG		sorting nexin 15 isoform A							31.0	27.0	29.0					11																	64806226		2199	4297	6496	SO:0001583	missense	29907				cell communication|intracellular protein transport	cytoplasmic vesicle membrane|cytosol	phosphatidylinositol binding|protein transporter activity	g.chr11:64806226G>A	AF175267	CCDS8089.1, CCDS8090.1	11q12	2008-05-22			ENSG00000110025	ENSG00000110025		"""Sorting nexins"""	14978	protein-coding gene	gene with protein product		605964				11208079	Standard	NM_013306		Approved			Q9NRS6	OTTHUMG00000037387	ENST00000377244.3:c.847G>A	11.37:g.64806226G>A	ENSP00000366452:p.Glu283Lys					SNX15_uc009ypy.2_Missense_Mutation_p.E283K|SNX15_uc001ocj.2_Missense_Mutation_p.E283K|SNX15_uc001ock.2_Intron|SAC3D1_uc010rnv.1_5'Flank|SAC3D1_uc001ocm.2_5'Flank	p.E283K	NM_013306	NP_037438	Q9NRS6	SNX15_HUMAN			10	1500	+			283			MIT.		E5KQS6|Q9NRS5	Missense_Mutation	SNP	ENST00000377244.3	37	c.847G>A	CCDS8089.1	.	.	.	.	.	.	.	.	.	.	G	17.05	3.290363	0.59976	.	.	ENSG00000110025	ENST00000377244	T	0.75477	-0.94	5.52	4.62	0.57501	MIT (2);	0.000000	0.85682	D	0.000000	D	0.86385	0.5920	M	0.86740	2.835	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.87677	0.2545	10	0.87932	D	0	-10.6372	10.2984	0.43637	0.0908:0.0:0.9092:0.0	.	283;283	E5KQS5;Q9NRS6	.;SNX15_HUMAN	K	283	ENSP00000366452:E283K	ENSP00000366452:E283K	E	+	1	0	SNX15	64562802	1.000000	0.71417	0.879000	0.34478	0.067000	0.16453	5.688000	0.68227	1.343000	0.45638	-0.251000	0.11542	GAG		0.652	SNX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091004.3			9	9	0	0	0	0.004482	0	9	9				
MTL5	9633	broad.mit.edu	37	11	68514791	68514791	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr11:68514791G>T	ENST00000255087.5	-	3	698	c.515C>A	c.(514-516)cCg>cAg	p.P172Q	MTL5_ENST00000443940.2_Missense_Mutation_p.P172Q|MTL5_ENST00000540869.1_5'UTR|MTL5_ENST00000544963.1_Missense_Mutation_p.P172Q	NM_004923.3	NP_004914.2	Q9Y4I5	MTL5_HUMAN	metallothionein-like 5, testis-specific (tesmin)	172					cell differentiation (GO:0030154)|cellular metal ion homeostasis (GO:0006875)|multicellular organismal development (GO:0007275)|response to metal ion (GO:0010038)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.P172Q(1)		breast(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)	15	Esophageal squamous(3;4.37e-12)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.185)			TGCTTCTTCCGGATTATTACT	0.423																																							uc001ooc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(1)	3						c.(514-516)CCG>CAG		metallothionein-like 5, testis-specific isoform							134.0	128.0	130.0					11																	68514791		2200	4294	6494	SO:0001583	missense	9633				cell differentiation|cellular metal ion homeostasis|multicellular organismal development|response to metal ion|spermatogenesis	cytoplasm|nucleus|soluble fraction	metal ion binding	g.chr11:68514791G>T	U86074	CCDS8184.1, CCDS44661.1	11q13.2-q13.3	2007-01-03			ENSG00000132749	ENSG00000132749			7446	protein-coding gene	gene with protein product	"""CXC domain containing 2"""	604374				1091092	Standard	XR_428932		Approved	CXCDC2	uc001ooc.3	Q9Y4I5	OTTHUMG00000167891	ENST00000255087.5:c.515C>A	11.37:g.68514791G>T	ENSP00000255087:p.Pro172Gln					MTL5_uc001ood.1_Missense_Mutation_p.P172Q|MTL5_uc009ysi.1_Missense_Mutation_p.P172Q|MTL5_uc001ooe.2_Missense_Mutation_p.P172Q	p.P172Q	NM_004923	NP_004914	Q9Y4I5	MTL5_HUMAN	LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.185)		3	655	-	Esophageal squamous(3;4.37e-12)		172					A8K8J3|Q4G182|Q6P2E2|Q8NCC8	Missense_Mutation	SNP	ENST00000255087.5	37	c.515C>A	CCDS8184.1	.	.	.	.	.	.	.	.	.	.	G	0.020	-1.439057	0.01098	.	.	ENSG00000132749	ENST00000255087;ENST00000443940;ENST00000544963	T;T;T	0.40476	1.62;1.03;1.61	5.1	-2.27	0.06846	.	1.095660	0.06919	N	0.809035	T	0.22003	0.0530	N	0.17082	0.46	0.09310	N	1	B;B;B	0.10296	0.002;0.001;0.003	B;B;B	0.11329	0.006;0.006;0.002	T	0.22661	-1.0210	10	0.19590	T	0.45	-1.9232	4.6009	0.12352	0.3337:0.0:0.385:0.2813	.	172;155;172	Q9Y4I5-3;Q6PHY4;Q9Y4I5	.;.;MTL5_HUMAN	Q	172	ENSP00000255087:P172Q;ENSP00000403086:P172Q;ENSP00000440968:P172Q	ENSP00000255087:P172Q	P	-	2	0	MTL5	68271367	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.165000	0.09968	-0.189000	0.10482	-0.215000	0.12644	CCG		0.423	MTL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396844.1	NM_004923		4	63	1	0	0.00909568	0.009096	0.00983033	4	63				
FOLR3	2352	broad.mit.edu	37	11	71847143	71847143	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr11:71847143C>A	ENST00000445078.2	+	2	210	c.139C>A	c.(139-141)Ccc>Acc	p.P47T	FOLR3_ENST00000442948.2_Missense_Mutation_p.P49T|FOLR3_ENST00000456237.1_Missense_Mutation_p.P49T			P41439	FOLR3_HUMAN	folate receptor 3 (gamma)	47					folic acid transport (GO:0015884)	extracellular region (GO:0005576)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)	folic acid binding (GO:0005542)	p.P49T(1)		large_intestine(3)|lung(8)|prostate(2)	13					Folic Acid(DB00158)	ACAGCCCAGCCCCGAGGACGA	0.642																																							uc001ory.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(145-147)CCC>ACC		SubName: Full=FOLR3 protein; Flags: Fragment;	Folic Acid(DB00158)						94.0	98.0	97.0					11																	71847143		2200	4293	6493	SO:0001583	missense	2352				folic acid transport	extracellular region|extrinsic to membrane|membrane fraction	folic acid binding|receptor activity	g.chr11:71847143C>A	U08471	CCDS73344.1	11q13.4	2012-11-14			ENSG00000110203	ENSG00000110203			3795	protein-coding gene	gene with protein product		602469				8110752	Standard	NM_000804		Approved	FR-G	uc001orx.1	P41439	OTTHUMG00000167870	ENST00000445078.2:c.139C>A	11.37:g.71847143C>A	ENSP00000390338:p.Pro47Thr					FOLR3_uc001orx.1_Missense_Mutation_p.P49T	p.P49T			P41439	FOLR3_HUMAN			2	195	+			47					J3KQ90|Q05C14	Missense_Mutation	SNP	ENST00000445078.2	37	c.145C>A		.	.	.	.	.	.	.	.	.	.	N	12.98	2.099768	0.37048	.	.	ENSG00000110203	ENST00000445078;ENST00000456237;ENST00000442948;ENST00000546166	T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09	3.57	1.59	0.23543	Folate receptor-like (1);	0.427685	0.19731	U	0.107352	T	0.70859	0.3272	.	.	.	0.09310	N	1	B;D	0.76494	0.437;0.999	B;D	0.80764	0.108;0.994	T	0.60005	-0.7347	9	0.87932	D	0	.	2.778	0.05353	0.1862:0.5255:0.1813:0.107	.	49;47	E9PGT2;P41439	.;FOLR3_HUMAN	T	47;49;49;47	ENSP00000390338:P47T;ENSP00000399235:P49T;ENSP00000411161:P49T;ENSP00000446279:P47T	ENSP00000325032:P47T	P	+	1	0	FOLR3	71524791	0.246000	0.23909	0.003000	0.11579	0.002000	0.02628	1.580000	0.36547	0.040000	0.15660	-0.479000	0.04858	CCC		0.642	FOLR3-001	NOVEL	upstream_ATG|basic	protein_coding	protein_coding	OTTHUMT00000396739.1	NM_000804		62	114	1	0	5.98616e-33	0.00361	1.11398e-32	62	114				
PPME1	51400	broad.mit.edu	37	11	73950231	73950231	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr11:73950231T>A	ENST00000328257.8	+	9	1087	c.764T>A	c.(763-765)aTa>aAa	p.I255K	PPME1_ENST00000398427.4_Missense_Mutation_p.I255K|P4HA3_ENST00000540363.1_Intron|PPME1_ENST00000543525.1_Missense_Mutation_p.I68K			Q9Y570	PPME1_HUMAN	protein phosphatase methylesterase 1	255					negative regulation of catalytic activity (GO:0043086)|protein demethylation (GO:0006482)|regulation of catalytic activity (GO:0050790)		protein C-terminal methylesterase activity (GO:0051722)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|protein phosphatase inhibitor activity (GO:0004864)|protein phosphatase type 2A regulator activity (GO:0008601)	p.I255K(1)		endometrium(1)|large_intestine(2)|lung(2)	5	Breast(11;3.29e-05)					GAAGGAATCATAGAGGAAGAA	0.368																																							uc001ouw.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(763-765)ATA>AAA		protein phosphatase methylesterase 1							100.0	99.0	99.0					11																	73950231		1874	4095	5969	SO:0001583	missense	51400				protein demethylation		carboxylesterase activity|protein C-terminal methylesterase activity|protein phosphatase 2A binding|protein phosphatase inhibitor activity|protein phosphatase type 2A regulator activity	g.chr11:73950231T>A		CCDS44678.1, CCDS60891.1	11q13.4	2014-03-14			ENSG00000214517	ENSG00000214517	3.1.1.89		30178	protein-coding gene	gene with protein product		611117				10318862	Standard	NM_016147		Approved	PME-1	uc009yty.4	Q9Y570	OTTHUMG00000168115	ENST00000328257.8:c.764T>A	11.37:g.73950231T>A	ENSP00000329867:p.Ile255Lys					PPME1_uc009yty.2_Missense_Mutation_p.I125K|PPME1_uc001oux.2_Missense_Mutation_p.I68K	p.I255K	NM_016147	NP_057231	Q9Y570	PPME1_HUMAN			9	863	+	Breast(11;3.29e-05)		255					B3KMU6|B5MEE7|J3QT22|Q8WYG8|Q9NVT5|Q9UI18	Missense_Mutation	SNP	ENST00000328257.8	37	c.764T>A	CCDS44678.1	.	.	.	.	.	.	.	.	.	.	T	15.35	2.806461	0.50421	.	.	ENSG00000214517	ENST00000328257;ENST00000398427;ENST00000543525	T;T	0.68181	-0.31;-0.31	5.59	5.59	0.84812	.	0.038951	0.85682	D	0.000000	T	0.51143	0.1657	L	0.29908	0.895	0.80722	D	1	B;B	0.31625	0.006;0.332	B;B	0.29942	0.01;0.109	T	0.50857	-0.8778	10	0.05959	T	0.93	-21.952	15.4152	0.74960	0.0:0.0:0.0:1.0	.	68;255	Q9Y570-2;Q9Y570	.;PPME1_HUMAN	K	255;255;68	ENSP00000329867:I255K;ENSP00000381461:I255K	ENSP00000329867:I255K	I	+	2	0	PPME1	73627879	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.687000	0.68219	2.137000	0.66172	0.533000	0.62120	ATA		0.368	PPME1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398254.1	NM_016147		18	36	0	0	0	0.007413	0	18	36				
ENDOD1	23052	broad.mit.edu	37	11	94861876	94861876	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr11:94861876A>T	ENST00000278505.4	+	2	754	c.636A>T	c.(634-636)aaA>aaT	p.K212N		NM_015036.2	NP_055851.1	O94919	ENDD1_HUMAN	endonuclease domain containing 1	212						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.K212N(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.00824)				TTAAAGACAAAGTGGCAGTCC	0.557																																							uc001pfh.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(634-636)AAA>AAT		endonuclease domain containing 1 precursor							105.0	104.0	104.0					11																	94861876		1992	4166	6158	SO:0001583	missense	23052					extracellular region	endonuclease activity|metal ion binding|nucleic acid binding	g.chr11:94861876A>T	BC026191	CCDS41699.1	11q21	2010-03-19			ENSG00000149218	ENSG00000149218			29129	protein-coding gene	gene with protein product						10048485	Standard	NM_015036		Approved	KIAA0830	uc001pfh.3	O94919	OTTHUMG00000167835	ENST00000278505.4:c.636A>T	11.37:g.94861876A>T	ENSP00000278505:p.Lys212Asn						p.K212N	NM_015036	NP_055851	O94919	ENDD1_HUMAN			2	711	+		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.00824)	212					A8K6K8|Q6GQY5|Q8TAQ8	Missense_Mutation	SNP	ENST00000278505.4	37	c.636A>T	CCDS41699.1	.	.	.	.	.	.	.	.	.	.	A	13.77	2.336137	0.41398	.	.	ENSG00000149218	ENST00000278505	T	0.70631	-0.5	5.78	-0.766	0.11020	DNA/RNA non-specific endonuclease (2);Extracellular Endonuclease, subunit A (2);	0.687987	0.14539	N	0.313410	T	0.61248	0.2332	L	0.42245	1.32	0.21897	N	0.999489	B	0.31318	0.319	B	0.34452	0.183	T	0.53041	-0.8494	10	0.41790	T	0.15	-0.4192	11.5733	0.50848	0.5122:0.0:0.4878:0.0	.	212	O94919	ENDD1_HUMAN	N	212	ENSP00000278505:K212N	ENSP00000278505:K212N	K	+	3	2	ENDOD1	94501524	0.590000	0.26815	0.044000	0.18714	0.853000	0.48598	0.937000	0.28951	-0.145000	0.11294	0.374000	0.22700	AAA		0.557	ENDOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396545.1	NM_015036		22	31	0	0	0	0.012319	0	22	31				
DYNC2H1	79659	broad.mit.edu	37	11	103091378	103091378	+	Silent	SNP	A	A	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr11:103091378A>T	ENST00000375735.2	+	57	9117	c.8973A>T	c.(8971-8973)gcA>gcT	p.A2991A	DYNC2H1_ENST00000398093.3_Silent_p.A2991A|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	2991	Stalk. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.A424A(1)		NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		CTAAACTAGCAGTTGGAAACA	0.323																																							uc001pho.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(8971-8973)GCA>GCT		dynein, cytoplasmic 2, heavy chain 1							100.0	98.0	99.0					11																	103091378		1845	4102	5947	SO:0001819	synonymous_variant	79659				cell projection organization|Golgi organization|microtubule-based movement|multicellular organismal development	cilium axoneme|dynein complex|Golgi apparatus|microtubule|plasma membrane	ATP binding|ATPase activity|microtubule motor activity	g.chr11:103091378A>T	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.8973A>T	11.37:g.103091378A>T						DYNC2H1_uc001phn.1_Silent_p.A2991A|DYNC2H1_uc009yxe.1_Intron	p.A2991A	NM_001080463	NP_001073932	Q8NCM8	DYHC2_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)	57	9117	+		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)	2991			Stalk (By similarity).		O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Silent	SNP	ENST00000375735.2	37	c.8973A>T	CCDS53701.1																																																																																				0.323	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652		64	91	0	0	0	0.00361	0	64	91				
CASP5	838	broad.mit.edu	37	11	104879698	104879698	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr11:104879698C>T	ENST00000260315.3	-	2	16	c.17G>A	c.(16-18)gGc>gAc	p.G6D	CASP5_ENST00000393139.2_5'UTR|CASP5_ENST00000418434.1_Intron|CASP5_ENST00000444749.2_Intron|CASP5_ENST00000393141.2_Missense_Mutation_p.G19D|CASP5_ENST00000526056.1_Missense_Mutation_p.G19D|CASP5_ENST00000531367.1_Intron			P51878	CASP5_HUMAN	caspase 5, apoptosis-related cysteine peptidase	6					apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|execution phase of apoptosis (GO:0097194)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of inflammatory response (GO:0050727)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|NLRP1 inflammasome complex (GO:0072558)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)	p.G19D(1)		NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|ovary(3)|skin(1)|urinary_tract(1)	35		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000943)|Epithelial(105;0.0104)|all cancers(92;0.042)		TTTTTTTTTGCCACTGTCTTC	0.388																																							uc010rva.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(1)	3						c.(16-18)GGC>GAC		caspase 5 isoform a precursor							95.0	94.0	94.0					11																	104879698		2202	4299	6501	SO:0001583	missense	838				apoptosis|cellular response to mechanical stimulus|proteolysis|regulation of apoptosis	intracellular	cysteine-type endopeptidase activity|protein binding	g.chr11:104879698C>T		CCDS8328.2, CCDS44718.1, CCDS44719.1, CCDS44720.1	11q22.2-q22.3	2006-02-17	2005-08-17		ENSG00000137757	ENSG00000137757		"""Caspases"""	1506	protein-coding gene	gene with protein product		602665	"""caspase 5, apoptosis-related cysteine protease"""			7797592, 9250871	Standard	NM_004347		Approved	ICE(rel)III	uc010ruz.1	P51878	OTTHUMG00000048073	ENST00000260315.3:c.17G>A	11.37:g.104879698C>T	ENSP00000260315:p.Gly6Asp					CASP5_uc010ruz.1_Missense_Mutation_p.G19D|CASP5_uc010rvb.1_Intron|CASP5_uc010rvc.1_Intron|CASP5_uc009yxh.2_Intron|CASP5_uc010rvd.1_Intron	p.G6D	NM_004347	NP_004338	P51878	CASP5_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.000943)|Epithelial(105;0.0104)|all cancers(92;0.042)	2	49	-		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)	6					B4DKP5|Q0QVY7|Q0QVY8|Q0QVZ0|Q0QVZ1|Q0QVZ2|Q14DD6|Q1HBJ3|Q6DJV7	Missense_Mutation	SNP	ENST00000260315.3	37	c.17G>A	CCDS8328.2	.	.	.	.	.	.	.	.	.	.	.	1.538	-0.542610	0.04053	.	.	ENSG00000137757	ENST00000393141;ENST00000260315;ENST00000526056	T;T;T	0.02258	4.37;4.44;4.37	0.961	-1.92	0.07618	.	.	.	.	.	T	0.01156	0.0038	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.46582	-0.9181	9	0.38643	T	0.18	.	2.1722	0.03852	0.0:0.2611:0.3255:0.4135	.	6;19	P51878;P51878-5	CASP5_HUMAN;.	D	19;6;19	ENSP00000376849:G19D;ENSP00000260315:G6D;ENSP00000436877:G19D	ENSP00000260315:G6D	G	-	2	0	CASP5	104384908	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.871000	0.04223	-0.751000	0.04734	-1.396000	0.01147	GGC		0.388	CASP5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109397.2	NM_004347		15	39	0	0	0	0.006122	0	15	39				
BLID	414899	broad.mit.edu	37	11	121986432	121986432	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr11:121986432G>T	ENST00000560104.1	-	1	491	c.199C>A	c.(199-201)Ctt>Att	p.L67I		NM_001001786.2	NP_001001786.2	Q8IZY5	BLID_HUMAN	BH3-like motif containing, cell death inducer	67					apoptotic process (GO:0006915)	mitochondrion (GO:0005739)		p.L67I(1)		NS(1)|large_intestine(4)|lung(6)|pancreas(1)	12		Breast(109;0.0164)|Medulloblastoma(222;0.0523)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;2.08e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.101)		TACCTTTTAAGAGAAAGCACT	0.463											OREG0021435	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001pyf.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(199-201)CTT>ATT		BRCC2 protein							165.0	164.0	165.0					11																	121986432		2202	4299	6501	SO:0001583	missense	414899				apoptosis	mitochondrion		g.chr11:121986432G>T	AF303179	CCDS31693.1	11q24.1	2007-06-22				ENSG00000259571			33495	protein-coding gene	gene with protein product	"""breast cancer cell 2"""	608853				15069058, 17220890	Standard	NM_001001786		Approved	BRCC2	uc001pyf.3	Q8IZY5		ENST00000560104.1:c.199C>A	11.37:g.121986432G>T	ENSP00000453153:p.Leu67Ile		OREG0021435	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1515	LOC399959_uc009zba.2_Intron	p.L67I	NM_001001786	NP_001001786	Q8IZY5	BLID_HUMAN		BRCA - Breast invasive adenocarcinoma(274;2.08e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.101)	1	492	-		Breast(109;0.0164)|Medulloblastoma(222;0.0523)|all_neural(223;0.224)	67					A1L416	Missense_Mutation	SNP	ENST00000560104.1	37	c.199C>A	CCDS31693.1	.	.	.	.	.	.	.	.	.	.	G	9.467	1.094714	0.20471	.	.	ENSG00000258606;ENSG00000258574	ENST00000553434;ENST00000556841	.	.	.	3.21	-0.0123	0.13989	.	.	.	.	.	T	0.16514	0.0397	N	0.08118	0	0.09310	N	1	P	0.44816	0.844	B	0.43809	0.432	T	0.13683	-1.0500	8	0.87932	D	0	.	5.672	0.17728	0.0:0.1925:0.4137:0.3938	.	67	Q8IZY5	BLID_HUMAN	I	67	.	ENSP00000448995:L67I	L	-	1	0	BLID;AP001924.1	121491642	0.004000	0.15560	0.003000	0.11579	0.039000	0.13416	-0.054000	0.11826	0.014000	0.14944	0.591000	0.81541	CTT		0.463	BLID-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387656.1	NM_001001786		71	55	1	0	2.5377e-55	0.00361	5.28217e-55	71	55				
CACNA1C	775	broad.mit.edu	37	12	2721098	2721098	+	Silent	SNP	C	C	A	rs370576211	byFrequency	TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr12:2721098C>A	ENST00000347598.4	+	30	3807	c.3807C>A	c.(3805-3807)atC>atA	p.I1269I	CACNA1C_ENST00000327702.7_Silent_p.I1249I|CACNA1C_ENST00000399606.1_Silent_p.I1269I|CACNA1C_ENST00000399629.1_Silent_p.I1249I|CACNA1C_ENST00000399597.1_Silent_p.I1249I|CACNA1C_ENST00000399617.1_Silent_p.I1249I|CACNA1C_ENST00000399655.1_Silent_p.I1249I|CACNA1C_ENST00000399649.1_Silent_p.I1249I|CACNA1C_ENST00000399634.1_Silent_p.I1249I|CACNA1C_ENST00000399591.1_Silent_p.I1249I|CACNA1C_ENST00000399638.1_Silent_p.I1249I|CACNA1C_ENST00000480911.1_Silent_p.I1249I|CACNA1C_ENST00000399595.1_Silent_p.I1249I|CACNA1C_ENST00000344100.3_Silent_p.I1249I|CACNA1C_ENST00000406454.3_Silent_p.I1249I|CACNA1C_ENST00000399637.1_Silent_p.I1249I|CACNA1C_ENST00000399641.1_Silent_p.I1249I|CACNA1C_ENST00000402845.3_Silent_p.I1249I|CACNA1C_ENST00000399644.1_Silent_p.I1249I|CACNA1C_ENST00000399621.1_Silent_p.I1249I|CACNA1C_ENST00000399601.1_Silent_p.I1249I|CACNA1C_ENST00000399603.1_Silent_p.I1249I|CACNA1C_ENST00000335762.5_Silent_p.I1274I	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	1269					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.I1249I(2)|p.I784I(1)|p.I1269I(1)|p.I1299I(1)		NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	TGTTCAAAATCGCCATGAACA	0.562																																							uc009zdu.1		NA																	5	Substitution - coding silent(5)		lung(5)	ovary(10)|central_nervous_system(1)	11						c.(3805-3807)ATC>ATA		calcium channel, voltage-dependent, L type,	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)						101.0	98.0	99.0					12																	2721098		2184	4296	6480	SO:0001819	synonymous_variant	775				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity	g.chr12:2721098C>A	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.3807C>A	12.37:g.2721098C>A						CACNA1C_uc009zdv.1_Silent_p.I1246I|CACNA1C_uc001qkb.2_Silent_p.I1249I|CACNA1C_uc001qkc.2_Silent_p.I1249I|CACNA1C_uc001qke.2_Silent_p.I1249I|CACNA1C_uc001qkf.2_Silent_p.I1249I|CACNA1C_uc001qjz.2_Silent_p.I1249I|CACNA1C_uc001qkd.2_Silent_p.I1249I|CACNA1C_uc001qkg.2_Silent_p.I1249I|CACNA1C_uc009zdw.1_Silent_p.I1249I|CACNA1C_uc001qkh.2_Silent_p.I1249I|CACNA1C_uc001qkl.2_Silent_p.I1269I|CACNA1C_uc001qkn.2_Silent_p.I1249I|CACNA1C_uc001qko.2_Silent_p.I1269I|CACNA1C_uc001qkp.2_Silent_p.I1249I|CACNA1C_uc001qkr.2_Silent_p.I1249I|CACNA1C_uc001qku.2_Silent_p.I1249I|CACNA1C_uc001qkq.2_Silent_p.I1249I|CACNA1C_uc001qks.2_Silent_p.I1249I|CACNA1C_uc001qkt.2_Silent_p.I1249I|CACNA1C_uc001qka.1_Silent_p.I784I|CACNA1C_uc001qki.1_Silent_p.I985I|CACNA1C_uc001qkj.1_Silent_p.I985I|CACNA1C_uc001qkk.1_Silent_p.I985I|CACNA1C_uc001qkm.1_Silent_p.I985I	p.I1269I	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	30	4120	+			1269			IV.|Extracellular (Potential).		B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Silent	SNP	ENST00000347598.4	37	c.3807C>A	CCDS44788.1																																																																																				0.562	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719		39	41	1	0	1.59361e-14	0.006999	2.30827e-14	39	41				
VWF	7450	broad.mit.edu	37	12	6085306	6085306	+	Nonsense_Mutation	SNP	G	G	A	rs61751288		TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr12:6085306G>A	ENST00000261405.5	-	43	7662	c.7408C>T	c.(7408-7410)Cag>Tag	p.Q2470*		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	2470	VWFC 2. {ECO:0000255|PROSITE- ProRule:PRU00220}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)	p.Q2470*(1)		NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	CAGGGCTTCTGGGAGCACTGG	0.637																																							uc001qnn.1		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12	GRCh37	CM020777	VWF	M	rs61751288	c.(7408-7410)CAG>TAG		von Willebrand factor preproprotein	Antihemophilic Factor(DB00025)						56.0	53.0	54.0					12																	6085306		2203	4300	6503	SO:0001587	stop_gained	7450				blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding	g.chr12:6085306G>A		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.7408C>T	12.37:g.6085306G>A	ENSP00000261405:p.Gln2470*					VWF_uc010set.1_Intron	p.Q2470*	NM_000552	NP_000543	P04275	VWF_HUMAN			43	7658	-			2470			VWFC 2.		Q8TCE8|Q99806	Nonsense_Mutation	SNP	ENST00000261405.5	37	c.7408C>T	CCDS8539.1	.	.	.	.	.	.	.	.	.	.	G	50	16.196276	0.99857	.	.	ENSG00000110799	ENST00000261405	.	.	.	5.28	4.33	0.51752	.	0.635484	0.13108	N	0.413167	.	.	.	.	.	.	0.48632	D	0.999683	.	.	.	.	.	.	.	.	.	.	0.06757	T	0.87	.	13.3078	0.60363	0.0:0.2167:0.7833:0.0	rs61751288	.	.	.	X	2470	.	ENSP00000261405:Q2470X	Q	-	1	0	VWF	5955567	0.908000	0.30866	0.998000	0.56505	0.968000	0.65278	2.124000	0.42006	2.459000	0.83118	0.655000	0.94253	CAG		0.637	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552		18	80	0	0	0	0.006122	0	18	80				
VWF	7450	broad.mit.edu	37	12	6085325	6085325	+	Silent	SNP	G	G	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr12:6085325G>A	ENST00000261405.5	-	43	7643	c.7389C>T	c.(7387-7389)ctC>ctT	p.L2463L		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	2463	VWFC 2. {ECO:0000255|PROSITE- ProRule:PRU00220}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)	p.L2463L(1)		NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	GGGCCACGCGGAGGCCCATCA	0.642																																							uc001qnn.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12						c.(7387-7389)CTC>CTT		von Willebrand factor preproprotein	Antihemophilic Factor(DB00025)						71.0	63.0	66.0					12																	6085325		2203	4300	6503	SO:0001819	synonymous_variant	7450				blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding	g.chr12:6085325G>A		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.7389C>T	12.37:g.6085325G>A						VWF_uc010set.1_Intron	p.L2463L	NM_000552	NP_000543	P04275	VWF_HUMAN			43	7639	-			2463			VWFC 2.		Q8TCE8|Q99806	Silent	SNP	ENST00000261405.5	37	c.7389C>T	CCDS8539.1																																																																																				0.642	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552		17	83	0	0	0	0.006122	0	17	83				
SLC2A14	144195	broad.mit.edu	37	12	7984358	7984358	+	Silent	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr12:7984358G>T	ENST00000543909.1	-	9	942	c.183C>A	c.(181-183)atC>atA	p.I61I	SLC2A14_ENST00000340749.5_Silent_p.I38I|SLC2A14_ENST00000535295.1_Intron|SLC2A14_ENST00000542505.1_Intron|SLC2A14_ENST00000396589.2_Silent_p.I61I|SLC2A14_ENST00000539924.1_Silent_p.I76I|SLC2A14_ENST00000431042.2_Silent_p.I38I|SLC2A14_ENST00000542546.1_Intron			Q8TDB8	GTR14_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 14	61					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	glucose transmembrane transporter activity (GO:0005355)	p.I61I(1)		central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	38				Kidney(36;0.0883)		ATTCCTTTATGATCTGCAAAA	0.443											OREG0021654	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001qtk.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(181-183)ATC>ATA		glucose transporter 14							76.0	74.0	74.0					12																	7984358		2203	4300	6503	SO:0001819	synonymous_variant	144195				cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane	glucose transmembrane transporter activity	g.chr12:7984358G>T	AF481878	CCDS8585.1, CCDS66300.1, CCDS66301.1, CCDS66302.1	12p13.31	2013-07-15			ENSG00000173262	ENSG00000173262		"""Solute carriers"""	18301	protein-coding gene	gene with protein product		611039	"""solute carrier family 2 (facilitated glucose transporter), member 3 pseudogene 3"""	SLC2A3P3		12504846	Standard	NM_001286234		Approved	GLUT14	uc001qtn.3	Q8TDB8	OTTHUMG00000168463	ENST00000543909.1:c.183C>A	12.37:g.7984358G>T			OREG0021654	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	645	SLC2A14_uc001qtl.2_Silent_p.I38I|SLC2A14_uc001qtm.2_Silent_p.I38I|SLC2A14_uc010sgg.1_Intron|SLC2A14_uc001qtn.2_Silent_p.I61I|SLC2A14_uc001qto.2_Intron|SLC2A14_uc010sgh.1_Silent_p.I76I	p.I61I	NM_153449	NP_703150	Q8TDB8	GTR14_HUMAN		Kidney(36;0.0883)	9	976	-			61			Extracellular (Potential).		B3KVB5|B3KWW7|B7Z844|B7ZAC3|Q6UY84|Q8TDB9	Silent	SNP	ENST00000543909.1	37	c.183C>A	CCDS8585.1																																																																																				0.443	SLC2A14-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000399836.2	NM_153449		18	58	1	0	3.52763e-06	0.00499	4.06256e-06	18	58				
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	A	rs121913530		TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr12:25398285C>A	ENST00000256078.4	-	2	97	c.34G>T	c.(34-36)Ggt>Tgt	p.G12C	KRAS_ENST00000556131.1_Missense_Mutation_p.G12C|KRAS_ENST00000311936.3_Missense_Mutation_p.G12C|KRAS_ENST00000557334.1_Missense_Mutation_p.G12C	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1	G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12C(CALU1_LUNG)|G12C(NCIH2030_LUNG)|G12C(LU99_LUNG)|G12C(NCIH1792_LUNG)|G12R(KP2_PANCREAS)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(NCIH2122_LUNG)|G12C(NCIH358_LUNG)|G12R(PSN1_PANCREAS)|G12C(KYSE410_OESOPHAGUS)|G12S(A549_LUNG)|G12R(HUPT3_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12C(HCC44_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(SW1463_LARGE_INTESTINE)|G12C(NCIH23_LUNG)|G12C(LU65_LUNG)|G12C(NCIH1373_LUNG)|G12C(MIAPACA2_PANCREAS)|G12R(HS274T_BREAST)|G12S(LS123_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(OV56_OVARY)|G12C(IALM_LUNG)	119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		5144	Substitution - Missense(5142)|Insertion - In frame(2)	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12G(6)|p.G12N(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)GGT>TGT		c-K-ras2 protein isoform a precursor							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25398285C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>T	12.37:g.25398285C>A	ENSP00000256078:p.Gly12Cys	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_uc001rgq.1_Missense_Mutation_p.G12C|KRAS_uc001rgr.2_RNA	p.G12C	NM_033360	NP_203524	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		2	215	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		12		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).	GTP.		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	c.34G>T	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676185	0.88445	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90466	0.7014	M	0.90650	3.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	D	0.91833	0.5477	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	C	12	ENSP00000308495:G12C;ENSP00000452512:G12C;ENSP00000256078:G12C;ENSP00000451856:G12C	ENSP00000256078:G12C	G	-	1	0	KRAS	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		13	9	1	0	4.7546e-09	0.004007	5.96448e-09	13	9				
TMTC1	83857	broad.mit.edu	37	12	29908673	29908673	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr12:29908673G>T	ENST00000539277.1	-	4	758	c.700C>A	c.(700-702)Ctc>Atc	p.L234I	TMTC1_ENST00000381224.2_Missense_Mutation_p.L126I|TMTC1_ENST00000552618.1_Missense_Mutation_p.L234I|TMTC1_ENST00000256062.5_Missense_Mutation_p.L126I|TMTC1_ENST00000551659.1_Missense_Mutation_p.L234I	NM_001193451.1	NP_001180380.1	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat containing 1	234						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)		p.L126I(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(17)|lung(45)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					AGGGAAAAGAGGTCATAAACC	0.433																																							uc001rjb.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(376-378)CTC>ATC		transmembrane and tetratricopeptide repeat							119.0	107.0	111.0					12																	29908673		2203	4300	6503	SO:0001583	missense	83857					integral to membrane	binding	g.chr12:29908673G>T		CCDS8718.1, CCDS53772.1	12p11.22	2014-06-09	2006-01-06			ENSG00000133687		"""Tetratricopeptide (TTC) repeat domain containing"""	24099	protein-coding gene	gene with protein product		615855				24764305	Standard	NM_001193451		Approved	ARG99, OLF, FLJ31400, FLJ41625	uc021qwi.1	Q8IUR5	OTTHUMG00000169324	ENST00000539277.1:c.700C>A	12.37:g.29908673G>T	ENSP00000442046:p.Leu234Ile					TMTC1_uc001rjc.1_Missense_Mutation_p.L126I	p.L126I	NM_175861	NP_787057	Q8IUR5	TMTC1_HUMAN			4	850	-	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)		234					D0EP37|F5H8B5|Q6PIU4|Q6ZSM5|Q96N52|Q9BXM2	Missense_Mutation	SNP	ENST00000539277.1	37	c.376C>A	CCDS53772.1	.	.	.	.	.	.	.	.	.	.	G	15.64	2.891971	0.52014	.	.	ENSG00000133687	ENST00000256062;ENST00000551659;ENST00000552618;ENST00000539277;ENST00000381224	T;T;T;T;T	0.70045	-0.4;-0.2;-0.45;-0.32;1.4	5.58	3.77	0.43336	.	0.359901	0.29572	N	0.011775	T	0.50326	0.1609	L	0.31664	0.95	0.27228	N	0.959483	B;P	0.45044	0.134;0.849	B;B	0.40702	0.067;0.338	T	0.40794	-0.9544	9	.	.	.	-13.9422	7.1324	0.25508	0.3316:0.0:0.6684:0.0	.	126;234	Q8IUR5-3;Q8IUR5	.;TMTC1_HUMAN	I	126;234;234;234;126	ENSP00000256062:L126I;ENSP00000448112:L234I;ENSP00000449043:L234I;ENSP00000442046:L234I;ENSP00000370622:L126I	.	L	-	1	0	TMTC1	29799940	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.574000	0.46016	0.726000	0.32339	0.655000	0.94253	CTC		0.433	TMTC1-002	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403509.1	NM_031920		46	13	1	0	3.21987e-24	0.00361	5.32226e-24	46	13				
KRT85	3891	broad.mit.edu	37	12	52756686	52756686	+	Silent	SNP	G	G	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr12:52756686G>A	ENST00000257901.3	-	6	1104	c.1029C>T	c.(1027-1029)aaC>aaT	p.N343N	KRT85_ENST00000544265.1_Silent_p.N131N	NM_002283.3	NP_002274.1	P78386	KRT85_HUMAN	keratin 85	343	Coil 2.|Rod.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.N343N(1)		NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(7)|liver(1)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	36	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		GGATCATGCGGTTCAGCTCGT	0.582																																							uc001sag.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1027-1029)AAC>AAT		keratin 85							157.0	126.0	136.0					12																	52756686		2203	4300	6503	SO:0001819	synonymous_variant	3891				epidermis development	keratin filament	protein binding|structural molecule activity	g.chr12:52756686G>A	X99140	CCDS8824.1, CCDS73472.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000135443	ENSG00000135443		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6462	protein-coding gene	gene with protein product	"""hard keratin type II"""	602767	"""keratin, hair, basic, 5"""	KRTHB5		9084137, 16831889	Standard	NM_002283		Approved	Hb-5	uc001sag.3	P78386	OTTHUMG00000169633	ENST00000257901.3:c.1029C>T	12.37:g.52756686G>A							p.N343N	NM_002283	NP_002274	P78386	KRT85_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.189)	6	1149	-	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)		343			Rod.|Coil 2.		Q9NSB1	Silent	SNP	ENST00000257901.3	37	c.1029C>T	CCDS8824.1																																																																																				0.582	KRT85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405184.1	NM_002283		96	34	0	0	0	0.00361	0	96	34				
GRIP1	23426	broad.mit.edu	37	12	66765685	66765685	+	Missense_Mutation	SNP	G	G	T	rs367781032		TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr12:66765685G>T	ENST00000398016.3	-	22	2713	c.2645C>A	c.(2644-2646)aCg>aAg	p.T882K	GRIP1_ENST00000286445.7_Missense_Mutation_p.T919K|GRIP1_ENST00000359742.4_Missense_Mutation_p.T934K	NM_021150.3	NP_066973.2	Q96DT0	LEG12_HUMAN	glutamate receptor interacting protein 1	0					intrinsic apoptotic signaling pathway (GO:0097193)	nucleus (GO:0005634)	lactose binding (GO:0030395)	p.T882K(1)		NS(3)|breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(19)|ovary(2)|prostate(2)|skin(1)	50			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		CAAACTCATCGTGCTCCCCGA	0.512																																							uc001stk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(2644-2646)ACG>AAG		glutamate receptor interacting protein 1							53.0	57.0	56.0					12																	66765685		2028	4197	6225	SO:0001583	missense	23426				androgen receptor signaling pathway|intracellular signal transduction|positive regulation of transcription, DNA-dependent|synaptic transmission	cell junction|cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|postsynaptic membrane	androgen receptor binding|beta-catenin binding|protein C-terminus binding|receptor signaling complex scaffold activity|transcription coactivator activity	g.chr12:66765685G>T	AJ133439	CCDS41807.1	12q13.13	2008-05-02			ENSG00000155974	ENSG00000155974			18708	protein-coding gene	gene with protein product		604597				10197531	Standard	NM_021150		Approved		uc001stk.3	Q9Y3R0	OTTHUMG00000169019	ENST00000398016.3:c.2645C>A	12.37:g.66765685G>T	ENSP00000381098:p.Thr882Lys					GRIP1_uc010sta.1_Missense_Mutation_p.T826K|GRIP1_uc001stj.2_Missense_Mutation_p.T649K|GRIP1_uc001stl.1_Missense_Mutation_p.T759K|GRIP1_uc001stm.2_Missense_Mutation_p.T867K	p.T882K	NM_021150	NP_066973	Q9Y3R0	GRIP1_HUMAN	GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)	22	2886	-			934					B2R9N2|G5E970|Q96DS9|Q96PR9|Q9H258|Q9H259|Q9NZ02	Missense_Mutation	SNP	ENST00000398016.3	37	c.2645C>A	CCDS41807.1	.	.	.	.	.	.	.	.	.	.	G	15.41	2.825753	0.50739	.	.	ENSG00000155974	ENST00000398016;ENST00000359742;ENST00000286445;ENST00000538211;ENST00000540433;ENST00000536215	T;T;T;T;T;T	0.78924	-1.22;-1.22;-1.22;-1.22;-1.22;-1.22	6.07	6.07	0.98685	.	0.147302	0.64402	D	0.000014	T	0.79822	0.4512	L	0.56769	1.78	0.47341	D	0.999399	B;P;B;P	0.45126	0.413;0.768;0.117;0.851	B;B;B;P	0.44647	0.229;0.137;0.068;0.456	T	0.77167	-0.2687	9	.	.	.	-13.6657	20.6593	0.99626	0.0:0.0:1.0:0.0	.	867;934;882;919	F5H4N6;Q9Y3R0;Q9Y3R0-3;Q9Y3R0-2	.;GRIP1_HUMAN;.;.	K	882;934;919;867;826;759	ENSP00000381098:T882K;ENSP00000352780:T934K;ENSP00000286445:T919K;ENSP00000446047:T867K;ENSP00000446024:T826K;ENSP00000446011:T759K	.	T	-	2	0	GRIP1	65051952	1.000000	0.71417	1.000000	0.80357	0.717000	0.41224	5.059000	0.64306	2.885000	0.99019	0.655000	0.94253	ACG		0.512	GRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401975.2			84	30	1	0	8.2577e-42	0.00361	1.63409e-41	84	30				
NAV3	89795	broad.mit.edu	37	12	78574707	78574707	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr12:78574707C>A	ENST00000397909.2	+	30	5747	c.5574C>A	c.(5572-5574)aaC>aaA	p.N1858K	NAV3_ENST00000228327.6_Missense_Mutation_p.N1836K|NAV3_ENST00000266692.7_Missense_Mutation_p.N1659K|NAV3_ENST00000552300.1_3'UTR|NAV3_ENST00000536525.2_Missense_Mutation_p.N1836K			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1858						membrane (GO:0016020)|nuclear envelope (GO:0005635)		p.N1836K(1)		NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						AAACTGGTAACACAGCTAAGC	0.408										HNSCC(70;0.22)																													uc001syp.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						c.(5572-5574)AAC>AAA		neuron navigator 3							90.0	91.0	91.0					12																	78574707		1961	4147	6108	SO:0001583	missense	89795					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity	g.chr12:78574707C>A	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.5574C>A	12.37:g.78574707C>A	ENSP00000381007:p.Asn1858Lys	HNSCC(70;0.22)				NAV3_uc001syo.2_Missense_Mutation_p.N1836K|NAV3_uc010sub.1_Missense_Mutation_p.N1315K|NAV3_uc009zsf.2_Missense_Mutation_p.N667K	p.N1858K	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN			30	5747	+			1858			Potential.		Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37	c.5574C>A		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.69|13.69	2.312711|2.312711	0.40895|0.40895	.|.	.|.	ENSG00000067798|ENSG00000067798	ENST00000552895|ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692;ENST00000378640;ENST00000550788	.|T;T;T;T;T	.|0.26518	.|1.83;1.83;1.82;1.73;2.61	6.02|6.02	3.98|3.98	0.46160|0.46160	.|.	.|0.000000	.|0.43110	.|U	.|0.000608	T|T	0.10723|0.10723	0.0262|0.0262	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	.|B;B;P;B	.|0.45531	.|0.215;0.11;0.86;0.372	.|B;B;B;B	.|0.39590	.|0.101;0.059;0.304;0.121	T|T	0.06197|0.06197	-1.0840|-1.0840	5|10	.|0.39692	.|T	.|0.17	-21.1592|-21.1592	4.342|4.342	0.11115|0.11115	0.0:0.5697:0.0:0.4303|0.0:0.5697:0.0:0.4303	.|.	.|1836;1659;1858;1836	.|E7EUC6;Q8IVL0-3;Q8IVL0;Q8IVL0-2	.|.;.;NAV3_HUMAN;.	N|K	731|1836;1858;1836;1659;450;458	.|ENSP00000446132:N1836K;ENSP00000381007:N1858K;ENSP00000228327:N1836K;ENSP00000266692:N1659K;ENSP00000448303:N458K	.|ENSP00000228327:N1836K	H|N	+|+	1|3	0|2	NAV3|NAV3	77098838|77098838	1.000000|1.000000	0.71417|0.71417	0.177000|0.177000	0.23020|0.23020	0.922000|0.922000	0.55478|0.55478	1.739000|1.739000	0.38217|0.38217	1.542000|1.542000	0.49330|0.49330	0.650000|0.650000	0.86243|0.86243	CAC|AAC		0.408	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383		62	12	1	0	2.40265e-35	0.00361	4.56179e-35	62	12				
STAB2	55576	broad.mit.edu	37	12	104030904	104030904	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr12:104030904C>T	ENST00000388887.2	+	7	803	c.599C>T	c.(598-600)gCa>gTa	p.A200V		NM_017564.9	NP_060034.9			stabilin 2									p.A200V(1)		NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						CCTGAATGTGCAGCCTTGCTC	0.428																																							uc001tjw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(9)|skin(5)	14						c.(598-600)GCA>GTA		stabilin 2 precursor							121.0	119.0	120.0					12																	104030904		2203	4300	6503	SO:0001583	missense	55576				angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity	g.chr12:104030904C>T	AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.599C>T	12.37:g.104030904C>T	ENSP00000373539:p.Ala200Val						p.A200V	NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN			7	785	+			200			Extracellular (Potential).|EGF-like 3.			Missense_Mutation	SNP	ENST00000388887.2	37	c.599C>T	CCDS31888.1	.	.	.	.	.	.	.	.	.	.	C	12.91	2.079604	0.36662	.	.	ENSG00000136011	ENST00000388887	T	0.08193	3.12	5.33	4.36	0.52297	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.297435	0.31577	N	0.007401	T	0.10594	0.0259	M	0.64997	1.995	0.35849	D	0.82662	B	0.20052	0.041	B	0.15870	0.014	T	0.06826	-1.0805	10	0.30078	T	0.28	.	12.5978	0.56481	0.2451:0.7549:0.0:0.0	.	200	Q8WWQ8	STAB2_HUMAN	V	200	ENSP00000373539:A200V	ENSP00000373539:A200V	A	+	2	0	STAB2	102555034	0.773000	0.28580	0.981000	0.43875	0.666000	0.39218	1.002000	0.29796	2.490000	0.84030	0.655000	0.94253	GCA		0.428	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1			132	40	0	0	0	0.00361	0	132	40				
NUAK1	9891	broad.mit.edu	37	12	106477704	106477704	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr12:106477704C>A	ENST00000261402.2	-	4	1896	c.517G>T	c.(517-519)Ggt>Tgt	p.G173C		NM_014840.2	NP_055655.1	O60285	NUAK1_HUMAN	NUAK family, SNF1-like kinase, 1	173	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell adhesion (GO:0007155)|cellular response to DNA damage stimulus (GO:0006974)|regulation of cell adhesion (GO:0030155)|regulation of cell proliferation (GO:0042127)|regulation of cellular senescence (GO:2000772)|regulation of myosin-light-chain-phosphatase activity (GO:0035507)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)	p.G173C(4)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	37						TGGACCACACCGTTCTGAAAT	0.488																																							uc001tlj.1		NA																	4	Substitution - Missense(4)		lung(4)	ovary(1)|central_nervous_system(1)	2						c.(517-519)GGT>TGT		AMPK-related protein kinase 5							98.0	87.0	91.0					12																	106477704		2203	4300	6503	SO:0001583	missense	9891						ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity	g.chr12:106477704C>A	AB011109	CCDS31892.1	12q23.3	2005-08-09				ENSG00000074590			14311	protein-coding gene	gene with protein product	"""AMP-activated protein kinase family member 5"""	608130				12409306, 13679856	Standard	NM_014840		Approved	ARK5, KIAA0537, NuaK1	uc001tlj.1	O60285	OTTHUMG00000169763	ENST00000261402.2:c.517G>T	12.37:g.106477704C>A	ENSP00000261402:p.Gly173Cys						p.G173C	NM_014840	NP_055655	O60285	NUAK1_HUMAN			4	1897	-			173			Protein kinase.		A7MD39|Q96KA8	Missense_Mutation	SNP	ENST00000261402.2	37	c.517G>T	CCDS31892.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.142439	0.77888	.	.	ENSG00000074590	ENST00000261402;ENST00000359413;ENST00000548902	T;T	0.32023	1.47;1.47	5.38	5.38	0.77491	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.56097	D	0.000025	T	0.62563	0.2438	M	0.87827	2.91	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.64330	-0.6433	10	0.37606	T	0.19	.	19.1645	0.93548	0.0:1.0:0.0:0.0	.	173	O60285	NUAK1_HUMAN	C	173;173;42	ENSP00000261402:G173C;ENSP00000448288:G42C	ENSP00000261402:G173C	G	-	1	0	NUAK1	105001834	1.000000	0.71417	0.986000	0.45419	0.999000	0.98932	7.487000	0.81328	2.532000	0.85374	0.650000	0.86243	GGT		0.488	NUAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405767.2	NM_014840		110	24	1	0	1.89039e-43	0.00361	3.79428e-43	110	24				
CSNK1A1L	122011	broad.mit.edu	37	13	37678663	37678663	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr13:37678663G>T	ENST00000379800.3	-	1	1140	c.731C>A	c.(730-732)cCt>cAt	p.P244H		NM_145203.5	NP_660204.2	Q8N752	KC1AL_HUMAN	casein kinase 1, alpha 1-like	244	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell morphogenesis (GO:0000902)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.P244H(1)		NS(1)|breast(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	37		Lung NSC(96;7.97e-05)|Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.109)		all cancers(112;3.58e-07)|Epithelial(112;1.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00695)|BRCA - Breast invasive adenocarcinoma(63;0.0117)|GBM - Glioblastoma multiforme(144;0.0407)		AACTTCAACAGGGGTGGACAT	0.418																																							uc001uwm.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(730-732)CCT>CAT		casein kinase 1, alpha 1-like							114.0	114.0	114.0					13																	37678663		2203	4300	6503	SO:0001583	missense	122011				Wnt receptor signaling pathway	cytoplasm	ATP binding|protein serine/threonine kinase activity	g.chr13:37678663G>T	BC028723	CCDS9363.1	13q13.2	2008-02-05			ENSG00000180138	ENSG00000180138			20289	protein-coding gene	gene with protein product							Standard	NM_145203		Approved	MGC33182	uc001uwm.1	Q8N752	OTTHUMG00000016748	ENST00000379800.3:c.731C>A	13.37:g.37678663G>T	ENSP00000369126:p.Pro244His						p.P244H	NM_145203	NP_660204	Q8N752	KC1AL_HUMAN		all cancers(112;3.58e-07)|Epithelial(112;1.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00695)|BRCA - Breast invasive adenocarcinoma(63;0.0117)|GBM - Glioblastoma multiforme(144;0.0407)	1	1139	-		Lung NSC(96;7.97e-05)|Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.109)	244			Protein kinase.		Q5T2N2	Missense_Mutation	SNP	ENST00000379800.3	37	c.731C>A	CCDS9363.1	.	.	.	.	.	.	.	.	.	.	G	16.02	3.003835	0.54254	.	.	ENSG00000180138	ENST00000379800	T	0.10960	2.82	1.08	1.08	0.20341	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.43986	0.1272	H	0.98507	4.25	0.44985	D	0.998007	D	0.89917	1.0	D	0.85130	0.997	T	0.54708	-0.8253	10	0.87932	D	0	.	7.9927	0.30250	0.0:0.0:1.0:0.0	.	244	Q8N752	KC1AL_HUMAN	H	244	ENSP00000369126:P244H	ENSP00000369126:P244H	P	-	2	0	CSNK1A1L	36576663	1.000000	0.71417	0.994000	0.49952	0.944000	0.59088	6.640000	0.74319	0.871000	0.35750	0.561000	0.74099	CCT		0.418	CSNK1A1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044563.1	NM_145203		45	28	1	0	1.76056e-25	0.011902	2.98022e-25	45	28				
ENOX1	55068	broad.mit.edu	37	13	43930154	43930154	+	Silent	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr13:43930154G>T	ENST00000261488.6	-	8	1301	c.724C>A	c.(724-726)Cgg>Agg	p.R242R	ENOX1_ENST00000540032.1_Silent_p.R55R|ENOX1_ENST00000412891.1_Silent_p.R242R	NM_001242863.1|NM_017993.3	NP_001229792.1|NP_060463.2	Q8TC92	ENOX1_HUMAN	ecto-NOX disulfide-thiol exchanger 1	242					rhythmic process (GO:0048511)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)	nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|oxidoreductase activity (GO:0016491)	p.R242R(2)		breast(1)|endometrium(3)|large_intestine(7)|lung(18)|pancreas(2)|prostate(1)|skin(1)|urinary_tract(1)	34		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)		AGCTTGCGCCGGTGCCGCTCC	0.617																																							uc001uza.3		NA																	2	Substitution - coding silent(2)		lung(2)	pancreas(1)|skin(1)	2						c.(724-726)CGG>AGG		ecto-NOX disulfide-thiol exchanger 1							83.0	88.0	86.0					13																	43930154		2203	4300	6503	SO:0001819	synonymous_variant	55068				electron transport chain|rhythmic process|transport	extracellular space|plasma membrane	nucleic acid binding|nucleotide binding|oxidoreductase activity	g.chr13:43930154G>T	EF432052	CCDS9389.1	13q14.11	2013-02-12			ENSG00000120658	ENSG00000120658		"""RNA binding motif (RRM) containing"""	25474	protein-coding gene	gene with protein product		610914				11360993	Standard	NM_001127615		Approved	FLJ10094, PIG38, CNOX, cCNOX	uc001uza.4	Q8TC92	OTTHUMG00000016818	ENST00000261488.6:c.724C>A	13.37:g.43930154G>T						ENOX1_uc001uzb.3_Silent_p.R242R|ENOX1_uc001uzc.3_Silent_p.R242R|ENOX1_uc001uyz.3_5'UTR|ENOX1_uc010tfm.1_Silent_p.R55R	p.R242R	NM_001127615	NP_001121087	Q8TC92	ENOX1_HUMAN		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)	8	1024	-		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)	242					A4GU15|A6NMH9|B7Z5K1|Q2TU81|Q5VT11|Q9NWE0	Silent	SNP	ENST00000261488.6	37	c.724C>A	CCDS9389.1																																																																																				0.617	ENOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044717.2	NM_017993		74	32	1	0	6.00099e-30	0.00361	1.08095e-29	74	32				
RB1	5925	broad.mit.edu	37	13	49039189	49039189	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr13:49039189A>G	ENST00000267163.4	+	22	2405	c.2267A>G	c.(2266-2268)tAt>tGt	p.Y756C		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	756	Domain B.|Pocket; binds T and E1A.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(12)|p.Y756C(2)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	ATAGTATTCTATAACTCGGTC	0.299		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																													uc001vcb.2		6	yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	D|Mis|N|F|S	retinoblastoma gene			"""L, E, M, O"""		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung		29	Whole gene deletion(15)|Unknown(12)|Substitution - Missense(2)	p.?(8)|p.Y756*(1)	bone(11)|breast(5)|haematopoietic_and_lymphoid_tissue(4)|lung(3)|adrenal_gland(1)|eye(1)|soft_tissue(1)|endometrium(1)|urinary_tract(1)|liver(1)	lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358						c.(2266-2268)TAT>TGT		retinoblastoma 1	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)						58.0	61.0	60.0					13																	49039189		2203	4300	6503	SO:0001583	missense	5925	Hereditary_Retinoblastoma	Familial Cancer Database		androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	g.chr13:49039189A>G	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.2267A>G	13.37:g.49039189A>G	ENSP00000267163:p.Tyr756Cys	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)					p.Y756C	NM_000321	NP_000312	P06400	RB_HUMAN		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	22	2433	+		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)	756			Pocket; binds T and E1A.|Domain B.		A8K5E3|P78499|Q5VW46|Q8IZL4	Missense_Mutation	SNP	ENST00000267163.4	37	c.2267A>G	CCDS31973.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.155894	0.78114	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	D	0.95035	-3.59	5.48	5.48	0.80851	Retinoblastoma-associated protein, B-box (1);Cyclin-like (3);	0.000000	0.85682	D	0.000000	D	0.97760	0.9265	M	0.92026	3.265	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98799	1.0739	10	0.87932	D	0	-13.3485	15.5628	0.76262	1.0:0.0:0.0:0.0	.	756	P06400	RB_HUMAN	C	735;756	ENSP00000267163:Y756C	ENSP00000267163:Y756C	Y	+	2	0	RB1	47937190	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.962000	0.93254	2.096000	0.63516	0.482000	0.46254	TAT		0.299	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000044884.1			22	47	0	0	0	0.003954	0	22	47				
MYCBP2	23077	broad.mit.edu	37	13	77631213	77631213	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr13:77631213T>C	ENST00000544440.2	-	79	13248	c.13231A>G	c.(13231-13233)Ata>Gta	p.I4411V	MYCBP2_ENST00000357337.6_Missense_Mutation_p.I4411V|MYCBP2_ENST00000407578.2_Missense_Mutation_p.I4449V					MYC binding protein 2, E3 ubiquitin protein ligase									p.I4449V(1)|p.I4411V(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		AAGTGGAATATGTGACTACAA	0.363																																							uc001vkf.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14						c.(13231-13233)ATA>GTA		MYC binding protein 2							112.0	106.0	108.0					13																	77631213		2203	4300	6503	SO:0001583	missense	23077				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding	g.chr13:77631213T>C	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.13231A>G	13.37:g.77631213T>C	ENSP00000444596:p.Ile4411Val					MYCBP2_uc010aev.2_Missense_Mutation_p.I3815V|MYCBP2_uc001vke.2_Missense_Mutation_p.I1028V	p.I4411V	NM_015057	NP_055872	O75592	MYCB2_HUMAN		GBM - Glioblastoma multiforme(99;0.109)	80	13322	-		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)	4411			RING-type; atypical.			Missense_Mutation	SNP	ENST00000544440.2	37	c.13231A>G		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.898|0.898	-0.723268|-0.723268	0.03158|0.03158	.|.	.|.	ENSG00000005810|ENSG00000005810	ENST00000429715|ENST00000357337;ENST00000407578;ENST00000544440	T|T;T;T	0.65364|0.24723	-0.15|1.84;1.84;1.84	5.56|5.56	0.233|0.233	0.15386|0.15386	.|Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);	.|0.222986	.|0.37053	.|N	.|0.002275	T|T	0.10809|0.10809	0.0264|0.0264	N|N	0.12611|0.12611	0.24|0.24	0.21184|0.21184	N|N	0.999764|0.999764	.|B	.|0.02656	.|0.0	.|B	.|0.04013	.|0.001	T|T	0.37267|0.37267	-0.9713|-0.9713	7|10	0.87932|0.02654	D|T	0|1	.|.	11.9528|11.9528	0.52964|0.52964	0.0:0.5973:0.0:0.4026|0.0:0.5973:0.0:0.4026	.|.	.|4411	.|O75592	.|MYCB2_HUMAN	R|V	831|4411;4449;4411	ENSP00000413907:H831R|ENSP00000349892:I4411V;ENSP00000384288:I4449V;ENSP00000444596:I4411V	ENSP00000413907:H831R|ENSP00000349892:I4411V	H|I	-|-	2|1	0|0	MYCBP2|MYCBP2	76529214|76529214	0.548000|0.548000	0.26473|0.26473	0.116000|0.116000	0.21606|0.21606	0.938000|0.938000	0.57974|0.57974	1.218000|1.218000	0.32467|0.32467	0.054000|0.054000	0.16065|0.16065	-0.202000|-0.202000	0.12741|0.12741	CAT|ATA		0.363	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057		39	87	0	0	0	0.00623	0	39	87				
JPH4	84502	broad.mit.edu	37	14	24045665	24045665	+	Splice_Site	SNP	C	C	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr14:24045665C>T	ENST00000397118.3	-	4	1282	c.380G>A	c.(379-381)gGc>gAc	p.G127D	JPH4_ENST00000356300.4_Splice_Site_p.G127D	NM_032452.2	NP_115828.2	Q96JJ6	JPH4_HUMAN	junctophilin 4	127					calcium ion transport into cytosol (GO:0060402)|learning (GO:0007612)|neuromuscular process controlling balance (GO:0050885)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of synaptic plasticity (GO:0048167)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)		p.G127D(1)		endometrium(1)|large_intestine(2)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00654)		CTGGTAGGTGCCTGCGGGCGG	0.731																																							uc001wkq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(379-381)GGC>GAC		junctophilin 4							4.0	5.0	4.0					14																	24045665		1660	3447	5107	SO:0001630	splice_region_variant	84502				calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional sarcoplasmic reticulum membrane		g.chr14:24045665C>T	AB058734	CCDS9603.1	14q11	2004-05-28	2004-05-28	2004-05-28	ENSG00000092051	ENSG00000092051			20156	protein-coding gene	gene with protein product			"""junctophilin like 1"""	JPHL1		11347906	Standard	NM_032452		Approved	KIAA1831	uc001wkr.2	Q96JJ6	OTTHUMG00000028769	ENST00000397118.3:c.380-1G>A	14.37:g.24045665C>T						JPH4_uc001wkr.2_Missense_Mutation_p.G127D|JPH4_uc001wks.2_Missense_Mutation_p.G127D	p.G127D	NM_032452	NP_115828	Q96JJ6	JPH4_HUMAN		GBM - Glioblastoma multiforme(265;0.00654)	4	1298	-	all_cancers(95;0.000251)		127			Cytoplasmic (Potential).|MORN 4.		D3DS53|Q8ND44|Q96DQ0	Missense_Mutation	SNP	ENST00000397118.3	37	c.380G>A	CCDS9603.1	.	.	.	.	.	.	.	.	.	.	.	23.7	4.451216	0.84209	.	.	ENSG00000092051	ENST00000356300;ENST00000397118;ENST00000543864;ENST00000267407	T;T	0.51817	0.69;0.69	4.41	3.48	0.39840	.	.	.	.	.	T	0.45716	0.1356	N	0.05608	-0.01	0.46774	D	0.999195	D;D	0.76494	0.999;0.999	D;D	0.70935	0.971;0.971	T	0.54417	-0.8297	9	0.87932	D	0	.	11.4032	0.49883	0.181:0.819:0.0:0.0	.	127;127	A8K396;Q96JJ6	.;JPH4_HUMAN	D	127;127;127;128	ENSP00000348648:G127D;ENSP00000380307:G127D	ENSP00000267407:G128D	G	-	2	0	JPH4	23115505	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	5.568000	0.67385	1.999000	0.58509	0.491000	0.48974	GGC		0.731	JPH4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413853.1	NM_032452	Missense_Mutation	3	5	0	0	0	0.004672	0	3	5				
LTB4R	1241	broad.mit.edu	37	14	24785218	24785218	+	Missense_Mutation	SNP	C	C	A	rs200787982		TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr14:24785218C>A	ENST00000396789.4	+	2	2086	c.361C>A	c.(361-363)Cgc>Agc	p.R121S	LTB4R_ENST00000345363.3_Missense_Mutation_p.R121S|LTB4R_ENST00000396782.2_Missense_Mutation_p.R121S	NM_181657.3	NP_858043.1	Q15722	LT4R1_HUMAN	leukotriene B4 receptor	121					cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|muscle contraction (GO:0006936)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	leukotriene B4 receptor activity (GO:0001632)|leukotriene receptor activity (GO:0004974)|nucleotide binding (GO:0000166)	p.R121S(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|stomach(1)	8				GBM - Glioblastoma multiforme(265;0.018)		GGCGGTGGCCCGCCCCTTTGT	0.642																																							uc001wos.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(361-363)CGC>AGC		leukotriene B4 receptor							40.0	42.0	42.0					14																	24785218		2203	4300	6503	SO:0001583	missense	1241				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|cellular component movement|immune response|inflammatory response|muscle contraction	integral to plasma membrane	nucleotide binding	g.chr14:24785218C>A	X98356	CCDS9626.1	14q11.2-q12	2012-08-10			ENSG00000213903	ENSG00000213903		"""GPCR / Class A : Leukotriene receptors"""	6713	protein-coding gene	gene with protein product		601531		P2RY7, GPR16, CMKRL1		8921391, 8702478	Standard	NM_181657		Approved	BLTR, P2Y7, LTB4R1	uc001wos.3	Q15722	OTTHUMG00000029346	ENST00000396789.4:c.361C>A	14.37:g.24785218C>A	ENSP00000380008:p.Arg121Ser					LTB4R_uc010alp.2_Missense_Mutation_p.R121S|LTB4R_uc001wou.2_Missense_Mutation_p.R121S	p.R121S	NM_001143919	NP_001137391	Q15722	LT4R1_HUMAN		GBM - Glioblastoma multiforme(265;0.018)	2	682	+			121			Cytoplasmic (Potential).		Q13305|Q53XV5|Q92641|Q9BSU5	Missense_Mutation	SNP	ENST00000396789.4	37	c.361C>A	CCDS9626.1	.	.	.	.	.	.	.	.	.	.	C	13.15	2.151724	0.38021	.	.	ENSG00000213903	ENST00000345363;ENST00000396789;ENST00000556141;ENST00000396782	T;T;T;T	0.38077	1.16;1.16;1.16;1.16	5.89	4.02	0.46733	GPCR, rhodopsin-like superfamily (1);	0.389766	0.23764	U	0.044792	T	0.28928	0.0718	L	0.39692	1.235	0.30208	N	0.798025	B	0.29301	0.241	B	0.27715	0.082	T	0.13899	-1.0492	10	0.22706	T	0.39	.	13.2634	0.60120	0.2768:0.7232:0.0:0.0	.	121	Q15722	LT4R1_HUMAN	S	121;121;21;121	ENSP00000307445:R121S;ENSP00000380008:R121S;ENSP00000451929:R21S;ENSP00000380002:R121S	ENSP00000307445:R121S	R	+	1	0	LTB4R	23855058	0.000000	0.05858	0.960000	0.40013	0.579000	0.36224	-0.016000	0.12613	0.777000	0.33496	0.655000	0.94253	CGC		0.642	LTB4R-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073198.4			15	33	1	0	3.45872e-05	0.004007	3.85674e-05	15	33				
CLEC14A	161198	broad.mit.edu	37	14	38724679	38724679	+	Silent	SNP	G	G	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr14:38724679G>A	ENST00000342213.2	-	1	895	c.549C>T	c.(547-549)cgC>cgT	p.R183R		NM_175060.2	NP_778230.1	Q86T13	CLC14_HUMAN	C-type lectin domain family 14, member A	183						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.R183R(1)		breast(1)|cervix(2)|endometrium(2)|large_intestine(7)|lung(9)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)		cggccccggggcgcggcgcAG	0.667																																							uc001wum.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|skin(1)	4						c.(547-549)CGC>CGT		C-type lectin domain family 14, member A							36.0	35.0	36.0					14																	38724679		2197	4282	6479	SO:0001819	synonymous_variant	161198					integral to membrane	sugar binding	g.chr14:38724679G>A		CCDS9667.1	14q21.1	2010-04-27	2005-02-11	2005-02-11	ENSG00000176435	ENSG00000176435		"""C-type lectin domain containing"""	19832	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 27"""	C14orf27			Standard	NM_175060		Approved		uc001wum.2	Q86T13	OTTHUMG00000140248	ENST00000342213.2:c.549C>T	14.37:g.38724679G>A							p.R183R	NM_175060	NP_778230	Q86T13	CLC14_HUMAN	Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)	1	896	-	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		183			Extracellular (Potential).		Q695G9|Q6PWT6|Q8N5V5	Silent	SNP	ENST00000342213.2	37	c.549C>T	CCDS9667.1																																																																																				0.667	CLEC14A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276729.1	NM_175060		37	53	0	0	0	0.010771	0	37	53				
MIA2	117153	broad.mit.edu	37	14	39717248	39717248	+	Silent	SNP	T	T	C			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr14:39717248T>C	ENST00000280082.3	+	4	1669	c.1470T>C	c.(1468-1470)aaT>aaC	p.N490N	MIA2_ENST00000556784.1_Silent_p.N489N|RP11-407N17.3_ENST00000553728.1_Silent_p.N490N	NM_054024.3	NP_473365.3	Q96PC5	MIA2_HUMAN	melanoma inhibitory activity 2	490					cholesterol homeostasis (GO:0042632)|triglyceride homeostasis (GO:0070328)	endoplasmic reticulum exit site (GO:0070971)|extracellular region (GO:0005576)		p.N490N(1)		NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	31	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0216)		ATCAAAATAATGTAATTGAAA	0.313																																							uc001wux.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|breast(1)	2						c.(1468-1470)AAT>AAC		melanoma inhibitory activity 2							48.0	57.0	54.0					14																	39717248		2201	4286	6487	SO:0001819	synonymous_variant	117153					extracellular region		g.chr14:39717248T>C	BC035981	CCDS9672.1	14q13.2	2007-05-01			ENSG00000150526	ENSG00000150526			18432	protein-coding gene	gene with protein product		608001				12586826	Standard	NM_054024		Approved	FLJ22404	uc001wux.3	Q96PC5	OTTHUMG00000028831	ENST00000280082.3:c.1470T>C	14.37:g.39717248T>C						MIA2_uc010amy.1_Silent_p.N421N	p.N490N	NM_054024	NP_473365	Q96PC5	MIA2_HUMAN	LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0216)	4	1664	+	Hepatocellular(127;0.213)		490					A1L4H0|Q9H6C1	Silent	SNP	ENST00000280082.3	37	c.1470T>C	CCDS9672.1																																																																																				0.313	MIA2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276768.3	NM_054024		55	86	0	0	0	0.00361	0	55	86				
TBPL2	387332	broad.mit.edu	37	14	55907125	55907125	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr14:55907125A>T	ENST00000247219.5	-	1	209	c.139T>A	c.(139-141)Tgc>Agc	p.C47S		NM_199047.2	NP_950248.1			TATA box binding protein like 2									p.C47S(1)		endometrium(2)|kidney(1)|large_intestine(1)|lung(4)	8						TGAGCGGCGCACTGGTCCAGG	0.632																																							uc001xby.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(139-141)TGC>AGC		TATA box binding protein like 2							40.0	41.0	41.0					14																	55907125		2153	4212	6365	SO:0001583	missense	387332				multicellular organismal development|transcription initiation from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding	g.chr14:55907125A>T	AY457923	CCDS9724.1	14q22.2	2004-06-03			ENSG00000182521	ENSG00000182521			19841	protein-coding gene	gene with protein product		608964				14634207	Standard	NM_199047		Approved	TRF3, TBP2	uc001xby.3	Q6SJ96	OTTHUMG00000140313	ENST00000247219.5:c.139T>A	14.37:g.55907125A>T	ENSP00000247219:p.Cys47Ser						p.C47S	NM_199047	NP_950248	Q6SJ96	TBPL2_HUMAN			1	139	-			47						Missense_Mutation	SNP	ENST00000247219.5	37	c.139T>A	CCDS9724.1	.	.	.	.	.	.	.	.	.	.	A	9.286	1.049335	0.19827	.	.	ENSG00000182521	ENST00000247219	T	0.42131	0.98	5.12	3.97	0.46021	.	0.371888	0.28431	N	0.015375	T	0.33962	0.0881	L	0.46157	1.445	0.22989	N	0.998463	B	0.10296	0.003	B	0.06405	0.002	T	0.19418	-1.0306	10	0.31617	T	0.26	-0.5559	9.7403	0.40413	0.9169:0.0:0.0831:0.0	.	47	Q6SJ96	TBPL2_HUMAN	S	47	ENSP00000247219:C47S	ENSP00000247219:C47S	C	-	1	0	TBPL2	54976878	0.386000	0.25180	0.051000	0.19133	0.189000	0.23516	3.106000	0.50322	0.800000	0.34041	0.379000	0.24179	TGC		0.632	TBPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276916.1	NM_199047		31	55	0	0	0	0.010818	0	31	55				
SYT16	83851	broad.mit.edu	37	14	62547784	62547784	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr14:62547784G>T	ENST00000430451.2	+	4	1423	c.1226G>T	c.(1225-1227)gGg>gTg	p.G409V	RP11-355I22.5_ENST00000553990.1_lincRNA	NM_031914.2	NP_114120.2	Q17RD7	SYT16_HUMAN	synaptotagmin XVI	409	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)			p.G389V(1)|p.G409V(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(12)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	35				OV - Ovarian serous cystadenocarcinoma(108;0.0438)|BRCA - Breast invasive adenocarcinoma(234;0.118)		ATACAGAGAGGGCCCAACCCC	0.592																																							uc001xfu.1		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(1)	1						c.(1225-1227)GGG>GTG		synaptotagmin XIV-like							40.0	45.0	43.0					14																	62547784		2149	4259	6408	SO:0001583	missense	83851							g.chr14:62547784G>T	BC040924	CCDS45121.1	14q23.2	2014-07-02	2005-07-15	2005-07-15	ENSG00000139973	ENSG00000139973		"""Synaptotagmins"""	23142	protein-coding gene	gene with protein product	"""synaptotagmin XIV-related"", "" chr14 synaptotagmin"""	610950	"""synaptotagmin XIV-like"""	SYT14L		11543631	Standard	NM_031914		Approved	yt14r, CHR14SYT, Strep14	uc001xfu.1	Q17RD7	OTTHUMG00000171106	ENST00000430451.2:c.1226G>T	14.37:g.62547784G>T	ENSP00000394700:p.Gly409Val					SYT16_uc010tsd.1_3'UTR|SYT16_uc010tse.1_5'UTR	p.G409V	NM_031914	NP_114120	Q17RD7	SYT16_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0438)|BRCA - Breast invasive adenocarcinoma(234;0.118)	4	1423	+			409			C2 1.		B4DZH2|B7ZL60|C9J8I3|Q707N2|Q7Z441|Q8IUU0|Q9BQR8	Missense_Mutation	SNP	ENST00000430451.2	37	c.1226G>T	CCDS45121.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.766354	0.90020	.	.	ENSG00000139973	ENST00000430451	T	0.80033	-1.33	5.27	5.27	0.74061	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.89054	0.6606	M	0.72576	2.205	0.80722	D	1	D	0.60575	0.988	D	0.67900	0.954	D	0.89758	0.3945	10	0.87932	D	0	-28.171	19.0978	0.93260	0.0:0.0:1.0:0.0	.	409	Q17RD7	SYT16_HUMAN	V	409	ENSP00000394700:G409V	ENSP00000394700:G409V	G	+	2	0	SYT16	61617537	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.657000	0.98554	2.735000	0.93741	0.655000	0.94253	GGG		0.592	SYT16-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000411700.1	NM_031914		17	18	1	0	3.52763e-06	0.00499	4.06256e-06	17	18				
ADAM20	8748	broad.mit.edu	37	14	70990220	70990220	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr14:70990220C>A	ENST00000256389.3	-	2	1649	c.1405G>T	c.(1405-1407)Gag>Tag	p.E469*	RP11-486O13.4_ENST00000556646.1_lincRNA	NM_003814.4	NP_003805.3	O43506	ADA20_HUMAN	ADAM metallopeptidase domain 20	419	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.E469*(1)		autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|prostate(1)|skin(2)	27			KIRC - Kidney renal clear cell carcinoma(12;0.133)|Kidney(31;0.188)	all cancers(60;0.00294)|BRCA - Breast invasive adenocarcinoma(234;0.00668)|OV - Ovarian serous cystadenocarcinoma(108;0.0344)		TCACATTCCTCCCCTTCTTCA	0.443																																							uc001xme.2		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(1)	1						c.(1405-1407)GAG>TAG		ADAM metallopeptidase domain 20 preproprotein							146.0	129.0	135.0					14																	70990220		2203	4300	6503	SO:0001587	stop_gained	8748				proteolysis|single fertilization	integral to membrane	metalloendopeptidase activity|zinc ion binding	g.chr14:70990220C>A	AF029899	CCDS32111.1	14q24.2	2012-04-30	2005-08-18		ENSG00000134007	ENSG00000134007		"""ADAM metallopeptidase domain containing"""	199	protein-coding gene	gene with protein product		603712	"""a disintegrin and metalloproteinase domain 20"""			9469942	Standard	NM_003814		Approved		uc001xme.3	O43506	OTTHUMG00000167548	ENST00000256389.3:c.1405G>T	14.37:g.70990220C>A	ENSP00000256389:p.Glu469*						p.E469*	NM_003814	NP_003805	O43506	ADA20_HUMAN	KIRC - Kidney renal clear cell carcinoma(12;0.133)|Kidney(31;0.188)	all cancers(60;0.00294)|BRCA - Breast invasive adenocarcinoma(234;0.00668)|OV - Ovarian serous cystadenocarcinoma(108;0.0344)	2	1650	-			419			Disintegrin.|Extracellular (Potential).		Q6GTZ1|Q9UKJ9	Nonsense_Mutation	SNP	ENST00000256389.3	37	c.1405G>T	CCDS32111.1	.	.	.	.	.	.	.	.	.	.	C	36	5.945235	0.97134	.	.	ENSG00000134007	ENST00000256389	.	.	.	4.54	4.54	0.55810	.	0.000000	0.37053	U	0.002279	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.6498	0.88159	0.0:1.0:0.0:0.0	.	.	.	.	X	469	.	ENSP00000256389:E469X	E	-	1	0	ADAM20	70059973	1.000000	0.71417	1.000000	0.80357	0.287000	0.27160	5.530000	0.67141	2.222000	0.72286	0.557000	0.71058	GAG		0.443	ADAM20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395004.2			74	152	1	0	3.89499e-28	0.00361	6.84057e-28	74	152				
VRTN	55237	broad.mit.edu	37	14	74824273	74824273	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr14:74824273C>A	ENST00000256362.4	+	2	1028	c.787C>A	c.(787-789)Cca>Aca	p.P263T		NM_018228.2	NP_060698.2	Q9H8Y1	VRTN_HUMAN	vertebrae development associated	263					transposition, DNA-mediated (GO:0006313)		sequence-specific DNA binding (GO:0043565)|transposase activity (GO:0004803)	p.P263T(1)		NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(15)|ovary(5)|prostate(2)|skin(1)|urinary_tract(1)	41						AGCCCTGGCCCCACTCTCATC	0.632																																							uc001xpw.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(787-789)CCA>ACA		hypothetical protein LOC55237							38.0	39.0	39.0					14																	74824273		2203	4300	6503	SO:0001583	missense	55237				transposition, DNA-mediated		DNA binding|transposase activity	g.chr14:74824273C>A	AK001673	CCDS9830.1	14q24.2	2012-12-07	2012-12-07	2010-10-20	ENSG00000133980	ENSG00000133980			20223	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 115"", ""vertebrae development homolog (pig)"""	C14orf115		21232157	Standard	NM_018228		Approved	FLJ10811, vertnin	uc001xpw.4	Q9H8Y1	OTTHUMG00000171208	ENST00000256362.4:c.787C>A	14.37:g.74824273C>A	ENSP00000256362:p.Pro263Thr						p.P263T	NM_018228	NP_060698	Q9H8Y1	VRTN_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.00147)	2	978	+			263					Q9NVC7	Missense_Mutation	SNP	ENST00000256362.4	37	c.787C>A	CCDS9830.1	.	.	.	.	.	.	.	.	.	.	C	3.656	-0.070571	0.07228	.	.	ENSG00000133980	ENST00000256362	T	0.44482	0.92	4.64	0.647	0.17796	.	0.441615	0.22727	N	0.056376	T	0.30103	0.0754	L	0.44542	1.39	0.09310	N	1	B	0.27625	0.183	B	0.25140	0.058	T	0.20075	-1.0286	10	0.66056	D	0.02	-16.3326	6.3347	0.21289	0.0:0.5424:0.297:0.1606	.	263	Q9H8Y1	VRTN_HUMAN	T	263	ENSP00000256362:P263T	ENSP00000256362:P263T	P	+	1	0	VRTN	73894026	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-0.233000	0.09041	-0.054000	0.13266	0.561000	0.74099	CCA		0.632	VRTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412339.1	NM_018228		22	30	1	0	2.39556e-15	0.00278	3.50601e-15	22	30				
CALM1	801	broad.mit.edu	37	14	90870237	90870237	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr14:90870237G>T	ENST00000356978.4	+	4	458	c.210G>T	c.(208-210)ttG>ttT	p.L70F	RP11-471B22.2_ENST00000555853.1_RNA|CALM1_ENST00000447653.3_Missense_Mutation_p.L71F|CALM1_ENST00000544280.2_Missense_Mutation_p.L34F|CALM1_ENST00000553542.1_Missense_Mutation_p.L34F	NM_006888.4	NP_008819.1	P62158	CALM_HUMAN	calmodulin 1 (phosphorylase kinase, delta)	70	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|carbohydrate metabolic process (GO:0005975)|detection of calcium ion (GO:0005513)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nitric oxide metabolic process (GO:0046209)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cyclic nucleotide metabolic process (GO:0030801)|positive regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051343)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of cytokinesis (GO:0032465)|regulation of heart rate (GO:0002027)|regulation of high voltage-gated calcium channel activity (GO:1901841)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|response to corticosterone (GO:0051412)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)|synaptic transmission (GO:0007268)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcomere (GO:0030017)|spindle microtubule (GO:0005876)|spindle pole (GO:0000922)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|N-terminal myristoylation domain binding (GO:0031997)|nitric-oxide synthase regulator activity (GO:0030235)|phospholipase binding (GO:0043274)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|protein phosphatase activator activity (GO:0072542)|protein serine/threonine kinase activator activity (GO:0043539)|thioesterase binding (GO:0031996)|titin binding (GO:0031432)	p.L70F(1)		central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(4)|skin(1)|urinary_tract(1)	10		all_cancers(154;0.13)		COAD - Colon adenocarcinoma(157;0.208)	Aprindine(DB01429)|Bepridil(DB01244)|Chlorpromazine(DB00477)|Cinchocaine(DB00527)|Felodipine(DB01023)|Flunarizine(DB04841)|Fluphenazine(DB00623)|Isoflurane(DB00753)|Loperamide(DB00836)|Melatonin(DB01065)|Nicardipine(DB00622)|Nifedipine(DB01115)|Perphenazine(DB00850)|Phenoxybenzamine(DB00925)|Pimozide(DB01100)|Promethazine(DB01069)|Trifluoperazine(DB00831)	CCGAATTTTTGACTATGATGG	0.383																																							uc001xyl.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(208-210)TTG>TTT		calmodulin 1 isoform 1	Aprindine(DB01429)|Bepridil(DB01244)|Dibucaine(DB00527)|Felodipine(DB01023)|Flunarizine(DB04841)|Fluphenazine(DB00623)|Isoflurane(DB00753)|Loperamide(DB00836)|Miconazole(DB01110)|Perphenazine(DB00850)|Phenoxybenzamine(DB00925)|Pimozide(DB01100)|Promethazine(DB01069)						127.0	113.0	118.0					14																	90870237		2203	4300	6503	SO:0001583	missense	801				activation of phospholipase C activity|G-protein coupled receptor protein signaling pathway|glucose metabolic process|glycogen catabolic process|muscle contraction|negative regulation of ryanodine-sensitive calcium-release channel activity|nerve growth factor receptor signaling pathway|nitric oxide metabolic process|platelet activation|platelet degranulation|positive regulation of ryanodine-sensitive calcium-release channel activity|regulation of cytokinesis|regulation of nitric-oxide synthase activity|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to calcium ion|synaptic transmission	centrosome|cytosol|extracellular region|nucleoplasm|plasma membrane|spindle microtubule|spindle pole	calcium ion binding|N-terminal myristoylation domain binding|phospholipase binding|protein domain specific binding|thioesterase binding|titin binding	g.chr14:90870237G>T		CCDS9892.1	14q32.11	2013-02-25			ENSG00000198668	ENSG00000198668	2.7.11.19	"""EF-hand domain containing"", ""Endogenous ligands"""	1442	protein-coding gene	gene with protein product	"""prepro-calmodulin 1"""	114180		CALML2		6385987	Standard	NM_006888		Approved	CAMI, PHKD, DD132	uc001xyl.2	P62158	OTTHUMG00000171044	ENST00000356978.4:c.210G>T	14.37:g.90870237G>T	ENSP00000349467:p.Leu70Phe					CALM1_uc010atq.1_Missense_Mutation_p.L71F|CALM1_uc010atr.1_Intron|CALM1_uc001xym.1_Missense_Mutation_p.L34F	p.L70F	NM_006888	NP_008819	P62158	CALM_HUMAN		COAD - Colon adenocarcinoma(157;0.208)	4	412	+		all_cancers(154;0.13)	70			EF-hand 2.		P02593|P70667|P99014|Q13942|Q53S29|Q61379|Q61380|Q96HK3	Missense_Mutation	SNP	ENST00000356978.4	37	c.210G>T	CCDS9892.1	.	.	.	.	.	.	.	.	.	.	G	16.12	3.031968	0.54790	.	.	ENSG00000198668	ENST00000557020;ENST00000356978;ENST00000447653;ENST00000553542;ENST00000544280	T;D;D;T;T	0.87491	-1.26;-2.26;-2.26;-1.26;-1.26	5.22	5.22	0.72569	EF-hand-like domain (1);	0.000000	0.64402	D	0.000003	D	0.92034	0.7476	.	.	.	0.80722	D	1	D;D	0.89917	1.0;0.962	D;P	0.71870	0.975;0.725	D	0.92248	0.5806	9	0.87932	D	0	.	9.5509	0.39310	0.1632:0.0:0.8368:0.0	.	71;70	E7ETZ0;P62158	.;CALM_HUMAN	F	34;70;71;34;34	ENSP00000451062:L34F;ENSP00000349467:L70F;ENSP00000403491:L71F;ENSP00000450829:L34F;ENSP00000442853:L34F	ENSP00000349467:L70F	L	+	3	2	CALM1	89939990	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.742000	0.47434	2.583000	0.87209	0.555000	0.69702	TTG		0.383	CALM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000411346.1			12	27	1	0	2.80697e-09	0.010729	3.53704e-09	12	27				
SERPINA4	5267	broad.mit.edu	37	14	95030231	95030231	+	Missense_Mutation	SNP	C	C	G	rs140563422	byFrequency	TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr14:95030231C>G	ENST00000557004.1	+	2	833	c.412C>G	c.(412-414)Cgc>Ggc	p.R138G	SERPINA4_ENST00000298841.5_Missense_Mutation_p.R138G|SERPINA4_ENST00000555095.1_Missense_Mutation_p.R138G|SERPINA5_ENST00000553780.1_Intron			P29622	KAIN_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4	138					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.R138G(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(9)|lung(28)|ovary(3)|skin(1)|urinary_tract(1)	46				COAD - Colon adenocarcinoma(157;0.211)		GCTGGAAACACGCGTGGGCAG	0.562																																							uc001ydk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(412-414)CGC>GGC		serine (or cysteine) proteinase inhibitor, clade							105.0	96.0	99.0					14																	95030231		2203	4300	6503	SO:0001583	missense	5267				regulation of proteolysis	extracellular space	serine-type endopeptidase inhibitor activity	g.chr14:95030231C>G	L19684	CCDS9927.1	14q32.13	2014-02-18	2005-08-18		ENSG00000100665	ENSG00000100665		"""Serine (or cysteine) peptidase inhibitors"""	8948	protein-coding gene	gene with protein product		147935	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4"""	PI4		8227002, 24172014	Standard	NM_001289032		Approved	KST, KAL, KLST, kallistatin	uc001ydk.3	P29622	OTTHUMG00000170859	ENST00000557004.1:c.412C>G	14.37:g.95030231C>G	ENSP00000450838:p.Arg138Gly					SERPINA4_uc010avd.2_Missense_Mutation_p.R175G|SERPINA4_uc001ydl.2_Missense_Mutation_p.R138G	p.R138G	NM_006215	NP_006206	P29622	KAIN_HUMAN		COAD - Colon adenocarcinoma(157;0.211)	2	478	+			138					Q53XB5|Q86TR9|Q96BZ5	Missense_Mutation	SNP	ENST00000557004.1	37	c.412C>G	CCDS9927.1	.	.	.	.	.	.	.	.	.	.	C	8.256	0.810196	0.16537	.	.	ENSG00000100665	ENST00000557004;ENST00000555095;ENST00000298841	D;D;D	0.84516	-1.86;-1.86;-1.86	4.38	-1.08	0.09936	Serpin domain (3);	0.690838	0.12487	N	0.464631	T	0.81650	0.4867	L	0.51422	1.61	0.09310	N	1	P;B	0.41450	0.75;0.265	P;B	0.47206	0.541;0.118	T	0.71632	-0.4534	10	0.56958	D	0.05	.	4.5789	0.12248	0.4969:0.2534:0.0:0.2497	.	138;138	B2R815;P29622	.;KAIN_HUMAN	G	138	ENSP00000450838:R138G;ENSP00000451172:R138G;ENSP00000298841:R138G	ENSP00000298841:R138G	R	+	1	0	SERPINA4	94099984	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.233000	0.09041	-0.498000	0.06632	-0.244000	0.11960	CGC		0.562	SERPINA4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410718.1	NM_006215		36	66	0	0	0	0.004289	0	36	66				
FMN1	342184	broad.mit.edu	37	15	33091096	33091096	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr15:33091096T>A	ENST00000559047.1	-	16	4038	c.4039A>T	c.(4039-4041)Aca>Tca	p.T1347S	FMN1_ENST00000334528.9_Missense_Mutation_p.T1124S|FMN1_ENST00000561249.1_Missense_Mutation_p.T1249S			Q68DA7	FMN1_HUMAN	formin 1	1347	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin nucleation (GO:0045010)	actin filament (GO:0005884)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.T1347S(1)|p.T1124S(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|upper_aerodigestive_tract(3)	29		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		TAGCTGGGTGTGATCTCCTTC	0.428																																							uc001zhf.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(3370-3372)ACA>TCA		formin 1							106.0	95.0	99.0					15																	33091096		1890	4126	6016	SO:0001583	missense	342184				actin cytoskeleton organization	actin cytoskeleton|adherens junction|cytoplasm|nucleus	actin binding	g.chr15:33091096T>A	AH002864	CCDS45209.1, CCDS61581.1, CCDS61582.1	15q13.3	2013-06-13	2005-01-20	2005-01-22	ENSG00000248905	ENSG00000248905			3768	protein-coding gene	gene with protein product	"""limb deformity protein"""	136535	"""formin (limb deformity)"""	LD, FMN		1673046	Standard	NM_001277313		Approved	DKFZP686C2281, FLJ45135, MGC125288, MGC125289	uc031qrh.1	Q68DA7	OTTHUMG00000172201	ENST00000559047.1:c.4039A>T	15.37:g.33091096T>A	ENSP00000454047:p.Thr1347Ser						p.T1124S	NM_001103184	NP_001096654	Q68DA7	FMN1_HUMAN		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)	15	3370	-		all_lung(180;1.14e-07)	1347			FH2.		Q3B7I6|Q3ZAR4|Q6ZSY1	Missense_Mutation	SNP	ENST00000559047.1	37	c.3370A>T		.	.	.	.	.	.	.	.	.	.	T	12.18	1.859307	0.32884	.	.	ENSG00000248905	ENST00000334528	T	0.16324	2.35	5.86	3.57	0.40892	.	0.147926	0.64402	D	0.000009	T	0.11452	0.0279	N	0.05487	-0.04	.	.	.	B	0.31548	0.328	B	0.43251	0.413	T	0.33675	-0.9859	9	0.15066	T	0.55	.	9.9145	0.41425	0.0:0.1375:0.0:0.8625	.	1124	Q68DA7-5	.	S	1124	ENSP00000333950:T1124S	ENSP00000333950:T1124S	T	-	1	0	FMN1	30878388	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.761000	0.38440	1.033000	0.39918	0.533000	0.62120	ACA		0.428	FMN1-005	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000417414.1	NM_001103184		13	23	0	0	0	0.001855	0	13	23				
PLCB2	5330	broad.mit.edu	37	15	40594168	40594168	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr15:40594168G>A	ENST00000260402.3	-	7	821	c.572C>T	c.(571-573)cCc>cTc	p.P191L	PLCB2_ENST00000456256.2_Missense_Mutation_p.P191L|PLCB2-AS1_ENST00000559520.1_RNA|PLCB2_ENST00000543785.2_Missense_Mutation_p.P191L|PLCB2_ENST00000557821.1_Missense_Mutation_p.P191L	NM_001284297.1|NM_004573.2	NP_001271226.1|NP_004564.2	Q00722	PLCB2_HUMAN	phospholipase C, beta 2	191					activation of phospholipase C activity (GO:0007202)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|sensory perception of bitter taste (GO:0050913)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)	p.P191L(2)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(3)	39		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)		TTTGCCTTTGGGGAGGTGGCA	0.582																																							uc001zld.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|breast(3)|kidney(1)|pancreas(1)	8						c.(571-573)CCC>CTC		phospholipase C, beta 2							44.0	48.0	47.0					15																	40594168		2020	4184	6204	SO:0001583	missense	5330				activation of phospholipase C activity|intracellular signal transduction|lipid catabolic process|phospholipid metabolic process|synaptic transmission	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity	g.chr15:40594168G>A		CCDS42020.1, CCDS61591.1, CCDS61592.1, CCDS73704.1	15q15.1	2012-01-23			ENSG00000137841	ENSG00000137841	3.1.4.11		9055	protein-coding gene	gene with protein product		604114				1644792, 9925923	Standard	XM_005254448		Approved	FLJ38135	uc001zld.3	Q00722	OTTHUMG00000172412	ENST00000260402.3:c.572C>T	15.37:g.40594168G>A	ENSP00000260402:p.Pro191Leu					PLCB2_uc010bbo.2_Missense_Mutation_p.P191L|PLCB2_uc010ucm.1_Missense_Mutation_p.P191L|PLCB2_uc001zle.3_Missense_Mutation_p.P191L	p.P191L	NM_004573	NP_004564	Q00722	PLCB2_HUMAN		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)	7	873	-		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)	191					A8K6J2|B9EGH5	Missense_Mutation	SNP	ENST00000260402.3	37	c.572C>T	CCDS42020.1	.	.	.	.	.	.	.	.	.	.	G	17.86	3.491820	0.64074	.	.	ENSG00000137841	ENST00000260402;ENST00000456256;ENST00000543785	T;T;T	0.38077	1.16;1.16;1.16	4.86	4.86	0.63082	.	0.164542	0.56097	D	0.000034	T	0.48502	0.1503	M	0.80616	2.505	0.53688	D	0.999973	B;P;P;B	0.50443	0.434;0.617;0.935;0.037	B;B;P;B	0.44597	0.166;0.179;0.454;0.066	T	0.60647	-0.7222	10	0.87932	D	0	.	18.553	0.91072	0.0:0.0:1.0:0.0	.	191;191;191;191	B9EGH5;Q00722-2;Q9BVT6;Q00722	.;.;.;PLCB2_HUMAN	L	191	ENSP00000260402:P191L;ENSP00000411991:P191L;ENSP00000444652:P191L	ENSP00000260402:P191L	P	-	2	0	PLCB2	38381460	1.000000	0.71417	0.110000	0.21437	0.795000	0.44927	7.741000	0.84997	2.706000	0.92434	0.555000	0.69702	CCC		0.582	PLCB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418430.1			23	39	0	0	0	0.004656	0	23	39				
UNC13C	440279	broad.mit.edu	37	15	54305977	54305977	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr15:54305977A>T	ENST00000260323.11	+	1	877	c.877A>T	c.(877-879)Aca>Tca	p.T293S	UNC13C_ENST00000537900.1_Missense_Mutation_p.T293S|UNC13C_ENST00000545554.1_Missense_Mutation_p.T293S	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	293					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)	p.T293S(2)		breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		GCAGTTGCGCACAGGGTTTGT	0.453																																							uc002ack.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|pancreas(2)	7						c.(877-879)ACA>TCA		unc-13 homolog C							131.0	125.0	127.0					15																	54305977		1943	4166	6109	SO:0001583	missense	440279				exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding	g.chr15:54305977A>T	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.877A>T	15.37:g.54305977A>T	ENSP00000260323:p.Thr293Ser						p.T293S	NM_001080534	NP_001074003	Q8NB66	UN13C_HUMAN		GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)	1	877	+			293					Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	ENST00000260323.11	37	c.877A>T	CCDS45264.1	.	.	.	.	.	.	.	.	.	.	A	7.981	0.751187	0.15778	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	T;T;T	0.78816	-1.21;-1.21;-1.21	5.08	3.88	0.44766	.	.	.	.	.	T	0.55816	0.1944	N	0.04880	-0.145	0.29103	N	0.881323	B	0.14438	0.01	B	0.17433	0.018	T	0.46105	-0.9215	9	0.15499	T	0.54	.	10.0817	0.42393	0.85:0.0:0.0:0.15	.	293	Q8NB66	UN13C_HUMAN	S	293	ENSP00000260323:T293S;ENSP00000438156:T293S;ENSP00000442569:T293S	ENSP00000260323:T293S	T	+	1	0	UNC13C	52093269	0.997000	0.39634	0.792000	0.32020	0.092000	0.18411	3.589000	0.53972	1.900000	0.55004	0.533000	0.62120	ACA		0.453	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166		62	135	0	0	0	0.00361	0	62	135				
BNC1	646	broad.mit.edu	37	15	83926424	83926424	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr15:83926424G>T	ENST00000345382.2	-	5	2840	c.2755C>A	c.(2755-2757)Ctt>Att	p.L919I	RP11-382A20.4_ENST00000565495.1_RNA|BNC1_ENST00000569704.1_Missense_Mutation_p.L912I	NM_001717.3	NP_001708.3	Q01954	BNC1_HUMAN	basonuclin 1	919					chromosome organization (GO:0051276)|epidermis development (GO:0008544)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L919I(1)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	56						AGGCTAGCAAGGCTCTGGTCA	0.527																																							uc002bjt.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(2755-2757)CTT>ATT		basonuclin 1							208.0	200.0	203.0					15																	83926424		2203	4300	6503	SO:0001583	missense	646				epidermis development|positive regulation of cell proliferation	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr15:83926424G>T	L03427	CCDS10324.1, CCDS73771.1	15q25.1	2013-05-20	2004-04-30	2004-05-04	ENSG00000169594	ENSG00000169594		"""Zinc fingers, C2H2-type"""	1081	protein-coding gene	gene with protein product		601930	"""basonuclin"""	BNC		1332044	Standard	NM_001717		Approved	HsT19447	uc002bjt.1	Q01954	OTTHUMG00000147362	ENST00000345382.2:c.2755C>A	15.37:g.83926424G>T	ENSP00000307041:p.Leu919Ile					BNC1_uc010uos.1_Missense_Mutation_p.L907I	p.L919I	NM_001717	NP_001708	Q01954	BNC1_HUMAN			5	2843	-			919					Q15840	Missense_Mutation	SNP	ENST00000345382.2	37	c.2755C>A	CCDS10324.1	.	.	.	.	.	.	.	.	.	.	G	10.24	1.294561	0.23564	.	.	ENSG00000169594	ENST00000345382;ENST00000541809	T	0.47528	0.84	5.93	4.83	0.62350	.	0.209249	0.43747	D	0.000539	T	0.29223	0.0727	L	0.29908	0.895	0.27125	N	0.96204	P;P	0.39282	0.649;0.666	B;B	0.37601	0.254;0.112	T	0.13737	-1.0498	10	0.11794	T	0.64	-14.4858	6.8834	0.24187	0.2385:0.0:0.7615:0.0	.	912;919	F5GY04;Q01954	.;BNC1_HUMAN	I	919;912	ENSP00000307041:L919I	ENSP00000307041:L919I	L	-	1	0	BNC1	81717428	1.000000	0.71417	0.998000	0.56505	0.777000	0.43975	2.459000	0.45023	2.811000	0.96726	0.557000	0.71058	CTT		0.527	BNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304006.1	NM_001717		82	185	1	0	1.84514e-49	0.00361	3.73011e-49	82	185				
XYLT1	64131	broad.mit.edu	37	16	17211799	17211799	+	Missense_Mutation	SNP	C	C	T	rs555809214		TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr16:17211799C>T	ENST00000261381.6	-	11	2345	c.2261G>A	c.(2260-2262)cGc>cAc	p.R754H		NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	754					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)	p.R754H(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						CCCAAAGTTGCGGAATAGCCT	0.572													C|||	1	0.000199681	0.0	0.0	5008	,	,		17610	0.0		0.0	False		,,,				2504	0.001						uc002dfa.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)	4						c.(2260-2262)CGC>CAC		xylosyltransferase I							86.0	76.0	79.0					16																	17211799		2197	4300	6497	SO:0001583	missense	64131				glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity	g.chr16:17211799C>T	AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.2261G>A	16.37:g.17211799C>T	ENSP00000261381:p.Arg754His						p.R754H	NM_022166	NP_071449	Q86Y38	XYLT1_HUMAN			11	2346	-			754			Lumenal (Potential).		Q9H1B6	Missense_Mutation	SNP	ENST00000261381.6	37	c.2261G>A	CCDS10569.1	.	.	.	.	.	.	.	.	.	.	C	34	5.313058	0.95655	.	.	ENSG00000103489	ENST00000261381	T	0.61742	0.08	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.78848	0.4348	M	0.84326	2.69	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82063	-0.0643	10	0.87932	D	0	-38.4378	18.0823	0.89444	0.0:1.0:0.0:0.0	.	754	Q86Y38	XYLT1_HUMAN	H	754	ENSP00000261381:R754H	ENSP00000261381:R754H	R	-	2	0	XYLT1	17119300	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.818000	0.86416	2.575000	0.86900	0.462000	0.41574	CGC		0.572	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252241.2	NM_022166		17	23	0	0	0	0.012319	0	17	23				
ARHGAP17	55114	broad.mit.edu	37	16	24942256	24942256	+	Silent	SNP	C	C	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr16:24942256C>T	ENST00000289968.6	-	19	2433	c.2364G>A	c.(2362-2364)caG>caA	p.Q788Q	ARHGAP17_ENST00000441763.2_3'UTR|ARHGAP17_ENST00000303665.5_Silent_p.Q710Q	NM_001006634.1	NP_001006635.1	Q68EM7	RHG17_HUMAN	Rho GTPase activating protein 17	788	Pro-rich.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	GTPase activator activity (GO:0005096)	p.Q788Q(1)|p.Q710Q(1)		breast(2)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|urinary_tract(2)	30				GBM - Glioblastoma multiforme(48;0.0407)		CAGCATGTGGCTGTGCAGTTT	0.632																																							uc002dnb.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(2362-2364)CAG>CAA		nadrin isoform 1							74.0	84.0	80.0					16																	24942256		2197	4300	6497	SO:0001819	synonymous_variant	55114				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|tight junction	GTPase activator activity|SH3 domain binding	g.chr16:24942256C>T	AJ306731	CCDS32408.1, CCDS32409.1	16p12.2-p12.1	2011-06-29				ENSG00000140750		"""Rho GTPase activating proteins"""	18239	protein-coding gene	gene with protein product		608293				10967100, 11431473	Standard	XM_005255413		Approved	RICH1, FLJ10308, NADRIN, FLJ13219, WBP15	uc002dnb.3	Q68EM7		ENST00000289968.6:c.2364G>A	16.37:g.24942256C>T						ARHGAP17_uc002dmx.2_Silent_p.Q50Q|ARHGAP17_uc002dmw.2_Silent_p.Q50Q|ARHGAP17_uc002dmy.2_Silent_p.Q233Q|ARHGAP17_uc002dmz.2_Silent_p.Q312Q|ARHGAP17_uc002dna.2_Silent_p.Q515Q|ARHGAP17_uc002dnc.2_Silent_p.Q710Q|ARHGAP17_uc010vcf.1_Silent_p.Q531Q|ARHGAP17_uc002dne.1_Silent_p.Q50Q	p.Q788Q	NM_001006634	NP_001006635	Q68EM7	RHG17_HUMAN		GBM - Glioblastoma multiforme(48;0.0407)	19	2457	-			788			Pro-rich.		A8K6M6|Q6ZUS4|Q7Z2F2|Q8NDG2|Q96KS2|Q96KS3|Q96SS8|Q9BVF6|Q9H8U5|Q9NW54	Silent	SNP	ENST00000289968.6	37	c.2364G>A	CCDS32409.1																																																																																				0.632	ARHGAP17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436548.3	NM_018054		26	98	0	0	0	0.00333	0	26	98				
TAOK2	9344	broad.mit.edu	37	16	29998953	29998953	+	Silent	SNP	G	G	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr16:29998953G>A	ENST00000308893.4	+	16	4403	c.3360G>A	c.(3358-3360)aaG>aaA	p.K1120K	TAOK2_ENST00000416441.2_Silent_p.K947K|TAOK2_ENST00000279394.3_Intron|TAOK2_ENST00000543033.1_Silent_p.K1007K	NM_001252043.1|NM_016151.3	NP_001238972.1|NP_057235.2	Q9UL54	TAOK2_HUMAN	TAO kinase 2	1120					actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|focal adhesion assembly (GO:0048041)|G2 DNA damage checkpoint (GO:0031572)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein targeting to membrane (GO:0006612)|regulation of cell growth (GO:0001558)|regulation of cell shape (GO:0008360)|response to stress (GO:0006950)|stress-activated MAPK cascade (GO:0051403)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleolus (GO:0005730)|nucleus (GO:0005634)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|mitogen-activated protein kinase kinase binding (GO:0031434)|protein serine/threonine kinase activity (GO:0004674)	p.K1120K(1)		breast(1)|endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(3)|skin(1)	22						AAACCAACAAGGATGGCTTCC	0.667																																							uc002dva.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(3358-3360)AAG>AAA		TAO kinase 2 isoform 2							60.0	68.0	65.0					16																	29998953		2197	4299	6496	SO:0001819	synonymous_variant	9344				actin cytoskeleton organization|activation of MAPKK activity|apoptosis|cell migration|focal adhesion assembly|positive regulation of JNK cascade|protein targeting to membrane|regulation of cell growth|regulation of cell shape|response to stress	cytoplasmic vesicle membrane|cytoskeleton|dendrite|integral to membrane|nucleolus	ATP binding|protein serine/threonine kinase activity	g.chr16:29998953G>A	AB020688	CCDS10662.1, CCDS10663.1, CCDS58448.1	16p11.2	2008-02-05			ENSG00000149930	ENSG00000149930			16835	protein-coding gene	gene with protein product		613199				10048485, 9786855	Standard	NM_016151		Approved	TAO1, KIAA0881, PSK, PSK1, TAO2, MAP3K17	uc002dva.2	Q9UL54	OTTHUMG00000132111	ENST00000308893.4:c.3360G>A	16.37:g.29998953G>A						uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|TAOK2_uc002dvb.1_Intron|TAOK2_uc002dvc.1_Intron|TAOK2_uc010bzm.1_Silent_p.K1127K|TAOK2_uc002dvd.1_Silent_p.K947K	p.K1120K	NM_016151	NP_057235	Q9UL54	TAOK2_HUMAN			16	4143	+			1120					A5PKY1|A7MCZ2|B2RN35|B7ZM88|O94957|Q6UW73|Q7LC09|Q9NSW2	Silent	SNP	ENST00000308893.4	37	c.3360G>A	CCDS10663.1																																																																																				0.667	TAOK2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255152.2	NM_016151		27	98	0	0	0	0.005443	0	27	98				
ITGAM	3684	broad.mit.edu	37	16	31284711	31284711	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr16:31284711G>A	ENST00000287497.8	+	8	805	c.730G>A	c.(730-732)Gga>Aga	p.G244R	ITGAM_ENST00000544665.3_Missense_Mutation_p.G244R			P11215	ITAM_HUMAN	integrin, alpha M (complement component 3 receptor 3 subunit)	244	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular extravasation (GO:0045123)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|microglia development (GO:0014005)|neutrophil chemotaxis (GO:0030593)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)	p.G244R(1)		endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(1)|prostate(4)|skin(1)	56						CATCACCAACGGAGCCCGAAA	0.428																																							uc002ebq.2		NA																	1	Substitution - Missense(1)		lung(1)	kidney(1)	1						c.(730-732)GGA>AGA		integrin alpha M isoform 2 precursor							132.0	122.0	125.0					16																	31284711		1927	4139	6066	SO:0001583	missense	3684				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration	integrin complex	glycoprotein binding|receptor activity	g.chr16:31284711G>A	J03925	CCDS45470.1, CCDS54004.1	16p11.2	2010-03-23	2006-02-10			ENSG00000169896		"""CD molecules"", ""Complement system"", ""Integrins"""	6149	protein-coding gene	gene with protein product		120980	"""integrin, alpha M (complement component receptor 3, alpha; also known as CD11b (p170), macrophage antigen alpha polypeptide)"""	CR3A, CD11B			Standard	NM_001145808		Approved	MAC-1, CD11b	uc002ebr.3	P11215		ENST00000287497.8:c.730G>A	16.37:g.31284711G>A	ENSP00000287497:p.Gly244Arg					ITGAM_uc002ebr.2_Missense_Mutation_p.G244R|ITGAM_uc010cam.1_5'Flank	p.G244R	NM_000632	NP_000623	P11215	ITAM_HUMAN			8	828	+			244			VWFA.|Extracellular (Potential).		Q4VAK0|Q4VAK1|Q4VAK2	Missense_Mutation	SNP	ENST00000287497.8	37	c.730G>A	CCDS45470.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.528996	0.85706	.	.	ENSG00000169896	ENST00000544665;ENST00000287497	T;T	0.33654	1.4;1.4	4.95	4.95	0.65309	von Willebrand factor, type A (3);	.	.	.	.	T	0.65883	0.2734	M	0.88842	2.985	0.47276	D	0.99937	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.988	T	0.72491	-0.4277	9	0.87932	D	0	.	15.5797	0.76425	0.0:0.0:1.0:0.0	.	244;244	Q4VAK1;P11215	.;ITAM_HUMAN	R	244	ENSP00000441691:G244R;ENSP00000287497:G244R	ENSP00000287497:G244R	G	+	1	0	ITGAM	31192212	1.000000	0.71417	0.804000	0.32291	0.051000	0.14879	5.772000	0.68889	2.730000	0.93505	0.655000	0.94253	GGA		0.428	ITGAM-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000432816.1	NM_000632		54	65	0	0	0	0.00361	0	54	65				
ITGAX	3687	broad.mit.edu	37	16	31388320	31388320	+	Splice_Site	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr16:31388320G>T	ENST00000268296.4	+	22	2746		c.e22-1		ITGAX_ENST00000562522.1_Splice_Site	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)						blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)	p.?(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						CTTTTCCTCAGATCACCTTCT	0.622																																							uc002ebu.1		NA																	1	Unknown(1)		lung(1)	ovary(2)|central_nervous_system(1)|pancreas(1)	4						c.e22-1		integrin alpha X precursor							140.0	122.0	128.0					16																	31388320		2197	4300	6497	SO:0001630	splice_region_variant	3687				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration|organ morphogenesis	integrin complex	protein binding|receptor activity	g.chr16:31388320G>T	BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.2626-1G>T	16.37:g.31388320G>T						ITGAX_uc002ebt.2_Splice_Site_p.I876_splice	p.I876_splice	NM_000887	NP_000878	P20702	ITAX_HUMAN			22	2693	+								Q8IVA6	Splice_Site	SNP	ENST00000268296.4	37	c.2626_splice	CCDS10711.1	.	.	.	.	.	.	.	.	.	.	G	16.71	3.199287	0.58126	.	.	ENSG00000140678	ENST00000268296	.	.	.	4.33	4.33	0.51752	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.5066	0.55986	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ITGAX	31295821	0.990000	0.36364	0.977000	0.42913	0.879000	0.50718	4.724000	0.61972	2.411000	0.81874	0.390000	0.25778	.		0.622	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255628.2	NM_000887	Intron	16	81	1	0	1.5739e-10	0.004007	2.04752e-10	16	81				
ABCC11	85320	broad.mit.edu	37	16	48210987	48210987	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr16:48210987G>A	ENST00000394747.1	-	24	3735	c.3386C>T	c.(3385-3387)aCa>aTa	p.T1129I	ABCC11_ENST00000356608.2_Missense_Mutation_p.T1129I|ABCC11_ENST00000394748.1_Missense_Mutation_p.T1129I|ABCC11_ENST00000353782.5_Missense_Mutation_p.T1129I|ABCC11_ENST00000565329.1_5'UTR	NM_033151.3	NP_149163.2	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 11	1129					organic anion transport (GO:0015711)|purine nucleotide transport (GO:0015865)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)|purine nucleotide transmembrane transporter activity (GO:0015216)	p.T1129I(1)		breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(3)|prostate(2)|skin(5)|urinary_tract(2)	83		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)			Conjugated Estrogens(DB00286)|Folic Acid(DB00158)|Indomethacin(DB00328)|Methotrexate(DB00563)|Probenecid(DB01032)	GGGACAACTTGTGCCTTCCAT	0.463																																							uc002eff.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)|central_nervous_system(1)	6						c.(3385-3387)ACA>ATA		ATP-binding cassette, sub-family C, member 11							137.0	121.0	126.0					16																	48210987		2201	4300	6501	SO:0001583	missense	85320	Cerumen_Type				integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances	g.chr16:48210987G>A	AF367202	CCDS10732.1, CCDS10733.1	16q12	2012-03-14			ENSG00000121270	ENSG00000121270		"""ATP binding cassette transporters / subfamily C"""	14639	protein-coding gene	gene with protein product		607040				11483364, 11435397	Standard	NM_033151		Approved	MRP8	uc002efg.1	Q96J66	OTTHUMG00000133146	ENST00000394747.1:c.3386C>T	16.37:g.48210987G>A	ENSP00000378230:p.Thr1129Ile					ABCC11_uc002efg.1_Missense_Mutation_p.T1129I|ABCC11_uc002efh.1_Missense_Mutation_p.T1129I|ABCC11_uc010cbg.1_RNA	p.T1129I	NM_033151	NP_149163	Q96J66	ABCCB_HUMAN			24	3736	-		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)	1129			Cytoplasmic (Potential).		Q8TDJ0|Q96JA6|Q9BX80	Missense_Mutation	SNP	ENST00000394747.1	37	c.3386C>T	CCDS10732.1	.	.	.	.	.	.	.	.	.	.	G	10.78	1.446084	0.25987	.	.	ENSG00000121270	ENST00000353782;ENST00000356608;ENST00000394748;ENST00000394747	D;D;D;D	0.91996	-2.95;-2.86;-2.86;-2.86	5.12	-9.87	0.00470	.	1.409040	0.04863	N	0.444491	T	0.81173	0.4767	L	0.33710	1.025	0.09310	N	1	B;B	0.28933	0.228;0.014	B;B	0.24155	0.051;0.01	T	0.69213	-0.5204	10	0.25751	T	0.34	6.6579	2.5652	0.04781	0.5036:0.0977:0.1051:0.2936	.	1129;1129	Q96J66-2;Q96J66	.;ABCCB_HUMAN	I	1129	ENSP00000311326:T1129I;ENSP00000349017:T1129I;ENSP00000378231:T1129I;ENSP00000378230:T1129I	ENSP00000311326:T1129I	T	-	2	0	ABCC11	46768488	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	-0.654000	0.05354	-2.066000	0.00886	-0.291000	0.09656	ACA		0.463	ABCC11-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000429984.1	NM_032583		24	15	0	0	0	0.004656	0	24	15				
SALL1	6299	broad.mit.edu	37	16	51174869	51174869	+	Silent	SNP	A	A	G			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr16:51174869A>G	ENST00000251020.4	-	2	1297	c.1264T>C	c.(1264-1266)Ttg>Ctg	p.L422L	SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_Silent_p.L325L|SALL1_ENST00000541611.1_Intron|SALL1_ENST00000562674.1_5'Flank	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	422					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L422L(1)		NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			TGCTGGGCCAAGGCAGACAAG	0.493																																					GBM(103;1352 1446 1855 4775 8890)	GBM(103;1352 1446 1855 4775 8890)	uc010vgs.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(5)|ovary(3)	8						c.(1264-1266)TTG>CTG		sal-like 1 isoform a							101.0	102.0	101.0					16																	51174869		2198	4300	6498	SO:0001819	synonymous_variant	6299				adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr16:51174869A>G	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.1264T>C	16.37:g.51174869A>G						SALL1_uc010vgr.1_Silent_p.L325L|SALL1_uc010cbv.2_Intron	p.L422L	NM_002968	NP_002959	Q9NSC2	SALL1_HUMAN	COAD - Colon adenocarcinoma(2;0.24)		2	1295	-		all_cancers(37;0.0322)	422					Q99881|Q9NSC3|Q9P1R0	Silent	SNP	ENST00000251020.4	37	c.1264T>C	CCDS10747.1																																																																																				0.493	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968		93	92	0	0	0	0.00361	0	93	92				
ENKD1	84080	broad.mit.edu	37	16	67698948	67698948	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr16:67698948C>T	ENST00000243878.4	-	3	725	c.404G>A	c.(403-405)cGc>cAc	p.R135H	ENKD1_ENST00000602644.1_Missense_Mutation_p.R135H|ENKD1_ENST00000602409.1_5'UTR|C16orf86_ENST00000403458.4_5'Flank	NM_032140.1	NP_115516.1	Q9H0I2	ENKD1_HUMAN	enkurin domain containing 1	135						cytoplasmic microtubule (GO:0005881)|microtubule cytoskeleton (GO:0015630)		p.R135H(1)									CTTGGGTGAGCGCCACAGAGC	0.597																																							uc002etw.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(403-405)CGC>CAC		hypothetical protein LOC84080							101.0	111.0	107.0					16																	67698948		2198	4300	6498	SO:0001583	missense	84080					microtubule cytoskeleton	protein binding	g.chr16:67698948C>T	BC008284	CCDS10844.1	16q22.1	2012-10-09	2012-10-09	2012-10-09	ENSG00000124074	ENSG00000124074			25246	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 48"""	C16orf48		11230166	Standard	NM_032140		Approved	DKFZP434A1319	uc002etw.1	Q9H0I2	OTTHUMG00000137550	ENST00000243878.4:c.404G>A	16.37:g.67698948C>T	ENSP00000243878:p.Arg135His					C16orf48_uc002etv.1_5'Flank|C16orf48_uc010cem.1_Missense_Mutation_p.R135H|C16orf86_uc002etx.1_5'Flank|C16orf86_uc002ety.2_5'Flank|C16orf86_uc002etz.2_5'Flank	p.R135H	NM_032140	NP_115516	Q9H0I2	CP048_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.047)|all cancers(182;0.228)	3	687	-		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)	135					Q6UWD7	Missense_Mutation	SNP	ENST00000243878.4	37	c.404G>A	CCDS10844.1	.	.	.	.	.	.	.	.	.	.	C	12.62	1.993584	0.35131	.	.	ENSG00000124074	ENST00000243878	.	.	.	5.6	3.65	0.41850	.	0.286275	0.37012	N	0.002292	T	0.35189	0.0923	L	0.43152	1.355	0.30855	N	0.734144	B	0.11235	0.004	B	0.04013	0.001	T	0.31420	-0.9944	9	0.44086	T	0.13	-10.3566	5.7408	0.18092	0.0:0.638:0.0:0.362	.	135	Q9H0I2	CP048_HUMAN	H	135	.	ENSP00000243878:R135H	R	-	2	0	C16orf48	66256449	0.916000	0.31088	0.998000	0.56505	0.496000	0.33645	0.590000	0.23954	1.379000	0.46325	0.563000	0.77884	CGC		0.597	ENKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268884.1	NM_032140		43	130	0	0	0	0.00874	0	43	130				
DHX38	9785	broad.mit.edu	37	16	72141383	72141383	+	Silent	SNP	C	C	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr16:72141383C>T	ENST00000268482.3	+	20	3254	c.2745C>T	c.(2743-2745)ccC>ccT	p.P915P	DHX38_ENST00000536867.1_Silent_p.P227P	NM_014003.3	NP_054722.2	Q92620	PRP16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 38	915					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)	p.P915P(1)		endometrium(5)|kidney(1)|large_intestine(16)|lung(15)|pancreas(1)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	48		Ovarian(137;0.125)				TGGACCCGCCCCCGGAGGACA	0.637																																					Melanoma(97;711 1442 7855 13832 28836)	Melanoma(97;711 1442 7855 13832 28836)	uc002fcb.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(2743-2745)CCC>CCT		DEAH (Asp-Glu-Ala-His) box polypeptide 38							43.0	42.0	42.0					16																	72141383		2198	4300	6498	SO:0001819	synonymous_variant	9785				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|nucleoplasm	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding	g.chr16:72141383C>T	AF038391	CCDS10907.1	16q22	2008-02-05	2003-06-13	2003-06-20	ENSG00000140829	ENSG00000140829		"""DEAH-boxes"""	17211	protein-coding gene	gene with protein product		605584	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 38"""	DDX38		9524131, 9039502	Standard	NM_014003		Approved	PRP16, KIAA0224, hPrp16, PRPF16	uc002fcb.3	Q92620	OTTHUMG00000137596	ENST00000268482.3:c.2745C>T	16.37:g.72141383C>T						DHX38_uc010vmp.1_Silent_p.P227P	p.P915P	NM_014003	NP_054722	Q92620	PRP16_HUMAN			20	3100	+		Ovarian(137;0.125)	915					B4DVG8|D3DWS7|O75212|Q96HN7	Silent	SNP	ENST00000268482.3	37	c.2745C>T	CCDS10907.1																																																																																				0.637	DHX38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269004.3	NM_014003		20	25	0	0	0	0.008871	0	20	25				
CHST5	23563	broad.mit.edu	37	16	75563159	75563159	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr16:75563159A>G	ENST00000336257.3	-	3	2518	c.1124T>C	c.(1123-1125)cTg>cCg	p.L375P	RP11-77K12.7_ENST00000460606.1_3'UTR|CHST5_ENST00000541075.1_Missense_Mutation_p.L381P	NM_024533.4	NP_078809.2	Q9GZS9	CHST5_HUMAN	carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5	375					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|N-acetylglucosamine metabolic process (GO:0006044)|protein sulfation (GO:0006477)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)	p.L375P(1)		cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)	24						CAGCAGCTGCAGCGCGCCGGC	0.657																																							uc002fei.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1123-1125)CTG>CCG		carbohydrate (N-acetylglucosamine 6-O)							42.0	37.0	39.0					16																	75563159		2197	4298	6495	SO:0001583	missense	23563				N-acetylglucosamine metabolic process|protein sulfation	integral to membrane|intrinsic to Golgi membrane	N-acetylglucosamine 6-O-sulfotransferase activity	g.chr16:75563159A>G	AF176839	CCDS10919.1	16q23.1	2008-02-05			ENSG00000135702	ENSG00000135702		"""Sulfotransferases, membrane-bound"""	1973	protein-coding gene	gene with protein product		604817				10491328, 11017086	Standard	NM_024533		Approved	I-GLCNAC-6-ST, FLJ22167	uc002fei.3	Q9GZS9	OTTHUMG00000137610	ENST00000336257.3:c.1124T>C	16.37:g.75563159A>G	ENSP00000338783:p.Leu375Pro					CHST5_uc002fej.1_Missense_Mutation_p.L381P	p.L375P	NM_024533	NP_078809	Q9GZS9	CHST5_HUMAN			3	2519	-			375			Lumenal (Potential).		B2RV23|Q7LCN3|Q9UBY3	Missense_Mutation	SNP	ENST00000336257.3	37	c.1124T>C	CCDS10919.1	.	.	.	.	.	.	.	.	.	.	A	13.94	2.387764	0.42308	.	.	ENSG00000135702	ENST00000336257;ENST00000541075	D;D	0.85339	-1.97;-1.97	2.84	2.84	0.33178	Sulfotransferase domain (1);	0.110120	0.64402	D	0.000018	D	0.90075	0.6900	M	0.74647	2.275	0.80722	D	1	D;D	0.69078	0.997;0.995	D;D	0.69479	0.964;0.961	D	0.90244	0.4288	10	0.87932	D	0	.	10.0936	0.42462	1.0:0.0:0.0:0.0	.	381;375	Q9GZS9-2;Q9GZS9	.;CHST5_HUMAN	P	375;381	ENSP00000338783:L375P;ENSP00000441220:L381P	ENSP00000338783:L375P	L	-	2	0	CHST5	74120660	1.000000	0.71417	0.957000	0.39632	0.269000	0.26545	8.746000	0.91604	1.296000	0.44742	0.260000	0.18958	CTG		0.657	CHST5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269025.2	NM_012126		23	22	0	0	0	0.003954	0	23	22				
PKD1L2	114780	broad.mit.edu	37	16	81228608	81228608	+	RNA	SNP	C	C	A	rs375354612		TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr16:81228608C>A	ENST00000525539.1	-	0	1565				PKD1L2_ENST00000337114.4_RNA	NM_052892.3	NP_443124.3	Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)	p.L522L(2)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						CATTCCTCACCAGCATGGTGA	0.473																																							uc002fgh.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(1564-1566)CTG>CTT		polycystin 1-like 2 isoform a							110.0	109.0	109.0					16																	81228608		1977	4163	6140			114780				neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding	g.chr16:81228608C>A	AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81228608C>A						PKD1L2_uc002fgj.2_Silent_p.L522L	p.L522L	NM_052892	NP_443124	Q7Z442	PK1L2_HUMAN			8	1566	-			522			REJ.|Extracellular (Potential).		Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	Silent	SNP	ENST00000525539.1	37	c.1566G>T		.	.	.	.	.	.	.	.	.	.	C	0.684	-0.797249	0.02862	.	.	ENSG00000166473	ENST00000526632	.	.	.	5.09	-1.54	0.08584	.	.	.	.	.	T	0.20333	0.0489	.	.	.	0.20764	N	0.999858	.	.	.	.	.	.	T	0.25950	-1.0117	4	.	.	.	0.6478	2.4124	0.04428	0.2961:0.3807:0.1871:0.1361	.	.	.	.	C	50	.	.	G	-	1	0	PKD1L2	79786109	0.006000	0.16342	0.082000	0.20525	0.254000	0.26022	-0.130000	0.10498	-0.074000	0.12820	0.549000	0.68633	GGT		0.473	PKD1L2-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000387972.2			13	53	1	0	4.93089e-13	0.00245	6.75893e-13	13	53				
PKD1L2	114780	broad.mit.edu	37	16	81253859	81253859	+	RNA	SNP	G	G	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr16:81253859G>A	ENST00000525539.1	-	0	116				PKD1L2_ENST00000337114.4_RNA	NM_052892.3	NP_443124.3	Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)	p.C39C(2)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						CAAATTCATAGCAAGCATCTC	0.562																																							uc002fgh.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(115-117)TGC>TGT		polycystin 1-like 2 isoform a							100.0	98.0	99.0					16																	81253859		2040	4198	6238			114780				neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding	g.chr16:81253859G>A	AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81253859G>A						PKD1L2_uc002fgj.2_Silent_p.C39C	p.C39C	NM_052892	NP_443124	Q7Z442	PK1L2_HUMAN			1	117	-			39			Extracellular (Potential).|C-type lectin.		Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	Silent	SNP	ENST00000525539.1	37	c.117C>T																																																																																					0.562	PKD1L2-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000387972.2			49	41	0	0	0	0.00361	0	49	41				
DNAAF1	123872	broad.mit.edu	37	16	84199428	84199428	+	Silent	SNP	T	T	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr16:84199428T>A	ENST00000378553.5	+	7	1027	c.903T>A	c.(901-903)gcT>gcA	p.A301A	DNAAF1_ENST00000563818.1_3'UTR|DNAAF1_ENST00000334315.5_Silent_p.A301A	NM_178452.4	NP_848547.4	Q8NEP3	DAAF1_HUMAN	dynein, axonemal, assembly factor 1	301					axonemal dynein complex assembly (GO:0070286)|cilium morphogenesis (GO:0060271)|cilium movement (GO:0003341)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|inner dynein arm assembly (GO:0036159)|left/right pattern formation (GO:0060972)|lung development (GO:0030324)|motile cilium assembly (GO:0044458)|outer dynein arm assembly (GO:0036158)|regulation of cilium beat frequency (GO:0003356)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dynein binding (GO:0045502)	p.A301A(1)		NS(1)|endometrium(7)|kidney(1)|large_intestine(6)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(4)|urinary_tract(1)	41						GGTACGCAGCTGAAAAGGAGG	0.517																																							uc002fhl.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(901-903)GCT>GCA		leucine rich repeat containing 50							154.0	151.0	152.0					16																	84199428		2200	4300	6500	SO:0001819	synonymous_variant	123872	Kartagener_syndrome			axonemal dynein complex assembly|cilium morphogenesis	cilium axoneme|cytoplasm|spindle pole	dynein binding	g.chr16:84199428T>A	BC024009	CCDS10943.2	16q24.1	2012-05-03	2011-06-09	2011-06-09	ENSG00000154099	ENSG00000154099			30539	protein-coding gene	gene with protein product	"""outer row dynein assembly 7 homolog (Chlamydomonas)"""	613190	"""leucine rich repeat containing 50"""	LRRC50		19944405	Standard	NM_178452		Approved	FLJ25330, ODA7, CILD13	uc002fhl.4	Q8NEP3	OTTHUMG00000128517	ENST00000378553.5:c.903T>A	16.37:g.84199428T>A						LRRC50_uc010vnw.1_Silent_p.A49A	p.A301A	NM_178452	NP_848547	Q8NEP3	DAAF1_HUMAN			7	1084	+			301					B4DJA3|Q69YI8|Q69YJ0|Q69YW5|Q96LP3|Q96MB6	Silent	SNP	ENST00000378553.5	37	c.903T>A	CCDS10943.2																																																																																				0.517	DNAAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250328.3	NM_178452		57	73	0	0	0	0.00361	0	57	73				
FOXF1	2294	broad.mit.edu	37	16	86545096	86545096	+	Silent	SNP	C	C	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr16:86545096C>T	ENST00000262426.4	+	1	964	c.921C>T	c.(919-921)caC>caT	p.H307H	FENDRR_ENST00000595886.1_lincRNA	NM_001451.2	NP_001442.2	Q12946	FOXF1_HUMAN	forkhead box F1	307					blood vessel development (GO:0001568)|branching involved in open tracheal system development (GO:0060446)|cardiac left ventricle morphogenesis (GO:0003214)|cellular response to cytokine stimulus (GO:0071345)|cellular response to organic cyclic compound (GO:0071407)|detection of wounding (GO:0014822)|determination of left/right symmetry (GO:0007368)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic ectodermal digestive tract morphogenesis (GO:0048613)|embryonic foregut morphogenesis (GO:0048617)|endocardial cushion development (GO:0003197)|epithelial cell differentiation involved in mammary gland alveolus development (GO:0061030)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lateral mesodermal cell differentiation (GO:0048371)|lung alveolus development (GO:0048286)|lung development (GO:0030324)|lung lobe morphogenesis (GO:0060463)|lung vasculature development (GO:0060426)|mesenchyme migration (GO:0090131)|midgut development (GO:0007494)|morphogenesis of a branching structure (GO:0001763)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mast cell degranulation (GO:0043305)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pancreas development (GO:0031016)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of smooth muscle cell differentiation (GO:0051150)|renal system development (GO:0072001)|respiratory tube development (GO:0030323)|right lung morphogenesis (GO:0060461)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|smoothened signaling pathway (GO:0007224)|somitogenesis (GO:0001756)|trachea development (GO:0060438)|ureter development (GO:0072189)|vasculogenesis (GO:0001570)|venous blood vessel development (GO:0060841)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)	p.H282H(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|urinary_tract(1)	12						TCTCCACGCACTCCCTGGAGC	0.692																																							uc002fjl.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(919-921)CAC>CAT		forkhead box F1							5.0	6.0	5.0					16																	86545096		2078	4128	6206	SO:0001819	synonymous_variant	2294				branching involved in open tracheal system development|cardiac left ventricle morphogenesis|embryonic ectodermal digestive tract morphogenesis|endocardial cushion development|in utero embryonic development|lung vasculature development|midgut development|pancreas development|positive regulation of transcription, DNA-dependent|regulation of sequence-specific DNA binding transcription factor activity|ureter development|venous blood vessel development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription factor binding	g.chr16:86545096C>T	U13219	CCDS10957.2	16q24	2008-02-05			ENSG00000103241	ENSG00000103241		"""Forkhead boxes"""	3809	protein-coding gene	gene with protein product		601089		FKHL5		8825632, 7957066	Standard	NM_001451		Approved	FREAC1	uc002fjl.3	Q12946	OTTHUMG00000137651	ENST00000262426.4:c.921C>T	16.37:g.86545096C>T						uc002fjk.1_5'Flank	p.H307H	NM_001451	NP_001442	Q12946	FOXF1_HUMAN			1	964	+			307					B2RAF4|Q5FWE5	Silent	SNP	ENST00000262426.4	37	c.921C>T	CCDS10957.2																																																																																				0.692	FOXF1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000269103.2	NM_001451		6	9	0	0	0	0.001168	0	6	9				
SPG7	6687	broad.mit.edu	37	16	89592826	89592826	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr16:89592826G>T	ENST00000268704.2	+	5	723	c.708G>T	c.(706-708)gaG>gaT	p.E236D	SPG7_ENST00000341316.2_Missense_Mutation_p.E236D	NM_003119.2	NP_003110.1	Q9UQ90	SPG7_HUMAN	spastic paraplegia 7 (pure and complicated autosomal recessive)	236					anterograde axon cargo transport (GO:0008089)|cell death (GO:0008219)|mitochondrion organization (GO:0007005)|nervous system development (GO:0007399)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metalloendopeptidase activity (GO:0004222)|peptidase activity (GO:0008233)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)	p.E236D(2)		autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)|urinary_tract(1)	20		all_hematologic(23;0.00824)|Colorectal(91;0.102)		all cancers(4;1.39e-07)|OV - Ovarian serous cystadenocarcinoma(4;5.64e-06)|BRCA - Breast invasive adenocarcinoma(80;0.015)		TGAATATCGAGGCCAAGGACA	0.458																																							uc002fnj.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(706-708)GAG>GAT		spastic paraplegia 7 isoform 1							162.0	143.0	149.0					16																	89592826		2198	4300	6498	SO:0001583	missense	6687				cell death|nervous system development|protein catabolic process|proteolysis	integral to membrane|mitochondrial membrane	ATP binding|metalloendopeptidase activity|nucleoside-triphosphatase activity|unfolded protein binding|zinc ion binding	g.chr16:89592826G>T	Y16610	CCDS10977.1, CCDS10978.1	16q24.3	2010-04-21	2007-04-23		ENSG00000197912	ENSG00000197912		"""ATPases / AAA-type"""	11237	protein-coding gene	gene with protein product	"""paraplegin"""	602783	"""cell matrix adhesion regulator"""	CMAR		9635427, 9634528	Standard	XM_006721264		Approved	CAR, SPG5C	uc002fnj.3	Q9UQ90	OTTHUMG00000138046	ENST00000268704.2:c.708G>T	16.37:g.89592826G>T	ENSP00000268704:p.Glu236Asp					SPG7_uc002fni.2_Missense_Mutation_p.E236D	p.E236D	NM_003119	NP_003110	Q9UQ90	SPG7_HUMAN		all cancers(4;1.39e-07)|OV - Ovarian serous cystadenocarcinoma(4;5.64e-06)|BRCA - Breast invasive adenocarcinoma(80;0.015)	5	729	+		all_hematologic(23;0.00824)|Colorectal(91;0.102)	236			Mitochondrial intermembrane (Potential).		O75756|Q2TB70|Q58F00|Q96IB0	Missense_Mutation	SNP	ENST00000268704.2	37	c.708G>T	CCDS10977.1	.	.	.	.	.	.	.	.	.	.	G	10.23	1.292285	0.23564	.	.	ENSG00000197912	ENST00000268704;ENST00000341316	T;T	0.75260	-0.92;-0.92	5.35	-1.4	0.08968	Peptidase M41, FtsH extracellular (1);Peptidase M41, FtsH (1);	0.198491	0.52532	N	0.000075	T	0.42177	0.1191	N	0.11698	0.16	0.26096	N	0.980886	B;B	0.12013	0.001;0.005	B;B	0.11329	0.006;0.006	T	0.16482	-1.0401	10	0.10111	T	0.7	-1.9907	0.0246	0.00004	0.3071:0.2005:0.1852:0.3072	.	236;236	Q9UQ90;Q9UQ90-2	SPG7_HUMAN;.	D	236	ENSP00000268704:E236D;ENSP00000341157:E236D	ENSP00000268704:E236D	E	+	3	2	SPG7	88120327	0.430000	0.25538	0.821000	0.32701	0.817000	0.46193	0.013000	0.13310	-0.440000	0.07211	-0.518000	0.04402	GAG		0.458	SPG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269921.2	NM_003119		50	61	1	0	2.29192e-23	0.00361	3.72271e-23	50	61				
PLD2	5338	broad.mit.edu	37	17	4713204	4713204	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr17:4713204A>G	ENST00000263088.6	+	9	871	c.740A>G	c.(739-741)tAc>tGc	p.Y247C	PLD2_ENST00000572940.1_Missense_Mutation_p.Y247C|RP11-81A22.5_ENST00000571067.1_lincRNA	NM_001243108.1|NM_002663.4	NP_001230037.1|NP_002654.3	O14939	PLD2_HUMAN	phospholipase D2	247	PH.				cytoskeleton organization (GO:0007010)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G-protein coupled receptor internalization (GO:0002031)|glycerophospholipid biosynthetic process (GO:0046474)|innate immune response (GO:0045087)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	brush border membrane (GO:0031526)|endoplasmic reticulum membrane (GO:0005789)|plasma membrane (GO:0005886)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)	p.Y247C(2)		autonomic_ganglia(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)	31					Choline(DB00122)	TTCCTGCTGTACATGTGCCTC	0.572																																							uc002fzc.2		NA																	2	Substitution - Missense(2)		lung(2)	breast(2)|upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	5						c.(739-741)TAC>TGC		phospholipase D2	Choline(DB00122)						196.0	168.0	178.0					17																	4713204		2203	4300	6503	SO:0001583	missense	5338				cell communication|cytoskeleton organization|small GTPase mediated signal transduction		NAPE-specific phospholipase D activity|phosphatidylinositol binding|phospholipase D activity	g.chr17:4713204A>G	AF035483	CCDS11057.1, CCDS58507.1	17p13.3	2008-04-14			ENSG00000129219	ENSG00000129219	3.1.4.4		9068	protein-coding gene	gene with protein product	"""choline phosphatase 2"""	602384				9858823, 9582313	Standard	NM_002663		Approved		uc002fzc.3	O14939	OTTHUMG00000090779	ENST00000263088.6:c.740A>G	17.37:g.4713204A>G	ENSP00000263088:p.Tyr247Cys					PLD2_uc010vsj.1_Missense_Mutation_p.Y104C|PLD2_uc002fzd.2_Missense_Mutation_p.Y247C	p.Y247C	NM_002663	NP_002654	O14939	PLD2_HUMAN			9	841	+			247			PH.		I3L2C9|O43540|O43579|O43580|Q6PGR0|Q96BY3	Missense_Mutation	SNP	ENST00000263088.6	37	c.740A>G	CCDS11057.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.953913	0.73902	.	.	ENSG00000129219	ENST00000263088	T	0.08282	3.11	5.73	5.73	0.89815	Pleckstrin homology-type (1);Pleckstrin homology domain (1);	0.000000	0.85682	D	0.000000	T	0.35098	0.0920	M	0.88570	2.965	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.996;0.997	T	0.30563	-0.9974	10	0.87932	D	0	-24.3307	13.9761	0.64275	1.0:0.0:0.0:0.0	.	104;247;247	B7Z905;O14939-2;O14939	.;.;PLD2_HUMAN	C	247	ENSP00000263088:Y247C	ENSP00000263088:Y247C	Y	+	2	0	PLD2	4660168	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.621000	0.90949	2.193000	0.70182	0.459000	0.35465	TAC		0.572	PLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207561.3	NM_002663		85	48	0	0	0	0.00361	0	85	48				
TP53	7157	broad.mit.edu	37	17	7579312	7579312	+	Splice_Site	SNP	C	C	A	rs55863639		TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr17:7579312C>A	ENST00000269305.4	-	4	564	c.375G>T	c.(373-375)acG>acT	p.T125T	TP53_ENST00000359597.4_Splice_Site_p.T125T|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Splice_Site_p.T125T|TP53_ENST00000455263.2_Splice_Site_p.T125T|TP53_ENST00000445888.2_Splice_Site_p.T125T|TP53_ENST00000420246.2_Splice_Site_p.T125T	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	125	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		T -> A (in a sporadic cancer; somatic mutation).|T -> K (in sporadic cancers; somatic mutation).|T -> M (in sporadic cancers; somatic mutation).|T -> P (in a sporadic cancer; somatic mutation).|T -> R (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.T125T(51)|p.0?(8)|p.?(2)|p.V73fs*9(1)|p.G105_T125del21(1)|p.Y126fs*11(1)|p.P13fs*18(1)|p.T125_Y126insX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCAACTGACCGTGCAAGTCA	0.537		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		66	Substitution - coding silent(51)|Whole gene deletion(8)|Deletion - Frameshift(3)|Unknown(2)|Deletion - In frame(1)|Insertion - In frame(1)	p.T125T(15)|p.0?(7)|p.T125M(7)|p.T125K(3)|p.T125R(3)|p.?(2)|p.V73fs*9(1)|p.T125P(1)|p.G105_T125del21(1)|p.Y126fs*11(1)|p.T125fs*45(1)|p.T125fs*24(1)|p.T125A(1)|p.P13fs*18(1)|p.T125_Y126insX(1)	lung(21)|haematopoietic_and_lymphoid_tissue(14)|large_intestine(8)|upper_aerodigestive_tract(7)|bone(4)|central_nervous_system(3)|biliary_tract(3)|stomach(1)|liver(1)|urinary_tract(1)|kidney(1)|ovary(1)|pancreas(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245	GRCh37	CS004351|CS011573|CS971913	TP53	S	rs55863639	c.(373-375)ACG>ACT	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							66.0	61.0	63.0					17																	7579312		2203	4300	6503	SO:0001630	splice_region_variant	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7579312C>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.375+1G>T	17.37:g.7579312C>A		HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_uc002gig.1_Silent_p.T125T|TP53_uc002gih.2_Silent_p.T125T|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_5'Flank|TP53_uc010cng.1_5'Flank|TP53_uc002gii.1_5'Flank|TP53_uc010cnh.1_Silent_p.T125T|TP53_uc010cni.1_Silent_p.T125T|TP53_uc002gij.2_Silent_p.T125T|TP53_uc010cnj.1_5'Flank|TP53_uc002gin.2_Intron|TP53_uc002gio.2_Intron|TP53_uc010vug.1_Silent_p.T86T|TP53_uc010cnk.1_Silent_p.T140T	p.T125T	NM_001126112	NP_001119584	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	4	569	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	125		T -> A (in a sporadic cancer; somatic mutation).|T -> M (in sporadic cancers; somatic mutation).|T -> R (in sporadic cancers; somatic mutation).|T -> P (in a sporadic cancer; somatic mutation).|T -> K (in sporadic cancers; somatic mutation).	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Silent	SNP	ENST00000269305.4	37	c.375G>T	CCDS11118.1																																																																																				0.537	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Silent	36	18	1	0	2.52637e-11	0.005524	3.33291e-11	36	18				
MYH4	4622	broad.mit.edu	37	17	10363568	10363568	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr17:10363568T>A	ENST00000255381.2	-	13	1328	c.1218A>T	c.(1216-1218)agA>agT	p.R406S	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	406	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)	p.R406S(1)		NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						CGACCTTGACTCTGGGATAGC	0.453																																							uc002gmn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(10)|skin(2)|central_nervous_system(1)	13						c.(1216-1218)AGA>AGT		myosin, heavy polypeptide 4, skeletal muscle							119.0	106.0	110.0					17																	10363568		2203	4300	6503	SO:0001583	missense	4622				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr17:10363568T>A		CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.1218A>T	17.37:g.10363568T>A	ENSP00000255381:p.Arg406Ser					uc002gml.1_Intron	p.R406S	NM_017533	NP_060003	Q9Y623	MYH4_HUMAN			13	1329	-			406			Myosin head-like.			Missense_Mutation	SNP	ENST00000255381.2	37	c.1218A>T	CCDS11154.1	.	.	.	.	.	.	.	.	.	.	T	18.74	3.687829	0.68271	.	.	ENSG00000141048	ENST00000255381	D	0.87729	-2.29	5.56	-0.304	0.12788	Myosin head, motor domain (2);	0.000000	0.38720	U	0.001584	D	0.91650	0.7361	M	0.83384	2.64	0.50632	D	0.999883	D	0.57257	0.979	D	0.68943	0.961	D	0.90078	0.4168	10	0.87932	D	0	.	9.4659	0.38813	0.0:0.5743:0.0958:0.3299	.	406	Q9Y623	MYH4_HUMAN	S	406	ENSP00000255381:R406S	ENSP00000255381:R406S	R	-	3	2	MYH4	10304293	0.101000	0.21875	0.999000	0.59377	0.788000	0.44548	-0.537000	0.06128	0.047000	0.15862	-1.266000	0.01441	AGA		0.453	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1	NM_017533		66	59	0	0	0	0.00361	0	66	59				
TOP2A	7153	broad.mit.edu	37	17	38560655	38560655	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr17:38560655T>A	ENST00000423485.1	-	18	2293	c.2135A>T	c.(2134-2136)gAg>gTg	p.E712V		NM_001067.3	NP_001058.2	P11388	TOP2A_HUMAN	topoisomerase (DNA) II alpha 170kDa	712					apoptotic chromosome condensation (GO:0030263)|ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromosome segregation (GO:0007059)|DNA ligation (GO:0006266)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|embryonic cleavage (GO:0040016)|hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cell cycle (GO:0000278)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|positive regulation of apoptotic process (GO:0043065)|positive regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral genome replication (GO:0045070)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|DNA-dependent ATPase activity (GO:0008094)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|magnesium ion binding (GO:0000287)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|ubiquitin binding (GO:0043130)	p.E712V(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(9)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	39		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00183)		Amsacrine(DB00276)|Ciprofloxacin(DB00537)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Doxorubicin(DB00997)|Enoxacin(DB00467)|Epirubicin(DB00445)|Etoposide(DB00773)|Fleroxacin(DB04576)|Idarubicin(DB01177)|Levofloxacin(DB01137)|Lomefloxacin(DB00978)|Lucanthone(DB04967)|Mitoxantrone(DB01204)|Moxifloxacin(DB00218)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Pefloxacin(DB00487)|Podofilox(DB01179)|Sparfloxacin(DB01208)|Teniposide(DB00444)|Trovafloxacin(DB00685)|Valrubicin(DB00385)	GATAGATCTCTCGTTATCAGA	0.343																																							uc002huq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7						c.(2134-2136)GAG>GTG		DNA topoisomerase II, alpha isozyme	Amsacrine(DB00276)|Ciprofloxacin(DB00537)|Dexrazoxane(DB00380)|Doxorubicin(DB00997)|Enoxacin(DB00467)|Epirubicin(DB00445)|Etoposide(DB00773)|Fleroxacin(DB04576)|Gatifloxacin(DB01044)|Idarubicin(DB01177)|Levofloxacin(DB01137)|Lomefloxacin(DB00978)|Lucanthone(DB04967)|Mitoxantrone(DB01204)|Moxifloxacin(DB00218)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Pefloxacin(DB00487)|Podofilox(DB01179)|Sparfloxacin(DB01208)|Teniposide(DB00444)|Trovafloxacin(DB00685)|Valrubicin(DB00385)						139.0	129.0	132.0					17																	38560655		1886	4115	6001	SO:0001583	missense	7153				apoptotic chromosome condensation|DNA ligation|DNA repair|DNA topological change|DNA-dependent DNA replication|mitotic cell cycle G2/M transition decatenation checkpoint|mitotic recombination|phosphatidylinositol-mediated signaling|positive regulation of apoptosis|positive regulation of retroviral genome replication|resolution of meiotic recombination intermediates|sister chromatid segregation	cytoplasm|DNA topoisomerase complex (ATP-hydrolyzing)|nucleolus|nucleoplasm|synaptonemal complex	ATP binding|chromatin binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA-dependent ATPase activity|drug binding|histone deacetylase binding|protein C-terminus binding|protein heterodimerization activity|protein homodimerization activity|protein kinase C binding|sequence-specific DNA binding transcription factor activity|ubiquitin binding	g.chr17:38560655T>A		CCDS45672.1	17q21-q22	2008-08-06	2002-08-29		ENSG00000131747	ENSG00000131747	5.99.1.2		11989	protein-coding gene	gene with protein product		126430	"""topoisomerase (DNA) II alpha (170kD)"""	TOP2			Standard	NM_001067		Approved		uc002huq.3	P11388	OTTHUMG00000155008	ENST00000423485.1:c.2135A>T	17.37:g.38560655T>A	ENSP00000411532:p.Glu712Val						p.E712V	NM_001067	NP_001058	P11388	TOP2A_HUMAN	STAD - Stomach adenocarcinoma(5;0.00183)		18	2261	-		Breast(137;0.00328)	712					B2RTS1|Q71UN1|Q71UQ5|Q9HB24|Q9HB25|Q9HB26|Q9UP44|Q9UQP9	Missense_Mutation	SNP	ENST00000423485.1	37	c.2135A>T	CCDS45672.1	.	.	.	.	.	.	.	.	.	.	T	13.39	2.222924	0.39300	.	.	ENSG00000131747	ENST00000423485;ENST00000269577;ENST00000348049;ENST00000357601	T	0.25749	1.78	5.25	5.25	0.73442	DNA topoisomerase, type IIA, subunit A/C-terminal (1);DNA topoisomerase, type IIA, subunit A/ C-terminal, alpha-beta (1);DNA topoisomerase, type IIA, central (1);	0.000000	0.85682	D	0.000000	T	0.23133	0.0559	L	0.46741	1.465	0.80722	D	1	B	0.33826	0.427	B	0.30716	0.119	T	0.03413	-1.1039	10	0.22706	T	0.39	.	15.135	0.72558	0.0:0.0:0.0:1.0	.	712	P11388	TOP2A_HUMAN	V	712;792;735;748	ENSP00000411532:E712V	ENSP00000269577:E792V	E	-	2	0	TOP2A	35814181	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.980000	0.88113	1.984000	0.57885	0.482000	0.46254	GAG		0.343	TOP2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338035.1			40	74	0	0	0	0.006999	0	40	74				
KRT24	192666	broad.mit.edu	37	17	38859882	38859882	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr17:38859882C>A	ENST00000264651.2	-	1	120	c.64G>T	c.(64-66)Gct>Tct	p.A22S		NM_019016.2	NP_061889.2	Q2M2I5	K1C24_HUMAN	keratin 24	22	Gly-rich.|Head.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	structural molecule activity (GO:0005198)	p.A22S(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Breast(137;0.00526)				CTTCCACCAGCAGACACCCTG	0.642																																					GBM(61;380 1051 14702 23642 31441)	GBM(61;380 1051 14702 23642 31441)	uc002hvd.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(64-66)GCT>TCT		keratin 24							37.0	39.0	38.0					17																	38859882		2202	4298	6500	SO:0001583	missense	192666					cytoplasm|intermediate filament	structural molecule activity	g.chr17:38859882C>A		CCDS11372.1	17q21.2	2013-06-25			ENSG00000167916	ENSG00000167916		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	18527	protein-coding gene	gene with protein product		607742				16831889	Standard	NM_019016		Approved	FLJ20261, MGC138169, MGC138173	uc002hvd.3	Q2M2I5	OTTHUMG00000133372	ENST00000264651.2:c.64G>T	17.37:g.38859882C>A	ENSP00000264651:p.Ala22Ser						p.A22S	NM_019016	NP_061889	Q2M2I5	K1C24_HUMAN			1	121	-		Breast(137;0.00526)	22			Head.|Gly-rich.		Q9NXG7	Missense_Mutation	SNP	ENST00000264651.2	37	c.64G>T	CCDS11372.1	.	.	.	.	.	.	.	.	.	.	C	2.570	-0.299806	0.05532	.	.	ENSG00000167916	ENST00000264651	D	0.81739	-1.53	4.41	1.1	0.20463	.	.	.	.	.	T	0.57577	0.2063	N	0.11427	0.14	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.38802	-0.9644	9	0.15499	T	0.54	.	4.7821	0.13208	0.3782:0.5144:0.0:0.1074	.	22	Q2M2I5	K1C24_HUMAN	S	22	ENSP00000264651:A22S	ENSP00000264651:A22S	A	-	1	0	KRT24	36113408	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-0.713000	0.05007	0.044000	0.15775	-0.311000	0.09066	GCT		0.642	KRT24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257217.1	NM_019016		26	29	1	0	2.4375e-19	0.007291	3.78418e-19	26	29				
KRT17	3872	broad.mit.edu	37	17	39778674	39778674	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr17:39778674G>T	ENST00000311208.8	-	3	672	c.605C>A	c.(604-606)gCc>gAc	p.A202D	JUP_ENST00000540235.1_Missense_Mutation_p.A361D	NM_000422.2	NP_000413.1	Q04695	K1C17_HUMAN	keratin 17	202	Coil 1B.|Rod.				epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinization (GO:0031424)|morphogenesis of an epithelium (GO:0002009)|positive regulation of cell growth (GO:0030307)|positive regulation of hair follicle development (GO:0051798)|positive regulation of translation (GO:0045727)|signal transduction (GO:0007165)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	MHC class II protein binding (GO:0042289)|MHC class II receptor activity (GO:0032395)|structural constituent of cytoskeleton (GO:0005200)	p.A202D(1)		central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	12		Breast(137;0.000307)				CTCCAGGTCGGCTCTGGCCAG	0.607																																					Pancreas(92;1242 2086 39193 50508)	Pancreas(92;1242 2086 39193 50508)	uc002hxh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(604-606)GCC>GAC		keratin 17							75.0	77.0	76.0					17																	39778674		2203	4300	6503	SO:0001583	missense	3872	Steatocystoma_Multiplex			epidermis development	cytoplasm|intermediate filament	protein binding|structural constituent of cytoskeleton	g.chr17:39778674G>T	X62571	CCDS11402.1	17q21.2	2014-06-12			ENSG00000128422	ENSG00000128422		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6427	protein-coding gene	gene with protein product		148069		PCHC1		7539673, 1281771, 16831889	Standard	NM_000422		Approved		uc002hxh.2	Q04695	OTTHUMG00000133505	ENST00000311208.8:c.605C>A	17.37:g.39778674G>T	ENSP00000308452:p.Ala202Asp					JUP_uc010wfs.1_Intron	p.A202D	NM_000422	NP_000413	Q04695	K1C17_HUMAN			3	726	-		Breast(137;0.000307)	202			Coil 1B.|Rod.		A5Z1M9|A5Z1N0|A5Z1N1|A5Z1N2|A6NDV6|A6NKQ2|Q6IP98|Q8N1P6	Missense_Mutation	SNP	ENST00000311208.8	37	c.605C>A	CCDS11402.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.213239	0.79352	.	.	ENSG00000128422;ENSG00000173801	ENST00000311208;ENST00000540235	T;T	0.76186	-1.0;-1.0	3.87	2.87	0.33458	Prefoldin (1);Filament (1);	0.000000	0.44097	D	0.000489	D	0.87026	0.6075	M	0.91354	3.2	0.29508	N	0.854395	D	0.53151	0.958	P	0.62740	0.906	D	0.84877	0.0828	10	0.87932	D	0	.	13.6353	0.62219	0.0:0.1564:0.8436:0.0	.	202	Q04695	K1C17_HUMAN	D	202;361	ENSP00000308452:A202D;ENSP00000441751:A361D	ENSP00000441751:A361D	A	-	2	0	JUP;KRT17	37032200	0.973000	0.33851	0.843000	0.33291	0.934000	0.57294	5.391000	0.66266	0.949000	0.37715	0.655000	0.94253	GCC		0.607	KRT17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257460.1	NM_000422		57	109	1	0	1.80625e-27	0.00361	3.13307e-27	57	109				
GNGT2	2793	broad.mit.edu	37	17	47284772	47284772	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr17:47284772G>T	ENST00000511277.1	-	3	192	c.13C>A	c.(13-15)Ctc>Atc	p.L5I	GNGT2_ENST00000300406.2_Missense_Mutation_p.L5I|GNGT2_ENST00000507680.1_Missense_Mutation_p.L5I|GNGT2_ENST00000511673.1_Missense_Mutation_p.L5I|ABI3_ENST00000225941.1_5'Flank|GNGT2_ENST00000515635.1_Missense_Mutation_p.L5I|GNGT2_ENST00000503070.1_Missense_Mutation_p.L5I	NM_001198756.1	NP_001185685.1	O14610	GBGT2_HUMAN	guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2	5					G-protein coupled receptor signaling pathway (GO:0007186)|GTP catabolic process (GO:0006184)|phototransduction (GO:0007602)|synaptic transmission (GO:0007268)	heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	GTPase activity (GO:0003924)|signal transducer activity (GO:0004871)	p.L5I(1)		endometrium(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4			Epithelial(5;6.37e-06)|all cancers(6;6.36e-05)			TTCTCGCTGAGATCCTGGGCC	0.537																																							uc002ioo.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(13-15)CTC>ATC		guanine nucleotide binding protein-gamma							201.0	182.0	189.0					17																	47284772		2203	4300	6503	SO:0001583	missense	2793				G-protein coupled receptor protein signaling pathway|phototransduction|synaptic transmission	extracellular region|heterotrimeric G-protein complex	GTPase activity|signal transducer activity	g.chr17:47284772G>T		CCDS11545.1	17q21	2003-12-17				ENSG00000167083			4412	protein-coding gene	gene with protein product		139391				9286705	Standard	NM_031498		Approved	GNG9	uc021tzq.1	O14610		ENST00000511277.1:c.13C>A	17.37:g.47284772G>T	ENSP00000426022:p.Leu5Ile					ABI3_uc002ioq.1_5'Flank|ABI3_uc002iop.1_5'Flank	p.L5I	NM_031498	NP_113686	O14610	GBGT2_HUMAN	Epithelial(5;6.37e-06)|all cancers(6;6.36e-05)		3	320	-			5					B2R746|D3DTW5	Missense_Mutation	SNP	ENST00000511277.1	37	c.13C>A	CCDS11545.1	.	.	.	.	.	.	.	.	.	.	G	18.26	3.585114	0.66105	.	.	ENSG00000167083	ENST00000503070;ENST00000511277;ENST00000300406;ENST00000515635;ENST00000507680;ENST00000511673	T;T;T;T;T;T	0.30981	1.51;1.51;1.51;1.51;1.51;1.51	4.99	4.99	0.66335	G-protein gamma domain (3);	0.070231	0.64402	D	0.000017	T	0.46073	0.1374	.	.	.	0.36364	D	0.860893	D	0.55385	0.971	P	0.58077	0.832	T	0.52756	-0.8533	9	0.44086	T	0.13	-12.5053	12.8351	0.57770	0.0:0.0:0.8361:0.1639	.	5	O14610	GBGT2_HUMAN	I	5	ENSP00000420946:L5I;ENSP00000426022:L5I;ENSP00000300406:L5I;ENSP00000423924:L5I;ENSP00000421710:L5I;ENSP00000422879:L5I	ENSP00000300406:L5I	L	-	1	0	GNGT2	44639771	0.995000	0.38212	0.989000	0.46669	0.643000	0.38383	2.267000	0.43329	2.606000	0.88127	0.561000	0.74099	CTC		0.537	GNGT2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364482.1	NM_031498		116	176	1	0	1.71345e-61	0.00361	3.59313e-61	116	176				
EPX	8288	broad.mit.edu	37	17	56277675	56277675	+	Silent	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr17:56277675C>A	ENST00000225371.5	+	10	1737	c.1627C>A	c.(1627-1629)Cgg>Agg	p.R543R		NM_000502.4	NP_000493.1	P11678	PERE_HUMAN	eosinophil peroxidase	543					defense response to nematode (GO:0002215)|eosinophil migration (GO:0072677)|hydrogen peroxide catabolic process (GO:0042744)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-5 production (GO:0032714)|positive regulation of interleukin-4 production (GO:0032753)	extracellular vesicular exosome (GO:0070062)	heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.R543R(1)		breast(2)|endometrium(9)|kidney(1)|large_intestine(9)|liver(2)|lung(20)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	48					Melatonin(DB01065)	GCTCCGGGACCGGCTGTTTCG	0.647											OREG0024608	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002ivq.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(1627-1629)CGG>AGG		eosinophil peroxidase preproprotein							70.0	70.0	70.0					17																	56277675		2203	4300	6503	SO:0001819	synonymous_variant	8288				hydrogen peroxide catabolic process		heme binding|peroxidase activity|protein binding	g.chr17:56277675C>A	M26515	CCDS11602.1	17q23.1	2006-09-25				ENSG00000121053	1.11.1.7		3423	protein-coding gene	gene with protein product		131399				2550461, 2541222	Standard	NM_000502		Approved	EPO, EPP, EPX-PEN	uc002ivq.3	P11678		ENST00000225371.5:c.1627C>A	17.37:g.56277675C>A			OREG0024608	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1014		p.R543R	NM_000502	NP_000493	P11678	PERE_HUMAN			10	1713	+			543					Q4TVP3	Silent	SNP	ENST00000225371.5	37	c.1627C>A	CCDS11602.1																																																																																				0.647	EPX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443367.1	NM_000502		46	68	1	0	3.77016e-25	0.013114	6.30604e-25	46	68				
TBX4	9496	broad.mit.edu	37	17	59560748	59560748	+	Silent	SNP	G	G	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr17:59560748G>A	ENST00000240335.1	+	8	1554	c.1509G>A	c.(1507-1509)agG>agA	p.R503R	TBX4_ENST00000393853.4_Silent_p.R504R	NM_018488.2	NP_060958.2	P57082	TBX4_HUMAN	T-box 4	503					angiogenesis (GO:0001525)|embryonic limb morphogenesis (GO:0030326)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|morphogenesis of an epithelium (GO:0002009)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R503R(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(15)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						GGTGTGAGAGGAAGCCACCCT	0.547																																							uc002izi.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)	2						c.(1507-1509)AGG>AGA		T-box 4							67.0	68.0	68.0					17																	59560748		2203	4300	6503	SO:0001819	synonymous_variant	9496				leg morphogenesis|skeletal system morphogenesis	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr17:59560748G>A	AF188703	CCDS11629.1	17q21-q22	2005-10-11				ENSG00000121075		"""T-boxes"""	11603	protein-coding gene	gene with protein product		601719				10945475	Standard	NM_018488		Approved		uc002izi.3	P57082		ENST00000240335.1:c.1509G>A	17.37:g.59560748G>A						TBX4_uc010ddo.2_Silent_p.R504R|TBX4_uc010woy.1_Silent_p.R504R	p.R503R	NM_018488	NP_060958	P57082	TBX4_HUMAN			8	1554	+			503					A5PKU7|B2RMT1|B7ZLV3	Silent	SNP	ENST00000240335.1	37	c.1509G>A	CCDS11629.1																																																																																				0.547	TBX4-002	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000449649.1	NM_018488		28	42	0	0	0	0.00632	0	28	42				
BRIP1	83990	broad.mit.edu	37	17	59937249	59937249	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr17:59937249C>A	ENST00000259008.2	-	3	380	c.113G>T	c.(112-114)aGc>aTc	p.S38I	BRIP1_ENST00000577598.1_Missense_Mutation_p.S38I	NM_032043.2	NP_114432.2	Q9BX63	FANCJ_HUMAN	BRCA1 interacting protein C-terminal helicase 1	38	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S38I(2)		NS(1)|breast(3)|endometrium(9)|kidney(5)|large_intestine(9)|liver(2)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	55						ATGTTGCTTGCTGTTTAATCC	0.353			"""F, N, Mis"""			"""AML, leukemia, breast"""		Involved in tolerance or repair of DNA crosslinks																															uc002izk.1		NA	yes	Rec		"""Fanconi anaemia J, breast cancer susceptiblity"""	17	17q22	83990	F|N|Mis	BRCA1 interacting protein C-terminal helicase 1			"""L, E"""		AML|leukemia|breast			2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(112-114)AGC>ATC	Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	BRCA1 interacting protein C-terminal helicase 1							125.0	121.0	122.0					17																	59937249		2203	4300	6503	SO:0001583	missense	83990	FanconAnemia			DNA damage checkpoint|double-strand break repair|regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding	g.chr17:59937249C>A	AF360549	CCDS11631.1	17q22.2	2014-09-17				ENSG00000136492		"""Fanconi anemia, complementation groups"""	20473	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-associated helicase 1"""	605882				11595410, 11301010	Standard	NM_032043		Approved	OF, BACH1, FANCJ	uc002izk.2	Q9BX63		ENST00000259008.2:c.113G>T	17.37:g.59937249C>A	ENSP00000259008:p.Ser38Ile						p.S38I	NM_032043	NP_114432	Q9BX63	FANCJ_HUMAN			3	254	-			38			Helicase ATP-binding.		Q3MJE2|Q8NCI5	Missense_Mutation	SNP	ENST00000259008.2	37	c.113G>T	CCDS11631.1	.	.	.	.	.	.	.	.	.	.	C	10.45	1.353206	0.24512	.	.	ENSG00000136492	ENST00000259008	T	0.55930	0.49	5.56	4.59	0.56863	DEAD-like helicase (1);Helicase, superfamily 1/2, ATP-binding domain, DinG/Rad3-type (1);	0.686172	0.16425	N	0.215007	T	0.50360	0.1611	M	0.65975	2.015	0.28705	N	0.903832	P	0.52842	0.956	B	0.40825	0.341	T	0.52801	-0.8527	9	.	.	.	-5.5575	11.7339	0.51755	0.0:0.8519:0.0:0.1481	.	38	Q9BX63	FANCJ_HUMAN	I	38	ENSP00000259008:S38I	.	S	-	2	0	BRIP1	57292031	0.808000	0.29022	1.000000	0.80357	0.971000	0.66376	0.430000	0.21428	1.353000	0.45828	0.585000	0.79938	AGC		0.353	BRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445362.1	NM_032043		26	43	1	0	4.7796e-09	0.004656	5.96919e-09	26	43				
MAP3K3	4215	broad.mit.edu	37	17	61767648	61767648	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr17:61767648G>T	ENST00000361733.3	+	12	1408	c.1088G>T	c.(1087-1089)cGc>cTc	p.R363L	MAP3K3_ENST00000361357.3_Missense_Mutation_p.R394L|MAP3K3_ENST00000579585.1_Missense_Mutation_p.R394L|MAP3K3_ENST00000577395.1_Missense_Mutation_p.R359L|MAP3K3_ENST00000584573.1_Missense_Mutation_p.R390L	NM_002401.3	NP_002392.2	Q99759	M3K3_HUMAN	mitogen-activated protein kinase kinase kinase 3	363	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein autophosphorylation (GO:0046777)	cytosol (GO:0005829)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)	p.R363L(2)		breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	28						ATCAACTGGCGCCGGGGAAAG	0.517																																							uc002jbg.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(3)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)	6						c.(1087-1089)CGC>CTC		mitogen-activated protein kinase kinase kinase 3							73.0	79.0	77.0					17																	61767648		2203	4300	6503	SO:0001583	missense	4215				MAPKKK cascade|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autophosphorylation	cytosol	ATP binding|MAP kinase kinase kinase activity|metal ion binding|protein binding	g.chr17:61767648G>T	U78876	CCDS32701.1, CCDS32702.1	17q	2011-06-09				ENSG00000198909		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6855	protein-coding gene	gene with protein product	"""MAP/ERK kinase kinase 3"", ""MAPK/ERK kinase kinase 3"""	602539		MEKK3		9006902	Standard	NM_002401		Approved	MAPKKK3	uc002jbf.3	Q99759		ENST00000361733.3:c.1088G>T	17.37:g.61767648G>T	ENSP00000354485:p.Arg363Leu					MAP3K3_uc002jbe.2_Missense_Mutation_p.R394L|MAP3K3_uc002jbf.2_Missense_Mutation_p.R394L|MAP3K3_uc002jbh.2_Missense_Mutation_p.R390L|MAP3K3_uc010wpo.1_Missense_Mutation_p.R278L|MAP3K3_uc010wpp.1_Missense_Mutation_p.R359L	p.R363L	NM_002401	NP_002392	Q99759	M3K3_HUMAN			12	1407	+			363			Protein kinase.		B2RCW2|D3DU15|Q5BKZ6|Q8N3I9	Missense_Mutation	SNP	ENST00000361733.3	37	c.1088G>T	CCDS32702.1	.	.	.	.	.	.	.	.	.	.	G	33	5.290811	0.95546	.	.	ENSG00000198909	ENST00000361357;ENST00000361733	T;T	0.66460	-0.21;-0.21	5.23	5.23	0.72850	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.79673	0.4486	L	0.53729	1.69	0.80722	D	1	D;D;P;P	0.76494	0.999;0.999;0.808;0.766	D;D;P;P	0.76575	0.988;0.982;0.474;0.493	T	0.81161	-0.1059	10	0.87932	D	0	.	19.1762	0.93603	0.0:0.0:1.0:0.0	.	359;331;363;394	Q1PBM3;Q96HN9;Q99759;Q99759-2	.;.;M3K3_HUMAN;.	L	394;363	ENSP00000354927:R394L;ENSP00000354485:R363L	ENSP00000354927:R394L	R	+	2	0	MAP3K3	59121380	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.062000	0.89475	2.608000	0.88229	0.561000	0.74099	CGC		0.517	MAP3K3-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000443867.1	NM_002401		55	90	1	0	8.28887e-21	0.00361	1.32339e-20	55	90				
UBE2O	63893	broad.mit.edu	37	17	74392671	74392671	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr17:74392671C>A	ENST00000319380.7	-	14	2411	c.2347G>T	c.(2347-2349)Gct>Tct	p.A783S	UBE2O_ENST00000587581.1_5'Flank	NM_022066.3	NP_071349.3	Q9C0C9	UBE2O_HUMAN	ubiquitin-conjugating enzyme E2O	783					positive regulation of BMP signaling pathway (GO:0030513)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.A783S(2)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36						TGGACGGCAGCTGTGGCTGCC	0.662																																							uc002jrm.3		NA																	2	Substitution - Missense(2)		lung(2)	breast(2)|skin(2)|lung(1)	5						c.(2347-2349)GCT>TCT		ubiquitin-conjugating enzyme E2O							52.0	63.0	59.0					17																	74392671		2199	4285	6484	SO:0001583	missense	63893						ATP binding|ubiquitin-protein ligase activity	g.chr17:74392671C>A	AB051521	CCDS32742.1	17q25.1	2013-10-09			ENSG00000175931	ENSG00000175931			29554	protein-coding gene	gene with protein product						11311559, 11214970	Standard	NM_022066		Approved	E2-230K	uc002jrm.4	Q9C0C9	OTTHUMG00000180178	ENST00000319380.7:c.2347G>T	17.37:g.74392671C>A	ENSP00000323687:p.Ala783Ser					UBE2O_uc002jrn.3_Missense_Mutation_p.A783S|UBE2O_uc002jrl.3_Missense_Mutation_p.A387S	p.A783S	NM_022066	NP_071349	Q9C0C9	UBE2O_HUMAN			14	2412	-			783					A6NDU5|Q69YP4|Q6PIZ2|Q86UA4|Q8N425|Q8TBN1|Q9BSW1|Q9H6E6|Q9H7E4|Q9H9B2	Missense_Mutation	SNP	ENST00000319380.7	37	c.2347G>T	CCDS32742.1	.	.	.	.	.	.	.	.	.	.	C	12.66	2.003830	0.35320	.	.	ENSG00000175931	ENST00000319380	T	0.73258	-0.73	4.94	4.94	0.65067	.	0.139466	0.47455	D	0.000225	T	0.48978	0.1530	N	0.14661	0.345	0.37616	D	0.921106	B	0.29037	0.231	B	0.19666	0.026	T	0.52358	-0.8586	10	0.09338	T	0.73	-14.5838	13.6711	0.62424	0.0:1.0:0.0:0.0	.	783	Q9C0C9	UBE2O_HUMAN	S	783	ENSP00000323687:A783S	ENSP00000323687:A783S	A	-	1	0	UBE2O	71904266	0.990000	0.36364	0.627000	0.29227	0.714000	0.41099	2.980000	0.49321	2.283000	0.76528	0.462000	0.41574	GCT		0.662	UBE2O-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450123.1	NM_022066		72	122	1	0	2.48295e-43	0.00361	4.94829e-43	72	122				
RPTOR	57521	broad.mit.edu	37	17	78681705	78681705	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr17:78681705G>T	ENST00000306801.3	+	4	775	c.413G>T	c.(412-414)cGt>cTt	p.R138L	RPTOR_ENST00000537330.1_5'UTR|RPTOR_ENST00000570891.1_Missense_Mutation_p.R138L|RPTOR_ENST00000544334.2_Missense_Mutation_p.R138L	NM_020761.2	NP_065812.1	Q8N122	RPTOR_HUMAN	regulatory associated protein of MTOR, complex 1	138					cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nutrient levels (GO:0031669)|insulin receptor signaling pathway (GO:0008286)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|regulation of cell size (GO:0008361)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|TORC1 complex (GO:0031931)	14-3-3 protein binding (GO:0071889)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)	p.R138L(1)|p.R138H(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	44						ACGTCCTTACGTCGCAACGCC	0.562																																							uc002jyt.1		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)	lung(4)|urinary_tract(1)|ovary(1)	6						c.(412-414)CGT>CTT		raptor isoform 1							70.0	60.0	64.0					17																	78681705		2203	4300	6503	SO:0001583	missense	57521				cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding	g.chr17:78681705G>T		CCDS11773.1, CCDS54175.1	17q25.3	2013-01-10				ENSG00000141564		"""WD repeat domain containing"""	30287	protein-coding gene	gene with protein product	"""regulatory associated protein of mTOR"""	607130				10718198, 12150926	Standard	NM_001163034		Approved	KOG1, Mip1, KIAA1303, raptor	uc002jyt.1	Q8N122		ENST00000306801.3:c.413G>T	17.37:g.78681705G>T	ENSP00000307272:p.Arg138Leu					RPTOR_uc002jys.2_Missense_Mutation_p.R138L|RPTOR_uc010wuf.1_5'UTR|RPTOR_uc010wug.1_Missense_Mutation_p.R138L	p.R138L	NM_020761	NP_065812	Q8N122	RPTOR_HUMAN			4	1218	+			138					B2RN36|C6KEF2|F5H7J5|Q8N4V9|Q8TB32|Q9P2P3	Missense_Mutation	SNP	ENST00000306801.3	37	c.413G>T	CCDS11773.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.588131	0.86851	.	.	ENSG00000141564	ENST00000306801;ENST00000544334	T;T	0.60920	0.15;0.21	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	D	0.83464	0.5260	H	0.94306	3.52	0.80722	D	1	D;D	0.89917	0.992;1.0	D;D	0.91635	0.979;0.999	D	0.88270	0.2929	10	0.87932	D	0	.	18.975	0.92731	0.0:0.0:1.0:0.0	.	138;138	F5H7J5;Q8N122	.;RPTOR_HUMAN	L	138	ENSP00000307272:R138L;ENSP00000442479:R138L	ENSP00000307272:R138L	R	+	2	0	RPTOR	76296300	1.000000	0.71417	0.269000	0.24586	0.536000	0.34869	9.713000	0.98740	2.485000	0.83878	0.655000	0.94253	CGT		0.562	RPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438125.1	NM_020761		21	28	1	0	1.00905e-13	0.008871	1.41066e-13	21	28				
ROCK1	6093	broad.mit.edu	37	18	18629083	18629083	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr18:18629083C>A	ENST00000399799.2	-	4	1324	c.384G>T	c.(382-384)atG>atT	p.M128I		NM_005406.2	NP_005397.1	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein kinase 1	128	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|apical constriction (GO:0003383)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|bleb assembly (GO:0032060)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of focal adhesion assembly (GO:0051894)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.M128I(1)		NS(1)|breast(4)|central_nervous_system(1)|large_intestine(8)|lung(2)	16	Melanoma(1;0.165)					TGGCAAAAGCCATGATGTCCC	0.373																																							uc002kte.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|breast(2)|central_nervous_system(1)	5						c.(382-384)ATG>ATT		Rho-associated, coiled-coil containing protein							96.0	92.0	93.0					18																	18629083		2203	4300	6503	SO:0001583	missense	6093				actin cytoskeleton organization|axon guidance|cellular component disassembly involved in apoptosis|cytokinesis|leukocyte tethering or rolling|membrane to membrane docking|Rho protein signal transduction	centriole|cytosol|Golgi membrane	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity	g.chr18:18629083C>A		CCDS11870.2	18q11.2	2013-01-10			ENSG00000067900	ENSG00000067900	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10251	protein-coding gene	gene with protein product		601702				8617235	Standard	NM_005406		Approved	p160ROCK	uc002kte.3	Q13464	OTTHUMG00000131723	ENST00000399799.2:c.384G>T	18.37:g.18629083C>A	ENSP00000382697:p.Met128Ile						p.M128I	NM_005406	NP_005397	Q13464	ROCK1_HUMAN			4	1325	-	Melanoma(1;0.165)		128			Protein kinase.		B0YJ91|Q2KHM4|Q59GZ4	Missense_Mutation	SNP	ENST00000399799.2	37	c.384G>T	CCDS11870.2	.	.	.	.	.	.	.	.	.	.	C	35	5.420811	0.96111	.	.	ENSG00000067900	ENST00000399799	T	0.25414	1.8	5.94	5.94	0.96194	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.52322	0.1727	M	0.62088	1.915	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.47736	-0.9094	10	0.72032	D	0.01	.	20.3616	0.98856	0.0:1.0:0.0:0.0	.	128	Q13464	ROCK1_HUMAN	I	128	ENSP00000382697:M128I	ENSP00000382697:M128I	M	-	3	0	ROCK1	16883081	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.811000	0.86092	2.818000	0.97014	0.637000	0.83480	ATG		0.373	ROCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254641.2	NM_005406		44	65	1	0	4.44401e-20	0.010771	6.97635e-20	44	65				
DSC3	1825	broad.mit.edu	37	18	28598198	28598198	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr18:28598198C>T	ENST00000360428.4	-	9	1182	c.1102G>A	c.(1102-1104)Gca>Aca	p.A368T	DSC3_ENST00000434452.1_Missense_Mutation_p.A368T	NM_001941.3	NP_001932.2	Q14574	DSC3_HUMAN	desmocollin 3	368	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|protein stabilization (GO:0050821)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|desmosome (GO:0030057)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)	p.A368T(2)		endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(29)|ovary(2)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56			OV - Ovarian serous cystadenocarcinoma(10;0.125)			ACATTGAATGCATTTTCCTCT	0.279																																							uc002kwj.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|skin(2)	4						c.(1102-1104)GCA>ACA		desmocollin 3 isoform Dsc3a preproprotein							54.0	51.0	52.0					18																	28598198		2202	4293	6495	SO:0001583	missense	1825				homophilic cell adhesion|protein stabilization	desmosome|integral to membrane|membrane fraction	calcium ion binding|gamma-catenin binding	g.chr18:28598198C>T	X83929	CCDS32810.1	18q12.1	2014-07-30			ENSG00000134762	ENSG00000134762		"""Cadherins / Major cadherins"""	3037	protein-coding gene	gene with protein product		600271		DSC4		7774948, 8486729	Standard	NM_001941		Approved	CDHF3, DSC, DSC1, DSC2	uc002kwj.4	Q14574	OTTHUMG00000179622	ENST00000360428.4:c.1102G>A	18.37:g.28598198C>T	ENSP00000353608:p.Ala368Thr					DSC3_uc002kwi.3_Missense_Mutation_p.A368T	p.A368T	NM_001941	NP_001932	Q14574	DSC3_HUMAN	OV - Ovarian serous cystadenocarcinoma(10;0.125)		9	1257	-			368			Cadherin 3.|Extracellular (Potential).		A6NN35|Q14200|Q9HAZ9	Missense_Mutation	SNP	ENST00000360428.4	37	c.1102G>A	CCDS32810.1	.	.	.	.	.	.	.	.	.	.	C	0.231	-1.020767	0.02061	.	.	ENSG00000134762	ENST00000360428;ENST00000434452	T;T	0.55413	0.52;0.52	5.36	-2.02	0.07388	Cadherin (3);Cadherin-like (1);	1.129960	0.06989	N	0.821195	T	0.22666	0.0547	N	0.01235	-0.94	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.22836	-1.0205	10	0.15066	T	0.55	.	11.8844	0.52594	0.0:0.2791:0.0:0.7209	.	368;368	Q14574;Q14574-2	DSC3_HUMAN;.	T	368	ENSP00000353608:A368T;ENSP00000392068:A368T	ENSP00000353608:A368T	A	-	1	0	DSC3	26852196	0.000000	0.05858	0.005000	0.12908	0.237000	0.25408	-0.510000	0.06328	-0.504000	0.06577	0.579000	0.79373	GCA		0.279	DSC3-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447384.1	NM_001941, NM_024423		16	28	0	0	0	0.00499	0	16	28				
INO80C	125476	broad.mit.edu	37	18	33048628	33048628	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr18:33048628C>A	ENST00000334598.7	-	5	642	c.526G>T	c.(526-528)Gac>Tac	p.D176Y	INO80C_ENST00000441607.2_Missense_Mutation_p.D212Y|RP11-322E11.6_ENST00000589258.1_Intron|INO80C_ENST00000592173.1_Intron|RP11-322E11.5_ENST00000591141.1_lincRNA|INO80C_ENST00000586489.1_Missense_Mutation_p.D121Y|INO80C_ENST00000590757.1_Missense_Mutation_p.D79Y	NM_194281.3	NP_919257.2	Q6PI98	IN80C_HUMAN	INO80 complex subunit C	176					chromatin remodeling (GO:0006338)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ino80 complex (GO:0031011)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)		p.D176Y(1)		central_nervous_system(1)|endometrium(1)|lung(3)|prostate(2)|skin(1)	8						GTGACGACGTCAGAGGGCAGC	0.557																																							uc002kyy.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(526-528)GAC>TAC		Ies6-similar protein isoform 2							135.0	136.0	135.0					18																	33048628		2203	4300	6503	SO:0001583	missense	125476				DNA recombination|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Ino80 complex|MLL1 complex		g.chr18:33048628C>A		CCDS11914.1, CCDS45853.1	18q12.2	2011-07-06	2008-08-07	2008-08-07	ENSG00000153391	ENSG00000153391		"""INO80 complex subunits"""	26994	protein-coding gene	gene with protein product	"""IES6 homolog (S. cerevisiae)"""		"""chromosome 18 open reading frame 37"""	C18orf37		16230350	Standard	NM_001098817		Approved	FLJ38183, hIes6, IES6	uc010dmt.3	Q6PI98	OTTHUMG00000132564	ENST00000334598.7:c.526G>T	18.37:g.33048628C>A	ENSP00000334473:p.Asp176Tyr					INO80C_uc002kyw.1_Intron|INO80C_uc002kyx.3_Missense_Mutation_p.D121Y|INO80C_uc010dmt.2_Missense_Mutation_p.D212Y	p.D176Y	NM_194281	NP_919257	Q6PI98	IN80C_HUMAN			5	643	-			176					B4DUI4|E9PCS7|Q86WR1|Q8N994	Missense_Mutation	SNP	ENST00000334598.7	37	c.526G>T	CCDS11914.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.615885	0.87359	.	.	ENSG00000153391	ENST00000441607;ENST00000334598	.	.	.	5.27	5.27	0.74061	.	.	.	.	.	T	0.80576	0.4649	M	0.83603	2.65	0.80722	D	1	D;D	0.89917	1.0;0.977	D;P	0.73380	0.98;0.815	T	0.82833	-0.0262	8	0.62326	D	0.03	.	16.7354	0.85445	0.0:1.0:0.0:0.0	.	212;176	E9PCS7;Q6PI98	.;IN80C_HUMAN	Y	212;176	.	ENSP00000334473:D176Y	D	-	1	0	INO80C	31302626	1.000000	0.71417	0.072000	0.20136	0.835000	0.47333	7.469000	0.80959	2.615000	0.88500	0.557000	0.71058	GAC		0.557	INO80C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255768.1	NM_194281		81	161	1	0	1.51503e-27	0.00361	2.64425e-27	81	161				
ZNF443	10224	broad.mit.edu	37	19	12542605	12542605	+	Silent	SNP	C	C	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr19:12542605C>T	ENST00000301547.5	-	4	578	c.381G>A	c.(379-381)ggG>ggA	p.G127G	CTD-3105H18.16_ENST00000595562.1_Intron	NM_005815.4	NP_005806	Q9Y2A4	ZN443_HUMAN	zinc finger protein 443	127					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G127G(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(11)|lung(10)|pancreas(1)|prostate(1)	28						GTGGTTTGTGCCCAGCACCAA	0.433																																							uc002mtu.2		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(1)	1						c.(379-381)GGG>GGA		zinc finger protein 443							152.0	132.0	139.0					19																	12542605		2203	4300	6503	SO:0001819	synonymous_variant	10224				induction of apoptosis|regulation of transcription, DNA-dependent|response to stress|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:12542605C>T	AB011414	CCDS32918.1	19p13.13	2013-01-08			ENSG00000180855	ENSG00000180855		"""Zinc fingers, C2H2-type"", ""-"""	20878	protein-coding gene	gene with protein product		606697				9731181	Standard	NM_005815		Approved	ZK1	uc002mtu.3	Q9Y2A4	OTTHUMG00000156404	ENST00000301547.5:c.381G>A	19.37:g.12542605C>T							p.G127G	NM_005815	NP_005806	Q9Y2A4	ZN443_HUMAN			4	579	-			127						Silent	SNP	ENST00000301547.5	37	c.381G>A	CCDS32918.1																																																																																				0.433	ZNF443-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344084.1	NM_005815		4	78	0	0	0	0.009096	0	4	78				
EMR3	84658	broad.mit.edu	37	19	14736374	14736374	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr19:14736374A>T	ENST00000253673.5	-	15	1950	c.1850T>A	c.(1849-1851)gTa>gAa	p.V617E	EMR3_ENST00000599900.1_Missense_Mutation_p.V402E|EMR3_ENST00000344373.4_Missense_Mutation_p.V565E|EMR3_ENST00000443157.2_Missense_Mutation_p.V491E	NM_032571.3	NP_115960.2	Q9BY15	EMR3_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 3	617					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.V617E(1)		NS(1)|autonomic_ganglia(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(14)|ovary(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	50						TTTTGATTTTACGATCTCTCT	0.403																																							uc002mzi.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(1)	6						c.(1849-1851)GTA>GAA		egf-like module-containing mucin-like receptor							236.0	210.0	219.0					19																	14736374		2203	4300	6503	SO:0001583	missense	84658				neuropeptide signaling pathway	extracellular space|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity	g.chr19:14736374A>T	AF239764	CCDS12315.1, CCDS74296.1, CCDS74297.1	19p13.1	2014-08-08				ENSG00000131355		"""-"", ""GPCR / Class B : Orphans"""	23647	protein-coding gene	gene with protein product		606101				11279179, 12975309	Standard	XM_005260118		Approved		uc002mzi.4	Q9BY15		ENST00000253673.5:c.1850T>A	19.37:g.14736374A>T	ENSP00000253673:p.Val617Glu					EMR3_uc010dzp.2_Missense_Mutation_p.V565E|EMR3_uc010xnv.1_Missense_Mutation_p.V491E	p.V617E	NM_032571	NP_115960	Q9BY15	EMR3_HUMAN			15	1998	-			617			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000253673.5	37	c.1850T>A	CCDS12315.1	.	.	.	.	.	.	.	.	.	.	A	0.017	-1.490967	0.01009	.	.	ENSG00000131355	ENST00000443157;ENST00000253673;ENST00000344373	T;T;T	0.37584	1.19;1.19;1.19	3.79	-3.66	0.04489	.	.	.	.	.	T	0.14960	0.0361	N	0.08118	0	0.09310	N	1	B;B;B	0.28933	0.079;0.228;0.015	B;B;B	0.29862	0.05;0.108;0.005	T	0.26326	-1.0106	9	0.27785	T	0.31	.	5.0717	0.14609	0.2661:0.3431:0.3908:0.0	.	491;565;617	E7EW83;Q9BY15-2;Q9BY15	.;.;EMR3_HUMAN	E	491;617;565	ENSP00000396208:V491E;ENSP00000253673:V617E;ENSP00000340758:V565E	ENSP00000253673:V617E	V	-	2	0	EMR3	14597374	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.377000	0.02558	-0.549000	0.06191	0.455000	0.32223	GTA		0.403	EMR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466488.1	NM_032571		63	39	0	0	0	0.00361	0	63	39				
IL12RB1	3594	broad.mit.edu	37	19	18174812	18174812	+	Missense_Mutation	SNP	C	C	T	rs374771268		TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr19:18174812C>T	ENST00000600835.2	-	14	1790	c.1492G>A	c.(1492-1494)Gtg>Atg	p.V498M	IL12RB1_ENST00000593993.2_Missense_Mutation_p.V498M			P42701	I12R1_HUMAN	interleukin 12 receptor, beta 1	498	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cellular response to interferon-gamma (GO:0071346)|cytokine-mediated signaling pathway (GO:0019221)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-23-mediated signaling pathway (GO:0038155)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 cell lineage commitment (GO:2000330)|positive regulation of T-helper 17 type immune response (GO:2000318)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|interleukin-12 receptor complex (GO:0042022)|interleukin-23 receptor complex (GO:0072536)	cytokine receptor activity (GO:0004896)	p.V498M(1)		endometrium(1)|kidney(1)|lung(3)|pancreas(1)|skin(2)	8						GTGGGCTGCACGGGATGCTCT	0.637																																							uc002nhw.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(1492-1494)GTG>ATG		interleukin 12 receptor, beta 1 isoform 1		C	MET/VAL	0,3986		0,0,1993	30.0	31.0	31.0		1492	0.9	0.0	19		31	1,8359		0,1,4179	no	missense	IL12RB1	NM_005535.1	21	0,1,6172	TT,TC,CC		0.012,0.0,0.0081	probably-damaging	498/663	18174812	1,12345	1993	4180	6173	SO:0001583	missense	3594				cellular response to interferon-gamma|interleukin-12-mediated signaling pathway|positive regulation of activated T cell proliferation|positive regulation of defense response to virus by host|positive regulation of interferon-gamma production|positive regulation of memory T cell differentiation|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response	interleukin-12 receptor complex|interleukin-23 receptor complex	cytokine receptor activity	g.chr19:18174812C>T	U03187	CCDS32957.1, CCDS54232.1	19p13.1	2014-09-17						"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	5971	protein-coding gene	gene with protein product		601604		IL12RB		9284929	Standard	XM_005259893		Approved	CD212	uc002nhw.1	P42701		ENST00000600835.2:c.1492G>A	19.37:g.18174812C>T	ENSP00000470788:p.Val498Met					IL12RB1_uc010xqb.1_Missense_Mutation_p.V498M|IL12RB1_uc002nhx.1_Missense_Mutation_p.V538M	p.V498M	NM_005535	NP_005526	P42701	I12R1_HUMAN			13	1556	-			498			Extracellular (Potential).|Fibronectin type-III 5.		A8K308|B2RPF1|B7ZKK3|Q8N6Q7	Missense_Mutation	SNP	ENST00000600835.2	37	c.1492G>A	CCDS54232.1	.	.	.	.	.	.	.	.	.	.	C	12.41	1.930538	0.34096	0.0	1.2E-4	ENSG00000096996	ENST00000430026	T	0.61392	0.11	3.21	0.873	0.19118	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.328967	0.21667	N	0.070940	T	0.71316	0.3325	M	0.78049	2.395	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.77557	0.983;0.99	T	0.60895	-0.7172	10	0.72032	D	0.01	-13.7896	8.9348	0.35693	0.0:0.5482:0.4518:0.0	.	498;498	P42701-2;P42701	.;I12R1_HUMAN	M	498	ENSP00000403103:V498M	ENSP00000403103:V498M	V	-	1	0	IL12RB1	18035812	0.002000	0.14202	0.005000	0.12908	0.035000	0.12851	0.133000	0.15912	0.312000	0.23038	0.491000	0.48974	GTG		0.637	IL12RB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466525.3			12	4	0	0	0	0.010729	0	12	4				
PSG2	5670	broad.mit.edu	37	19	43579616	43579616	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr19:43579616C>A	ENST00000406487.1	-	3	697	c.599G>T	c.(598-600)aGg>aTg	p.R200M		NM_031246.3	NP_112536.2	P11465	PSG2_HUMAN	pregnancy specific beta-1-glycoprotein 2	200	Ig-like C2-type 1.				cell migration (GO:0016477)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)		p.R200M(1)		central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(24)|ovary(1)|pancreas(2)|prostate(6)|stomach(2)|urinary_tract(2)	49		Prostate(69;0.00682)				AAAGAGGGTCCTGTTGGTTTC	0.507																																							uc002ovr.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(598-600)AGG>ATG		pregnancy specific beta-1-glycoprotein 2							250.0	258.0	255.0					19																	43579616		2202	4298	6500	SO:0001583	missense	5670				cell migration|female pregnancy	extracellular region		g.chr19:43579616C>A		CCDS12616.1	19q13.1-q13.2	2013-01-29			ENSG00000242221	ENSG00000242221		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9519	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1 glycoprotein"", ""pregnancy-specific beta-1-glycoprotein 7"", ""carcinoembryonic antigen SG8"""	176391		PSBG2		2377620	Standard	NM_031246		Approved	PSGGB, PSG1, CEA	uc002ovr.3	P11465	OTTHUMG00000151547	ENST00000406487.1:c.599G>T	19.37:g.43579616C>A	ENSP00000385706:p.Arg200Met					PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG2_uc002ovq.3_Missense_Mutation_p.R200M|PSG2_uc010eiq.1_Missense_Mutation_p.R200M|PSG2_uc002ovs.3_Missense_Mutation_p.R200M|PSG2_uc002ovt.3_Missense_Mutation_p.R200M	p.R200M	NM_031246	NP_112536	P11465	PSG2_HUMAN			3	692	-		Prostate(69;0.00682)	200			Ig-like C2-type 1.		Q8TCD9|Q9UEA4|Q9UQ78	Missense_Mutation	SNP	ENST00000406487.1	37	c.599G>T	CCDS12616.1	.	.	.	.	.	.	.	.	.	.	N	11.14	1.551010	0.27739	.	.	ENSG00000242221	ENST00000406487;ENST00000329509;ENST00000401942;ENST00000406917	T	0.12984	2.63	1.33	1.33	0.21861	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.40862	0.1134	M	0.92604	3.325	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.10382	-1.0632	9	0.66056	D	0.02	.	6.0088	0.19562	0.0:1.0:0.0:0.0	.	200;200	B5MCM8;P11465	.;PSG2_HUMAN	M	200	ENSP00000385706:R200M	ENSP00000332984:R200M	R	-	2	0	PSG2	48271456	0.877000	0.30153	0.104000	0.21259	0.030000	0.12068	0.079000	0.14782	0.703000	0.31848	0.454000	0.30748	AGG		0.507	PSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323083.1	NM_031246		232	322	1	0	4.32306e-105	0.00361	9.20288e-105	232	322				
ZNF235	9310	broad.mit.edu	37	19	44791609	44791609	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr19:44791609C>T	ENST00000291182.4	-	5	2081	c.1979G>A	c.(1978-1980)tGt>tAt	p.C660Y	ZNF235_ENST00000589248.1_Intron|ZNF235_ENST00000589799.1_Intron	NM_004234.4	NP_004225.3	Q14590	ZN235_HUMAN	zinc finger protein 235	660					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.C660Y(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29		Prostate(69;0.0352)|all_neural(266;0.116)				TTCTTTCCCACATTCCTCACA	0.463																																							uc002oza.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(1)	3						c.(1978-1980)TGT>TAT		zinc finger protein 93 homolog							112.0	104.0	107.0					19																	44791609		2203	4300	6503	SO:0001583	missense	9310				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:44791609C>T	X78929	CCDS33048.1	19q13.2	2013-01-08	2002-11-04	2002-11-08	ENSG00000159917	ENSG00000159917		"""Zinc fingers, C2H2-type"", ""-"""	12866	protein-coding gene	gene with protein product		604749	"""zinc finger protein homologous to Zfp93 in mouse"""	ZNF270, ZFP93		7865130, 9570955	Standard	NM_004234		Approved	HZF6, ANF270	uc002oza.4	Q14590		ENST00000291182.4:c.1979G>A	19.37:g.44791609C>T	ENSP00000291182:p.Cys660Tyr					ZNF235_uc002oyx.1_Intron|ZNF235_uc010eji.2_Intron|ZNF235_uc002ozb.3_Missense_Mutation_p.C656Y|ZNF235_uc010xwx.1_Missense_Mutation_p.C574Y	p.C660Y	NM_004234	NP_004225	Q14590	ZN235_HUMAN			5	2082	-		Prostate(69;0.0352)|all_neural(266;0.116)	660			C2H2-type 14.		B4DTQ7|O14898|O14899|Q17RR8	Missense_Mutation	SNP	ENST00000291182.4	37	c.1979G>A	CCDS33048.1	.	.	.	.	.	.	.	.	.	.	C	19.53	3.844860	0.71603	.	.	ENSG00000159917	ENST00000391957;ENST00000291182;ENST00000359844	D	0.85861	-2.04	4.96	4.96	0.65561	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.44688	D	0.000430	D	0.94391	0.8196	M	0.93150	3.385	0.58432	D	0.999994	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.95729	0.8773	10	0.87932	D	0	-20.8457	17.3494	0.87318	0.0:1.0:0.0:0.0	.	656;660	Q14590-2;Q14590	.;ZN235_HUMAN	Y	660;660;552	ENSP00000291182:C660Y	ENSP00000291182:C660Y	C	-	2	0	ZNF235	49483449	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	7.446000	0.80609	2.469000	0.83416	0.305000	0.20034	TGT		0.463	ZNF235-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460732.1			62	90	0	0	0	0.00361	0	62	90				
MYH14	79784	broad.mit.edu	37	19	50735303	50735303	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr19:50735303G>T	ENST00000596571.1	+	8	1066	c.1066G>T	c.(1066-1068)Gga>Tga	p.G356*	MYH14_ENST00000598205.1_Nonsense_Mutation_p.G364*|MYH14_ENST00000601313.1_Nonsense_Mutation_p.G364*|MYH14_ENST00000440075.2_Nonsense_Mutation_p.G364*|MYH14_ENST00000262269.8_Nonsense_Mutation_p.G364*|MYH14_ENST00000425460.1_Nonsense_Mutation_p.G364*|MYH14_ENST00000376970.2_Nonsense_Mutation_p.G356*			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	356	Myosin motor.				actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.G356*(1)|p.G364*(1)		central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		GCGGGTCCTGGGATTCAGCCA	0.662																																							uc002prr.1		NA																	2	Substitution - Nonsense(2)		lung(2)	central_nervous_system(1)	1						c.(1066-1068)GGA>TGA		myosin, heavy chain 14 isoform 2							32.0	35.0	34.0					19																	50735303		1942	4142	6084	SO:0001587	stop_gained	79784				axon guidance|regulation of cell shape	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity	g.chr19:50735303G>T	AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.1066G>T	19.37:g.50735303G>T	ENSP00000472819:p.Gly356*					MYH14_uc010enu.1_Nonsense_Mutation_p.G364*|MYH14_uc002prq.1_Nonsense_Mutation_p.G364*	p.G356*	NM_024729	NP_079005	Q7Z406	MYH14_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)	9	1113	+		all_neural(266;0.0571)|Ovarian(192;0.0728)	356			Myosin head-like.		B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Nonsense_Mutation	SNP	ENST00000596571.1	37	c.1066G>T	CCDS59411.1	.	.	.	.	.	.	.	.	.	.	G	38	6.708958	0.97780	.	.	ENSG00000105357	ENST00000301415;ENST00000440075;ENST00000376970;ENST00000425460;ENST00000376965;ENST00000262269	.	.	.	4.09	4.09	0.47781	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	14.1722	0.65517	0.0:0.0:1.0:0.0	.	.	.	.	X	356;364;356;364;356;364	.	ENSP00000262269:G364X	G	+	1	0	MYH14	55427115	1.000000	0.71417	0.998000	0.56505	0.921000	0.55340	4.146000	0.58072	2.292000	0.77174	0.491000	0.48974	GGA		0.662	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464710.2	NM_024729		26	35	1	0	1.33986e-20	0.004656	2.11518e-20	26	35				
ZNF347	84671	broad.mit.edu	37	19	53645328	53645328	+	Silent	SNP	C	C	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr19:53645328C>T	ENST00000334197.7	-	5	821	c.753G>A	c.(751-753)ggG>ggA	p.G251G	ZNF347_ENST00000452676.2_Silent_p.G252G|ZNF347_ENST00000601469.2_Silent_p.G252G|ZNF347_ENST00000601804.1_Intron	NM_032584.2	NP_115973.2	Q96SE7	ZN347_HUMAN	zinc finger protein 347	251					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G251G(1)		endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|prostate(3)|skin(1)	23				GBM - Glioblastoma multiforme(134;0.0179)		TTGCTTTTTGCCCCTGTGTGA	0.373																																					Melanoma(64;205 1597 17324 45721)	Melanoma(64;205 1597 17324 45721)	uc002qbb.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(751-753)GGG>GGA		zinc finger protein 347							110.0	112.0	111.0					19																	53645328		2203	4300	6503	SO:0001819	synonymous_variant	84671				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53645328C>T	AY029765	CCDS33097.1, CCDS54314.1	19q13.3	2013-01-08				ENSG00000197937		"""Zinc fingers, C2H2-type"", ""-"""	16447	protein-coding gene	gene with protein product							Standard	NM_032584		Approved	ZNF1111	uc010eql.2	Q96SE7		ENST00000334197.7:c.753G>A	19.37:g.53645328C>T						ZNF347_uc010eql.1_Silent_p.G252G|ZNF347_uc002qbc.1_Silent_p.G252G	p.G251G	NM_032584	NP_115973	Q96SE7	ZN347_HUMAN		GBM - Glioblastoma multiforme(134;0.0179)	5	822	-			251					B3KU77|B9EG59|G5E9N4|Q8TCN1	Silent	SNP	ENST00000334197.7	37	c.753G>A	CCDS33097.1																																																																																				0.373	ZNF347-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464170.1	NM_032584		4	165	0	0	0	0.009096	0	4	165				
LILRA4	23547	broad.mit.edu	37	19	54850356	54850356	+	Silent	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr19:54850356G>T	ENST00000291759.4	-	1	65	c.9C>A	c.(7-9)ctC>ctA	p.L3L	AC008984.2_ENST00000507363.1_RNA	NM_012276.3	NP_036408.3	P59901	LIRA4_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 4	3				L -> P (in Ref. 1; AAD02203). {ECO:0000305}.	immune system process (GO:0002376)	integral component of membrane (GO:0016021)		p.L3L(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(13)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	32	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0565)		TTGTGAGAATGAGGGTCATGG	0.572																																							uc002qfj.2		NA																	1	Substitution - coding silent(1)		lung(1)	upper_aerodigestive_tract(1)|central_nervous_system(1)	2						c.(7-9)CTC>CTA		leukocyte immunoglobulin-like receptor subfamily							123.0	103.0	110.0					19																	54850356		2203	4300	6503	SO:0001819	synonymous_variant	23547					integral to membrane	receptor activity	g.chr19:54850356G>T	AF041261	CCDS12890.1	19q13.4	2013-01-11			ENSG00000239961	ENSG00000239961		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15503	protein-coding gene	gene with protein product		607517				10941842	Standard	NM_012276		Approved	ILT7, CD85g	uc002qfj.3	P59901	OTTHUMG00000065355	ENST00000291759.4:c.9C>A	19.37:g.54850356G>T						LILRA4_uc002qfi.2_5'UTR	p.L3L	NM_012276	NP_036408	P59901	LIRA4_HUMAN		GBM - Glioblastoma multiforme(193;0.0565)	1	66	-	Ovarian(34;0.19)		3	L -> P (in Ref. 1; AAD02203).				Q32MC4	Silent	SNP	ENST00000291759.4	37	c.9C>A	CCDS12890.1																																																																																				0.572	LILRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140229.2	NM_012276		17	40	1	0	1.02788e-11	0.00499	1.36889e-11	17	40				
PEG3	5178	broad.mit.edu	37	19	57328066	57328066	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr19:57328066G>T	ENST00000326441.9	-	10	2107	c.1744C>A	c.(1744-1746)Cag>Aag	p.Q582K	ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000598410.1_Missense_Mutation_p.Q458K|ZIM2_ENST00000601070.1_Intron|ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000391708.3_Intron|PEG3_ENST00000593695.1_Missense_Mutation_p.Q456K|PEG3_ENST00000423103.2_Missense_Mutation_p.Q582K|ZIM2_ENST00000599935.1_Intron	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	582					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.Q582K(2)		NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		TGGATTTTCTGGTGCTCAATC	0.468																																							uc002qnu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12						c.(1744-1746)CAG>AAG		paternally expressed 3 isoform 1							108.0	88.0	95.0					19																	57328066		2203	4300	6503	SO:0001583	missense	5178				apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:57328066G>T	AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.1744C>A	19.37:g.57328066G>T	ENSP00000326581:p.Gln582Lys					ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Missense_Mutation_p.Q553K|PEG3_uc002qnv.2_Missense_Mutation_p.Q582K|PEG3_uc002qnw.2_Missense_Mutation_p.Q458K|PEG3_uc002qnx.2_Missense_Mutation_p.Q456K|PEG3_uc010etr.2_Missense_Mutation_p.Q582K	p.Q582K	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN		GBM - Glioblastoma multiforme(193;0.0269)	7	2095	-		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)	582			C2H2-type 3.		A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	ENST00000326441.9	37	c.1744C>A	CCDS12948.1	.	.	.	.	.	.	.	.	.	.	G	18.48	3.634149	0.67130	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.01725	4.67;4.67	4.14	4.14	0.48551	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.159932	0.29995	N	0.010677	T	0.04724	0.0128	N	0.25332	0.735	.	.	.	P;B;D	0.69078	0.945;0.276;0.997	P;B;D	0.79108	0.767;0.191;0.992	T	0.60306	-0.7289	9	0.28530	T	0.3	-16.5644	14.7172	0.69277	0.0:0.0:1.0:0.0	.	458;582;517	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	K	582	ENSP00000326581:Q582K;ENSP00000403051:Q582K	ENSP00000326581:Q582K	Q	-	1	0	ZIM2	62019878	0.817000	0.29147	1.000000	0.80357	0.998000	0.95712	0.398000	0.20899	2.596000	0.87737	0.650000	0.86243	CAG		0.468	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2			26	68	1	0	7.33532e-06	0.003954	8.2449e-06	26	68				
GREB1	9687	broad.mit.edu	37	2	11738806	11738806	+	Splice_Site	SNP	G	G	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr2:11738806G>A	ENST00000381486.2	+	15	2453	c.2153G>A	c.(2152-2154)gGg>gAg	p.G718E	GREB1_ENST00000234142.5_Splice_Site_p.G718E	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	718						integral component of membrane (GO:0016021)		p.G718E(1)		breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		TGTGTTGCAGGGGTTTTGCTG	0.483																																					Ovarian(39;850 945 2785 23371 33093)	Ovarian(39;850 945 2785 23371 33093)	uc002rbk.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2152-2154)GGG>GAG		growth regulation by estrogen in breast cancer 1							182.0	187.0	185.0					2																	11738806		2022	4190	6212	SO:0001630	splice_region_variant	9687					integral to membrane		g.chr2:11738806G>A		CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.2153-1G>A	2.37:g.11738806G>A						GREB1_uc002rbo.1_Missense_Mutation_p.G352E	p.G718E	NM_014668	NP_055483	Q4ZG55	GREB1_HUMAN		Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)	15	2453	+	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)		718					A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Missense_Mutation	SNP	ENST00000381486.2	37	c.2153G>A	CCDS42655.1	.	.	.	.	.	.	.	.	.	.	G	17.20	3.329221	0.60743	.	.	ENSG00000196208	ENST00000381486;ENST00000234142;ENST00000432985	T;T;T	0.58210	2.67;2.67;0.35	5.16	5.16	0.70880	.	0.063724	0.64402	D	0.000007	T	0.73313	0.3571	M	0.74647	2.275	0.80722	D	1	D;D	0.89917	1.0;0.972	D;P	0.97110	1.0;0.727	T	0.74328	-0.3701	9	.	.	.	.	18.6712	0.91512	0.0:0.0:1.0:0.0	.	352;718	C9JIG0;Q4ZG55	.;GREB1_HUMAN	E	718;718;352	ENSP00000370896:G718E;ENSP00000234142:G718E;ENSP00000403886:G352E	.	G	+	2	0	GREB1	11656257	1.000000	0.71417	0.977000	0.42913	0.021000	0.10359	9.130000	0.94437	2.413000	0.81919	0.655000	0.94253	GGG		0.483	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280490.1	NM_014668	Missense_Mutation	53	96	0	0	0	0.00361	0	53	96				
RAD51AP2	729475	broad.mit.edu	37	2	17697597	17697597	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr2:17697597C>A	ENST00000399080.2	-	1	2109	c.2086G>T	c.(2086-2088)Gac>Tac	p.D696Y		NM_001099218.2	NP_001092688.1	Q09MP3	R51A2_HUMAN	RAD51 associated protein 2	696								p.D696Y(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(10)|liver(1)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					TCATCCATGTCATCAAAGTCC	0.303																																							uc002rcl.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2086-2088)GAC>TAC		RAD51 associated protein 2							46.0	44.0	45.0					2																	17697597		1808	4045	5853	SO:0001583	missense	729475							g.chr2:17697597C>A	AK310498	CCDS42656.1	2p24.2	2009-01-13			ENSG00000214842	ENSG00000214842			34417	protein-coding gene	gene with protein product						16990250	Standard	NM_001099218		Approved	FLJ17540	uc002rcl.1	Q09MP3	OTTHUMG00000151761	ENST00000399080.2:c.2086G>T	2.37:g.17697597C>A	ENSP00000382030:p.Asp696Tyr					RAD51AP2_uc010exn.1_Missense_Mutation_p.D687Y	p.D696Y	NM_001099218	NP_001092688	Q09MP3	R51A2_HUMAN			1	2110	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)		696						Missense_Mutation	SNP	ENST00000399080.2	37	c.2086G>T	CCDS42656.1	.	.	.	.	.	.	.	.	.	.	C	11.36	1.615017	0.28712	.	.	ENSG00000214842	ENST00000399080	T	0.28454	1.61	4.76	1.84	0.25277	.	.	.	.	.	T	0.20659	0.0497	L	0.27053	0.805	0.24891	N	0.992161	P	0.41784	0.762	B	0.40199	0.322	T	0.11275	-1.0594	9	0.72032	D	0.01	-0.8689	6.0186	0.19616	0.1555:0.6717:0.0:0.1728	.	696	Q09MP3	R51A2_HUMAN	Y	696	ENSP00000382030:D696Y	ENSP00000382030:D696Y	D	-	1	0	RAD51AP2	17561078	0.740000	0.28207	0.779000	0.31741	0.124000	0.20399	0.427000	0.21379	0.628000	0.30357	0.591000	0.81541	GAC		0.303	RAD51AP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323801.3	NM_001099218		32	57	1	0	2.81731e-10	0.010818	3.64823e-10	32	57				
CAD	790	broad.mit.edu	37	2	27458430	27458430	+	Silent	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr2:27458430G>T	ENST00000403525.1	+	24	3951	c.3807G>T	c.(3805-3807)gtG>gtT	p.V1269V	CAD_ENST00000264705.4_Silent_p.V1332V			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)	p.V1332V(1)		NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCCCAACTGTGCGGCTACTGG	0.537																																							uc002rji.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|large_intestine(2)|kidney(2)|lung(1)|pancreas(1)	10						c.(3994-3996)GTG>GTT		carbamoylphosphate synthetase 2/aspartate	L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)						76.0	78.0	77.0					2																	27458430		2203	4300	6503	SO:0001819	synonymous_variant	790				'de novo' pyrimidine base biosynthetic process|drug metabolic process|glutamine metabolic process|peptidyl-threonine phosphorylation|protein autophosphorylation|pyrimidine nucleoside biosynthetic process|pyrimidine nucleotide biosynthetic process	cytosol|neuronal cell body|nuclear matrix|terminal button	aspartate binding|aspartate carbamoyltransferase activity|ATP binding|carbamoyl-phosphate synthase (glutamine-hydrolyzing) activity|dihydroorotase activity|enzyme binding|identical protein binding|metal ion binding|protein kinase activity	g.chr2:27458430G>T	D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.3807G>T	2.37:g.27458430G>T						CAD_uc010eyw.2_Silent_p.V1269V	p.V1332V	NM_004341	NP_004332	P27708	PYR1_HUMAN			25	4158	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		1332			CPSase B.|CPSase (Carbamoyl-phosphate synthase).		O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Silent	SNP	ENST00000403525.1	37	c.3996G>T																																																																																					0.537	CAD-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000324970.1			39	71	1	0	2.00842e-17	0.010771	3.10091e-17	39	71				
FSHR	2492	broad.mit.edu	37	2	49216164	49216164	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr2:49216164G>T	ENST00000406846.2	-	6	595	c.476C>A	c.(475-477)aCa>aAa	p.T159K	FSHR_ENST00000346173.3_Missense_Mutation_p.T159K|FSHR_ENST00000304421.4_Intron|FSHR_ENST00000541117.1_5'UTR|FSHR_ENST00000469138.1_5'UTR	NM_000145.3	NP_000136.2	P23945	FSHR_HUMAN	follicle stimulating hormone receptor	159					female gamete generation (GO:0007292)|female gonad development (GO:0008585)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor signaling pathway (GO:0007186)|gonad development (GO:0008406)|male gonad development (GO:0008584)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	follicle-stimulating hormone receptor activity (GO:0004963)	p.T159K(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|liver(1)|lung(45)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	73		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Suramin(DB04786)|Urofollitropin(DB00094)	TCTTTCAATTGTGTGGATGTT	0.328									Gonadal Dysgenesis, 46 XX																														uc002rww.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|lung(2)|central_nervous_system(1)|skin(1)	8						c.(475-477)ACA>AAA		follicle stimulating hormone receptor isoform 1	Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Urofollitropin(DB00094)						88.0	86.0	87.0					2																	49216164		2202	4300	6502	SO:0001583	missense	2492	Gonadal_Dysgenesis_46_XX	Familial Cancer Database		female gamete generation|male gonad development|spermatogenesis	integral to membrane|plasma membrane	follicle-stimulating hormone receptor activity|protein binding	g.chr2:49216164G>T		CCDS1843.1, CCDS1844.1, CCDS1844.2	2p21-p16	2014-09-17			ENSG00000170820	ENSG00000170820		"""GPCR / Class A : Gonadotropin and TSH receptors"""	3969	protein-coding gene	gene with protein product		136435		ODG1		8230163, 8855829	Standard	NM_000145		Approved	FSHRO, LGR1	uc002rww.3	P23945	OTTHUMG00000129259	ENST00000406846.2:c.476C>A	2.37:g.49216164G>T	ENSP00000384708:p.Thr159Lys					FSHR_uc002rwx.2_Missense_Mutation_p.T159K|FSHR_uc010fbn.2_Intron|FSHR_uc010fbo.1_RNA	p.T159K	NM_000145	NP_000136	P23945	FSHR_HUMAN	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		6	550	-		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	159			LRR 5.|Extracellular (Potential).		A8K947|G5CBS7|G5E967|J3KQ00|Q05AH0|Q16225|Q4QRJ3|Q4ZFZ2|Q53RW2	Missense_Mutation	SNP	ENST00000406846.2	37	c.476C>A	CCDS1843.1	.	.	.	.	.	.	.	.	.	.	G	6.731	0.503704	0.12822	.	.	ENSG00000170820	ENST00000406846;ENST00000346173;ENST00000454032	D;D;D	0.81821	-1.54;-1.54;-1.54	4.96	0.635	0.17723	.	0.692044	0.14316	N	0.327332	T	0.62889	0.2465	N	0.25992	0.78	0.09310	N	0.999999	P;B	0.48407	0.91;0.009	B;B	0.39771	0.309;0.001	T	0.54622	-0.8266	9	.	.	.	.	4.5737	0.12223	0.3424:0.0:0.5116:0.1459	.	159;159	G5E967;P23945	.;FSHR_HUMAN	K	159	ENSP00000384708:T159K;ENSP00000333908:T159K;ENSP00000415504:T159K	.	T	-	2	0	FSHR	49069668	0.209000	0.23505	0.009000	0.14445	0.766000	0.43426	0.483000	0.22292	0.002000	0.14630	0.591000	0.81541	ACA		0.328	FSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251367.2			19	25	1	0	1.10513e-12	0.002299	1.48585e-12	19	25				
ZNF638	27332	broad.mit.edu	37	2	71654429	71654429	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr2:71654429G>C	ENST00000409544.1	+	24	6060	c.5430G>C	c.(5428-5430)aaG>aaC	p.K1810N	ZNF638_ENST00000264447.4_Missense_Mutation_p.K1810N|ZNF638_ENST00000409407.1_Missense_Mutation_p.K750N|ZNF638_ENST00000355812.3_3'UTR	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	1810					regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.K1810N(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						GGAATAGAAAGAAGAGAGCTG	0.368																																							uc002shx.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(2)|ovary(1)|skin(1)	4						c.(5428-5430)AAG>AAC		zinc finger protein 638							80.0	81.0	81.0					2																	71654429		2203	4300	6503	SO:0001583	missense	27332				RNA splicing	cytoplasm|nuclear speck	double-stranded DNA binding|nucleotide binding|RNA binding|zinc ion binding	g.chr2:71654429G>C	D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.5430G>C	2.37:g.71654429G>C	ENSP00000386433:p.Lys1810Asn					ZNF638_uc002shy.2_Missense_Mutation_p.K1810N|ZNF638_uc002shz.2_Missense_Mutation_p.K1810N|ZNF638_uc002sia.2_Missense_Mutation_p.K1810N|ZNF638_uc002sib.1_3'UTR|ZNF638_uc010fed.2_Intron|ZNF638_uc002sic.2_Missense_Mutation_p.K907N|ZNF638_uc002sid.2_Missense_Mutation_p.K179N	p.K1810N	NM_014497	NP_055312	Q14966	ZN638_HUMAN			24	5749	+			1810					B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Missense_Mutation	SNP	ENST00000409544.1	37	c.5430G>C	CCDS1917.1	.	.	.	.	.	.	.	.	.	.	G	14.87	2.663138	0.47572	.	.	ENSG00000075292	ENST00000264447;ENST00000409544;ENST00000409407	T;T;T	0.39056	1.1;1.1;1.5	5.18	1.87	0.25490	.	0.312849	0.28322	N	0.015763	T	0.46367	0.1389	L	0.32530	0.975	0.80722	D	1	D;D	0.76494	0.996;0.999	P;D	0.78314	0.876;0.991	T	0.21724	-1.0237	10	0.33940	T	0.23	-10.1853	7.8179	0.29271	0.2457:0.0:0.7543:0.0	.	1810;1810	Q14966-3;Q14966	.;ZN638_HUMAN	N	1810;1810;750	ENSP00000264447:K1810N;ENSP00000386433:K1810N;ENSP00000386813:K750N	ENSP00000264447:K1810N	K	+	3	2	ZNF638	71507937	1.000000	0.71417	0.998000	0.56505	0.904000	0.53231	0.970000	0.29383	0.220000	0.20860	0.655000	0.94253	AAG		0.368	ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000327431.1	NM_014497		28	63	0	0	0	0.005443	0	28	63				
C2orf78	388960	broad.mit.edu	37	2	74043317	74043317	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr2:74043317T>A	ENST00000409561.1	+	3	2088	c.1967T>A	c.(1966-1968)cTg>cAg	p.L656Q		NM_001080474.1	NP_001073943.1	A6NCI8	CB078_HUMAN	chromosome 2 open reading frame 78	656								p.L656Q(1)|p.L626Q(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(2)|prostate(2)|soft_tissue(1)|urinary_tract(1)	34						TCCAGGACCCTGGGAAGCTCA	0.507																																							uc002sjr.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(1966-1968)CTG>CAG		hypothetical protein LOC388960							44.0	46.0	45.0					2																	74043317		1858	4099	5957	SO:0001583	missense	388960							g.chr2:74043317T>A	AC092653, AC136006, AK125975	CCDS46338.1	2p13.2	2008-07-18			ENSG00000187833	ENSG00000187833			34349	protein-coding gene	gene with protein product							Standard	NM_001080474		Approved	FLJ43987, hCG1989538, COG5373	uc002sjr.1	A6NCI8	OTTHUMG00000152819	ENST00000409561.1:c.1967T>A	2.37:g.74043317T>A	ENSP00000387124:p.Leu656Gln						p.L656Q	NM_001080474	NP_001073943	A6NCI8	CB078_HUMAN			3	2088	+			656						Missense_Mutation	SNP	ENST00000409561.1	37	c.1967T>A	CCDS46338.1	.	.	.	.	.	.	.	.	.	.	T	10.56	1.384875	0.25031	.	.	ENSG00000187833	ENST00000409561;ENST00000342345	T	0.55413	0.52	4.5	1.9	0.25705	.	0.000000	0.35407	N	0.003230	T	0.63988	0.2558	M	0.78637	2.42	0.09310	N	1	D	0.61080	0.989	D	0.64776	0.929	T	0.53308	-0.8457	10	0.87932	D	0	-1.7173	4.1471	0.10220	0.0:0.1089:0.2086:0.6824	.	656	A6NCI8	CB078_HUMAN	Q	656;626	ENSP00000387124:L656Q	ENSP00000340692:L626Q	L	+	2	0	C2orf78	73896825	0.009000	0.17119	0.302000	0.25058	0.059000	0.15707	-0.655000	0.05348	0.834000	0.34852	0.460000	0.39030	CTG		0.507	C2orf78-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000328083.1	NM_001080474		19	57	0	0	0	0.008871	0	19	57				
ACTG2	72	broad.mit.edu	37	2	74128468	74128468	+	Silent	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr2:74128468G>T	ENST00000409624.1	+	3	673	c.30G>T	c.(28-30)gtG>gtT	p.V10V	ACTG2_ENST00000409731.3_Silent_p.V10V|ACTG2_ENST00000345517.3_Silent_p.V10V|ACTG2_ENST00000409918.1_Silent_p.V10V			P63267	ACTH_HUMAN	actin, gamma 2, smooth muscle, enteric	10					muscle contraction (GO:0006936)	blood microparticle (GO:0072562)|cell periphery (GO:0071944)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)	p.V10V(1)		large_intestine(3)|lung(14)|skin(1)	18						CCGCGCTCGTGTGTGACAATG	0.622																																							uc002sjw.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(28-30)GTG>GTT		actin, gamma 2 propeptide							70.0	61.0	64.0					2																	74128468		2203	4300	6503	SO:0001819	synonymous_variant	72				muscle contraction	cytoskeleton|cytosol	ATP binding	g.chr2:74128468G>T		CCDS1930.1, CCDS56124.1	2p13.1	2008-05-20			ENSG00000163017	ENSG00000163017			145	protein-coding gene	gene with protein product		102545		ACTL3, ACTA3		1710027, 1673027	Standard	NM_001199893		Approved	ACTSG	uc002sjw.3	P63267	OTTHUMG00000129813	ENST00000409624.1:c.30G>T	2.37:g.74128468G>T						ACTG2_uc010fex.1_Silent_p.V10V|ACTG2_uc010fey.2_Silent_p.V10V|ACTG2_uc010yrn.1_Silent_p.V10V	p.V10V	NM_001615	NP_001606	P63267	ACTH_HUMAN			2	152	+			10					B2R7E7|B4E315|D6W5H8|E9PG30|P12718|Q504R1|Q6FI22	Silent	SNP	ENST00000409624.1	37	c.30G>T	CCDS1930.1																																																																																				0.622	ACTG2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328086.1	NM_001615		17	33	1	0	2.48551e-13	0.00499	3.42366e-13	17	33				
MYO7B	4648	broad.mit.edu	37	2	128347777	128347777	+	Silent	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr2:128347777C>A	ENST00000409816.2	+	15	1997	c.1965C>A	c.(1963-1965)atC>atA	p.I655I	MYO7B_ENST00000428314.1_Silent_p.I655I|MYO7B_ENST00000389524.4_Silent_p.I655I			Q6PIF6	MYO7B_HUMAN	myosin VIIB	655	Myosin motor.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.I655I(2)		breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		TCCGCTGCATCAAACCTAATG	0.532																																							uc002top.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)|pancreas(1)	2						c.(1963-1965)ATC>ATA		myosin VIIB							53.0	55.0	54.0					2																	128347777		1965	4155	6120	SO:0001819	synonymous_variant	4648					apical plasma membrane|myosin complex	actin binding|ATP binding|motor activity	g.chr2:128347777C>A		CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.1965C>A	2.37:g.128347777C>A							p.I655I	NM_001080527	NP_001073996	Q6PIF6	MYO7B_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0753)	16	2018	+	Colorectal(110;0.1)		655			Myosin head-like.		Q14786|Q8TEE1	Silent	SNP	ENST00000409816.2	37	c.1965C>A	CCDS46405.1																																																																																				0.532	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331124.3	XM_291001		19	28	1	0	2.32416e-17	0.002299	3.56879e-17	19	28				
WDR33	55339	broad.mit.edu	37	2	128477085	128477085	+	Silent	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr2:128477085C>A	ENST00000322313.4	-	16	2672	c.2514G>T	c.(2512-2514)ggG>ggT	p.G838G		NM_018383.4	NP_060853.3	Q9C0J8	WDR33_HUMAN	WD repeat domain 33	838					mRNA processing (GO:0006397)|postreplication repair (GO:0006301)|spermatogenesis (GO:0007283)	collagen trimer (GO:0005581)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.G838G(1)		NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0695)		GGGGTGGAGGCCCCTGCATGC	0.627																																							uc002tpg.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(2512-2514)GGG>GGT		WD repeat domain 33 isoform 1							33.0	36.0	35.0					2																	128477085		2203	4299	6502	SO:0001819	synonymous_variant	55339				postreplication repair|spermatogenesis	collagen|nucleus	protein binding	g.chr2:128477085C>A		CCDS2150.1, CCDS42746.1, CCDS46407.1	2q21.1	2013-01-09			ENSG00000136709	ENSG00000136709		"""WD repeat domain containing"""	25651	protein-coding gene	gene with protein product						11162572	Standard	NM_001006622		Approved	FLJ11294, WDC146, NET14	uc002tpg.2	Q9C0J8	OTTHUMG00000131534	ENST00000322313.4:c.2514G>T	2.37:g.128477085C>A							p.G838G	NM_018383	NP_060853	Q9C0J8	WDR33_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0695)	16	2697	-	Colorectal(110;0.1)		838					Q05DP8|Q53FG9|Q587J1|Q69YF7|Q6NUQ0|Q9NUL1	Silent	SNP	ENST00000322313.4	37	c.2514G>T	CCDS2150.1																																																																																				0.627	WDR33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331141.2	NM_018383		22	31	1	0	2.70639e-06	0.002299	3.15559e-06	22	31				
AMER3	205147	broad.mit.edu	37	2	131521635	131521635	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr2:131521635G>C	ENST00000423981.1	+	2	2100	c.1990G>C	c.(1990-1992)Ggt>Cgt	p.G664R	AMER3_ENST00000321420.4_Missense_Mutation_p.G664R	NM_001105193.1|NM_001105194.1|NM_001105195.1|NM_152698.2	NP_001098663.1|NP_001098664.1|NP_001098665.1|NP_689911.2	Q8N944	AMER3_HUMAN	APC membrane recruitment protein 3	664					Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	lipid binding (GO:0008289)	p.G664R(1)									AGGTCACGGAGGTGACACTCT	0.662																																							uc002trw.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(2)|ovary(1)	3						c.(1990-1992)GGT>CGT		hypothetical protein LOC205147							23.0	26.0	25.0					2																	131521635		2201	4300	6501	SO:0001583	missense	205147							g.chr2:131521635G>C	AK095696	CCDS2164.1	2q21.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000178171	ENSG00000178171		"""-"""	26771	protein-coding gene	gene with protein product			"""family with sequence similarity 123C"""	FAM123C		20843316	Standard	NM_001105195		Approved	FLJ38377	uc002trw.2	Q8N944	OTTHUMG00000131637	ENST00000423981.1:c.1990G>C	2.37:g.131521635G>C	ENSP00000392700:p.Gly664Arg					FAM123C_uc010fmv.2_Missense_Mutation_p.G664R|FAM123C_uc010fms.1_Missense_Mutation_p.G664R|FAM123C_uc010fmt.1_Missense_Mutation_p.G664R|FAM123C_uc010fmu.1_Missense_Mutation_p.G664R	p.G664R	NM_152698	NP_689911	Q8N944	F123C_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.13)	2	2180	+	Colorectal(110;0.1)		664					B7ZLH6	Missense_Mutation	SNP	ENST00000423981.1	37	c.1990G>C	CCDS2164.1	.	.	.	.	.	.	.	.	.	.	G	5.839	0.339042	0.11069	.	.	ENSG00000178171	ENST00000321420;ENST00000423981	T;T	0.42131	0.98;0.98	3.94	2.06	0.26882	.	0.494172	0.17020	N	0.190169	T	0.24005	0.0581	L	0.27053	0.805	0.09310	N	1	B	0.12630	0.006	B	0.16289	0.015	T	0.12400	-1.0549	10	0.21540	T	0.41	.	4.8198	0.13385	0.1208:0.224:0.6552:0.0	.	664	Q8N944	F123C_HUMAN	R	664	ENSP00000314914:G664R;ENSP00000392700:G664R	ENSP00000314914:G664R	G	+	1	0	FAM123C	131238105	0.000000	0.05858	0.001000	0.08648	0.031000	0.12232	0.298000	0.19120	0.960000	0.38005	0.462000	0.41574	GGT		0.662	AMER3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254531.3	NM_152698		8	18	0	0	0	0.00308	0	8	18				
ZRANB3	84083	broad.mit.edu	37	2	136107556	136107556	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr2:136107556C>T	ENST00000264159.6	-	5	705	c.589G>A	c.(589-591)Gag>Aag	p.E197K	ZRANB3_ENST00000401392.1_Missense_Mutation_p.E197K|ZRANB3_ENST00000536680.1_Missense_Mutation_p.E197K	NM_032143.2	NP_115519.2	Q5FWF4	ZRAB3_HUMAN	zinc finger, RAN-binding domain containing 3	197	DNA annealing helicase activity.|Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|DNA rewinding (GO:0036292)|DNA strand renaturation (GO:0000733)|negative regulation of DNA recombination (GO:0045910)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to UV (GO:0009411)	nuclear replication fork (GO:0043596)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|endodeoxyribonuclease activity (GO:0004520)|helicase activity (GO:0004386)|K63-linked polyubiquitin binding (GO:0070530)|zinc ion binding (GO:0008270)	p.E197K(1)		NS(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|upper_aerodigestive_tract(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.135)		TGTAATACCTCTTCAGGCCTT	0.408																																							uc002tum.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)	2						c.(589-591)GAG>AAG		zinc finger, RAN-binding domain containing 3							113.0	102.0	106.0					2																	136107556		1844	4095	5939	SO:0001583	missense	84083					intracellular	ATP binding|DNA binding|endonuclease activity|helicase activity|zinc ion binding	g.chr2:136107556C>T	AL136824	CCDS46419.1, CCDS67963.1, CCDS74580.1	2q21.3	2013-05-13			ENSG00000121988	ENSG00000121988		"""Zinc fingers, RAN-binding domain containing"""	25249	protein-coding gene	gene with protein product						11230166	Standard	XM_005263809		Approved	DKFZP434B1727	uc002tum.3	Q5FWF4	OTTHUMG00000150475	ENST00000264159.6:c.589G>A	2.37:g.136107556C>T	ENSP00000264159:p.Glu197Lys					ZRANB3_uc002tuk.2_5'UTR|ZRANB3_uc002tul.2_Missense_Mutation_p.E197K|ZRANB3_uc002tun.1_Missense_Mutation_p.E137K	p.E197K	NM_032143	NP_115519	Q5FWF4	ZRAB3_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.135)	5	706	-			197			Helicase ATP-binding.		B3KYA1|B4E375|B5MDI3|D3DP76|E9PBP0|Q53SM1|Q6P2C4|Q8N1P4|Q9H0E8	Missense_Mutation	SNP	ENST00000264159.6	37	c.589G>A	CCDS46419.1	.	.	.	.	.	.	.	.	.	.	C	36	5.659756	0.96734	.	.	ENSG00000121988	ENST00000401392;ENST00000264159;ENST00000536680;ENST00000397448	D;D;D	0.94793	-3.52;-3.52;-3.52	5.57	5.57	0.84162	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.98658	0.9550	H	0.99042	4.41	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.997;1.0;1.0	D	0.99501	1.0953	10	0.87932	D	0	-16.9016	19.5544	0.95335	0.0:1.0:0.0:0.0	.	137;197;197	E9PBP0;Q5FWF4;Q5FWF4-3	.;ZRAB3_HUMAN;.	K	197;197;197;137	ENSP00000383979:E197K;ENSP00000264159:E197K;ENSP00000441320:E197K	ENSP00000264159:E197K	E	-	1	0	ZRANB3	135824026	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	7.776000	0.85560	2.623000	0.88846	0.591000	0.81541	GAG		0.408	ZRANB3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318254.1	NM_032143		30	40	0	0	0	0.004878	0	30	40				
THSD7B	80731	broad.mit.edu	37	2	137928486	137928486	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr2:137928486G>T	ENST00000409968.1	+	7	1879	c.1701G>T	c.(1699-1701)aaG>aaT	p.K567N	THSD7B_ENST00000413152.2_Missense_Mutation_p.K536N|THSD7B_ENST00000543459.1_Intron|THSD7B_ENST00000272643.3_Missense_Mutation_p.K567N			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	567						integral component of membrane (GO:0016021)		p.K567N(1)|p.K536N(1)		NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		GTATTCTGAAGGCCGTCTGCC	0.493																																							uc002tva.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|central_nervous_system(2)|pancreas(1)	7						c.(1606-1608)AAG>AAT		thrombospondin, type I, domain containing 7B							92.0	84.0	86.0					2																	137928486		1966	4159	6125	SO:0001583	missense	80731							g.chr2:137928486G>T			2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.1701G>T	2.37:g.137928486G>T	ENSP00000387145:p.Lys567Asn					THSD7B_uc010zbj.1_Intron|THSD7B_uc002tvb.2_Missense_Mutation_p.K426N	p.K536N	NM_001080427	NP_001073896				BRCA - Breast invasive adenocarcinoma(221;0.19)	6	1608	+									Missense_Mutation	SNP	ENST00000409968.1	37	c.1608G>T		.	.	.	.	.	.	.	.	.	.	G	6.696	0.496975	0.12762	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152	T;T;T	0.23754	2.43;2.29;1.89	5.91	3.72	0.42706	.	0.142253	0.64402	D	0.000005	T	0.16257	0.0391	L	0.36672	1.1	0.80722	D	1	B;B	0.17268	0.021;0.007	B;B	0.11329	0.006;0.006	T	0.08006	-1.0743	10	0.18710	T	0.47	.	5.6941	0.17845	0.1804:0.0:0.6593:0.1603	.	567;536	Q9C0I4;C9JKN6	THS7B_HUMAN;.	N	567;567;536	ENSP00000387145:K567N;ENSP00000272643:K567N;ENSP00000413841:K536N	ENSP00000272643:K567N	K	+	3	2	THSD7B	137644956	0.988000	0.35896	0.999000	0.59377	0.094000	0.18550	0.129000	0.15830	1.434000	0.47414	0.655000	0.94253	AAG		0.493	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331769.2	XM_046570.9		16	31	1	0	2.23348e-06	0.004007	2.61504e-06	16	31				
ZEB2	9839	broad.mit.edu	37	2	145156362	145156362	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr2:145156362T>A	ENST00000558170.2	-	8	3576	c.2392A>T	c.(2392-2394)Agt>Tgt	p.S798C	ZEB2_ENST00000409487.3_Missense_Mutation_p.S798C|ZEB2_ENST00000539609.3_Missense_Mutation_p.S774C|ZEB2_ENST00000303660.4_Missense_Mutation_p.S798C	NM_014795.3	NP_055610.1	O60315	ZEB2_HUMAN	zinc finger E-box binding homeobox 2	798					cell proliferation in forebrain (GO:0021846)|developmental pigmentation (GO:0048066)|hippocampus development (GO:0021766)|melanocyte migration (GO:0097324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of melanosome organization (GO:1903056)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|phosphatase regulator activity (GO:0019208)	p.S798C(1)		breast(3)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(6)|large_intestine(23)|lung(45)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	107				BRCA - Breast invasive adenocarcinoma(221;0.112)		TATGAACTACTGTGGGAGTTT	0.388																																					Melanoma(33;1235 1264 5755 16332)	Melanoma(33;1235 1264 5755 16332)	uc002tvu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)	9						c.(2392-2394)AGT>TGT		zinc finger homeobox 1b							129.0	134.0	132.0					2																	145156362		2203	4300	6503	SO:0001583	missense	9839					cytoplasm|nucleolus	phosphatase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|SMAD binding|zinc ion binding	g.chr2:145156362T>A	AB011141	CCDS2186.1, CCDS54403.1	2q22.3	2013-01-08	2007-02-15	2007-02-15	ENSG00000169554	ENSG00000169554		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	14881	protein-coding gene	gene with protein product	"""SMAD interacting protein 1"""	605802	"""zinc finger homeobox 1b"""	ZFHX1B			Standard	NM_014795		Approved	KIAA0569, SIP-1, SIP1	uc002tvu.3	O60315	OTTHUMG00000131834	ENST00000558170.2:c.2392A>T	2.37:g.145156362T>A	ENSP00000454157:p.Ser798Cys					ZEB2_uc002tvv.2_Missense_Mutation_p.S792C|ZEB2_uc010zbm.1_Missense_Mutation_p.S769C|ZEB2_uc010fnp.2_Intron|ZEB2_uc010fnq.1_Missense_Mutation_p.S827C	p.S798C	NM_014795	NP_055610	O60315	ZEB2_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.112)	8	2872	-			798					A0JP09|B7Z2P2|F5H814|Q9UED1	Missense_Mutation	SNP	ENST00000558170.2	37	c.2392A>T	CCDS2186.1	.	.	.	.	.	.	.	.	.	.	T	14.54	2.565307	0.45694	.	.	ENSG00000169554	ENST00000539609;ENST00000303660;ENST00000409487	T;T;T	0.14766	2.48;2.48;2.48	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.28797	0.0714	L	0.54323	1.7	0.58432	D	0.999999	D;D;D;D	0.69078	0.997;0.983;0.983;0.983	P;P;P;P	0.58660	0.843;0.533;0.533;0.533	T	0.00797	-1.1562	10	0.51188	T	0.08	-8.6668	15.7747	0.78204	0.0:0.0:0.0:1.0	.	774;663;797;798	F5H814;Q53TD9;A0JP08;O60315	.;.;.;ZEB2_HUMAN	C	774;798;798	ENSP00000443792:S774C;ENSP00000302501:S798C;ENSP00000386854:S798C	ENSP00000302501:S798C	S	-	1	0	ZEB2	144872832	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.249000	0.72427	2.194000	0.70268	0.533000	0.62120	AGT		0.388	ZEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254778.5	NM_014795		76	128	0	0	0	0.00361	0	76	128				
TANC1	85461	broad.mit.edu	37	2	159992709	159992709	+	Silent	SNP	C	C	G	rs375201296	byFrequency	TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr2:159992709C>G	ENST00000263635.6	+	5	501	c.264C>G	c.(262-264)ccC>ccG	p.P88P	TANC1_ENST00000454300.1_Silent_p.P88P	NM_001145909.1|NM_033394.2	NP_001139381.1|NP_203752.2	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1	88					dendritic spine maintenance (GO:0097062)|myoblast fusion (GO:0007520)|visual learning (GO:0008542)	axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)		p.P88P(2)		breast(3)|central_nervous_system(4)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(25)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	77						CTACAGGTCCCGTCAGGAAGC	0.483																																							uc002uag.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|central_nervous_system(1)	3						c.(262-264)CCC>CCG		tetratricopeptide repeat, ankyrin repeat and							140.0	144.0	143.0					2																	159992709		1921	4127	6048	SO:0001819	synonymous_variant	85461					cell junction|postsynaptic density|postsynaptic membrane	binding	g.chr2:159992709C>G	AB051515	CCDS42766.1	2q24.2	2013-01-11			ENSG00000115183	ENSG00000115183		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29364	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	611397				15673434	Standard	NM_033394		Approved	KIAA1728, ROLSB	uc002uag.3	Q9C0D5	OTTHUMG00000153945	ENST00000263635.6:c.264C>G	2.37:g.159992709C>G						TANC1_uc010fol.1_Silent_p.P88P|TANC1_uc010zcm.1_Silent_p.P88P|TANC1_uc010fom.1_Silent_p.P88P|TANC1_uc002uah.1_5'UTR	p.P88P	NM_033394	NP_203752	Q9C0D5	TANC1_HUMAN			5	538	+			88					C9JD88|Q49AI8	Silent	SNP	ENST00000263635.6	37	c.264C>G	CCDS42766.1																																																																																				0.483	TANC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333135.1			52	99	0	0	0	0.00361	0	52	99				
PSMD14	10213	broad.mit.edu	37	2	162224311	162224311	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr2:162224311G>A	ENST00000409682.3	+	5	841	c.137G>A	c.(136-138)cGt>cAt	p.R46H		NM_005805.5	NP_005796.1	O00487	PSDE_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 14	46	MPN.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|double-strand break repair via homologous recombination (GO:0000724)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of endopeptidase activity (GO:0010950)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K63-linked deubiquitination (GO:0070536)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle, lid subcomplex (GO:0008541)	endopeptidase activator activity (GO:0061133)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|proteasome binding (GO:0070628)|ubiquitin thiolesterase activity (GO:0004221)	p.R46H(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(6)|prostate(2)	12						AAACATGGCCGTGCTGGAGTT	0.388																																							uc002ubu.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(136-138)CGT>CAT		proteasome 26S subunit, non-ATPase 14							124.0	116.0	118.0					2																	162224311		1906	4132	6038	SO:0001583	missense	10213				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K63-linked deubiquitination|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of proteasomal protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome complex	endopeptidase activator activity|metal ion binding|metallopeptidase activity|proteasome binding|ubiquitin thiolesterase activity	g.chr2:162224311G>A	U86782	CCDS46437.1	2q14.3	2008-05-22			ENSG00000115233	ENSG00000115233		"""Proteasome (prosome, macropain) subunits"""	16889	protein-coding gene	gene with protein product		607173				9374539	Standard	NM_005805		Approved	POH1, pad1, Rpn11	uc002ubu.3	O00487	OTTHUMG00000153882	ENST00000409682.3:c.137G>A	2.37:g.162224311G>A	ENSP00000386541:p.Arg46His						p.R46H	NM_005805	NP_005796	O00487	PSDE_HUMAN			5	604	+			46			MPN.		B3KNW2|O00176	Missense_Mutation	SNP	ENST00000409682.3	37	c.137G>A	CCDS46437.1	.	.	.	.	.	.	.	.	.	.	G	36	5.678389	0.96764	.	.	ENSG00000115233	ENST00000409682;ENST00000437630	T;T	0.56275	0.47;0.47	5.94	5.94	0.96194	.	0.046806	0.85682	D	0.000000	T	0.71333	0.3327	M	0.65677	2.01	0.80722	D	1	D	0.69078	0.997	D	0.62955	0.909	T	0.72207	-0.4360	10	0.87932	D	0	-1.5151	20.3593	0.98849	0.0:0.0:1.0:0.0	.	46	O00487	PSDE_HUMAN	H	46	ENSP00000386541:R46H;ENSP00000399311:R46H	ENSP00000386541:R46H	R	+	2	0	PSMD14	161932557	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.807000	0.96579	0.591000	0.81541	CGT		0.388	PSMD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332833.1	NM_005805		21	32	0	0	0	0.012319	0	21	32				
KCNH7	90134	broad.mit.edu	37	2	163693240	163693240	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr2:163693240G>T	ENST00000332142.5	-	2	213	c.114C>A	c.(112-114)aaC>aaA	p.N38K	KCNH7_ENST00000328032.4_Missense_Mutation_p.N38K	NM_033272.3	NP_150375.2	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 7	38					circadian rhythm (GO:0007623)|potassium ion transmembrane transport (GO:0071805)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)|signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)	p.N38K(2)		NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(22)|lung(53)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	108					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	TGATGGCACAGTTCTGCACTC	0.418																																					GBM(196;1492 2208 17507 24132 45496)	GBM(196;1492 2208 17507 24132 45496)	uc002uch.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|skin(2)	5						c.(112-114)AAC>AAA		potassium voltage-gated channel, subfamily H,	Ibutilide(DB00308)						71.0	63.0	66.0					2																	163693240		2203	4300	6503	SO:0001583	missense	90134				regulation of transcription, DNA-dependent	integral to membrane	protein binding|signal transducer activity	g.chr2:163693240G>T	AF032897	CCDS2219.1, CCDS2220.1	2q24.3	2012-07-05			ENSG00000184611	ENSG00000184611		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18863	protein-coding gene	gene with protein product		608169				16382104	Standard	NM_173162		Approved	Kv11.3, HERG3, erg3	uc002uch.2	Q9NS40	OTTHUMG00000132069	ENST00000332142.5:c.114C>A	2.37:g.163693240G>T	ENSP00000331727:p.Asn38Lys					KCNH7_uc002uci.2_Missense_Mutation_p.N38K	p.N38K	NM_033272	NP_150375	Q9NS40	KCNH7_HUMAN			2	326	-			38			Cytoplasmic (Potential).		Q53QU4|Q53TB7|Q53TP9|Q8IV15	Missense_Mutation	SNP	ENST00000332142.5	37	c.114C>A	CCDS2219.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.112813	0.77210	.	.	ENSG00000184611	ENST00000332142;ENST00000328032	D;D	0.99541	-6.12;-6.12	5.94	5.07	0.68467	PAS (2);	0.000000	0.85682	D	0.000000	D	0.99435	0.9800	M	0.66506	2.035	0.44061	D	0.996804	D;P	0.76494	0.999;0.791	D;P	0.87578	0.998;0.759	D	0.98686	1.0694	10	0.62326	D	0.03	.	12.161	0.54103	0.1412:0.0:0.8588:0.0	.	38;38	Q9NS40-2;Q9NS40	.;KCNH7_HUMAN	K	38	ENSP00000331727:N38K;ENSP00000333781:N38K	ENSP00000333781:N38K	N	-	3	2	KCNH7	163401486	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.468000	0.45102	1.535000	0.49220	0.561000	0.74099	AAC		0.418	KCNH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255093.1	NM_033272		24	30	1	0	4.26978e-12	0.00333	5.71337e-12	24	30				
TLK1	9874	broad.mit.edu	37	2	171867901	171867901	+	Silent	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr2:171867901G>T	ENST00000431350.2	-	14	1802	c.1398C>A	c.(1396-1398)ggC>ggA	p.G466G	TLK1_ENST00000434911.2_Silent_p.G370G|TLK1_ENST00000360843.3_Silent_p.G487G|TLK1_ENST00000521943.1_Silent_p.G418G|TLK1_ENST00000442919.2_Silent_p.G418G			Q9UKI8	TLK1_HUMAN	tousled-like kinase 1	466	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|intracellular protein transport (GO:0006886)|intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)|regulation of chromatin assembly or disassembly (GO:0001672)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.G418G(1)|p.G466G(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(8)|liver(3)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	33						CTTCACTAAAGCCACCTCTAC	0.333																																							uc002ugn.2		NA																	2	Substitution - coding silent(2)		lung(2)	central_nervous_system(1)	1						c.(1396-1398)GGC>GGA		tousled-like kinase 1 isoform 1							113.0	104.0	107.0					2																	171867901		2203	4300	6503	SO:0001819	synonymous_variant	9874				cell cycle|chromatin modification|intracellular protein transport|intracellular signal transduction|regulation of chromatin assembly or disassembly|response to DNA damage stimulus	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr2:171867901G>T	AB004885	CCDS2241.1, CCDS46447.1, CCDS46448.1	2q31.1	2010-04-19			ENSG00000198586	ENSG00000198586			11841	protein-coding gene	gene with protein product		608438				9427565, 12660173	Standard	NM_012290		Approved	KIAA0137, PKU-BETA	uc002ugp.2	Q9UKI8	OTTHUMG00000132243	ENST00000431350.2:c.1398C>A	2.37:g.171867901G>T						TLK1_uc002ugo.2_Silent_p.G487G|TLK1_uc002ugp.2_Silent_p.G418G|TLK1_uc002ugq.2_RNA|TLK1_uc010zdn.1_Silent_p.G370G	p.G466G	NM_012290	NP_036422	Q9UKI8	TLK1_HUMAN			14	1870	-			466			Protein kinase.|ATP (By similarity).		B3KR15|B4DX87|Q14150|Q8N591|Q9NYH2|Q9Y4F6	Silent	SNP	ENST00000431350.2	37	c.1398C>A	CCDS2241.1																																																																																				0.333	TLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255314.1	NM_012290		14	56	1	0	2.23348e-06	0.004007	2.61504e-06	14	56				
SLC25A12	8604	broad.mit.edu	37	2	172666787	172666787	+	Splice_Site	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr2:172666787C>A	ENST00000422440.2	-	12	1209		c.e12-1		SLC25A12_ENST00000392592.4_Splice_Site	NM_003705.4	NP_003696.2	O75746	CMC1_HUMAN	solute carrier family 25 (aspartate/glutamate carrier), member 12						aspartate transport (GO:0015810)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|L-glutamate transport (GO:0015813)|malate-aspartate shuttle (GO:0043490)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)	p.?(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(10)|upper_aerodigestive_tract(1)	23			OV - Ovarian serous cystadenocarcinoma(117;0.216)		L-Aspartic Acid(DB00128)	GGTATCAGACCTAGGTAAAGG	0.378																																							uc002uhh.2		NA																	1	Unknown(1)		lung(1)		0						c.e12-1		solute carrier family 25, member 12	L-Aspartic Acid(DB00128)						142.0	139.0	140.0					2																	172666787		2203	4300	6503	SO:0001630	splice_region_variant	8604				gluconeogenesis|malate-aspartate shuttle|response to calcium ion	integral to membrane|mitochondrial inner membrane	calcium ion binding|L-aspartate transmembrane transporter activity|L-glutamate transmembrane transporter activity|protein binding	g.chr2:172666787C>A	Y14494	CCDS33327.1	2q24	2013-05-22	2012-03-29		ENSG00000115840	ENSG00000115840		"""Solute carriers"", ""EF-hand domain containing"""	10982	protein-coding gene	gene with protein product		603667	"""solute carrier family 25 (mitochondrial carrier, Aralar), member 12"""			9722566, 10702666, 11566871	Standard	NM_003705		Approved	Aralar	uc002uhh.3	O75746	OTTHUMG00000134290	ENST00000422440.2:c.1172-1G>T	2.37:g.172666787C>A						SLC25A12_uc010fqh.2_Splice_Site_p.G284_splice	p.G391_splice	NM_003705	NP_003696	O75746	CMC1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.216)		12	1261	-								B3KR64|Q96AM8	Splice_Site	SNP	ENST00000422440.2	37	c.1172_splice	CCDS33327.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.152355	0.78001	.	.	ENSG00000115840	ENST00000422440;ENST00000392592	.	.	.	5.79	5.79	0.91817	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.0133	0.97467	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SLC25A12	172375033	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	7.593000	0.82686	2.727000	0.93392	0.655000	0.94253	.		0.378	SLC25A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259010.2	NM_003705	Intron	45	62	1	0	1.62263e-30	0.00361	2.94166e-30	45	62				
KIAA1715	80856	broad.mit.edu	37	2	176812337	176812337	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr2:176812337C>A	ENST00000272748.4	-	9	824	c.577G>T	c.(577-579)Gta>Tta	p.V193L	KIAA1715_ENST00000535310.1_Missense_Mutation_p.V118L|KIAA1715_ENST00000544803.1_Missense_Mutation_p.V193L	NM_030650.1	NP_085153.1	Q9C0E8	LNP_HUMAN	KIAA1715	193	Pro-rich.				blood coagulation (GO:0007596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|limb development (GO:0060173)|regulation of chondrocyte differentiation (GO:0032330)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)	p.V193L(1)		endometrium(1)|large_intestine(4)|lung(12)|ovary(2)|skin(1)	20			OV - Ovarian serous cystadenocarcinoma(117;0.0793)			CCAGGAGATACTGGAACTTGT	0.512																																							uc002ukc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(577-579)GTA>TTA		Lunapark							142.0	131.0	134.0					2																	176812337		2203	4300	6503	SO:0001583	missense	80856					integral to membrane	protein binding	g.chr2:176812337C>A	AB051502	CCDS33332.1	2q31	2014-06-27			ENSG00000144320	ENSG00000144320			21610	protein-coding gene	gene with protein product	"""lunapark"", ""limb and neural patterns"""	610236				11214970, 22729086	Standard	NM_030650		Approved	ulnaless, Ul, LNP1, LNP	uc002ukc.1	Q9C0E8	OTTHUMG00000154112	ENST00000272748.4:c.577G>T	2.37:g.176812337C>A	ENSP00000272748:p.Val193Leu					KIAA1715_uc010zer.1_Missense_Mutation_p.V193L|KIAA1715_uc010fqw.1_Missense_Mutation_p.V259L|KIAA1715_uc010zes.1_Missense_Mutation_p.V195L|KIAA1715_uc002ukd.1_Missense_Mutation_p.V70L|KIAA1715_uc010zet.1_RNA	p.V193L	NM_030650	NP_085153	Q9C0E8	LNP_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0793)		9	770	-			193			Cytoplasmic (Potential).|Pro-rich.		B7ZLA8|Q2M2V8|Q2YD99|Q658W8|Q8N5V9|Q96MS5	Missense_Mutation	SNP	ENST00000272748.4	37	c.577G>T	CCDS33332.1	.	.	.	.	.	.	.	.	.	.	C	10.24	1.295344	0.23564	.	.	ENSG00000144320	ENST00000272748;ENST00000536291;ENST00000409660;ENST00000544803;ENST00000535310	.	.	.	6.02	6.02	0.97574	.	0.896444	0.09903	N	0.740787	T	0.37237	0.0996	N	0.11427	0.14	0.34595	D	0.715926	P;B;P;B	0.43788	0.77;0.012;0.817;0.339	B;B;B;B	0.41088	0.347;0.008;0.275;0.055	T	0.52866	-0.8518	9	0.87932	D	0	-4.6646	16.7888	0.85582	0.1293:0.8707:0.0:0.0	.	195;193;190;193	F5H2Y7;B7ZLA8;B7ZLA9;Q9C0E8	.;.;.;LNP_HUMAN	L	193;195;70;193;118	.	ENSP00000272748:V193L	V	-	1	0	KIAA1715	176520583	0.975000	0.34042	1.000000	0.80357	0.998000	0.95712	0.809000	0.27168	2.865000	0.98341	0.655000	0.94253	GTA		0.512	KIAA1715-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333949.3	XM_042834		49	100	1	0	2.17126e-26	0.00361	3.72026e-26	49	100				
TTN	7273	broad.mit.edu	37	2	179477551	179477551	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr2:179477551C>A	ENST00000591111.1	-	215	45198	c.44974G>T	c.(44974-44976)Gaa>Taa	p.E14992*	TTN_ENST00000589042.1_Nonsense_Mutation_p.E16633*|TTN_ENST00000342992.6_Nonsense_Mutation_p.E14065*|TTN_ENST00000460472.2_Nonsense_Mutation_p.E7568*|TTN_ENST00000359218.5_Nonsense_Mutation_p.E7693*|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Nonsense_Mutation_p.E7760*|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592630.1_RNA			Q8WZ42	TITIN_HUMAN	titin	14992	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.E14065*(2)|p.E7693*(1)|p.E7568*(1)|p.E7760*(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGTTCACTTTCCCCAGCCTTA	0.502																																							uc010zfg.1		NA																	5	Substitution - Nonsense(5)		lung(5)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(42193-42195)GAA>TAA		titin isoform N2-A							40.0	38.0	38.0					2																	179477551		1934	4170	6104	SO:0001587	stop_gained	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179477551C>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.44974G>T	2.37:g.179477551C>A	ENSP00000465570:p.Glu14992*					uc002ump.1_Intron|TTN_uc010zfh.1_Nonsense_Mutation_p.E7760*|TTN_uc010zfi.1_Nonsense_Mutation_p.E7693*|TTN_uc010zfj.1_Nonsense_Mutation_p.E7568*	p.E14065*	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		214	42417	-			14992					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	ENST00000591111.1	37	c.42193G>T		.	.	.	.	.	.	.	.	.	.	C	59	37.922714	0.99984	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	.	.	.	5.71	5.71	0.89125	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.85	0.96736	0.0:1.0:0.0:0.0	.	.	.	.	X	14065;7568;7760;7693;7568	.	ENSP00000340554:E7760X	E	-	1	0	TTN	179185796	1.000000	0.71417	0.959000	0.39883	0.963000	0.63663	7.770000	0.85390	2.697000	0.92050	0.563000	0.77884	GAA		0.502	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		14	35	1	0	7.93312e-07	0.00245	9.40594e-07	14	35				
SGOL2	151246	broad.mit.edu	37	2	201438669	201438669	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr2:201438669A>T	ENST00000357799.4	+	7	3698	c.3600A>T	c.(3598-3600)aaA>aaT	p.K1200N		NM_001160033.1|NM_001160046.1|NM_152524.5	NP_001153505.1|NP_001153518.1|NP_689737.4	Q562F6	SGOL2_HUMAN	shugoshin-like 2 (S. pombe)	1200					meiotic sister chromatid cohesion, centromeric (GO:0051754)|mitotic cell cycle (GO:0000278)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic cohesin complex (GO:0030892)|nucleus (GO:0005634)		p.K1200N(1)		NS(2)|breast(2)|cervix(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	46						TGAAATTTAAAGTCAACCGGA	0.318																																							uc002uvw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)	4						c.(3598-3600)AAA>AAT		shugoshin-like 2 isoform 1							69.0	63.0	65.0					2																	201438669		1817	4076	5893	SO:0001583	missense	151246				cell division|mitotic prometaphase	condensed chromosome kinetochore|cytosol|mitotic cohesin complex	protein binding	g.chr2:201438669A>T	AY094614	CCDS42796.1	2q33.2	2008-02-05			ENSG00000163535	ENSG00000163535			30812	protein-coding gene	gene with protein product		612425					Standard	NM_001160046		Approved	TRIPIN, FLJ25211	uc002uvw.2	Q562F6	OTTHUMG00000154535	ENST00000357799.4:c.3600A>T	2.37:g.201438669A>T	ENSP00000350447:p.Lys1200Asn					SGOL2_uc010zhd.1_Missense_Mutation_p.K1200N|SGOL2_uc010zhe.1_Missense_Mutation_p.K1200N	p.K1200N	NM_152524	NP_689737	Q562F6	SGOL2_HUMAN			7	3713	+			1200					Q53RR9|Q53T20|Q86XY4|Q8IWK2|Q8IZK1|Q8N1Q5|Q96LQ3	Missense_Mutation	SNP	ENST00000357799.4	37	c.3600A>T	CCDS42796.1	.	.	.	.	.	.	.	.	.	.	A	12.62	1.991698	0.35131	.	.	ENSG00000163535	ENST00000357799	T	0.12569	2.67	5.24	-2.16	0.07080	.	1.023730	0.07784	N	0.953751	T	0.06234	0.0161	N	0.14661	0.345	0.09310	N	1	B;B;B	0.12013	0.005;0.005;0.005	B;B;B	0.10450	0.005;0.005;0.005	T	0.39742	-0.9599	10	0.39692	T	0.17	-0.2773	0.4076	0.00436	0.4022:0.1378:0.1635:0.2965	.	1200;1200;1200	B7Z7S9;Q562F6-2;Q562F6	.;.;SGOL2_HUMAN	N	1200	ENSP00000350447:K1200N	ENSP00000350447:K1200N	K	+	3	2	SGOL2	201146914	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.019000	0.13444	-0.513000	0.06496	-0.451000	0.05528	AAA		0.318	SGOL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335834.1	NM_152524		34	45	0	0	0	0.010818	0	34	45				
ABCA12	26154	broad.mit.edu	37	2	215820017	215820017	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr2:215820017G>T	ENST00000272895.7	-	43	6521	c.6302C>A	c.(6301-6303)aCt>aAt	p.T2101N	ABCA12_ENST00000389661.4_Missense_Mutation_p.T1783N|AC072062.1_ENST00000607412.1_RNA	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	2101					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)	p.T2101N(1)		NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		ACAGACGTAAGTGATGAAGGC	0.403																																					Ovarian(66;664 1488 5121 34295)	Ovarian(66;664 1488 5121 34295)	uc002vew.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11						c.(6301-6303)ACT>AAT		ATP-binding cassette, sub-family A, member 12							100.0	88.0	92.0					2																	215820017		2203	4300	6503	SO:0001583	missense	26154				cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity	g.chr2:215820017G>T	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.6302C>A	2.37:g.215820017G>T	ENSP00000272895:p.Thr2101Asn					ABCA12_uc002vev.2_Missense_Mutation_p.T1783N|ABCA12_uc010zjn.1_Missense_Mutation_p.T1028N	p.T2101N	NM_173076	NP_775099	Q86UK0	ABCAC_HUMAN		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)	43	6522	-		Renal(323;0.127)	2101					Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	37	c.6302C>A	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	G	19.56	3.850449	0.71719	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.82893	-1.66;-1.66	5.97	5.97	0.96955	.	0.153763	0.46758	D	0.000265	D	0.86871	0.6037	M	0.61703	1.905	0.80722	D	1	P;D	0.54772	0.942;0.968	P;P	0.58266	0.836;0.669	D	0.85693	0.1308	10	0.42905	T	0.14	.	11.3433	0.49546	0.1085:0.0:0.8915:0.0	.	2101;1783	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	N	2101;1783	ENSP00000272895:T2101N;ENSP00000374312:T1783N	ENSP00000272895:T2101N	T	-	2	0	ABCA12	215528262	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.166000	0.58203	2.834000	0.97654	0.650000	0.86243	ACT		0.403	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076		15	28	1	0	2.32078e-09	0.003163	2.93757e-09	15	28				
PCSK2	5126	broad.mit.edu	37	20	17462466	17462466	+	Silent	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr20:17462466C>A	ENST00000262545.2	+	12	1983	c.1668C>A	c.(1666-1668)acC>acA	p.T556T	PCSK2_ENST00000459871.1_3'UTR|PCSK2_ENST00000536609.1_Silent_p.T521T|PCSK2_ENST00000377899.1_Silent_p.T537T	NM_002594.3	NP_002585.2	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2	556					cellular protein metabolic process (GO:0044267)|embryo development (GO:0009790)|enkephalin processing (GO:0034230)|insulin processing (GO:0030070)|islet amyloid polypeptide processing (GO:0034231)|nervous system development (GO:0007399)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)	dendrite (GO:0030425)|extracellular space (GO:0005615)|membrane (GO:0016020)|perikaryon (GO:0043204)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)	p.T556T(1)		breast(2)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|lung(17)|ovary(3)|pancreas(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	53					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	CTTTCATGACCACTCACACGT	0.607																																							uc002wpm.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|central_nervous_system(2)|large_intestine(1)|pancreas(1)	7						c.(1666-1668)ACC>ACA		proprotein convertase subtilisin/kexin type 2	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)						68.0	61.0	64.0					20																	17462466		2203	4300	6503	SO:0001819	synonymous_variant	5126				enkephalin processing|insulin processing|islet amyloid polypeptide processing	extracellular space|membrane|soluble fraction|transport vesicle	serine-type endopeptidase activity	g.chr20:17462466C>A	AK312341	CCDS13125.1, CCDS56179.1, CCDS56180.1	20p11.2	2008-08-01			ENSG00000125851	ENSG00000125851			8744	protein-coding gene	gene with protein product	"""neuroendocrine convertase 2"", ""KEX2-like endoprotease 2"""	162151		NEC2		1765368	Standard	NM_001201528		Approved	PC2, SPC2	uc002wpm.3	P16519	OTTHUMG00000031941	ENST00000262545.2:c.1668C>A	20.37:g.17462466C>A						PCSK2_uc002wpl.2_Silent_p.T537T|PCSK2_uc010zrm.1_Silent_p.T521T|PCSK2_uc002wpn.2_Silent_p.T210T	p.T556T	NM_002594	NP_002585	P16519	NEC2_HUMAN			12	1988	+			556					B1ANH9|B4DFQ3|Q14927|Q5JYQ1|Q8IWA8|Q9NQG3|Q9NUG1|Q9UJC6	Silent	SNP	ENST00000262545.2	37	c.1668C>A	CCDS13125.1																																																																																				0.607	PCSK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078120.2	NM_002594		14	45	1	0	5.3912e-06	0.006122	6.15825e-06	14	45				
PREX1	57580	broad.mit.edu	37	20	47273634	47273634	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr20:47273634G>T	ENST00000371941.3	-	18	2089	c.2067C>A	c.(2065-2067)aaC>aaA	p.N689K	PREX1_ENST00000396220.1_Missense_Mutation_p.N689K	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	689	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.N689K(2)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			AGAAGGACTGGTTGAGGATGG	0.642																																							uc002xtw.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(3)|ovary(2)|pancreas(1)	6						c.(2065-2067)AAC>AAA		phosphatidylinositol-3,4,							93.0	69.0	77.0					20																	47273634		2203	4300	6503	SO:0001583	missense	57580				actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity	g.chr20:47273634G>T	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.2067C>A	20.37:g.47273634G>T	ENSP00000361009:p.Asn689Lys					PREX1_uc002xtv.1_5'Flank	p.N689K	NM_020820	NP_065871	Q8TCU6	PREX1_HUMAN	BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)		18	2090	-			689			PDZ.		E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Missense_Mutation	SNP	ENST00000371941.3	37	c.2067C>A	CCDS13410.1	.	.	.	.	.	.	.	.	.	.	G	9.330	1.060183	0.19987	.	.	ENSG00000124126	ENST00000371941;ENST00000396220	T;T	0.49139	0.79;0.79	5.12	3.14	0.36123	PDZ/DHR/GLGF (2);	0.000000	0.64402	U	0.000015	T	0.21921	0.0528	N	0.08118	0	0.54753	D	0.999985	B	0.19583	0.037	B	0.12837	0.008	T	0.14062	-1.0486	10	0.02654	T	1	.	11.8942	0.52648	0.1287:0.0:0.8713:0.0	.	689	Q8TCU6	PREX1_HUMAN	K	689	ENSP00000361009:N689K;ENSP00000379522:N689K	ENSP00000361009:N689K	N	-	3	2	PREX1	46707041	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.887000	0.39698	2.376000	0.81061	0.561000	0.74099	AAC		0.642	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	NM_020820		8	8	1	0	0.00307968	0.00308	0.00334127	8	8				
ARFGEF2	10564	broad.mit.edu	37	20	47626850	47626850	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr20:47626850G>T	ENST00000371917.4	+	27	3666	c.3666G>T	c.(3664-3666)tgG>tgT	p.W1222C		NM_006420.2	NP_006411.2	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)	1222					endomembrane system organization (GO:0010256)|endosome organization (GO:0007032)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of tumor necrosis factor production (GO:0032760)|protein transport (GO:0015031)|receptor recycling (GO:0001881)|regulation of ARF protein signal transduction (GO:0032012)|vesicle-mediated transport (GO:0016192)	asymmetric synapse (GO:0032279)|axonemal microtubule (GO:0005879)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|recycling endosome (GO:0055037)|symmetric synapse (GO:0032280)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|GABA receptor binding (GO:0050811)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase A regulatory subunit binding (GO:0034237)	p.W1222C(1)		breast(7)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	63			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			GCTCAGGTTGGAAGAACATCT	0.567																																					Esophageal Squamous(176;1738 1974 26285 33069 35354)	Esophageal Squamous(176;1738 1974 26285 33069 35354)	uc002xtx.3		NA																	1	Substitution - Missense(1)		lung(1)	breast(3)|upper_aerodigestive_tract(1)	4						c.(3664-3666)TGG>TGT		ADP-ribosylation factor guanine							139.0	108.0	118.0					20																	47626850		2203	4300	6503	SO:0001583	missense	10564				exocytosis|intracellular signal transduction|regulation of ARF protein signal transduction	cytosol|Golgi membrane	ARF guanyl-nucleotide exchange factor activity	g.chr20:47626850G>T	AF084521	CCDS13411.1	20q13.13	2010-08-20			ENSG00000124198	ENSG00000124198		"""A-kinase anchor proteins"""	15853	protein-coding gene	gene with protein product	"""Brefeldin A-inhibited guanine nucleotide-exchange protein 2"""	605371				10212200	Standard	NM_006420		Approved	BIG2	uc002xtx.4	Q9Y6D5	OTTHUMG00000032687	ENST00000371917.4:c.3666G>T	20.37:g.47626850G>T	ENSP00000360985:p.Trp1222Cys					ARFGEF2_uc010zyf.1_Missense_Mutation_p.W515C	p.W1222C	NM_006420	NP_006411	Q9Y6D5	BIG2_HUMAN	BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)		27	3818	+			1222					Q5TFT9|Q9NTS1	Missense_Mutation	SNP	ENST00000371917.4	37	c.3666G>T	CCDS13411.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.471394	0.84533	.	.	ENSG00000124198	ENST00000371917	T	0.64991	-0.13	5.18	5.18	0.71444	Domain of unknown function DUF1981, SEC7 associated (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.86814	0.6023	H	0.96604	3.85	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91213	0.5000	10	0.87932	D	0	.	19.0742	0.93154	0.0:0.0:1.0:0.0	.	1222	Q9Y6D5	BIG2_HUMAN	C	1222	ENSP00000360985:W1222C	ENSP00000360985:W1222C	W	+	3	0	ARFGEF2	47060257	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	9.813000	0.99286	2.576000	0.86940	0.655000	0.94253	TGG		0.567	ARFGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079627.1	NM_006420		37	24	1	0	9.80977e-26	0.004289	1.67063e-25	37	24				
COL9A3	1299	broad.mit.edu	37	20	61468487	61468487	+	Silent	SNP	C	C	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr20:61468487C>T	ENST00000343916.3	+	30	1659	c.1656C>T	c.(1654-1656)tcC>tcT	p.S552S	COL9A3_ENST00000462700.1_3'UTR	NM_001853.3	NP_001844.3	Q14050	CO9A3_HUMAN	collagen, type IX, alpha 3	552	Triple-helical region 2 (COL2).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female gonad development (GO:0008585)|male gonad development (GO:0008584)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)	p.S552S(1)		breast(1)|endometrium(3)|large_intestine(1)|lung(18)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	28	Breast(26;5.68e-08)					CACCCGGGTCCATTGGTCGGC	0.632																																							uc002ydm.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1654-1656)TCC>TCT		alpha 3 type IX collagen precursor							112.0	134.0	126.0					20																	61468487		2203	4300	6503	SO:0001819	synonymous_variant	1299				axon guidance	collagen type IX		g.chr20:61468487C>T	AK075240	CCDS13505.1	20q13.3	2013-01-16			ENSG00000092758	ENSG00000092758		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2219	protein-coding gene	gene with protein product	"""collagen type IX proteoglycan"""	120270				8586434, 1429648	Standard	NM_001853		Approved	IDD, MED, EDM3, FLJ90759, DJ885L7.4.1	uc002ydm.3	Q14050	OTTHUMG00000032938	ENST00000343916.3:c.1656C>T	20.37:g.61468487C>T						COL9A3_uc002ydn.2_Silent_p.S46S	p.S552S	NM_001853	NP_001844	Q14050	CO9A3_HUMAN			30	1659	+	Breast(26;5.68e-08)		552			Triple-helical region 2 (COL2).		Q13681|Q9H4G9|Q9UPE2	Silent	SNP	ENST00000343916.3	37	c.1656C>T	CCDS13505.1																																																																																				0.632	COL9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080071.2	NM_001853		36	476	0	0	0	0.005524	0	36	476				
SEZ6L	23544	broad.mit.edu	37	22	26688836	26688836	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr22:26688836G>T	ENST00000248933.6	+	2	654	c.559G>T	c.(559-561)Gac>Tac	p.D187Y	SEZ6L_ENST00000403121.1_5'UTR|SEZ6L_ENST00000404234.3_Missense_Mutation_p.D187Y|SEZ6L_ENST00000529632.2_Missense_Mutation_p.D187Y|SEZ6L_ENST00000343706.4_Missense_Mutation_p.D187Y|SEZ6L_ENST00000402979.1_5'UTR|SEZ6L_ENST00000360929.3_Missense_Mutation_p.D187Y			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	187					adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)		p.D187Y(1)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						CCTTTGGCTGGACCGAAAGGA	0.647																																							uc003acb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(1)|pancreas(1)	6						c.(559-561)GAC>TAC		seizure related 6 homolog (mouse)-like							53.0	54.0	53.0					22																	26688836		2203	4300	6503	SO:0001583	missense	23544					endoplasmic reticulum membrane|integral to membrane		g.chr22:26688836G>T	AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.559G>T	22.37:g.26688836G>T	ENSP00000248933:p.Asp187Tyr					SEZ6L_uc003acc.2_Missense_Mutation_p.D187Y|SEZ6L_uc011akc.1_Missense_Mutation_p.D187Y|SEZ6L_uc003acd.2_Missense_Mutation_p.D187Y|SEZ6L_uc011akd.1_Missense_Mutation_p.D187Y|SEZ6L_uc003ace.2_Missense_Mutation_p.D187Y|SEZ6L_uc003acf.1_5'UTR|SEZ6L_uc010gvc.1_5'UTR	p.D187Y	NM_021115	NP_066938	Q9BYH1	SE6L1_HUMAN			2	715	+			187			Extracellular (Potential).		A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Missense_Mutation	SNP	ENST00000248933.6	37	c.559G>T	CCDS13833.1	.	.	.	.	.	.	.	.	.	.	G	11.33	1.606711	0.28623	.	.	ENSG00000100095	ENST00000404234;ENST00000529632;ENST00000360929;ENST00000248933;ENST00000343706	T;T;T;T;T	0.26957	1.94;2.05;2.14;1.94;1.7	4.21	-1.01	0.10169	.	1.351900	0.05285	U	0.520072	T	0.16769	0.0403	N	0.08118	0	0.09310	N	1	P;P;P;P;P;P	0.49447	0.679;0.454;0.589;0.924;0.454;0.454	B;B;B;P;B;B	0.47941	0.204;0.094;0.192;0.562;0.094;0.094	T	0.16808	-1.0390	10	0.46703	T	0.11	.	5.354	0.16051	0.346:0.184:0.47:0.0	.	187;187;187;187;187;187	B7ZLJ8;B7ZLJ6;Q9BYH1-5;Q9BYH1-4;B0QYG3;Q9BYH1	.;.;.;.;.;SE6L1_HUMAN	Y	187	ENSP00000384772:D187Y;ENSP00000437037:D187Y;ENSP00000354185:D187Y;ENSP00000248933:D187Y;ENSP00000342661:D187Y	ENSP00000248933:D187Y	D	+	1	0	SEZ6L	25018836	0.012000	0.17670	0.004000	0.12327	0.005000	0.04900	0.458000	0.21892	-0.015000	0.14150	0.508000	0.49915	GAC		0.647	SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320359.3			27	31	1	0	4.87955e-14	0.005443	6.89022e-14	27	31				
RNF185	91445	broad.mit.edu	37	22	31583195	31583195	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr22:31583195T>A	ENST00000326132.6	+	2	274	c.115T>A	c.(115-117)Tgc>Agc	p.C39S	RNF185_ENST00000426256.2_Missense_Mutation_p.S14R|RNF185_ENST00000266252.7_Missense_Mutation_p.C39S	NM_152267.3	NP_689480.2	Q96GF1	RN185_HUMAN	ring finger protein 185	39					autophagy (GO:0006914)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.C39S(1)		NS(1)|large_intestine(1)|lung(3)|skin(1)	6						CACTTTCGAGTGCAACATCTG	0.617																																							uc003akb.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(115-117)TGC>AGC		ring finger protein 185 isoform 1							110.0	87.0	95.0					22																	31583195		2203	4300	6503	SO:0001583	missense	91445					integral to membrane	zinc ion binding	g.chr22:31583195T>A		CCDS13890.1, CCDS46689.1	22q12.2	2013-01-09			ENSG00000138942	ENSG00000138942		"""RING-type (C3HC4) zinc fingers"""	26783	protein-coding gene	gene with protein product	"""hypothetical protein FLJ38628"""					12477932	Standard	NM_152267		Approved	FLJ38628	uc003akb.3	Q96GF1	OTTHUMG00000151253	ENST00000326132.6:c.115T>A	22.37:g.31583195T>A	ENSP00000320508:p.Cys39Ser					RNF185_uc010gwh.2_RNA|RNF185_uc011alm.1_Missense_Mutation_p.S14R|RNF185_uc003akc.2_Missense_Mutation_p.S14R|RNF185_uc003ake.2_Missense_Mutation_p.C39S	p.C39S	NM_152267	NP_689480	Q96GF1	RN185_HUMAN			2	315	+			39			RING-type.		A8K5C1|A9X3T8|Q8N900	Missense_Mutation	SNP	ENST00000326132.6	37	c.115T>A	CCDS13890.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	27.3|27.3	4.819088|4.819088	0.90873|0.90873	.|.	.|.	ENSG00000138942|ENSG00000138942	ENST00000326132;ENST00000436825;ENST00000266252|ENST00000426256	D;D|.	0.99948|.	-8.66;-8.66|.	5.62|5.62	5.62|5.62	0.85841|0.85841	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.80696|0.80696	0.4672|0.4672	H|H	0.98314|0.98314	4.2|4.2	0.35463|0.35463	D|D	0.796682|0.796682	P;P|B	0.48407|0.29162	0.89;0.91|0.235	D;D|B	0.69824|0.29353	0.943;0.966|0.101	D|D	0.86855|0.86855	0.2026|0.2026	10|8	0.87932|0.87932	D|D	0|0	.|.	15.0572|15.0572	0.71925|0.71925	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	39;39|14	Q96GF1-2;Q96GF1|B4DMD6	.;RN185_HUMAN|.	S|R	39|14	ENSP00000320508:C39S;ENSP00000266252:C39S|.	ENSP00000266252:C39S|ENSP00000410916:S14R	C|S	+|+	1|3	0|2	RNF185|RNF185	29913195|29913195	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	7.698000|7.698000	0.84413|0.84413	2.153000|2.153000	0.67306|0.67306	0.529000|0.529000	0.55759|0.55759	TGC|AGT		0.617	RNF185-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321927.2	NM_152267		31	71	0	0	0	0.009535	0	31	71				
FBLN2	2199	broad.mit.edu	37	3	13678060	13678060	+	Silent	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr3:13678060C>A	ENST00000295760.7	+	16	3258	c.3189C>A	c.(3187-3189)gtC>gtA	p.V1063V	FBLN2_ENST00000404922.3_Silent_p.V1110V|FBLN2_ENST00000535798.1_Silent_p.V1089V|FBLN2_ENST00000492059.1_Silent_p.V1110V	NM_001998.2	NP_001989.2	P98095	FBLN2_HUMAN	fibulin 2	1063	EGF-like 10; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)	p.V1110V(1)|p.V529V(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(3)|prostate(3)|urinary_tract(1)	24			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			ATGTCCAAGTCTCCAAAACGT	0.597																																							uc011avb.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(3187-3189)GTC>GTA		fibulin 2 isoform b precursor							61.0	67.0	65.0					3																	13678060		2169	4270	6439	SO:0001819	synonymous_variant	2199					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent	g.chr3:13678060C>A	X82494	CCDS46761.1, CCDS46762.1	3p25-p24	2010-06-15			ENSG00000163520	ENSG00000163520		"""Fibulins"""	3601	protein-coding gene	gene with protein product		135821				7806230	Standard	NM_001165035		Approved		uc011ava.2	P98095	OTTHUMG00000155437	ENST00000295760.7:c.3189C>A	3.37:g.13678060C>A						FBLN2_uc011auz.1_Silent_p.V1089V|FBLN2_uc011ava.1_Silent_p.V1110V|FBLN2_uc011avc.1_Silent_p.V1110V	p.V1063V	NM_001998	NP_001989	P98095	FBLN2_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)		16	3314	+			1063			EGF-like 10; calcium-binding.		B7Z9C5|Q8IUI0|Q8IUI1	Silent	SNP	ENST00000295760.7	37	c.3189C>A	CCDS46762.1	.	.	.	.	.	.	.	.	.	.	C	2.590	-0.295500	0.05532	.	.	ENSG00000163520	ENST00000295761;ENST00000421373	.	.	.	4.98	3.04	0.35103	.	.	.	.	.	T	0.54447	0.1859	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45338	-0.9268	4	.	.	.	.	5.9081	0.19012	0.0:0.4075:0.3965:0.1961	.	.	.	.	Y	82;39	.	.	S	+	2	0	FBLN2	13653061	0.936000	0.31750	0.893000	0.35052	0.260000	0.26232	-0.029000	0.12329	0.429000	0.26202	0.561000	0.74099	TCT		0.597	FBLN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000340083.3	NM_001004019		10	6	1	0	7.48243e-07	0.006214	8.90916e-07	10	6				
NBEAL2	23218	broad.mit.edu	37	3	47043987	47043987	+	Missense_Mutation	SNP	G	G	T	rs538047537		TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr3:47043987G>T	ENST00000450053.3	+	32	5457	c.5278G>T	c.(5278-5280)Gcc>Tcc	p.A1760S	NBEAL2_ENST00000383740.2_Missense_Mutation_p.A39S|NBEAL2_ENST00000292309.5_Missense_Mutation_p.A1576S	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	1760					blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)		p.A1760S(1)|p.A1137S(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		GTGGGAGCGCGCCCAGAGTCG	0.577													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17252	0.0		0.0	False		,,,				2504	0.0						uc003cqp.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(5278-5280)GCC>TCC		neurobeachin-like 2							32.0	34.0	33.0					3																	47043987		2054	4182	6236	SO:0001583	missense	23218						binding	g.chr3:47043987G>T	AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.5278G>T	3.37:g.47043987G>T	ENSP00000415034:p.Ala1760Ser					NBEAL2_uc010hjm.1_Missense_Mutation_p.A1137S|NBEAL2_uc010hjn.1_Missense_Mutation_p.A156S|NBEAL2_uc010hjo.1_5'Flank	p.A1760S	NM_015175	NP_055990	Q6ZNJ1	NBEL2_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)	32	5457	+		Acute lymphoblastic leukemia(5;0.0534)	1760					O60288|Q6P994|Q6UX91|Q8NAC9	Missense_Mutation	SNP	ENST00000450053.3	37	c.5278G>T	CCDS46817.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	6.271|6.271	0.418194|0.418194	0.11870|0.11870	.|.	.|.	ENSG00000160796|ENSG00000160796	ENST00000292309;ENST00000383740;ENST00000450053|ENST00000443829	T;T;T|T	0.56275|0.41400	0.47;1.05;0.49|1.0	5.03|5.03	-4.72|-4.72	0.03269|0.03269	.|.	1.153370|.	0.06234|.	N|.	0.689117|.	T|T	0.23806|0.23806	0.0576|0.0576	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	1|1	B;B|.	0.09022|.	0.001;0.002|.	B;B|.	0.08055|.	0.003;0.002|.	T|T	0.32508|0.32508	-0.9904|-0.9904	10|7	0.13470|0.38643	T|T	0.59|0.18	.|.	7.9735|7.9735	0.30140|0.30140	0.5272:0.0:0.3693:0.1035|0.5272:0.0:0.3693:0.1035	.|.	1576;1760|.	Q6ZNJ1-2;Q6ZNJ1|.	.;NBEL2_HUMAN|.	S|L	1576;39;1760|128	ENSP00000292309:A1576S;ENSP00000373246:A39S;ENSP00000415034:A1760S|ENSP00000414560:R128L	ENSP00000292309:A1576S|ENSP00000414560:R128L	A|R	+|+	1|2	0|0	NBEAL2|NBEAL2	47018991|47018991	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.098000|0.098000	0.18820|0.18820	0.206000|0.206000	0.17375|0.17375	-0.827000|-0.827000	0.04278|0.04278	0.650000|0.650000	0.86243|0.86243	GCC|CGC		0.577	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344363.3	XM_291064		24	14	1	0	3.5997e-14	0.002299	5.18726e-14	24	14				
COL7A1	1294	broad.mit.edu	37	3	48610962	48610962	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr3:48610962C>A	ENST00000328333.8	-	82	6709	c.6602G>T	c.(6601-6603)gGa>gTa	p.G2201V	COL7A1_ENST00000454817.1_Missense_Mutation_p.G2169V	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	2201	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.G2201V(1)		NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GCCAGAAGGTCCTTGGGGTCC	0.587																																							uc003ctz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|breast(3)|skin(3)|central_nervous_system(1)	11						c.(6601-6603)GGA>GTA		alpha 1 type VII collagen precursor							95.0	94.0	94.0					3																	48610962		2203	4300	6503	SO:0001583	missense	1294				cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity	g.chr3:48610962C>A	L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.6602G>T	3.37:g.48610962C>A	ENSP00000332371:p.Gly2201Val						p.G2201V	NM_000094	NP_000085	Q02388	CO7A1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)	82	6603	-			2201			Triple-helical region.		Q14054|Q16507	Missense_Mutation	SNP	ENST00000328333.8	37	c.6602G>T	CCDS2773.1	.	.	.	.	.	.	.	.	.	.	C	14.26	2.481963	0.44147	.	.	ENSG00000114270	ENST00000328333;ENST00000454817	D;D	0.99637	-6.29;-6.29	5.1	5.1	0.69264	.	0.000000	0.42964	D	0.000630	D	0.99825	0.9922	H	0.99011	4.4	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96773	0.9570	10	0.62326	D	0.03	.	16.6582	0.85234	0.0:1.0:0.0:0.0	.	2201	Q02388	CO7A1_HUMAN	V	2201;2169	ENSP00000332371:G2201V;ENSP00000412569:G2169V	ENSP00000332371:G2201V	G	-	2	0	COL7A1	48585966	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.421000	0.59848	2.518000	0.84900	0.655000	0.94253	GGA		0.587	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257519.1	NM_000094		33	19	1	0	3.76114e-14	0.004289	5.36487e-14	33	19				
TLR9	54106	broad.mit.edu	37	3	52255676	52255676	+	Missense_Mutation	SNP	A	A	C			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr3:52255676A>C	ENST00000360658.2	-	2	3289	c.2656T>G	c.(2656-2658)Tgg>Ggg	p.W886G	TLR9_ENST00000494383.1_Missense_Mutation_p.L1039R|TLR9_ENST00000597542.1_Missense_Mutation_p.W910G	NM_017442.3	NP_059138.1	Q9NR96	TLR9_HUMAN	toll-like receptor 9	886	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|maintenance of gastrointestinal epithelium (GO:0030277)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to molecule of bacterial origin (GO:0002237)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)	p.W886G(1)		endometrium(4)|large_intestine(11)|lung(9)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(193;2.41e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Chloroquine(DB00608)|Hydroxychloroquine(DB01611)	TTGTACACCCAGTCTGCCACT	0.657																																							uc003dda.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)|skin(2)	4						c.(2656-2658)TGG>GGG		toll-like receptor 9 isoform A precursor	Chloroquine(DB00608)						78.0	80.0	80.0					3																	52255676		2203	4300	6503	SO:0001583	missense	54106				defense response to bacterium|fibroblast growth factor receptor signaling pathway|I-kappaB phosphorylation|inflammatory response|innate immune response|insulin receptor signaling pathway|maintenance of gastrointestinal epithelium|negative regulation of interleukin-6 production|negative regulation of interleukin-8 production|negative regulation of NF-kappaB transcription factor activity|negative regulation of toll-like receptor signaling pathway|positive regulation of chemokine production|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-beta production|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-10 production|positive regulation of interleukin-12 production|positive regulation of interleukin-18 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of toll-like receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|response to molecule of bacterial origin	apical plasma membrane|basolateral plasma membrane|early phagosome|endoplasmic reticulum membrane|endosome membrane|extracellular region|integral to membrane|lysosome	interleukin-1 receptor binding|siRNA binding|transmembrane receptor activity	g.chr3:52255676A>C	AF259262	CCDS2848.1	3p21.3	2006-02-23			ENSG00000239732	ENSG00000239732		"""CD molecules"""	15633	protein-coding gene	gene with protein product		605474				11022119	Standard	NM_017442		Approved	CD289	uc003ddb.3	Q9NR96	OTTHUMG00000158106	ENST00000360658.2:c.2656T>G	3.37:g.52255676A>C	ENSP00000353874:p.Trp886Gly					TLR9_uc003ddb.2_Missense_Mutation_p.W983G	p.W886G	NM_017442	NP_059138	Q9NR96	TLR9_HUMAN		BRCA - Breast invasive adenocarcinoma(193;2.41e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	2	3290	-			886			TIR.|Cytoplasmic (Potential).		B3Y661|D1CS56|Q6UVZ2|Q9HD68|Q9HD69|Q9HD70|Q9NYC2|Q9NYC3	Missense_Mutation	SNP	ENST00000360658.2	37	c.2656T>G	CCDS2848.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.86|18.86	3.714399|3.714399	0.68730|0.68730	.|.	.|.	ENSG00000173366|ENSG00000239732	ENST00000494383|ENST00000360658	.|T	.|0.02812	.|4.15	5.1|5.1	5.1|5.1	0.69264|0.69264	.|Toll/interleukin-1 receptor homology (TIR) domain (3);	.|0.000000	.|0.35262	.|N	.|0.003331	T|T	0.19644|0.19644	0.0472|0.0472	M|M	0.91872|0.91872	3.25|3.25	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.91635	.|0.999;0.999	T|T	0.01528|0.01528	-1.1332|-1.1332	5|10	.|0.87932	.|D	.|0	.|.	12.8248|12.8248	0.57714|0.57714	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|983;886	.|B4E0A1;Q9NR96	.|.;TLR9_HUMAN	R|G	1039|886	.|ENSP00000353874:W886G	.|ENSP00000353874:W886G	L|W	-|-	2|1	0|0	RP11-330H6.5|TLR9	52230716|52230716	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.802000|0.802000	0.45316|0.45316	7.120000|7.120000	0.77153|0.77153	1.917000|1.917000	0.55516|0.55516	0.533000|0.533000	0.62120|0.62120	CTG|TGG		0.657	TLR9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000350203.1			64	128	0	0	0	0.00361	0	64	128				
PROS1	5627	broad.mit.edu	37	3	93619674	93619674	+	Missense_Mutation	SNP	T	T	C	rs387906675		TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr3:93619674T>C	ENST00000394236.3	-	7	1017	c.701A>G	c.(700-702)tAt>tGt	p.Y234C	PROS1_ENST00000407433.1_Missense_Mutation_p.Y103C	NM_000313.3	NP_000304.2	P07225	PROS_HUMAN	protein S (alpha)	234	EGF-like 3; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.		Y -> C (in THPH6). {ECO:0000269|PubMed:20484936}.		blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|negative regulation of endopeptidase activity (GO:0010951)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|endopeptidase inhibitor activity (GO:0004866)	p.Y234C(1)		endometrium(3)|kidney(5)|large_intestine(8)|lung(26)|ovary(1)|skin(2)|urinary_tract(1)	46					Drotrecogin alfa(DB00055)|Menadione(DB00170)|Sodium Tetradecyl Sulfate(DB00464)	TTTGAGATTATATCTGTAGCC	0.433																																							uc003drb.3		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(700-702)TAT>TGT		protein S, alpha preproprotein	Antihemophilic Factor(DB00025)|Drotrecogin alfa(DB00055)|Menadione(DB00170)						125.0	111.0	116.0					3																	93619674		2203	4300	6503	SO:0001583	missense	5627				leukocyte migration|peptidyl-glutamic acid carboxylation|platelet activation|platelet degranulation|post-translational protein modification|proteolysis	endoplasmic reticulum membrane|extracellular region|Golgi lumen|Golgi membrane|platelet alpha granule lumen	calcium ion binding|endopeptidase inhibitor activity	g.chr3:93619674T>C		CCDS2923.1	3q11.1	2013-06-03			ENSG00000184500	ENSG00000184500			9456	protein-coding gene	gene with protein product		176880		PROS		214811, 1833851	Standard	NM_000313		Approved		uc003drb.4	P07225	OTTHUMG00000150354	ENST00000394236.3:c.701A>G	3.37:g.93619674T>C	ENSP00000377783:p.Tyr234Cys					PROS1_uc010hoo.2_Missense_Mutation_p.Y103C|PROS1_uc003dqz.3_Missense_Mutation_p.Y103C	p.Y234C	NM_000313	NP_000304	P07225	PROS_HUMAN			7	1042	-			234			EGF-like 3; calcium-binding (Potential).		A8KAC9|D3DN28|Q15518|Q7Z715|Q9UCZ8	Missense_Mutation	SNP	ENST00000394236.3	37	c.701A>G	CCDS2923.1	.	.	.	.	.	.	.	.	.	.	T	15.24	2.774015	0.49786	.	.	ENSG00000184500	ENST00000394236;ENST00000407433	D;D	0.91996	-2.95;-2.95	4.08	2.88	0.33553	EGF-like region, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.134011	0.52532	D	0.000074	D	0.95573	0.8561	M	0.86651	2.83	0.40241	D	0.977958	D	0.89917	1.0	D	0.70487	0.969	D	0.95141	0.8264	10	0.87932	D	0	.	9.916	0.41434	0.1529:0.0:0.0:0.8471	.	234	P07225	PROS_HUMAN	C	234;103	ENSP00000377783:Y234C;ENSP00000385794:Y103C	ENSP00000377783:Y234C	Y	-	2	0	PROS1	95102364	0.993000	0.37304	0.580000	0.28601	0.789000	0.44602	2.700000	0.47085	0.686000	0.31488	0.482000	0.46254	TAT		0.433	PROS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317762.1	NM_000313		21	37	0	0	0	0.003954	0	21	37				
LSAMP	4045	broad.mit.edu	37	3	116163754	116163754	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr3:116163754G>A	ENST00000490035.2	-	1	624	c.125C>T	c.(124-126)aCc>aTc	p.T42I	LSAMP_ENST00000539563.1_Missense_Mutation_p.T39I	NM_002338.3	NP_002329.2	Q13449	LSAMP_HUMAN	limbic system-associated membrane protein	42	Ig-like C2-type 1.				cell adhesion (GO:0007155)|locomotory exploration behavior (GO:0035641)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.T42I(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|kidney(1)|large_intestine(4)|lung(14)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	31		all_cancers(1;0.00189)|all_epithelial(1;0.0366)|Myeloproliferative disorder(1037;0.17)|all_neural(597;0.208)|Lung NSC(201;0.215)		GBM - Glioblastoma multiforme(114;0.00117)|LUSC - Lung squamous cell carcinoma(41;0.0407)|Lung(219;0.152)		CTGCCTCACGGTGATGTTGTC	0.562																																							uc003ebt.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(124-126)ACC>ATC		limbic system-associated membrane protein							111.0	93.0	99.0					3																	116163754		2203	4300	6503	SO:0001583	missense	4045				cell adhesion|nervous system development	anchored to membrane|plasma membrane		g.chr3:116163754G>A	U41901	CCDS2982.1	3q13.2-q21	2013-01-11			ENSG00000185565	ENSG00000185565		"""Immunoglobulin superfamily / I-set domain containing"""	6705	protein-coding gene	gene with protein product	"""IgLON family member 3"""	603241				9615236	Standard	NM_002338		Approved	LAMP, IGLON3	uc003ebs.3	Q13449	OTTHUMG00000159308	ENST00000490035.2:c.125C>T	3.37:g.116163754G>A	ENSP00000419000:p.Thr42Ile					LSAMP_uc011bis.1_Missense_Mutation_p.T42I|LSAMP_uc010hqq.1_RNA	p.T42I	NM_002338	NP_002329	Q13449	LSAMP_HUMAN		GBM - Glioblastoma multiforme(114;0.00117)|LUSC - Lung squamous cell carcinoma(41;0.0407)|Lung(219;0.152)	1	625	-		all_cancers(1;0.00189)|all_epithelial(1;0.0366)|Myeloproliferative disorder(1037;0.17)|all_neural(597;0.208)|Lung NSC(201;0.215)	42			Ig-like C2-type 1.		Q8IV49	Missense_Mutation	SNP	ENST00000490035.2	37	c.125C>T	CCDS2982.1	.	.	.	.	.	.	.	.	.	.	G	17.49	3.402757	0.62288	.	.	ENSG00000185565	ENST00000333617;ENST00000490035;ENST00000539563;ENST00000474851	T;T;T;T	0.68331	-0.32;-0.32;-0.32;-0.32	4.47	4.47	0.54385	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.148969	0.44902	D	0.000412	T	0.78362	0.4271	M	0.85542	2.76	0.44380	D	0.997287	B;P	0.49185	0.047;0.92	B;P	0.51355	0.041;0.667	D	0.83494	0.0071	10	0.72032	D	0.01	-9.4506	16.3688	0.83346	0.0:0.0:1.0:0.0	.	42;42	B2RCU8;Q13449	.;LSAMP_HUMAN	I	26;42;39;76	ENSP00000328455:T26I;ENSP00000419000:T42I;ENSP00000443429:T39I;ENSP00000418506:T76I	ENSP00000328455:T26I	T	-	2	0	LSAMP	117646444	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.954000	0.93051	2.328000	0.79073	0.650000	0.86243	ACC		0.562	LSAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354495.4	NM_002338		4	16	0	0	0	0.009096	0	4	16				
GMPS	8833	broad.mit.edu	37	3	155649570	155649570	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr3:155649570A>G	ENST00000496455.2	+	13	1912	c.1577A>G	c.(1576-1578)tAc>tGc	p.Y526C	GMPS_ENST00000295920.7_Missense_Mutation_p.Y427C	NM_003875.2	NP_003866.1	P49915	GUAA_HUMAN	guanine monphosphate synthase	526					glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|GMP synthase (glutamine-hydrolyzing) activity (GO:0003922)|GMP synthase activity (GO:0003921)|pyrophosphatase activity (GO:0016462)	p.Y526C(1)		breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(12)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)		L-Glutamine(DB00130)	TGTCGTTCCTACAGTTACGTG	0.343			T	MLL	AML																																Ovarian(153;896 1876 4149 15499 28134)	Ovarian(153;896 1876 4149 15499 28134)	uc003faq.2		NA		Dom	yes		3	3q24	8833	T	guanine monphosphate synthetase			L	MLL		AML		1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(1)	3						c.(1576-1578)TAC>TGC		guanine monophosphate synthetase	L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)						160.0	145.0	150.0					3																	155649570		1836	4082	5918	SO:0001583	missense	8833				glutamine metabolic process|purine base biosynthetic process	cytosol	ATP binding|GMP synthase (glutamine-hydrolyzing) activity|GMP synthase activity	g.chr3:155649570A>G	U10860	CCDS46941.1	3q25.31	2013-06-18	2013-06-18		ENSG00000163655	ENSG00000163655	6.3.5.2		4378	protein-coding gene	gene with protein product	"""GMP synthase"""	600358	"""guanine monphosphate synthetase"""			8089153, 9195163	Standard	NM_003875		Approved		uc003faq.3	P49915	OTTHUMG00000158551	ENST00000496455.2:c.1577A>G	3.37:g.155649570A>G	ENSP00000419851:p.Tyr526Cys					GMPS_uc011bom.1_Missense_Mutation_p.Y427C	p.Y526C	NM_003875	NP_003866	P49915	GUAA_HUMAN	Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)		13	1912	+			526					A8K639|B4DXV7|F8W720	Missense_Mutation	SNP	ENST00000496455.2	37	c.1577A>G	CCDS46941.1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.274336	0.80580	.	.	ENSG00000163655	ENST00000496455;ENST00000295920;ENST00000537975;ENST00000541628	.	.	.	5.55	5.55	0.83447	GMP synthase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.85500	0.5711	M	0.92923	3.36	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.89000	0.3421	9	0.87932	D	0	-11.5885	14.2701	0.66147	1.0:0.0:0.0:0.0	.	427;526	F8W720;P49915	.;GUAA_HUMAN	C	526;427;475;526	.	ENSP00000295920:Y427C	Y	+	2	0	GMPS	157132264	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.044000	0.93805	2.097000	0.63578	0.533000	0.62120	TAC		0.343	GMPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351260.2			64	116	0	0	0	0.00361	0	64	116				
GABRA2	2555	broad.mit.edu	37	4	46307719	46307719	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr4:46307719G>T	ENST00000510861.1	-	7	742	c.569C>A	c.(568-570)aCa>aAa	p.T190K	GABRA2_ENST00000515082.1_Missense_Mutation_p.T190K|GABRA2_ENST00000356504.1_Missense_Mutation_p.T190K|GABRA2_ENST00000540012.1_Missense_Mutation_p.T135K|GABRA2_ENST00000381620.4_Missense_Mutation_p.T190K|GABRA2_ENST00000514090.1_Missense_Mutation_p.T190K|GABRA2_ENST00000507069.1_Missense_Mutation_p.T190K			P47869	GBRA2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 2	190					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|neurotransmitter transport (GO:0006836)|regulation of neurotransmitter levels (GO:0001505)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of synaptic vesicle membrane (GO:0030285)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.T190K(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	56					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zolpidem(DB00425)|Zopiclone(DB01198)	CTCTGAAGTTGTATATGCATC	0.363																																							uc003gxc.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)	4						c.(568-570)ACA>AAA		gamma-aminobutyric acid A receptor, alpha 2	Alprazolam(DB00404)|Bromazepam(DB01558)|Diazepam(DB00829)|Ethchlorvynol(DB00189)|Fludiazepam(DB01567)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)						84.0	84.0	84.0					4																	46307719		2203	4300	6503	SO:0001583	missense	2555				gamma-aminobutyric acid signaling pathway|neurotransmitter transport|regulation of neurotransmitter levels	cell junction|chloride channel complex|integral to synaptic vesicle membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity	g.chr4:46307719G>T		CCDS3471.1	4p12	2012-06-22			ENSG00000151834	ENSG00000151834		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4076	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 2"""	137140					Standard	NM_000807		Approved		uc010igc.2	P47869	OTTHUMG00000044266	ENST00000510861.1:c.569C>A	4.37:g.46307719G>T	ENSP00000421828:p.Thr190Lys					GABRA2_uc010igc.2_Missense_Mutation_p.T190K|GABRA2_uc011bzc.1_Missense_Mutation_p.T135K|GABRA2_uc003gxe.2_Missense_Mutation_p.T190K	p.T190K	NM_001114175	NP_001107647	P47869	GBRA2_HUMAN			6	1242	-			190			Extracellular (Probable).		A8K0U7|B7Z1H8|Q59G14	Missense_Mutation	SNP	ENST00000510861.1	37	c.569C>A	CCDS3471.1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.890329	0.91889	.	.	ENSG00000151834	ENST00000510861;ENST00000514090;ENST00000381620;ENST00000356504;ENST00000540012;ENST00000507069;ENST00000515082	T;T;T;T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19;-1.19;-1.19;-1.19	5.76	5.76	0.90799	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.91074	0.7191	M	0.92169	3.28	0.58432	D	0.999999	D;D;D	0.71674	0.998;0.975;0.963	D;P;P	0.72625	0.978;0.848;0.88	D	0.92407	0.5934	10	0.66056	D	0.02	.	18.9453	0.92620	0.0:0.0:1.0:0.0	.	135;190;190	B7Z1H8;G5E9Z6;P47869	.;.;GBRA2_HUMAN	K	190;190;190;190;135;190;190	ENSP00000421828:T190K;ENSP00000421300:T190K;ENSP00000371033:T190K;ENSP00000348897:T190K;ENSP00000444409:T135K;ENSP00000427603:T190K;ENSP00000423840:T190K	ENSP00000348897:T190K	T	-	2	0	GABRA2	46002476	1.000000	0.71417	0.998000	0.56505	0.633000	0.38033	9.869000	0.99810	2.721000	0.93114	0.655000	0.94253	ACA		0.363	GABRA2-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360848.2			22	21	1	0	8.10497e-08	0.010504	9.9454e-08	22	21				
GNRHR	2798	broad.mit.edu	37	4	68619639	68619639	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr4:68619639G>T	ENST00000226413.4	-	1	439	c.415C>A	c.(415-417)Cgc>Agc	p.R139S	UBA6-AS1_ENST00000502758.1_RNA|UBA6-AS1_ENST00000500538.2_RNA|GNRHR_ENST00000420975.2_Missense_Mutation_p.R139S	NM_000406.2	NP_000397.1	P30968	GNRHR_HUMAN	gonadotropin-releasing hormone receptor	139			R -> H (in HH7; completely eliminates detectable GnRH-binding activity and prevents GnRH-induced stimulation of inositol phosphate accumulation in vitro). {ECO:0000269|PubMed:11397871}.		cellular response to gonadotropin-releasing hormone (GO:0097211)|G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	gonadotropin-releasing hormone receptor activity (GO:0004968)	p.R139S(1)		endometrium(2)|large_intestine(4)|liver(1)|lung(4)|ovary(1)|urinary_tract(1)	13					Abarelix(DB00106)|Buserelin(DB06719)|Cetrorelix(DB00050)|Danazol(DB01406)|Degarelix(DB06699)|Gonadorelin(DB00644)|Goserelin(DB00014)|Leuprolide(DB00007)|Nafarelin(DB00666)	GCCAGGGAGCGGTCCAGGCTG	0.517																																							uc003hdn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1	GRCh37	CM066865	GNRHR	M		c.(415-417)CGC>AGC		gonadotropin-releasing hormone receptor isoform	Abarelix(DB00106)|Cetrorelix(DB00050)|Danazol(DB01406)|Gonadorelin(DB00644)|Leuprolide(DB00007)|Nafarelin(DB00666)						75.0	74.0	74.0					4																	68619639		2203	4300	6503	SO:0001583	missense	2798				multicellular organismal development	integral to plasma membrane	gonadotropin-releasing hormone receptor activity	g.chr4:68619639G>T		CCDS3517.1, CCDS47064.1	4q21.2	2012-08-08			ENSG00000109163	ENSG00000109163		"""GPCR / Class A : Gonadotropin-releasing hormone receptors"""	4421	protein-coding gene	gene with protein product		138850		GRHR		8386108	Standard	NM_000406		Approved	LHRHR	uc003hdn.3	P30968	OTTHUMG00000129302	ENST00000226413.4:c.415C>A	4.37:g.68619639G>T	ENSP00000226413:p.Arg139Ser					LOC550112_uc003hdl.3_Intron|GNRHR_uc003hdm.2_Missense_Mutation_p.R139S	p.R139S	NM_000406	NP_000397	P30968	GNRHR_HUMAN			1	2166	-			139		R -> H (in IHH; completely eliminates detectable GnRH-binding activity and prevents GnRH-induced stimulation of inositol phosphate accumulation in vitro).	Cytoplasmic (Potential).		O75793|Q14D13|Q92644	Missense_Mutation	SNP	ENST00000226413.4	37	c.415C>A	CCDS3517.1	.	.	.	.	.	.	.	.	.	.	G	18.30	3.594427	0.66219	.	.	ENSG00000109163	ENST00000226413;ENST00000420975	D;D	0.97161	-4.27;-4.27	6.17	5.26	0.73747	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000007	D	0.98673	0.9555	M	0.92784	3.345	0.47245	D	0.999362	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.996	D	0.98781	1.0732	10	0.87932	D	0	-18.7797	13.5464	0.61707	0.0:0.0:0.7798:0.2202	.	139;139	P30968;P30968-2	GNRHR_HUMAN;.	S	139	ENSP00000226413:R139S;ENSP00000397561:R139S	ENSP00000226413:R139S	R	-	1	0	GNRHR	68302234	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	3.238000	0.51352	2.941000	0.99782	0.655000	0.94253	CGC		0.517	GNRHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251432.2			17	29	1	0	3.52763e-06	0.00499	4.06256e-06	17	29				
SULT1B1	27284	broad.mit.edu	37	4	70596333	70596333	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr4:70596333C>T	ENST00000310613.3	-	7	961	c.664G>A	c.(664-666)Gat>Aat	p.D222N		NM_014465.3	NP_055280.2	O43704	ST1B1_HUMAN	sulfotransferase family, cytosolic, 1B, member 1	222					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|cellular biogenic amine metabolic process (GO:0006576)|epithelial cell differentiation (GO:0030855)|flavonoid metabolic process (GO:0009812)|phenol-containing compound metabolic process (GO:0018958)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sulfation (GO:0051923)|thyroid hormone metabolic process (GO:0042403)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	aryl sulfotransferase activity (GO:0004062)|sulfotransferase activity (GO:0008146)	p.D222N(1)		breast(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(14)|prostate(1)|upper_aerodigestive_tract(1)	24						ATGATCCTATCCAAGATCTCA	0.373																																							uc003hen.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(664-666)GAT>AAT		sulfotransferase family, cytosolic, 1B, member							164.0	150.0	155.0					4																	70596333		2203	4300	6503	SO:0001583	missense	27284				3'-phosphoadenosine 5'-phosphosulfate metabolic process|cellular biogenic amine metabolic process|flavonoid metabolic process|steroid metabolic process|sulfation|thyroid hormone metabolic process|xenobiotic metabolic process	cytosol		g.chr4:70596333C>T	D89479	CCDS3530.1	4q13.3	2008-02-05			ENSG00000173597	ENSG00000173597		"""Sulfotransferases, cytosolic"""	17845	protein-coding gene	gene with protein product		608436				11688987, 9443824	Standard	NM_014465		Approved	ST1B2	uc003hen.3	O43704	OTTHUMG00000129407	ENST00000310613.3:c.664G>A	4.37:g.70596333C>T	ENSP00000308770:p.Asp222Asn						p.D222N	NM_014465	NP_055280	O43704	ST1B1_HUMAN			7	962	-			222			PAPS (By similarity).		O15497|Q96FI1|Q9UK34	Missense_Mutation	SNP	ENST00000310613.3	37	c.664G>A	CCDS3530.1	.	.	.	.	.	.	.	.	.	.	C	11.56	1.674623	0.29693	.	.	ENSG00000173597	ENST00000310613	T	0.01871	4.59	4.09	2.34	0.29019	Sulfotransferase domain (1);	0.434509	0.19149	N	0.121491	T	0.02156	0.0067	L	0.34521	1.04	0.41583	D	0.988759	B	0.12013	0.005	B	0.17433	0.018	T	0.52975	-0.8503	10	0.31617	T	0.26	.	8.2366	0.31629	0.0:0.7963:0.0:0.2037	.	222	O43704	ST1B1_HUMAN	N	222	ENSP00000308770:D222N	ENSP00000308770:D222N	D	-	1	0	SULT1B1	70630922	0.062000	0.20869	0.017000	0.16124	0.962000	0.63368	0.535000	0.23114	0.324000	0.23333	0.467000	0.42956	GAT		0.373	SULT1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251563.2	NM_014465		19	20	0	0	0	0.008871	0	19	20				
PPEF2	5470	broad.mit.edu	37	4	76781857	76781857	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr4:76781857G>A	ENST00000286719.7	-	17	2581	c.2225C>T	c.(2224-2226)gCt>gTt	p.A742V		NM_006239.2	NP_006230.2	O14830	PPE2_HUMAN	protein phosphatase, EF-hand calcium binding domain 2	742					detection of stimulus involved in sensory perception (GO:0050906)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|protein dephosphorylation (GO:0006470)|regulation of JUN kinase activity (GO:0043506)|regulation of MAP kinase activity (GO:0043405)|visual perception (GO:0007601)	cilium (GO:0005929)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|Hsp70 protein binding (GO:0030544)|Hsp90 protein binding (GO:0051879)|iron ion binding (GO:0005506)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein serine/threonine phosphatase activity (GO:0004722)	p.A742V(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	50			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			ACTGTCTTTAGCATTTGTAGC	0.517																																					NSCLC(105;1359 1603 15961 44567 47947)	NSCLC(105;1359 1603 15961 44567 47947)	uc003hix.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(1)|central_nervous_system(1)	4						c.(2224-2226)GCT>GTT		serine/threonine protein phosphatase with							71.0	63.0	66.0					4																	76781857		2203	4300	6503	SO:0001583	missense	5470				detection of stimulus involved in sensory perception|negative regulation of MAPKKK cascade|negative regulation of peptidyl-threonine phosphorylation|protein dephosphorylation|visual perception	cytoplasm|photoreceptor inner segment|photoreceptor outer segment	calcium ion binding|Hsp70 protein binding|Hsp90 protein binding|iron ion binding|manganese ion binding|mitogen-activated protein kinase kinase kinase binding|protein serine/threonine phosphatase activity	g.chr4:76781857G>A	AF023456	CCDS34013.1	4q21.1	2013-01-10			ENSG00000156194	ENSG00000156194		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9244	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, beta isozyme"""	602256				9326663, 12051765	Standard	NM_006239		Approved	PPP7CB	uc003hix.3	O14830	OTTHUMG00000160915	ENST00000286719.7:c.2225C>T	4.37:g.76781857G>A	ENSP00000286719:p.Ala742Val					PPEF2_uc003hiy.2_RNA	p.A742V	NM_006239	NP_006230	O14830	PPE2_HUMAN	Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)		17	2582	-			742					O14831	Missense_Mutation	SNP	ENST00000286719.7	37	c.2225C>T	CCDS34013.1	.	.	.	.	.	.	.	.	.	.	G	12.39	1.924296	0.34002	.	.	ENSG00000156194	ENST00000286719	T	0.39997	1.05	5.45	1.72	0.24424	.	1.542140	0.03521	N	0.220989	T	0.26882	0.0658	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.25537	-1.0129	10	0.46703	T	0.11	-12.2971	8.6087	0.33789	0.0825:0.45:0.4674:0.0	.	742	O14830	PPE2_HUMAN	V	742	ENSP00000286719:A742V	ENSP00000286719:A742V	A	-	2	0	PPEF2	77000881	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.467000	0.22035	0.109000	0.17891	0.591000	0.81541	GCT		0.517	PPEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362929.1	NM_006239		12	20	0	0	0	0.010729	0	12	20				
WDFY3	23001	broad.mit.edu	37	4	85642649	85642649	+	Silent	SNP	T	T	C			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr4:85642649T>C	ENST00000295888.4	-	47	7925	c.7518A>G	c.(7516-7518)caA>caG	p.Q2506Q	WDFY3_ENST00000322366.6_Silent_p.Q2489Q	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	2506	Sufficient for translocalization to p62 bodies/ALIS.				aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)	p.Q2506Q(1)		breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		CAATCTGGTCTTGTAGCTGCT	0.488																																							uc003hpd.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(7516-7518)CAA>CAG		WD repeat and FYVE domain containing 3 isoform							166.0	150.0	156.0					4																	85642649		2203	4300	6503	SO:0001819	synonymous_variant	23001					cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding	g.chr4:85642649T>C	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.7518A>G	4.37:g.85642649T>C						WDFY3_uc003hpe.1_Silent_p.Q117Q	p.Q2506Q	NM_014991	NP_055806	Q8IZQ1	WDFY3_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000808)	47	7926	-		Hepatocellular(203;0.114)	2506					Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Silent	SNP	ENST00000295888.4	37	c.7518A>G	CCDS3609.1																																																																																				0.488	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991		36	75	0	0	0	0.002836	0	36	75				
RAP1GDS1	5910	broad.mit.edu	37	4	99342456	99342456	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr4:99342456G>T	ENST00000408927.3	+	12	1464	c.1351G>T	c.(1351-1353)Gtg>Ttg	p.V451L	RAP1GDS1_ENST00000380158.4_Missense_Mutation_p.V403L|RAP1GDS1_ENST00000453712.2_Missense_Mutation_p.V451L|RAP1GDS1_ENST00000264572.7_Missense_Mutation_p.V360L|RAP1GDS1_ENST00000339360.5_Missense_Mutation_p.V452L|RAP1GDS1_ENST00000408900.3_Missense_Mutation_p.V402L	NM_001100426.1|NM_001100427.1|NM_021159.4	NP_001093896.1|NP_001093897.1|NP_066982.3	P52306	GDS1_HUMAN	RAP1, GTP-GDP dissociation stimulator 1	451					myosin filament assembly (GO:0031034)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|positive regulation of Rho GTPase activity (GO:0032321)|vascular smooth muscle contraction (GO:0014829)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)	p.V451L(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)	28				OV - Ovarian serous cystadenocarcinoma(123;2.9e-07)|LUSC - Lung squamous cell carcinoma(1;0.0253)|Lung(1;0.0576)		GGAGCGTTTGGTGGAATGGTG	0.433			T	NUP98	T-ALL																																		uc003htx.3		NA		Dom	yes		4	4q21-q25	5910	T	"""RAP1, GTP-GDP dissociation stimulator 1"""			L	NUP98		T-ALL		1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)|breast(1)	3						c.(1351-1353)GTG>TTG		RAP1, GTP-GDP dissociation stimulator 1 isoform							126.0	125.0	125.0					4																	99342456		1977	4166	6143	SO:0001583	missense	5910						binding|GTPase activator activity	g.chr4:99342456G>T		CCDS43253.1, CCDS43254.1, CCDS47105.1, CCDS47106.1, CCDS47107.1, CCDS47108.1	4q23-q25	2013-02-14			ENSG00000138698	ENSG00000138698		"""Armadillo repeat containing"""	9859	protein-coding gene	gene with protein product		179502				8262526, 17951244	Standard	NM_001100426		Approved	SmgGDS	uc003htw.4	P52306	OTTHUMG00000160987	ENST00000408927.3:c.1351G>T	4.37:g.99342456G>T	ENSP00000386153:p.Val451Leu					RAP1GDS1_uc003htw.3_Missense_Mutation_p.V452L|RAP1GDS1_uc003htv.3_Missense_Mutation_p.V451L|RAP1GDS1_uc003htz.3_Missense_Mutation_p.V402L|RAP1GDS1_uc003hty.3_Missense_Mutation_p.V403L|RAP1GDS1_uc003hua.3_Missense_Mutation_p.V360L	p.V451L	NM_001100427	NP_001093897	P52306	GDS1_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;2.9e-07)|LUSC - Lung squamous cell carcinoma(1;0.0253)|Lung(1;0.0576)	12	1541	+			451					E9PH06|G5E9P9|Q499L7|Q4KMV2|Q4QQI8|Q9BUW9|Q9BUX6|Q9NYM2|Q9NZA8	Missense_Mutation	SNP	ENST00000408927.3	37	c.1351G>T	CCDS43253.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.962443	0.92791	.	.	ENSG00000138698	ENST00000380158;ENST00000264572;ENST00000408927;ENST00000453712;ENST00000408900;ENST00000339360	T;T;T;T;T;T	0.50548	0.74;2.86;0.74;0.74;0.74;0.74	5.91	5.91	0.95273	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.64638	0.2616	M	0.68593	2.085	0.80722	D	1	D;P;P;D;D;D	0.71674	0.998;0.902;0.841;0.991;0.979;0.994	D;D;P;P;P;D	0.77557	0.99;0.927;0.846;0.782;0.827;0.928	T	0.57929	-0.7726	10	0.02654	T	1	-12.2846	20.2985	0.98592	0.0:0.0:1.0:0.0	.	360;402;403;451;452;451	E9PH06;P52306-2;Q499L7;P52306;Q4QQI8;G5E9P9	.;.;.;GDS1_HUMAN;.;.	L	403;360;451;451;402;452	ENSP00000369503:V403L;ENSP00000264572:V360L;ENSP00000386153:V451L;ENSP00000407157:V451L;ENSP00000386223:V402L;ENSP00000340454:V452L	ENSP00000264572:V360L	V	+	1	0	RAP1GDS1	99561479	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.497000	0.81536	2.793000	0.96121	0.655000	0.94253	GTG		0.433	RAP1GDS1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363273.2	NM_001100426		22	30	1	0	3.62473e-10	0.012319	4.67225e-10	22	30				
RAP1GDS1	5910	broad.mit.edu	37	4	99342458	99342458	+	Silent	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr4:99342458G>T	ENST00000408927.3	+	12	1466	c.1353G>T	c.(1351-1353)gtG>gtT	p.V451V	RAP1GDS1_ENST00000380158.4_Silent_p.V403V|RAP1GDS1_ENST00000453712.2_Silent_p.V451V|RAP1GDS1_ENST00000264572.7_Silent_p.V360V|RAP1GDS1_ENST00000339360.5_Silent_p.V452V|RAP1GDS1_ENST00000408900.3_Silent_p.V402V	NM_001100426.1|NM_001100427.1|NM_021159.4	NP_001093896.1|NP_001093897.1|NP_066982.3	P52306	GDS1_HUMAN	RAP1, GTP-GDP dissociation stimulator 1	451					myosin filament assembly (GO:0031034)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|positive regulation of Rho GTPase activity (GO:0032321)|vascular smooth muscle contraction (GO:0014829)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)	p.V451V(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)	28				OV - Ovarian serous cystadenocarcinoma(123;2.9e-07)|LUSC - Lung squamous cell carcinoma(1;0.0253)|Lung(1;0.0576)		AGCGTTTGGTGGAATGGTGTG	0.433			T	NUP98	T-ALL																																		uc003htx.3		NA		Dom	yes		4	4q21-q25	5910	T	"""RAP1, GTP-GDP dissociation stimulator 1"""			L	NUP98		T-ALL		1	Substitution - coding silent(1)		lung(1)	ovary(1)|lung(1)|breast(1)	3						c.(1351-1353)GTG>GTT		RAP1, GTP-GDP dissociation stimulator 1 isoform							125.0	125.0	125.0					4																	99342458		1985	4168	6153	SO:0001819	synonymous_variant	5910						binding|GTPase activator activity	g.chr4:99342458G>T		CCDS43253.1, CCDS43254.1, CCDS47105.1, CCDS47106.1, CCDS47107.1, CCDS47108.1	4q23-q25	2013-02-14			ENSG00000138698	ENSG00000138698		"""Armadillo repeat containing"""	9859	protein-coding gene	gene with protein product		179502				8262526, 17951244	Standard	NM_001100426		Approved	SmgGDS	uc003htw.4	P52306	OTTHUMG00000160987	ENST00000408927.3:c.1353G>T	4.37:g.99342458G>T						RAP1GDS1_uc003htw.3_Silent_p.V452V|RAP1GDS1_uc003htv.3_Silent_p.V451V|RAP1GDS1_uc003htz.3_Silent_p.V402V|RAP1GDS1_uc003hty.3_Silent_p.V403V|RAP1GDS1_uc003hua.3_Silent_p.V360V	p.V451V	NM_001100427	NP_001093897	P52306	GDS1_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;2.9e-07)|LUSC - Lung squamous cell carcinoma(1;0.0253)|Lung(1;0.0576)	12	1543	+			451					E9PH06|G5E9P9|Q499L7|Q4KMV2|Q4QQI8|Q9BUW9|Q9BUX6|Q9NYM2|Q9NZA8	Silent	SNP	ENST00000408927.3	37	c.1353G>T	CCDS43253.1																																																																																				0.433	RAP1GDS1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363273.2	NM_001100426		23	30	1	0	6.44725e-10	0.002299	8.2349e-10	23	30				
ANK2	287	broad.mit.edu	37	4	114117535	114117535	+	Missense_Mutation	SNP	C	C	A	rs146964054	byFrequency	TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr4:114117535C>A	ENST00000357077.4	+	3	251	c.198C>A	c.(196-198)aaC>aaA	p.N66K	ANK2_ENST00000264366.6_Missense_Mutation_p.N66K|ANK2_ENST00000506722.1_Missense_Mutation_p.N45K|ANK2_ENST00000394537.3_Missense_Mutation_p.N66K	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	66					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.N66K(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		ATGGACTCAACGCTCTCCATC	0.483																																							uc003ibe.3		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14						c.(196-198)AAC>AAA		ankyrin 2 isoform 1							73.0	74.0	73.0					4																	114117535		2203	4300	6503	SO:0001583	missense	287				axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding	g.chr4:114117535C>A	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.198C>A	4.37:g.114117535C>A	ENSP00000349588:p.Asn66Lys					ANK2_uc003ibd.3_Missense_Mutation_p.N45K|ANK2_uc003ibf.3_Missense_Mutation_p.N66K|ANK2_uc003ibc.2_Missense_Mutation_p.N42K|ANK2_uc011cgb.1_Missense_Mutation_p.N81K	p.N66K	NM_001148	NP_001139	Q01484	ANK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)	3	298	+		Ovarian(17;0.0448)|Hepatocellular(203;0.218)	66			ANK 2.		Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	c.198C>A	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	C	19.07	3.755211	0.69648	.	.	ENSG00000145362	ENST00000503271;ENST00000503423;ENST00000506722;ENST00000504454;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000508613;ENST00000511380;ENST00000343056	T;T;T;T;T;T;T;T;T	0.67865	1.99;0.58;0.58;0.58;0.58;-0.29;-0.29;-0.06;-0.11	4.7	-5.31	0.02730	Ankyrin repeat-containing domain (3);	0.000000	0.49916	D	0.000138	T	0.72953	0.3525	L	0.52126	1.63	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;0.999	D;D;D;D;D	0.97110	1.0;1.0;0.999;0.997;0.996	T	0.74636	-0.3599	10	0.87932	D	0	.	15.8113	0.78568	0.0:0.143:0.0:0.857	.	66;66;66;45;45	Q01484;Q01484-2;Q01484-4;Q01484-5;F8WEF9	ANK2_HUMAN;.;.;.;.	K	45;45;45;81;66;66;66;81;83;45	ENSP00000423799:N45K;ENSP00000421011:N45K;ENSP00000421067:N45K;ENSP00000424722:N81K;ENSP00000378044:N66K;ENSP00000349588:N66K;ENSP00000264366:N66K;ENSP00000422900:N81K;ENSP00000425775:N83K	ENSP00000264366:N66K	N	+	3	2	ANK2	114336984	0.873000	0.30073	0.917000	0.36280	0.990000	0.78478	-0.080000	0.11339	-1.090000	0.03069	-0.345000	0.07892	AAC		0.483	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148		13	31	1	0	4.3838e-07	0.001855	5.30969e-07	13	31				
MAML3	55534	broad.mit.edu	37	4	141074131	141074131	+	Silent	SNP	G	G	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr4:141074131G>A	ENST00000509479.2	-	1	1207	c.351C>T	c.(349-351)acC>acT	p.T117T		NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)									p.T117T(2)		breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					TCTGCTCCAGGGTCCGCTGGT	0.672																																							uc003ihz.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(349-351)ACC>ACT		mastermind-like 3							26.0	31.0	29.0					4																	141074131		1984	4161	6145	SO:0001819	synonymous_variant	55534				Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity	g.chr4:141074131G>A	AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.351C>T	4.37:g.141074131G>A						MAML3_uc011chd.1_Silent_p.T117T	p.T117T	NM_018717	NP_061187	Q96JK9	MAML3_HUMAN			1	1103	-	all_hematologic(180;0.162)		117						Silent	SNP	ENST00000509479.2	37	c.351C>T	CCDS54805.1																																																																																				0.672	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364934.2			12	9	0	0	0	0.010729	0	12	9				
TENM3	55714	broad.mit.edu	37	4	183713606	183713606	+	Silent	SNP	C	C	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr4:183713606C>T	ENST00000511685.1	+	26	5904	c.5781C>T	c.(5779-5781)gaC>gaT	p.D1927D	TENM3_ENST00000406950.2_Silent_p.D1927D			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	1927					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.D1927D(1)									TCATCACGGACTACAACGAGG	0.502																																							uc003ivd.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(5779-5781)GAC>GAT		odz, odd Oz/ten-m homolog 3							67.0	69.0	68.0					4																	183713606		1986	4151	6137	SO:0001819	synonymous_variant	55714				signal transduction	integral to membrane		g.chr4:183713606C>T	AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.5781C>T	4.37:g.183713606C>T							p.D1927D	NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)	25	5818	+		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)	1927			Extracellular (Potential).|YD 8.		Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Silent	SNP	ENST00000511685.1	37	c.5781C>T	CCDS47165.1																																																																																				0.502	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361734.1			30	40	0	0	0	0.007291	0	30	40				
CDH10	1008	broad.mit.edu	37	5	24537633	24537633	+	Missense_Mutation	SNP	G	G	T	rs373340564		TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr5:24537633G>T	ENST00000264463.4	-	3	889	c.382C>A	c.(382-384)Cgc>Agc	p.R128S		NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	128	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R128S(1)|p.R128C(1)		NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		GCTTGTGCGCGTAGAGTATAA	0.413										HNSCC(23;0.051)																													uc003jgr.1		NA																	2	Substitution - Missense(2)		lung(1)|endometrium(1)	ovary(6)|pancreas(4)|breast(2)	12						c.(382-384)CGC>AGC		cadherin 10, type 2 preproprotein							160.0	148.0	152.0					5																	24537633		2203	4300	6503	SO:0001583	missense	1008				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:24537633G>T	AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.382C>A	5.37:g.24537633G>T	ENSP00000264463:p.Arg128Ser	HNSCC(23;0.051)				CDH10_uc011cnu.1_RNA	p.R128S	NM_006727	NP_006718	Q9Y6N8	CAD10_HUMAN		STAD - Stomach adenocarcinoma(35;0.0556)	3	714	-			128			Cadherin 1.|Extracellular (Potential).		Q9ULB3	Missense_Mutation	SNP	ENST00000264463.4	37	c.382C>A	CCDS3892.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.012433	0.75046	.	.	ENSG00000040731	ENST00000264463	T	0.49432	0.78	5.82	5.82	0.92795	Cadherin (4);Cadherin-like (1);	0.155567	0.64402	D	0.000017	T	0.63094	0.2482	L	0.58302	1.8	0.39764	D	0.972069	D	0.56287	0.975	P	0.57502	0.822	T	0.65286	-0.6205	10	0.72032	D	0.01	.	19.0796	0.93177	0.0:0.0:1.0:0.0	.	128	Q9Y6N8	CAD10_HUMAN	S	128	ENSP00000264463:R128S	ENSP00000264463:R128S	R	-	1	0	CDH10	24573390	0.998000	0.40836	1.000000	0.80357	0.994000	0.84299	2.645000	0.46621	2.758000	0.94735	0.557000	0.71058	CGC		0.413	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207345.2	NM_006727		51	108	1	0	6.3237e-29	0.00361	1.11758e-28	51	108				
CDH6	1004	broad.mit.edu	37	5	31323074	31323074	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr5:31323074A>G	ENST00000265071.2	+	12	2297	c.2032A>G	c.(2032-2034)Agg>Ggg	p.R678G		NM_004932.3	NP_004923.1	P55285	CADH6_HUMAN	cadherin 6, type 2, K-cadherin (fetal kidney)	678					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R678G(1)		NS(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(42)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						CGGCACCCTGAGGAATCCTGA	0.502																																							uc003jhe.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)|large_intestine(1)	7						c.(2032-2034)AGG>GGG		cadherin 6, type 2 preproprotein							84.0	78.0	80.0					5																	31323074		2203	4300	6503	SO:0001583	missense	1004				adherens junction organization|cell junction assembly|homophilic cell adhesion	cytoplasm|integral to membrane|nucleus|plasma membrane	calcium ion binding	g.chr5:31323074A>G	D31784	CCDS3894.1	5p13.3	2010-01-26			ENSG00000113361	ENSG00000113361		"""Cadherins / Major cadherins"""	1765	protein-coding gene	gene with protein product	"""K-Cadherin"""	603007				7743525, 10191097	Standard	NM_004932		Approved		uc003jhe.2	P55285	OTTHUMG00000090673	ENST00000265071.2:c.2032A>G	5.37:g.31323074A>G	ENSP00000265071:p.Arg678Gly						p.R678G	NM_004932	NP_004923	P55285	CADH6_HUMAN			12	2358	+			678			Cytoplasmic (Potential).		A8K5H5|Q9BWS0	Missense_Mutation	SNP	ENST00000265071.2	37	c.2032A>G	CCDS3894.1	.	.	.	.	.	.	.	.	.	.	A	19.16	3.774580	0.70107	.	.	ENSG00000113361	ENST00000265071	T	0.79141	-1.24	5.52	-0.226	0.13106	Cadherin, cytoplasmic domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	H	0.94964	3.605	0.46725	D	0.99917	D	0.89917	1.0	D	0.81914	0.995	D	0.92272	0.5826	10	0.87932	D	0	.	16.9153	0.86149	0.3643:0.6357:0.0:0.0	.	678	P55285	CADH6_HUMAN	G	678	ENSP00000265071:R678G	ENSP00000265071:R678G	R	+	1	2	CDH6	31358831	1.000000	0.71417	0.988000	0.46212	0.994000	0.84299	1.357000	0.34090	-0.199000	0.10317	0.533000	0.62120	AGG		0.502	CDH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207355.2	NM_004932		4	74	0	0	0	0.009096	0	4	74				
ADAMTS12	81792	broad.mit.edu	37	5	33614470	33614470	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr5:33614470C>A	ENST00000504830.1	-	16	2735	c.2400G>T	c.(2398-2400)caG>caT	p.Q800H	ADAMTS12_ENST00000504582.1_5'UTR|ADAMTS12_ENST00000352040.3_Missense_Mutation_p.Q715H	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	800	Spacer 1.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.Q800H(1)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						GGTTAGTCACCTGGAATAGAA	0.438										HNSCC(64;0.19)																													uc003jia.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						c.(2398-2400)CAG>CAT		ADAM metallopeptidase with thrombospondin type 1							146.0	115.0	126.0					5																	33614470		2203	4300	6503	SO:0001583	missense	81792				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:33614470C>A	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.2400G>T	5.37:g.33614470C>A	ENSP00000422554:p.Gln800His	HNSCC(64;0.19)				ADAMTS12_uc010iuq.1_Missense_Mutation_p.Q715H	p.Q800H	NM_030955	NP_112217	P58397	ATS12_HUMAN			16	2563	-			800			Spacer 1.		A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	ENST00000504830.1	37	c.2400G>T	CCDS34140.1	.	.	.	.	.	.	.	.	.	.	C	16.85	3.236251	0.58886	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.54866	0.55;0.55	5.73	2.58	0.30949	ADAM-TS Spacer 1 (1);	0.000000	0.85682	D	0.000000	T	0.71256	0.3318	M	0.84846	2.72	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76071	0.977;0.987	T	0.71603	-0.4543	10	0.36615	T	0.2	.	11.5243	0.50571	0.0:0.7202:0.0:0.2798	.	715;800	P58397-3;P58397	.;ATS12_HUMAN	H	800;715	ENSP00000422554:Q800H;ENSP00000344847:Q715H	ENSP00000344847:Q715H	Q	-	3	2	ADAMTS12	33650227	0.999000	0.42202	1.000000	0.80357	0.903000	0.53119	0.705000	0.25675	0.782000	0.33613	0.561000	0.74099	CAG		0.438	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955		15	25	1	0	7.05477e-17	0.00499	1.07156e-16	15	25				
HCN1	348980	broad.mit.edu	37	5	45262155	45262155	+	Silent	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr5:45262155C>A	ENST00000303230.4	-	8	2598	c.2541G>T	c.(2539-2541)tcG>tcT	p.S847S		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	847					apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)	p.S847S(1)		NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						GGATGGCTCCCGACGACATCT	0.647																																							uc003jok.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(2539-2541)TCG>TCT		hyperpolarization activated cyclic							49.0	57.0	54.0					5																	45262155		2203	4300	6503	SO:0001819	synonymous_variant	348980					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity	g.chr5:45262155C>A	AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.2541G>T	5.37:g.45262155C>A							p.S847S	NM_021072	NP_066550	O60741	HCN1_HUMAN			8	2566	-			847			Cytoplasmic (Potential).			Silent	SNP	ENST00000303230.4	37	c.2541G>T	CCDS3952.1																																																																																				0.647	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253847.1	NM_021072		36	81	1	0	1.47197e-15	0.007835	2.17697e-15	36	81				
HCN1	348980	broad.mit.edu	37	5	45267293	45267293	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr5:45267293G>T	ENST00000303230.4	-	7	1738	c.1681C>A	c.(1681-1683)Ctt>Att	p.L561I		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	561					apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)	p.L561I(1)		NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						AGTGAGTAAAGACGACAATAT	0.428																																							uc003jok.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1681-1683)CTT>ATT		hyperpolarization activated cyclic							164.0	148.0	153.0					5																	45267293		2203	4300	6503	SO:0001583	missense	348980					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity	g.chr5:45267293G>T	AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.1681C>A	5.37:g.45267293G>T	ENSP00000307342:p.Leu561Ile						p.L561I	NM_021072	NP_066550	O60741	HCN1_HUMAN			7	1706	-			561			cAMP.|Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000303230.4	37	c.1681C>A	CCDS3952.1	.	.	.	.	.	.	.	.	.	.	G	35	5.490259	0.96339	.	.	ENSG00000164588	ENST00000303230	D	0.97529	-4.42	5.91	5.91	0.95273	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.000000	0.56097	D	0.000022	D	0.98353	0.9453	M	0.80422	2.495	0.80722	D	1	P	0.42757	0.789	P	0.58013	0.831	D	0.98429	1.0581	10	0.62326	D	0.03	.	20.2963	0.98556	0.0:0.0:1.0:0.0	.	561	O60741	HCN1_HUMAN	I	561	ENSP00000307342:L561I	ENSP00000307342:L561I	L	-	1	0	HCN1	45303050	1.000000	0.71417	0.998000	0.56505	0.728000	0.41692	6.371000	0.73119	2.813000	0.96785	0.655000	0.94253	CTT		0.428	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253847.1	NM_021072		28	56	1	0	1.38267e-23	0.005443	2.2721e-23	28	56				
ADAMTS19	171019	broad.mit.edu	37	5	128862046	128862046	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr5:128862046C>A	ENST00000274487.4	+	4	1110	c.965C>A	c.(964-966)cCt>cAt	p.P322H	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	322						proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.P322H(1)		NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		TACAAATTACCTCAAGAATAC	0.388																																							uc003kvb.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|breast(2)|lung(1)|skin(1)	9						c.(964-966)CCT>CAT		ADAM metallopeptidase with thrombospondin type 1							99.0	92.0	94.0					5																	128862046		2203	4300	6503	SO:0001583	missense	171019				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:128862046C>A	AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.965C>A	5.37:g.128862046C>A	ENSP00000274487:p.Pro322His					ADAMTS19_uc003kvc.1_RNA	p.P322H	NM_133638	NP_598377	Q8TE59	ATS19_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)	4	965	+		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	322						Missense_Mutation	SNP	ENST00000274487.4	37	c.965C>A	CCDS4146.1	.	.	.	.	.	.	.	.	.	.	C	18.90	3.721910	0.68959	.	.	ENSG00000145808	ENST00000274487	D	0.87103	-2.21	4.23	4.23	0.50019	Metallopeptidase, catalytic domain (1);	0.182651	0.37906	N	0.001899	T	0.77089	0.4079	N	0.14661	0.345	0.34637	D	0.720264	B	0.20988	0.05	B	0.10450	0.005	T	0.74919	-0.3500	9	.	.	.	.	17.9268	0.88986	0.0:1.0:0.0:0.0	.	322	Q8TE59	ATS19_HUMAN	H	322	ENSP00000274487:P322H	.	P	+	2	0	ADAMTS19	128889945	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.266000	0.65525	2.648000	0.89879	0.557000	0.71058	CCT		0.388	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	NM_133638		7	61	1	0	0.00198382	0.001984	0.00216908	7	61				
PCDHA7	56141	broad.mit.edu	37	5	140215250	140215250	+	Missense_Mutation	SNP	C	C	T	rs566217489		TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr5:140215250C>T	ENST00000525929.1	+	1	1282	c.1282C>T	c.(1282-1284)Cgg>Tgg	p.R428W	PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA7_ENST00000378125.3_Missense_Mutation_p.R428W|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	428	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.R428W(6)		NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTTACCGCGCGGGACGGGGG	0.617																																					NSCLC(160;258 2013 5070 22440 28951)	NSCLC(160;258 2013 5070 22440 28951)	uc003lhq.2		NA																	6	Substitution - Missense(6)		lung(4)|urinary_tract(2)	ovary(2)|skin(2)	4						c.(1282-1284)CGG>TGG		protocadherin alpha 7 isoform 1 precursor							94.0	98.0	97.0					5																	140215250		2203	4300	6503	SO:0001583	missense	56141				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140215250C>T	AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.1282C>T	5.37:g.140215250C>T	ENSP00000436426:p.Arg428Trp					PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc011dac.1_Missense_Mutation_p.R428W	p.R428W	NM_018910	NP_061733	Q9UN72	PCDA7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1282	+			428			Cadherin 4.|Extracellular (Potential).		O75282	Missense_Mutation	SNP	ENST00000525929.1	37	c.1282C>T	CCDS54918.1	.	.	.	.	.	.	.	.	.	.	C	5.766	0.325666	0.10900	.	.	ENSG00000204963	ENST00000525929;ENST00000378125	T;T	0.01804	4.63;4.63	4.04	-2.34	0.06704	Cadherin (5);Cadherin-like (1);	0.000000	0.29417	U	0.012219	T	0.02494	0.0076	L	0.31845	0.965	0.09310	N	1	P;P	0.43885	0.631;0.82	B;P	0.49276	0.136;0.605	T	0.33650	-0.9860	10	0.66056	D	0.02	.	10.9804	0.47490	0.5789:0.3132:0.1079:0.0	.	428;428	Q9UN72-2;Q9UN72	.;PCDA7_HUMAN	W	428	ENSP00000436426:R428W;ENSP00000367365:R428W	ENSP00000367365:R428W	R	+	1	2	PCDHA7	140195434	0.000000	0.05858	0.000000	0.03702	0.173000	0.22820	-0.979000	0.03774	-0.350000	0.08262	0.305000	0.20034	CGG		0.617	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372887.2	NM_018910		75	130	0	0	0	0.00361	0	75	130				
PCDHB5	26167	broad.mit.edu	37	5	140516961	140516961	+	Missense_Mutation	SNP	C	C	T	rs17844424		TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr5:140516961C>T	ENST00000231134.5	+	1	2162	c.1945C>T	c.(1945-1947)Cct>Tct	p.P649S		NM_015669.2	NP_056484.1	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5	649	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P649S(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|kidney(1)|large_intestine(18)|lung(25)|ovary(3)|prostate(6)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	81			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CAATGGCGAGCCTCCGCGCTC	0.731																																							uc003liq.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(2)	5						c.(1945-1947)CCT>TCT		protocadherin beta 5 precursor							21.0	25.0	24.0					5																	140516961		2093	4088	6181	SO:0001583	missense	26167				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding|protein binding	g.chr5:140516961C>T	AF152498	CCDS4247.1	5q31	2010-01-26			ENSG00000113209	ENSG00000113209		"""Cadherins / Protocadherins : Clustered"""	8690	other	protocadherin		606331				10380929	Standard	NM_015669		Approved	DKFZp586B0217, PCDH-BETA5	uc003liq.3	Q9Y5E4	OTTHUMG00000129616	ENST00000231134.5:c.1945C>T	5.37:g.140516961C>T	ENSP00000231134:p.Pro649Ser						p.P649S	NM_015669	NP_056484	Q9Y5E4	PCDB5_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	2162	+			649			Cadherin 6.|Extracellular (Potential).		Q549F4|Q9UFU9	Missense_Mutation	SNP	ENST00000231134.5	37	c.1945C>T	CCDS4247.1	.	.	.	.	.	.	.	.	.	.	C	15.37	2.813071	0.50527	.	.	ENSG00000113209	ENST00000231134	T	0.56776	0.44	4.71	4.71	0.59529	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.78761	0.4334	H	0.95611	3.695	0.37630	D	0.921644	P	0.37398	0.593	P	0.52554	0.702	D	0.86368	0.1721	9	0.87932	D	0	.	18.069	0.89399	0.0:1.0:0.0:0.0	rs17844424	649	Q9Y5E4	PCDB5_HUMAN	S	649	ENSP00000231134:P649S	ENSP00000231134:P649S	P	+	1	0	PCDHB5	140497145	0.011000	0.17503	1.000000	0.80357	0.387000	0.30353	1.295000	0.33377	2.337000	0.79520	0.430000	0.28490	CCT		0.731	PCDHB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251811.1	NM_015669		36	57	0	0	0	0.003271	0	36	57				
PCDHB6	56130	broad.mit.edu	37	5	140529963	140529963	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr5:140529963C>A	ENST00000231136.1	+	1	125	c.125C>A	c.(124-126)aCg>aAg	p.T42K	PCDHB6_ENST00000543635.1_Intron	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	42	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.T42K(1)		cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GAAAGTGGCACGTTTGTGGCC	0.502																																							uc003lir.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(124-126)ACG>AAG		protocadherin beta 6 precursor							133.0	137.0	136.0					5																	140529963		2203	4300	6503	SO:0001583	missense	56130				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140529963C>A	AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.125C>A	5.37:g.140529963C>A	ENSP00000231136:p.Thr42Lys					PCDHB6_uc011dah.1_Intron	p.T42K	NM_018939	NP_061762	Q9Y5E3	PCDB6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	125	+			42			Extracellular (Potential).|Cadherin 1.		B2R8R9	Missense_Mutation	SNP	ENST00000231136.1	37	c.125C>A	CCDS4248.1	.	.	.	.	.	.	.	.	.	.	C	15.38	2.817689	0.50633	.	.	ENSG00000113211	ENST00000231136	T	0.46063	0.88	4.97	4.08	0.47627	Cadherin, N-terminal (1);Cadherin (1);	.	.	.	.	T	0.56761	0.2007	M	0.81341	2.54	0.80722	D	1	P	0.39759	0.687	P	0.48030	0.564	T	0.64334	-0.6432	9	0.87932	D	0	.	14.7468	0.69494	0.1459:0.8541:0.0:0.0	.	42	Q9Y5E3	PCDB6_HUMAN	K	42	ENSP00000231136:T42K	ENSP00000231136:T42K	T	+	2	0	PCDHB6	140510147	0.626000	0.27120	0.614000	0.29051	0.643000	0.38383	5.985000	0.70556	1.170000	0.42753	0.561000	0.74099	ACG		0.502	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251818.2	NM_018939		48	78	1	0	2.81731e-22	0.00361	4.54979e-22	48	78				
PCDHGA1	56114	broad.mit.edu	37	5	140710439	140710439	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr5:140710439G>T	ENST00000517417.1	+	1	188	c.188G>T	c.(187-189)gGa>gTa	p.G63V	PCDHGA1_ENST00000378105.3_Missense_Mutation_p.G63V|AC005618.6_ENST00000606901.1_lincRNA	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1	63	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G63V(2)		breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCAGATGGCGGAGTCCGCATC	0.572																																							uc003lji.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|breast(1)|pancreas(1)	3						c.(187-189)GGA>GTA		protocadherin gamma subfamily A, 1 isoform 1							105.0	112.0	110.0					5																	140710439		2203	4300	6503	SO:0001583	missense	56114				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140710439G>T	AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.188G>T	5.37:g.140710439G>T	ENSP00000431083:p.Gly63Val					PCDHGA1_uc011dan.1_Missense_Mutation_p.G63V	p.G63V	NM_018912	NP_061735	Q9Y5H4	PCDG1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	188	+			63			Cadherin 1.|Extracellular (Potential).		Q2M273|Q9Y5D6	Missense_Mutation	SNP	ENST00000517417.1	37	c.188G>T	CCDS54922.1	.	.	.	.	.	.	.	.	.	.	G	15.30	2.792094	0.50102	.	.	ENSG00000204956	ENST00000517417;ENST00000378105	T;T	0.30448	1.53;1.53	4.28	4.28	0.50868	Cadherin, N-terminal (1);Cadherin (2);Cadherin-like (1);	0.647625	0.13504	N	0.382989	T	0.68320	0.2988	H	0.95816	3.725	0.43439	D	0.995619	D;D	0.64830	0.976;0.994	D;D	0.71656	0.915;0.974	T	0.77747	-0.2472	10	0.87932	D	0	.	16.9001	0.86110	0.0:0.0:1.0:0.0	.	63;63	Q9Y5H4-2;Q9Y5H4	.;PCDG1_HUMAN	V	63	ENSP00000431083:G63V;ENSP00000367345:G63V	ENSP00000367345:G63V	G	+	2	0	PCDHGA1	140690623	0.000000	0.05858	0.857000	0.33713	0.690000	0.40134	0.397000	0.20883	2.389000	0.81357	0.655000	0.94253	GGA		0.572	PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374737.1	NM_018912		67	98	1	0	7.75977e-34	0.00361	1.45366e-33	67	98				
PCDHGA11	56105	broad.mit.edu	37	5	140801564	140801564	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr5:140801564G>T	ENST00000398587.2	+	1	803	c.770G>T	c.(769-771)aGc>aTc	p.S257I	PCDHGA11_ENST00000518882.1_Missense_Mutation_p.S257I|PCDHGB7_ENST00000398594.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron	NM_018914.2|NM_032092.1	NP_061737.1|NP_114481.1	Q9Y5H2	PCDGB_HUMAN	protocadherin gamma subfamily A, 11	257	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S257I(1)		breast(3)|endometrium(8)|kidney(3)|large_intestine(9)|lung(22)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAAAACATCAGCTCCGGAACT	0.483																																							uc003lkq.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(769-771)AGC>ATC		protocadherin gamma subfamily A, 11 isoform 1							119.0	122.0	121.0					5																	140801564		1936	4138	6074	SO:0001583	missense	56105				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140801564G>T	AF152505	CCDS47294.1, CCDS54930.1, CCDS75345.1	5q31	2010-01-26			ENSG00000253873	ENSG00000253873		"""Cadherins / Protocadherins : Clustered"""	8698	other	protocadherin		606298				10380929	Standard	NM_018914		Approved	PCDH-GAMMA-A11		Q9Y5H2	OTTHUMG00000164055	ENST00000398587.2:c.770G>T	5.37:g.140801564G>T	ENSP00000381589:p.Ser257Ile					PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lko.1_Missense_Mutation_p.S257I|PCDHGA11_uc003lkp.1_Missense_Mutation_p.S257I	p.S257I	NM_018914	NP_061737	Q9Y5H2	PCDGB_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1028	+			257			Extracellular (Potential).|Cadherin 3.		B7ZVY8|Q9Y5D8|Q9Y5D9	Missense_Mutation	SNP	ENST00000398587.2	37	c.770G>T	CCDS47294.1	.	.	.	.	.	.	.	.	.	.	g	12.22	1.872237	0.33069	.	.	ENSG00000253873	ENST00000398587;ENST00000518882	T;T	0.01804	4.63;4.63	5.96	3.13	0.36017	Cadherin (4);Cadherin-like (1);	16.296300	0.04256	U	0.339480	T	0.03095	0.0091	L	0.31371	0.925	0.09310	N	1	B;P;B	0.44659	0.452;0.84;0.397	B;P;B	0.44732	0.296;0.459;0.196	T	0.51100	-0.8748	10	0.87932	D	0	.	9.9296	0.41514	0.086:0.5213:0.3927:0.0	.	257;257;257	Q9Y5H2;Q9Y5H2-3;Q9Y5H2-2	PCDGB_HUMAN;.;.	I	257	ENSP00000381589:S257I;ENSP00000428333:S257I	ENSP00000381589:S257I	S	+	2	0	PCDHGA11	140781748	0.000000	0.05858	0.758000	0.31321	0.816000	0.46133	-2.818000	0.00751	0.841000	0.35020	0.655000	0.94253	AGC		0.483	PCDHGA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376974.1	NM_018914		65	138	1	0	1.02487e-32	0.00361	1.89466e-32	65	138				
SLC36A3	285641	broad.mit.edu	37	5	150657178	150657178	+	Silent	SNP	G	G	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr5:150657178G>A	ENST00000335230.3	-	10	1600	c.1189C>T	c.(1189-1191)Ctg>Ttg	p.L397L	SLC36A3_ENST00000377713.3_Silent_p.L438L	NM_181774.3	NP_861439.3	Q495N2	S36A3_HUMAN	solute carrier family 36, member 3	397						integral component of membrane (GO:0016021)		p.L397L(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|skin(1)|stomach(2)|urinary_tract(2)	21		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GAGCCTACCAGGGAGATGACC	0.532																																							uc003ltw.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(1)	3						c.(1189-1191)CTG>TTG		solute carrier family 36, member 3 isoform 2							59.0	54.0	55.0					5																	150657178		2203	4300	6503	SO:0001819	synonymous_variant	285641					integral to membrane		g.chr5:150657178G>A	AY162215	CCDS4314.1, CCDS47316.1	5q33.1	2013-07-17	2013-07-17		ENSG00000186334	ENSG00000186334		"""Solute carriers"""	19659	protein-coding gene	gene with protein product		608332				12809675	Standard	NM_181774		Approved	PAT3, TRAMD2, tramdorin2	uc003ltw.2	Q495N2	OTTHUMG00000130128	ENST00000335230.3:c.1189C>T	5.37:g.150657178G>A						GM2A_uc011dcs.1_Intron|SLC36A3_uc003ltv.2_Silent_p.L382L|SLC36A3_uc003ltx.2_Silent_p.L438L	p.L397L	NM_181774	NP_861439	Q495N2	S36A3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		10	1608	-		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	397			Helical; (Potential).		Q495N3|Q6ZMU7|Q6ZRU4|Q7Z6B4	Silent	SNP	ENST00000335230.3	37	c.1189C>T	CCDS4314.1																																																																																				0.532	SLC36A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252436.1	NM_181774		26	43	0	0	0	0.00632	0	26	43				
KIF4B	285643	broad.mit.edu	37	5	154395153	154395153	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr5:154395153G>T	ENST00000435029.4	+	1	1894	c.1734G>T	c.(1732-1734)ttG>ttT	p.L578F		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	578					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)	p.L578F(2)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			AGGAAGAATTGGTTCGTGAAC	0.423																																							uc010jih.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1732-1734)TTG>TTT		kinesin family member 4B							79.0	81.0	81.0					5																	154395153		2203	4300	6503	SO:0001583	missense	285643				axon guidance|blood coagulation|microtubule-based movement	cytosol|microtubule|nuclear matrix	ATP binding|DNA binding|microtubule motor activity	g.chr5:154395153G>T	AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.1734G>T	5.37:g.154395153G>T	ENSP00000387875:p.Leu578Phe						p.L578F	NM_001099293	NP_001092763	Q2VIQ3	KIF4B_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)		1	1894	+	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	578			Potential.			Missense_Mutation	SNP	ENST00000435029.4	37	c.1734G>T	CCDS47324.1	.	.	.	.	.	.	.	.	.	.	g	8.722	0.914474	0.17907	.	.	ENSG00000226650	ENST00000435029	T	0.73789	-0.78	1.2	0.29	0.15728	.	.	.	.	.	D	0.82453	0.5040	M	0.85041	2.73	0.51482	D	0.999923	D	0.89917	1.0	D	0.91635	0.999	T	0.77696	-0.2491	9	0.72032	D	0.01	.	1.9226	0.03310	0.2231:0.0:0.4589:0.3179	.	578	Q2VIQ3	KIF4B_HUMAN	F	578	ENSP00000387875:L578F	ENSP00000387875:L578F	L	+	3	2	KIF4B	154375346	0.925000	0.31364	0.542000	0.28115	0.591000	0.36615	0.406000	0.21032	0.089000	0.17243	-0.251000	0.11542	TTG		0.423	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377478.1			26	63	1	0	1.42536e-11	0.004656	1.88927e-11	26	63				
KIF4B	285643	broad.mit.edu	37	5	154396937	154396937	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr5:154396937G>T	ENST00000435029.4	+	1	3678	c.3518G>T	c.(3517-3519)tGt>tTt	p.C1173F		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	1173	Globular. {ECO:0000250}.|Interaction with PRC1. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)	p.C1173F(2)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			AAAGAGATGTGTGACATGGAG	0.507																																							uc010jih.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(3517-3519)TGT>TTT		kinesin family member 4B							82.0	85.0	84.0					5																	154396937		2203	4300	6503	SO:0001583	missense	285643				axon guidance|blood coagulation|microtubule-based movement	cytosol|microtubule|nuclear matrix	ATP binding|DNA binding|microtubule motor activity	g.chr5:154396937G>T	AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.3518G>T	5.37:g.154396937G>T	ENSP00000387875:p.Cys1173Phe						p.C1173F	NM_001099293	NP_001092763	Q2VIQ3	KIF4B_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)		1	3678	+	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	1173			Interaction with PRC1 (By similarity).|Globular (By similarity).			Missense_Mutation	SNP	ENST00000435029.4	37	c.3518G>T	CCDS47324.1	.	.	.	.	.	.	.	.	.	.	G	0.671	-0.801811	0.02841	.	.	ENSG00000226650	ENST00000435029	T	0.46063	0.88	1.77	-0.197	0.13228	.	.	.	.	.	T	0.26376	0.0644	L	0.44542	1.39	0.28269	N	0.924502	B	0.22746	0.074	B	0.17722	0.019	T	0.29610	-1.0006	9	0.11794	T	0.64	.	3.729	0.08485	0.1605:0.0:0.6004:0.2391	.	1173	Q2VIQ3	KIF4B_HUMAN	F	1173	ENSP00000387875:C1173F	ENSP00000387875:C1173F	C	+	2	0	KIF4B	154377130	0.220000	0.23631	0.185000	0.23176	0.033000	0.12548	-0.475000	0.06599	-0.079000	0.12707	-0.261000	0.10672	TGT		0.507	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377478.1			22	60	1	0	8.10497e-08	0.010504	9.9454e-08	22	60				
STC2	8614	broad.mit.edu	37	5	172755182	172755182	+	Silent	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr5:172755182C>A	ENST00000265087.4	-	1	1324	c.15G>T	c.(13-15)cgG>cgT	p.R5R		NM_003714.2	NP_003705.1	O76061	STC2_HUMAN	stanniocalcin 2	5					cellular calcium ion homeostasis (GO:0006874)|cellular response to hypoxia (GO:0071456)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of gene expression (GO:0010629)|negative regulation of multicellular organism growth (GO:0040015)|regulation of hormone biosynthetic process (GO:0046885)|regulation of store-operated calcium entry (GO:2001256)|response to oxidative stress (GO:0006979)|response to peptide hormone (GO:0043434)|response to vitamin D (GO:0033280)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|heme binding (GO:0020037)|protein homodimerization activity (GO:0042803)	p.R5R(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(3)	25	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|Ovarian(839;0.223)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			ACTGGCCCAGCCGCTCGGCAC	0.632																																							uc003mco.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|ovary(1)	3						c.(13-15)CGG>CGT		stanniocalcin 2 precursor							93.0	92.0	92.0					5																	172755182		2203	4300	6503	SO:0001819	synonymous_variant	8614				cell surface receptor linked signaling pathway|cell-cell signaling	extracellular region	hormone activity	g.chr5:172755182C>A	AB012664	CCDS4388.1	5q35.2	2004-05-17			ENSG00000113739	ENSG00000113739			11374	protein-coding gene	gene with protein product		603665				9723890, 9753616	Standard	NM_003714		Approved	STC-2	uc003mco.1	O76061	OTTHUMG00000130542	ENST00000265087.4:c.15G>T	5.37:g.172755182C>A						STC2_uc003mcn.1_5'Flank	p.R5R	NM_003714	NP_003705	O76061	STC2_HUMAN	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)		1	1325	-	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|Ovarian(839;0.223)	5						Silent	SNP	ENST00000265087.4	37	c.15G>T	CCDS4388.1																																																																																				0.632	STC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252965.1	NM_003714		57	106	1	0	1.45723e-30	0.00361	2.65897e-30	57	106				
CDYL	9425	broad.mit.edu	37	6	4716036	4716036	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr6:4716036G>T	ENST00000328908.5	+	2	155	c.24G>T	c.(22-24)agG>agT	p.R8S				Q9Y232	CDYL1_HUMAN	chromodomain protein, Y-like	8					regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|methylated histone binding (GO:0035064)|transcription corepressor activity (GO:0003714)	p.R8S(1)		breast(2)|kidney(2)|large_intestine(9)|lung(13)|skin(1)|stomach(2)|urinary_tract(1)	30	Ovarian(93;0.11)	all_hematologic(90;0.0901)|Lung NSC(90;0.244)		OV - Ovarian serous cystadenocarcinoma(45;0.182)		CAAGCCACAGGTCAGCCTGGG	0.448																																							uc003mwi.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(22-24)AGG>AGT		chromodomain protein, Y chromosome-like isoform							62.0	66.0	65.0					6																	4716036		2203	4300	6503	SO:0001583	missense	9425				regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	histone acetyltransferase activity	g.chr6:4716036G>T	AF081258	CCDS4491.2, CCDS47364.1	6p25.1	2010-05-04	2003-09-12		ENSG00000153046	ENSG00000153046			1811	protein-coding gene	gene with protein product	"""CDY-like, autosomal"", ""testis-specific chromodomain Y-like protein"""	603778	"""chromodomain protein, Y chromosome-like"""			10192397	Standard	NM_001143970		Approved	DKFZP586C1622, CDYL1	uc003mwj.3	Q9Y232	OTTHUMG00000014170	ENST00000328908.5:c.24G>T	6.37:g.4716036G>T	ENSP00000330512:p.Arg8Ser						p.R8S	NM_001143971	NP_001137443	Q9Y232	CDYL1_HUMAN		OV - Ovarian serous cystadenocarcinoma(45;0.182)	2	155	+	Ovarian(93;0.11)	all_hematologic(90;0.0901)|Lung NSC(90;0.244)	8					A8K6D6|B4DLG4|Q0VDG7|Q32NC5|Q5VX99|Q6P7T5|Q9BWZ2|Q9Y424	Missense_Mutation	SNP	ENST00000328908.5	37	c.24G>T		.	.	.	.	.	.	.	.	.	.	G	7.419	0.636415	0.14386	.	.	ENSG00000153046	ENST00000328908	T	0.49720	0.77	5.12	-4.16	0.03869	.	.	.	.	.	T	0.11922	0.0290	.	.	.	0.09310	N	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.28490	-1.0042	8	0.87932	D	0	.	2.6199	0.04913	0.356:0.1352:0.4019:0.1069	.	8	Q9Y232	CDYL1_HUMAN	S	8	ENSP00000330512:R8S	ENSP00000330512:R8S	R	+	3	2	CDYL	4661035	0.006000	0.16342	0.000000	0.03702	0.003000	0.03518	0.035000	0.13797	-1.254000	0.02485	-0.142000	0.14014	AGG		0.448	CDYL-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000039736.1	NM_004824		23	9	1	0	1.10513e-12	0.002299	1.48585e-12	23	9				
FAM65B	9750	broad.mit.edu	37	6	24843714	24843714	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr6:24843714G>T	ENST00000259698.4	-	14	1471	c.1296C>A	c.(1294-1296)agC>agA	p.S432R	FAM65B_ENST00000378023.4_Missense_Mutation_p.S382R|FAM65B_ENST00000540914.1_Missense_Mutation_p.S382R|FAM65B_ENST00000510784.2_Missense_Mutation_p.S416R|FAM65B_ENST00000538035.1_Missense_Mutation_p.S411R|FAM65B_ENST00000473070.1_5'Flank	NM_014722.2	NP_055537.2	Q9Y4F9	FA65B_HUMAN	family with sequence similarity 65, member B	432					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)		p.S382R(1)|p.S432R(1)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	25						GGTCACTGAAGCTGAGCGACA	0.478																																							uc003neo.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1294-1296)AGC>AGA		hypothetical protein LOC9750 isoform 1							64.0	64.0	64.0					6																	24843714		1987	4155	6142	SO:0001583	missense	9750				cell differentiation|muscle organ development	cytoskeleton|filopodium|mitochondrion	binding	g.chr6:24843714G>T	U49187	CCDS47383.1, CCDS47384.1, CCDS69057.1, CCDS69058.1, CCDS75410.1	6p22.3-p21.32	2012-11-30	2008-06-13	2008-06-13	ENSG00000111913	ENSG00000111913			13872	protein-coding gene	gene with protein product	"""myogenesis-related and NCAM-associated protein homolog (chicken)"""	611410	"""chromosome 6 open reading frame 32"""	C6orf32		9205841, 17150207, 17825087	Standard	NM_001286447		Approved	KIAA0386, DIFF48, MYONAP	uc003neo.1	Q9Y4F9	OTTHUMG00000014375	ENST00000259698.4:c.1296C>A	6.37:g.24843714G>T	ENSP00000259698:p.Ser432Arg					FAM65B_uc011djs.1_Missense_Mutation_p.S411R|FAM65B_uc011dju.1_Missense_Mutation_p.S416R|FAM65B_uc003nep.2_Missense_Mutation_p.S382R|FAM65B_uc011djt.1_Missense_Mutation_p.S382R	p.S432R	NM_014722	NP_055537	Q9Y4F9	FA65B_HUMAN			14	1472	-			432					A6NHP2|Q13529|Q5VV37|Q5VV38|Q9BQ28	Missense_Mutation	SNP	ENST00000259698.4	37	c.1296C>A	CCDS47383.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.951181	0.73787	.	.	ENSG00000111913	ENST00000259698;ENST00000538035;ENST00000378023;ENST00000540914;ENST00000510784	T;T;T;T;T	0.57107	0.42;0.42;0.42;0.42;0.42	4.99	3.91	0.45181	.	0.129222	0.64402	D	0.000001	T	0.50718	0.1632	M	0.62723	1.935	0.36773	D	0.883903	D;D;P;P	0.59357	0.973;0.985;0.946;0.946	P;P;P;P	0.56916	0.754;0.809;0.754;0.668	T	0.56232	-0.8013	10	0.54805	T	0.06	-22.4231	8.7415	0.34560	0.229:0.0:0.771:0.0	.	416;411;382;432	B7Z6U4;F5GX51;Q9Y4F9-2;Q9Y4F9	.;.;.;FA65B_HUMAN	R	432;411;382;382;416	ENSP00000259698:S432R;ENSP00000441138:S411R;ENSP00000367262:S382R;ENSP00000438425:S382R;ENSP00000441305:S416R	ENSP00000259698:S432R	S	-	3	2	FAM65B	24951693	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	2.644000	0.46613	2.305000	0.77605	0.561000	0.74099	AGC		0.478	FAM65B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040024.2			38	10	1	0	9.8876e-21	0.004878	1.56973e-20	38	10				
TRIM39	56658	broad.mit.edu	37	6	30297471	30297471	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr6:30297471G>C	ENST00000396547.1	+	2	537	c.377G>C	c.(376-378)tGc>tCc	p.C126S	TRIM39_ENST00000396548.1_Missense_Mutation_p.C126S|TRIM39-RPP21_ENST00000513556.1_Missense_Mutation_p.C38S|HCG18_ENST00000412685.2_RNA|HCG18_ENST00000426882.1_RNA|HCG18_ENST00000413358.2_RNA|TRIM39_ENST00000540416.1_Missense_Mutation_p.C126S|TRIM39_ENST00000376656.4_Missense_Mutation_p.C126S|TRIM39_ENST00000396551.3_Missense_Mutation_p.C126S|TRIM39_ENST00000376659.5_Missense_Mutation_p.C126S			Q9HCM9	TRI39_HUMAN	tripartite motif containing 39	126					apoptotic process (GO:0006915)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|positive regulation of apoptotic signaling pathway (GO:2001235)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.C126S(1)		ovary(3)	3						GAGGCTGTATGCTTGATATGT	0.577																																							uc010jrz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(376-378)TGC>TCC		tripartite motif-containing 39 isoform 1							68.0	72.0	71.0					6																	30297471		1509	2707	4216	SO:0001583	missense	56658				apoptosis	cytosol|mitochondrion	identical protein binding|zinc ion binding	g.chr6:30297471G>C	BC034985	CCDS34377.1, CCDS34378.1	6p22.1	2013-01-09	2011-01-25	2002-06-07	ENSG00000204599	ENSG00000204599		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10065	protein-coding gene	gene with protein product		605700	"""ring finger protein 23"", ""tripartite motif-containing 39"""	RNF23		11006080	Standard	NM_021253		Approved			Q9HCM9	OTTHUMG00000031066	ENST00000396547.1:c.377G>C	6.37:g.30297471G>C	ENSP00000379796:p.Cys126Ser					HCG18_uc003npx.2_5'Flank|HCG18_uc003npy.2_5'Flank|TRIM39_uc003npz.2_Missense_Mutation_p.C126S|TRIM39_uc003nqb.2_Missense_Mutation_p.C126S|TRIM39_uc003nqc.2_Missense_Mutation_p.C126S|TRIM39_uc010jsa.1_Missense_Mutation_p.C126S	p.C126S	NM_021253	NP_067076	Q9HCM9	TRI39_HUMAN			3	689	+			126			B box-type.		Q5STG3|Q5STG4|Q76BL3|Q8IYT9|Q96IB6	Missense_Mutation	SNP	ENST00000396547.1	37	c.377G>C	CCDS34377.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.9|20.9	4.072607|4.072607	0.76415|0.76415	.|.	.|.	ENSG00000204599|ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000248167	ENST00000420746|ENST00000458516;ENST00000396551;ENST00000376656;ENST00000545104;ENST00000540416;ENST00000449040;ENST00000412529;ENST00000428728;ENST00000396548;ENST00000376659;ENST00000396547;ENST00000513556	.|D;D;D;D;D;D;D;D;D	.|0.99080	.|-5.4;-5.4;-5.4;-5.4;-5.4;-5.4;-5.4;-5.4;-5.4	5.5|5.5	5.5|5.5	0.81552|0.81552	.|Zinc finger, B-box (3);	.|0.083882	.|0.50627	.|D	.|0.000115	D|D	0.99375|0.99375	0.9780|0.9780	M|M	0.90759|0.90759	3.145|3.145	0.49915|0.49915	D|D	0.999833|0.999833	.|D;D;D	.|0.89917	.|0.999;1.0;1.0	.|D;D;D	.|0.97110	.|0.994;0.998;1.0	D|D	0.98847|0.98847	1.0757|1.0757	5|10	.|0.66056	.|D	.|0.02	.|.	14.7732|14.7732	0.69696|0.69696	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|40;126;126	.|F5H2V3;Q9HCM9;Q9HCM9-2	.|.;TRI39_HUMAN;.	P|S	56|126;126;126;126;126;126;40;126;126;126;126;38	.|ENSP00000405928:C126S;ENSP00000379800:C126S;ENSP00000365844:C126S;ENSP00000439400:C126S;ENSP00000406019:C126S;ENSP00000379797:C126S;ENSP00000365847:C126S;ENSP00000379796:C126S;ENSP00000424048:C38S	.|ENSP00000365844:C126S	A|C	+|+	1|2	0|0	TRIM39|TRIM39-RPP21;TRIM39	30405450|30405450	1.000000|1.000000	0.71417|0.71417	0.760000|0.760000	0.31359|0.31359	0.753000|0.753000	0.42808|0.42808	8.856000|8.856000	0.92245|0.92245	2.868000|2.868000	0.98415|0.98415	0.555000|0.555000	0.69702|0.69702	GCT|TGC		0.577	TRIM39-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076086.2	NM_172016		55	23	0	0	0	0.00361	0	55	23				
ABCF1	23	broad.mit.edu	37	6	30545863	30545863	+	Missense_Mutation	SNP	A	A	G	rs191359115		TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr6:30545863A>G	ENST00000326195.8	+	4	339	c.227A>G	c.(226-228)aAg>aGg	p.K76R	ABCF1_ENST00000376545.3_Missense_Mutation_p.K76R|ABCF1_ENST00000396515.4_Missense_Mutation_p.K76R	NM_001025091.1	NP_001020262.1	Q8NE71	ABCF1_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 1	76					inflammatory response (GO:0006954)|positive regulation of translation (GO:0045727)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)|ribosome (GO:0005840)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)|translation activator activity (GO:0008494)|translation factor activity, nucleic acid binding (GO:0008135)	p.K76R(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(3)|skin(2)	21						CAAAAAAAAAAGCGAGATACC	0.493													A|||	1	0.000199681	0.0	0.0	5008	,	,		18622	0.0		0.001	False		,,,				2504	0.0						uc003nql.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(226-228)AAG>AGG		ATP-binding cassette, sub-family F, member 1							73.0	79.0	77.0					6																	30545863		2203	4300	6503	SO:0001583	missense	23				inflammatory response|translational initiation	nuclear envelope|nuclear envelope|nucleoplasm|nucleoplasm|polysomal ribosome	ATP binding|ATP binding|ATPase activity|protein binding|ribosome binding|translation activator activity|translation factor activity, nucleic acid binding	g.chr6:30545863A>G	AF027302	CCDS34380.1, CCDS34381.1	6p21.33	2012-03-14			ENSG00000204574	ENSG00000204574		"""ATP binding cassette transporters / subfamily F"""	70	protein-coding gene	gene with protein product		603429		ABC50		9790762	Standard	NM_001025091		Approved	EST123147	uc003nql.3	Q8NE71	OTTHUMG00000031094	ENST00000326195.8:c.227A>G	6.37:g.30545863A>G	ENSP00000313603:p.Lys76Arg					ABCF1_uc003nqk.2_Missense_Mutation_p.K77R|ABCF1_uc003nqm.2_Missense_Mutation_p.K76R|ABCF1_uc010jsb.2_Missense_Mutation_p.K76R	p.K76R	NM_001025091	NP_001020262	Q8NE71	ABCF1_HUMAN			4	322	+			76					A2BF75|O14897|Q69YP6	Missense_Mutation	SNP	ENST00000326195.8	37	c.227A>G	CCDS34380.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	A	20.9	4.062531	0.76187	.	.	ENSG00000204574	ENST00000326195;ENST00000376545;ENST00000455943;ENST00000441867;ENST00000396515	T;T;T;T	0.58652	0.95;0.55;0.32;3.32	5.53	5.53	0.82687	.	0.061223	0.64402	D	0.000008	T	0.19248	0.0462	N	0.19112	0.55	0.24107	N	0.995853	B;B;B;B	0.21071	0.01;0.018;0.018;0.051	B;B;B;B	0.23716	0.01;0.028;0.028;0.048	T	0.06499	-1.0823	10	0.14252	T	0.57	-25.2983	8.5275	0.33313	0.9131:0.0:0.0869:0.0	.	76;76;76;76	Q5STZ7;Q2L6I2;Q8NE71;A2BF75	.;.;ABCF1_HUMAN;.	R	76;76;77;77;76	ENSP00000313603:K76R;ENSP00000365728:K76R;ENSP00000405512:K77R;ENSP00000379772:K76R	ENSP00000313603:K76R	K	+	2	0	ABCF1	30653842	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	5.462000	0.66707	2.232000	0.73038	0.455000	0.32223	AAG		0.493	ABCF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076137.3			29	68	0	0	0	0.00632	0	29	68				
TCP11	6954	broad.mit.edu	37	6	35090040	35090040	+	Missense_Mutation	SNP	C	C	A	rs142915532	byFrequency	TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr6:35090040C>A	ENST00000512012.1	-	4	588	c.432G>T	c.(430-432)ttG>ttT	p.L144F	TCP11_ENST00000418521.2_Missense_Mutation_p.L81F|TCP11_ENST00000373979.2_Missense_Mutation_p.L82F|TCP11_ENST00000373974.4_Missense_Mutation_p.L111F|TCP11_ENST00000311875.5_Missense_Mutation_p.L157F|TCP11_ENST00000244645.3_Missense_Mutation_p.L82F|TCP11_ENST00000412155.2_Missense_Mutation_p.L106F|TCP11_ENST00000444780.2_Missense_Mutation_p.L152F			Q8WWU5	TCP11_HUMAN	t-complex 11, testis-specific	144					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.L157F(1)|p.L82F(1)		breast(1)|kidney(5)|large_intestine(3)|lung(10)|ovary(3)|prostate(1)|skin(4)	27						CCTGCTTGAGCAAGTCCATGT	0.488																																							uc003okd.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|skin(2)	5						c.(469-471)TTG>TTT		t-complex 11 isoform 1							128.0	118.0	121.0					6																	35090040		2203	4300	6503	SO:0001583	missense	6954				cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane		g.chr6:35090040C>A		CCDS4799.1, CCDS47413.1, CCDS59015.1, CCDS59016.1, CCDS59017.1, CCDS59018.1	6p21.31	2012-09-20	2012-09-20		ENSG00000124678	ENSG00000124678			11658	protein-coding gene	gene with protein product	"""fertilization-promoting peptide receptor"""	186982	"""t-complex 11 (a murine tcp homolog)"", ""t-complex 11 homolog (mouse)"""	D6S230E		1427894, 11756566, 21597245	Standard	NM_001093728		Approved	KIAA0229, FPPR	uc003okd.2	Q8WWU5	OTTHUMG00000014560	ENST00000512012.1:c.432G>T	6.37:g.35090040C>A	ENSP00000425995:p.Leu144Phe					TCP11_uc003ojz.1_Missense_Mutation_p.L82F|TCP11_uc003oka.2_Missense_Mutation_p.L82F|TCP11_uc003okb.2_Missense_Mutation_p.L81F|TCP11_uc003okc.2_Missense_Mutation_p.L81F|TCP11_uc011dsu.1_Missense_Mutation_p.L139F|TCP11_uc011dsv.1_Missense_Mutation_p.L106F|TCP11_uc011dsw.1_Missense_Mutation_p.L111F	p.L157F	NM_001093728	NP_001087197	Q8WWU5	TCP11_HUMAN			5	652	-			144					B2RCE9|B3KQ27|B7Z7B5|B7Z7G1|B7Z7H4|B7Z7S8|E7EP29|J3KNG1|Q8NF85|Q9NQZ9|Q9NR39	Missense_Mutation	SNP	ENST00000512012.1	37	c.471G>T		.	.	.	.	.	.	.	.	.	.	C	7.904	0.735055	0.15574	.	.	ENSG00000124678	ENST00000373979;ENST00000412155;ENST00000244645;ENST00000373977;ENST00000311875;ENST00000444780;ENST00000373974;ENST00000418521;ENST00000512012;ENST00000486638;ENST00000492680;ENST00000507706	T;T;T;T;T;T;T;T;T;T;T	0.16597	2.33;2.33;2.33;2.33;2.33;2.33;2.33;2.33;2.33;2.33;2.33	4.33	-1.25	0.09405	.	0.484848	0.21627	N	0.071551	T	0.17789	0.0427	M	0.66506	2.035	0.31350	N	0.682623	B;B;B;B;B;B	0.28512	0.073;0.073;0.073;0.208;0.154;0.214	B;B;B;B;B;B	0.43508	0.2;0.2;0.2;0.269;0.358;0.422	T	0.32161	-0.9917	10	0.41790	T	0.15	.	21.9792	0.99964	0.0:0.7424:0.2576:0.0	.	111;106;152;217;144;82	B7Z7G1;E7EP29;B7Z7B5;Q5TB88;Q8WWU5;Q8WWU5-2	.;.;.;.;TCP11_HUMAN;.	F	82;106;82;106;157;152;111;81;144;3;82;81	ENSP00000363091:L82F;ENSP00000402816:L106F;ENSP00000244645:L82F;ENSP00000308708:L157F;ENSP00000404479:L152F;ENSP00000363085:L111F;ENSP00000415320:L81F;ENSP00000425995:L144F;ENSP00000421103:L3F;ENSP00000422774:L82F;ENSP00000423183:L81F	ENSP00000244645:L82F	L	-	3	2	TCP11	35198018	0.322000	0.24634	0.004000	0.12327	0.036000	0.12997	-0.504000	0.06375	-0.390000	0.07774	-0.300000	0.09419	TTG		0.488	TCP11-014	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000370354.1	NM_001093728		68	36	1	0	2.26907e-38	0.00361	4.3973e-38	68	36				
FGD2	221472	broad.mit.edu	37	6	36976674	36976674	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr6:36976674C>A	ENST00000274963.8	+	2	304	c.133C>A	c.(133-135)Cct>Act	p.P45T		NM_173558.3	NP_775829.2	Q7Z6J4	FGD2_HUMAN	FYVE, RhoGEF and PH domain containing 2	45					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.P45T(1)		central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	25						TGAGTGCAGGCCTCCCGAGTC	0.632																																							uc010jwp.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|lung(1)|pancreas(1)	3						c.(133-135)CCT>ACT		FYVE, RhoGEF and PH domain containing 2							56.0	60.0	59.0					6																	36976674		2203	4300	6503	SO:0001583	missense	221472				actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|early endosome membrane|Golgi apparatus|lamellipodium|nucleus|ruffle membrane	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding	g.chr6:36976674C>A	AK097230	CCDS4829.1	6p21.2	2013-01-10	2004-08-24		ENSG00000146192	ENSG00000146192		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	3664	protein-coding gene	gene with protein product		605091	"""FGD1 family, member 2"""			10458911	Standard	NM_173558		Approved	ZFYVE4	uc010jwp.1	Q7Z6J4	OTTHUMG00000014616	ENST00000274963.8:c.133C>A	6.37:g.36976674C>A	ENSP00000274963:p.Pro45Thr					FGD2_uc003onf.2_Missense_Mutation_p.P45T|FGD2_uc011dtu.1_Missense_Mutation_p.P45T|FGD2_uc003ong.2_5'UTR|FGD2_uc011dtv.1_5'UTR	p.P45T	NM_173558	NP_775829	Q7Z6J4	FGD2_HUMAN			2	304	+			45					Q5T8I1|Q6P6A8|Q6ZNL5|Q8IZ32|Q8N868|Q9H7M2	Missense_Mutation	SNP	ENST00000274963.8	37	c.133C>A	CCDS4829.1	.	.	.	.	.	.	.	.	.	.	C	11.31	1.599929	0.28534	.	.	ENSG00000146192	ENST00000274963	T	0.57436	0.4	5.04	-2.51	0.06365	.	1.659580	0.03369	N	0.198628	T	0.11110	0.0271	N	0.24115	0.695	0.09310	N	1	B;B;B	0.16396	0.003;0.0;0.017	B;B;B	0.12156	0.007;0.001;0.007	T	0.04090	-1.0978	10	0.13108	T	0.6	0.0445	1.067	0.01613	0.261:0.3694:0.1171:0.2525	.	45;45;45	B4DV77;Q7Z6J4;F8WEZ2	.;FGD2_HUMAN;.	T	45	ENSP00000274963:P45T	ENSP00000274963:P45T	P	+	1	0	FGD2	37084652	0.000000	0.05858	0.000000	0.03702	0.239000	0.25481	-1.776000	0.01781	-0.337000	0.08426	0.561000	0.74099	CCT		0.632	FGD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040398.2	NM_173558		39	24	1	0	5.04308e-16	0.00623	7.5781e-16	39	24				
TDRD6	221400	broad.mit.edu	37	6	46658781	46658781	+	Silent	SNP	A	A	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr6:46658781A>T	ENST00000316081.6	+	1	2916	c.2916A>T	c.(2914-2916)ctA>ctT	p.L972L	TDRD6_ENST00000544460.1_Silent_p.L972L|RP11-446F17.3_ENST00000434329.2_RNA	NM_001010870.2	NP_001010870.1	O60522	TDRD6_HUMAN	tudor domain containing 6	972					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|P granule (GO:0043186)		p.L972L(1)		NS(1)|breast(9)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80			Lung(136;0.192)			CTGTTCAGCTACATTCCTACT	0.388																																							uc003oyj.2		NA																	1	Substitution - coding silent(1)		lung(1)	breast(3)|ovary(2)|skin(1)	6						c.(2914-2916)CTA>CTT		tudor domain containing 6							58.0	64.0	62.0					6																	46658781		2203	4300	6503	SO:0001819	synonymous_variant	221400				cell differentiation|multicellular organismal development|spermatogenesis	chromatoid body	nucleic acid binding	g.chr6:46658781A>T	AF039442	CCDS34470.1, CCDS55017.1	6p12.3	2013-01-23			ENSG00000180113	ENSG00000180113		"""Tudor domain containing"""	21339	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.2"", ""spermatogenesis associated 36"""	611200				9610721	Standard	NM_001010870		Approved	NY-CO-45, bA446F17.4, CT41.2, SPATA36	uc003oyj.3	O60522	OTTHUMG00000014788	ENST00000316081.6:c.2916A>T	6.37:g.46658781A>T						TDRD6_uc010jze.2_Silent_p.L966L	p.L972L	NM_001010870	NP_001010870	O60522	TDRD6_HUMAN	Lung(136;0.192)		1	2916	+			972					B3KWU2|F5H5M3|Q5HYB1|Q5VTS4|Q6ZMX5	Silent	SNP	ENST00000316081.6	37	c.2916A>T	CCDS34470.1																																																																																				0.388	TDRD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040800.1	XM_166443		40	18	0	0	0	0.010771	0	40	18				
MCM3	4172	broad.mit.edu	37	6	52143587	52143587	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr6:52143587C>T	ENST00000229854.7	-	6	908	c.832G>A	c.(832-834)Gct>Act	p.A278T	MCM3_ENST00000596288.1_Missense_Mutation_p.A323T|MCM3_ENST00000476448.1_5'UTR|MCM3_ENST00000419835.2_Missense_Mutation_p.A232T			P25205	MCM3_HUMAN	minichromosome maintenance complex component 3	278					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	alpha DNA polymerase:primase complex (GO:0005658)|centrosome (GO:0005813)|intracellular membrane-bounded organelle (GO:0043231)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)	p.A278T(1)		endometrium(4)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	20	Lung NSC(77;0.0931)					ATATCCTCAGCAGAGAAAGAG	0.438																																							uc003pan.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)|skin(1)	3						c.(832-834)GCT>ACT		minichromosome maintenance complex component 3							95.0	92.0	93.0					6																	52143587		2203	4300	6503	SO:0001583	missense	4172				cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	alpha DNA polymerase:primase complex|centrosome|MCM complex|perinuclear region of cytoplasm	ATP binding|DNA binding|helicase activity|protein binding	g.chr6:52143587C>T	X62153	CCDS4940.1, CCDS4940.2, CCDS75468.1	6p12	2008-02-05	2007-04-04		ENSG00000112118	ENSG00000112118			6945	protein-coding gene	gene with protein product		602693	"""minichromosome maintenance deficient (S. cerevisiae) 3"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae)"""			1549468	Standard	NM_002388		Approved		uc011dwu.2	P25205	OTTHUMG00000014844	ENST00000229854.7:c.832G>A	6.37:g.52143587C>T	ENSP00000229854:p.Ala278Thr					MCM3_uc011dwu.1_Missense_Mutation_p.A232T	p.A278T	NM_002388	NP_002379	P25205	MCM3_HUMAN			6	942	-	Lung NSC(77;0.0931)		278					B4DWW4|Q92660|Q9BTR3|Q9NUE7	Missense_Mutation	SNP	ENST00000229854.7	37	c.832G>A		.	.	.	.	.	.	.	.	.	.	C	21.1	4.095445	0.76870	.	.	ENSG00000112118	ENST00000229854;ENST00000419835	T;T	0.02552	4.32;4.25	5.55	5.55	0.83447	.	0.153336	0.64402	D	0.000020	T	0.03564	0.0102	M	0.78049	2.395	0.80722	D	1	B;B	0.29936	0.029;0.262	B;B	0.29598	0.017;0.104	T	0.23119	-1.0197	10	0.48119	T	0.1	-18.9029	18.671	0.91512	0.0:1.0:0.0:0.0	.	232;278	B4DUQ9;P25205	.;MCM3_HUMAN	T	278;232	ENSP00000229854:A278T;ENSP00000388647:A232T	ENSP00000229854:A278T	A	-	1	0	MCM3	52251546	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.625000	0.67770	2.885000	0.99019	0.655000	0.94253	GCT		0.438	MCM3-006	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470784.1			41	19	0	0	0	0.010771	0	41	19				
PRIM2	5558	broad.mit.edu	37	6	57183296	57183296	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr6:57183296G>T	ENST00000607273.1	+	2	140	c.53G>T	c.(52-54)aGg>aTg	p.R18M	PRIM2_ENST00000389488.2_3'UTR	NM_000947.3	NP_000938.2	P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)	18					DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)	p.R18M(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		GGTGACCAGAGGAATGCTTCC	0.398																																							uc003pdx.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(52-54)AGG>ATG		DNA primase polypeptide 2							62.0	60.0	60.0					6																	57183296		1881	4116	5997	SO:0001583	missense	5558				DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding	g.chr6:57183296G>T		CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000607273.1:c.53G>T	6.37:g.57183296G>T	ENSP00000475738:p.Arg18Met					PRIM2_uc003pdv.1_Missense_Mutation_p.R18M|PRIM2_uc003pdw.2_Missense_Mutation_p.R18M	p.R18M	NM_000947	NP_000938	P49643	PRI2_HUMAN		Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)	2	140	+			18					Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	Missense_Mutation	SNP	ENST00000607273.1	37	c.53G>T																																																																																					0.398	PRIM2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_000947		9	13	1	0	2.17888e-05	0.006214	2.4393e-05	9	13				
PHIP	55023	broad.mit.edu	37	6	79697925	79697925	+	Splice_Site	SNP	C	C	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr6:79697925C>T	ENST00000275034.4	-	21	2628		c.e21+1			NM_017934.5	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein						cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)	p.?(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(10)|kidney(4)|large_intestine(20)|lung(20)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	68		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		TGATATCTTACATCTGAAGAA	0.318																																							uc003pir.2		NA																	1	Unknown(1)		lung(1)	large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	6						c.e21+1		pleckstrin homology domain interacting protein							171.0	162.0	165.0					6																	79697925		2203	4300	6503	SO:0001630	splice_region_variant	55023				insulin receptor signaling pathway|negative regulation of apoptosis|positive regulation of cell proliferation|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis	nucleus	insulin receptor binding	g.chr6:79697925C>T	AF310250	CCDS4987.1	6q14	2013-01-09			ENSG00000146247	ENSG00000146247		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	15673	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 14"""	612870		WDR11		11018022	Standard	NM_017934		Approved	ndrp, FLJ20705, DCAF14, BRWD2	uc003pir.3	Q8WWQ0	OTTHUMG00000015071	ENST00000275034.4:c.2460+1G>A	6.37:g.79697925C>T						PHIP_uc011dyp.1_Splice_Site_p.D819_splice	p.D820_splice	NM_017934	NP_060404	Q8WWQ0	PHIP_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.231)	21	2686	-		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)						A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Splice_Site	SNP	ENST00000275034.4	37	c.2460_splice	CCDS4987.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.220895	0.79464	.	.	ENSG00000146247	ENST00000275034	.	.	.	5.07	5.07	0.68467	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5945	0.76569	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PHIP	79754644	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	5.694000	0.68272	2.344000	0.79699	0.650000	0.86243	.		0.318	PHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041297.2		Intron	10	65	0	0	0	0.001368	0	10	65				
C6orf165	154313	broad.mit.edu	37	6	88138502	88138502	+	Silent	SNP	G	G	A	rs183010552	byFrequency	TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr6:88138502G>A	ENST00000507897.1	+	9	1202	c.1119G>A	c.(1117-1119)gcG>gcA	p.A373A	C6ORF165_ENST00000369562.4_Silent_p.A373A			Q8IYR0	CF165_HUMAN	chromosome 6 open reading frame 165	373								p.A373A(2)		NS(1)|central_nervous_system(1)|large_intestine(5)|lung(8)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0419)		TTAATGGAGCGACTGTGAAAA	0.368													.|||	2	0.000399361	0.0	0.0	5008	,	,		17626	0.002		0.0	False		,,,				2504	0.0						uc003plv.2		NA																	2	Substitution - coding silent(2)		lung(2)	central_nervous_system(1)	1						c.(1117-1119)GCG>GCA		hypothetical protein LOC154313 isoform 1							123.0	109.0	114.0					6																	88138502		2203	4300	6503	SO:0001819	synonymous_variant	154313							g.chr6:88138502G>A	BC035083	CCDS34498.1	6q15	2012-02-07			ENSG00000213204	ENSG00000213204			21405	protein-coding gene	gene with protein product							Standard	NM_001031743		Approved	FLJ25974, dJ382I10.1	uc003plv.3	Q8IYR0	OTTHUMG00000015173	ENST00000507897.1:c.1119G>A	6.37:g.88138502G>A						C6orf165_uc003plw.2_Silent_p.A185A|C6orf165_uc010kbv.1_RNA|C6orf165_uc003plu.1_Silent_p.A373A	p.A373A	NM_001031743	NP_001026913	Q8IYR0	CF165_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0419)	9	1211	+		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)	373					A8K969|E1P507|Q8N9U4	Silent	SNP	ENST00000507897.1	37	c.1119G>A	CCDS34498.1																																																																																				0.368	C6orf165-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding	OTTHUMT00000470406.1	NM_178823		27	34	0	0	0	0.005443	0	27	34				
CLVS2	134829	broad.mit.edu	37	6	123318960	123318960	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr6:123318960T>A	ENST00000275162.5	+	2	1373	c.38T>A	c.(37-39)cTg>cAg	p.L13Q	CLVS2_ENST00000368438.1_Intron	NM_001010852.3	NP_001010852.2	Q5SYC1	CLVS2_HUMAN	clavesin 2	13					lysosome organization (GO:0007040)	clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|transporter activity (GO:0005215)	p.L13Q(2)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(24)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	40						CCTGAGACCCTGGAGAAAGCT	0.537																																							uc003pzi.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						c.(37-39)CTG>CAG		retinaldehyde binding protein 1-like 2							87.0	85.0	85.0					6																	123318960		2203	4300	6503	SO:0001583	missense	134829				lysosome organization	clathrin-coated vesicle|early endosome membrane|trans-Golgi network	phosphatidylinositol-3,5-bisphosphate binding|transporter activity	g.chr6:123318960T>A	AK095527	CCDS34525.1	6q22.31	2009-10-14	2009-10-14	2009-10-14	ENSG00000146352	ENSG00000146352			23046	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 212"", ""chromosome 6 open reading frame 213"", ""retinaldehyde binding protein 1-like 2"""	C6orf212, C6orf213, RLBP1L2		19651769	Standard	NM_001010852		Approved	bA160A10.4	uc003pzi.1	Q5SYC1	OTTHUMG00000015495	ENST00000275162.5:c.38T>A	6.37:g.123318960T>A	ENSP00000275162:p.Leu13Gln						p.L13Q	NM_001010852	NP_001010852	Q5SYC1	CLVS2_HUMAN			2	907	+			13					B3KTG5|B4DHL0|C8UZT4|Q5SYC0	Missense_Mutation	SNP	ENST00000275162.5	37	c.38T>A	CCDS34525.1	.	.	.	.	.	.	.	.	.	.	T	15.91	2.972347	0.53614	.	.	ENSG00000146352	ENST00000275162	T	0.80033	-1.33	5.39	5.39	0.77823	Phosphatidylinositol transfer protein-like, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.50086	0.1595	N	0.05158	-0.105	0.80722	D	1	B	0.23990	0.095	B	0.17979	0.02	T	0.54234	-0.8324	10	0.37606	T	0.19	0.7355	15.5751	0.76373	0.0:0.0:0.0:1.0	.	13	Q5SYC1	CLVS2_HUMAN	Q	13	ENSP00000275162:L13Q	ENSP00000275162:L13Q	L	+	2	0	CLVS2	123360659	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.858000	0.86971	2.270000	0.75569	0.477000	0.44152	CTG		0.537	CLVS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042042.2	NM_001010852		15	38	0	0	0	0.004007	0	15	38				
ALDH8A1	64577	broad.mit.edu	37	6	135239695	135239695	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr6:135239695C>A	ENST00000265605.2	-	7	1390	c.1322G>T	c.(1321-1323)gGc>gTc	p.G441V	ALDH8A1_ENST00000367847.2_Missense_Mutation_p.G391V|ALDH8A1_ENST00000367845.2_Missense_Mutation_p.G387V	NM_022568.3	NP_072090.1	Q9H2A2	AL8A1_HUMAN	aldehyde dehydrogenase 8 family, member A1	441					9-cis-retinoic acid biosynthetic process (GO:0042904)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	retinal dehydrogenase activity (GO:0001758)	p.G441V(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	36	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00401)|GBM - Glioblastoma multiforme(68;0.0058)		CCAGACCAAGCCAGACTGCAG	0.562																																							uc003qew.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)|skin(1)	4						c.(1321-1323)GGC>GTC		aldehyde dehydrogenase 8A1 isoform 1							95.0	74.0	81.0					6																	135239695		2203	4300	6503	SO:0001583	missense	64577				retinal metabolic process	cytoplasm	retinal dehydrogenase activity	g.chr6:135239695C>A	AL021939	CCDS5171.1, CCDS5172.1, CCDS55057.1	6q24.1-q25.1	2008-07-03			ENSG00000118514	ENSG00000118514		"""Aldehyde dehydrogenases"""	15471	protein-coding gene	gene with protein product		606467				11007799	Standard	NM_001193480		Approved	ALDH12	uc003qew.3	Q9H2A2	OTTHUMG00000015623	ENST00000265605.2:c.1322G>T	6.37:g.135239695C>A	ENSP00000265605:p.Gly441Val					ALDH8A1_uc003qex.2_Missense_Mutation_p.G387V|ALDH8A1_uc010kgh.2_Missense_Mutation_p.G219V|ALDH8A1_uc011ecx.1_Missense_Mutation_p.G391V	p.G441V	NM_022568	NP_072090	Q9H2A2	AL8A1_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;0.00401)|GBM - Glioblastoma multiforme(68;0.0058)	7	1375	-	Colorectal(23;0.221)		441					B7Z521|O60793|Q24JS9|Q53GT3|Q5TI80	Missense_Mutation	SNP	ENST00000265605.2	37	c.1322G>T	CCDS5171.1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.951520	0.92660	.	.	ENSG00000118514	ENST00000265605;ENST00000367845;ENST00000367847;ENST00000460753	D;T;D;D	0.87029	-2.2;0.6;-2.2;-2.2	6.07	6.07	0.98685	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.000000	0.85682	D	0.000000	D	0.96030	0.8707	H	0.96365	3.81	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.999	D	0.96316	0.9232	10	0.87932	D	0	.	20.6439	0.99570	0.0:1.0:0.0:0.0	.	391;387;441	B7Z521;Q9H2A2-2;Q9H2A2	.;.;AL8A1_HUMAN	V	441;387;391;126	ENSP00000265605:G441V;ENSP00000356819:G387V;ENSP00000356821:G391V;ENSP00000437161:G126V	ENSP00000265605:G441V	G	-	2	0	ALDH8A1	135281388	1.000000	0.71417	0.800000	0.32199	0.869000	0.49853	7.710000	0.84655	2.884000	0.98904	0.655000	0.94253	GGC		0.562	ALDH8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042334.2			15	30	1	0	2.23348e-06	0.004007	2.61504e-06	15	30				
WIPI2	26100	broad.mit.edu	37	7	5256250	5256250	+	Silent	SNP	G	G	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr7:5256250G>A	ENST00000288828.4	+	5	670	c.438G>A	c.(436-438)aaG>aaA	p.K146K	WIPI2_ENST00000404704.3_Silent_p.K146K|WIPI2_ENST00000484262.1_Silent_p.K87K|WIPI2_ENST00000401525.3_Silent_p.K128K|WIPI2_ENST00000382384.2_Silent_p.K128K	NM_001033518.1|NM_001278299.1|NM_015610.3	NP_001028690.1|NP_001265228.1|NP_056425.1	Q9Y4P8	WIPI2_HUMAN	WD repeat domain, phosphoinositide interacting 2	146					autophagic vacuole assembly (GO:0000045)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|pre-autophagosomal structure (GO:0000407)|pre-autophagosomal structure membrane (GO:0034045)|protein complex (GO:0043234)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)	p.K146K(1)		NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)	16		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0925)|OV - Ovarian serous cystadenocarcinoma(56;2.59e-14)		GGGACATGAAGGTGCTGCATA	0.498																																							uc003snv.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(436-438)AAG>AAA		WD repeat domain, phosphoinositide interacting 2							144.0	119.0	127.0					7																	5256250		2203	4300	6503	SO:0001819	synonymous_variant	26100				autophagic vacuole assembly	cytosol|PAS complex|pre-autophagosomal structure membrane	phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding	g.chr7:5256250G>A		CCDS5339.1, CCDS34593.1, CCDS47531.1, CCDS47532.1, CCDS47533.1	7p22.1	2014-02-12			ENSG00000157954	ENSG00000157954		"""WD repeat domain containing"""	32225	protein-coding gene	gene with protein product		609225				15602573	Standard	NM_001278299		Approved	Atg21, CGI-50, FLJ12979, FLJ14217, FLJ42984, DKFZP434J154, DKFZp686P02188, ATG18B	uc003snv.3	Q9Y4P8	OTTHUMG00000121179	ENST00000288828.4:c.438G>A	7.37:g.5256250G>A						WIPI2_uc003snw.2_Silent_p.K146K|WIPI2_uc003snx.2_Silent_p.K128K|WIPI2_uc003sny.2_Silent_p.K128K|WIPI2_uc010ksv.2_Silent_p.K2K|WIPI2_uc003snz.2_Silent_p.K87K|WIPI2_uc003soa.2_Silent_p.K87K	p.K146K	NM_015610	NP_056425	Q9Y4P8	WIPI2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.0925)|OV - Ovarian serous cystadenocarcinoma(56;2.59e-14)	5	654	+		Ovarian(82;0.0175)	146					B3KNC2|Q5MNZ8|Q6FI96|Q75L50|Q96IE4|Q9Y364	Silent	SNP	ENST00000288828.4	37	c.438G>A	CCDS5339.1																																																																																				0.498	WIPI2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000241669.2	NM_015610		33	102	0	0	0	0.006999	0	33	102				
MIOS	54468	broad.mit.edu	37	7	7622753	7622753	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr7:7622753G>C	ENST00000340080.4	+	6	1819	c.1398G>C	c.(1396-1398)atG>atC	p.M466I	MIOS_ENST00000461907.2_3'UTR|MIOS_ENST00000405785.1_Missense_Mutation_p.M466I	NM_019005.3	NP_061878.3	Q9NXC5	MIO_HUMAN	missing oocyte, meiosis regulator, homolog (Drosophila)	466						lysosomal membrane (GO:0005765)		p.M466I(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(15)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						TTTTAGGAATGGTGGAAAGCA	0.303																																							uc003srf.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1396-1398)ATG>ATC		missing oocyte, meiosis regulator, homolog							89.0	88.0	88.0					7																	7622753		1815	4071	5886	SO:0001583	missense	54468							g.chr7:7622753G>C		CCDS43554.1	7p21.3	2011-09-12			ENSG00000164654	ENSG00000164654			21905	protein-coding gene	gene with protein product	"""WD repeat-containing protein mio"""	615359				14973288	Standard	NM_019005		Approved	FLJ20323	uc003srf.3	Q9NXC5	OTTHUMG00000152440	ENST00000340080.4:c.1398G>C	7.37:g.7622753G>C	ENSP00000339881:p.Met466Ile					MIOS_uc003srg.2_Missense_Mutation_p.M1I|MIOS_uc010ktq.2_5'Flank	p.M466I	NM_019005	NP_061878	Q9NXC5	MIO_HUMAN			6	1706	+			466					B2RTV6|O75216|Q7L551|Q9H092	Missense_Mutation	SNP	ENST00000340080.4	37	c.1398G>C	CCDS43554.1	.	.	.	.	.	.	.	.	.	.	G	12.42	1.931670	0.34096	.	.	ENSG00000164654	ENST00000340080;ENST00000405785	T;T	0.39997	1.05;1.05	5.77	5.77	0.91146	.	0.152620	0.46145	D	0.000308	T	0.19765	0.0475	N	0.04508	-0.205	0.34827	D	0.739291	B	0.10296	0.003	B	0.08055	0.003	T	0.21177	-1.0253	10	0.30078	T	0.28	-8.4073	7.8955	0.29704	0.1882:0.0:0.8118:0.0	.	466	Q9NXC5	MIO_HUMAN	I	466	ENSP00000339881:M466I;ENSP00000384088:M466I	ENSP00000339881:M466I	M	+	3	0	MIOS	7589278	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.710000	0.37920	2.902000	0.99343	0.650000	0.86243	ATG		0.303	MIOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326218.1	NM_019005		20	80	0	0	0	0.007413	0	20	80				
KLHL7	55975	broad.mit.edu	37	7	23163444	23163444	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr7:23163444G>T	ENST00000339077.5	+	2	412	c.169G>T	c.(169-171)Gct>Tct	p.A57S	KLHL7_ENST00000545771.1_Missense_Mutation_p.A35S|KLHL7_ENST00000542558.1_Intron|KLHL7_ENST00000322275.5_Missense_Mutation_p.A57S|KLHL7_ENST00000409689.1_Missense_Mutation_p.A9S|KLHL7_ENST00000539124.1_Intron|KLHL7_ENST00000545443.1_Missense_Mutation_p.A35S|KLHL7_ENST00000322231.7_Missense_Mutation_p.A35S|KLHL7_ENST00000410047.1_Missense_Mutation_p.A35S|KLHL7_ENST00000479288.1_Intron	NM_001031710.2	NP_001026880.2	Q8IXQ5	KLHL7_HUMAN	kelch-like family member 7	57	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)	p.A57S(1)|p.A35S(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						AAAGATACCTGCTCATCGTGT	0.358																																							uc003svs.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(169-171)GCT>TCT		kelch-like 7 isoform 1							160.0	144.0	149.0					7																	23163444		2203	4300	6503	SO:0001583	missense	55975					Golgi apparatus|nucleolus|plasma membrane		g.chr7:23163444G>T		CCDS5378.1, CCDS34609.1, CCDS5378.2, CCDS55095.1	7p15.3	2013-01-30	2013-01-30		ENSG00000122550	ENSG00000122550		"""Kelch-like"", ""BTB/POZ domain containing"""	15646	protein-coding gene	gene with protein product	"""retinitis pigmentosa 42"""	611119	"""kelch-like 7 (Drosophila)"""			19520207	Standard	NM_001031710		Approved	KLHL6, SBBI26, RP42	uc003svs.4	Q8IXQ5	OTTHUMG00000094813	ENST00000339077.5:c.169G>T	7.37:g.23163444G>T	ENSP00000343273:p.Ala57Ser					KLHL7_uc003svr.3_Missense_Mutation_p.A35S|KLHL7_uc011jys.1_Intron|KLHL7_uc011jyt.1_Intron|KLHL7_uc003svt.2_Missense_Mutation_p.A9S|KLHL7_uc003svp.2_Missense_Mutation_p.A35S|KLHL7_uc003svq.2_Missense_Mutation_p.A57S|KLHL7_uc011jyu.1_Missense_Mutation_p.A35S	p.A57S	NM_001031710	NP_001026880	Q8IXQ5	KLHL7_HUMAN			2	462	+			57			BTB.		A4D144|B7Z5I9|G5E9G3|Q7Z765|Q96MV2|Q9BQF8|Q9UDQ9	Missense_Mutation	SNP	ENST00000339077.5	37	c.169G>T	CCDS34609.1	.	.	.	.	.	.	.	.	.	.	G	33	5.217590	0.95104	.	.	ENSG00000122550	ENST00000538858;ENST00000536369;ENST00000322231;ENST00000339077;ENST00000322275;ENST00000409689;ENST00000410047;ENST00000545771;ENST00000545443	T;T;T;T;T;T;T	0.77750	-1.12;-1.12;-1.12;-1.12;-1.12;-1.12;-1.12	5.46	5.46	0.80206	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.90027	0.6886	M	0.87456	2.885	0.80722	D	1	D;D;D;D;D	0.89917	0.998;1.0;1.0;0.998;0.998	D;D;D;D;D	0.80764	0.994;0.991;0.984;0.994;0.994	D	0.90899	0.4767	10	0.66056	D	0.02	.	19.6805	0.95960	0.0:0.0:1.0:0.0	.	35;57;35;57;35	F5GYE2;Q8IXQ5;Q8IXQ5-2;Q8IXQ5-3;Q8IXQ5-4	.;KLHL7_HUMAN;.;.;.	S	57;57;35;57;57;9;35;35;35	ENSP00000322958:A35S;ENSP00000343273:A57S;ENSP00000323270:A57S;ENSP00000386263:A9S;ENSP00000386999:A35S;ENSP00000446445:A35S;ENSP00000442366:A35S	ENSP00000322958:A35S	A	+	1	0	KLHL7	23129969	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.829000	0.92055	2.724000	0.93272	0.563000	0.77884	GCT		0.358	KLHL7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326860.3	NM_018846		25	65	1	0	4.87955e-14	0.005443	6.89022e-14	25	65				
IGF2BP3	10643	broad.mit.edu	37	7	23387344	23387344	+	Silent	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr7:23387344G>T	ENST00000258729.3	-	7	1049	c.693C>A	c.(691-693)gtC>gtA	p.V231V		NM_006547.2	NP_006538.2	O00425	IF2B3_HUMAN	insulin-like growth factor 2 mRNA binding protein 3	231	KH 1. {ECO:0000255|PROSITE- ProRule:PRU00117}.				anatomical structure morphogenesis (GO:0009653)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation regulator activity (GO:0045182)	p.V231V(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(14)|ovary(2)|prostate(2)|skin(4)|stomach(1)	34						CTTTACGGTGGACATCGATTC	0.478																																							uc003swg.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(691-693)GTC>GTA		insulin-like growth factor 2 mRNA binding							84.0	76.0	79.0					7																	23387344		2203	4300	6503	SO:0001819	synonymous_variant	10643				anatomical structure morphogenesis|negative regulation of translation|translation	cytosol|nucleus	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity	g.chr7:23387344G>T	AF117108	CCDS5382.1	7p15.3	2014-02-19			ENSG00000136231	ENSG00000136231		"""RNA binding motif (RRM) containing"""	28868	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 3"", ""cancer/testis antigen 98"""	608259				9891060, 9178771	Standard	NM_006547		Approved	IMP-3, CT98, IMP3	uc003swg.3	O00425	OTTHUMG00000128445	ENST00000258729.3:c.693C>A	7.37:g.23387344G>T						IGF2BP3_uc003swf.2_5'UTR	p.V231V	NM_006547	NP_006538	O00425	IF2B3_HUMAN			7	959	-			231			KH 1.		A0A4Z5|Q63HM0|Q6MZZ2|Q86VB1	Silent	SNP	ENST00000258729.3	37	c.693C>A	CCDS5382.1																																																																																				0.478	IGF2BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250243.2	NM_006547		28	127	1	0	3.99451e-17	0.009535	6.10031e-17	28	127				
BBS9	27241	broad.mit.edu	37	7	33573735	33573735	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr7:33573735G>T	ENST00000242067.6	+	21	2989	c.2468G>T	c.(2467-2469)gGc>gTc	p.G823V	BBS9_ENST00000396127.2_Missense_Mutation_p.G788V|BBS9_ENST00000350941.3_Missense_Mutation_p.G783V|BBS9_ENST00000354265.4_Missense_Mutation_p.G788V|BBS9_ENST00000355070.2_Missense_Mutation_p.G818V	NM_198428.2	NP_940820.1	Q3SYG4	PTHB1_HUMAN	Bardet-Biedl syndrome 9	823					cilium assembly (GO:0042384)|fat cell differentiation (GO:0045444)|protein transport (GO:0015031)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)		p.G823V(2)	BBS9/PKD1L1(2)	NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	50			GBM - Glioblastoma multiforme(11;0.0894)			TCCAAAGGTGGCCGTCTCTGC	0.493									Bardet-Biedl syndrome																														uc003tdn.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5						c.(2467-2469)GGC>GTC		parathyroid hormone-responsive B1 isoform 2							120.0	89.0	100.0					7																	33573735		2203	4300	6503	SO:0001583	missense	27241	Bardet-Biedl_syndrome	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	fat cell differentiation|response to stimulus|visual perception	BBSome|cilium membrane|microtubule organizing center|nucleus	protein binding	g.chr7:33573735G>T		CCDS5441.1, CCDS34618.1, CCDS43566.1, CCDS47572.1	7p14	2014-06-17			ENSG00000122507	ENSG00000122507			30000	protein-coding gene	gene with protein product	"""parathyroid hormone responsive B1 gene"""	607968				16380913, 10221542	Standard	XM_005249701		Approved	B1, PTHB1	uc003tdn.1	Q3SYG4	OTTHUMG00000128659	ENST00000242067.6:c.2468G>T	7.37:g.33573735G>T	ENSP00000242067:p.Gly823Val					BBS9_uc003tdo.1_Missense_Mutation_p.G788V|BBS9_uc003tdp.1_Missense_Mutation_p.G818V|BBS9_uc003tdq.1_Missense_Mutation_p.G783V|BBS9_uc010kwn.1_RNA|BBS9_uc003tdr.1_Missense_Mutation_p.G347V|BBS9_uc003tds.1_Missense_Mutation_p.G246V|BBS9_uc003tdt.2_RNA	p.G823V	NM_198428	NP_940820	Q3SYG4	PTHB1_HUMAN	GBM - Glioblastoma multiforme(11;0.0894)		21	2981	+			823					E9PDC9|P78514|Q7KYS6|Q7KYS7|Q8N570|Q99844|Q99854|Q9Y699|Q9Y6A0	Missense_Mutation	SNP	ENST00000242067.6	37	c.2468G>T	CCDS43566.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.6|21.6	4.168873|4.168873	0.78339|0.78339	.|.	.|.	ENSG00000122507|ENSG00000122507	ENST00000242067;ENST00000350941;ENST00000396127;ENST00000355070;ENST00000354265;ENST00000396132|ENST00000434373	T;T;T;T;T|.	0.61158|.	0.16;0.13;0.13;0.18;0.13|.	5.93|5.93	5.06|5.06	0.68205|0.68205	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.63319|0.63319	0.2501|0.2501	L|L	0.50333|0.50333	1.59|1.59	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.89917|.	0.999;0.999;0.999;0.999;1.0|.	D;D;D;D;D|.	0.78314|.	0.968;0.968;0.984;0.968;0.991|.	T|T	0.61108|0.61108	-0.7129|-0.7129	10|5	0.72032|.	D|.	0.01|.	-14.0336|-14.0336	14.9765|14.9765	0.71277|0.71277	0.0678:0.0:0.9322:0.0|0.0678:0.0:0.9322:0.0	.|.	823;783;818;788;823|.	Q3SYG4-3;Q3SYG4-2;E9PDC9;Q3SYG4-4;Q3SYG4|.	.;.;.;.;PTHB1_HUMAN|.	V|C	823;783;788;818;788;823|389	ENSP00000242067:G823V;ENSP00000313122:G783V;ENSP00000379433:G788V;ENSP00000347182:G818V;ENSP00000346214:G788V|.	ENSP00000242067:G823V|.	G|W	+|+	2|3	0|0	BBS9|BBS9	33540260|33540260	1.000000|1.000000	0.71417|0.71417	0.754000|0.754000	0.31244|0.31244	0.931000|0.931000	0.56810|0.56810	9.204000|9.204000	0.95041|0.95041	1.535000|1.535000	0.49220|0.49220	0.655000|0.655000	0.94253|0.94253	GGC|TGG		0.493	BBS9-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000329064.1			34	56	1	0	1.45844e-13	0.002836	2.02881e-13	34	56				
DPY19L2P1	554236	broad.mit.edu	37	7	35144371	35144371	+	RNA	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr7:35144371G>T	ENST00000436258.1	-	0	1695							Q6NXN4	D19P1_HUMAN	DPY19L2 pseudogene 1							integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)										TGTGTGAAAAGCCAGCTATAA	0.308																																							uc003teq.1		NA																	0					0						c.(736-738)GCT>GAT		RecName: Full=Protein dpy-19 homolog 2-like 2; AltName: Full=Dpy-19-like protein 2 pseudogene 2;																																						554236							g.chr7:35144371G>T	BC066987		7p14.2	2014-03-18	2013-09-12		ENSG00000189212	ENSG00000189212			22305	pseudogene	pseudogene			"""dpy-19-like 2 pseudogene 1 (C. elegans)"""				Standard	NR_002833		Approved		uc031swy.1	Q6NXN4	OTTHUMG00000155026		7.37:g.35144371G>T						DPY19L2P1_uc003tep.1_RNA|DPY19L2P1_uc010kwz.1_RNA	p.A246D							18	1844	-								B4E2E3	Missense_Mutation	SNP	ENST00000436258.1	37	c.737C>A																																																																																					0.308	DPY19L2P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000338113.1			19	55	1	0	6.94344e-10	0.006122	8.82854e-10	19	55				
EEPD1	80820	broad.mit.edu	37	7	36194118	36194118	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr7:36194118G>T	ENST00000242108.4	+	2	903	c.185G>T	c.(184-186)cGc>cTc	p.R62L	EEPD1_ENST00000534978.1_Missense_Mutation_p.R62L	NM_030636.2	NP_085139.2	Q7L9B9	EEPD1_HUMAN	endonuclease/exonuclease/phosphatase family domain containing 1	62	HhH.				DNA repair (GO:0006281)		DNA binding (GO:0003677)	p.R62L(1)		endometrium(2)|large_intestine(3)|lung(10)|ovary(1)|pancreas(1)|skin(1)	18						GCCGTGGCACGCAGCATCGTG	0.577																																							uc003tfa.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(184-186)CGC>CTC		endonuclease/exonuclease/phosphatase family							113.0	112.0	112.0					7																	36194118		2203	4300	6503	SO:0001583	missense	80820				DNA repair		DNA binding	g.chr7:36194118G>T	AK027386	CCDS34619.1	7p14.2	2007-12-07	2007-12-07		ENSG00000122547	ENSG00000122547			22223	protein-coding gene	gene with protein product							Standard	NM_030636		Approved	KIAA1706	uc003tfa.3	Q7L9B9	OTTHUMG00000154904	ENST00000242108.4:c.185G>T	7.37:g.36194118G>T	ENSP00000242108:p.Arg62Leu						p.R62L	NM_030636	NP_085139	Q7L9B9	EEPD1_HUMAN			2	825	+			62			HhH.		Q96K64|Q9C0F7	Missense_Mutation	SNP	ENST00000242108.4	37	c.185G>T	CCDS34619.1	.	.	.	.	.	.	.	.	.	.	G	14.63	2.592839	0.46214	.	.	ENSG00000122547	ENST00000242108;ENST00000534978	T;T	0.25085	1.82;1.82	5.68	3.89	0.44902	RuvA domain 2-like (1);Competence protein ComEA, helix-hairpin-helix domain (1);Helix-hairpin-helix DNA-binding motif, class 1 (1);	0.124925	0.64402	D	0.000017	T	0.19248	0.0462	L	0.39245	1.2	0.47123	D	0.999324	P	0.36354	0.549	B	0.34779	0.189	T	0.03364	-1.1044	10	0.62326	D	0.03	-26.213	6.9426	0.24500	0.3769:0.0:0.6231:0.0	.	62	Q7L9B9	EEPD1_HUMAN	L	62	ENSP00000242108:R62L;ENSP00000442692:R62L	ENSP00000242108:R62L	R	+	2	0	EEPD1	36160643	1.000000	0.71417	0.992000	0.48379	0.694000	0.40290	2.834000	0.48167	0.766000	0.33244	0.561000	0.74099	CGC		0.577	EEPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337602.1	NM_030636		226	67	1	0	1.5621e-98	0.00361	3.30037e-98	226	67				
PKD1L1	168507	broad.mit.edu	37	7	47906168	47906168	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr7:47906168C>T	ENST00000289672.2	-	25	3991	c.3941G>A	c.(3940-3942)gGg>gAg	p.G1314E		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	1314	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.G1314E(1)	BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						TGTGTAACTCCCCATCAGCTG	0.443																																							uc003tny.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|upper_aerodigestive_tract(2)|breast(1)	11						c.(3940-3942)GGG>GAG		polycystin-1L1							139.0	128.0	132.0					7																	47906168		2203	4300	6503	SO:0001583	missense	168507				cell-cell adhesion	integral to membrane		g.chr7:47906168C>T	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.3941G>A	7.37:g.47906168C>T	ENSP00000289672:p.Gly1314Glu						p.G1314E	NM_138295	NP_612152	Q8TDX9	PK1L1_HUMAN			25	3941	-			1314			Extracellular (Potential).|REJ.		Q6UWK1	Missense_Mutation	SNP	ENST00000289672.2	37	c.3941G>A	CCDS34633.1	.	.	.	.	.	.	.	.	.	.	C	9.115	1.007439	0.19199	.	.	ENSG00000158683	ENST00000289672	T	0.74842	-0.88	4.94	3.1	0.35709	Egg jelly receptor, REJ-like (1);PKD/REJ-like protein (1);	0.000000	0.64402	D	0.000004	T	0.78027	0.4219	L	0.52364	1.645	0.27862	N	0.940369	D	0.71674	0.998	D	0.72338	0.977	T	0.68349	-0.5432	10	0.62326	D	0.03	-15.178	4.553	0.12123	0.177:0.6377:0.0:0.1853	.	1314	Q8TDX9	PK1L1_HUMAN	E	1314	ENSP00000289672:G1314E	ENSP00000289672:G1314E	G	-	2	0	PKD1L1	47872693	0.953000	0.32496	0.208000	0.23602	0.003000	0.03518	2.107000	0.41844	0.485000	0.27652	-0.181000	0.13052	GGG		0.443	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295		32	96	0	0	0	0.010818	0	32	96				
ABCA13	154664	broad.mit.edu	37	7	48411995	48411995	+	Silent	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr7:48411995G>T	ENST00000435803.1	+	33	11058	c.11034G>T	c.(11032-11034)gcG>gcT	p.A3678A		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	3678					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.A3678A(1)|p.A3623A(1)		breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						CTAATACAGCGGCCCTTTGTA	0.413																																							uc003toq.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(5)|central_nervous_system(4)|skin(1)	10						c.(11032-11034)GCG>GCT		ATP binding cassette, sub-family A (ABC1),							204.0	196.0	198.0					7																	48411995		1975	4174	6149	SO:0001819	synonymous_variant	154664				transport	integral to membrane	ATP binding|ATPase activity	g.chr7:48411995G>T	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.11034G>T	7.37:g.48411995G>T						ABCA13_uc010kys.1_Silent_p.A752A|ABCA13_uc003tos.1_Silent_p.A504A	p.A3678A	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN			33	11059	+			3678					K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Silent	SNP	ENST00000435803.1	37	c.11034G>T	CCDS47584.1																																																																																				0.413	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701		104	333	1	0	1.04275e-50	0.00361	2.12327e-50	104	333				
POM121	9883	broad.mit.edu	37	7	72419892	72419892	+	3'UTR	SNP	C	C	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr7:72419892C>T	ENST00000395270.1	+	0	4924				NSUN5P2_ENST00000388955.4_RNA	NM_001257190.1	NP_001244119.1	Q96HA1	P121A_HUMAN	POM121 transmembrane nucleoporin						carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)		p.E114E(1)		NS(1)|breast(1)|endometrium(9)|kidney(4)|large_intestine(6)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Lung NSC(55;0.163)				CATAGTGGACCTCACGATAGC	0.622																																							uc003twn.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(340-342)GAG>GAA		NOL1/NOP2/Sun domain family, member 5C isoform							20.0	23.0	22.0					7																	72419892		2196	4290	6486	SO:0001624	3_prime_UTR_variant	260294							g.chr7:72419892C>T	AB014518	CCDS5542.1, CCDS59059.1	7q11.23	2013-01-08	2012-03-13		ENSG00000196313	ENSG00000196313		"""-"""	19702	protein-coding gene	gene with protein product		615753	"""POM121 membrane glycoprotein (rat)"", ""POM121 membrane glycoprotein"""			8335683, 9734811, 17900573	Standard	NM_172020		Approved	KIAA0618, DKFZP586G1822, DKFZP586P2220, POM121A	uc003twk.2	Q96HA1	OTTHUMG00000023527	ENST00000395270.1:c.*883C>T	7.37:g.72419892C>T						POM121_uc010lam.1_3'UTR|NSUN5P2_uc003twl.2_RNA|NSUN5P2_uc003twm.2_Silent_p.E114E|NSUN5P2_uc003two.2_Silent_p.E114E|NSUN5P2_uc003twq.2_Silent_p.E114E|NSUN5P2_uc010lan.1_Intron|NSUN5P2_uc003twp.2_Silent_p.E114E	p.E114E	NM_032158	NP_115534					8	1054	-								A6NFS9|A8CDT4|A8K933|A8MXF9|O75115|Q96DI0|Q9H9X1|Q9Y2N3|Q9Y4S7	Silent	SNP	ENST00000395270.1	37	c.342G>A	CCDS59059.1																																																																																				0.622	POM121-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252020.1			9	19	0	0	0	0.008291	0	9	19				
PCLO	27445	broad.mit.edu	37	7	82387975	82387975	+	Silent	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr7:82387975G>T	ENST00000333891.9	-	25	15682	c.15345C>A	c.(15343-15345)gcC>gcA	p.A5115A		NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.A5115A(2)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						GCCAGATACAGGCTTCACCAA	0.343																																							uc003uhx.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(7)	7						c.(15343-15345)GCC>GCA		piccolo isoform 1							182.0	170.0	174.0					7																	82387975		1824	4074	5898	SO:0001819	synonymous_variant	27445				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity	g.chr7:82387975G>T	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.15345C>A	7.37:g.82387975G>T							p.A5115A	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN			25	15634	-			5038			C2 2.			Silent	SNP	ENST00000333891.9	37	c.15345C>A	CCDS47630.1																																																																																				0.343	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510		88	86	1	0	6.16549e-39	0.00361	1.20313e-38	88	86				
ZNF804B	219578	broad.mit.edu	37	7	88966128	88966128	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr7:88966128C>A	ENST00000333190.4	+	4	4441	c.3832C>A	c.(3832-3834)Cca>Aca	p.P1278T		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	1278							metal ion binding (GO:0046872)	p.P1278T(1)		NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			CCCCTTCCACCCATCTCACAT	0.463										HNSCC(36;0.09)																													uc011khi.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11						c.(3832-3834)CCA>ACA		zinc finger protein 804B							230.0	198.0	209.0					7																	88966128		2203	4300	6503	SO:0001583	missense	219578					intracellular	zinc ion binding	g.chr7:88966128C>A	AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.3832C>A	7.37:g.88966128C>A	ENSP00000329638:p.Pro1278Thr	HNSCC(36;0.09)					p.P1278T	NM_181646	NP_857597	A4D1E1	Z804B_HUMAN	STAD - Stomach adenocarcinoma(171;0.0513)		4	4370	+	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		1278					B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	ENST00000333190.4	37	c.3832C>A	CCDS5613.1	.	.	.	.	.	.	.	.	.	.	C	15.26	2.781835	0.49891	.	.	ENSG00000182348	ENST00000333190	T	0.12984	2.63	5.29	1.21	0.21127	.	0.549033	0.17753	N	0.163148	T	0.12860	0.0312	M	0.72894	2.215	0.31398	N	0.677042	P	0.37441	0.595	B	0.31016	0.123	T	0.09357	-1.0678	10	0.72032	D	0.01	-1.8583	6.0432	0.19746	0.1306:0.6448:0.0:0.2245	.	1278	A4D1E1	Z804B_HUMAN	T	1278	ENSP00000329638:P1278T	ENSP00000329638:P1278T	P	+	1	0	ZNF804B	88804064	0.998000	0.40836	0.284000	0.24805	0.884000	0.51177	1.266000	0.33039	0.031000	0.15407	-0.345000	0.07892	CCA		0.463	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253683.2	NM_181646		52	155	1	0	1.91693e-13	0.00361	2.65348e-13	52	155				
PCOLCE	5118	broad.mit.edu	37	7	100205337	100205337	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr7:100205337T>C	ENST00000223061.5	+	8	1370	c.1090T>C	c.(1090-1092)Tat>Cat	p.Y364H		NM_002593.3	NP_002584.2	Q15113	PCOC1_HUMAN	procollagen C-endopeptidase enhancer	364	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				multicellular organismal development (GO:0007275)|positive regulation of peptidase activity (GO:0010952)|proteolysis (GO:0006508)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|peptidase activator activity (GO:0016504)	p.Y364H(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	23	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					TATTGGTGCTTATAAAACTGG	0.557																																							uc003uvo.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1090-1092)TAT>CAT		procollagen C-endopeptidase enhancer							168.0	161.0	163.0					7																	100205337		2203	4300	6503	SO:0001583	missense	5118				multicellular organismal development	extracellular space	collagen binding|heparin binding|peptidase activator activity	g.chr7:100205337T>C	L33799	CCDS5700.1	7q22	2008-07-18			ENSG00000106333	ENSG00000106333			8738	protein-coding gene	gene with protein product	"""procollagen, type 1, COOH-terminal proteinase enhancer"", ""procollagen C-proteinase enhancer 1"""	600270				8824813, 9799793	Standard	NM_002593		Approved	PCPE, PCPE1	uc003uvo.3	Q15113	OTTHUMG00000156675	ENST00000223061.5:c.1090T>C	7.37:g.100205337T>C	ENSP00000223061:p.Tyr364His					PCOLCE_uc010lhb.1_RNA|PCOLCE_uc003uvp.1_RNA	p.Y364H	NM_002593	NP_002584	Q15113	PCOC1_HUMAN			8	1288	+	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)		364			NTR.		B2R9E1|O14550	Missense_Mutation	SNP	ENST00000223061.5	37	c.1090T>C	CCDS5700.1	.	.	.	.	.	.	.	.	.	.	T	18.81	3.703360	0.68501	.	.	ENSG00000106333	ENST00000223061	T	0.38722	1.12	4.61	3.47	0.39725	Tissue inhibitor of metalloproteinases-like, OB-fold (1);Netrin domain (1);Netrin module, non-TIMP type (2);	0.069504	0.64402	N	0.000013	T	0.59004	0.2162	M	0.71206	2.165	0.54753	D	0.999986	D	0.89917	1.0	D	0.97110	1.0	T	0.59611	-0.7422	10	0.87932	D	0	-11.1548	7.997	0.30273	0.0:0.0976:0.0:0.9024	.	364	Q15113	PCOC1_HUMAN	H	364	ENSP00000223061:Y364H	ENSP00000223061:Y364H	Y	+	1	0	PCOLCE	100043273	0.999000	0.42202	0.685000	0.30070	0.921000	0.55340	3.801000	0.55545	0.816000	0.34421	0.379000	0.24179	TAT		0.557	PCOLCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345285.1	NM_002593		22	91	0	0	0	0.00632	0	22	91				
SND1	27044	broad.mit.edu	37	7	127334986	127334986	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr7:127334986G>T	ENST00000354725.3	+	3	527	c.333G>T	c.(331-333)atG>atT	p.M111I		NM_014390.2	NP_055205.2	Q7KZF4	SND1_HUMAN	staphylococcal nuclease and tudor domain containing 1	111	TNase-like 1. {ECO:0000255|PROSITE- ProRule:PRU00272}.				gene silencing by RNA (GO:0031047)|osteoblast differentiation (GO:0001649)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|dense body (GO:0097433)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|RISC complex (GO:0016442)	nuclease activity (GO:0004518)|poly(A) RNA binding (GO:0044822)|transcription cofactor activity (GO:0003712)	p.M111I(1)		central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	41						AGTATGGCATGATCTACCTTG	0.478																																							uc003vmi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(331-333)ATG>ATT		staphylococcal nuclease domain containing 1							82.0	80.0	81.0					7																	127334986		2203	4300	6503	SO:0001583	missense	27044				gene silencing by RNA|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	melanosome|nucleus|RNA-induced silencing complex	nuclease activity|nucleic acid binding|protein binding|transcription cofactor activity	g.chr7:127334986G>T		CCDS34747.1	7q31.3	2014-03-24			ENSG00000197157	ENSG00000197157		"""Tudor domain containing"""	30646	protein-coding gene	gene with protein product	"""p100 EBNA2 co-activator"", ""Tudor-SN"""	602181				7651391, 9003410, 12819296	Standard	NM_014390		Approved	TDRD11, p100	uc003vmi.3	Q7KZF4	OTTHUMG00000157560	ENST00000354725.3:c.333G>T	7.37:g.127334986G>T	ENSP00000346762:p.Met111Ile						p.M111I	NM_014390	NP_055205	Q7KZF4	SND1_HUMAN			3	559	+			111			TNase-like 1.		Q13122|Q96AG0	Missense_Mutation	SNP	ENST00000354725.3	37	c.333G>T	CCDS34747.1	.	.	.	.	.	.	.	.	.	.	G	15.08	2.727973	0.48833	.	.	ENSG00000197157	ENST00000354725;ENST00000438400	T	0.27890	1.64	5.64	5.64	0.86602	Staphylococcal nuclease (SNase-like) (4);Staphylococcal nuclease (SNase-like), OB-fold (1);	0.074821	0.85682	D	0.000000	T	0.20861	0.0502	N	0.15975	0.35	0.58432	D	0.999999	B	0.02656	0.0	B	0.12156	0.007	T	0.05937	-1.0855	10	0.21540	T	0.41	-26.1574	17.202	0.86908	0.0:0.0:1.0:0.0	.	111	Q7KZF4	SND1_HUMAN	I	111;101	ENSP00000346762:M111I	ENSP00000346762:M111I	M	+	3	0	SND1	127122222	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.647000	0.98478	2.676000	0.91093	0.563000	0.77884	ATG		0.478	SND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349148.1	NM_014390		19	70	1	0	5.35267e-07	0.007413	6.45536e-07	19	70				
FAM180A	389558	broad.mit.edu	37	7	135418891	135418891	+	Silent	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr7:135418891G>T	ENST00000338588.3	-	3	619	c.354C>A	c.(352-354)ctC>ctA	p.L118L	FAM180A_ENST00000435869.1_Intron|FAM180A_ENST00000415751.1_Silent_p.L118L	NM_205855.3	NP_995327.1	Q6UWF9	F180A_HUMAN	family with sequence similarity 180, member A	118						extracellular region (GO:0005576)		p.L118L(1)		endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|pancreas(1)	14						CTTCTTTCTTGAGGATGCCAG	0.612																																							uc003vtd.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(352-354)CTC>CTA		hypothetical protein LOC389558 precursor							140.0	120.0	127.0					7																	135418891		2203	4300	6503	SO:0001819	synonymous_variant	389558					extracellular region		g.chr7:135418891G>T	AC091736, AK290250, AK310180, AY358803	CCDS5841.1	7q33	2008-07-25			ENSG00000189320	ENSG00000189320			33773	protein-coding gene	gene with protein product						12975309, 12690205	Standard	NM_205855		Approved	HWKM1940, UNQ1940	uc003vtd.3	Q6UWF9	OTTHUMG00000155537	ENST00000338588.3:c.354C>A	7.37:g.135418891G>T						FAM180A_uc010lmt.2_RNA|FAM180A_uc010lmu.2_Silent_p.L118L	p.L118L	NM_205855	NP_995327	Q6UWF9	F180A_HUMAN			3	620	-			118					B2RP85	Silent	SNP	ENST00000338588.3	37	c.354C>A	CCDS5841.1																																																																																				0.612	FAM180A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340554.2	NM_205855		56	56	1	0	3.84483e-29	0.00361	6.83796e-29	56	56				
DENND2A	27147	broad.mit.edu	37	7	140301269	140301269	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr7:140301269G>C	ENST00000275884.6	-	2	1346	c.929C>G	c.(928-930)tCt>tGt	p.S310C	DENND2A_ENST00000537639.1_Missense_Mutation_p.S310C|DENND2A_ENST00000492720.1_Missense_Mutation_p.S310C|DENND2A_ENST00000496613.1_Missense_Mutation_p.S310C			Q9ULE3	DEN2A_HUMAN	DENN/MADD domain containing 2A	310					positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.S310C(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(22)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49	Melanoma(164;0.00956)					aggtgggggagaggagggcag	0.592																																							uc010lnj.2		NA																	1	Substitution - Missense(1)	p.S310A(1)	lung(1)	ovary(3)|breast(1)	4						c.(928-930)TCT>TGT		DENN/MADD domain containing 2A							44.0	49.0	47.0					7																	140301269		1976	4153	6129	SO:0001583	missense	27147							g.chr7:140301269G>C	AB033103	CCDS43659.1	7q34	2012-10-03	2005-08-17	2005-08-17	ENSG00000146966	ENSG00000146966		"""DENN/MADD domain containing"""	22212	protein-coding gene	gene with protein product			"""KIAA1277"""	KIAA1277			Standard	NM_015689		Approved	FAM31D	uc010lnj.3	Q9ULE3	OTTHUMG00000157411	ENST00000275884.6:c.929C>G	7.37:g.140301269G>C	ENSP00000275884:p.Ser310Cys					DENND2A_uc011kre.1_RNA|DENND2A_uc010lnk.2_Missense_Mutation_p.S310C|DENND2A_uc003vvw.2_Missense_Mutation_p.S310C|DENND2A_uc003vvx.2_Missense_Mutation_p.S310C	p.S310C	NM_015689	NP_056504	Q9ULE3	DEN2A_HUMAN			1	1074	-	Melanoma(164;0.00956)		310					C9JUI3|Q1RMD5|Q86XY0	Missense_Mutation	SNP	ENST00000275884.6	37	c.929C>G	CCDS43659.1	.	.	.	.	.	.	.	.	.	.	G	14.98	2.698485	0.48307	.	.	ENSG00000146966	ENST00000275884;ENST00000537639;ENST00000496613;ENST00000492720	T;T;T;T	0.10860	3.54;3.54;3.54;2.83	4.85	4.85	0.62838	.	0.209266	0.43260	D	0.000581	T	0.17365	0.0417	M	0.68952	2.095	0.42758	D	0.993791	B;B	0.25609	0.13;0.107	B;B	0.26310	0.052;0.068	T	0.03463	-1.1034	10	0.66056	D	0.02	-9.5576	18.1513	0.89675	0.0:0.0:1.0:0.0	.	310;310	Q9ULE3-2;Q9ULE3	.;DEN2A_HUMAN	C	310	ENSP00000275884:S310C;ENSP00000442245:S310C;ENSP00000419654:S310C;ENSP00000419464:S310C	ENSP00000275884:S310C	S	-	2	0	DENND2A	139947738	1.000000	0.71417	0.994000	0.49952	0.956000	0.61745	5.489000	0.66875	2.519000	0.84933	0.462000	0.41574	TCT		0.592	DENND2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348742.1	NM_015689		28	39	0	0	0	0.003271	0	28	39				
PRSS58	136541	broad.mit.edu	37	7	141952343	141952343	+	Silent	SNP	C	C	T	rs150069777		TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr7:141952343C>T	ENST00000552471.1	-	4	844	c.525G>A	c.(523-525)acG>acA	p.T175T	PRSS58_ENST00000547058.2_Silent_p.T175T			Q8IYP2	PRS58_HUMAN	protease, serine, 58	175	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)	p.T175T(1)		kidney(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(2)|skin(2)	19						GCATATTTTCCGTGATGTTGT	0.433																																							uc003vxb.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(523-525)ACG>ACA		trypsin X3 precursor		C		0,4406		0,0,2203	178.0	161.0	167.0		525	-4.2	0.0	7	dbSNP_134	167	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous	PRSS58	NM_001001317.3		0,3,6500	TT,TC,CC		0.0349,0.0,0.0231		175/242	141952343	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	136541				proteolysis	extracellular region	serine-type endopeptidase activity	g.chr7:141952343C>T		CCDS5871.1	7q34	2012-10-03			ENSG00000258223	ENSG00000258223	3.4.21.4	"""Serine peptidases / Serine peptidases"""	39125	protein-coding gene	gene with protein product	"""trypsin X3"""						Standard	NM_001001317		Approved	TRYX3	uc003vxc.4	Q8IYP2	OTTHUMG00000158565	ENST00000552471.1:c.525G>A	7.37:g.141952343C>T						TRYX3_uc003vxc.3_Silent_p.T175T	p.T175T	NM_001001317	NP_001001317	Q8IYP2	PRS58_HUMAN			4	845	-	Melanoma(164;0.0272)		175			Peptidase S1.		B3KVJ6|D3DXD2	Silent	SNP	ENST00000552471.1	37	c.525G>A	CCDS5871.1																																																																																				0.433	PRSS58-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351328.2	NM_001001317		24	92	0	0	0	0.003954	0	24	92				
ZNF746	155061	broad.mit.edu	37	7	149174757	149174757	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr7:149174757C>A	ENST00000340622.3	-	5	890	c.610G>T	c.(610-612)Gtg>Ttg	p.V204L	ZNF746_ENST00000458143.2_Missense_Mutation_p.V204L			Q6NUN9	ZN746_HUMAN	zinc finger protein 746	204					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neuron death (GO:1901216)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)	p.V204L(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34	Melanoma(164;0.165)		OV - Ovarian serous cystadenocarcinoma(82;0.00358)			CACGCCTCCACGCCCAGGGCC	0.672																																							uc003wfw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(1)	3						c.(610-612)GTG>TTG		zinc finger protein 746 isoform 2							29.0	32.0	31.0					7																	149174757		2203	4300	6503	SO:0001583	missense	155061				negative regulation of transcription, DNA-dependent|neuron death|regulation of cell death|transcription, DNA-dependent	cytoplasm|nucleus	transcription regulatory region DNA binding|ubiquitin protein ligase binding|zinc ion binding	g.chr7:149174757C>A	AK055975	CCDS5897.1, CCDS55180.1	7q36.1	2013-01-08			ENSG00000181220	ENSG00000181220		"""Zinc fingers, C2H2-type"", ""-"""	21948	protein-coding gene	gene with protein product		613914					Standard	NM_152557		Approved	FLJ31413	uc010lpi.2	Q6NUN9	OTTHUMG00000158972	ENST00000340622.3:c.610G>T	7.37:g.149174757C>A	ENSP00000345140:p.Val204Leu					ZNF746_uc010lpi.2_Missense_Mutation_p.V204L	p.V204L	NM_152557	NP_689770	Q6NUN9	ZN746_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00358)		5	881	-	Melanoma(164;0.165)		204					A8K6Z9|Q6ZRF9	Missense_Mutation	SNP	ENST00000340622.3	37	c.610G>T	CCDS5897.1	.	.	.	.	.	.	.	.	.	.	C	15.21	2.764692	0.49574	.	.	ENSG00000181220	ENST00000340622;ENST00000458143	T;T	0.08807	3.07;3.05	4.94	4.94	0.65067	.	0.172850	0.27464	N	0.019260	T	0.11410	0.0278	L	0.36672	1.1	0.37210	D	0.904787	D;D	0.57257	0.979;0.965	P;P	0.52424	0.698;0.502	T	0.18053	-1.0349	10	0.09338	T	0.73	-17.018	13.6907	0.62544	0.0:1.0:0.0:0.0	.	204;204	Q6NUN9-2;Q6NUN9	.;ZN746_HUMAN	L	204	ENSP00000345140:V204L;ENSP00000395007:V204L	ENSP00000345140:V204L	V	-	1	0	ZNF746	148805690	0.000000	0.05858	0.976000	0.42696	0.163000	0.22366	0.807000	0.27140	2.286000	0.76751	0.563000	0.77884	GTG		0.672	ZNF746-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352730.1	NM_152557		11	20	1	0	3.86212e-05	0.008291	4.28955e-05	11	20				
ZNF467	168544	broad.mit.edu	37	7	149461930	149461930	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr7:149461930C>A	ENST00000302017.3	-	5	2074	c.1661G>T	c.(1660-1662)cGc>cTc	p.R554L	ZNF467_ENST00000484747.1_Intron	NM_207336.1	NP_997219.1	Q7Z7K2	ZN467_HUMAN	zinc finger protein 467	554					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R554L(1)		central_nervous_system(1)|kidney(1)|large_intestine(2)|liver(1)|lung(7)|urinary_tract(1)	13	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GTGGGTCTTGCGGCTGAAGCT	0.706																																							uc003wgd.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1660-1662)CGC>CTC		zinc finger protein 467							29.0	35.0	33.0					7																	149461930		2173	4286	6459	SO:0001583	missense	168544				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:149461930C>A	BC029296	CCDS5899.1	7q36.1	2013-01-08			ENSG00000181444	ENSG00000181444		"""Zinc fingers, C2H2-type"""	23154	protein-coding gene	gene with protein product		614040				12426389	Standard	NM_207336		Approved	EZI, Zfp467	uc003wgd.2	Q7Z7K2	OTTHUMG00000157883	ENST00000302017.3:c.1661G>T	7.37:g.149461930C>A	ENSP00000304769:p.Arg554Leu					ZNF467_uc003wgc.2_Intron	p.R554L	NM_207336	NP_997219	Q7Z7K2	ZN467_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00625)		5	1802	-	Melanoma(164;0.165)|Ovarian(565;0.177)		554			C2H2-type 12.			Missense_Mutation	SNP	ENST00000302017.3	37	c.1661G>T	CCDS5899.1	.	.	.	.	.	.	.	.	.	.	C	16.04	3.010040	0.54361	.	.	ENSG00000181444	ENST00000302017	T	0.19669	2.13	3.97	3.97	0.46021	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.296195	0.16779	U	0.199892	T	0.15089	0.0364	L	0.33624	1.015	0.24308	N	0.995092	P	0.35507	0.506	B	0.34779	0.189	T	0.11767	-1.0574	10	0.45353	T	0.12	-20.142	7.6315	0.28243	0.0:0.8075:0.0:0.1925	.	554	Q7Z7K2	ZN467_HUMAN	L	554	ENSP00000304769:R554L	ENSP00000304769:R554L	R	-	2	0	ZNF467	149092863	0.000000	0.05858	1.000000	0.80357	0.899000	0.52679	0.015000	0.13355	2.072000	0.62099	0.462000	0.41574	CGC		0.706	ZNF467-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349833.1	NM_207336		26	24	1	0	1.08312e-15	0.009535	1.61035e-15	26	24				
RP1L1	94137	broad.mit.edu	37	8	10470400	10470400	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr8:10470400G>T	ENST00000382483.3	-	4	1431	c.1208C>A	c.(1207-1209)cCc>cAc	p.P403H		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	403					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)		p.P403H(1)		breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		TTCATACTTGGGCCCTGGCTG	0.667																																							uc003wtc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|breast(3)|central_nervous_system(1)	8						c.(1207-1209)CCC>CAC		retinitis pigmentosa 1-like 1							43.0	50.0	47.0					8																	10470400		1946	4131	6077	SO:0001583	missense	94137				intracellular signal transduction			g.chr8:10470400G>T	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.1208C>A	8.37:g.10470400G>T	ENSP00000371923:p.Pro403His						p.P403H	NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN		COAD - Colon adenocarcinoma(149;0.0811)	4	1437	-			403					Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	c.1208C>A	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	G	16.29	3.081571	0.55753	.	.	ENSG00000183638	ENST00000382483	T	0.04706	3.57	4.92	4.92	0.64577	.	0.254544	0.20714	U	0.087039	T	0.10165	0.0249	N	0.22421	0.69	0.09310	N	0.999994	D	0.67145	0.996	D	0.66847	0.947	T	0.09729	-1.0661	10	0.87932	D	0	-9.6611	11.1065	0.48205	0.0:0.0:0.7022:0.2978	.	403	A6NKC6	.	H	403	ENSP00000371923:P403H	ENSP00000371923:P403H	P	-	2	0	RP1L1	10507810	0.114000	0.22134	0.010000	0.14722	0.033000	0.12548	0.772000	0.26647	2.271000	0.75665	0.561000	0.74099	CCC		0.667	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1			30	50	1	0	7.26314e-15	0.007291	1.05748e-14	30	50				
MTMR9	66036	broad.mit.edu	37	8	11177238	11177238	+	Silent	SNP	C	C	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr8:11177238C>T	ENST00000221086.3	+	9	1850	c.1377C>T	c.(1375-1377)tcC>tcT	p.S459S	MTMR9_ENST00000526292.1_Silent_p.S374S|AF131216.6_ENST00000498997.2_RNA	NM_015458.3	NP_056273.2	Q96QG7	MTMR9_HUMAN	myotubularin related protein 9	459	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.					cytoplasm (GO:0005737)	enzyme regulator activity (GO:0030234)|phosphatase activity (GO:0016791)	p.S459S(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|urinary_tract(2)	16			STAD - Stomach adenocarcinoma(15;0.215)	COAD - Colon adenocarcinoma(149;0.0678)		CTTTGTGGTCCTGGGTTAATC	0.423																																							uc003wtm.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1375-1377)TCC>TCT		myotubularin related protein 9							139.0	127.0	131.0					8																	11177238		2203	4300	6503	SO:0001819	synonymous_variant	66036					cytoplasm	phosphatase activity|protein binding	g.chr8:11177238C>T	AJ297823	CCDS5979.1	8p23-p22	2011-06-09	2002-09-05	2002-09-06	ENSG00000104643	ENSG00000104643		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	14596	protein-coding gene	gene with protein product		606260	"""myotubularin related protein 8"""	C8orf9, MTMR8		11472061, 11896452, 12890864	Standard	NM_015458		Approved	DKFZp434K171, LIP-STYX	uc003wtm.3	Q96QG7	OTTHUMG00000090647	ENST00000221086.3:c.1377C>T	8.37:g.11177238C>T						MTMR9_uc010lrx.2_Silent_p.S352S|MTMR9_uc011kxa.1_Silent_p.S374S|uc003wtn.1_RNA	p.S459S	NM_015458	NP_056273	Q96QG7	MTMR9_HUMAN	STAD - Stomach adenocarcinoma(15;0.215)	COAD - Colon adenocarcinoma(149;0.0678)	9	1775	+			459			Myotubularin phosphatase.		B7Z291|Q52LU3|Q8WW11|Q96QG6|Q9NX50	Silent	SNP	ENST00000221086.3	37	c.1377C>T	CCDS5979.1																																																																																				0.423	MTMR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207307.2	NM_015458		36	58	0	0	0	0.004289	0	36	58				
ZMAT4	79698	broad.mit.edu	37	8	40532360	40532360	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr8:40532360C>A	ENST00000297737.6	-	5	586	c.440G>T	c.(439-441)tGt>tTt	p.C147F	ZMAT4_ENST00000315769.7_Intron	NM_024645.2	NP_078921.1	Q9H898	ZMAT4_HUMAN	zinc finger, matrin-type 4	147						nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.C147F(1)		NS(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	18	Ovarian(28;0.00724)|Colorectal(14;0.0468)	all_cancers(7;0.00936)|all_epithelial(6;3.53e-06)|all_lung(54;0.0318)|Lung NSC(58;0.0919)|Esophageal squamous(32;0.15)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;0.00722)			ACAGAGCCCACAGTATCTGTC	0.498																																							uc003xnr.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)|central_nervous_system(1)|skin(1)	3						c.(439-441)TGT>TTT		zinc finger, matrin type 4 isoform a							196.0	194.0	195.0					8																	40532360		2203	4300	6503	SO:0001583	missense	79698					nucleus	DNA binding|zinc ion binding	g.chr8:40532360C>A	AK023904	CCDS34885.1, CCDS47848.1	8p11.21	2012-10-05	2010-09-15		ENSG00000165061	ENSG00000165061		"""Zinc fingers, matrin-type"""	25844	protein-coding gene	gene with protein product						12477932	Standard	NM_024645		Approved	FLJ13842	uc003xnr.3	Q9H898	OTTHUMG00000164049	ENST00000297737.6:c.440G>T	8.37:g.40532360C>A	ENSP00000297737:p.Cys147Phe					ZMAT4_uc003xns.2_Intron	p.C147F	NM_024645	NP_078921	Q9H898	ZMAT4_HUMAN	LUSC - Lung squamous cell carcinoma(45;0.00722)		5	586	-	Ovarian(28;0.00724)|Colorectal(14;0.0468)	all_cancers(7;0.00936)|all_epithelial(6;3.53e-06)|all_lung(54;0.0318)|Lung NSC(58;0.0919)|Esophageal squamous(32;0.15)|Hepatocellular(245;0.152)	147			Matrin-type 3.		Q8WUT8	Missense_Mutation	SNP	ENST00000297737.6	37	c.440G>T	CCDS34885.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.597538	0.87055	.	.	ENSG00000165061	ENST00000297737;ENST00000519406	D;D	0.98947	-5.26;-5.26	5.88	5.88	0.94601	Zinc finger, C2H2-like (1);Zinc finger, double-stranded RNA binding (1);Zinc finger, U1-type (1);Zinc finger, C2H2 (1);	0.042155	0.85682	D	0.000000	D	0.99187	0.9718	M	0.82517	2.595	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99785	1.1029	10	0.87932	D	0	-16.4438	18.7792	0.91925	0.0:1.0:0.0:0.0	.	147	Q9H898	ZMAT4_HUMAN	F	147	ENSP00000297737:C147F;ENSP00000428423:C147F	ENSP00000297737:C147F	C	-	2	0	ZMAT4	40651517	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.376000	0.79658	2.782000	0.95742	0.557000	0.71058	TGT		0.498	ZMAT4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376950.1	NM_024645		116	201	1	0	5.16181e-52	0.00361	1.05874e-51	116	201				
CRISPLD1	83690	broad.mit.edu	37	8	75898471	75898471	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr8:75898471G>A	ENST00000262207.4	+	2	717	c.249G>A	c.(247-249)atG>atA	p.M83I	CRISPLD1_ENST00000519798.1_Intron	NM_031461.5	NP_113649.1	Q9H336	CRLD1_HUMAN	cysteine-rich secretory protein LCCL domain containing 1	83	SCP.				face morphogenesis (GO:0060325)	extracellular vesicular exosome (GO:0070062)		p.M83I(1)		biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)			CCTCTAATATGGAGTATATGG	0.358																																							uc003yan.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(247-249)ATG>ATA		cysteine-rich secretory protein LCCL domain							94.0	98.0	97.0					8																	75898471		2203	4300	6503	SO:0001583	missense	83690					extracellular region		g.chr8:75898471G>A	AL834301	CCDS6219.1, CCDS69497.1, CCDS75754.1	8q21.13	2005-09-23	2005-02-16	2005-02-16	ENSG00000121005	ENSG00000121005			18206	protein-coding gene	gene with protein product			"""LCCL domain containing cysteine-rich secretory protein 1"""	LCRISP1			Standard	NM_031461		Approved	Cocoacrisp, DKFZp762F133	uc003yan.3	Q9H336	OTTHUMG00000164529	ENST00000262207.4:c.249G>A	8.37:g.75898471G>A	ENSP00000262207:p.Met83Ile						p.M83I	NM_031461	NP_113649	Q9H336	CRLD1_HUMAN	Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)		2	624	+	Breast(64;0.0799)		83					B2RA60|B7Z929	Missense_Mutation	SNP	ENST00000262207.4	37	c.249G>A	CCDS6219.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.716467	0.89205	.	.	ENSG00000121005	ENST00000262207;ENST00000520277	T;T	0.20200	2.09;2.09	5.37	5.37	0.77165	CAP domain (3);	0.000000	0.85682	D	0.000000	T	0.53449	0.1797	M	0.85859	2.78	0.80722	D	1	D	0.69078	0.997	D	0.80764	0.994	T	0.58463	-0.7632	10	0.72032	D	0.01	.	19.3071	0.94167	0.0:0.0:1.0:0.0	.	83	Q9H336	CRLD1_HUMAN	I	83	ENSP00000262207:M83I;ENSP00000430504:M83I	ENSP00000262207:M83I	M	+	3	0	CRISPLD1	76061026	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.263000	0.95617	2.793000	0.96121	0.563000	0.77884	ATG		0.358	CRISPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379117.1	NM_031461		51	46	0	0	0	0.00361	0	51	46				
RIMS2	9699	broad.mit.edu	37	8	104898392	104898392	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr8:104898392C>A	ENST00000436393.2	+	2	1140	c.899C>A	c.(898-900)aCg>aAg	p.T300K	RIMS2_ENST00000262231.10_Missense_Mutation_p.T330K|RIMS2_ENST00000507740.1_Missense_Mutation_p.T330K|RIMS2_ENST00000406091.3_Missense_Mutation_p.T522K			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	553					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)	p.T330K(2)|p.T558K(1)|p.T300K(1)|p.T522K(1)		NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			TTGGCTTCCACGCCTGAATAT	0.403										HNSCC(12;0.0054)																													uc003yls.2		NA																	5	Substitution - Missense(5)		lung(5)	ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15						c.(898-900)ACG>AAG		regulating synaptic membrane exocytosis 2							61.0	57.0	58.0					8																	104898392		1965	4143	6108	SO:0001583	missense	9699				intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding	g.chr8:104898392C>A	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.899C>A	8.37:g.104898392C>A	ENSP00000390665:p.Thr300Lys	HNSCC(12;0.0054)				RIMS2_uc003ylp.2_Missense_Mutation_p.T522K|RIMS2_uc003ylw.2_Missense_Mutation_p.T330K|RIMS2_uc003ylq.2_Missense_Mutation_p.T330K|RIMS2_uc003ylr.2_Missense_Mutation_p.T330K	p.T300K	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)		2	1140	+			553					B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	ENST00000436393.2	37	c.899C>A		.	.	.	.	.	.	.	.	.	.	C	25.5	4.642402	0.87859	.	.	ENSG00000176406	ENST00000504942;ENST00000329869;ENST00000406091;ENST00000402998;ENST00000515551;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393	T;T;T;T;T;T;T	0.28895	1.59;2.05;1.94;1.73;1.96;1.73;2.08	5.54	5.54	0.83059	.	.	.	.	.	T	0.54062	0.1835	L	0.55213	1.73	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.968;1.0;1.0	D;D;P;D;D	0.97110	1.0;0.998;0.897;0.999;0.999	T	0.54384	-0.8302	9	0.87932	D	0	.	19.4836	0.95020	0.0:1.0:0.0:0.0	.	553;300;330;330;522	Q9UQ26;D6RA03;Q9UQ26-1;Q9UQ26-3;F8WD47	RIMS2_HUMAN;.;.;.;.	K	522;553;522;553;330;330;330;330;300	ENSP00000427018:T522K;ENSP00000384892:T522K;ENSP00000425205:T330K;ENSP00000262231:T330K;ENSP00000423559:T330K;ENSP00000386228:T330K;ENSP00000390665:T300K	ENSP00000262231:T330K	T	+	2	0	RIMS2	104967568	1.000000	0.71417	0.978000	0.43139	0.959000	0.62525	7.780000	0.85658	2.597000	0.87782	0.563000	0.77884	ACG		0.403	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	NM_001100117		8	25	1	0	1.76689e-08	0.006214	2.18721e-08	8	25				
LRP12	29967	broad.mit.edu	37	8	105503016	105503016	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr8:105503016C>A	ENST00000276654.5	-	7	2573	c.2465G>T	c.(2464-2466)cGa>cTa	p.R822L	LRP12_ENST00000518375.1_5'UTR|LRP12_ENST00000424843.2_Missense_Mutation_p.R803L	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12	822					endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)	p.R822L(1)		NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			GGGGCCATCTCGATTACTTGG	0.468																																							uc003yma.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2464-2466)CGA>CTA		low density lipoprotein-related protein 12							185.0	142.0	157.0					8																	105503016		2203	4300	6503	SO:0001583	missense	29967				endocytosis|regulation of growth	coated pit|integral to plasma membrane	low-density lipoprotein receptor activity|protein binding	g.chr8:105503016C>A	AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.2465G>T	8.37:g.105503016C>A	ENSP00000276654:p.Arg822Leu					LRP12_uc003ymb.2_Missense_Mutation_p.R803L|LRP12_uc003ylz.2_Missense_Mutation_p.R228L	p.R822L	NM_013437	NP_038465	Q9Y561	LRP12_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)		7	2560	-			822			Cytoplasmic (Potential).		A8K137|B4DRQ2	Missense_Mutation	SNP	ENST00000276654.5	37	c.2465G>T	CCDS6303.1	.	.	.	.	.	.	.	.	.	.	C	17.70	3.453674	0.63290	.	.	ENSG00000147650	ENST00000424843;ENST00000276654;ENST00000520873	D;D	0.88354	-2.37;-2.3	5.47	4.59	0.56863	.	0.060919	0.64402	D	0.000002	D	0.88797	0.6534	L	0.27053	0.805	0.80722	D	1	D;D	0.60575	0.988;0.979	P;P	0.57911	0.829;0.68	D	0.90109	0.4190	10	0.87932	D	0	-10.9438	14.2694	0.66143	0.0:0.9284:0.0:0.0716	.	803;822	Q9Y561-2;Q9Y561	.;LRP12_HUMAN	L	803;822;187	ENSP00000399148:R803L;ENSP00000276654:R822L	ENSP00000276654:R822L	R	-	2	0	LRP12	105572192	1.000000	0.71417	0.362000	0.25862	0.977000	0.68977	4.187000	0.58344	1.298000	0.44778	-0.145000	0.13849	CGA		0.468	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380821.1	NM_013437		14	52	1	0	4.3838e-07	0.001855	5.30969e-07	14	52				
PKHD1L1	93035	broad.mit.edu	37	8	110516570	110516570	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr8:110516570G>T	ENST00000378402.5	+	68	10947	c.10843G>T	c.(10843-10845)Gga>Tga	p.G3615*		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	3615					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.G3619*(1)		NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			AACATTTGTTGGATTTAAGAA	0.284										HNSCC(38;0.096)																													uc003yne.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14						c.(10843-10845)GGA>TGA		fibrocystin L precursor							80.0	77.0	78.0					8																	110516570		1814	4055	5869	SO:0001587	stop_gained	93035				immune response	cytosol|extracellular space|integral to membrane	receptor activity	g.chr8:110516570G>T	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.10843G>T	8.37:g.110516570G>T	ENSP00000367655:p.Gly3615*	HNSCC(38;0.096)					p.G3615*	NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)		68	10947	+			3615			Extracellular (Potential).		Q567P2|Q9UF27	Nonsense_Mutation	SNP	ENST00000378402.5	37	c.10843G>T	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	G	37	6.442716	0.97572	.	.	ENSG00000205038	ENST00000378402;ENST00000526472	.	.	.	5.71	4.83	0.62350	.	0.142463	0.45867	D	0.000340	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	.	13.9432	0.64069	0.0:0.0:0.8471:0.1529	.	.	.	.	X	3615;543	.	ENSP00000367655:G3615X	G	+	1	0	PKHD1L1	110585746	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.972000	0.63756	1.398000	0.46701	0.655000	0.94253	GGA		0.284	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531		4	44	1	0	0.00024832	0.009096	0.000274716	4	44				
FER1L6	654463	broad.mit.edu	37	8	125025722	125025723	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr8:125025722_125025723CC>AA	ENST00000522917.1	+	15	2079_2080	c.1873_1874CC>AA	c.(1873-1875)CCt>AAt	p.P625N	FER1L6_ENST00000399018.1_Missense_Mutation_p.P625N|FER1L6-AS1_ENST00000518567.1_RNA	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	625						integral component of membrane (GO:0016021)		p.P625N(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			ACAGGAGGCACCTGAAGAGAAA	0.49																																							uc003yqw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(5)|central_nervous_system(1)	11						c.(1873-1875)CCT>AAT		fer-1-like 6																																				SO:0001583	missense	654463					integral to membrane		g.chr8:125025722_125025723CC>AA	AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	Exception_encountered	8.37:g.125025722_125025723delinsAA	ENSP00000428280:p.Pro625Asn					uc003yqx.1_Intron	p.P625N	NM_001039112	NP_001034201	Q2WGJ9	FR1L6_HUMAN	STAD - Stomach adenocarcinoma(47;0.00186)		15	2079_2080	+	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		625			Cytoplasmic (Potential).			Missense_Mutation	DNP	ENST00000522917.1	37	c.1873_1874CC>AA	CCDS43767.1																																																																																				0.490	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	NM_001039112		26	47	0	0	0	0.004672	0	26	47				
EPPK1	83481	broad.mit.edu	37	8	144947001	144947001	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr8:144947001C>T	ENST00000525985.1	-	2	492	c.421G>A	c.(421-423)Gtt>Att	p.V141I				P58107	EPIPL_HUMAN	epiplakin 1	141						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)	p.V141I(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CTGTCCACAACCTCCTTCCCG	0.682																																							uc003zaa.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)|skin(1)	2						c.(421-423)GTT>ATT		epiplakin 1							20.0	24.0	23.0					8																	144947001		1970	4102	6072	SO:0001583	missense	83481					cytoplasm|cytoskeleton	protein binding|structural molecule activity	g.chr8:144947001C>T	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.421G>A	8.37:g.144947001C>T	ENSP00000436337:p.Val141Ile						p.V141I	NM_031308	NP_112598	P58107	EPIPL_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)		1	434	-	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		141			Plectin 3.		Q76E58|Q9NSU9	Missense_Mutation	SNP	ENST00000525985.1	37	c.421G>A		.	.	.	.	.	.	.	.	.	.	C	5.068	0.198242	0.09652	.	.	ENSG00000227184	ENST00000525985	T	0.66638	-0.22	4.44	0.572	0.17357	.	.	.	.	.	T	0.42585	0.1209	N	0.14661	0.345	0.21220	N	0.999754	B	0.02656	0.0	B	0.04013	0.001	T	0.19192	-1.0313	9	0.25106	T	0.35	.	4.5986	0.12341	0.0:0.4828:0.1532:0.364	.	141	E9PPU0	.	I	141	ENSP00000436337:V141I	ENSP00000436337:V141I	V	-	1	0	EPPK1	145018989	0.031000	0.19500	0.539000	0.28077	0.369000	0.29798	0.268000	0.18571	-0.079000	0.12707	-0.567000	0.04161	GTT		0.682	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308		9	30	0	0	0	0.006214	0	9	30				
PTPRD	5789	broad.mit.edu	37	9	8636710	8636710	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr9:8636710G>C	ENST00000381196.4	-	10	742	c.199C>G	c.(199-201)Cag>Gag	p.Q67E	PTPRD_ENST00000397611.3_Missense_Mutation_p.Q67E|PTPRD_ENST00000463477.1_Missense_Mutation_p.Q67E|PTPRD_ENST00000360074.4_Missense_Mutation_p.Q67E|PTPRD_ENST00000358503.5_Missense_Mutation_p.Q67E|PTPRD_ENST00000355233.5_Missense_Mutation_p.Q67E|PTPRD_ENST00000486161.1_Missense_Mutation_p.Q67E|PTPRD_ENST00000537002.1_Missense_Mutation_p.Q67E|PTPRD_ENST00000397617.3_Missense_Mutation_p.Q67E|PTPRD_ENST00000540109.1_Missense_Mutation_p.Q67E|PTPRD_ENST00000356435.5_Missense_Mutation_p.Q67E|PTPRD_ENST00000397606.3_Missense_Mutation_p.Q67E	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	67	Ig-like C2-type 1.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.Q67E(4)		NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		TCAAATCTCTGATTGCTGACT	0.443										TSP Lung(15;0.13)																													uc003zkk.2		NA																	4	Substitution - Missense(4)		lung(4)	lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22						c.(199-201)CAG>GAG		protein tyrosine phosphatase, receptor type, D							142.0	129.0	134.0					9																	8636710		2203	4300	6503	SO:0001583	missense	5789				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr9:8636710G>C	X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.199C>G	9.37:g.8636710G>C	ENSP00000370593:p.Gln67Glu	TSP Lung(15;0.13)				PTPRD_uc003zkp.2_Missense_Mutation_p.Q67E|PTPRD_uc003zkq.2_Missense_Mutation_p.Q67E|PTPRD_uc003zkr.2_Missense_Mutation_p.Q67E|PTPRD_uc003zks.2_Missense_Mutation_p.Q67E|PTPRD_uc003zkl.2_Missense_Mutation_p.Q67E|PTPRD_uc003zkm.2_Missense_Mutation_p.Q67E|PTPRD_uc003zkn.2_Missense_Mutation_p.Q67E|PTPRD_uc003zko.2_Missense_Mutation_p.Q67E|PTPRD_uc003zkt.1_Missense_Mutation_p.Q67E	p.Q67E	NM_002839	NP_002830	P23468	PTPRD_HUMAN		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)	12	910	-		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)	67			Ig-like C2-type 1.|Extracellular (Potential).		B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	ENST00000381196.4	37	c.199C>G	CCDS43786.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.823480	0.90873	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000355233;ENST00000397617;ENST00000397611;ENST00000537002;ENST00000346816;ENST00000540109;ENST00000486161;ENST00000397606;ENST00000463477;ENST00000481079	T;T;T;T;T;T;T;T;T;T;T;T;T	0.72942	-0.7;-0.7;-0.7;-0.7;-0.7;-0.7;-0.7;-0.7;-0.7;-0.7;-0.7;-0.7;-0.7	5.57	5.57	0.84162	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.67524	0.2902	N	0.03084	-0.415	0.80722	D	1	P;D;P;D;D;B;D;P;B;P	0.56746	0.847;0.973;0.953;0.977;0.977;0.414;0.967;0.76;0.411;0.65	P;D;P;D;D;B;P;P;B;B	0.66716	0.901;0.929;0.898;0.946;0.946;0.097;0.884;0.522;0.18;0.396	T	0.70328	-0.4902	9	.	.	.	.	19.5464	0.95299	0.0:0.0:1.0:0.0	.	67;67;67;67;67;67;67;67;67;67	C9J8S8;Q3KPJ2;Q3KPI9;Q3KPJ0;Q3KPJ1;F5GWT7;F5GWY7;G3XAE2;Q2HXI4;P23468	.;.;.;.;.;.;.;.;.;PTPRD_HUMAN	E	67	ENSP00000370593:Q67E;ENSP00000348812:Q67E;ENSP00000353187:Q67E;ENSP00000351293:Q67E;ENSP00000347373:Q67E;ENSP00000380741:Q67E;ENSP00000380735:Q67E;ENSP00000440515:Q67E;ENSP00000438164:Q67E;ENSP00000417093:Q67E;ENSP00000380731:Q67E;ENSP00000417661:Q67E;ENSP00000417890:Q67E	.	Q	-	1	0	PTPRD	8626710	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.814000	0.99346	2.615000	0.88500	0.557000	0.71058	CAG		0.443	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3			26	69	0	0	0	0.003954	0	26	69				
CTSV	1515	broad.mit.edu	37	9	99799533	99799533	+	Splice_Site	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr9:99799533C>A	ENST00000259470.5	-	4	646		c.e4+1		CTSV_ENST00000479932.1_5'Flank|CTSV_ENST00000538255.1_Splice_Site	NM_001333.3	NP_001324.2	O60911	CATL2_HUMAN	cathepsin V						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|autophagic cell death (GO:0048102)|catagen (GO:0042637)|cellular response to starvation (GO:0009267)|decidualization (GO:0046697)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hair follicle morphogenesis (GO:0031069)|multicellular organismal aging (GO:0010259)|negative regulation of keratinocyte proliferation (GO:0010839)|nerve development (GO:0021675)|protein autoprocessing (GO:0016540)|regulation of actin cytoskeleton reorganization (GO:2000249)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to gonadotropin (GO:0034698)|Sertoli cell differentiation (GO:0060008)|spermatogenesis (GO:0007283)	cytoplasmic vesicle (GO:0031410)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|microvillus (GO:0005902)|neuron projection (GO:0043005)|nucleolus (GO:0005730)|perikaryon (GO:0043204)	aminopeptidase activity (GO:0004177)|cysteine-type carboxypeptidase activity (GO:0016807)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|peptide binding (GO:0042277)	p.?(1)									CGCTGTCTCACCTGATTCTTC	0.483																																							uc004awt.2		NA																	1	Unknown(1)		lung(1)		0						c.e4+1		cathepsin L2 preproprotein							59.0	53.0	55.0					9																	99799533		2203	4300	6503	SO:0001630	splice_region_variant	1515					lysosome	cysteine-type endopeptidase activity	g.chr9:99799533C>A	Y14734	CCDS6723.1	9q22.33	2013-06-27	2013-06-27	2013-06-27	ENSG00000136943	ENSG00000136943		"""Cathepsins"""	2538	protein-coding gene	gene with protein product		603308	"""cathepsin L2"""	CTSL2		9563472, 10029531	Standard	NM_001201575		Approved	CTSU	uc004awt.3	O60911	OTTHUMG00000020314	ENST00000259470.5:c.396+1G>T	9.37:g.99799533C>A						CTSL2_uc010msi.2_Splice_Site_p.Q132_splice|CTSL2_uc004awu.2_Splice_Site_p.Q77_splice|CTSL2_uc010msj.1_Splice_Site_p.Q77_splice|CTSL2_uc010msk.2_Splice_Site_p.Q77_splice	p.Q132_splice	NM_001333	NP_001324	O60911	CATL2_HUMAN			4	593	-		Acute lymphoblastic leukemia(62;0.0559)						O60233|Q2TB86|Q5T1U0	Splice_Site	SNP	ENST00000259470.5	37	c.396_splice	CCDS6723.1	.	.	.	.	.	.	.	.	.	.	c	18.73	3.686092	0.68157	.	.	ENSG00000136943	ENST00000259470;ENST00000538255	.	.	.	3.7	3.7	0.42460	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.749	0.62894	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CTSL2	98839354	1.000000	0.71417	0.998000	0.56505	0.893000	0.52053	6.813000	0.75231	2.390000	0.81377	0.561000	0.74099	.		0.483	CTSV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053301.2	NM_001333	Intron	16	27	1	0	1.5739e-10	0.004007	2.04752e-10	16	27				
IKBKAP	8518	broad.mit.edu	37	9	111663784	111663784	+	Silent	SNP	T	T	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr9:111663784T>A	ENST00000374647.5	-	18	2242	c.1935A>T	c.(1933-1935)gcA>gcT	p.A645A	IKBKAP_ENST00000537196.1_Silent_p.A296A	NM_003640.3	NP_003631.2	O95163	ELP1_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein	645					chromatin organization (GO:0006325)|immune response (GO:0006955)|positive regulation of cell migration (GO:0030335)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|nucleolus (GO:0005730)|transcription elongation factor complex (GO:0008023)	phosphorylase kinase regulator activity (GO:0008607)|signal transducer activity (GO:0004871)	p.A645A(1)		NS(2)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						CATCATATACTGCAAATGACG	0.408																																							uc004bdm.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(2)|upper_aerodigestive_tract(1)|breast(1)|kidney(1)	7						c.(1933-1935)GCA>GCT		inhibitor of kappa light polypeptide gene							125.0	107.0	113.0					9																	111663784		2203	4300	6503	SO:0001819	synonymous_variant	8518				immune response|protein complex assembly|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|nucleolus|transcription elongation factor complex	phosphorylase kinase regulator activity|protein binding|signal transducer activity	g.chr9:111663784T>A	AF044195	CCDS6773.1	9q31	2014-09-17	2003-12-02		ENSG00000070061	ENSG00000070061		"""Elongator acetyltransferase complex subunits"""	5959	protein-coding gene	gene with protein product	"""elongator acetyltransferase complex subunit 1"""	603722	"""dysautonomia (Riley-Day syndrome, hereditary sensory autonomic neuropathy type III)"""	DYS		9751059, 11179008	Standard	NM_003640		Approved	IKAP, TOT1, ELP1, IKI3	uc004bdm.4	O95163	OTTHUMG00000020465	ENST00000374647.5:c.1935A>T	9.37:g.111663784T>A						IKBKAP_uc004bdl.2_Silent_p.A296A|IKBKAP_uc011lwc.1_Silent_p.A531A|IKBKAP_uc010mtq.2_Silent_p.A296A	p.A645A	NM_003640	NP_003631	O95163	ELP1_HUMAN			18	2455	-			645					Q5JSV2|Q9H327|Q9UG87	Silent	SNP	ENST00000374647.5	37	c.1935A>T	CCDS6773.1																																																																																				0.408	IKBKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053574.1			12	26	0	0	0	0.001368	0	12	26				
SPTAN1	6709	broad.mit.edu	37	9	131347078	131347078	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr9:131347078G>A	ENST00000372731.4	+	18	2626	c.2516G>A	c.(2515-2517)cGc>cAc	p.R839H	SPTAN1_ENST00000372739.3_Missense_Mutation_p.R839H|SPTAN1_ENST00000358161.5_Missense_Mutation_p.R839H	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	839					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.R839H(1)		NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						CATGAACCACGCATCAAAGCA	0.488																																					NSCLC(120;833 1744 2558 35612 37579)	NSCLC(120;833 1744 2558 35612 37579)	uc004bvl.3		NA																	1	Substitution - Missense(1)		lung(1)	breast(5)|ovary(4)|pancreas(1)	10						c.(2515-2517)CGC>CAC		spectrin, alpha, non-erythrocytic 1							155.0	118.0	130.0					9																	131347078		2203	4300	6503	SO:0001583	missense	6709				actin filament capping|axon guidance|cellular component disassembly involved in apoptosis	cytosol|intracellular membrane-bounded organelle|membrane fraction|microtubule cytoskeleton|spectrin	actin binding|calcium ion binding|calmodulin binding|structural constituent of cytoskeleton	g.chr9:131347078G>A	M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.2516G>A	9.37:g.131347078G>A	ENSP00000361816:p.Arg839His					SPTAN1_uc011mbg.1_Missense_Mutation_p.R839H|SPTAN1_uc011mbh.1_Missense_Mutation_p.R851H|SPTAN1_uc004bvm.3_Missense_Mutation_p.R839H|SPTAN1_uc004bvn.3_Missense_Mutation_p.R839H	p.R839H	NM_003127	NP_003118	Q13813	SPTA2_HUMAN			18	2629	+			839			Spectrin 9.		Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Missense_Mutation	SNP	ENST00000372731.4	37	c.2516G>A	CCDS6905.1	.	.	.	.	.	.	.	.	.	.	G	32	5.162517	0.94727	.	.	ENSG00000197694	ENST00000358161;ENST00000372731;ENST00000372739;ENST00000372719	T;T;T	0.55052	0.54;0.54;0.54	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.68311	0.2987	L	0.52364	1.645	0.80722	D	1	D;D;P;B;D	0.89917	1.0;1.0;0.556;0.024;0.998	D;D;B;B;D	0.87578	0.998;0.996;0.116;0.011;0.953	T	0.68629	-0.5358	10	0.51188	T	0.08	.	17.8183	0.88642	0.0:0.0:1.0:0.0	.	839;839;839;839;839	A6NG51;B4DTV8;Q13813-3;Q13813-2;Q13813	.;.;.;.;SPTA2_HUMAN	H	839	ENSP00000350882:R839H;ENSP00000361816:R839H;ENSP00000361824:R839H	ENSP00000350882:R839H	R	+	2	0	SPTAN1	130386899	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.400000	0.97290	2.449000	0.82847	0.561000	0.74099	CGC		0.488	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054472.1	NM_003127		29	41	0	0	0	0.009535	0	29	41				
NUP188	23511	broad.mit.edu	37	9	131745599	131745599	+	Silent	SNP	G	G	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr9:131745599G>A	ENST00000372577.2	+	18	1845	c.1824G>A	c.(1822-1824)gtG>gtA	p.V608V		NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	608					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)		p.V608V(1)		breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						CCCCACCTGTGGATGTCATTG	0.438																																							uc004bws.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|kidney(1)|breast(1)	7						c.(1822-1824)GTG>GTA		nucleoporin 188kDa							222.0	207.0	212.0					9																	131745599		2203	4300	6503	SO:0001819	synonymous_variant	23511				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding	g.chr9:131745599G>A	D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.1824G>A	9.37:g.131745599G>A						NUP188_uc004bwu.2_5'Flank	p.V608V	NM_015354	NP_056169	Q5SRE5	NU188_HUMAN			18	1846	+			608					Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Silent	SNP	ENST00000372577.2	37	c.1824G>A	CCDS35156.1																																																																																				0.438	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054529.2			52	137	0	0	0	0.00361	0	52	137				
SCML2	10389	broad.mit.edu	37	X	18278317	18278317	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chrX:18278317C>A	ENST00000251900.4	-	9	1202	c.1043G>T	c.(1042-1044)gGg>gTg	p.G348V	SCML2_ENST00000398048.3_Missense_Mutation_p.G84V	NM_006089.2	NP_006080.1	Q9UQR0	SCML2_HUMAN	sex comb on midleg-like 2 (Drosophila)	348					anatomical structure morphogenesis (GO:0009653)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G348V(1)		breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	36	Hepatocellular(33;0.183)					TTTACATGGCCCAGAAGCGAC	0.353																																					Esophageal Squamous(100;1252 1965 19021 35517)	Esophageal Squamous(100;1252 1965 19021 35517)	uc004cyl.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1042-1044)GGG>GTG		sex comb on midleg-like 2							66.0	62.0	63.0					X																	18278317		2203	4300	6503	SO:0001583	missense	10389				anatomical structure morphogenesis	PcG protein complex	DNA binding|sequence-specific DNA binding transcription factor activity	g.chrX:18278317C>A	Y18004	CCDS14185.1	Xp22	2013-01-10	2001-11-28		ENSG00000102098	ENSG00000102098		"""Sterile alpha motif (SAM) domain containing"""	10581	protein-coding gene	gene with protein product		300208	"""sex comb on midleg (Drosophila)-like 2"""			10331946	Standard	NM_006089		Approved		uc004cyl.2	Q9UQR0	OTTHUMG00000021212	ENST00000251900.4:c.1043G>T	X.37:g.18278317C>A	ENSP00000251900:p.Gly348Val					SCML2_uc004cyk.3_RNA|SCML2_uc010nfd.1_Missense_Mutation_p.G348V|SCML2_uc011miz.1_Missense_Mutation_p.G282V|SCML2_uc010nfc.2_Missense_Mutation_p.G84V	p.G348V	NM_006089	NP_006080	Q9UQR0	SCML2_HUMAN			9	1200	-	Hepatocellular(33;0.183)		348					Q5JXE6|Q86U98|Q8IWD0|Q8NDP2|Q9UGC5	Missense_Mutation	SNP	ENST00000251900.4	37	c.1043G>T	CCDS14185.1	.	.	.	.	.	.	.	.	.	.	C	2.943	-0.218563	0.06101	.	.	ENSG00000102098	ENST00000251900;ENST00000398048;ENST00000442000	T;T	0.42900	2.33;0.96	4.17	1.28	0.21552	.	8.424590	0.00465	N	0.000111	T	0.41858	0.1177	M	0.62723	1.935	0.25853	N	0.983913	B;P;P	0.49961	0.409;0.506;0.93	B;B;P	0.44673	0.168;0.074;0.457	T	0.21280	-1.0250	10	0.13853	T	0.58	.	4.076	0.09904	0.0:0.5804:0.1901:0.2294	.	316;84;348	B4DZR9;B4DRC2;Q9UQR0	.;.;SCML2_HUMAN	V	348;84;316	ENSP00000251900:G348V;ENSP00000381126:G84V	ENSP00000251900:G348V	G	-	2	0	SCML2	18188238	0.007000	0.16637	0.000000	0.03702	0.230000	0.25150	-0.178000	0.09782	0.025000	0.15241	0.538000	0.68166	GGG		0.353	SCML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055941.1	NM_006089		27	15	1	0	9.65021e-13	0.010818	1.31e-12	27	15				
CAPN6	827	broad.mit.edu	37	X	110496280	110496280	+	Silent	SNP	G	G	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chrX:110496280G>T	ENST00000324068.1	-	4	629	c.462C>A	c.(460-462)tcC>tcA	p.S154S	CAPN6_ENST00000541758.1_5'UTR	NM_014289.3	NP_055104.2	Q9Y6Q1	CAN6_HUMAN	calpain 6	154	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				microtubule bundle formation (GO:0001578)|proteolysis (GO:0006508)|regulation of cytoskeleton organization (GO:0051493)	perinuclear region of cytoplasm (GO:0048471)|spindle microtubule (GO:0005876)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|microtubule binding (GO:0008017)	p.S154S(1)		cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(25)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	47						ACTCATTCATGGAAGTGGAGA	0.433																																							uc004epc.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|skin(1)	6						c.(460-462)TCC>TCA		calpain 6							130.0	109.0	116.0					X																	110496280		2203	4300	6503	SO:0001819	synonymous_variant	827				microtubule bundle formation|proteolysis|regulation of cytoskeleton organization	perinuclear region of cytoplasm|spindle microtubule	calcium-dependent cysteine-type endopeptidase activity|microtubule binding	g.chrX:110496280G>T	AF029232	CCDS14555.1	Xq23	2008-07-29			ENSG00000077274	ENSG00000077274			1483	protein-coding gene	gene with protein product		300146				9503024, 9339374	Standard	NM_014289		Approved	CAPNX, CalpM, CANPX	uc004epc.2	Q9Y6Q1	OTTHUMG00000022203	ENST00000324068.1:c.462C>A	X.37:g.110496280G>T						CAPN6_uc011msu.1_5'UTR	p.S154S	NM_014289	NP_055104	Q9Y6Q1	CAN6_HUMAN			4	630	-			154			Calpain catalytic.		D3DUY7|Q9UEQ1|Q9UJA8	Silent	SNP	ENST00000324068.1	37	c.462C>A	CCDS14555.1																																																																																				0.433	CAPN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057922.1			40	13	1	0	1.47244e-24	0.00623	2.44827e-24	40	13				
ENOX2	10495	broad.mit.edu	37	X	129837188	129837188	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chrX:129837188C>A	ENST00000370927.1	-	2	111	c.90G>T	c.(88-90)atG>atT	p.M30I	ENOX2_ENST00000492263.1_5'UTR|ENOX2_ENST00000370935.1_Start_Codon_SNP_p.M1I|ENOX2_ENST00000394363.1_Start_Codon_SNP_p.M1I|ENOX2_ENST00000338144.3_Missense_Mutation_p.M30I			Q16206	ENOX2_HUMAN	ecto-NOX disulfide-thiol exchanger 2	30					cell growth (GO:0016049)|oxidation-reduction process (GO:0055114)|regulation of growth (GO:0040008)|ultradian rhythm (GO:0007624)	cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)	nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|protein disulfide oxidoreductase activity (GO:0015035)	p.M30I(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(3)	33						TAGGTAGTGTCATTGCAGTGG	0.418																																					Ovarian(101;828 1506 2951 9500 35258)	Ovarian(101;828 1506 2951 9500 35258)	uc004evw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(88-90)ATG>ATT		ecto-NOX disulfide-thiol exchanger 2 isoform b							148.0	118.0	128.0					X																	129837188		2203	4300	6503	SO:0001583	missense	10495				cell growth|electron transport chain|regulation of growth|transport|ultradian rhythm	cytosol|external side of plasma membrane|extracellular space	nucleic acid binding|nucleotide binding|protein disulfide oxidoreductase activity	g.chrX:129837188C>A	AF207881	CCDS14626.1, CCDS14627.1	Xq25	2013-02-12	2007-03-23	2007-03-23	ENSG00000165675	ENSG00000165675		"""RNA binding motif (RRM) containing"""	2259	protein-coding gene	gene with protein product		300282	"""cytosolic ovarian carcinoma antigen 1"""	COVA1		8150545, 11888291	Standard	NM_006375		Approved	APK1, tNOX	uc004evw.3	Q16206	OTTHUMG00000022401	ENST00000370927.1:c.90G>T	X.37:g.129837188C>A	ENSP00000359965:p.Met30Ile					ENOX2_uc004evx.2_Missense_Mutation_p.M1I|ENOX2_uc004evy.2_Missense_Mutation_p.M1I	p.M30I	NM_182314	NP_872114	Q16206	ENOX2_HUMAN			5	508	-			30					A8K197|A8K1C2|Q5VTJ1|Q5VTJ2|Q8WUX0|Q9NTP6|Q9UH82	Missense_Mutation	SNP	ENST00000370927.1	37	c.90G>T	CCDS14626.1	.	.	.	.	.	.	.	.	.	.	C	14.49	2.550561	0.45383	.	.	ENSG00000165675	ENST00000538435;ENST00000370935;ENST00000338144;ENST00000394363;ENST00000350369;ENST00000370927;ENST00000432489	.	.	.	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	T	0.27241	0.0668	N	0.19112	0.55	0.24848	N	0.992427	B	0.06786	0.001	B	0.08055	0.003	T	0.09228	-1.0684	8	.	.	.	-9.2021	12.6109	0.56549	0.0:1.0:0.0:0.0	.	30	Q16206	ENOX2_HUMAN	I	1;1;30;1;58;30;1	.	.	M	-	3	0	ENOX2	129664869	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.840000	0.48215	2.471000	0.83476	0.600000	0.82982	ATG		0.418	ENOX2-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058277.1	NM_182314		54	13	1	0	1.93748e-29	0.00361	3.46772e-29	54	13				
PROX1	5629	broad.mit.edu	37	1	214171394	214171394	+	Frame_Shift_Del	DEL	G	G	-			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr1:214171394delG	ENST00000366958.4	+	2	2124	c.1516delG	c.(1516-1518)ggafs	p.G506fs	PROX1_ENST00000261454.4_Frame_Shift_Del_p.G506fs|PROX1_ENST00000435016.1_Frame_Shift_Del_p.G506fs|PROX1_ENST00000498508.2_Frame_Shift_Del_p.G506fs	NM_001270616.1	NP_001257545.1	Q92786	PROX1_HUMAN	prospero homeobox 1	506					aorta smooth muscle tissue morphogenesis (GO:0060414)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|brain development (GO:0007420)|cell fate determination (GO:0001709)|cerebellar granule cell differentiation (GO:0021707)|dentate gyrus development (GO:0021542)|dorsal spinal cord development (GO:0021516)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocardium formation (GO:0060214)|hepatocyte cell migration (GO:0002194)|hepatocyte differentiation (GO:0070365)|hepatocyte proliferation (GO:0072574)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lens fiber cell morphogenesis (GO:0070309)|liver development (GO:0001889)|lung development (GO:0030324)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of cell proliferation (GO:0008285)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|olfactory placode formation (GO:0030910)|optic placode formation involved in camera-type eye formation (GO:0046619)|otic placode formation (GO:0043049)|pancreas development (GO:0031016)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell cycle checkpoint (GO:1901978)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of forebrain neuron differentiation (GO:2000979)|positive regulation of heart growth (GO:0060421)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of sarcomere organization (GO:0060298)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of gene expression (GO:0010468)|regulation of transcription involved in lymphatic endothelial cell fate commitment (GO:0060849)|response to nutrient levels (GO:0031667)|retina morphogenesis in camera-type eye (GO:0060042)|skeletal muscle thin filament assembly (GO:0030240)|venous blood vessel morphogenesis (GO:0048845)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DBD domain binding (GO:0050692)|DNA binding (GO:0003677)|LBD domain binding (GO:0050693)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|prostate(2)|skin(4)	47				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		CTCCTTCTCTGGAAAAGACAG	0.557																																							uc001hkh.2		NA																	0				ovary(3)|lung(1)|central_nervous_system(1)|skin(1)	6						c.(1516-1518)GGAfs		prospero homeobox 1							76.0	83.0	81.0					1																	214171394		2203	4300	6503	SO:0001589	frameshift_variant	5629				aorta smooth muscle tissue morphogenesis|atrial cardiac muscle tissue morphogenesis|brain development|dorsal spinal cord development|embryonic retina morphogenesis in camera-type eye|endocardium formation|hepatocyte differentiation|kidney development|lens fiber cell morphogenesis|lung development|lymphangiogenesis|negative regulation of bile acid biosynthetic process|negative regulation of cell proliferation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of viral genome replication|neural tube development|olfactory placode formation|optic placode formation involved in camera-type eye formation|otic placode formation|pancreas development|positive regulation of cyclin-dependent protein kinase activity|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of heart growth|positive regulation of S phase of mitotic cell cycle|positive regulation of sarcomere organization|positive regulation of transcription, DNA-dependent|regulation of transcription involved in lymphatic endothelial cell fate commitment|skeletal muscle thin filament assembly|venous blood vessel morphogenesis|ventricular cardiac muscle tissue morphogenesis|ventricular cardiac myofibril development|ventricular septum morphogenesis	cytoplasm|nucleus	DBD domain binding|LBD domain binding|ligand-dependent nuclear receptor binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription corepressor activity|transcription regulatory region DNA binding	g.chr1:214171394delG	U44060	CCDS31021.1	1q41	2011-06-20	2007-06-01		ENSG00000117707	ENSG00000117707		"""Homeoboxes / PROS class"""	9459	protein-coding gene	gene with protein product		601546	"""prospero-related homeobox 1"""			8812486	Standard	NM_002763		Approved		uc001hkg.2	Q92786	OTTHUMG00000036946	ENST00000366958.4:c.1516delG	1.37:g.214171394delG	ENSP00000355925:p.Gly506fs					PROX1_uc001hkg.1_Frame_Shift_Del_p.G506fs	p.G506fs	NM_002763	NP_002754	Q92786	PROX1_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)	2	1788	+			506					A6NK29|A8K2B1|Q5SW76|Q8TB91	Frame_Shift_Del	DEL	ENST00000366958.4	37	c.1516delG	CCDS31021.1																																																																																				0.557	PROX1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089727.6	NM_002763		98	65	NA	NA	NA	NA	NA	98	65	---	---	---	---
METTL21B	25895	broad.mit.edu	37	12	58174037	58174037	+	Splice_Site	DEL	G	G	-	rs143311691	byFrequency	TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr12:58174037delG	ENST00000300209.8	+	3	414		c.e3-1		RP11-571M6.15_ENST00000471530.1_Intron|METTL21B_ENST00000548256.1_Splice_Site|TSFM_ENST00000350762.5_5'Flank|RP11-571M6.15_ENST00000553083.1_Intron|TSFM_ENST00000543727.1_5'Flank|METTL21B_ENST00000333012.5_Splice_Site|TSFM_ENST00000540550.1_5'Flank|TSFM_ENST00000550559.1_5'Flank|TSFM_ENST00000548851.1_5'Flank|METTL21B_ENST00000551420.1_Splice_Site|TSFM_ENST00000323833.8_5'Flank|TSFM_ENST00000454289.3_5'Flank	NM_015433.2	NP_056248.2	Q96AZ1	MT21B_HUMAN	methyltransferase like 21B							cytoplasm (GO:0005737)|intracellular (GO:0005622)	methyltransferase activity (GO:0008168)			endometrium(1)|lung(1)	2						CTCTCTCTCAGGGGGGGATGT	0.582																																							uc001sqg.2		NA																	0					0						c.e3-1		hypothetical protein LOC25895 isoform a							40.0	40.0	40.0					12																	58174037		2203	4299	6502	SO:0001630	splice_region_variant	25895					integral to membrane|intracellular	methyltransferase activity	g.chr12:58174037delG	AL050100, AF455816	CCDS8957.1, CCDS31848.1	12q14.1	2011-03-03	2011-03-03	2011-03-03	ENSG00000123427	ENSG00000123427			24936	protein-coding gene	gene with protein product		615258	"""family with sequence similarity 119, member B"""	FAM119B		12477932	Standard	NM_015433		Approved	DKFZP586D0919	uc001sqg.3	Q96AZ1	OTTHUMG00000170459	ENST00000300209.8:c.290-1G>-	12.37:g.58174037delG						FAM119B_uc001sqf.2_Splice_Site_p.R143_splice|FAM119B_uc009zqd.2_Splice_Site|TSFM_uc001sqi.2_5'Flank|TSFM_uc010sse.1_5'Flank|TSFM_uc001sqh.2_5'Flank|TSFM_uc010ssf.1_5'Flank	p.G97_splice	NM_015433	NP_056248	Q96AZ1	MT21B_HUMAN			3	415	+	all_cancers(7;9.07e-82)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)							Q9H749|Q9Y3W2	Splice_Site	DEL	ENST00000300209.8	37	c.290_splice	CCDS8957.1																																																																																				0.582	METTL21B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409268.1	NM_015433	Intron	35	15	NA	NA	NA	NA	NA	35	15	---	---	---	---
ZIC2	7546	broad.mit.edu	37	13	100635008	100635010	+	In_Frame_Del	DEL	CCA	CCA	-	rs375069774		TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	CCA	CCA	-	-	CCA	CCA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr13:100635008_100635010delCCA	ENST00000376335.3	+	1	983_985	c.690_692delCCA	c.(688-693)gcccac>gcc	p.H239del		NM_007129.3	NP_009060.2	O95409	ZIC2_HUMAN	Zic family member 2	239	Necessary for interaction with MDFIC and transcriptional activation or repression. {ECO:0000250}.|Poly-His.		H -> HH. {ECO:0000269|PubMed:15221788}.|Missing. {ECO:0000269|PubMed:15221788}.		brain development (GO:0007420)|developmental pigmentation (GO:0048066)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|retinal ganglion cell axon guidance (GO:0031290)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(2)|liver(2)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					CAGCCGCGGCccaccaccaccac	0.621																																					Pancreas(97;119 1522 31925 44771 48764)	Pancreas(97;119 1522 31925 44771 48764)	uc001von.2		NA																	0					0						c.(688-693)GCCCAC>GCC		zinc finger protein of the cerebellum 2																																				SO:0001651	inframe_deletion	7546				brain development|negative regulation of transcription, DNA-dependent|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|visual perception	cytoplasm|nucleus	chromatin DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr13:100635008_100635010delCCA	AF104902	CCDS9495.1	13q32	2013-01-08	2011-05-19		ENSG00000043355	ENSG00000043355		"""Zinc fingers, C2H2-type"""	12873	protein-coding gene	gene with protein product	"""Zinc finger protein of the cerebellum 2"""	603073	"""Zic family member 2 (odd-paired Drosophila homolog)"", ""Zic family member 2 (odd-paired homolog, Drosophila)"""			9771712	Standard	NM_007129		Approved	HPE5	uc001von.3	O95409	OTTHUMG00000017279	ENST00000376335.3:c.690_692delCCA	13.37:g.100635017_100635019delCCA	ENSP00000365514:p.His239del						p.H239del	NM_007129	NP_009060	O95409	ZIC2_HUMAN			1	690_692	+	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)		239		Missing.|H -> HH.	Necessary for interaction with MDFIC and transcriptional activation or repression (By similarity).|Poly-His.		Q5VYA9|Q9H309	In_Frame_Del	DEL	ENST00000376335.3	37	c.690_692delCCA	CCDS9495.1																																																																																				0.621	ZIC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045618.2	NM_007129		7	92	NA	NA	NA	NA	NA	7	92	---	---	---	---
ARHGEF15	22899	broad.mit.edu	37	17	8215575	8215576	+	Frame_Shift_Ins	INS	-	-	T			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr17:8215575_8215576insT	ENST00000361926.3	+	2	328_329	c.218_219insT	c.(217-222)cctgctfs	p.A74fs	ARHGEF15_ENST00000421050.1_Frame_Shift_Ins_p.A74fs	NM_173728.3	NP_776089.2	O94989	ARHGF_HUMAN	Rho guanine nucleotide exchange factor (GEF) 15	74	Pro-rich.				negative regulation of synapse maturation (GO:2000297)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|regulation of catalytic activity (GO:0050790)|retina vasculature morphogenesis in camera-type eye (GO:0061299)	cytoplasm (GO:0005737)|dendrite (GO:0030425)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(9)|large_intestine(5)|lung(11)|ovary(5)|prostate(3)|skin(2)|urinary_tract(1)	37						CTCAAGCCCCCTGCTCTTTTGC	0.614																																							uc002glc.2		NA																	0				ovary(2)|skin(1)	3						c.(217-219)CCTfs		Rho guanine exchange factor 15																																				SO:0001589	frameshift_variant	22899				negative regulation of synapse maturation|regulation of Rho protein signal transduction	dendrite|intracellular	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity	g.chr17:8215575_8215576insT	AB020722	CCDS11139.1	17p13.1	2011-11-16			ENSG00000198844	ENSG00000198844		"""Rho guanine nucleotide exchange factors"""	15590	protein-coding gene	gene with protein product	"""Rho guanine exchange factor (GEF) 15"""	608504				10048485	Standard	NM_173728		Approved	KIAA0915, Vsm-RhoGEF, ARGEF15, FLJ13791, MGC44868	uc002glc.3	O94989	OTTHUMG00000108187	ENST00000361926.3:c.219dupT	17.37:g.8215576_8215576dupT	ENSP00000355026:p.Ala74fs					ARHGEF15_uc002glb.1_Frame_Shift_Ins_p.P73fs|ARHGEF15_uc002gld.2_Frame_Shift_Ins_p.P73fs|ARHGEF15_uc010vuw.1_Frame_Shift_Ins_p.P73fs	p.P73fs	NM_173728	NP_776089	O94989	ARHGF_HUMAN			2	339_340	+			73			Pro-rich.		A8K6G1|Q8N449|Q9H8B4	Frame_Shift_Ins	INS	ENST00000361926.3	37	c.218_219insT	CCDS11139.1																																																																																				0.614	ARHGEF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226993.2	NM_173728		35	31	NA	NA	NA	NA	NA	35	31	---	---	---	---
CD226	10666	broad.mit.edu	37	18	67614136	67614136	+	Frame_Shift_Del	DEL	C	C	-			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr18:67614136delC	ENST00000280200.4	-	3	484	c.216delG	c.(214-216)aggfs	p.R72fs	CD226_ENST00000581982.1_Intron|CD226_ENST00000582621.1_Frame_Shift_Del_p.R72fs|CD226_ENST00000577287.1_Intron	NM_006566.2	NP_006557.2	Q15762	CD226_HUMAN	CD226 molecule	72	Ig-like C2-type 1.				cell adhesion (GO:0007155)|cell recognition (GO:0008037)|cytokine production (GO:0001816)|positive regulation of Fc receptor mediated stimulatory signaling pathway (GO:0060369)|positive regulation of immunoglobulin mediated immune response (GO:0002891)|positive regulation of mast cell activation (GO:0033005)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)			breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(14)|prostate(1)|urinary_tract(1)	24		Esophageal squamous(42;0.129)				CATAGGGCTTCCTTATGACCA	0.453																																					NSCLC(184;838 2130 8673 21498 50749)	NSCLC(184;838 2130 8673 21498 50749)	uc010dqo.2		NA																	0					0						c.(214-216)AGGfs		CD226 molecule precursor							104.0	88.0	93.0					18																	67614136		2203	4300	6503	SO:0001589	frameshift_variant	10666				cell adhesion|cell recognition|positive regulation of Fc receptor mediated stimulatory signaling pathway|positive regulation of immunoglobulin mediated immune response|positive regulation of mast cell activation|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target	cell surface|integral to plasma membrane|membrane raft	cell adhesion molecule binding|integrin binding|protein kinase binding|receptor activity	g.chr18:67614136delC	U56102	CCDS11997.1	18q22.3	2013-01-11	2006-03-28		ENSG00000150637	ENSG00000150637		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	16961	protein-coding gene	gene with protein product		605397	"""CD226 antigen"""			8673704	Standard	NM_006566		Approved	DNAM-1, DNAM1, PTA1, TLiSA1	uc002lkm.4	Q15762	OTTHUMG00000132809	ENST00000280200.4:c.216delG	18.37:g.67614136delC	ENSP00000280200:p.Arg72fs					CD226_uc002lkm.3_Frame_Shift_Del_p.R72fs	p.R72fs	NM_006566	NP_006557	Q15762	CD226_HUMAN			2	663	-		Esophageal squamous(42;0.129)	72			Ig-like C2-type 1.|Extracellular (Potential).		B2R818	Frame_Shift_Del	DEL	ENST00000280200.4	37	c.216delG	CCDS11997.1																																																																																				0.453	CD226-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256226.3	NM_006566		42	44	NA	NA	NA	NA	NA	42	44	---	---	---	---
STK11	6794	broad.mit.edu	37	19	1220663	1220676	+	Frame_Shift_Del	DEL	CCTGGACACCTTCT	CCTGGACACCTTCT	-			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	CCTGGACACCTTCT	CCTGGACACCTTCT	-	-	CCTGGACACCTTCT	CCTGGACACCTTCT	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr19:1220663_1220676delCCTGGACACCTTCT	ENST00000326873.7	+	5	1854_1867	c.681_694delCCTGGACACCTTCT	c.(679-696)ggcctggacaccttctccfs	p.LDTFS228fs		NM_000455.4	NP_000446.1	Q15831	STK11_HUMAN	serine/threonine kinase 11	228	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|anoikis (GO:0043276)|autophagy (GO:0006914)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|energy reserve metabolic process (GO:0006112)|establishment of cell polarity (GO:0030010)|glucose homeostasis (GO:0042593)|Golgi localization (GO:0051645)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of protein kinase B signaling (GO:0051896)|regulation of Wnt signaling pathway (GO:0030111)|response to glucagon (GO:0033762)|response to ionizing radiation (GO:0010212)|response to lipid (GO:0033993)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|T cell receptor signaling pathway (GO:0050852)|TCR signalosome assembly (GO:0036399)|tissue homeostasis (GO:0001894)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|TCR signalosome (GO:0036398)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|p53 binding (GO:0002039)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.0?(20)|p.?(2)|p.F231L(1)		biliary_tract(1)|breast(3)|cervix(35)|gastrointestinal_tract_(site_indeterminate)(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|liver(1)|lung(219)|oesophagus(1)|ovary(4)|pancreas(6)|prostate(2)|skin(15)|small_intestine(1)|stomach(9)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	328		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		TTGCCAACGGCCTGGACACCTTCTCCGGCTTCAA	0.701		14	"""D, Mis, N, F, S"""		"""NSCLC, pancreatic"""	"""jejunal harmartoma, ovarian, testicular, pancreatic"""			Peutz-Jeghers syndrome	TSP Lung(3;<1E-08)																													uc002lrl.1		14	yes	Rec	yes	Peutz-Jeghers syndrome	19	19p13.3	6794	D|Mis|N|F|S	serine/threonine kinase 11 gene (LKB1)			"""E, M, O"""		jejunal harmartoma|ovarian|testicular|pancreatic	NSCLC|pancreatic		23	Whole gene deletion(20)|Unknown(2)|Substitution - Missense(1)	p.0?(19)|p.?(2)|p.F231L(1)	cervix(15)|lung(4)|oesophagus(1)|ovary(1)|kidney(1)|pancreas(1)	lung(174)|cervix(35)|skin(15)|large_intestine(12)|pancreas(6)|gastrointestinal_tract_(site_indeterminate)(5)|stomach(4)|ovary(4)|breast(2)|upper_aerodigestive_tract(1)|testis(1)|liver(1)|biliary_tract(1)|small_intestine(1)|urinary_tract(1)|oesophagus(1)|prostate(1)|kidney(1)	266	GRCh37	CM001344|CM041081	STK11	M		c.(679-696)GGCCTGGACACCTTCTCCfs		serine/threonine protein kinase 11																																				SO:0001589	frameshift_variant	6794	Peutz-Jeghers_syndrome	Familial Cancer Database	PJS, Hamartous Intestinal Polyposis	anoikis|cell cycle arrest|energy reserve metabolic process|insulin receptor signaling pathway|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr19:1220663_1220676delCCTGGACACCTTCT	U63333	CCDS45896.1	19p13.3	2014-09-17	2005-12-13			ENSG00000118046			11389	protein-coding gene	gene with protein product	"""polarization-related protein LKB1"""	602216	"""serine/threonine kinase 11 (Peutz-Jeghers syndrome)"""			9425897	Standard	XM_005259617		Approved	PJS, LKB1	uc002lrl.1	Q15831		ENST00000326873.7:c.681_694delCCTGGACACCTTCT	19.37:g.1220663_1220676delCCTGGACACCTTCT	ENSP00000324856:p.Leu228fs	TSP Lung(3;<1E-08)					p.G227fs	NM_000455	NP_000446	Q15831	STK11_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)	5	1796_1809	+		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)	227_232		S -> P (in sporadic cancer; somatic mutation; no effect heterotrimeric complex assembly with STRADA and CAB39).	Protein kinase.		B2RBX7|E7EW76	Frame_Shift_Del	DEL	ENST00000326873.7	37	c.681_694delCCTGGACACCTTCT	CCDS45896.1																																																																																				0.701	STK11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449839.3	NM_000455		17	12	NA	NA	NA	NA	NA	17	12	---	---	---	---
SLC23A2	9962	broad.mit.edu	37	20	4850569	4850569	+	Frame_Shift_Del	DEL	G	G	-			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr20:4850569delG	ENST00000379333.1	-	12	1625	c.1233delC	c.(1231-1233)cccfs	p.P411fs	SLC23A2_ENST00000424750.2_Frame_Shift_Del_p.P297fs|SNORA31_ENST00000516287.1_RNA|SLC23A2_ENST00000338244.1_Frame_Shift_Del_p.P411fs|SLC23A2_ENST00000468355.1_5'UTR	NM_203327.1	NP_976072.1	Q9UGH3	S23A2_HUMAN	solute carrier family 23 (ascorbic acid transporter), member 2	411					L-ascorbic acid metabolic process (GO:0019852)|L-ascorbic acid transport (GO:0015882)|molecular hydrogen transport (GO:0015993)|nucleobase transport (GO:0015851)|nucleobase-containing compound metabolic process (GO:0006139)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|transepithelial L-ascorbic acid transport (GO:0070904)|vitamin metabolic process (GO:0006766)|vitamin transmembrane transport (GO:0035461)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-ascorbate:sodium symporter activity (GO:0008520)|L-ascorbic acid transporter activity (GO:0015229)|nucleobase transmembrane transporter activity (GO:0015205)|sodium-dependent L-ascorbate transmembrane transporter activity (GO:0070890)|sodium-dependent multivitamin transmembrane transporter activity (GO:0008523)	p.I412fs*4(1)		endometrium(1)|kidney(3)|large_intestine(9)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						TTGCGTGGATGGGGGGGGGTG	0.527																																							uc002wlg.1		NA																	1	Deletion - Frameshift(1)		ovary(1)	ovary(2)	2						c.(1231-1233)CCCfs		solute carrier family 23 (nucleobase							65.0	70.0	68.0					20																	4850569		2203	4300	6503	SO:0001589	frameshift_variant	9962				L-ascorbic acid metabolic process|molecular hydrogen transport|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|transepithelial L-ascorbic acid transport	apical plasma membrane|integral to plasma membrane|membrane fraction	nucleobase transmembrane transporter activity|sodium-dependent L-ascorbate transmembrane transporter activity|sodium-dependent multivitamin transmembrane transporter activity	g.chr20:4850569delG	AF058319	CCDS13085.1	20p13	2013-07-18	2013-07-18	2003-03-21	ENSG00000089057	ENSG00000089057		"""Solute carriers"""	10973	protein-coding gene	gene with protein product		603791	"""solute carrier family 23 (nucleobase transporters), member 1"""	SLC23A1		9804989, 10331392	Standard	NM_005116		Approved	SVCT2, KIAA0238, YSPL2	uc002wlh.1	Q9UGH3	OTTHUMG00000031793	ENST00000379333.1:c.1233delC	20.37:g.4850569delG	ENSP00000368637:p.Pro411fs					SLC23A2_uc010zqr.1_Frame_Shift_Del_p.P296fs|SLC23A2_uc002wlh.1_Frame_Shift_Del_p.P411fs|SLC23A2_uc002wli.2_Frame_Shift_Del_p.P410fs	p.P411fs	NM_005116	NP_005107	Q9UGH3	S23A2_HUMAN			12	1608	-			411					B4DJZ1|Q8WWR4|Q92512|Q96D54|Q9UNU1|Q9UP85	Frame_Shift_Del	DEL	ENST00000379333.1	37	c.1233delC	CCDS13085.1																																																																																				0.527	SLC23A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077832.1			11	139	NA	NA	NA	NA	NA	11	139	---	---	---	---
CCDC174	51244	broad.mit.edu	37	3	14712602	14712603	+	Frame_Shift_Ins	INS	-	-	A			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr3:14712602_14712603insA	ENST00000383794.3	+	11	1378_1379	c.1305_1306insA	c.(1306-1308)acgfs	p.T436fs	CCDC174_ENST00000303688.7_Frame_Shift_Ins_p.T360fs	NM_016474.4	NP_057558.3	Q6PII3	CC174_HUMAN	coiled-coil domain containing 174	436			T -> M (in dbSNP:rs60239620).			cytoplasm (GO:0005737)|nucleus (GO:0005634)											GCCCTGAACATACGTCACCCAC	0.55																																							uc003byw.2		NA																	0					0						c.(1303-1308)CATACGfs		hypothetical protein LOC51244																																				SO:0001589	frameshift_variant	51244							g.chr3:14712602_14712603insA	AF151046	CCDS2620.2	3p25.1	2012-09-20	2012-09-20	2012-09-20	ENSG00000154781	ENSG00000154781			28033	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 19"""	C3orf19		11042152	Standard	NM_016474		Approved	FLJ33839	uc003byw.3	Q6PII3	OTTHUMG00000129837	ENST00000383794.3:c.1306dupA	3.37:g.14712603_14712603dupA	ENSP00000373304:p.Thr436fs					C3orf19_uc010hej.2_Frame_Shift_Ins_p.H264fs	p.H435fs	NM_016474	NP_057558	Q6PII3	CC019_HUMAN			11	1396_1397	+			435_436					Q96CS5	Frame_Shift_Ins	INS	ENST00000383794.3	37	c.1305_1306insA	CCDS2620.2																																																																																				0.550	CCDC174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252077.2	NM_016474		40	18	NA	NA	NA	NA	NA	40	18	---	---	---	---
ZNF608	57507	broad.mit.edu	37	5	123982754	123982762	+	In_Frame_Del	DEL	TACTTCTCA	TACTTCTCA	-			TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	TACTTCTCA	TACTTCTCA	-	-	TACTTCTCA	TACTTCTCA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr5:123982754_123982762delTACTTCTCA	ENST00000306315.5	-	4	3750_3758	c.3315_3323delTGAGAAGTA	c.(3313-3324)tatgagaagtac>tac	p.1105_1108YEKY>Y	ZNF608_ENST00000504926.1_In_Frame_Del_p.678_681YEKY>Y|ZNF608_ENST00000513985.1_5'Flank	NM_020747.2	NP_065798.2	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	1105							metal ion binding (GO:0046872)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(12)|ovary(3)|skin(6)|urinary_tract(1)	46		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		GTCCTCATAGTACTTCTCATACTGCTGTC	0.522																																							uc003ktq.1		NA																	0				skin(3)|ovary(2)|lung(1)	6						c.(3313-3324)TATGAGAAGTAC>TAC		zinc finger protein 608																																				SO:0001651	inframe_deletion	57507					intracellular	zinc ion binding	g.chr5:123982754_123982762delTACTTCTCA	AB033107	CCDS34219.1	5q23.2	2008-05-02			ENSG00000168916	ENSG00000168916		"""Zinc fingers, C2H2-type"""	29238	protein-coding gene	gene with protein product						10574462, 10508479	Standard	NM_020747		Approved	KIAA1281, DKFZp434M098, NY-REN-36	uc003ktq.1	Q9ULD9	OTTHUMG00000162999	ENST00000306315.5:c.3315_3323delTGAGAAGTA	5.37:g.123982754_123982762delTACTTCTCA	ENSP00000307746:p.Tyr1105_Lys1107del					ZNF608_uc003ktr.1_Intron|ZNF608_uc003kts.1_In_Frame_Del_p.1105_1108YEKY>Y|ZNF608_uc003ktt.1_In_Frame_Del_p.1105_1108YEKY>Y|ZNF608_uc003ktp.1_5'Flank	p.1105_1108YEKY>Y	NM_020747	NP_065798	Q9ULD9	ZN608_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)	4	3438_3446	-		all_cancers(142;0.186)|Prostate(80;0.081)	1105_1108					A7E2W9|Q3SYM6|Q68D12|Q8IY05|Q9Y5A1	In_Frame_Del	DEL	ENST00000306315.5	37	c.3315_3323delTGAGAAGTA	CCDS34219.1																																																																																				0.522	ZNF608-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371300.1	XM_114432		27	81	NA	NA	NA	NA	NA	27	81	---	---	---	---
HLA-F	3134	broad.mit.edu	37	6	29694802	29694803	+	IGR	INS	-	-	T	rs17875385		TCGA-05-4415-01A-22D-1855-08	TCGA-05-4415-10A-01D-1855-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	128f52c7-49dc-4a9f-a5bc-1c14684edc9c	1339361e-fe70-4584-a7cd-946ccd8476bc	g.chr6:29694802_29694803insT	ENST00000376861.1	+	0	1544				HLA-F_ENST00000440587.2_Intron|HLA-F_ENST00000259951.7_Frame_Shift_Ins_p.F394fs|HLA-F_ENST00000475996.1_Intron			P30511	HLAF_HUMAN	major histocompatibility complex, class I, F						antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)	early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)|TAP1 binding (GO:0046978)|TAP2 binding (GO:0046979)			cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	8						TGTGGATCTTGTTTTTTTTGTG	0.535																																							uc003nno.3		NA																	0					0						c.(1177-1182)TTGTTTfs		major histocompatibility complex, class I, F				16,3332		2,12,1660						-0.3	0.3		dbSNP_124	229	17,6555		4,9,3273	no	frameshift	HLA-F	NM_001098479.1		6,21,4933	A1A1,A1R,RR		0.2587,0.4779,0.3327				33,9887				SO:0001628	intergenic_variant	3134				antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity	g.chr6:29694802_29694803insT	AY253269	CCDS43437.1, CCDS43438.1, CCDS43439.1	6p21.3	2013-01-11			ENSG00000204642	ENSG00000204642		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4963	protein-coding gene	gene with protein product		143110				1688605	Standard	NM_018950		Approved		uc003nno.4	P30511	OTTHUMG00000031156		6.37:g.29694810_29694810dupT						HLA-F_uc011dlx.1_Intron|HLA-F_uc011dly.1_Intron|LOC285830_uc003nnp.2_RNA|LOC285830_uc011dlz.1_RNA	p.L393fs	NM_001098479	NP_001091949	P30511	HLAF_HUMAN			7	1303_1304	+			Error:Variant_position_missing_in_P30511_after_alignment					Q5JQI8|Q5JQJ1|Q5SPT5|Q860R0|Q8MGQ1|Q8WLP5|Q95HC0|Q9TP68	Frame_Shift_Ins	INS	ENST00000376861.1	37	c.1179_1180insT	CCDS43438.1																																																																																				0.535	HLA-F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195083.1	NM_018950		9	335	NA	NA	NA	NA	NA	9	335	---	---	---	---
