#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
TTLL10	254173	broad.mit.edu	37	1	1118337	1118337	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr1:1118337C>T	ENST00000379290.1	+	11	1171	c.998C>T	c.(997-999)gCc>gTc	p.A333V	TTLL10_ENST00000379289.1_Missense_Mutation_p.A333V|TTLL10_ENST00000379288.3_Missense_Mutation_p.A260V			Q6ZVT0	TTL10_HUMAN	tubulin tyrosine ligase-like family, member 10	333	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)			p.A260V(1)		haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(2)|skin(1)	7	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;4.75e-36)|OV - Ovarian serous cystadenocarcinoma(86;5.82e-22)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;4.22e-05)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		GAGGAAGTTGCCGCCCTGCAG	0.662																																							uc001acy.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(997-999)GCC>GTC		tubulin tyrosine ligase-like family, member 10							35.0	25.0	28.0					1																	1118337		2191	4295	6486	SO:0001583	missense	254173				protein modification process		ATP binding|tubulin-tyrosine ligase activity	g.chr1:1118337C>T	AK093438	CCDS8.1, CCDS44036.1	1p36.33	2014-01-28	2005-07-29	2005-07-29	ENSG00000162571	ENSG00000162571		"""Tubulin tyrosine ligase-like family"""	26693	protein-coding gene	gene with protein product			"""tubulin tyrosine ligase-like family, member 5"""	TTLL5		15890843	Standard	NM_153254		Approved	FLJ36119	uc001acy.2	Q6ZVT0	OTTHUMG00000000851	ENST00000379290.1:c.998C>T	1.37:g.1118337C>T	ENSP00000368592:p.Ala333Val					TTLL10_uc010nyg.1_Missense_Mutation_p.A333V|TTLL10_uc001acz.1_Missense_Mutation_p.A260V	p.A333V	NM_001130045	NP_001123517	Q6ZVT0	TTL10_HUMAN		Epithelial(90;4.75e-36)|OV - Ovarian serous cystadenocarcinoma(86;5.82e-22)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;4.22e-05)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)	11	1149	+	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)	333			TTL.		B1AMF6|Q5T2W4|Q5T2W5|Q8N9X2	Missense_Mutation	SNP	ENST00000379290.1	37	c.998C>T	CCDS44036.1	.	.	.	.	.	.	.	.	.	.	C	9.724	1.160394	0.21454	.	.	ENSG00000162571	ENST00000379290;ENST00000379289;ENST00000379288	T;T;T	0.05513	3.43;3.43;3.43	3.9	0.474	0.16768	.	1.147390	0.06862	U	0.799207	T	0.04815	0.0130	L	0.29908	0.895	0.09310	N	1	B;B	0.24132	0.08;0.098	B;B	0.27380	0.074;0.079	T	0.47302	-0.9128	10	0.27785	T	0.31	.	1.4164	0.02302	0.2244:0.4223:0.2192:0.1341	.	260;333	Q6ZVT0-3;Q6ZVT0	.;TTL10_HUMAN	V	333;333;260	ENSP00000368592:A333V;ENSP00000368591:A333V;ENSP00000368590:A260V	ENSP00000368590:A260V	A	+	2	0	TTLL10	1108200	0.000000	0.05858	0.003000	0.11579	0.502000	0.33828	0.608000	0.24223	0.270000	0.21984	0.486000	0.48141	GCC		0.662	TTLL10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002421.3	NM_153254		3	16	0	0	0	0.004672	0	3	16				
UBE4B	10277	broad.mit.edu	37	1	10155625	10155625	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr1:10155625G>A	ENST00000253251.8	+	3	1157	c.318G>A	c.(316-318)atG>atA	p.M106I	UBE4B_ENST00000343090.6_Missense_Mutation_p.M106I|UBE4B_ENST00000377157.3_5'UTR					ubiquitination factor E4B									p.M106I(2)		NS(3)|breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(14)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	48		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		CCCAGAGCATGGATATCGATG	0.448																																							uc001aqs.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|skin(2)	4						c.(316-318)ATG>ATA		ubiquitination factor E4B isoform 1							151.0	126.0	134.0					1																	10155625		2203	4300	6503	SO:0001583	missense	10277				apoptosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to UV	cytoplasm|ubiquitin ligase complex	enzyme binding	g.chr1:10155625G>A	AF091093	CCDS110.1, CCDS41245.1	1p36.1	2013-01-28	2011-05-19		ENSG00000130939	ENSG00000130939		"""U-box domain containing"""	12500	protein-coding gene	gene with protein product		613565	"""ubiquitination factor E4B (homologous to yeast UFD2)"", ""ubiquitination factor E4B (UFD2 homolog, yeast)"""			9734811, 10089879	Standard	NM_006048		Approved	UBOX3, E4, UFD2, KIAA0684	uc001aqs.4	O95155	OTTHUMG00000001797	ENST00000253251.8:c.318G>A	1.37:g.10155625G>A	ENSP00000253251:p.Met106Ile					UBE4B_uc001aqr.3_Missense_Mutation_p.M106I|UBE4B_uc010oai.1_RNA|UBE4B_uc010oaj.1_5'UTR	p.M106I	NM_001105562	NP_001099032	O95155	UBE4B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)	3	1031	+		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)	106						Missense_Mutation	SNP	ENST00000253251.8	37	c.318G>A	CCDS110.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.598644	0.87055	.	.	ENSG00000130939	ENST00000253251;ENST00000343090	T;T	0.61158	0.32;0.13	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.68081	0.2962	L	0.49126	1.545	0.80722	D	1	P;P	0.45126	0.851;0.656	P;P	0.58391	0.838;0.584	T	0.59910	-0.7365	10	0.18276	T	0.48	-28.1731	19.1791	0.93615	0.0:0.0:1.0:0.0	.	106;106	O95155;O95155-2	UBE4B_HUMAN;.	I	106	ENSP00000253251:M106I;ENSP00000343001:M106I	ENSP00000253251:M106I	M	+	3	0	UBE4B	10078212	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.420000	0.97426	2.603000	0.88011	0.650000	0.86243	ATG		0.448	UBE4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005017.1	NM_006048		33	78	0	0	0	0.004878	0	33	78				
KIF1B	23095	broad.mit.edu	37	1	10407885	10407885	+	Splice_Site	SNP	G	G	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr1:10407885G>A	ENST00000377086.1	+	36	4066	c.3864G>A	c.(3862-3864)caG>caA	p.Q1288Q	KIF1B_ENST00000465635.1_3'UTR|KIF1B_ENST00000377081.1_Splice_Site_p.Q1288Q|KIF1B_ENST00000263934.6_Splice_Site_p.Q1242Q			O60333	KIF1B_HUMAN	kinesin family member 1B	1288					anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)	p.?(1)		breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		TGCTTCATCAGGTACTAATGA	0.398																																							uc001aqx.3		NA																	1	Unknown(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)	3						c.(3862-3864)CAG>CAA		kinesin family member 1B isoform b							103.0	99.0	100.0					1																	10407885		2203	4300	6503	SO:0001630	splice_region_variant	23095				anterograde axon cargo transport|apoptosis|neuromuscular synaptic transmission|neuron-neuron synaptic transmission	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|mitochondrion	ATP binding|ATPase activity|kinesin binding|microtubule motor activity|protein binding	g.chr1:10407885G>A	AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.3864+1G>A	1.37:g.10407885G>A						KIF1B_uc001aqw.3_Silent_p.Q1242Q|KIF1B_uc001aqy.2_Silent_p.Q1262Q|KIF1B_uc001aqz.2_Silent_p.Q1288Q|KIF1B_uc001ara.2_Silent_p.Q1248Q|KIF1B_uc001arb.2_Silent_p.Q1274Q	p.Q1288Q	NM_015074	NP_055889	O60333	KIF1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)	36	4066	+	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)	1288					A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Silent	SNP	ENST00000377086.1	37	c.3864G>A																																																																																					0.398	KIF1B-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000005102.1		Silent	20	62	0	0	0	0.010504	0	20	62				
C1orf127	148345	broad.mit.edu	37	1	11008316	11008316	+	Missense_Mutation	SNP	G	G	A	rs370186380		TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr1:11008316G>A	ENST00000377008.4	-	11	1821	c.1375C>T	c.(1375-1377)Cgc>Tgc	p.R459C	C1orf127_ENST00000377004.4_Missense_Mutation_p.R626C			Q8N9H9	CA127_HUMAN	chromosome 1 open reading frame 127	459								p.R459C(1)|p.R626C(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(5)	32	Ovarian(185;0.249)	Lung NSC(185;0.000226)|all_lung(284;0.000302)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.71e-07)|COAD - Colon adenocarcinoma(227;7.79e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000305)|Kidney(185;0.000785)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|READ - Rectum adenocarcinoma(331;0.0509)		CCTGTCTGGCGTGGCCTCTCC	0.657																																							uc010oao.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1429-1431)CGC>TGC		hypothetical protein LOC148345		G	CYS/ARG	0,4406		0,0,2203	57.0	65.0	62.0		1876	-2.7	0.0	1		62	1,8599	1.2+/-3.3	0,1,4299	no	missense	C1orf127	NM_001170754.1	180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	626/824	11008316	1,13005	2203	4300	6503	SO:0001583	missense	148345							g.chr1:11008316G>A	AK094437	CCDS53267.1	1p36.22	2008-02-05			ENSG00000175262	ENSG00000175262			26730	protein-coding gene	gene with protein product						14702039	Standard	NM_001170754		Approved	FLJ37118	uc010oao.2	Q8N9H9	OTTHUMG00000002032	ENST00000377008.4:c.1375C>T	1.37:g.11008316G>A	ENSP00000366207:p.Arg459Cys					C1orf127_uc001arr.1_Missense_Mutation_p.R459C|C1orf127_uc001ars.1_Missense_Mutation_p.R451C	p.R477C	NM_173507	NP_775778	B7ZLG7	B7ZLG7_HUMAN	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.71e-07)|COAD - Colon adenocarcinoma(227;7.79e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000305)|Kidney(185;0.000785)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|READ - Rectum adenocarcinoma(331;0.0509)	8	1434	-	Ovarian(185;0.249)	Lung NSC(185;0.000226)|all_lung(284;0.000302)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)	477					A0AVG8|A6NKM7|Q5VXJ2	Missense_Mutation	SNP	ENST00000377008.4	37	c.1429C>T		.	.	.	.	.	.	.	.	.	.	G	13.07	2.127043	0.37533	0.0	1.16E-4	ENSG00000175262	ENST00000377004;ENST00000377008	T;T	0.26660	1.72;1.72	4.34	-2.73	0.05950	.	0.920442	0.08805	N	0.891158	T	0.08403	0.0209	N	0.08118	0	0.09310	N	1	P;P;P	0.49358	0.923;0.923;0.923	B;B;B	0.31751	0.135;0.135;0.135	T	0.20174	-1.0283	10	0.51188	T	0.08	0.7213	4.868	0.13618	0.3133:0.0:0.4535:0.2331	.	477;451;459	B7ZLG7;Q8N9H9-2;Q8N9H9	.;.;CA127_HUMAN	C	626;459	ENSP00000366203:R626C;ENSP00000366207:R459C	ENSP00000366203:R626C	R	-	1	0	C1orf127	10930903	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.490000	0.06482	-1.073000	0.03137	-2.067000	0.00394	CGC		0.657	C1orf127-202	KNOWN	basic	protein_coding	protein_coding		NM_173507		24	140	0	0	0	0.008361	0	24	140				
UBR4	23352	broad.mit.edu	37	1	19443790	19443790	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr1:19443790C>A	ENST00000375254.3	-	73	10775	c.10748G>T	c.(10747-10749)cGg>cTg	p.R3583L	UBR4_ENST00000375226.2_Missense_Mutation_p.R3559L|UBR4_ENST00000375218.3_5'UTR|UBR4_ENST00000375217.2_Missense_Mutation_p.R3576L|UBR4_ENST00000375267.2_Missense_Mutation_p.R3583L	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	3583					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R3583L(1)		breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CATCTTGGTCCGTTTCAGATC	0.507																																							uc001bbi.2		NA																	1	Substitution - Missense(1)		lung(1)	kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25						c.(10747-10749)CGG>CTG		retinoblastoma-associated factor 600							215.0	182.0	193.0					1																	19443790		2203	4300	6503	SO:0001583	missense	23352				interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr1:19443790C>A	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.10748G>T	1.37:g.19443790C>A	ENSP00000364403:p.Arg3583Leu					UBR4_uc001bbj.1_5'UTR	p.R3583L	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)	73	10752	-		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)	3583					A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	ENST00000375254.3	37	c.10748G>T	CCDS189.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.587219	0.86851	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226	T;T;T;T	0.34859	1.34;1.34;1.37;1.38	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.64371	0.2592	M	0.86028	2.79	0.80722	D	1	D	0.60160	0.987	D	0.65010	0.931	T	0.70117	-0.4960	10	0.87932	D	0	.	17.9829	0.89147	0.0:1.0:0.0:0.0	.	3583	Q5T4S7	UBR4_HUMAN	L	3583;3583;3576;3559	ENSP00000364403:R3583L;ENSP00000364416:R3583L;ENSP00000364365:R3576L;ENSP00000364374:R3559L	ENSP00000364365:R3576L	R	-	2	0	UBR4	19316377	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.487000	0.81328	2.581000	0.87130	0.655000	0.94253	CGG		0.507	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765		68	127	1	0	1.43987e-31	0.00361	2.29499e-31	68	127				
LDLRAP1	26119	broad.mit.edu	37	1	25880433	25880433	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr1:25880433G>T	ENST00000374338.4	+	2	228	c.109G>T	c.(109-111)Gac>Tac	p.D37Y	LDLRAP1_ENST00000488127.1_3'UTR	NM_015627.2	NP_056442.2	Q5SW96	ARH_HUMAN	low density lipoprotein receptor adaptor protein 1	37					amyloid precursor protein metabolic process (GO:0042982)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|positive regulation of cholesterol metabolic process (GO:0090205)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of signal transduction (GO:0009967)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|regulation of protein binding (GO:0043393)|transport (GO:0006810)	axon (GO:0030424)|basal plasma membrane (GO:0009925)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|early endosome (GO:0005769)|neurofilament (GO:0005883)|recycling endosome (GO:0055037)	AP-2 adaptor complex binding (GO:0035612)|beta-amyloid binding (GO:0001540)|clathrin adaptor activity (GO:0035615)|clathrin binding (GO:0030276)|low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphotyrosine binding (GO:0001784)|receptor signaling complex scaffold activity (GO:0030159)|signaling adaptor activity (GO:0035591)	p.D37Y(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)|urinary_tract(1)	9		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.63e-26)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000728)|STAD - Stomach adenocarcinoma(196;0.000766)|BRCA - Breast invasive adenocarcinoma(304;0.000969)|GBM - Glioblastoma multiforme(114;0.00914)|READ - Rectum adenocarcinoma(331;0.0649)		GAACTGGACAGACACGCGGGA	0.647																																							uc001bkl.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(109-111)GAC>TAC		low density lipoprotein receptor adaptor protein							54.0	44.0	47.0					1																	25880433		2203	4300	6503	SO:0001583	missense	26119				amyloid precursor protein metabolic process|cholesterol homeostasis|cholesterol metabolic process|positive regulation of receptor-mediated endocytosis|receptor internalization|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport|regulation of establishment of protein localization in plasma membrane|regulation of protein binding	basal plasma membrane|cytosol|early endosome|internal side of plasma membrane|neurofilament|recycling endosome	beta-amyloid binding|clathrin binding|low-density lipoprotein particle receptor binding|phosphatidylinositol-4,5-bisphosphate binding|phosphotyrosine binding|protein binding, bridging|protein complex binding|receptor signaling complex scaffold activity|signaling adaptor activity	g.chr1:25880433G>T	BC029770	CCDS30639.1	1p36-p35	2014-09-17			ENSG00000157978	ENSG00000157978			18640	protein-coding gene	gene with protein product		605747					Standard	NM_015627		Approved	ARH, ARH2, FHCB1, FHCB2, MGC34705, DKFZp586D0624	uc001bkl.4	Q5SW96	OTTHUMG00000007386	ENST00000374338.4:c.109G>T	1.37:g.25880433G>T	ENSP00000363458:p.Asp37Tyr						p.D37Y	NM_015627	NP_056442	Q5SW96	ARH_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.63e-26)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000728)|STAD - Stomach adenocarcinoma(196;0.000766)|BRCA - Breast invasive adenocarcinoma(304;0.000969)|GBM - Glioblastoma multiforme(114;0.00914)|READ - Rectum adenocarcinoma(331;0.0649)	2	223	+		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)	37					A2BHI5|Q6TQS9|Q8N2Y0|Q9UFI9	Missense_Mutation	SNP	ENST00000374338.4	37	c.109G>T	CCDS30639.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.036912	0.93630	.	.	ENSG00000157978	ENST00000374338	T	0.64085	-0.08	5.59	5.59	0.84812	Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.71676	0.3368	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.72982	0.979	T	0.72899	-0.4152	10	0.56958	D	0.05	-36.1556	18.5826	0.91177	0.0:0.0:1.0:0.0	.	37	Q5SW96	ARH_HUMAN	Y	37	ENSP00000363458:D37Y	ENSP00000363458:D37Y	D	+	1	0	LDLRAP1	25753020	1.000000	0.71417	0.972000	0.41901	0.973000	0.67179	9.831000	0.99420	2.642000	0.89623	0.561000	0.74099	GAC		0.647	LDLRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019350.3	NM_015627		10	40	1	0	7.03913e-09	0.001368	8.26135e-09	10	40				
PPCS	79717	broad.mit.edu	37	1	42922700	42922700	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr1:42922700A>G	ENST00000372561.3	+	1	471	c.464A>G	c.(463-465)tAt>tGt	p.Y155C	ZMYND12_ENST00000372565.3_5'Flank|PPCS_ENST00000372556.3_Intron|PPCS_ENST00000372560.3_Missense_Mutation_p.Y155C|ZMYND12_ENST00000433602.2_5'Flank|PPCS_ENST00000472013.1_3'UTR|PPCS_ENST00000372562.1_Intron|PPCS_ENST00000455780.1_Intron	NM_024664.2	NP_078940.2	Q9HAB8	PPCS_HUMAN	phosphopantothenoylcysteine synthetase	155					coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	phosphopantothenate--cysteine ligase activity (GO:0004632)	p.Y155C(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|skin(3)	12	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				TTGGCGGACTATTTGCATCTG	0.582																																							uc001chl.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(463-465)TAT>TGT		phosphopantothenoylcysteine synthetase isoform							33.0	35.0	34.0					1																	42922700		2069	4207	6276	SO:0001583	missense	79717				coenzyme biosynthetic process|pantothenate metabolic process	cytosol	phosphopantothenate--cysteine ligase activity	g.chr1:42922700A>G	AK021900	CCDS41311.1, CCDS41312.1	1p34.2	2008-02-05			ENSG00000127125	ENSG00000127125	6.3.2.5		25686	protein-coding gene	gene with protein product		609853				11923312	Standard	NM_024664		Approved	FLJ11838	uc001chl.3	Q9HAB8	OTTHUMG00000007332	ENST00000372561.3:c.464A>G	1.37:g.42922700A>G	ENSP00000361642:p.Tyr155Cys					ZMYND12_uc001chj.2_5'Flank|ZMYND12_uc010ojt.1_5'Flank|PPCS_uc001chk.2_Intron	p.Y155C	NM_024664	NP_078940	Q9HAB8	PPCS_HUMAN			1	528	+	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)	155					Q3KQT2|Q5VVM0	Missense_Mutation	SNP	ENST00000372561.3	37	c.464A>G	CCDS41311.1	.	.	.	.	.	.	.	.	.	.	A	25.2	4.617867	0.87359	.	.	ENSG00000127125	ENST00000372560;ENST00000372561	.	.	.	5.98	5.98	0.97165	DNA/pantothenate metabolism flavoprotein, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.87748	0.6255	H	0.96916	3.905	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91496	0.5215	9	0.87932	D	0	-11.5133	14.4472	0.67359	1.0:0.0:0.0:0.0	.	155	Q9HAB8	PPCS_HUMAN	C	155	.	ENSP00000361641:Y155C	Y	+	2	0	PPCS	42695287	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.034000	0.88864	2.299000	0.77371	0.524000	0.50904	TAT		0.582	PPCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019166.1	NM_024664		21	54	0	0	0	0.00333	0	21	54				
SLC6A9	6536	broad.mit.edu	37	1	44474186	44474186	+	Silent	SNP	G	G	C			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr1:44474186G>C	ENST00000360584.2	-	5	839	c.648C>G	c.(646-648)ccC>ccG	p.P216P	SLC6A9_ENST00000492434.2_Intron|SLC6A9_ENST00000357730.2_Silent_p.P162P|SLC6A9_ENST00000372310.3_Silent_p.P143P|SLC6A9_ENST00000475075.2_Silent_p.P32P|SLC6A9_ENST00000537678.1_Silent_p.P78P|SLC6A9_ENST00000372307.3_Silent_p.P78P|SLC6A9_ENST00000372306.3_Silent_p.P143P	NM_201649.3	NP_964012.2	P48067	SC6A9_HUMAN	solute carrier family 6 (neurotransmitter transporter, glycine), member 9	216					transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycine:sodium symporter activity (GO:0015375)|neurotransmitter:sodium symporter activity (GO:0005328)	p.P216P(1)|p.P143P(1)		endometrium(3)|large_intestine(8)|lung(7)|ovary(1)|skin(1)|urinary_tract(2)	22	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)			Glycine(DB00145)	AGTAGGCCCAGGGCAGCACGT	0.572																																							uc001cll.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(646-648)CCC>CCG		solute carrier family 6 member 9 isoform 2	Glycine(DB00145)						128.0	104.0	112.0					1																	44474186		2203	4300	6503	SO:0001819	synonymous_variant	6536					integral to plasma membrane|membrane fraction	glycine:sodium symporter activity|neurotransmitter:sodium symporter activity	g.chr1:44474186G>C	S70609	CCDS30695.1, CCDS41316.1, CCDS41317.1	1p33	2013-05-22			ENSG00000196517	ENSG00000196517		"""Solute carriers"""	11056	protein-coding gene	gene with protein product		601019				8183239, 7587377	Standard	NM_006934		Approved	GLYT1	uc001cll.4	P48067	OTTHUMG00000008294	ENST00000360584.2:c.648C>G	1.37:g.44474186G>C						SLC6A9_uc009vxe.2_Silent_p.P72P|SLC6A9_uc010okm.1_Silent_p.P143P|SLC6A9_uc001clm.2_Silent_p.P162P|SLC6A9_uc009vxd.2_RNA|SLC6A9_uc010okn.1_Silent_p.P147P|SLC6A9_uc001cln.2_Silent_p.P143P|SLC6A9_uc010oko.1_Silent_p.P32P|SLC6A9_uc010okp.1_RNA	p.P216P	NM_201649	NP_964012	P48067	SC6A9_HUMAN			5	840	-	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)	216			Extracellular (Potential).		A6NDH1|A6NII2|A6NNZ8|Q5TAB8|Q5TAB9|Q5TAC0	Silent	SNP	ENST00000360584.2	37	c.648C>G	CCDS41317.1																																																																																				0.572	SLC6A9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000022825.2	NM_201649		31	110	0	0	0	0.002836	0	31	110				
MKNK1	8569	broad.mit.edu	37	1	47030775	47030775	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr1:47030775C>T	ENST00000371946.4	-	10	869	c.706G>A	c.(706-708)Ggc>Agc	p.G236S	MKNK1_ENST00000428112.2_Missense_Mutation_p.G195S|MKNK1_ENST00000371945.4_Missense_Mutation_p.G195S|MKNK1_ENST00000341183.5_Missense_Mutation_p.G195S|MKNK1_ENST00000371944.4_Missense_Mutation_p.G100S|MKNK1-AS1_ENST00000602433.1_RNA	NM_003684.5	NP_003675.2	Q9BUB5	MKNK1_HUMAN	MAP kinase interacting serine/threonine kinase 1	236	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|fibroblast growth factor receptor signaling pathway (GO:0008543)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of translation (GO:0006417)|response to salt stress (GO:0009651)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.G236S(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	13	Acute lymphoblastic leukemia(166;0.155)					ATCCCACTGCCCAAGTCAAAG	0.493																																							uc001cqb.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)	2						c.(706-708)GGC>AGC		MAP kinase-interacting serine/threonine kinase 1							233.0	222.0	226.0					1																	47030775		2203	4300	6503	SO:0001583	missense	8569				intracellular protein kinase cascade|peptidyl-serine phosphorylation|regulation of translation	cytoplasm|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr1:47030775C>T	AB000409	CCDS538.1, CCDS30705.1, CCDS44134.1	1p33	2008-02-05			ENSG00000079277	ENSG00000079277			7110	protein-coding gene	gene with protein product		606724				9155018	Standard	NM_003684		Approved	MNK1	uc001cqb.4	Q9BUB5	OTTHUMG00000007983	ENST00000371946.4:c.706G>A	1.37:g.47030775C>T	ENSP00000361014:p.Gly236Ser					MKNK1_uc010omd.1_Missense_Mutation_p.G100S|MKNK1_uc001cqc.2_Missense_Mutation_p.G195S|MKNK1_uc009vyi.2_Missense_Mutation_p.G195S|MKNK1_uc010ome.1_Missense_Mutation_p.G100S|MKNK1_uc009vyj.2_Missense_Mutation_p.G140S	p.G236S	NM_003684	NP_003675	Q9BUB5	MKNK1_HUMAN			10	950	-	Acute lymphoblastic leukemia(166;0.155)		236			Protein kinase.		D3DQ20|D3DQ21|O00312|Q5TC06|Q5TC07|Q6V0N6	Missense_Mutation	SNP	ENST00000371946.4	37	c.706G>A	CCDS538.1	.	.	.	.	.	.	.	.	.	.	C	35	5.561093	0.96527	.	.	ENSG00000079277	ENST00000371946;ENST00000371945;ENST00000371944;ENST00000341183;ENST00000428112	T;T;T;T;T	0.60424	0.19;0.19;0.19;0.19;0.19	5.8	5.8	0.92144	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.49983	0.1589	N	0.02213	-0.635	0.80722	D	1	P;D;P;P;D;D	0.89917	0.877;0.967;0.877;0.851;0.998;1.0	P;P;P;P;D;D	0.80764	0.53;0.838;0.627;0.493;0.982;0.994	T	0.49835	-0.8897	10	0.02654	T	1	.	19.0512	0.93046	0.0:1.0:0.0:0.0	.	100;100;195;195;195;236	B4DQK5;Q7Z319;A8K341;Q9BUB5-3;Q9BUB5-2;Q9BUB5	.;.;.;.;.;MKNK1_HUMAN	S	236;195;100;195;195	ENSP00000361014:G236S;ENSP00000361013:G195S;ENSP00000361012:G100S;ENSP00000339573:G195S;ENSP00000411135:G195S	ENSP00000339573:G195S	G	-	1	0	MKNK1	46803362	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.764000	0.85297	2.735000	0.93741	0.655000	0.94253	GGC		0.493	MKNK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021897.2	NM_003684		42	220	0	0	0	0.00361	0	42	220				
KANK4	163782	broad.mit.edu	37	1	62740193	62740193	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr1:62740193C>A	ENST00000371153.4	-	3	961	c.583G>T	c.(583-585)Ggt>Tgt	p.G195C	KANK4_ENST00000371150.1_5'Flank|KANK4_ENST00000354381.3_Intron	NM_181712.4	NP_859063.3	Q5T7N3	KANK4_HUMAN	KN motif and ankyrin repeat domains 4	195	Pro-rich.					cytoplasm (GO:0005737)		p.G195C(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(49)|ovary(3)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	81						CTGCCTTCACCCTGAAGGGGA	0.627																																							uc001dah.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)|lung(1)	6						c.(583-585)GGT>TGT		ankyrin repeat domain 38							36.0	37.0	37.0					1																	62740193		2202	4300	6502	SO:0001583	missense	163782							g.chr1:62740193C>A	AK096259	CCDS620.1	1p31.3	2013-10-11	2008-01-29	2008-01-29	ENSG00000132854	ENSG00000132854		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	27263	protein-coding gene	gene with protein product		614612	"""ankyrin repeat domain 38"""	ANKRD38		17996375, 19554261	Standard	NM_181712		Approved	KIAA0172	uc001dah.4	Q5T7N3	OTTHUMG00000008971	ENST00000371153.4:c.583G>T	1.37:g.62740193C>A	ENSP00000360195:p.Gly195Cys					KANK4_uc001dai.3_Intron|KANK4_uc001dag.3_5'Flank	p.G195C	NM_181712	NP_859063	Q5T7N3	KANK4_HUMAN			3	960	-			195			Pro-rich.		B1ALP7|Q6P9A0|Q86T71|Q86VE6|Q8NAX3	Missense_Mutation	SNP	ENST00000371153.4	37	c.583G>T	CCDS620.1	.	.	.	.	.	.	.	.	.	.	C	10.63	1.403712	0.25291	.	.	ENSG00000132854	ENST00000371153	T	0.77229	-1.08	4.6	0.683	0.17998	.	1.142150	0.06756	N	0.780934	T	0.61999	0.2392	N	0.22421	0.69	0.09310	N	1	P	0.45348	0.856	B	0.36186	0.219	T	0.53373	-0.8448	10	0.62326	D	0.03	-0.1035	7.6933	0.28579	0.0:0.6468:0.0:0.3532	.	195	Q5T7N3	KANK4_HUMAN	C	195	ENSP00000360195:G195C	ENSP00000360195:G195C	G	-	1	0	KANK4	62512781	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	0.135000	0.15952	-0.027000	0.13873	-0.244000	0.11960	GGT		0.627	KANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024877.1	NM_181712		15	49	1	0	5.3912e-06	0.006122	5.89159e-06	15	49				
LRRC40	55631	broad.mit.edu	37	1	70641659	70641659	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr1:70641659G>A	ENST00000370952.3	-	7	890	c.811C>T	c.(811-813)Cac>Tac	p.H271Y		NM_017768.4	NP_060238.3	Q9H9A6	LRC40_HUMAN	leucine rich repeat containing 40	271						membrane (GO:0016020)		p.H271Y(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|skin(2)	27						TCACCTACGTGCAATTCCTAC	0.308																																							uc001der.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(811-813)CAC>TAC		leucine rich repeat containing 40							88.0	86.0	87.0					1																	70641659		2203	4299	6502	SO:0001583	missense	55631							g.chr1:70641659G>A		CCDS646.1	1p31.1	2008-02-05			ENSG00000066557	ENSG00000066557			26004	protein-coding gene	gene with protein product						12477932	Standard	NM_017768		Approved	FLJ20331	uc001der.2	Q9H9A6	OTTHUMG00000009348	ENST00000370952.3:c.811C>T	1.37:g.70641659G>A	ENSP00000359990:p.His271Tyr						p.H271Y	NM_017768	NP_060238	Q9H9A6	LRC40_HUMAN			7	863	-			271			LRR 9.		Q9BTR7|Q9NSK1|Q9NXC1	Missense_Mutation	SNP	ENST00000370952.3	37	c.811C>T	CCDS646.1	.	.	.	.	.	.	.	.	.	.	G	8.009	0.757030	0.15846	.	.	ENSG00000066557	ENST00000370952	T	0.56275	0.47	5.53	4.6	0.57074	.	0.097993	0.64402	N	0.000001	T	0.12178	0.0296	N	0.03084	-0.415	0.58432	D	0.999992	B	0.02656	0.0	B	0.06405	0.002	T	0.12400	-1.0549	10	0.09338	T	0.73	.	14.3922	0.66986	0.0728:0.0:0.9272:0.0	.	271	Q9H9A6	LRC40_HUMAN	Y	271	ENSP00000359990:H271Y	ENSP00000359990:H271Y	H	-	1	0	LRRC40	70414247	1.000000	0.71417	0.908000	0.35775	0.546000	0.35178	4.960000	0.63673	1.305000	0.44909	0.585000	0.79938	CAC		0.308	LRRC40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025914.1	NM_017768		4	47	0	0	0	0.000602	0	4	47				
ERICH3	127254	broad.mit.edu	37	1	75037769	75037769	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr1:75037769G>T	ENST00000326665.5	-	14	3843	c.3625C>A	c.(3625-3627)Cgc>Agc	p.R1209S	C1orf173_ENST00000433746.2_5'UTR	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		1209	Glu-rich.							p.R1209S(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						CCATCTTGGCGGTGCCCTTCC	0.602																																							uc001dgg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						c.(3625-3627)CGC>AGC		hypothetical protein LOC127254							107.0	107.0	107.0					1																	75037769		2203	4300	6503	SO:0001583	missense	127254							g.chr1:75037769G>T																												ENST00000326665.5:c.3625C>A	1.37:g.75037769G>T	ENSP00000322609:p.Arg1209Ser						p.R1209S	NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN			14	3844	-			1209			Glu-rich.		Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	ENST00000326665.5	37	c.3625C>A	CCDS30755.1	.	.	.	.	.	.	.	.	.	.	G	8.917	0.960134	0.18507	.	.	ENSG00000178965	ENST00000326665	T	0.09630	2.96	4.67	-4.93	0.03066	.	.	.	.	.	T	0.00784	0.0026	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.46679	-0.9174	9	0.07990	T	0.79	7.932	1.0107	0.01496	0.166:0.2679:0.2299:0.3362	.	1209	Q5RHP9	CA173_HUMAN	S	1209	ENSP00000322609:R1209S	ENSP00000322609:R1209S	R	-	1	0	C1orf173	74810357	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.205000	0.09411	-1.059000	0.03193	-0.291000	0.09656	CGC		0.602	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1			68	126	1	0	9.4991e-31	0.00361	1.50094e-30	68	126				
LHX8	431707	broad.mit.edu	37	1	75608973	75608973	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr1:75608973G>A	ENST00000294638.5	+	6	1224	c.560G>A	c.(559-561)aGa>aAa	p.R187K	LHX8_ENST00000356261.3_Missense_Mutation_p.R177K	NM_001001933.1	NP_001001933.1	Q68G74	LHX8_HUMAN	LIM homeobox 8	187	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				female gonad development (GO:0008585)|forebrain neuron development (GO:0021884)|learning or memory (GO:0007611)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	female germ cell nucleus (GO:0001674)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.R187K(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(18)|ovary(3)|urinary_tract(1)	30						GTCCTCTGCAGAGTACATTAT	0.393																																							uc001dgo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(559-561)AGA>AAA		LIM homeobox 8							73.0	73.0	73.0					1																	75608973		2203	4299	6502	SO:0001583	missense	431707					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr1:75608973G>A	AB050476	CCDS30756.1, CCDS58008.1	1p31.1	2011-06-20			ENSG00000162624	ENSG00000162624		"""Homeoboxes / LIM class"""	28838	protein-coding gene	gene with protein product		604425				9598319	Standard	NM_001256114		Approved	Lhx7	uc031pmx.1	Q68G74	OTTHUMG00000009692	ENST00000294638.5:c.560G>A	1.37:g.75608973G>A	ENSP00000294638:p.Arg187Lys					LHX8_uc001dgq.2_Missense_Mutation_p.R126K	p.R187K	NM_001001933	NP_001001933	Q68G74	LHX8_HUMAN			6	1224	+			187			LIM zinc-binding 2.		E9PGE3	Missense_Mutation	SNP	ENST00000294638.5	37	c.560G>A	CCDS30756.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.245562	0.80024	.	.	ENSG00000162624	ENST00000294638;ENST00000356261	D;D	0.85955	-2.05;-2.05	5.15	5.15	0.70609	Zinc finger, LIM-type (4);	0.098616	0.64402	D	0.000001	T	0.75072	0.3800	N	0.01800	-0.715	0.58432	D	0.999999	D	0.57257	0.979	D	0.74023	0.982	T	0.78378	-0.2227	10	0.17369	T	0.5	.	19.0188	0.92905	0.0:0.0:1.0:0.0	.	187	Q68G74	LHX8_HUMAN	K	187;177	ENSP00000294638:R187K;ENSP00000348597:R177K	ENSP00000294638:R187K	R	+	2	0	LHX8	75381561	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.476000	0.97823	2.579000	0.87056	0.650000	0.86243	AGA		0.393	LHX8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026700.1	NM_001001933		9	39	0	0	0	0.008291	0	9	39				
IFI44L	10964	broad.mit.edu	37	1	79107250	79107250	+	Missense_Mutation	SNP	G	G	C	rs373251848		TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr1:79107250G>C	ENST00000370751.5	+	8	1459	c.1280G>C	c.(1279-1281)cGg>cCg	p.R427P	IFI44L_ENST00000476521.1_3'UTR|IFI44L_ENST00000342282.3_Missense_Mutation_p.R169P	NM_006820.2	NP_006811.2	Q53G44	IF44L_HUMAN	interferon-induced protein 44-like	427					defense response to virus (GO:0051607)|immune response (GO:0006955)	cytoplasm (GO:0005737)		p.R388L(1)|p.R388P(1)		endometrium(4)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	22						CAGATGCTGCGGGCTGCAGAT	0.438																																							uc010oro.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1279-1281)CGG>CCG		interferon-induced protein 44-like		G	PRO/ARG	1,4405	2.1+/-5.4	0,1,2202	122.0	121.0	121.0		1280	2.3	0.0	1		121	0,8598		0,0,4299	no	missense	IFI44L	NM_006820.2	103	0,1,6501	CC,CG,GG		0.0,0.0227,0.0077	probably-damaging	427/453	79107250	1,13003	2203	4299	6502	SO:0001583	missense	10964					cytoplasm		g.chr1:79107250G>C	AB000115	CCDS687.2	1p22.3	2008-07-18	2004-11-12	2004-11-12	ENSG00000137959	ENSG00000137959			17817	protein-coding gene	gene with protein product		613975	"""chromosome 1 open reading frame 29"""	C1orf29			Standard	NM_006820		Approved	GS3686	uc010oro.2	Q53G44	OTTHUMG00000009724	ENST00000370751.5:c.1280G>C	1.37:g.79107250G>C	ENSP00000359787:p.Arg427Pro					IFI44L_uc010orp.1_Missense_Mutation_p.R164P|IFI44L_uc010orq.1_Missense_Mutation_p.R164P	p.R427P	NM_006820	NP_006811	Q53G44	IF44L_HUMAN			8	1459	+			427					Q86TE1|Q96B64|Q99984	Missense_Mutation	SNP	ENST00000370751.5	37	c.1280G>C	CCDS687.2	.	.	.	.	.	.	.	.	.	.	G	8.512	0.866721	0.17250	2.27E-4	0.0	ENSG00000137959	ENST00000370751;ENST00000342282	T;T	0.32753	2.98;1.44	4.2	2.3	0.28687	.	0.483438	0.19039	N	0.124337	T	0.34629	0.0904	M	0.75777	2.31	0.09310	N	1	D	0.76494	0.999	D	0.72982	0.979	T	0.03673	-1.1014	10	0.39692	T	0.17	-8.5346	7.7877	0.29101	0.2078:0.0:0.7922:0.0	.	427	Q53G44	IF44L_HUMAN	P	427;169	ENSP00000359787:R427P;ENSP00000342833:R169P	ENSP00000342833:R169P	R	+	2	0	IFI44L	78879838	0.000000	0.05858	0.002000	0.10522	0.038000	0.13279	0.474000	0.22148	1.081000	0.41110	-0.261000	0.10672	CGG		0.438	IFI44L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026834.3	NM_006820		15	92	0	0	0	0.00499	0	15	92				
LPHN2	23266	broad.mit.edu	37	1	82408764	82408764	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr1:82408764T>C	ENST00000370728.1	+	8	1154	c.509T>C	c.(508-510)aTt>aCt	p.I170T	LPHN2_ENST00000469377.2_Intron|LPHN2_ENST00000370723.1_Missense_Mutation_p.I170T|LPHN2_ENST00000370721.1_Missense_Mutation_p.I174T|LPHN2_ENST00000359929.3_Missense_Mutation_p.I170T|LPHN2_ENST00000370727.1_Missense_Mutation_p.I170T|LPHN2_ENST00000271029.4_Missense_Mutation_p.I170T|LPHN2_ENST00000370715.1_Missense_Mutation_p.I170T|LPHN2_ENST00000370730.1_Missense_Mutation_p.I170T|LPHN2_ENST00000370717.2_Missense_Mutation_p.I170T|LPHN2_ENST00000370713.1_Missense_Mutation_p.I170T|LPHN2_ENST00000319517.6_Missense_Mutation_p.I170T|LPHN2_ENST00000335786.5_Missense_Mutation_p.I170T|LPHN2_ENST00000370725.1_Missense_Mutation_p.I170T|LPHN2_ENST00000394879.1_Missense_Mutation_p.I170T			O95490	LPHN2_HUMAN	latrophilin 2	170	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)	p.I170T(2)		NS(3)|breast(6)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(37)|ovary(3)|pancreas(1)|prostate(3)|skin(22)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	119				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		GCAGATAAAATTTATTTCATG	0.408																																							uc001dit.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|lung(3)|breast(2)|central_nervous_system(1)	9						c.(508-510)ATT>ACT		latrophilin 2 precursor							77.0	83.0	81.0					1																	82408764		2203	4299	6502	SO:0001583	missense	23266				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|latrotoxin receptor activity|sugar binding	g.chr1:82408764T>C	AJ131581	CCDS689.1, CCDS72811.1	1p31.1	2014-08-08	2003-03-17	2003-05-02	ENSG00000117114	ENSG00000117114		"""-"", ""GPCR / Class B : Orphans"""	18582	protein-coding gene	gene with protein product		607018	"""latrophilin 1"""	LPHH1		10760572	Standard	XR_248786		Approved	KIAA0786, LEC1	uc001diu.3	O95490	OTTHUMG00000009844	ENST00000370728.1:c.509T>C	1.37:g.82408764T>C	ENSP00000359763:p.Ile170Thr					LPHN2_uc001dis.2_Intron|LPHN2_uc001diu.2_Missense_Mutation_p.I170T|LPHN2_uc001div.2_Missense_Mutation_p.I170T|LPHN2_uc009wcd.2_Missense_Mutation_p.I170T	p.I170T	NM_012302	NP_036434	O95490	LPHN2_HUMAN		all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)	6	690	+			170			Extracellular (Potential).|Olfactomedin-like.		A5XEI2|B1ALT8|B1ALT9|B1ALU0|B1ALU2|B1ALU4|B1ALU5|B1ALU6|O94882|Q5VX76|Q9UKY5|Q9UKY6	Missense_Mutation	SNP	ENST00000370728.1	37	c.509T>C		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.18|16.18	3.051385|3.051385	0.55218|0.55218	.|.	.|.	ENSG00000117114|ENSG00000117114	ENST00000449420|ENST00000370721;ENST00000370728;ENST00000370730;ENST00000370727;ENST00000370725;ENST00000370723;ENST00000359929;ENST00000370715;ENST00000370713;ENST00000319517;ENST00000370717;ENST00000394879;ENST00000271029;ENST00000335786	.|D;D;D;D;D;D;D;D;D;D;D;D;D;D	.|0.90261	.|-2.64;-2.64;-2.64;-2.64;-2.64;-2.64;-2.64;-2.64;-2.64;-2.64;-2.64;-2.64;-2.64;-2.64	5.8|5.8	4.67|4.67	0.58626|0.58626	.|.	.|0.054895	.|0.64402	.|D	.|0.000001	D|D	0.88206|0.88206	0.6374|0.6374	M|M	0.79475|0.79475	2.455|2.455	0.49051|0.49051	D|D	0.999742|0.999742	.|P;P;P	.|0.47762	.|0.837;0.9;0.837	.|P;B;P	.|0.44673	.|0.457;0.311;0.457	D|D	0.88677|0.88677	0.3199|0.3199	5|10	.|0.87932	.|D	.|0	.|.	12.3401|12.3401	0.55089|0.55089	0.1267:0.0:0.0:0.8733|0.1267:0.0:0.0:0.8733	.|.	.|170;170;170	.|O95490-3;O95490-4;O95490-2	.|.;.;.	L|T	38|174;170;170;170;170;170;170;170;170;170;170;170;170;170	.|ENSP00000359756:I174T;ENSP00000359763:I170T;ENSP00000359765:I170T;ENSP00000359762:I170T;ENSP00000359760:I170T;ENSP00000359758:I170T;ENSP00000353006:I170T;ENSP00000359750:I170T;ENSP00000359748:I170T;ENSP00000322270:I170T;ENSP00000359752:I170T;ENSP00000378344:I170T;ENSP00000271029:I170T;ENSP00000337306:I170T	.|ENSP00000271029:I170T	F|I	+|+	1|2	0|0	LPHN2|LPHN2	82181352|82181352	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.978000|0.978000	0.69477|0.69477	8.040000|8.040000	0.89188|0.89188	1.005000|1.005000	0.39183|0.39183	0.477000|0.477000	0.44152|0.44152	TTT|ATT		0.408	LPHN2-007	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000027188.1	NM_012302		8	54	0	0	0	0.004482	0	8	54				
SYDE2	84144	broad.mit.edu	37	1	85648290	85648290	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr1:85648290A>G	ENST00000341460.5	-	3	2084	c.2035T>C	c.(2035-2037)Tct>Cct	p.S679P		NM_032184.1	NP_115560.1	Q5VT97	SYDE2_HUMAN	synapse defective 1, Rho GTPase, homolog 2 (C. elegans)	679					activation of Rho GTPase activity (GO:0032862)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)	p.S601P(1)|p.S679P(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)	20				all cancers(265;0.0126)|Epithelial(280;0.0336)		ATGAGCCCAGATATGTACTGT	0.343																																							uc009wcm.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|central_nervous_system(1)	2						c.(2035-2037)TCT>CCT		synapse defective 1, Rho GTPase, homolog 2							78.0	72.0	74.0					1																	85648290		1854	4096	5950	SO:0001583	missense	84144				activation of Rho GTPase activity|small GTPase mediated signal transduction	cytosol	Rho GTPase activator activity	g.chr1:85648290A>G	AL834286	CCDS44169.1	1p22.3	2008-02-05		2005-08-09	ENSG00000097096	ENSG00000097096			25841	protein-coding gene	gene with protein product							Standard	NM_032184		Approved	FLJ13815	uc009wcm.3	Q5VT97	OTTHUMG00000009956	ENST00000341460.5:c.2035T>C	1.37:g.85648290A>G	ENSP00000340594:p.Ser679Pro					SYDE2_uc001dku.3_Missense_Mutation_p.S679P	p.S679P	NM_032184	NP_115560	Q5VT97	SYDE2_HUMAN		all cancers(265;0.0126)|Epithelial(280;0.0336)	3	2084	-			679					Q5VT96|Q8NDB8|Q9H8A6	Missense_Mutation	SNP	ENST00000341460.5	37	c.2035T>C	CCDS44169.1	.	.	.	.	.	.	.	.	.	.	A	17.71	3.457148	0.63401	.	.	ENSG00000097096	ENST00000341460	T	0.10288	2.89	5.56	5.56	0.83823	C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.26557	0.0649	M	0.78916	2.43	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.979;0.999	T	0.03306	-1.1050	10	0.72032	D	0.01	.	15.6946	0.77484	1.0:0.0:0.0:0.0	.	679;679	Q5VT97;Q5VT97-2	SYDE2_HUMAN;.	P	679	ENSP00000340594:S679P	ENSP00000340594:S679P	S	-	1	0	SYDE2	85420878	1.000000	0.71417	1.000000	0.80357	0.638000	0.38207	8.829000	0.92055	2.116000	0.64780	0.454000	0.30748	TCT		0.343	SYDE2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127989.2			18	25	0	0	0	0.008871	0	18	25				
CLCA2	9635	broad.mit.edu	37	1	86900337	86900337	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr1:86900337C>A	ENST00000370565.4	+	6	1043	c.881C>A	c.(880-882)aCt>aAt	p.T294N		NM_006536.5	NP_006527.1	Q9UQC9	CLCA2_HUMAN	chloride channel accessory 2	294					cell adhesion (GO:0007155)|transport (GO:0006810)	cell junction (GO:0030054)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)|ligand-gated ion channel activity (GO:0015276)	p.T294N(1)		NS(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	42		Lung NSC(277;0.238)		all cancers(265;0.0233)|Epithelial(280;0.0452)		ATGAATGGGACTGAGCTTCCA	0.498																																					Melanoma(157;1000 1898 5363 5664 48018)|Ovarian(88;135 1366 2838 28875 34642)	Melanoma(157;1000 1898 5363 5664 48018)|Ovarian(88;135 1366 2838 28875 34642)	uc001dlr.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)|skin(1)	3						c.(880-882)ACT>AAT		chloride channel accessory 2 precursor							209.0	174.0	186.0					1																	86900337		2203	4300	6503	SO:0001583	missense	9635				cell adhesion	basal plasma membrane|cell junction|extracellular region|integral to plasma membrane	chloride channel activity	g.chr1:86900337C>A		CCDS708.1	1p22.3	2012-02-26	2009-01-29		ENSG00000137975	ENSG00000137975			2016	protein-coding gene	gene with protein product		604003	"""chloride channel, calcium activated, family member 2"", ""chloride channel regulator 2"""				Standard	NM_006536		Approved	CLCRG2	uc001dlr.4	Q9UQC9	OTTHUMG00000010256	ENST00000370565.4:c.881C>A	1.37:g.86900337C>A	ENSP00000359596:p.Thr294Asn						p.T294N	NM_006536	NP_006527	Q9UQC9	CLCA2_HUMAN		all cancers(265;0.0233)|Epithelial(280;0.0452)	6	1043	+		Lung NSC(277;0.238)	294			Extracellular (Potential).		A8K2T3|Q9Y6N2	Missense_Mutation	SNP	ENST00000370565.4	37	c.881C>A	CCDS708.1	.	.	.	.	.	.	.	.	.	.	C	16.45	3.128061	0.56721	.	.	ENSG00000137975	ENST00000370565	T	0.02837	4.14	6.17	2.66	0.31614	.	0.810877	0.11551	N	0.552751	T	0.00754	0.0025	L	0.48362	1.52	0.09310	N	1	P	0.42409	0.779	B	0.31191	0.125	T	0.48758	-0.9007	10	0.28530	T	0.3	-4.3337	3.8324	0.08880	0.1085:0.5729:0.1482:0.1705	.	294	Q9UQC9	CLCA2_HUMAN	N	294	ENSP00000359596:T294N	ENSP00000359596:T294N	T	+	2	0	CLCA2	86672925	0.000000	0.05858	0.009000	0.14445	0.946000	0.59487	-0.026000	0.12392	0.658000	0.30925	0.655000	0.94253	ACT		0.498	CLCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028284.1	NM_006536		13	105	1	0	3.85864e-22	0.00278	5.67905e-22	13	105				
LRRC8C	84230	broad.mit.edu	37	1	90179493	90179493	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr1:90179493A>T	ENST00000370454.4	+	3	1619	c.1364A>T	c.(1363-1365)aAg>aTg	p.K455M	LRRC8C_ENST00000479252.1_Intron|RP11-302M6.4_ENST00000370453.5_Intron	NM_032270.4	NP_115646	Q8TDW0	LRC8C_HUMAN	leucine rich repeat containing 8 family, member C	455					fat cell differentiation (GO:0045444)|ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.K455M(1)		breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	28		all_lung(203;0.126)		all cancers(265;0.00756)|Epithelial(280;0.0313)		GAAATCATTAAGAACGTAATG	0.443																																							uc001dnl.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(3)|pancreas(1)|central_nervous_system(1)	8						c.(1363-1365)AAG>ATG		leucine rich repeat containing 8 family, member							89.0	84.0	86.0					1																	90179493		2203	4300	6503	SO:0001583	missense	84230					endoplasmic reticulum membrane|integral to membrane		g.chr1:90179493A>T		CCDS725.1	1p22.2	2011-02-10			ENSG00000171488	ENSG00000171488			25075	protein-coding gene	gene with protein product	"""hypothetical protein AD158"""	612889				11230166	Standard	NM_032270		Approved	AD158	uc001dnl.4	Q8TDW0	OTTHUMG00000010305	ENST00000370454.4:c.1364A>T	1.37:g.90179493A>T	ENSP00000359483:p.Lys455Met						p.K455M	NM_032270	NP_115646	Q8TDW0	LRC8C_HUMAN		all cancers(265;0.00756)|Epithelial(280;0.0313)	3	1606	+		all_lung(203;0.126)	455			LRR 3.		B3KXS9|Q29RV6|Q9H075	Missense_Mutation	SNP	ENST00000370454.4	37	c.1364A>T	CCDS725.1	.	.	.	.	.	.	.	.	.	.	A	13.60	2.284104	0.40394	.	.	ENSG00000171488	ENST00000370454	T	0.17370	2.28	5.95	5.95	0.96441	.	0.128561	0.64402	D	0.000002	T	0.15609	0.0376	M	0.68317	2.08	0.39910	D	0.974012	P	0.35944	0.529	B	0.39068	0.289	T	0.01323	-1.1385	10	0.56958	D	0.05	.	16.4323	0.83853	1.0:0.0:0.0:0.0	.	455	Q8TDW0	LRC8C_HUMAN	M	455	ENSP00000359483:K455M	ENSP00000359483:K455M	K	+	2	0	LRRC8C	89952081	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.306000	0.78905	2.281000	0.76405	0.528000	0.53228	AAG		0.443	LRRC8C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028435.2	NM_032270		36	100	0	0	0	0.002836	0	36	100				
PRPF38B	55119	broad.mit.edu	37	1	109241810	109241810	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr1:109241810G>C	ENST00000370025.4	+	6	1078	c.809G>C	c.(808-810)cGg>cCg	p.R270P	PRPF38B_ENST00000370021.1_Missense_Mutation_p.R159P	NM_018061.2	NP_060531.2	Q5VTL8	PR38B_HUMAN	pre-mRNA processing factor 38B	270	Arg-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)	p.R270P(1)		NS(1)|kidney(3)|large_intestine(5)|lung(8)|prostate(1)|skin(1)	19		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0149)|Lung(183;0.0888)|COAD - Colon adenocarcinoma(174;0.113)|Epithelial(280;0.161)		CTGAGTCCACGGAGGTCCCCA	0.433																																							uc001dvv.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(808-810)CGG>CCG		PRP38 pre-mRNA processing factor 38 (yeast)							58.0	63.0	61.0					1																	109241810		2203	4300	6503	SO:0001583	missense	55119				mRNA processing|RNA splicing	spliceosomal complex		g.chr1:109241810G>C	AL833950	CCDS788.1	1p13.3	2013-10-03	2013-10-03		ENSG00000134186	ENSG00000134186			25512	protein-coding gene	gene with protein product			"""PRP38 pre-mRNA processing factor 38 (yeast) domain containing B"""				Standard	NM_018061		Approved	FLJ10330, NET1	uc001dvv.4	Q5VTL8	OTTHUMG00000010991	ENST00000370025.4:c.809G>C	1.37:g.109241810G>C	ENSP00000359042:p.Arg270Pro					PRPF38B_uc001dvw.3_Missense_Mutation_p.R159P|PRPF38B_uc010ouz.1_Missense_Mutation_p.R73P	p.R270P	NM_018061	NP_060531	Q5VTL8	PR38B_HUMAN		Colorectal(144;0.0149)|Lung(183;0.0888)|COAD - Colon adenocarcinoma(174;0.113)|Epithelial(280;0.161)	6	1091	+		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)	270			Arg-rich.		Q05DD6|Q32Q58|Q5VTL9|Q6PK39|Q7Z6E2|Q86WF3|Q8IWG9|Q9NW40	Missense_Mutation	SNP	ENST00000370025.4	37	c.809G>C	CCDS788.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.260191	0.80246	.	.	ENSG00000134186	ENST00000370025;ENST00000370021	T;T	0.14266	4.41;2.52	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.19167	0.0460	L	0.32530	0.975	0.80722	D	1	D	0.71674	0.998	D	0.79108	0.992	T	0.02208	-1.1195	10	0.29301	T	0.29	.	19.5074	0.95125	0.0:0.0:1.0:0.0	.	270	Q5VTL8	PR38B_HUMAN	P	270;159	ENSP00000359042:R270P;ENSP00000359038:R159P	ENSP00000359038:R159P	R	+	2	0	PRPF38B	109043333	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.911000	0.92721	2.698000	0.92095	0.591000	0.81541	CGG		0.433	PRPF38B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030231.1	NM_018061		30	57	0	0	0	0.009535	0	30	57				
SEMA6C	10500	broad.mit.edu	37	1	151110269	151110269	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr1:151110269T>A	ENST00000341697.3	-	10	2365	c.674A>T	c.(673-675)cAc>cTc	p.H225L				Q9H3T2	SEM6C_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C	225	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.H225L(1)		central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	28	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			CTGGACAAAGTGTGGCTCTAA	0.547																																							uc001ewu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(673-675)CAC>CTC		semaphorin Y precursor							109.0	92.0	98.0					1																	151110269		2203	4300	6503	SO:0001583	missense	10500					integral to membrane	receptor activity	g.chr1:151110269T>A	AF339154	CCDS984.1, CCDS53363.1, CCDS53364.1	1q21.2	2008-02-05			ENSG00000143434	ENSG00000143434		"""Semaphorins"""	10740	protein-coding gene	gene with protein product	"""m-Sema Y2"""	609294				12110693	Standard	NM_030913		Approved	KIAA1869	uc001ewv.3	Q9H3T2	OTTHUMG00000012261	ENST00000341697.3:c.674A>T	1.37:g.151110269T>A	ENSP00000344148:p.His225Leu					SEMA6C_uc001ewv.2_Missense_Mutation_p.H225L|SEMA6C_uc001eww.2_Missense_Mutation_p.H185L|SEMA6C_uc010pcq.1_Missense_Mutation_p.H225L|SEMA6C_uc009wml.1_RNA	p.H225L	NM_030913	NP_112175	Q9H3T2	SEM6C_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)		10	974	-	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		225			Extracellular (Potential).|Sema.		D3DV15|Q5JR71|Q5JR72|Q5JR73|Q8WXT8|Q8WXT9|Q8WXU0|Q96JF8	Missense_Mutation	SNP	ENST00000341697.3	37	c.674A>T	CCDS984.1	.	.	.	.	.	.	.	.	.	.	T	18.75	3.691038	0.68271	.	.	ENSG00000143434	ENST00000368914;ENST00000368912;ENST00000368913;ENST00000341697;ENST00000392792	T;T;T;T	0.10668	2.85;2.85;2.85;2.85	4.48	4.48	0.54585	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.152435	0.64402	D	0.000017	T	0.11922	0.0290	M	0.73430	2.235	0.58432	D	0.999998	P;B;B;B	0.41710	0.76;0.082;0.123;0.101	P;B;B;B	0.46208	0.507;0.053;0.138;0.089	T	0.00756	-1.1579	10	0.66056	D	0.02	.	11.7802	0.52010	0.0:0.0:0.0:1.0	.	225;185;225;225	B4DZD4;Q9H3T2-2;Q9H3T2-3;Q9H3T2	.;.;.;SEM6C_HUMAN	L	225;185;225;225;225	ENSP00000357910:H225L;ENSP00000357908:H185L;ENSP00000357909:H225L;ENSP00000344148:H225L	ENSP00000344148:H225L	H	-	2	0	SEMA6C	149376893	1.000000	0.71417	0.999000	0.59377	0.966000	0.64601	6.007000	0.70731	1.884000	0.54569	0.459000	0.35465	CAC		0.547	SEMA6C-004	KNOWN	alternative_5_UTR|mRNA_start_NF|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034074.1	NM_030913		37	137	0	0	0	0.004289	0	37	137				
HRNR	388697	broad.mit.edu	37	1	152191540	152191540	+	Silent	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr1:152191540G>T	ENST00000368801.2	-	3	2640	c.2565C>A	c.(2563-2565)ggC>ggA	p.G855G	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	855					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.G855G(1)		autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGTCATGTTGGCCGGAGCTTG	0.582																																							uc001ezt.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|ovary(1)	3						c.(2563-2565)GGC>GGA		hornerin							139.0	143.0	142.0					1																	152191540		2203	4300	6503	SO:0001819	synonymous_variant	388697				keratinization		calcium ion binding|protein binding	g.chr1:152191540G>T	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.2565C>A	1.37:g.152191540G>T							p.G855G	NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	2641	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		855			9.		Q5DT20|Q5U1F4	Silent	SNP	ENST00000368801.2	37	c.2565C>A	CCDS30859.1																																																																																				0.582	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868		72	102	1	0	9.04243e-43	0.00361	1.46039e-42	72	102				
IVL	3713	broad.mit.edu	37	1	152882670	152882670	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr1:152882670C>A	ENST00000368764.3	+	2	461	c.397C>A	c.(397-399)Caa>Aaa	p.Q133K	IVL_ENST00000392667.2_5'UTR			P07476	INVO_HUMAN	involucrin	133					isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|response to UV-B (GO:0010224)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)	p.Q133K(1)		breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CTTAGACCAGCAACTGGATCA	0.493																																							uc001fau.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(397-399)CAA>AAA		involucrin							61.0	66.0	65.0					1																	152882670		2203	4300	6503	SO:0001583	missense	3713				isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine|keratinization|response to UV-B	cornified envelope|cytoplasm	protein binding, bridging|structural molecule activity	g.chr1:152882670C>A	BC046391	CCDS1030.1	1q21	2008-02-05			ENSG00000163207	ENSG00000163207			6187	protein-coding gene	gene with protein product		147360				2873896	Standard	NM_005547		Approved		uc001fau.3	P07476	OTTHUMG00000012451	ENST00000368764.3:c.397C>A	1.37:g.152882670C>A	ENSP00000357753:p.Gln133Lys						p.Q133K	NM_005547	NP_005538	P07476	INVO_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.171)		2	443	+	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		133					Q5T7P4	Missense_Mutation	SNP	ENST00000368764.3	37	c.397C>A	CCDS1030.1	.	.	.	.	.	.	.	.	.	.	C	13.80	2.345063	0.41498	.	.	ENSG00000163207	ENST00000368764	T	0.08458	3.09	4.75	3.82	0.43975	.	.	.	.	.	T	0.02304	0.0071	L	0.47716	1.5	0.80722	D	1	B	0.24132	0.098	B	0.20577	0.03	T	0.18023	-1.0350	9	0.05351	T	0.99	.	11.5281	0.50593	0.0:0.6495:0.3505:0.0	.	133	P07476	INVO_HUMAN	K	133	ENSP00000357753:Q133K	ENSP00000357753:Q133K	Q	+	1	0	IVL	151149294	0.177000	0.23109	0.085000	0.20634	0.594000	0.36715	0.813000	0.27225	1.330000	0.45394	0.436000	0.28706	CAA		0.493	IVL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034664.1	NM_005547		13	45	1	0	8.60227e-14	0.004007	1.10948e-13	13	45				
GBA	2629	broad.mit.edu	37	1	155207330	155207330	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr1:155207330C>A	ENST00000327247.5	-	8	1033	c.801G>T	c.(799-801)tgG>tgT	p.W267C	GBA_ENST00000428024.3_Missense_Mutation_p.W180C|GBA_ENST00000493842.1_5'Flank|GBA_ENST00000368373.3_Missense_Mutation_p.W267C|GBA_ENST00000536770.1_Missense_Mutation_p.W154C|GBA_ENST00000427500.3_Missense_Mutation_p.W218C|AL713999.1_ENST00000401290.1_RNA	NM_001005741.2|NM_001005742.2	NP_001005741.1|NP_001005742.1	P04062	GLCM_HUMAN	glucosidase, beta, acid	267					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|cellular response to tumor necrosis factor (GO:0071356)|ceramide biosynthetic process (GO:0046513)|glucosylceramide catabolic process (GO:0006680)|glycosphingolipid metabolic process (GO:0006687)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of MAP kinase activity (GO:0043407)|positive regulation of protein dephosphorylation (GO:0035307)|regulation of water loss via skin (GO:0033561)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to pH (GO:0009268)|response to testosterone (GO:0033574)|response to thyroid hormone (GO:0097066)|skin morphogenesis (GO:0043589)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingosine biosynthetic process (GO:0046512)|termination of signal transduction (GO:0023021)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)	glucosylceramidase activity (GO:0004348)|receptor binding (GO:0005102)	p.W267C(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(9)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	26	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)		Velaglucerase alfa(DB06720)	CTGTCACTGCCCAGAACTGTA	0.542									Gaucher disease type I																														uc001fjh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(799-801)TGG>TGT		glucocerebrosidase precursor	Alglucerase(DB00088)|Imiglucerase(DB00053)						41.0	34.0	36.0					1																	155207330		2203	4296	6499	SO:0001583	missense	2629	Gaucher_disease_type_I	Familial Cancer Database	glucocerebrosidase insufficiency	carbohydrate metabolic process|cell death|cellular response to tumor necrosis factor|ceramide biosynthetic process|glucosylceramide catabolic process|lysosome organization|negative regulation of interleukin-6 production|negative regulation of MAP kinase activity|positive regulation of protein dephosphorylation|sphingosine biosynthetic process|termination of signal transduction	lysosomal lumen|lysosomal membrane	cation binding|glucosylceramidase activity|receptor binding	g.chr1:155207330C>A	M19285	CCDS1102.1, CCDS53373.1, CCDS53374.1	1q22	2010-01-19	2010-01-19		ENSG00000177628	ENSG00000177628	3.2.1.21		4177	protein-coding gene	gene with protein product		606463	"""glucosylceramidase"", ""glucosidase, beta; acid (includes glucosylceramidase)"""	GLUC		3359914	Standard	NM_001005742		Approved	GBA1	uc001fjl.3	P04062	OTTHUMG00000035841	ENST00000327247.5:c.801G>T	1.37:g.155207330C>A	ENSP00000314508:p.Trp267Cys					RAG1AP1_uc010pey.1_Intron|GBA_uc010pfw.1_Missense_Mutation_p.W154C|GBA_uc010pfx.1_Missense_Mutation_p.W218C|GBA_uc001fji.2_Missense_Mutation_p.W267C|GBA_uc001fjj.2_Missense_Mutation_p.W267C|GBA_uc001fjk.2_Missense_Mutation_p.W267C|GBA_uc001fjl.2_Missense_Mutation_p.W267C|GBA_uc010pfy.1_Missense_Mutation_p.W180C|GBA_uc009wqk.1_Missense_Mutation_p.W180C	p.W267C	NM_000157	NP_000148	P04062	GLCM_HUMAN	Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)		7	951	-	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		267					A8K796|B7Z5G2|B7Z6S1|J3KQG4|J3KQK9|Q16545|Q4VX22|Q6I9R6|Q9UMJ8	Missense_Mutation	SNP	ENST00000327247.5	37	c.801G>T	CCDS1102.1	.	.	.	.	.	.	.	.	.	.	.	17.75	3.467138	0.63625	.	.	ENSG00000177628	ENST00000427500;ENST00000428024;ENST00000368373;ENST00000327247;ENST00000536770;ENST00000536555;ENST00000402928	D;D;D;D;D	0.99691	-6.42;-6.42;-6.42;-6.42;-6.42	3.51	3.51	0.40186	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.64402	D	0.000002	D	0.99739	0.9897	H	0.94542	3.55	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.97489	1.0052	10	0.87932	D	0	-4.8663	10.6675	0.45739	0.0:1.0:0.0:0.0	.	218;154;267	B7Z5G2;F5H241;P04062	.;.;GLCM_HUMAN	C	218;180;267;267;154;224;252	ENSP00000402577:W218C;ENSP00000397986:W180C;ENSP00000357357:W267C;ENSP00000314508:W267C;ENSP00000445560:W154C	ENSP00000314508:W267C	W	-	3	0	GBA	153473954	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	6.922000	0.75811	1.948000	0.56530	0.313000	0.20887	TGG		0.542	GBA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087204.1	NM_000157		7	44	1	0	5.16669e-11	0.010729	6.37108e-11	7	44				
ARHGEF11	9826	broad.mit.edu	37	1	156914841	156914841	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr1:156914841C>A	ENST00000361409.2	-	29	3583	c.2841G>T	c.(2839-2841)agG>agT	p.R947S	ARHGEF11_ENST00000487682.1_5'UTR|ARHGEF11_ENST00000368194.3_Missense_Mutation_p.R987S|ARHGEF11_ENST00000315174.8_Missense_Mutation_p.R363S	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	947					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R987S(1)		NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					GGTTGCTGGCCCTCTCCAGGG	0.562																																							uc001fqo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)|pleura(1)|lung(1)|kidney(1)|pancreas(1)	9						c.(2839-2841)AGG>AGT		Rho guanine nucleotide exchange factor (GEF) 11							117.0	124.0	122.0					1																	156914841		2203	4300	6503	SO:0001583	missense	9826				actin cytoskeleton organization|apoptosis|axon guidance|cellular component movement|cytokinesis|establishment of cell polarity|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of cell growth|regulation of Rho protein signal transduction|Rho protein signal transduction|striated muscle contraction	cytosol|Golgi apparatus|plasma membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity|signal transducer activity	g.chr1:156914841C>A	AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.2841G>T	1.37:g.156914841C>A	ENSP00000354644:p.Arg947Ser					ARHGEF11_uc010phu.1_Missense_Mutation_p.R363S|ARHGEF11_uc001fqn.2_Missense_Mutation_p.R987S	p.R947S	NM_014784	NP_055599	O15085	ARHGB_HUMAN			29	3881	-	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)		947					D3DVD0|Q5VY40|Q6PFW2	Missense_Mutation	SNP	ENST00000361409.2	37	c.2841G>T	CCDS1162.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.528556	0.85706	.	.	ENSG00000132694	ENST00000368194;ENST00000361409;ENST00000315174	T;T;T	0.63096	-0.02;-0.02;-0.02	5.28	4.37	0.52481	Pleckstrin homology-type (1);	0.000000	0.64402	D	0.000004	T	0.52075	0.1712	L	0.32530	0.975	0.50813	D	0.999891	B;D;P	0.58268	0.2;0.982;0.867	B;P;P	0.54759	0.141;0.76;0.522	T	0.56481	-0.7972	10	0.46703	T	0.11	-23.3216	13.5549	0.61754	0.0:0.9244:0.0:0.0756	.	363;947;987	F8W8P9;O15085;O15085-2	.;ARHGB_HUMAN;.	S	987;947;363	ENSP00000357177:R987S;ENSP00000354644:R947S;ENSP00000313470:R363S	ENSP00000313470:R363S	R	-	3	2	ARHGEF11	155181465	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.259000	0.32956	1.457000	0.47850	0.650000	0.86243	AGG		0.562	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000098931.1	NM_198236		91	253	1	0	3.99045e-58	0.00361	6.59056e-58	91	253				
IGSF8	93185	broad.mit.edu	37	1	160063683	160063683	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr1:160063683C>T	ENST00000368086.1	-	3	937	c.721G>A	c.(721-723)Ggg>Agg	p.G241R	IGSF8_ENST00000460351.1_5'UTR|IGSF8_ENST00000314485.7_Missense_Mutation_p.G241R			Q969P0	IGSF8_HUMAN	immunoglobulin superfamily, member 8	241	Ig-like C2-type 2.				cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|nervous system development (GO:0007399)|single fertilization (GO:0007338)|skeletal muscle tissue development (GO:0007519)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.G241R(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(19)|pancreas(1)|prostate(1)|skin(1)	33	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			CGAAGCTCCCCTGCAGCCAAT	0.642																																							uc001fva.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(721-723)GGG>AGG		immunoglobulin superfamily, member 8							71.0	63.0	66.0					1																	160063683		2203	4300	6503	SO:0001583	missense	93185				cell proliferation|cellular component movement|nervous system development|single fertilization|skeletal muscle tissue development	integral to membrane	protein binding	g.chr1:160063683C>T	AF407274	CCDS1195.1	1q23.1	2013-01-11			ENSG00000162729	ENSG00000162729		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	17813	protein-coding gene	gene with protein product		606644				11504738, 11673522	Standard	NM_001206665		Approved	CD81P3, EWI2, PGRL, CD316	uc009wtf.3	Q969P0	OTTHUMG00000024075	ENST00000368086.1:c.721G>A	1.37:g.160063683C>T	ENSP00000357065:p.Gly241Arg					IGSF8_uc001fuz.2_Missense_Mutation_p.G241R|IGSF8_uc009wtf.2_Missense_Mutation_p.G241R	p.G241R	NM_052868	NP_443100	Q969P0	IGSF8_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)		3	766	-	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		241			Extracellular (Potential).|Ig-like C2-type 2.		Q8NG09|Q96DP4|Q9BTG9	Missense_Mutation	SNP	ENST00000368086.1	37	c.721G>A	CCDS1195.1	.	.	.	.	.	.	.	.	.	.	C	18.39	3.614017	0.66672	.	.	ENSG00000162729	ENST00000314485;ENST00000368086;ENST00000358475;ENST00000448417	T;T;T	0.25749	1.78;1.78;1.78	3.74	3.74	0.42951	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000003	T	0.19248	0.0462	M	0.64997	1.995	0.58432	D	0.999996	D	0.56521	0.976	P	0.45538	0.484	T	0.03473	-1.1033	10	0.62326	D	0.03	-20.9236	11.4872	0.50361	0.0:0.8162:0.1838:0.0	.	241	Q969P0	IGSF8_HUMAN	R	241	ENSP00000316664:G241R;ENSP00000357065:G241R;ENSP00000397464:G241R	ENSP00000316664:G241R	G	-	1	0	IGSF8	158330307	0.999000	0.42202	0.971000	0.41717	0.952000	0.60782	5.354000	0.66040	2.100000	0.63781	0.491000	0.48974	GGG		0.642	IGSF8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060636.1	NM_052868		20	35	0	0	0	0.002299	0	20	35				
OLFML2B	25903	broad.mit.edu	37	1	161970075	161970075	+	Silent	SNP	G	G	T	rs187153444	byFrequency	TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr1:161970075G>T	ENST00000294794.3	-	5	1200	c.777C>A	c.(775-777)atC>atA	p.I259I	OLFML2B_ENST00000367940.2_Silent_p.I260I	NM_015441.1	NP_056256.1	Q68BL8	OLM2B_HUMAN	olfactomedin-like 2B	259					extracellular matrix organization (GO:0030198)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)	p.I259I(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(22)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.0172)			GCAGAAGTTCGATGGAGTTGA	0.617																																							uc001gbu.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(775-777)ATC>ATA		olfactomedin-like 2B precursor							61.0	55.0	57.0					1																	161970075		2203	4300	6503	SO:0001819	synonymous_variant	25903							g.chr1:161970075G>T	BX648975	CCDS1236.1, CCDS72966.1	1q23.1	2008-02-05			ENSG00000162745	ENSG00000162745			24558	protein-coding gene	gene with protein product							Standard	XM_005245075		Approved	DKFZP586L151	uc001gbu.3	Q68BL8	OTTHUMG00000024047	ENST00000294794.3:c.777C>A	1.37:g.161970075G>T						OLFML2B_uc010pkq.1_Silent_p.I260I	p.I259I	NM_015441	NP_056256	Q68BL8	OLM2B_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.0172)		5	1201	-	all_hematologic(112;0.156)		259					B7ZA39|Q5VU96|Q6NX46|Q86X11|Q9Y3X6	Silent	SNP	ENST00000294794.3	37	c.777C>A	CCDS1236.1																																																																																				0.617	OLFML2B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060552.2	NM_015441		24	55	1	0	4.72057e-08	0.003954	5.41827e-08	24	55				
PRG4	10216	broad.mit.edu	37	1	186278009	186278009	+	Missense_Mutation	SNP	G	G	T	rs149799261		TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr1:186278009G>T	ENST00000445192.2	+	7	3203	c.3158G>T	c.(3157-3159)cGc>cTc	p.R1053L	PRG4_ENST00000367484.3_Missense_Mutation_p.R582L|PRG4_ENST00000367483.4_Missense_Mutation_p.R1012L|PRG4_ENST00000367486.3_Missense_Mutation_p.R1010L|PRG4_ENST00000367485.4_Missense_Mutation_p.R960L|RNU6-1240P_ENST00000365155.1_RNA	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	1053					cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.R1053L(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						CCAACTCCCCGCAAGATGACA	0.448																																							uc001gru.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(3157-3159)CGC>CTC		proteoglycan 4 isoform A							165.0	172.0	170.0					1																	186278009		2203	4300	6503	SO:0001583	missense	10216				cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity	g.chr1:186278009G>T	U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.3158G>T	1.37:g.186278009G>T	ENSP00000399679:p.Arg1053Leu					PRG4_uc001grt.3_Missense_Mutation_p.R1012L|PRG4_uc009wyl.2_Missense_Mutation_p.R960L|PRG4_uc009wym.2_Missense_Mutation_p.R919L|PRG4_uc010poo.1_RNA	p.R1053L	NM_005807	NP_005798	Q92954	PRG4_HUMAN			7	3209	+			1053					Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Missense_Mutation	SNP	ENST00000445192.2	37	c.3158G>T	CCDS1369.1	.	.	.	.	.	.	.	.	.	.	G	8.593	0.885000	0.17540	.	.	ENSG00000116690	ENST00000367486;ENST00000367484;ENST00000367483;ENST00000367485;ENST00000445192	T;T;T;T;T	0.04603	3.59;3.7;3.71;3.61;3.7	3.7	1.74	0.24563	.	1.226500	0.06294	N	0.699732	T	0.02571	0.0078	N	0.03608	-0.345	0.09310	N	0.999999	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.001;0.0;0.001	T	0.45483	-0.9258	10	0.33940	T	0.23	0.0581	5.6844	0.17794	0.0:0.6665:0.2149:0.1185	.	919;960;1053;1012	Q92954-4;Q92954-3;Q92954;Q92954-2	.;.;PRG4_HUMAN;.	L	1010;582;1012;960;1053	ENSP00000356456:R1010L;ENSP00000356454:R582L;ENSP00000356453:R1012L;ENSP00000356455:R960L;ENSP00000399679:R1053L	ENSP00000356453:R1012L	R	+	2	0	PRG4	184544632	0.000000	0.05858	0.059000	0.19551	0.094000	0.18550	0.153000	0.16323	0.349000	0.23975	-0.389000	0.06534	CGC		0.448	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086346.1	NM_005807		30	120	1	0	3.80469e-20	0.009535	5.48899e-20	30	120				
F13B	2165	broad.mit.edu	37	1	197029605	197029605	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr1:197029605T>A	ENST00000367412.1	-	5	739	c.696A>T	c.(694-696)gaA>gaT	p.E232D		NM_001994.2	NP_001985.2	P05160	F13B_HUMAN	coagulation factor XIII, B polypeptide	232	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation (GO:0007596)	extracellular region (GO:0005576)		p.E232D(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(5)|liver(1)|lung(40)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	66						CATCTCCTTCTTCATAGGTTT	0.299																																							uc001gtt.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						c.(694-696)GAA>GAT		coagulation factor XIII B subunit precursor							61.0	67.0	65.0					1																	197029605		2203	4297	6500	SO:0001583	missense	2165				blood coagulation	extracellular region		g.chr1:197029605T>A	M14057	CCDS1388.1	1q31-q32.1	2012-10-02			ENSG00000143278	ENSG00000143278			3534	protein-coding gene	gene with protein product		134580				2339067, 2271707	Standard	NM_001994		Approved	FXIIIB	uc001gtt.1	P05160	OTTHUMG00000036519	ENST00000367412.1:c.696A>T	1.37:g.197029605T>A	ENSP00000356382:p.Glu232Asp						p.E232D	NM_001994	NP_001985	P05160	F13B_HUMAN			5	740	-			232			Sushi 4.		A8K3E5|Q5VYL5	Missense_Mutation	SNP	ENST00000367412.1	37	c.696A>T	CCDS1388.1	.	.	.	.	.	.	.	.	.	.	T	19.78	3.890420	0.72524	.	.	ENSG00000143278	ENST00000367412	T	0.65916	-0.18	5.76	2.1	0.27182	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.34133	N	0.004240	T	0.65133	0.2662	L	0.43646	1.37	0.38252	D	0.941644	D	0.76494	0.999	D	0.74023	0.982	T	0.62807	-0.6776	10	0.41790	T	0.15	.	4.7186	0.12906	0.1288:0.1987:0.0:0.6725	.	232	P05160	F13B_HUMAN	D	232	ENSP00000356382:E232D	ENSP00000356382:E232D	E	-	3	2	F13B	195296228	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.659000	0.24994	0.159000	0.19401	0.528000	0.53228	GAA		0.299	F13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088821.2	NM_001994		3	32	0	0	0	0.004672	0	3	32				
CRB1	23418	broad.mit.edu	37	1	197390532	197390532	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr1:197390532T>C	ENST00000367400.3	+	6	1709	c.1574T>C	c.(1573-1575)tTc>tCc	p.F525S	CRB1_ENST00000535699.1_Missense_Mutation_p.F456S|CRB1_ENST00000367397.1_5'UTR|CRB1_ENST00000476483.1_3'UTR|CRB1_ENST00000544212.1_Missense_Mutation_p.F6S|CRB1_ENST00000367399.2_Missense_Mutation_p.F413S|CRB1_ENST00000538660.1_Missense_Mutation_p.F525S|CRB1_ENST00000543483.1_Missense_Mutation_p.F224S	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	525	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.F525S(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						CTTCTACTTTTCCGAAGCAAC	0.458																																							uc001gtz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(3)|large_intestine(1)	9						c.(1573-1575)TTC>TCC		crumbs homolog 1 precursor							116.0	113.0	114.0					1																	197390532		2203	4300	6503	SO:0001583	missense	23418				cell-cell signaling|establishment or maintenance of cell polarity	apical plasma membrane|extracellular region|integral to membrane	calcium ion binding|protein binding	g.chr1:197390532T>C		CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.1574T>C	1.37:g.197390532T>C	ENSP00000356370:p.Phe525Ser					CRB1_uc010poz.1_Missense_Mutation_p.F456S|CRB1_uc010ppa.1_RNA|CRB1_uc009wza.2_Missense_Mutation_p.F413S|CRB1_uc010ppb.1_Missense_Mutation_p.F525S|CRB1_uc010ppc.1_RNA|CRB1_uc010ppd.1_Missense_Mutation_p.F6S|CRB1_uc001gub.1_Missense_Mutation_p.F174S	p.F525S	NM_201253	NP_957705	P82279	CRUM1_HUMAN			6	1709	+			525			Extracellular (Potential).|Laminin G-like 1.		A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	ENST00000367400.3	37	c.1574T>C	CCDS1390.1	.	.	.	.	.	.	.	.	.	.	T	10.70	1.423010	0.25639	.	.	ENSG00000134376	ENST00000535699;ENST00000538660;ENST00000367400;ENST00000367399;ENST00000543483;ENST00000544212;ENST00000367401	T;T;T;T;T;T	0.78126	-1.15;-1.15;-1.15;-1.15;-1.15;-1.15	5.82	5.82	0.92795	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	.	.	.	.	T	0.76190	0.3953	M	0.62723	1.935	0.19300	N	0.999971	P;P;P;P;P	0.43938	0.822;0.666;0.787;0.467;0.583	P;B;B;B;B	0.45138	0.471;0.295;0.361;0.154;0.397	T	0.66685	-0.5861	9	0.17832	T	0.49	.	10.4091	0.44282	0.2416:0.0:0.0:0.7584	.	525;456;413;174;525	B7Z5T2;F5H0L2;P82279-3;P82279-4;P82279	.;.;.;.;CRUM1_HUMAN	S	456;525;525;413;224;6;174	ENSP00000438786:F456S;ENSP00000438091:F525S;ENSP00000356370:F525S;ENSP00000356369:F413S;ENSP00000439579:F224S;ENSP00000444556:F6S	ENSP00000356369:F413S	F	+	2	0	CRB1	195657155	0.023000	0.18921	0.489000	0.27452	0.088000	0.18126	2.240000	0.43088	2.216000	0.71823	0.528000	0.53228	TTC		0.458	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086565.2	NM_201253		35	64	0	0	0	0.00623	0	35	64				
CACNA1S	779	broad.mit.edu	37	1	201044702	201044702	+	Silent	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr1:201044702C>A	ENST00000362061.3	-	13	2095	c.1869G>T	c.(1867-1869)ggG>ggT	p.G623G	CACNA1S_ENST00000367338.3_Silent_p.G623G	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	623					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.G623G(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	AGGCCATGATCCCATTGTACA	0.542																																							uc001gvv.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|central_nervous_system(1)|skin(1)	5						c.(1867-1869)GGG>GGT		calcium channel, voltage-dependent, L type,	Magnesium Sulfate(DB00653)|Verapamil(DB00661)						207.0	184.0	192.0					1																	201044702		2203	4300	6503	SO:0001819	synonymous_variant	779				axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity	g.chr1:201044702C>A	L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.1869G>T	1.37:g.201044702C>A							p.G623G	NM_000069	NP_000060	Q13698	CAC1S_HUMAN			13	2096	-			623			II.|Extracellular (Potential).		A4IF51|B1ALM2|Q12896|Q13934	Silent	SNP	ENST00000362061.3	37	c.1869G>T	CCDS1407.1																																																																																				0.542	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087049.1	NM_000069		83	195	1	0	2.20344e-50	0.00361	3.60653e-50	83	195				
LRRN2	10446	broad.mit.edu	37	1	204587527	204587527	+	Silent	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr1:204587527G>T	ENST00000367175.1	-	1	3806	c.1594C>A	c.(1594-1596)Cgg>Agg	p.R532R	LRRN2_ENST00000367177.3_Silent_p.R532R|LRRN2_ENST00000496057.1_5'Flank|LRRN2_ENST00000367176.3_Silent_p.R532R|RP11-430C7.4_ENST00000453895.1_RNA			O75325	LRRN2_HUMAN	leucine rich repeat neuronal 2	532					cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.R532R(1)		central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|liver(1)|lung(22)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)			TCCTGCACCCGGAGCTCCAGC	0.637																																							uc001hbe.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(2)	2						c.(1594-1596)CGG>AGG		leucine rich repeat neuronal 2 precursor							79.0	76.0	77.0					1																	204587527		2203	4300	6503	SO:0001819	synonymous_variant	10446				cell adhesion	integral to membrane	receptor activity	g.chr1:204587527G>T	AF030435	CCDS1448.1	1q32.1	2013-01-11	2007-01-31	2007-01-31	ENSG00000170382	ENSG00000170382		"""Immunoglobulin superfamily / I-set domain containing"""	16914	protein-coding gene	gene with protein product	"""leucine rich and ankyrin repeats 1"", ""fibronectin type III, immunoglobulin and leucine rich repeat domain 7"""	605492	"""leucine rich repeat neuronal 5"""	LRRN5		9662332	Standard	NM_006338		Approved	GAC1, LRANK1, FIGLER7	uc001hbf.1	O75325	OTTHUMG00000035989	ENST00000367175.1:c.1594C>A	1.37:g.204587527G>T						MDM4_uc001hbd.1_Intron|LRRN2_uc001hbf.1_Silent_p.R532R|LRRN2_uc009xbf.1_Silent_p.R532R|MDM4_uc001hbc.2_Intron	p.R532R	NM_006338	NP_006329	O75325	LRRN2_HUMAN	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)		3	1982	-	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		532			Extracellular (Potential).		B2R624|Q5T0Y0|Q6UXM0|Q8N182	Silent	SNP	ENST00000367175.1	37	c.1594C>A	CCDS1448.1																																																																																				0.637	LRRN2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089894.1	NM_006338		37	70	1	0	6.19805e-25	0.005524	9.30983e-25	37	70				
LAMB3	3914	broad.mit.edu	37	1	209801421	209801421	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr1:209801421C>A	ENST00000356082.4	-	11	1381	c.1247G>T	c.(1246-1248)gGc>gTc	p.G416V	LAMB3_ENST00000391911.1_Missense_Mutation_p.G416V|LAMB3_ENST00000367030.3_Missense_Mutation_p.G416V	NM_000228.2	NP_000219.2	Q13751	LAMB3_HUMAN	laminin, beta 3	416	Laminin EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00460}.				brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	extracellular region (GO:0005576)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)	p.G416V(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		TCCAGTGAAGCCCGGCTTGCA	0.672											OREG0014217	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001hhg.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|skin(2)|large_intestine(1)|ovary(1)	6						c.(1246-1248)GGC>GTC		laminin, beta 3 precursor							65.0	45.0	52.0					1																	209801421		2202	4300	6502	SO:0001583	missense	3914				cell adhesion|epidermis development|hemidesmosome assembly		structural molecule activity	g.chr1:209801421C>A	D37766	CCDS1487.1	1q32	2013-03-01	2002-08-29		ENSG00000196878	ENSG00000196878		"""Laminins"""	6490	protein-coding gene	gene with protein product		150310	"""laminin, beta 3 (nicein (125kD), kalinin (140kD), BM600 (125kD))"""	LAMNB1		8088808, 7774918	Standard	NM_001127641		Approved	nicein-125kDa, kalinin-140kDa, BM600-125kDa	uc001hhh.3	Q13751	OTTHUMG00000036360	ENST00000356082.4:c.1247G>T	1.37:g.209801421C>A	ENSP00000348384:p.Gly416Val		OREG0014217	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	2185	LAMB3_uc009xco.2_Missense_Mutation_p.G416V|LAMB3_uc001hhh.2_Missense_Mutation_p.G416V|LAMB3_uc010psl.1_RNA	p.G416V	NM_001017402	NP_001017402	Q13751	LAMB3_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0519)	10	1637	-			416			Laminin EGF-like 3.		D3DT88|O14947|Q14733|Q9UJK4|Q9UJL1	Missense_Mutation	SNP	ENST00000356082.4	37	c.1247G>T	CCDS1487.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.801048	0.90538	.	.	ENSG00000196878	ENST00000391911;ENST00000356082;ENST00000367030	T;T;T	0.66815	-0.23;-0.23;-0.23	5.12	5.12	0.69794	EGF-like, laminin (4);	0.000000	0.85682	D	0.000000	D	0.89760	0.6808	H	0.98918	4.37	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93907	0.7193	10	0.87932	D	0	.	18.5745	0.91150	0.0:1.0:0.0:0.0	.	416	Q13751	LAMB3_HUMAN	V	416	ENSP00000375778:G416V;ENSP00000348384:G416V;ENSP00000355997:G416V	ENSP00000348384:G416V	G	-	2	0	LAMB3	207868044	1.000000	0.71417	0.976000	0.42696	0.953000	0.61014	7.091000	0.76923	2.556000	0.86216	0.456000	0.33151	GGC		0.672	LAMB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088525.2	NM_000228		3	12	1	0	0.000602214	0.000602	0.000635284	3	12				
CENPF	1063	broad.mit.edu	37	1	214818476	214818476	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr1:214818476G>T	ENST00000366955.3	+	13	5731	c.5563G>T	c.(5563-5565)Gag>Tag	p.E1855*		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	1951					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)	p.E1855*(1)		NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		TGATCACCAGGAGTTACTCCA	0.343																																					Colon(80;575 1284 11000 14801 43496)	Colon(80;575 1284 11000 14801 43496)	uc001hkm.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13						c.(5563-5565)GAG>TAG		centromere protein F							37.0	40.0	39.0					1																	214818476		2202	4299	6501	SO:0001587	stop_gained	1063				cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding	g.chr1:214818476G>T	U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.5563G>T	1.37:g.214818476G>T	ENSP00000355922:p.Glu1855*						p.E1855*	NM_016343	NP_057427	P49454	CENPF_HUMAN		all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)	13	5737	+			1951			Potential.		Q13171|Q13246|Q5VVM7	Nonsense_Mutation	SNP	ENST00000366955.3	37	c.5563G>T	CCDS31023.1	.	.	.	.	.	.	.	.	.	.	G	42	9.680498	0.99237	.	.	ENSG00000117724	ENST00000366955	.	.	.	4.91	1.09	0.20402	.	0.213831	0.23526	N	0.047230	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	.	7.9133	0.29803	0.1811:0.2869:0.5321:0.0	.	.	.	.	X	1855	.	ENSP00000355922:E1855X	E	+	1	0	CENPF	212885099	0.994000	0.37717	0.009000	0.14445	0.179000	0.23085	0.482000	0.22276	1.060000	0.40578	0.609000	0.83330	GAG		0.343	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343		5	44	1	0	5.9392e-07	0.001168	6.69077e-07	5	44				
NUP133	55746	broad.mit.edu	37	1	229588306	229588306	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr1:229588306G>A	ENST00000261396.3	-	22	3156	c.3065C>T	c.(3064-3066)gCg>gTg	p.A1022V	NUP133_ENST00000537506.1_Missense_Mutation_p.A1006V|NUP133_ENST00000485119.1_5'Flank	NM_018230.2	NP_060700.2	Q8WUM0	NU133_HUMAN	nucleoporin 133kDa	1022					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore organization (GO:0006999)|paraxial mesoderm development (GO:0048339)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)	p.A1022V(1)		NS(1)|breast(7)|endometrium(1)|kidney(6)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(4)	56	Breast(184;0.104)|Ovarian(103;0.249)	Prostate(94;0.167)				TACTGGCATCGCACTGAGATT	0.448																																							uc001htn.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(4)|skin(2)|ovary(1)	7						c.(3064-3066)GCG>GTG		nucleoporin 133kDa							110.0	95.0	100.0					1																	229588306		2203	4300	6503	SO:0001583	missense	55746				carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|nuclear pore organization|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding	g.chr1:229588306G>A		CCDS1579.1	1q42.13	2008-02-05	2002-08-29		ENSG00000069248	ENSG00000069248			18016	protein-coding gene	gene with protein product		607613	"""nucleoporin 133kD"""			11684705	Standard	NM_018230		Approved	FLJ10814	uc001htn.3	Q8WUM0	OTTHUMG00000039462	ENST00000261396.3:c.3065C>T	1.37:g.229588306G>A	ENSP00000261396:p.Ala1022Val						p.A1022V	NM_018230	NP_060700	Q8WUM0	NU133_HUMAN			22	3157	-	Breast(184;0.104)|Ovarian(103;0.249)	Prostate(94;0.167)	1022					B2RAZ8|Q5T8N0|Q9H9W2|Q9NV71|Q9NVC4	Missense_Mutation	SNP	ENST00000261396.3	37	c.3065C>T	CCDS1579.1	.	.	.	.	.	.	.	.	.	.	G	13.76	2.333778	0.41297	.	.	ENSG00000069248	ENST00000366681;ENST00000261396;ENST00000366679;ENST00000537506	T;T;T	0.23348	1.91;1.91;1.91	5.45	3.54	0.40534	Nucleoporin, Nup133/Nup155-like, C-terminal (1);	0.387462	0.30879	N	0.008697	T	0.14570	0.0352	L	0.36672	1.1	0.22866	N	0.998631	P	0.35944	0.529	B	0.29440	0.102	T	0.12993	-1.0526	10	0.28530	T	0.3	-0.205	5.237	0.15452	0.0791:0.1217:0.6113:0.1878	.	1022	Q8WUM0	NU133_HUMAN	V	951;1022;951;1006	ENSP00000261396:A1022V;ENSP00000355640:A951V;ENSP00000443496:A1006V	ENSP00000261396:A1022V	A	-	2	0	NUP133	227654929	0.232000	0.23762	0.389000	0.26208	0.770000	0.43624	2.374000	0.44274	1.262000	0.44165	0.655000	0.94253	GCG		0.448	NUP133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095224.1	NM_018230		15	60	0	0	0	0.008871	0	15	60				
RYR2	6262	broad.mit.edu	37	1	237656365	237656365	+	Missense_Mutation	SNP	C	C	A	rs202040519		TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr1:237656365C>A	ENST00000366574.2	+	19	2256	c.1939C>A	c.(1939-1941)Cgt>Agt	p.R647S	RYR2_ENST00000542537.1_Missense_Mutation_p.R631S|RYR2_ENST00000360064.6_Missense_Mutation_p.R645S	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	647	B30.2/SPRY 1. {ECO:0000255|PROSITE- ProRule:PRU00548}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.R645S(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ATTGCAGACACGTCTTGTGAA	0.443																																							uc001hyl.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(1939-1941)CGT>AGT		cardiac muscle ryanodine receptor							117.0	116.0	116.0					1																	237656365		1996	4183	6179	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237656365C>A	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.1939C>A	1.37:g.237656365C>A	ENSP00000355533:p.Arg647Ser						p.R647S	NM_001035	NP_001026	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		19	2059	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	647			Cytoplasmic (By similarity).|B30.2/SPRY 1.		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.1939C>A	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	C	17.90	3.501980	0.64298	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.95307	-3.67;-3.67;-3.67	6.16	5.26	0.73747	Intracellular calcium-release channel (1);B30.2/SPRY domain (1);	0.000000	0.64402	D	0.000003	D	0.94335	0.8179	L	0.54323	1.7	0.80722	D	1	P	0.48834	0.916	P	0.53861	0.736	D	0.92890	0.6330	10	0.34782	T	0.22	.	10.4139	0.44309	0.1335:0.7998:0.0:0.0666	.	647	Q92736	RYR2_HUMAN	S	647;645;631	ENSP00000355533:R647S;ENSP00000353174:R645S;ENSP00000443798:R631S	ENSP00000353174:R645S	R	+	1	0	RYR2	235722988	0.998000	0.40836	0.993000	0.49108	0.861000	0.49209	3.781000	0.55394	1.632000	0.50472	0.650000	0.86243	CGT		0.443	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		6	21	1	0	1.06961e-07	0.00308	1.22003e-07	6	21				
ZP4	57829	broad.mit.edu	37	1	238048738	238048738	+	Silent	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr1:238048738G>T	ENST00000366570.4	-	8	1271	c.1113C>A	c.(1111-1113)ccC>ccA	p.P371P	RP11-193H5.1_ENST00000450451.1_RNA	NM_021186.3	NP_067009.1	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4	371	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				acrosomal vesicle exocytosis (GO:0060478)|binding of sperm to zona pellucida (GO:0007339)|intracellular signal transduction (GO:0035556)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of humoral immune response (GO:0002922)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of T cell proliferation (GO:0042102)|protein kinase A signaling (GO:0010737)|protein kinase C signaling (GO:0070528)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	acrosin binding (GO:0032190)|signal transducer activity (GO:0004871)	p.P371P(1)		breast(6)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(42)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	73	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			GGTCAGTGCTGGGTGTTGCCC	0.537																																					NSCLC(166;160 2029 11600 18754 19936)	NSCLC(166;160 2029 11600 18754 19936)	uc001hym.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(1)	3						c.(1111-1113)CCC>CCA		zona pellucida glycoprotein 4 preproprotein							67.0	69.0	68.0					1																	238048738		2203	4300	6503	SO:0001819	synonymous_variant	57829				acrosomal vesicle exocytosis|negative regulation of binding of sperm to zona pellucida|positive regulation of acrosome reaction|positive regulation of humoral immune response|positive regulation of protein kinase activity|positive regulation of T cell proliferation|protein kinase A signaling cascade|protein kinase C signaling cascade	integral to membrane|intracellular|plasma membrane|proteinaceous extracellular matrix	acrosin binding|receptor activity	g.chr1:238048738G>T	U05781	CCDS1615.1	1q43	2013-01-17			ENSG00000116996	ENSG00000116996		"""Zona pellucida glycoproteins"""	15770	protein-coding gene	gene with protein product		613514				7841460	Standard	NM_021186		Approved	ZPB	uc001hym.3	Q12836	OTTHUMG00000039586	ENST00000366570.4:c.1113C>A	1.37:g.238048738G>T						LOC100130331_uc010pyc.1_Intron	p.P371P	NM_021186	NP_067009	Q12836	ZP4_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		8	1113	-	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	371			ZP.|Extracellular (Potential).		B2RAE1	Silent	SNP	ENST00000366570.4	37	c.1113C>A	CCDS1615.1																																																																																				0.537	ZP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095476.1			20	88	1	0	4.26978e-12	0.00333	5.33722e-12	20	88				
OR2L13	284521	broad.mit.edu	37	1	248263535	248263535	+	Silent	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr1:248263535C>A	ENST00000358120.2	+	2	1003	c.858C>A	c.(856-858)ccC>ccA	p.P286P	OR2L13_ENST00000366478.2_Silent_p.P286P			Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L, member 13	286						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P286P(2)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(32)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	59	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			TGCTCAATCCCATTATCTACA	0.493																																							uc001ids.2		NA																	2	Substitution - coding silent(2)		lung(2)	central_nervous_system(2)|ovary(1)|skin(1)	4						c.(856-858)CCC>CCA		olfactory receptor, family 2, subfamily L,							69.0	70.0	70.0					1																	248263535		2203	4300	6503	SO:0001819	synonymous_variant	284521				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity|protein binding	g.chr1:248263535C>A	BC028158	CCDS1637.1	1q44	2012-08-09			ENSG00000196071	ENSG00000196071		"""GPCR / Class A : Olfactory receptors"""	19578	protein-coding gene	gene with protein product				OR2L14			Standard	NM_175911		Approved		uc001ids.3	Q8N349	OTTHUMG00000040446	ENST00000358120.2:c.858C>A	1.37:g.248263535C>A							p.P286P	NM_175911	NP_787107	Q8N349	OR2LD_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0132)		3	1195	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		286			Helical; Name=7; (Potential).		Q5VUR5	Silent	SNP	ENST00000358120.2	37	c.858C>A	CCDS1637.1																																																																																				0.493	OR2L13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097342.1	NM_175911		6	61	1	0	2.62144e-13	0.004482	3.34554e-13	6	61				
OR2T12	127064	broad.mit.edu	37	1	248457981	248457981	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr1:248457981T>A	ENST00000317996.1	-	1	899	c.900A>T	c.(898-900)aaA>aaT	p.K300N		NM_001004692.1	NP_001004692.1	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T, member 12	300						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.K300N(1)		endometrium(4)|kidney(3)|large_intestine(3)|lung(25)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)			CCAGCCACCGTTTCAGGGCTT	0.453																																							uc010pzj.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(898-900)AAA>AAT		olfactory receptor, family 2, subfamily T,							165.0	161.0	162.0					1																	248457981		2203	4300	6503	SO:0001583	missense	127064				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248457981T>A	BK004485	CCDS31110.1	1q44	2012-08-09			ENSG00000177201	ENSG00000177201		"""GPCR / Class A : Olfactory receptors"""	19592	protein-coding gene	gene with protein product							Standard	NM_001004692		Approved		uc010pzj.2	Q8NG77	OTTHUMG00000040457	ENST00000317996.1:c.900A>T	1.37:g.248457981T>A	ENSP00000324583:p.Lys300Asn						p.K300N	NM_001004692	NP_001004692	Q8NG77	O2T12_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0201)		1	900	-	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		300			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000317996.1	37	c.900A>T	CCDS31110.1	.	.	.	.	.	.	.	.	.	.	t	9.964	1.223507	0.22457	.	.	ENSG00000177201	ENST00000317996	T	0.42900	0.96	1.55	1.55	0.23275	.	1.250670	0.06285	U	0.698163	T	0.34600	0.0903	L	0.38175	1.15	0.09310	N	1	B	0.02656	0.0	B	0.10450	0.005	T	0.35847	-0.9772	10	0.66056	D	0.02	.	7.6922	0.28575	0.0:0.0:0.0:1.0	.	300	Q8NG77	O2T12_HUMAN	N	300	ENSP00000324583:K300N	ENSP00000324583:K300N	K	-	3	2	OR2T12	246524604	0.030000	0.19436	0.006000	0.13384	0.167000	0.22549	0.124000	0.15728	0.540000	0.28808	0.147000	0.16070	AAA		0.453	OR2T12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097353.1	NM_001004692		17	220	0	0	0	0.008871	0	17	220				
FAM171A1	221061	broad.mit.edu	37	10	15326063	15326063	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr10:15326063G>T	ENST00000378116.4	-	2	145	c.139C>A	c.(139-141)Cag>Aag	p.Q47K		NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	47						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.Q47K(2)		breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						GCTACGGGCTGGTGGGTGCTG	0.532																																							uc001iob.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|breast(1)|skin(1)	4						c.(139-141)CAG>AAG		hypothetical protein LOC221061 precursor							72.0	65.0	68.0					10																	15326063		2203	4300	6503	SO:0001583	missense	221061					integral to membrane		g.chr10:15326063G>T	AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.139C>A	10.37:g.15326063G>T	ENSP00000367356:p.Gln47Lys						p.Q47K	NM_001010924	NP_001010924	Q5VUB5	F1711_HUMAN			2	146	-			47			Extracellular (Potential).		D3DRT9|Q32M49|Q8N4I0	Missense_Mutation	SNP	ENST00000378116.4	37	c.139C>A	CCDS31154.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.406704	0.83230	.	.	ENSG00000148468	ENST00000378116;ENST00000378114;ENST00000396781;ENST00000455654	T;T	0.33216	1.42;1.42	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.55847	0.1946	M	0.72894	2.215	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.47699	-0.9097	10	0.28530	T	0.3	-24.7406	19.4559	0.94889	0.0:0.0:1.0:0.0	.	47	Q5VUB5	F1711_HUMAN	K	47;47;48;47	ENSP00000367356:Q47K;ENSP00000407796:Q47K	ENSP00000367354:Q47K	Q	-	1	0	FAM171A1	15366069	1.000000	0.71417	1.000000	0.80357	0.700000	0.40528	9.420000	0.97426	2.669000	0.90835	0.591000	0.81541	CAG		0.532	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046984.1	XM_167709		24	88	1	0	5.24475e-26	0.004656	7.97639e-26	24	88				
ITGA8	8516	broad.mit.edu	37	10	15573137	15573137	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr10:15573137G>A	ENST00000378076.3	-	28	3247	c.2894C>T	c.(2893-2895)cCc>cTc	p.P965L		NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8	965					brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)	p.P965L(1)		NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						AAGAGCATAGGGATCATTTTT	0.333																																							uc001ioc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(3)	6						c.(2893-2895)CCC>CTC		integrin, alpha 8 precursor							84.0	82.0	83.0					10																	15573137		2203	4300	6503	SO:0001583	missense	8516				cell differentiation|cell-cell adhesion|cell-matrix adhesion|integrin-mediated signaling pathway|nervous system development	integrin complex	receptor activity	g.chr10:15573137G>A	L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.2894C>T	10.37:g.15573137G>A	ENSP00000367316:p.Pro965Leu					ITGA8_uc010qcb.1_Missense_Mutation_p.P950L	p.P965L	NM_003638	NP_003629	P53708	ITA8_HUMAN			28	2894	-			965			Extracellular (Potential).		B0YJ31|Q5VX94	Missense_Mutation	SNP	ENST00000378076.3	37	c.2894C>T	CCDS31155.1	.	.	.	.	.	.	.	.	.	.	G	12.51	1.958357	0.34565	.	.	ENSG00000077943	ENST00000378076;ENST00000538044	T	0.48836	0.8	5.64	4.73	0.59995	.	0.273600	0.42548	D	0.000681	T	0.36963	0.0986	L	0.41961	1.31	0.39470	D	0.967717	B;B	0.11235	0.004;0.002	B;B	0.15870	0.014;0.006	T	0.20907	-1.0261	10	0.07482	T	0.82	.	13.2275	0.59922	0.0:0.0:0.5972:0.4028	.	950;965	F5H818;P53708	.;ITA8_HUMAN	L	965;950	ENSP00000367316:P965L	ENSP00000367316:P965L	P	-	2	0	ITGA8	15613143	1.000000	0.71417	0.966000	0.40874	0.992000	0.81027	2.251000	0.43187	1.352000	0.45808	0.643000	0.83706	CCC		0.333	ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046987.1	NM_003638		36	98	0	0	0	0.005524	0	36	98				
GPR158	57512	broad.mit.edu	37	10	25886829	25886829	+	Silent	SNP	T	T	C			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr10:25886829T>C	ENST00000376351.3	+	11	2633	c.2274T>C	c.(2272-2274)atT>atC	p.I758I	GPR158_ENST00000490549.1_3'UTR	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	758					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.I758I(1)		breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						TGAGACGCATTACGGAGATCC	0.522																																							uc001isj.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|large_intestine(2)|pancreas(1)|skin(1)	8						c.(2272-2274)ATT>ATC		G protein-coupled receptor 158 precursor							104.0	116.0	112.0					10																	25886829		2203	4300	6503	SO:0001819	synonymous_variant	57512					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr10:25886829T>C	AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.2274T>C	10.37:g.25886829T>C						GPR158_uc001isk.2_Silent_p.I133I	p.I758I	NM_020752	NP_065803	Q5T848	GP158_HUMAN			11	2334	+			758			Cytoplasmic (Potential).		Q6QR81|Q9ULT3	Silent	SNP	ENST00000376351.3	37	c.2274T>C	CCDS31166.1																																																																																				0.522	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047248.2	XM_166110		28	124	0	0	0	0.007291	0	28	124				
ZNF248	57209	broad.mit.edu	37	10	38120804	38120804	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr10:38120804T>C	ENST00000395867.3	-	6	2029	c.1479A>G	c.(1477-1479)atA>atG	p.I493M	ZNF248_ENST00000374648.3_Intron|ZNF248_ENST00000357328.4_Missense_Mutation_p.I493M|ZNF248_ENST00000494133.1_Intron|AL135791.1_ENST00000583461.1_RNA	NM_001267605.1|NM_001267606.1|NM_001267607.1|NM_021045.2	NP_001254534.1|NP_001254535.1|NP_001254536.1|NP_066383.1	Q8NDW4	ZN248_HUMAN	zinc finger protein 248	493					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.I493M(1)		NS(1)|endometrium(2)|large_intestine(5)|lung(9)|ovary(2)|urinary_tract(1)	20						ATTCATTACATATAAACGGTT	0.433																																							uc001izd.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1477-1479)ATA>ATG		zinc finger protein 248							116.0	114.0	115.0					10																	38120804		2203	4299	6502	SO:0001583	missense	57209				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr10:38120804T>C	AJ491695	CCDS7194.1, CCDS58077.1, CCDS73087.1	10p11.21	2013-01-08			ENSG00000198105	ENSG00000198105		"""Zinc fingers, C2H2-type"", ""-"""	13041	protein-coding gene	gene with protein product						12566394	Standard	NM_021045		Approved	bA162G10.3	uc010qeu.2	Q8NDW4	OTTHUMG00000017980	ENST00000395867.3:c.1479A>G	10.37:g.38120804T>C	ENSP00000379208:p.Ile493Met					ZNF248_uc009xmc.2_Intron|ZNF248_uc001izb.2_Intron|ZNF248_uc001izc.2_Intron|ZNF248_uc010qeu.1_Missense_Mutation_p.I493M	p.I493M	NM_021045	NP_066383	Q8NDW4	ZN248_HUMAN			6	1978	-			493			C2H2-type 6.		Q8NDV8|Q9UMP3	Missense_Mutation	SNP	ENST00000395867.3	37	c.1479A>G	CCDS7194.1	.	.	.	.	.	.	.	.	.	.	T	8.661	0.900512	0.17686	.	.	ENSG00000198105	ENST00000395867;ENST00000357328	T;T	0.34667	1.35;1.35	4.52	2.05	0.26809	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.113742	0.39985	N	0.001213	T	0.19765	0.0475	N	0.21194	0.64	0.28920	N	0.892177	B	0.18610	0.029	B	0.21917	0.037	T	0.13202	-1.0518	10	0.59425	D	0.04	.	1.6236	0.02719	0.1706:0.0957:0.1768:0.5569	.	493	Q8NDW4	ZN248_HUMAN	M	493	ENSP00000379208:I493M;ENSP00000349882:I493M	ENSP00000349882:I493M	I	-	3	3	ZNF248	38160810	0.000000	0.05858	1.000000	0.80357	0.991000	0.79684	-1.484000	0.02316	0.307000	0.22880	0.528000	0.53228	ATA		0.433	ZNF248-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047609.1	NM_021045		27	73	0	0	0	0.008361	0	27	73				
SLC18A3	6572	broad.mit.edu	37	10	50818982	50818983	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr10:50818982_50818983GG>TT	ENST00000374115.3	+	1	636_637	c.196_197GG>TT	c.(196-198)GGg>TTg	p.G66L	CHAT_ENST00000351556.3_5'Flank|CHAT_ENST00000395559.2_5'Flank|CHAT_ENST00000339797.1_Intron	NM_003055.2	NP_003046.2	Q16572	VACHT_HUMAN	solute carrier family 18 (vesicular acetylcholine transporter), member 3	66					acetylcholine transport (GO:0015870)|cation transmembrane transport (GO:0098655)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	clathrin-sculpted acetylcholine transport vesicle membrane (GO:0060201)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	acetylcholine transmembrane transporter activity (GO:0005277)	p.G66L(1)		endometrium(6)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	43						CCACATGCGCGGGGGCGGCGAG	0.673																																							uc001jhw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(196-198)GGG>TTG		vesicular acetylcholine transporter																																				SO:0001583	missense	6572				neurotransmitter secretion	clathrin sculpted acetylcholine transport vesicle membrane|integral to plasma membrane|membrane fraction	acetylcholine transmembrane transporter activity	g.chr10:50818982_50818983GG>TT	BC007765	CCDS7231.1	10q11.2	2013-07-18	2013-07-18		ENSG00000187714	ENSG00000187714		"""Solute carriers"""	10936	protein-coding gene	gene with protein product		600336				8071310	Standard	NM_003055		Approved	VACHT	uc001jhw.3	Q16572	OTTHUMG00000018196	Exception_encountered	10.37:g.50818982_50818983delinsTT	ENSP00000363229:p.Gly66Leu					CHAT_uc001jhv.1_Intron|CHAT_uc001jhx.1_5'Flank|CHAT_uc001jhy.1_5'Flank	p.G66L	NM_003055	NP_003046	Q16572	VACHT_HUMAN			1	636_637	+			66			Lumenal, vesicle (Potential).		B2R7S1	Missense_Mutation	DNP	ENST00000374115.3	37	c.196_197GG>TT	CCDS7231.1																																																																																				0.673	SLC18A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047995.1	NM_003055		5	18	0	0	0	0.004672	0	5	18				
DDX50	79009	broad.mit.edu	37	10	70666761	70666761	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr10:70666761G>T	ENST00000373585.3	+	2	489	c.382G>T	c.(382-384)Gag>Tag	p.E128*		NM_024045.1	NP_076950.1	Q9BQ39	DDX50_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 50	128						membrane (GO:0016020)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)	p.E128*(1)		breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	29						TAAACTAGAGGAGGTATGGAA	0.274																																							uc001jou.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(382-384)GAG>TAG		nucleolar protein GU2							77.0	89.0	85.0					10																	70666761		2194	4295	6489	SO:0001587	stop_gained	79009					nucleolus	ATP binding|ATP-dependent helicase activity|RNA binding	g.chr10:70666761G>T	AF334103	CCDS7283.1	10q22.2	2010-09-30			ENSG00000107625	ENSG00000107625		"""DEAD-boxes"""	17906	protein-coding gene	gene with protein product		610373				11891046	Standard	NM_024045		Approved	GU2, MGC3199, GUB, RH-II/GuB	uc001jou.3	Q9BQ39	OTTHUMG00000018362	ENST00000373585.3:c.382G>T	10.37:g.70666761G>T	ENSP00000362687:p.Glu128*					DDX50_uc001jot.2_Nonsense_Mutation_p.E128*|DDX50_uc010qjc.1_Nonsense_Mutation_p.E128*	p.E128*	NM_024045	NP_076950	Q9BQ39	DDX50_HUMAN			2	489	+			128					Q5VX37|Q8WV76|Q9BWI8	Nonsense_Mutation	SNP	ENST00000373585.3	37	c.382G>T	CCDS7283.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.369672	0.82573	.	.	ENSG00000107625	ENST00000373585;ENST00000541832	.	.	.	4.88	4.88	0.63580	.	0.226724	0.32952	N	0.005441	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22109	T	0.4	-12.003	13.4657	0.61251	0.0:0.0:1.0:0.0	.	.	.	.	X	128	.	ENSP00000362687:E128X	E	+	1	0	DDX50	70336767	1.000000	0.71417	0.998000	0.56505	0.770000	0.43624	4.516000	0.60496	2.546000	0.85860	0.580000	0.79431	GAG		0.274	DDX50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048363.1	NM_024045		20	79	1	0	2.37509e-13	0.010504	3.04178e-13	20	79				
PRF1	5551	broad.mit.edu	37	10	72360447	72360447	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr10:72360447C>A	ENST00000441259.1	-	2	372	c.212G>T	c.(211-213)gGc>gTc	p.G71V	PRF1_ENST00000373209.2_Missense_Mutation_p.G71V	NM_001083116.1|NM_005041.4	NP_001076585.1|NP_005032.2	P14222	PERF_HUMAN	perforin 1 (pore forming protein)	71	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				apoptotic process (GO:0006915)|cellular defense response (GO:0006968)|cytolysis (GO:0019835)|defense response to tumor cell (GO:0002357)|defense response to virus (GO:0051607)|immune response to tumor cell (GO:0002418)|protein homooligomerization (GO:0051260)|transmembrane transport (GO:0055085)	cytolytic granule (GO:0044194)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|wide pore channel activity (GO:0022829)	p.G71V(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(3)|urinary_tract(3)	23						GGTGCAGGTGCCGTCGGGCCG	0.697			M			"""various leukaemia, lymphoma"""	Type 2 familial hemophagocytic lymphohistiocytosis		Familial Hemophagocytic Lymphohistiocytosis																														uc009xqg.2		NA	yes	Rec			10	10q22	5551	M	perforin 1 (pore forming protein)		Type 2 familial hemophagocytic lymphohistiocytosis	L		various leukaemia|lymphoma			1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)|central_nervous_system(1)	3						c.(211-213)GGC>GTC		perforin 1 precursor							41.0	40.0	40.0					10																	72360447		2203	4300	6503	SO:0001583	missense	5551	Familial_Hemophagocytic_Lymphohistiocytosis	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	apoptosis|cellular defense response|cytolysis|defense response to tumor cell|defense response to virus|immune response to tumor cell|protein homooligomerization	cytolytic granule|endosome lumen|extracellular region|integral to membrane|plasma membrane	calcium ion binding|protein binding|wide pore channel activity	g.chr10:72360447C>A	BC047695	CCDS7305.1	10q22	2014-09-17			ENSG00000180644	ENSG00000180644			9360	protein-coding gene	gene with protein product	"""Perforin"", ""perforin 1 (preforming protein)"""	170280				1505959, 2592021	Standard	NM_005041		Approved	PFP, P1, HPLH2	uc001jrf.4	P14222	OTTHUMG00000018412	ENST00000441259.1:c.212G>T	10.37:g.72360447C>A	ENSP00000398568:p.Gly71Val					PRF1_uc001jrf.3_Missense_Mutation_p.G71V	p.G71V	NM_001083116	NP_001076585	P14222	PERF_HUMAN			2	373	-			71			MACPF.		B2R6X4|Q59F57|Q86WX7	Missense_Mutation	SNP	ENST00000441259.1	37	c.212G>T	CCDS7305.1	.	.	.	.	.	.	.	.	.	.	C	18.44	3.624702	0.66901	.	.	ENSG00000180644	ENST00000373209;ENST00000441259;ENST00000318971	D;D	0.92099	-2.97;-2.97	5.7	4.8	0.61643	Membrane attack complex component/perforin (MACPF) domain (1);	0.339768	0.32736	N	0.005716	D	0.92932	0.7751	M	0.83012	2.62	0.43448	D	0.995639	P	0.51351	0.944	P	0.48114	0.567	D	0.92632	0.6117	10	0.66056	D	0.02	-39.7874	8.9439	0.35747	0.0:0.8324:0.0:0.1676	.	71	P14222	PERF_HUMAN	V	71	ENSP00000362305:G71V;ENSP00000398568:G71V	ENSP00000316746:G71V	G	-	2	0	PRF1	72030453	0.902000	0.30710	0.993000	0.49108	0.816000	0.46133	1.933000	0.40153	1.402000	0.46780	0.655000	0.94253	GGC		0.697	PRF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048517.2	NM_005041		28	55	1	0	6.00712e-18	0.012213	8.3687e-18	28	55				
CDHR1	92211	broad.mit.edu	37	10	85961589	85961589	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr10:85961589C>A	ENST00000372117.3	+	7	655	c.552C>A	c.(550-552)gaC>gaA	p.D184E	CDHR1_ENST00000332904.3_Missense_Mutation_p.D184E|CDHR1_ENST00000440770.2_5'Flank	NM_033100.2	NP_149091.1	Q96JP9	CDHR1_HUMAN	cadherin-related family member 1	184	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cellular process (GO:0009987)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	calcium ion binding (GO:0005509)	p.D184E(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(21)|ovary(1)|prostate(1)|skin(1)	36						TTGCCGTGGACCGCCACAGCG	0.617																																							uc001kcv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(550-552)GAC>GAA		protocadherin 21 precursor							48.0	51.0	50.0					10																	85961589		2203	4300	6503	SO:0001583	missense	92211				homophilic cell adhesion		calcium ion binding|receptor activity	g.chr10:85961589C>A	AB053448	CCDS7372.1, CCDS53548.1	10q23.1	2014-01-28	2010-01-25	2010-01-25	ENSG00000148600	ENSG00000148600		"""Cadherins / Cadherin-related"""	14550	protein-coding gene	gene with protein product		609502	"""protocadherin 21"""	PCDH21		11597768	Standard	NM_001171971		Approved	KIAA1775, CORD15, RP65	uc001kcv.3	Q96JP9	OTTHUMG00000018634	ENST00000372117.3:c.552C>A	10.37:g.85961589C>A	ENSP00000361189:p.Asp184Glu					CDHR1_uc001kcw.2_Missense_Mutation_p.D184E|CDHR1_uc009xst.2_5'UTR	p.D184E	NM_033100	NP_149091	Q96JP9	CDHR1_HUMAN			7	552	+			184			Cadherin 2.|Extracellular (Potential).		Q69YZ8|Q8IXY5	Missense_Mutation	SNP	ENST00000372117.3	37	c.552C>A	CCDS7372.1	.	.	.	.	.	.	.	.	.	.	C	11.12	1.545922	0.27652	.	.	ENSG00000148600	ENST00000332904;ENST00000372117	T;T	0.01705	4.68;4.68	5.11	3.22	0.36961	Cadherin (4);Cadherin-like (1);	0.094630	0.64402	D	0.000001	T	0.06005	0.0156	M	0.68952	2.095	0.80722	D	1	D;D	0.64830	0.981;0.994	P;P	0.61328	0.742;0.887	T	0.19095	-1.0316	10	0.52906	T	0.07	-25.665	7.651	0.28348	0.0:0.7389:0.0:0.2611	.	184;184	Q96JP9-2;Q96JP9	.;CDHR1_HUMAN	E	184	ENSP00000331063:D184E;ENSP00000361189:D184E	ENSP00000331063:D184E	D	+	3	2	CDHR1	85951569	0.998000	0.40836	1.000000	0.80357	0.125000	0.20455	0.514000	0.22786	1.286000	0.44565	-0.136000	0.14681	GAC		0.617	CDHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049111.1	NM_033100		15	41	1	0	9.16793e-09	0.00499	1.07253e-08	15	41				
BTAF1	9044	broad.mit.edu	37	10	93695424	93695424	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr10:93695424C>T	ENST00000265990.6	+	2	333	c.25C>T	c.(25-27)Ctt>Ttt	p.L9F		NM_003972.2	NP_003963.1	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa	9					negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L9F(1)		central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(6)	59		Colorectal(252;0.0846)				GCTAGATCGCCTTTTTATTTT	0.378																																							uc001khr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(25-27)CTT>TTT		BTAF1 RNA polymerase II, B-TFIID transcription							160.0	138.0	146.0					10																	93695424		2203	4300	6503	SO:0001583	missense	9044				negative regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|sequence-specific DNA binding transcription factor activity	g.chr10:93695424C>T	AJ001017	CCDS7419.1	10q22-q23	2013-05-01	2013-05-01		ENSG00000095564	ENSG00000095564			17307	protein-coding gene	gene with protein product	"""Mot1 homolog (S. cerevisiae)"""	605191	"""BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170 kD (Mot1 homolog, S. cerevisiae)"""			9342322, 9488487	Standard	NM_003972		Approved	TAFII170, TAF172, MOT1, TAF-172, TAF(II)170	uc001khr.3	O14981	OTTHUMG00000018752	ENST00000265990.6:c.25C>T	10.37:g.93695424C>T	ENSP00000265990:p.Leu9Phe					BTAF1_uc009xua.1_RNA	p.L9F	NM_003972	NP_003963	O14981	BTAF1_HUMAN			2	123	+		Colorectal(252;0.0846)	9					B4E0W6|O43578	Missense_Mutation	SNP	ENST00000265990.6	37	c.25C>T	CCDS7419.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.241732	0.79912	.	.	ENSG00000095564	ENST00000265990	T	0.72615	-0.67	5.12	4.21	0.49690	Armadillo-like helical (1);Armadillo-type fold (1);	0.072704	0.52532	D	0.000069	D	0.84433	0.5471	M	0.89785	3.06	0.80722	D	1	D	0.62365	0.991	P	0.57776	0.827	D	0.88415	0.3024	10	0.72032	D	0.01	-7.9513	15.9274	0.79628	0.0:0.8643:0.1357:0.0	.	9	O14981	BTAF1_HUMAN	F	9	ENSP00000265990:L9F	ENSP00000265990:L9F	L	+	1	0	BTAF1	93685404	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	3.844000	0.55873	1.271000	0.44313	0.655000	0.94253	CTT		0.378	BTAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049380.4	NM_003972		14	41	0	0	0	0.00245	0	14	41				
SORCS1	114815	broad.mit.edu	37	10	108371774	108371774	+	Missense_Mutation	SNP	G	G	T	rs370004055		TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr10:108371774G>T	ENST00000263054.6	-	22	2935	c.2928C>A	c.(2926-2928)ttC>ttA	p.F976L	SORCS1_ENST00000344440.6_Missense_Mutation_p.F976L|SORCS1_ENST00000478809.2_5'UTR|SORCS1_ENST00000369698.1_Missense_Mutation_p.F511L	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	976					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)	p.F976L(2)		breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		GAAGAGACCGGAATTCCTCTG	0.443																																							uc001kym.2		NA																	2	Substitution - Missense(2)		lung(2)	breast(1)|central_nervous_system(1)	2						c.(2926-2928)TTC>TTA		SORCS receptor 1 isoform a		G	LEU/PHE,LEU/PHE,LEU/PHE,LEU/PHE,LEU/PHE,LEU/PHE	0,4406		0,0,2203	88.0	83.0	85.0		2928,2928,2928,2928,2928,2928	1.7	1.0	10		85	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense	SORCS1	NM_001013031.2,NM_001206569.1,NM_001206570.1,NM_001206571.1,NM_001206572.1,NM_052918.4	22,22,22,22,22,22	0,1,6502	TT,TG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	976/1199,976/1180,976/1131,976/1160,976/1180,976/1169	108371774	1,13005	2203	4300	6503	SO:0001583	missense	114815					integral to membrane	neuropeptide receptor activity|protein binding	g.chr10:108371774G>T	AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.2928C>A	10.37:g.108371774G>T	ENSP00000263054:p.Phe976Leu					SORCS1_uc001kyl.2_Missense_Mutation_p.F976L|SORCS1_uc009xxs.2_Missense_Mutation_p.F976L|SORCS1_uc001kyn.1_Missense_Mutation_p.F976L|SORCS1_uc001kyo.2_Missense_Mutation_p.F976L	p.F976L	NM_052918	NP_443150	Q8WY21	SORC1_HUMAN		Epithelial(162;1.66e-05)|all cancers(201;0.000689)	22	2936	-		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)	976			Lumenal (Potential).		A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	ENST00000263054.6	37	c.2928C>A	CCDS7559.1	.	.	.	.	.	.	.	.	.	.	G	15.04	2.714123	0.48622	0.0	1.16E-4	ENSG00000108018	ENST00000369698;ENST00000263054;ENST00000344440	T;T;T	0.25579	1.79;2.35;2.3	5.66	1.69	0.24217	.	0.000000	0.85682	D	0.000000	T	0.42630	0.1211	M	0.84326	2.69	0.42513	D	0.99297	B;P;P;B;P	0.50617	0.361;0.494;0.937;0.361;0.937	B;B;P;B;P	0.56751	0.094;0.192;0.805;0.094;0.805	T	0.31888	-0.9927	9	.	.	.	-22.6867	7.4117	0.27021	0.5083:0.0:0.4917:0.0	.	976;976;976;976;976	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2	.;.;.;SORC1_HUMAN;.	L	511;976;976	ENSP00000358712:F511L;ENSP00000263054:F976L;ENSP00000345964:F976L	.	F	-	3	2	SORCS1	108361764	1.000000	0.71417	0.998000	0.56505	0.971000	0.66376	2.076000	0.41548	0.409000	0.25649	0.650000	0.86243	TTC		0.443	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	NM_052918		13	62	1	0	6.72482e-11	0.003163	8.23678e-11	13	62				
PNLIPRP1	5407	broad.mit.edu	37	10	118355764	118355764	+	Silent	SNP	T	T	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr10:118355764T>A	ENST00000528052.1	+	6	575	c.504T>A	c.(502-504)atT>atA	p.I168I	PNLIPRP1_ENST00000534537.1_Silent_p.I168I|PNLIPRP1_ENST00000358834.4_Silent_p.I168I			P54315	LIPR1_HUMAN	pancreatic lipase-related protein 1	168					lipid metabolic process (GO:0006629)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|triglyceride lipase activity (GO:0004806)	p.I168I(1)		breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	38				all cancers(201;0.0161)		TTCACCTCATTGGCCACAGCC	0.532																																							uc001lco.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|breast(1)	2						c.(502-504)ATT>ATA		pancreatic lipase-related protein 1 precursor							153.0	161.0	158.0					10																	118355764		2203	4300	6503	SO:0001819	synonymous_variant	5407				lipid metabolic process		calcium ion binding|triglyceride lipase activity	g.chr10:118355764T>A	BC025784	CCDS7595.1	10q26.12	2006-07-04			ENSG00000187021	ENSG00000187021			9156	protein-coding gene	gene with protein product		604422				1379598	Standard	NM_006229		Approved	PLRP1	uc001lco.1	P54315	OTTHUMG00000019109	ENST00000528052.1:c.504T>A	10.37:g.118355764T>A						PNLIPRP1_uc001lcp.2_Silent_p.I168I|PNLIPRP1_uc009xys.1_RNA	p.I168I	NM_006229	NP_006220	P54315	LIPR1_HUMAN		all cancers(201;0.0161)	6	522	+			168					Q68D83|Q68DR6|Q8TAU2|Q9BS82	Silent	SNP	ENST00000528052.1	37	c.504T>A	CCDS7595.1																																																																																				0.532	PNLIPRP1-011	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384633.1	NM_006229		219	280	0	0	0	0.00361	0	219	280				
LRRC27	80313	broad.mit.edu	37	10	134188652	134188652	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr10:134188652G>A	ENST00000368614.3	+	11	1604	c.1499G>A	c.(1498-1500)gGa>gAa	p.G500E	LRRC27_ENST00000368612.1_Missense_Mutation_p.G438E|LRRC27_ENST00000475747.1_3'UTR|LRRC27_ENST00000368613.4_Missense_Mutation_p.G500E|LRRC27_ENST00000392638.2_3'UTR|LRRC27_ENST00000368610.3_Missense_Mutation_p.G438E	NM_030626.2	NP_085129.1	Q9C0I9	LRC27_HUMAN	leucine rich repeat containing 27	500								p.G500E(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)	18		all_cancers(35;6.28e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)		OV - Ovarian serous cystadenocarcinoma(35;9.12e-05)|Epithelial(32;0.000116)|all cancers(32;0.000145)|BRCA - Breast invasive adenocarcinoma(275;0.218)		GCCCTCACTGGAAACCTTTCG	0.468																																							uc010quw.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1498-1500)GGA>GAA		leucine rich repeat containing 27 isoform a							63.0	65.0	65.0					10																	134188652		2203	4300	6503	SO:0001583	missense	80313							g.chr10:134188652G>A	AB051461	CCDS31316.1, CCDS44496.1	10q26.3	2013-09-20			ENSG00000148814	ENSG00000148814			29346	protein-coding gene	gene with protein product						11214970	Standard	NM_030626		Approved	KIAA1674	uc010quw.1	Q9C0I9	OTTHUMG00000019284	ENST00000368614.3:c.1499G>A	10.37:g.134188652G>A	ENSP00000357603:p.Gly500Glu					LRRC27_uc001llg.2_RNA|LRRC27_uc001lli.2_Missense_Mutation_p.G500E|LRRC27_uc001llj.2_Missense_Mutation_p.G438E	p.G500E	NM_030626	NP_085129	Q9C0I9	LRC27_HUMAN		OV - Ovarian serous cystadenocarcinoma(35;9.12e-05)|Epithelial(32;0.000116)|all cancers(32;0.000145)|BRCA - Breast invasive adenocarcinoma(275;0.218)	11	1694	+		all_cancers(35;6.28e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)	500					A6NE72|A6NJB4|A6NKD3|D3DRH0|Q5SZH6|Q5SZH8|Q5SZH9|Q86XT5|Q8N7C8|Q8NA21	Missense_Mutation	SNP	ENST00000368614.3	37	c.1499G>A	CCDS31316.1	.	.	.	.	.	.	.	.	.	.	G	14.78	2.637149	0.47049	.	.	ENSG00000148814	ENST00000368614;ENST00000368613;ENST00000368612;ENST00000368610	T;T;T;T	0.28666	1.6;1.6;3.39;3.39	3.34	3.34	0.38264	.	0.113124	0.30800	N	0.008851	T	0.42086	0.1187	L	0.42245	1.32	0.31542	N	0.659858	D;D	0.71674	0.998;0.997	D;P	0.66351	0.943;0.878	T	0.46331	-0.9199	10	0.66056	D	0.02	-11.5442	10.4626	0.44590	0.0:0.0:1.0:0.0	.	438;500	Q9C0I9-2;Q9C0I9	.;LRC27_HUMAN	E	500;500;438;438	ENSP00000357603:G500E;ENSP00000357602:G500E;ENSP00000357601:G438E;ENSP00000357599:G438E	ENSP00000357599:G438E	G	+	2	0	LRRC27	134038642	0.015000	0.18098	0.005000	0.12908	0.012000	0.07955	1.756000	0.38390	2.152000	0.67230	0.591000	0.81541	GGA		0.468	LRRC27-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051058.2	XM_290462		4	74	0	0	0	0.001168	0	4	74				
FRG2B	441581	broad.mit.edu	37	10	135438905	135438905	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr10:135438905C>G	ENST00000425520.1	-	4	587	c.535G>C	c.(535-537)Gtg>Ctg	p.V179L	FRG2B_ENST00000443774.1_Missense_Mutation_p.V180L	NM_001080998.1	NP_001074467.1	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B	179						nucleus (GO:0005634)		p.V180L(1)		endometrium(2)|kidney(2)|lung(14)|ovary(1)|prostate(1)	20		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		ATAGCTCGCACAGAGGTCACC	0.562																																							uc010qvg.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(535-537)GTG>CTG		FSHD region gene 2 family, member B							124.0	142.0	136.0					10																	135438905		2194	4296	6490	SO:0001583	missense	441581					nucleus		g.chr10:135438905C>G	AY744466	CCDS44502.1	10q26.3	2012-10-02			ENSG00000225899	ENSG00000225899			33518	protein-coding gene	gene with protein product						15520407	Standard	NM_001080998		Approved		uc010qvg.2	Q96QU4	OTTHUMG00000019328	ENST00000425520.1:c.535G>C	10.37:g.135438905C>G	ENSP00000401310:p.Val179Leu						p.V179L	NM_001080998	NP_001074467	Q96QU4	FRG2B_HUMAN		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)	4	588	-		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)	179					Q5VSQ1	Missense_Mutation	SNP	ENST00000425520.1	37	c.535G>C	CCDS44502.1	.	.	.	.	.	.	.	.	.	.	.	0.017	-1.500369	0.01001	.	.	ENSG00000225899	ENST00000443774;ENST00000425520	T;T	0.31510	1.49;1.49	.	.	.	.	0.518914	0.14567	N	0.311685	T	0.10895	0.0266	N	0.03608	-0.345	0.09310	N	1	B	0.28178	0.202	B	0.30782	0.12	T	0.36792	-0.9733	8	0.10902	T	0.67	-5.355	.	.	.	.	179	Q96QU4	FRG2B_HUMAN	L	180;179	ENSP00000408343:V180L;ENSP00000401310:V179L	ENSP00000401310:V179L	V	-	1	0	FRG2B	135288895	0.019000	0.18553	0.435000	0.26784	0.438000	0.31896	0.259000	0.18405	0.119000	0.18210	0.121000	0.15741	GTG		0.562	FRG2B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000467780.1	NM_001080998		7	344	0	0	0	0.012319	0	7	344				
MUC2	4583	broad.mit.edu	37	11	1080962	1080962	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr11:1080962T>A	ENST00000441003.2	+	10	1373	c.1346T>A	c.(1345-1347)cTg>cAg	p.L449Q	MUC2_ENST00000359061.5_Missense_Mutation_p.L449Q	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	449	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.L449Q(2)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ACGGTGGTGCTGCTGGCTGAC	0.647																																							uc001lsx.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(1)|breast(1)	2						c.(1345-1347)CTG>CAG		mucin 2 precursor	Pranlukast(DB01411)						70.0	80.0	77.0					11																	1080962		2069	4187	6256	SO:0001583	missense	4583					inner mucus layer|outer mucus layer	protein binding	g.chr11:1080962T>A	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.1346T>A	11.37:g.1080962T>A	ENSP00000415183:p.Leu449Gln						p.L449Q	NM_002457	NP_002448	Q02817	MUC2_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	10	1373	+		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)	449			VWFD 2.		Q14878	Missense_Mutation	SNP	ENST00000441003.2	37	c.1346T>A		.	.	.	.	.	.	.	.	.	.	T	14.53	2.561666	0.45590	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.61627	0.09;0.09	3.57	3.57	0.40892	.	0.341332	0.21140	U	0.079489	T	0.76821	0.4041	M	0.86805	2.84	0.31201	N	0.699781	D	0.63880	0.993	D	0.70227	0.968	T	0.79921	-0.1599	10	0.87932	D	0	.	12.305	0.54898	0.0:0.0:0.0:1.0	.	449	E7EUV1	.	Q	449	ENSP00000415183:L449Q;ENSP00000351956:L449Q	ENSP00000351956:L449Q	L	+	2	0	MUC2	1070962	0.994000	0.37717	0.980000	0.43619	0.802000	0.45316	3.691000	0.54720	1.513000	0.48852	0.358000	0.22013	CTG		0.647	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457		37	49	0	0	0	0.00874	0	37	49				
PGAP2	27315	broad.mit.edu	37	11	3845193	3845193	+	Silent	SNP	C	C	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr11:3845193C>T	ENST00000463452.2	+	3	329	c.246C>T	c.(244-246)ggC>ggT	p.G82G	PGAP2_ENST00000278243.4_Silent_p.G143G|PGAP2_ENST00000493547.2_Silent_p.G82G|AC090587.2_ENST00000507938.1_RNA|PGAP2_ENST00000532017.1_3'UTR|PGAP2_ENST00000396986.2_Silent_p.G139G|PGAP2_ENST00000396993.4_Missense_Mutation_p.P36S|PGAP2_ENST00000496834.2_5'UTR|PGAP2_ENST00000465307.2_Missense_Mutation_p.P86S|PGAP2_ENST00000396991.2_Silent_p.G143G|PGAP2_ENST00000300730.6_Silent_p.G139G|PGAP2_ENST00000479072.1_5'UTR	NM_001256240.1	NP_001243169.1	Q9UHJ9	PGAP2_HUMAN	post-GPI attachment to proteins 2	82					GPI anchor biosynthetic process (GO:0006506)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|signal transduction in response to DNA damage (GO:0042770)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)	p.G143G(1)|p.G139G(1)		NS(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(2)|urinary_tract(1)	11						TCTGCATCGGCCTGCACTCGG	0.642																																							uc001lys.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(427-429)GGC>GGT		FGF receptor activating protein 1 isoform 1							96.0	91.0	93.0					11																	3845193		2201	4298	6499	SO:0001819	synonymous_variant	27315				GPI anchor biosynthetic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane	protein transporter activity	g.chr11:3845193C>T	AF159615	CCDS7747.1, CCDS44523.1, CCDS58112.1, CCDS58113.1, CCDS73244.1, CCDS73245.1	11p15.4	2014-01-31			ENSG00000148985	ENSG00000148985			17893	protein-coding gene	gene with protein product	"""FGF receptor activating protein 1"", ""cell wall biogenesis 43 N-terminal homolog (S. cerevisiae)"""	615187	"""mental retardation, non-syndromic, autosomal recessive, 21"""	MRT21		10585768, 16407401, 23561846	Standard	NM_014489		Approved	FRAG1, CWH43-N	uc010qxw.3	Q9UHJ9	OTTHUMG00000012238	ENST00000463452.2:c.246C>T	11.37:g.3845193C>T						PGAP2_uc001lyl.2_Silent_p.G100G|PGAP2_uc010qxw.1_Silent_p.G200G|PGAP2_uc010qxx.1_Missense_Mutation_p.P124S|PGAP2_uc001lyp.3_Intron|PGAP2_uc010qxy.1_Silent_p.G139G|PGAP2_uc010qxz.1_Silent_p.G139G|PGAP2_uc001lyn.3_Missense_Mutation_p.P36S|PGAP2_uc010qya.1_RNA|PGAP2_uc001lyr.2_Silent_p.G82G|PGAP2_uc010qyb.1_Missense_Mutation_p.P86S|PGAP2_uc001lyt.2_5'UTR	p.G143G	NM_014489	NP_055304	Q9UHJ9	PGAP2_HUMAN			4	555	+			143					E9PJG5|H7BXL9|Q6UC77|Q96G66|Q9UF01|Q9Y4N1	Silent	SNP	ENST00000463452.2	37	c.429C>T	CCDS58112.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.66|10.66	1.411709|1.411709	0.25465|0.25465	.|.	.|.	ENSG00000148985|ENSG00000148985	ENST00000459679;ENST00000464906|ENST00000396993;ENST00000532523;ENST00000465307	.|.	.|.	.|.	5.86|5.86	1.83|1.83	0.25207|0.25207	.|.	.|.	.|.	.|.	.|.	T|T	0.37732|0.37732	0.1014|0.1014	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|B;B	.|0.27351	.|0.176;0.062	.|B;B	.|0.21917	.|0.037;0.011	T|T	0.24154|0.24154	-1.0168|-1.0168	4|7	.|0.87932	.|D	.|0	-13.876|-13.876	2.7823|2.7823	0.05364|0.05364	0.1488:0.5488:0.1438:0.1586|0.1488:0.5488:0.1438:0.1586	.|.	.|86;36	.|B7Z2X5;A8MZF5	.|.;.	V|S	113;173|36;101;86	.|.	.|ENSP00000380190:P36S	A|P	+|+	2|1	0|0	PGAP2|PGAP2	3801769|3801769	0.974000|0.974000	0.33945|0.33945	0.998000|0.998000	0.56505|0.56505	0.922000|0.922000	0.55478|0.55478	0.134000|0.134000	0.15932|0.15932	0.083000|0.083000	0.17047|0.17047	-0.897000|-0.897000	0.02905|0.02905	GCC|CCT		0.642	PGAP2-049	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000383260.1			17	129	0	0	0	0.006122	0	17	129				
OR51D1	390038	broad.mit.edu	37	11	4661687	4661687	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr11:4661687G>T	ENST00000357605.2	+	1	743	c.667G>T	c.(667-669)Gac>Tac	p.D223Y	OR51E1_ENST00000396952.5_5'Flank	NM_001004751.2	NP_001004751.1	Q8NGF3	O51D1_HUMAN	olfactory receptor, family 51, subfamily D, member 1	223						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.D223Y(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|liver(2)|lung(14)|prostate(1)|skin(2)|urinary_tract(1)	27		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;2.74e-13)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|GBM - Glioblastoma multiforme(2;0.0841)|LUSC - Lung squamous cell carcinoma(625;0.19)		CATGGGTGTGGACTCTCTCTT	0.493																																							uc010qyk.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(667-669)GAC>TAC		olfactory receptor, family 51, subfamily D,							267.0	224.0	238.0					11																	4661687		2201	4298	6499	SO:0001583	missense	390038				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4661687G>T	AB065855	CCDS31357.1	11p15.4	2012-08-09			ENSG00000197428	ENSG00000197428		"""GPCR / Class A : Olfactory receptors"""	15193	protein-coding gene	gene with protein product							Standard	NM_001004751		Approved	OR51D1Q	uc010qyk.2	Q8NGF3	OTTHUMG00000165724	ENST00000357605.2:c.667G>T	11.37:g.4661687G>T	ENSP00000350222:p.Asp223Tyr						p.D223Y	NM_001004751	NP_001004751	Q8NGF3	O51D1_HUMAN		Epithelial(150;2.74e-13)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|GBM - Glioblastoma multiforme(2;0.0841)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	667	+		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)	223			Helical; Name=5; (Potential).		B9EIK4	Missense_Mutation	SNP	ENST00000357605.2	37	c.667G>T	CCDS31357.1	.	.	.	.	.	.	.	.	.	.	G	12.33	1.904770	0.33628	.	.	ENSG00000197428	ENST00000357605	T	0.37411	1.2	4.29	4.29	0.51040	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47455	D	0.000226	T	0.72439	0.3460	H	0.96833	3.89	0.43114	D	0.994825	D	0.89917	1.0	D	0.97110	1.0	D	0.83556	0.0104	10	0.87932	D	0	.	15.8173	0.78612	0.0:0.0:1.0:0.0	.	223	Q8NGF3	O51D1_HUMAN	Y	223	ENSP00000350222:D223Y	ENSP00000350222:D223Y	D	+	1	0	OR51D1	4618263	1.000000	0.71417	0.970000	0.41538	0.009000	0.06853	4.713000	0.61895	2.352000	0.79861	0.563000	0.77884	GAC		0.493	OR51D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385956.1	NM_001004751		30	117	1	0	1.22674e-20	0.00874	1.78391e-20	30	117				
ARFIP2	23647	broad.mit.edu	37	11	6500372	6500372	+	Nonsense_Mutation	SNP	T	T	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr11:6500372T>A	ENST00000254584.2	-	4	396	c.313A>T	c.(313-315)Aag>Tag	p.K105*	TIMM10B_ENST00000254616.6_5'Flank|TIMM10B_ENST00000530751.1_5'Flank|ARFIP2_ENST00000445086.2_Intron|TIMM10B_ENST00000472836.1_5'Flank|ARFIP2_ENST00000423813.2_Nonsense_Mutation_p.K67*|ARFIP2_ENST00000525235.1_Nonsense_Mutation_p.K105*|ARFIP2_ENST00000396777.3_Nonsense_Mutation_p.K105*	NM_012402.3	NP_036534.1	P53365	ARFP2_HUMAN	ADP-ribosylation factor interacting protein 2	105					actin cytoskeleton organization (GO:0030036)|cellular component movement (GO:0006928)|lamellipodium assembly (GO:0030032)|ruffle organization (GO:0031529)|small GTPase mediated signal transduction (GO:0007264)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	GTP binding (GO:0005525)|GTP-dependent protein binding (GO:0030742)|Rac GTPase binding (GO:0048365)	p.K105*(1)		endometrium(2)|large_intestine(4)|liver(1)|lung(4)|pancreas(1)|prostate(1)|skin(2)	15		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;3.41e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		AATCCTACCTTATAGGTGTTG	0.488																																					Melanoma(119;796 1674 9049 20480 24794)	Melanoma(119;796 1674 9049 20480 24794)	uc001mdk.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(313-315)AAG>TAG		ADP-ribosylation factor interacting protein 2							81.0	75.0	77.0					11																	6500372		2201	4296	6497	SO:0001587	stop_gained	23647				actin cytoskeleton organization|cellular component movement|lamellipodium assembly|ruffle organization|small GTPase mediated signal transduction	cell cortex|plasma membrane|ruffle	GTP binding|GTP-dependent protein binding|Rac GTPase binding	g.chr11:6500372T>A	BC000392	CCDS7765.1, CCDS55739.1, CCDS55740.1, CCDS73250.1	11p15	2008-08-01	2008-08-01		ENSG00000132254	ENSG00000132254			17160	protein-coding gene	gene with protein product	"""arfaptin 2"""	601638				8670882, 9038142	Standard	NM_012402		Approved	POR1	uc010ran.2	P53365	OTTHUMG00000133406	ENST00000254584.2:c.313A>T	11.37:g.6500372T>A	ENSP00000254584:p.Lys105*					ARFIP2_uc001mdl.2_Nonsense_Mutation_p.K105*|ARFIP2_uc010ral.1_Nonsense_Mutation_p.K67*|ARFIP2_uc010ram.1_Intron|ARFIP2_uc010ran.1_Nonsense_Mutation_p.K138*|ARFIP2_uc001mdm.2_RNA|ARFIP2_uc009yfe.1_3'UTR|FXC1_uc001mdn.3_5'Flank|FXC1_uc001mdo.3_5'Flank	p.K105*	NM_012402	NP_036534	P53365	ARFP2_HUMAN		Epithelial(150;3.41e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)	4	450	-		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)	105					B4DX86|B4E306|D3DQT5	Nonsense_Mutation	SNP	ENST00000254584.2	37	c.313A>T	CCDS7765.1	.	.	.	.	.	.	.	.	.	.	T	28.5	4.929014	0.92389	.	.	ENSG00000132254	ENST00000254584;ENST00000396777;ENST00000423813;ENST00000525235	.	.	.	5.67	5.67	0.87782	.	0.043276	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.5602	0.76237	0.0:0.0:0.0:1.0	.	.	.	.	X	105;105;67;105	.	ENSP00000254584:K105X	K	-	1	0	ARFIP2	6456948	1.000000	0.71417	1.000000	0.80357	0.632000	0.37999	7.879000	0.87236	2.162000	0.67917	0.402000	0.26972	AAG		0.488	ARFIP2-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387044.1	NM_012402		23	92	0	0	0	0.003954	0	23	92				
OR10A3	26496	broad.mit.edu	37	11	7960643	7960643	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr11:7960643A>G	ENST00000360759.3	-	1	498	c.425T>C	c.(424-426)aTg>aCg	p.M142T		NM_001003745.1	NP_001003745.1	P58181	O10A3_HUMAN	olfactory receptor, family 10, subfamily A, member 3	142					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M142T(1)		endometrium(1)|large_intestine(5)|lung(12)|pancreas(1)|skin(2)	21				Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		TACTAATTTCATAAAAACCCC	0.423																																							uc010rbi.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(424-426)ATG>ACG		olfactory receptor, family 10, subfamily A,							50.0	49.0	50.0					11																	7960643		2201	4296	6497	SO:0001583	missense	26496				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:7960643A>G	BK004404	CCDS31421.1	11p15.4	2012-08-09			ENSG00000170683	ENSG00000170683		"""GPCR / Class A : Olfactory receptors"""	8162	protein-coding gene	gene with protein product						1370859	Standard	NM_001003745		Approved	HTPCRX12, HSHTPCRX12	uc010rbi.2	P58181	OTTHUMG00000165672	ENST00000360759.3:c.425T>C	11.37:g.7960643A>G	ENSP00000353988:p.Met142Thr						p.M142T	NM_001003745	NP_001003745	P58181	O10A3_HUMAN		Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)	1	425	-			142			Helical; Name=4; (Potential).		B9EH39|Q6IF58|Q96R11	Missense_Mutation	SNP	ENST00000360759.3	37	c.425T>C	CCDS31421.1	.	.	.	.	.	.	.	.	.	.	A	0.046	-1.266250	0.01433	.	.	ENSG00000170683	ENST00000360759	T	0.36340	1.26	4.77	-0.16	0.13375	GPCR, rhodopsin-like superfamily (1);	0.820594	0.10360	N	0.684051	T	0.13114	0.0318	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.31613	-0.9937	10	0.16420	T	0.52	.	4.608	0.12387	0.4317:0.1992:0.3691:0.0	.	142	P58181	O10A3_HUMAN	T	142	ENSP00000353988:M142T	ENSP00000353988:M142T	M	-	2	0	OR10A3	7917219	0.000000	0.05858	0.122000	0.21767	0.084000	0.17831	-0.051000	0.11885	0.079000	0.16929	0.528000	0.53228	ATG		0.423	OR10A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385704.1	NM_001003745		4	100	0	0	0	0.000602	0	4	100				
RIC3	79608	broad.mit.edu	37	11	8161742	8161742	+	Splice_Site	SNP	T	T	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr11:8161742T>A	ENST00000309737.6	-	2	124		c.e2-2		RIC3_ENST00000343202.4_Splice_Site|RIC3_ENST00000419822.2_Splice_Site|RIC3_ENST00000530060.1_5'Flank|RIC3_ENST00000539720.1_Splice_Site|RIC3_ENST00000425599.2_Splice_Site|RIC3_ENST00000335425.7_Intron			Q7Z5B4	RIC3_HUMAN	RIC3 acetylcholine receptor chaperone						cellular protein complex assembly (GO:0043623)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein folding (GO:0006457)|synaptic transmission, cholinergic (GO:0007271)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.?(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)	17				Epithelial(150;2.89e-07)|BRCA - Breast invasive adenocarcinoma(625;0.204)		CCAATTTTCCTGAGAAAATAA	0.428																																							uc001mgd.2		NA																	1	Unknown(1)		lung(1)	large_intestine(1)|ovary(1)|pancreas(1)	3						c.e2-1		resistance to inhibitors of cholinesterase 3							44.0	45.0	45.0					11																	8161742		2201	4296	6497	SO:0001630	splice_region_variant	79608					endoplasmic reticulum membrane|Golgi membrane|integral to membrane		g.chr11:8161742T>A		CCDS7788.1, CCDS44533.1, CCDS55741.1, CCDS55742.1	11p15.4	2013-08-05	2013-08-05		ENSG00000166405	ENSG00000166405			30338	protein-coding gene	gene with protein product		610509	"""resistance to inhibitors of cholinesterase 3 homolog (C. elegans)"""			12821669	Standard	NM_024557		Approved	FLJ11608, PRO1385, AYST720	uc001mgd.2	Q7Z5B4	OTTHUMG00000165694	ENST00000309737.6:c.125-2A>T	11.37:g.8161742T>A						RIC3_uc001mgb.2_5'Flank|RIC3_uc001mgc.2_Splice_Site_p.G42_splice|RIC3_uc001mge.2_Intron|RIC3_uc010rbl.1_Splice_Site|RIC3_uc010rbm.1_Splice_Site_p.G42_splice|RIC3_uc009yfm.2_Splice_Site_p.G42_splice|RIC3_uc009yfn.2_Intron|RIC3_uc001mgf.3_Intron	p.G42_splice	NM_024557	NP_078833	Q7Z5B4	RIC3_HUMAN		Epithelial(150;2.89e-07)|BRCA - Breast invasive adenocarcinoma(625;0.204)	2	179	-								B0B1U0|B2RD25|D3DQU5|Q6UX78|Q7Z5B3|Q86T94|Q8TBJ9|Q9HAH8	Splice_Site	SNP	ENST00000309737.6	37	c.125_splice	CCDS55742.1	.	.	.	.	.	.	.	.	.	.	T	15.21	2.765783	0.49574	.	.	ENSG00000166405	ENST00000343202;ENST00000309737;ENST00000543346;ENST00000425599;ENST00000531450;ENST00000419822	.	.	.	5.75	5.75	0.90469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0755	0.80965	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	RIC3	8118318	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	2.861000	0.48380	2.182000	0.69389	0.528000	0.53228	.		0.428	RIC3-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000385900.1	NM_024557	Intron	6	36	0	0	0	0.001984	0	6	36				
KIF18A	81930	broad.mit.edu	37	11	28106288	28106288	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr11:28106288C>A	ENST00000263181.6	-	7	1255	c.965G>T	c.(964-966)gGa>gTa	p.G322V		NM_031217.3	NP_112494.3	Q8NI77	KI18A_HUMAN	kinesin family member 18A	322	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)|protein transport (GO:0015031)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore microtubule (GO:0005828)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|ruffle (GO:0001726)	actin binding (GO:0003779)|ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|plus-end-directed microtubule motor activity (GO:0008574)|tubulin-dependent ATPase activity (GO:0070463)|ubiquitin binding (GO:0043130)	p.G322V(1)		breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(10)|ovary(3)|prostate(1)|skin(1)|urinary_tract(2)	36						TTGACAGTTTCCTCCAAGAGA	0.368																																							uc001msc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(964-966)GGA>GTA		kinesin family member 18A							122.0	118.0	120.0					11																	28106288		2202	4299	6501	SO:0001583	missense	81930				blood coagulation|microtubule depolymerization|microtubule-based movement|mitotic metaphase plate congression|mitotic prometaphase|protein transport	caveola|cytosol|kinetochore microtubule|microtubule organizing center|nucleus|ruffle	actin binding|ATP binding|microtubule plus-end binding|plus-end-directed microtubule motor activity|tubulin-dependent ATPase activity|ubiquitin binding	g.chr11:28106288C>A	AL136819	CCDS7867.1	11p14.1	2014-06-12			ENSG00000121621	ENSG00000121621		"""Kinesins"""	29441	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 99"""	611271				11230166	Standard	NM_031217		Approved	DKFZP434G2226, PPP1R99	uc001msc.2	Q8NI77	OTTHUMG00000166195	ENST00000263181.6:c.965G>T	11.37:g.28106288C>A	ENSP00000263181:p.Gly322Val						p.G322V	NM_031217	NP_112494	Q8NI77	KI18A_HUMAN			7	1147	-			322					Q4VPE3|Q86VS5|Q9H0F3	Missense_Mutation	SNP	ENST00000263181.6	37	c.965G>T	CCDS7867.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.681353	0.88542	.	.	ENSG00000121621	ENST00000263181	D	0.83419	-1.72	5.11	5.11	0.69529	Kinesin, motor domain (4);	0.000000	0.85682	D	0.000000	D	0.95743	0.8615	H	0.99697	4.71	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98204	1.0469	10	0.87932	D	0	.	18.6085	0.91275	0.0:1.0:0.0:0.0	.	322	Q8NI77	KI18A_HUMAN	V	322	ENSP00000263181:G322V	ENSP00000263181:G322V	G	-	2	0	KIF18A	28062864	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.773000	0.85462	2.411000	0.81874	0.650000	0.86243	GGA		0.368	KIF18A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388328.3	NM_031217		16	63	1	0	3.45872e-05	0.004007	3.71303e-05	16	63				
ELP4	26610	broad.mit.edu	37	11	31669325	31669325	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr11:31669325G>T	ENST00000350638.5	+	8	999	c.964G>T	c.(964-966)Gat>Tat	p.D322Y	ELP4_ENST00000395934.2_Missense_Mutation_p.D322Y|ELP4_ENST00000379163.5_Missense_Mutation_p.D323Y|Z83001.1_ENST00000429821.1_RNA	NM_019040.3	NP_061913.3	Q96EB1	ELP4_HUMAN	elongator acetyltransferase complex subunit 4	322					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|transcription elongation factor complex (GO:0008023)	phosphorylase kinase regulator activity (GO:0008607)	p.D322Y(2)		breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(3)	20	Lung SC(675;0.225)					AACCTTGTCAGATGTAGTAGT	0.323																																							uc001mtb.2		NA																	2	Substitution - Missense(2)		lung(2)	upper_aerodigestive_tract(1)|ovary(1)|prostate(1)	3						c.(964-966)GAT>TAT		elongation protein 4 homolog							199.0	182.0	187.0					11																	31669325		1849	4088	5937	SO:0001583	missense	26610				histone acetylation|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|Elongator holoenzyme complex|transcription elongation factor complex	phosphorylase kinase regulator activity|protein binding	g.chr11:31669325G>T	AJ276005	CCDS7875.2, CCDS73271.1, CCDS73272.1	11p13	2012-08-14	2012-08-08	2002-05-24	ENSG00000109911	ENSG00000109911		"""Elongator acetyltransferase complex subunits"""	1171	protein-coding gene	gene with protein product		606985	"""chromosome 11 open reading frame 19"", ""elongation protein 4 homolog (S. cerevisiae)"""	C11orf19		11889558, 11435442	Standard	XM_005252865		Approved	PAXNEB	uc001mtb.3	Q96EB1	OTTHUMG00000142919	ENST00000350638.5:c.964G>T	11.37:g.31669325G>T	ENSP00000298937:p.Asp322Tyr					ELP4_uc001mta.1_RNA|ELP4_uc001mtc.2_Missense_Mutation_p.D322Y|ELP4_uc010rdz.1_Missense_Mutation_p.D323Y	p.D322Y	NM_019040	NP_061913	Q96EB1	ELP4_HUMAN			8	999	+	Lung SC(675;0.225)		322					B4E3W0|E7EPZ6|Q9H4E8|Q9NX11	Missense_Mutation	SNP	ENST00000350638.5	37	c.964G>T	CCDS7875.2	.	.	.	.	.	.	.	.	.	.	G	23.4	4.410130	0.83340	.	.	ENSG00000109911	ENST00000350638;ENST00000379163;ENST00000395934	T;T;T	0.63417	-0.04;-0.04;-0.04	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	D	0.84732	0.5537	M	0.91406	3.205	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.86991	0.2110	10	0.87932	D	0	-22.0859	20.3172	0.98658	0.0:0.0:1.0:0.0	.	323;322;322	B4E3W0;G5E9D4;Q96EB1	.;.;ELP4_HUMAN	Y	322;323;322	ENSP00000298937:D322Y;ENSP00000368461:D323Y;ENSP00000379267:D322Y	ENSP00000298937:D322Y	D	+	1	0	ELP4	31625901	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	8.210000	0.89753	2.801000	0.96364	0.650000	0.86243	GAT		0.323	ELP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286640.1	NM_019040		14	46	1	0	1.37285e-15	0.004007	1.84905e-15	14	46				
OR5I1	10798	broad.mit.edu	37	11	55703060	55703060	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr11:55703060C>T	ENST00000301532.3	-	1	816	c.817G>A	c.(817-819)Gat>Aat	p.D273N		NM_006637.1	NP_006628.1	Q13606	OR5I1_HUMAN	olfactory receptor, family 5, subfamily I, member 1	273					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.D273N(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(34)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						ATAATTTTATCAGTGTTTGGA	0.408																																							uc010ris.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(817-819)GAT>AAT		olfactory receptor, family 5, subfamily I,							70.0	70.0	70.0					11																	55703060		2201	4295	6496	SO:0001583	missense	10798				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55703060C>T	BC069093	CCDS7949.1	11q11	2012-08-09			ENSG00000167825	ENSG00000167825		"""GPCR / Class A : Olfactory receptors"""	8347	protein-coding gene	gene with protein product		608496				9017400, 9787077	Standard	NM_006637		Approved	HSOlf1, OLF1	uc010ris.2	Q13606	OTTHUMG00000166821	ENST00000301532.3:c.817G>A	11.37:g.55703060C>T	ENSP00000301532:p.Asp273Asn						p.D273N	NM_006637	NP_006628	Q13606	OR5I1_HUMAN			1	817	-			273			Extracellular (Potential).		Q6IEU4	Missense_Mutation	SNP	ENST00000301532.3	37	c.817G>A	CCDS7949.1	.	.	.	.	.	.	.	.	.	.	C	13.17	2.156230	0.38021	.	.	ENSG00000167825	ENST00000301532	T	0.00216	8.53	5.16	4.23	0.50019	GPCR, rhodopsin-like superfamily (1);	0.134922	0.33401	N	0.004951	T	0.00178	0.0005	L	0.53729	1.69	0.09310	N	1	B	0.11235	0.004	B	0.13407	0.009	T	0.40813	-0.9543	10	0.44086	T	0.13	.	7.2125	0.25941	0.0:0.8154:0.0:0.1846	.	273	Q13606	OR5I1_HUMAN	N	273	ENSP00000301532:D273N	ENSP00000301532:D273N	D	-	1	0	OR5I1	55459636	0.000000	0.05858	0.301000	0.25044	0.931000	0.56810	-0.018000	0.12568	2.548000	0.85928	0.643000	0.83706	GAT		0.408	OR5I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391528.1	NM_006637		5	18	0	0	0	0.00308	0	5	18				
OR8J3	81168	broad.mit.edu	37	11	55904471	55904471	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr11:55904471C>T	ENST00000301529.1	-	1	723	c.724G>A	c.(724-726)Gct>Act	p.A242T		NM_001004064.1	NP_001004064.1	Q8NGG0	OR8J3_HUMAN	olfactory receptor, family 8, subfamily J, member 3	242						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A242T(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(38)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	59	Esophageal squamous(21;0.00693)					ATATGCGAAGCGCAGGTGGAA	0.393																																							uc010riz.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(724-726)GCT>ACT		olfactory receptor, family 8, subfamily J,							118.0	110.0	113.0					11																	55904471		2201	4296	6497	SO:0001583	missense	81168				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55904471C>T		CCDS31520.1	11q12.2	2012-08-09			ENSG00000167822	ENSG00000167822		"""GPCR / Class A : Olfactory receptors"""	15312	protein-coding gene	gene with protein product							Standard	NM_001004064		Approved		uc010riz.2	Q8NGG0	OTTHUMG00000166834	ENST00000301529.1:c.724G>A	11.37:g.55904471C>T	ENSP00000301529:p.Ala242Thr						p.A242T	NM_001004064	NP_001004064	Q8NGG0	OR8J3_HUMAN			1	724	-	Esophageal squamous(21;0.00693)		242			Helical; Name=6; (Potential).		Q6IFB6|Q96RC2	Missense_Mutation	SNP	ENST00000301529.1	37	c.724G>A	CCDS31520.1	.	.	.	.	.	.	.	.	.	.	C	6.142	0.394467	0.11638	.	.	ENSG00000167822	ENST00000301529	T	0.36878	1.23	3.27	2.24	0.28232	GPCR, rhodopsin-like superfamily (1);	0.498363	0.20235	N	0.096410	T	0.26376	0.0644	L	0.41356	1.27	0.09310	N	1	B	0.19706	0.038	B	0.26693	0.072	T	0.21449	-1.0245	10	0.49607	T	0.09	.	4.2674	0.10769	0.0:0.566:0.1844:0.2496	.	242	Q8NGG0	OR8J3_HUMAN	T	242	ENSP00000301529:A242T	ENSP00000301529:A242T	A	-	1	0	OR8J3	55661047	0.000000	0.05858	0.427000	0.26684	0.152000	0.21847	-0.353000	0.07691	0.368000	0.24481	0.297000	0.19635	GCT		0.393	OR8J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391542.1	NM_001004064		14	50	0	0	0	0.007413	0	14	50				
MS4A2	2206	broad.mit.edu	37	11	59857910	59857910	+	Missense_Mutation	SNP	T	T	G			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr11:59857910T>G	ENST00000278888.3	+	3	390	c.288T>G	c.(286-288)ttT>ttG	p.F96L		NM_000139.4	NP_000130.1	Q01362	FCERB_HUMAN	membrane-spanning 4-domains, subfamily A, member 2	96					activation of phospholipase C activity (GO:0007202)|cytokine secretion (GO:0050663)|Fc-epsilon receptor signaling pathway (GO:0038095)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of mast cell degranulation (GO:0043306)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|Fc-epsilon receptor I complex (GO:0032998)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)		p.F96L(1)		endometrium(1)|large_intestine(4)|lung(9)|ovary(1)|upper_aerodigestive_tract(2)	17		all_epithelial(135;0.245)			Omalizumab(DB00043)	TTTCATCATTTAAAGCAGGTT	0.338																																							uc001nop.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(286-288)TTT>TTG		membrane-spanning 4-domains, subfamily A, member	Omalizumab(DB00043)						179.0	172.0	174.0					11																	59857910		2200	4294	6494	SO:0001583	missense	2206				cell proliferation|humoral immune response	integral to plasma membrane	calcium channel activity	g.chr11:59857910T>G	M89796	CCDS7980.1, CCDS73292.1	11q12-q13	2012-02-28	2012-02-28		ENSG00000149534	ENSG00000149534			7316	protein-coding gene	gene with protein product	"""Fc fragment of IgE, high affinity I, receptor for; beta polypeptide"""	147138	"""IgE responsiveness (atopic)"", ""membrane-spanning 4-domains, subfamily A, member 2 (Fc fragment of IgE, high affinity I, receptor for; beta polypeptide)"""	FCER1B, IGER, APY		1386024	Standard	NM_000139		Approved	MS4A1	uc001nop.3	Q01362	OTTHUMG00000167239	ENST00000278888.3:c.288T>G	11.37:g.59857910T>G	ENSP00000278888:p.Phe96Leu					MS4A2_uc009ymu.2_Missense_Mutation_p.F96L	p.F96L	NM_000139	NP_000130	Q01362	FCERB_HUMAN			3	390	+		all_epithelial(135;0.245)	96			Extracellular (Potential).		Q54A81	Missense_Mutation	SNP	ENST00000278888.3	37	c.288T>G	CCDS7980.1	.	.	.	.	.	.	.	.	.	.	T	14.09	2.431528	0.43122	.	.	ENSG00000149534	ENST00000278888	T	0.01963	4.53	4.68	-0.185	0.13276	.	0.532223	0.20106	N	0.099123	T	0.02929	0.0087	L	0.39326	1.205	0.09310	N	0.999993	D;D	0.57257	0.979;0.959	P;P	0.58266	0.836;0.732	T	0.21484	-1.0244	10	0.02654	T	1	-20.3023	3.1578	0.06510	0.1757:0.2889:0.0:0.5354	.	26;96	Q14298;Q01362	.;FCERB_HUMAN	L	96	ENSP00000278888:F96L	ENSP00000278888:F96L	F	+	3	2	MS4A2	59614486	0.590000	0.26815	0.094000	0.20943	0.980000	0.70556	0.282000	0.18829	-0.042000	0.13535	0.528000	0.53228	TTT		0.338	MS4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393844.1			27	74	0	0	0	0.007291	0	27	74				
STIP1	10963	broad.mit.edu	37	11	63964764	63964764	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr11:63964764G>A	ENST00000305218.4	+	6	841	c.694G>A	c.(694-696)Ggg>Agg	p.G232R	STIP1_ENST00000538945.1_Missense_Mutation_p.G208R|STIP1_ENST00000358794.5_Missense_Mutation_p.G279R	NM_006819.2	NP_006810.1	P31948	STIP1_HUMAN	stress-induced phosphoprotein 1	232					response to stress (GO:0006950)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.G232R(1)		endometrium(4)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(1)|skin(1)	27						AAAAGAGCTGGGGAACGATGC	0.433																																							uc001nyk.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|liver(1)	3						c.(694-696)GGG>AGG		stress-induced-phosphoprotein 1							97.0	86.0	90.0					11																	63964764		2201	4297	6498	SO:0001583	missense	10963				axon guidance|response to stress	Golgi apparatus|nucleus		g.chr11:63964764G>A	BC039299	CCDS8058.1, CCDS60827.1, CCDS60828.1	11q13	2014-01-13	2014-01-13		ENSG00000168439	ENSG00000168439		"""Tetratricopeptide (TTC) repeat domain containing"""	11387	protein-coding gene	gene with protein product	"""Hsp70/Hsp90-organizing protein"""	605063	"""stress-induced-phosphoprotein 1"""			1569099	Standard	NM_006819		Approved	HOP, STI1	uc001nyk.1	P31948	OTTHUMG00000167789	ENST00000305218.4:c.694G>A	11.37:g.63964764G>A	ENSP00000305958:p.Gly232Arg					STIP1_uc010rnb.1_Missense_Mutation_p.G208R	p.G232R	NM_006819	NP_006810	P31948	STIP1_HUMAN			6	841	+			232			Bipartite nuclear localization signal (Potential).|TPR 4.		B4DM70|F5H0T1|G3XAD8|Q3ZCU9|Q5TZU9	Missense_Mutation	SNP	ENST00000305218.4	37	c.694G>A	CCDS8058.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.780133	0.90195	.	.	ENSG00000168439	ENST00000358794;ENST00000305218;ENST00000538945	T;T;T	0.80909	-1.43;-1.43;-1.43	5.84	5.84	0.93424	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	D	0.95069	0.8403	H	0.99752	4.75	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.79784	0.988;0.993	D	0.96805	0.9592	10	0.87932	D	0	-33.4261	19.298	0.94131	0.0:0.0:1.0:0.0	.	208;232	F5H0T1;P31948	.;STIP1_HUMAN	R	279;232;208	ENSP00000351646:G279R;ENSP00000305958:G232R;ENSP00000445957:G208R	ENSP00000305958:G232R	G	+	1	0	STIP1	63721340	1.000000	0.71417	0.993000	0.49108	0.482000	0.33219	9.028000	0.93712	2.937000	0.99478	0.650000	0.86243	GGG		0.433	STIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396289.2	NM_006819		17	43	0	0	0	0.008871	0	17	43				
NRXN2	9379	broad.mit.edu	37	11	64402833	64402833	+	Silent	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr11:64402833C>A	ENST00000377551.1	-	17	3706	c.3495G>T	c.(3493-3495)ctG>ctT	p.L1165L	NRXN2_ENST00000301894.2_Silent_p.L119L|NRXN2_ENST00000265459.6_Silent_p.L1165L|NRXN2_ENST00000377559.3_Silent_p.L1125L|NRXN2_ENST00000409571.1_Silent_p.L1158L			Q9P2S2	NRX2A_HUMAN	neurexin 2	1165	Laminin G-like 6. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)	p.L119L(1)|p.L1165L(1)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						AGCCCACGGCCAGGCGATCCA	0.652																																							uc001oap.2		NA																	2	Substitution - coding silent(2)		lung(2)	upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)|ovary(2)|kidney(1)|pancreas(1)	10						c.(355-357)CTG>CTT		neurexin 2 isoform beta precursor							39.0	36.0	37.0					11																	64402833		2201	4297	6498	SO:0001819	synonymous_variant	9379				cell adhesion	integral to membrane		g.chr11:64402833C>A		CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.3495G>T	11.37:g.64402833C>A						NRXN2_uc001oar.2_Silent_p.L1165L|NRXN2_uc001oas.2_Silent_p.L1125L|NRXN2_uc001oaq.2_Silent_p.L832L	p.L119L	NM_138734	NP_620063	P58401	NRX2B_HUMAN			3	868	-			119			Extracellular (Potential).|Laminin G-like.		A7E2C1|Q9Y2D6	Silent	SNP	ENST00000377551.1	37	c.357G>T	CCDS8077.1																																																																																				0.652	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104967.3	NM_015080		18	49	1	0	4.35082e-09	0.010504	5.156e-09	18	49				
ZNHIT2	741	broad.mit.edu	37	11	64884413	64884413	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr11:64884413G>A	ENST00000310597.4	-	1	757	c.713C>T	c.(712-714)tCt>tTt	p.S238F	AP003068.12_ENST00000527789.1_RNA	NM_014205.2	NP_055020.1	Q9UHR6	ZNHI2_HUMAN	zinc finger, HIT-type containing 2	238							metal ion binding (GO:0046872)	p.S238F(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(1)|urinary_tract(1)	6						ACAGAAGTCAGAGAGCAGCGC	0.662																																							uc001ocw.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(712-714)TCT>TTT		zinc finger, HIT domain containing 2							21.0	21.0	21.0					11																	64884413		2179	4269	6448	SO:0001583	missense	741						metal ion binding	g.chr11:64884413G>A		CCDS8094.1	11q13	2012-08-08	2010-09-15	2004-07-14	ENSG00000174276	ENSG00000174276		"""Zinc fingers, HIT-type"""	1177	protein-coding gene	gene with protein product		604575	"""chromosome 11 open reading frame 5"", ""zinc finger, HIT domain containing 2"""	C11orf5			Standard	NM_014205		Approved	FON	uc001ocw.3	Q9UHR6	OTTHUMG00000165604	ENST00000310597.4:c.713C>T	11.37:g.64884413G>A	ENSP00000308548:p.Ser238Phe					uc009yqb.1_Missense_Mutation_p.R95K	p.S238F	NM_014205	NP_055020	Q9UHR6	ZNHI2_HUMAN			1	758	-			238					Q3SY14|Q8IUV0	Missense_Mutation	SNP	ENST00000310597.4	37	c.713C>T	CCDS8094.1	.	.	.	.	.	.	.	.	.	.	G	9.857	1.195165	0.22037	.	.	ENSG00000174276	ENST00000310597;ENST00000528598	T	0.32515	1.45	4.67	3.67	0.42095	.	0.572776	0.16068	U	0.231126	T	0.15349	0.0370	N	0.19112	0.55	0.09310	N	1	B	0.34015	0.435	B	0.30782	0.12	T	0.08493	-1.0719	10	0.21014	T	0.42	-5.4284	5.5185	0.16919	0.2205:0.0:0.7795:0.0	.	238	Q9UHR6	ZNHI2_HUMAN	F	238;73	ENSP00000308548:S238F	ENSP00000308548:S238F	S	-	2	0	ZNHIT2	64640989	0.000000	0.05858	0.489000	0.27452	0.429000	0.31625	0.369000	0.20416	2.417000	0.82017	0.561000	0.74099	TCT		0.662	ZNHIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385260.1	NM_014205		6	19	0	0	0	0.001984	0	6	19				
GAL	51083	broad.mit.edu	37	11	68455487	68455487	+	Missense_Mutation	SNP	G	G	A	rs541536020	byFrequency	TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr11:68455487G>A	ENST00000265643.3	+	4	400	c.142G>A	c.(142-144)Gtt>Att	p.V48I		NM_015973.3	NP_057057.2	P22466	GALA_HUMAN	galanin/GMAP prepropeptide	48					cAMP-mediated signaling (GO:0019933)|feeding behavior (GO:0007631)|inflammatory response (GO:0006954)|insulin secretion (GO:0030073)|negative regulation of lymphocyte proliferation (GO:0050672)|negative regulation of root hair elongation (GO:1902891)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catagen (GO:0051795)|positive regulation of cortisol secretion (GO:0051464)|positive regulation of large conductance calcium-activated potassium channel activity (GO:1902608)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein kinase A signaling (GO:0010737)|regulation of glucocorticoid metabolic process (GO:0031943)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to insulin (GO:0032868)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|neuronal cell body (GO:0043025)|secretory granule (GO:0030141)	neuropeptide hormone activity (GO:0005184)|type 1 galanin receptor binding (GO:0031764)|type 2 galanin receptor binding (GO:0031765)|type 3 galanin receptor binding (GO:0031766)	p.V48I(1)		lung(4)	4	Esophageal squamous(3;7.33e-10)	Melanoma(852;0.0749)	LUAD - Lung adenocarcinoma(13;0.0514)	Kidney(183;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(183;3.23e-08)|Lung(977;0.000152)|LUSC - Lung squamous cell carcinoma(976;0.00154)		AACAGATGCCGTTGGCAACCA	0.572													G|||	3	0.000599042	0.0	0.0	5008	,	,		19672	0.0		0.0	False		,,,				2504	0.0031						uc001oob.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(142-144)GTT>ATT		galanin preproprotein							85.0	70.0	75.0					11																	68455487		2200	4294	6494	SO:0001583	missense	51083				growth hormone secretion|insulin secretion|neuropeptide signaling pathway|smooth muscle contraction	extracellular region	neuropeptide hormone activity	g.chr11:68455487G>A	L11144	CCDS8183.1	11q13.2	2013-02-26	2012-10-23		ENSG00000069482	ENSG00000069482		"""Endogenous ligands"""	4114	protein-coding gene	gene with protein product	"""galanin-message-associated peptide"", ""galanin/GMAP prepropeptide"""	137035	"""galanin"", ""galanin prepropeptide"""	GALN		7508413	Standard	XM_006718580		Approved	GMAP, GAL-GMAP, GLNN	uc001oob.3	P22466	OTTHUMG00000167890	ENST00000265643.3:c.142G>A	11.37:g.68455487G>A	ENSP00000265643:p.Val48Ile						p.V48I	NM_015973	NP_057057	P22466	GALA_HUMAN	LUAD - Lung adenocarcinoma(13;0.0514)	Kidney(183;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(183;3.23e-08)|Lung(977;0.000152)|LUSC - Lung squamous cell carcinoma(976;0.00154)	4	360	+	Esophageal squamous(3;7.33e-10)	Melanoma(852;0.0749)	48					Q14413	Missense_Mutation	SNP	ENST00000265643.3	37	c.142G>A	CCDS8183.1	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.222678	0.00283	.	.	ENSG00000069482	ENST00000265643	T	0.40476	1.03	4.03	-4.7	0.03288	Galanin (3);	0.454983	0.22311	N	0.061727	T	0.10035	0.0246	N	0.01473	-0.845	0.09310	N	1	B	0.17852	0.024	B	0.10450	0.005	T	0.32534	-0.9903	10	0.02654	T	1	-13.9433	7.2548	0.26171	0.2661:0.1582:0.5756:0.0	.	48	P22466	GALA_HUMAN	I	48	ENSP00000265643:V48I	ENSP00000265643:V48I	V	+	1	0	GAL	68212063	0.007000	0.16637	0.022000	0.16811	0.016000	0.09150	-0.378000	0.07446	-0.856000	0.04120	-0.136000	0.14681	GTT		0.572	GAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396843.2	NM_001479		17	47	0	0	0	0.008871	0	17	47				
PPFIA1	8500	broad.mit.edu	37	11	70221071	70221071	+	Missense_Mutation	SNP	A	A	C			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr11:70221071A>C	ENST00000253925.7	+	24	3402	c.3187A>C	c.(3187-3189)Att>Ctt	p.I1063L	PPFIA1_ENST00000389547.3_Missense_Mutation_p.I1063L|AP000487.5_ENST00000500185.2_RNA|AP000487.5_ENST00000530690.1_RNA|PPFIA1_ENST00000530548.1_3'UTR	NM_003626.3	NP_003617.1	Q13136	LIPA1_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1	1063	SAM 3. {ECO:0000255|PROSITE- ProRule:PRU00184}.				cell-matrix adhesion (GO:0007160)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of stress fiber assembly (GO:0051497)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|presynaptic active zone (GO:0048786)	signal transducer activity (GO:0004871)	p.I1063L(1)		breast(3)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	65			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			GATCCTGTCAATTGGCCTTAA	0.423																																							uc001opo.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|ovary(1)	3						c.(3187-3189)ATT>CTT		PTPRF interacting protein alpha 1 isoform b							147.0	129.0	135.0					11																	70221071		2200	4294	6494	SO:0001583	missense	8500				cell-matrix adhesion	cytoplasm	protein binding|signal transducer activity	g.chr11:70221071A>C	U22816	CCDS31627.1, CCDS31628.1	11q13.3	2013-01-10			ENSG00000131626	ENSG00000131626		"""Sterile alpha motif (SAM) domain containing"""	9245	protein-coding gene	gene with protein product	"""Liprin-alpha1"""	611054				7796809, 9624153	Standard	NM_003626		Approved	LIP.1, LIPRIN	uc001opo.3	Q13136	OTTHUMG00000167266	ENST00000253925.7:c.3187A>C	11.37:g.70221071A>C	ENSP00000253925:p.Ile1063Leu					PPFIA1_uc001opn.1_Missense_Mutation_p.I1063L|PPFIA1_uc001opp.2_RNA|PPFIA1_uc001opr.2_Missense_Mutation_p.I202L|PPFIA1_uc001ops.2_Missense_Mutation_p.I102L|uc001opt.1_RNA	p.I1063L	NM_003626	NP_003617	Q13136	LIPA1_HUMAN	BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)		24	3385	+			1063			SAM 3.		A6NLE3|Q13135|Q14567|Q8N4I2	Missense_Mutation	SNP	ENST00000253925.7	37	c.3187A>C	CCDS31627.1	.	.	.	.	.	.	.	.	.	.	A	13.14	2.149233	0.37923	.	.	ENSG00000131626	ENST00000253925;ENST00000389547;ENST00000544950	D;D	0.85171	-1.95;-1.95	5.75	4.63	0.57726	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 2 (1);	0.065402	0.64402	U	0.000014	D	0.89354	0.6691	M	0.70787	2.145	0.46416	D	0.999036	B;B;B	0.32425	0.371;0.068;0.04	P;B;B	0.49637	0.617;0.349;0.179	D	0.87402	0.2370	10	0.45353	T	0.12	.	11.6931	0.51527	0.9311:0.0:0.0689:0.0	.	560;1063;1063	F5H1G2;Q13136;Q13136-2	.;LIPA1_HUMAN;.	L	1063;1063;560	ENSP00000253925:I1063L;ENSP00000374198:I1063L	ENSP00000253925:I1063L	I	+	1	0	PPFIA1	69898719	1.000000	0.71417	0.013000	0.15412	0.008000	0.06430	5.001000	0.63946	1.006000	0.39211	-0.263000	0.10527	ATT		0.423	PPFIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000393905.1	NM_003626		20	104	0	0	0	0.010504	0	20	104				
CLPB	81570	broad.mit.edu	37	11	72028186	72028186	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr11:72028186T>C	ENST00000294053.3	-	8	1215	c.1042A>G	c.(1042-1044)Att>Gtt	p.I348V	CLPB_ENST00000437826.2_Missense_Mutation_p.I303V|CLPB_ENST00000538039.1_Missense_Mutation_p.I318V|CLPB_ENST00000340729.5_Missense_Mutation_p.I289V|CLPB_ENST00000543042.1_Missense_Mutation_p.I147V	NM_001258394.1|NM_030813.4	NP_001245323.1|NP_110440.1	Q9H078	CLPB_HUMAN	ClpB caseinolytic peptidase B homolog (E. coli)	348					cellular response to heat (GO:0034605)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)	p.I348V(1)		endometrium(3)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	19						TCCTGGCCAATGATGTGCTCC	0.612																																							uc001osj.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(1042-1044)ATT>GTT		caseinolytic peptidase B							115.0	99.0	105.0					11																	72028186		2200	4293	6493	SO:0001583	missense	81570				cellular response to heat		ATP binding|nucleoside-triphosphatase activity|protein binding	g.chr11:72028186T>C	BC006404	CCDS8215.1, CCDS58152.1, CCDS58153.1, CCDS58154.1	11q13.4	2013-01-10			ENSG00000162129	ENSG00000162129		"""Ankyrin repeat domain containing"""	30664	protein-coding gene	gene with protein product	"""suppressor of potassium transport defect 3"""					11230166, 7835694	Standard	NM_030813		Approved	HSP78, SKD3, FLJ13152	uc010rqy.3	Q9H078	OTTHUMG00000167902	ENST00000294053.3:c.1042A>G	11.37:g.72028186T>C	ENSP00000294053:p.Ile348Val					CLPB_uc010rqx.1_Missense_Mutation_p.I303V|CLPB_uc010rqy.1_Missense_Mutation_p.I289V|CLPB_uc001osk.2_Missense_Mutation_p.I318V|CLPB_uc009ytg.2_RNA|CLPB_uc010rqz.1_Missense_Mutation_p.I147V	p.I348V	NM_030813	NP_110440	Q9H078	CLPB_HUMAN			8	1092	-			348					B4DXJ7|B4DXP7|E7EWN6|F8W7P6|Q8ND11|Q9H8Y0	Missense_Mutation	SNP	ENST00000294053.3	37	c.1042A>G	CCDS8215.1	.	.	.	.	.	.	.	.	.	.	T	13.57	2.276576	0.40294	.	.	ENSG00000162129	ENST00000294053;ENST00000538039;ENST00000535990;ENST00000340729;ENST00000437826;ENST00000543042	T;T;T;T;T;T	0.28666	1.6;1.6;1.6;1.6;1.6;1.6	5.7	5.7	0.88788	.	0.127647	0.53938	D	0.000052	T	0.09905	0.0243	N	0.00750	-1.22	0.37302	D	0.90875	B;B;B;B;B	0.21309	0.001;0.054;0.018;0.027;0.027	B;B;B;B;B	0.21917	0.002;0.037;0.021;0.035;0.012	T	0.28396	-1.0045	10	0.17832	T	0.49	-9.7871	9.3234	0.37977	0.0:0.0804:0.0:0.9196	.	147;289;303;318;348	B4DXW4;F8W7P6;E7EWN6;Q9H078-2;Q9H078	.;.;.;.;CLPB_HUMAN	V	348;318;353;289;303;147	ENSP00000294053:I348V;ENSP00000441518:I318V;ENSP00000443822:I353V;ENSP00000340385:I289V;ENSP00000407296:I303V;ENSP00000439746:I147V	ENSP00000294053:I348V	I	-	1	0	CLPB	71705834	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.404000	0.66344	2.178000	0.69098	0.533000	0.62120	ATT		0.612	CLPB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000396889.1	NM_030813		55	143	0	0	0	0.00361	0	55	143				
ROBO3	64221	broad.mit.edu	37	11	124744018	124744018	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr11:124744018A>G	ENST00000397801.1	+	12	2029	c.1837A>G	c.(1837-1839)Aca>Gca	p.T613A	ROBO3_ENST00000538940.1_Missense_Mutation_p.T591A	NM_022370.3	NP_071765.2	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3 (Drosophila)	613	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|neuron migration (GO:0001764)	axon (GO:0030424)|integral component of membrane (GO:0016021)		p.T613A(2)		breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	35	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		GCAGCTGGAGACACACACAGT	0.587																																							uc001qbc.2		NA																	2	Substitution - Missense(2)		lung(2)	breast(1)|central_nervous_system(1)	2						c.(1837-1839)ACA>GCA		roundabout, axon guidance receptor, homolog 3							157.0	160.0	159.0					11																	124744018		2158	4258	6416	SO:0001583	missense	64221				axon midline choice point recognition	integral to membrane	receptor activity	g.chr11:124744018A>G	AK024697	CCDS44755.1	11q24	2013-02-11	2001-11-28		ENSG00000154134	ENSG00000154134		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13433	protein-coding gene	gene with protein product		608630	"""roundabout (axon guidance receptor, Drosophila) homolog 3"", ""horizontal gaze palsy with progressive scoliosis"""	HGPPS		15105459	Standard	NM_022370		Approved	RBIG1, FLJ21044, HGPS	uc001qbc.3	Q96MS0	OTTHUMG00000165934	ENST00000397801.1:c.1837A>G	11.37:g.124744018A>G	ENSP00000380903:p.Thr613Ala					ROBO3_uc010saq.1_5'Flank|ROBO3_uc001qbd.2_5'Flank|ROBO3_uc010sar.1_5'Flank|ROBO3_uc001qbe.2_5'Flank	p.T613A	NM_022370	NP_071765	Q96MS0	ROBO3_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)	12	2029	+	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)	613			Fibronectin type-III 1.|Extracellular (Potential).			Missense_Mutation	SNP	ENST00000397801.1	37	c.1837A>G	CCDS44755.1	.	.	.	.	.	.	.	.	.	.	A	15.39	2.820792	0.50633	.	.	ENSG00000154134	ENST00000397801;ENST00000538940	T;T	0.58506	0.33;0.33	5.33	5.33	0.75918	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.39341	N	0.001397	T	0.58177	0.2104	L	0.58101	1.795	0.29677	N	0.841995	B	0.29188	0.236	B	0.37989	0.262	T	0.56565	-0.7958	10	0.22706	T	0.39	.	14.4095	0.67106	1.0:0.0:0.0:0.0	.	613	Q96MS0	ROBO3_HUMAN	A	613;591	ENSP00000380903:T613A;ENSP00000441797:T591A	ENSP00000380903:T613A	T	+	1	0	ROBO3	124249228	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.074000	0.71253	2.239000	0.73571	0.533000	0.62120	ACA		0.587	ROBO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387091.1	XM_370663		49	209	0	0	0	0.00361	0	49	209				
GRIN2B	2904	broad.mit.edu	37	12	13715944	13715944	+	Missense_Mutation	SNP	T	T	G			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr12:13715944T>G	ENST00000609686.1	-	13	4437	c.4228A>C	c.(4228-4230)Acg>Ccg	p.T1410P		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	1410					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.T1410P(1)		NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CCCGCCACCGTGGGCTGCCTG	0.632																																							uc001rbt.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12						c.(4228-4230)ACG>CCG		N-methyl-D-aspartate receptor subunit 2B	Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)						35.0	36.0	36.0					12																	13715944		2203	4300	6503	SO:0001583	missense	2904				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding	g.chr12:13715944T>G		CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.4228A>C	12.37:g.13715944T>G	ENSP00000477455:p.Thr1410Pro						p.T1410P	NM_000834	NP_000825	Q13224	NMDE2_HUMAN			13	4407	-			1410			Cytoplasmic (Potential).		Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Missense_Mutation	SNP	ENST00000609686.1	37	c.4228A>C	CCDS8662.1	.	.	.	.	.	.	.	.	.	.	T	10.49	1.363540	0.24684	.	.	ENSG00000150086	ENST00000279593	T	0.11277	2.79	5.16	2.7	0.31948	Glutamate [NMDA] receptor, epsilon subunit, C-terminal (1);	0.446619	0.24213	N	0.040510	T	0.04048	0.0113	N	0.03608	-0.345	0.30785	N	0.741589	B	0.26041	0.14	B	0.28465	0.09	T	0.18967	-1.0320	10	0.42905	T	0.14	.	2.3726	0.04334	0.4009:0.1675:0.0:0.4316	.	1410	Q13224	NMDE2_HUMAN	P	1410	ENSP00000279593:T1410P	ENSP00000279593:T1410P	T	-	1	0	GRIN2B	13607211	1.000000	0.71417	0.991000	0.47740	0.977000	0.68977	2.264000	0.43302	0.378000	0.24764	0.496000	0.49642	ACG		0.632	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268014.2			27	35	0	0	0	0.009535	0	27	35				
SLCO1A2	6579	broad.mit.edu	37	12	21457403	21457403	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr12:21457403T>C	ENST00000307378.6	-	7	1267	c.547A>G	c.(547-549)Ata>Gta	p.I183V	SLCO1A2_ENST00000458504.1_Missense_Mutation_p.I51V|SLCO1A2_ENST00000452078.1_Missense_Mutation_p.I183V|SLCO1A2_ENST00000390670.3_Missense_Mutation_p.I181V|SLCO1A2_ENST00000537524.1_Missense_Mutation_p.I51V	NM_134431.3	NP_602307.1	P46721	SO1A2_HUMAN	solute carrier organic anion transporter family, member 1A2	183					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)	p.I183V(1)		breast(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(6)|upper_aerodigestive_tract(1)	48					Aminohippurate(DB00345)|Atorvastatin(DB01076)|Bumetanide(DB00887)|Chlorambucil(DB00291)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dexamethasone(DB01234)|Digitoxin(DB01396)|Digoxin(DB00390)|Dinoprostone(DB00917)|Enalapril(DB00584)|Erythromycin(DB00199)|Estradiol(DB00783)|Estriol(DB04573)|Estrone(DB00655)|Fexofenadine(DB00950)|Glyburide(DB01016)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Indinavir(DB00224)|Indomethacin(DB00328)|Ketoconazole(DB01026)|Ketoprofen(DB01009)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Lovastatin(DB00227)|Methotrexate(DB00563)|Methyltestosterone(DB06710)|Mirabegron(DB08893)|Naloxone(DB01183)|Naproxen(DB00788)|Nelfinavir(DB00220)|Ouabain(DB01092)|Pravastatin(DB00175)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Quinidine(DB00908)|Quinine(DB00468)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rocuronium(DB00728)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Simvastatin(DB00641)|Spironolactone(DB00421)|Sumatriptan(DB00669)|Tauroursodeoxycholic acid(DB08834)|Testosterone(DB00624)|Tolbutamide(DB01124)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)	AAATCTTCTATATAGGAAATA	0.363																																							uc001rer.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|pancreas(1)|ovary(1)|skin(1)	4						c.(547-549)ATA>GTA		organic anion transporting polypeptide A							64.0	65.0	65.0					12																	21457403		2203	4300	6503	SO:0001583	missense	6579				bile acid metabolic process|sodium-independent organic anion transport	integral to membrane|plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity	g.chr12:21457403T>C		CCDS8686.1	12p12	2013-05-22	2003-11-25	2003-11-26	ENSG00000084453	ENSG00000084453		"""Solute carriers"""	10956	protein-coding gene	gene with protein product		602883	"""solute carrier family 21 (organic anion transporter), member 3"""	SLC21A3		9007731	Standard	NM_134431		Approved	OATP, OATP1A2, OATP-A	uc001rer.3	P46721	OTTHUMG00000156259	ENST00000307378.6:c.547A>G	12.37:g.21457403T>C	ENSP00000305974:p.Ile183Val					SLCO1A2_uc001res.2_Missense_Mutation_p.I183V|SLCO1A2_uc010siq.1_Missense_Mutation_p.I51V|SLCO1A2_uc010sio.1_Missense_Mutation_p.I51V|SLCO1A2_uc010sip.1_Missense_Mutation_p.I51V|SLCO1A2_uc001ret.2_Missense_Mutation_p.I181V|SLCO1A2_uc001reu.2_Missense_Mutation_p.I163V	p.I183V	NM_021094	NP_066580	P46721	SO1A2_HUMAN			5	798	-			183			Helical; Name=4; (Potential).		Q9UGP7|Q9UL38	Missense_Mutation	SNP	ENST00000307378.6	37	c.547A>G	CCDS8686.1	.	.	.	.	.	.	.	.	.	.	T	12.72	2.023260	0.35701	.	.	ENSG00000084453	ENST00000307378;ENST00000452078;ENST00000458504;ENST00000537524;ENST00000390670	T;T;T;T;T	0.48836	0.8;0.8;0.8;0.8;0.8	4.75	2.37	0.29283	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.268917	0.36854	N	0.002372	T	0.46151	0.1378	L	0.55213	1.73	0.28067	N	0.932744	B;B;P	0.40376	0.407;0.354;0.715	B;B;P	0.50754	0.217;0.138;0.649	T	0.40270	-0.9572	10	0.40728	T	0.16	.	0.8828	0.01238	0.1588:0.2579:0.145:0.4383	.	163;181;183	Q8IV69;P46721-2;P46721	.;.;SO1A2_HUMAN	V	183;183;51;51;181	ENSP00000305974:I183V;ENSP00000393973:I183V;ENSP00000394854:I51V;ENSP00000439401:I51V;ENSP00000375088:I181V	ENSP00000305974:I183V	I	-	1	0	SLCO1A2	21348670	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	1.835000	0.39181	0.324000	0.23333	0.482000	0.46254	ATA		0.363	SLCO1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343648.3	NM_021094		33	43	0	0	0	0.012213	0	33	43				
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	A	rs121913530		TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr12:25398285C>A	ENST00000256078.4	-	2	97	c.34G>T	c.(34-36)Ggt>Tgt	p.G12C	KRAS_ENST00000556131.1_Missense_Mutation_p.G12C|KRAS_ENST00000311936.3_Missense_Mutation_p.G12C|KRAS_ENST00000557334.1_Missense_Mutation_p.G12C	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1	G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12C(CALU1_LUNG)|G12C(NCIH2030_LUNG)|G12C(LU99_LUNG)|G12C(NCIH1792_LUNG)|G12R(KP2_PANCREAS)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(NCIH2122_LUNG)|G12C(NCIH358_LUNG)|G12R(PSN1_PANCREAS)|G12C(KYSE410_OESOPHAGUS)|G12S(A549_LUNG)|G12R(HUPT3_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12C(HCC44_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(SW1463_LARGE_INTESTINE)|G12C(NCIH23_LUNG)|G12C(LU65_LUNG)|G12C(NCIH1373_LUNG)|G12C(MIAPACA2_PANCREAS)|G12R(HS274T_BREAST)|G12S(LS123_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(OV56_OVARY)|G12C(IALM_LUNG)	119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		5144	Substitution - Missense(5142)|Insertion - In frame(2)	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12G(6)|p.G12N(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)GGT>TGT		c-K-ras2 protein isoform a precursor							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25398285C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>T	12.37:g.25398285C>A	ENSP00000256078:p.Gly12Cys	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_uc001rgq.1_Missense_Mutation_p.G12C|KRAS_uc001rgr.2_RNA	p.G12C	NM_033360	NP_203524	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		2	215	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		12		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).	GTP.		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	c.34G>T	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676185	0.88445	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90466	0.7014	M	0.90650	3.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	D	0.91833	0.5477	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	C	12	ENSP00000308495:G12C;ENSP00000452512:G12C;ENSP00000256078:G12C;ENSP00000451856:G12C	ENSP00000256078:G12C	G	-	1	0	KRAS	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		4	8	1	0	0.00307968	0.00308	0.00322087	4	8				
ANO6	196527	broad.mit.edu	37	12	45795743	45795743	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr12:45795743A>G	ENST00000320560.8	+	13	1754	c.1552A>G	c.(1552-1554)Ata>Gta	p.I518V	ANO6_ENST00000425752.2_Missense_Mutation_p.I518V|ANO6_ENST00000426898.2_3'UTR|ANO6_ENST00000435642.1_Missense_Mutation_p.I518V|ANO6_ENST00000423947.3_Missense_Mutation_p.I539V|ANO6_ENST00000441606.2_Missense_Mutation_p.I500V	NM_001025356.2	NP_001020527.2	Q4KMQ2	ANO6_HUMAN	anoctamin 6	518					activation of blood coagulation via clotting cascade (GO:0002543)|blood coagulation (GO:0007596)|bone mineralization involved in bone maturation (GO:0035630)|calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|phosphatidylserine exposure on blood platelet (GO:0097045)|phospholipid scrambling (GO:0017121)|positive regulation of endothelial cell apoptotic process (GO:2000353)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)	cell surface (GO:0009986)|chloride channel complex (GO:0034707)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)|voltage-gated chloride channel activity (GO:0005247)|voltage-gated ion channel activity (GO:0005244)	p.I518V(2)		central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	46						CATCAGCTTTATAATTATCAT	0.388																																							uc001roo.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|kidney(1)	2						c.(1552-1554)ATA>GTA		anoctamin 6 isoform a							115.0	111.0	112.0					12																	45795743		2203	4300	6503	SO:0001583	missense	196527				activation of blood coagulation via clotting cascade|phosphatidylserine exposure on blood platelet	chloride channel complex|plasma membrane	chloride channel activity	g.chr12:45795743A>G	AL832340	CCDS31782.1, CCDS44865.1, CCDS44866.1, CCDS55819.1	12q12-q13.11	2014-09-17	2008-08-28	2008-08-28				"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	25240	protein-coding gene	gene with protein product		608663	"""transmembrane protein 16F"""	TMEM16F		15067359, 24692353	Standard	NM_001025356		Approved	DKFZp313M0720	uc010slf.2	Q4KMQ2	OTTHUMG00000169564	ENST00000320560.8:c.1552A>G	12.37:g.45795743A>G	ENSP00000320087:p.Ile518Val					ANO6_uc010sld.1_Missense_Mutation_p.I518V|ANO6_uc010sle.1_Missense_Mutation_p.I518V|ANO6_uc010slf.1_Missense_Mutation_p.I539V|ANO6_uc010slg.1_Missense_Mutation_p.I500V	p.I518V	NM_001025356	NP_001020527	Q4KMQ2	ANO6_HUMAN			13	1887	+			518			Helical; (Potential).		A6NNM6|B9EGG0|E7ENK4|E9PB30|E9PCT2|Q8N3Q2	Missense_Mutation	SNP	ENST00000320560.8	37	c.1552A>G	CCDS31782.1	.	.	.	.	.	.	.	.	.	.	A	1.788	-0.480112	0.04383	.	.	ENSG00000177119	ENST00000425752;ENST00000423947;ENST00000435642;ENST00000320560;ENST00000441606	T;T;T;T;T	0.61859	0.07;0.07;0.07;0.07;0.07	4.98	2.6	0.31112	.	0.259337	0.38837	N	0.001550	T	0.37461	0.1004	N	0.26162	0.8	0.46149	D	0.998897	B;B;B;B	0.14438	0.01;0.003;0.003;0.001	B;B;B;B	0.19148	0.022;0.024;0.01;0.018	T	0.11542	-1.0583	10	0.07325	T	0.83	.	9.5706	0.39425	0.7873:0.0:0.2127:0.0	.	500;539;518;518	E9PB30;B9EGG0;E9PCT2;Q4KMQ2	.;.;.;ANO6_HUMAN	V	518;539;518;518;500	ENSP00000391417:I518V;ENSP00000409126:I539V;ENSP00000413840:I518V;ENSP00000320087:I518V;ENSP00000413137:I500V	ENSP00000320087:I518V	I	+	1	0	ANO6	44082010	0.939000	0.31865	0.824000	0.32777	0.860000	0.49131	1.946000	0.40283	0.440000	0.26502	0.533000	0.62120	ATA		0.388	ANO6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404822.1	XM_113743		20	133	0	0	0	0.008871	0	20	133				
SP7	121340	broad.mit.edu	37	12	53722173	53722173	+	Silent	SNP	C	C	T	rs137853893		TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr12:53722173C>T	ENST00000536324.2	-	3	1336	c.1053G>A	c.(1051-1053)gaG>gaA	p.E351E	SP7_ENST00000303846.3_Silent_p.E351E|SP7_ENST00000537210.2_Silent_p.E333E	NM_001173467.1	NP_001166938.1	Q8TDD2	SP7_HUMAN	Sp7 transcription factor	351					hematopoietic stem cell differentiation (GO:0060218)|osteoblast differentiation (GO:0001649)|positive regulation of stem cell differentiation (GO:2000738)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DEAD/H-box RNA helicase binding (GO:0017151)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E351E(1)		cervix(2)|large_intestine(3)|lung(7)|skin(1)|urinary_tract(1)	14						TGAACTTCTTCTCCCGGGTGT	0.617											OREG0021867	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001sct.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1051-1053)GAG>GAA		osterix							54.0	63.0	60.0					12																	53722173		2200	4298	6498	SO:0001819	synonymous_variant	121340				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr12:53722173C>T	AF477981	CCDS44897.1, CCDS73475.1	12q13.13	2013-01-08				ENSG00000170374		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	17321	protein-coding gene	gene with protein product		606633				11792318	Standard	NM_152860		Approved	osterix, OSX	uc001sct.3	Q8TDD2		ENST00000536324.2:c.1053G>A	12.37:g.53722173C>T			OREG0021867	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	994	SP7_uc001scu.2_Silent_p.E333E|SP7_uc001scv.2_Silent_p.E351E	p.E351E	NM_152860	NP_690599	Q8TDD2	SP7_HUMAN			2	1160	-			351					B3KY26|Q3MJ72|Q7Z718	Silent	SNP	ENST00000536324.2	37	c.1053G>A	CCDS44897.1																																																																																				0.617	SP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406917.1			46	69	0	0	0	0.00361	0	46	69				
MAP3K12	7786	broad.mit.edu	37	12	53875772	53875772	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr12:53875772C>T	ENST00000267079.2	-	14	2659	c.2434G>A	c.(2434-2436)Gaa>Aaa	p.E812K	MAP3K12_ENST00000547488.1_Missense_Mutation_p.E845K|MAP3K12_ENST00000547035.1_Missense_Mutation_p.E845K	NM_001193511.1|NM_006301.3	NP_001180440.1|NP_006292.3	Q12852	M3K12_HUMAN	mitogen-activated protein kinase kinase kinase 12	812					histone phosphorylation (GO:0016572)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)	p.E845K(1)|p.E812K(1)		NS(2)|breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	37						GAGCTGGGTTCAGGGCCAGGG	0.562											OREG0021873	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001sdm.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(2)|ovary(1)|breast(1)|skin(1)	5						c.(2434-2436)GAA>AAA		mitogen-activated protein kinase kinase kinase							84.0	79.0	81.0					12																	53875772		2203	4300	6503	SO:0001583	missense	7786				histone phosphorylation|JNK cascade|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|protein autophosphorylation	cytosol|membrane fraction|plasma membrane	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein kinase binding	g.chr12:53875772C>T	U07358	CCDS8860.1, CCDS55831.1	12q13.13	2013-10-30			ENSG00000139625	ENSG00000139625		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6851	protein-coding gene	gene with protein product	"""dual leucine zipper kinase DLK"""	600447		ZPK		8037767	Standard	NM_006301		Approved	MUK, DLK, ZPKP1, MEKK12	uc001sdn.2	Q12852	OTTHUMG00000169854	ENST00000267079.2:c.2434G>A	12.37:g.53875772C>T	ENSP00000267079:p.Glu812Lys		OREG0021873	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	996	MAP3K12_uc001sdn.1_Missense_Mutation_p.E845K	p.E812K	NM_006301	NP_006292	Q12852	M3K12_HUMAN			14	2532	-			812					B3KSS9|G3V1Y2|Q86VQ5|Q8WY25	Missense_Mutation	SNP	ENST00000267079.2	37	c.2434G>A	CCDS8860.1	.	.	.	.	.	.	.	.	.	.	C	11.15	1.553304	0.27739	.	.	ENSG00000139625	ENST00000267079;ENST00000547488;ENST00000547035	T;T;T	0.56776	0.44;0.44;0.44	3.98	3.98	0.46160	.	0.301827	0.24056	N	0.041942	T	0.21186	0.0510	N	0.00554	-1.385	0.38401	D	0.945661	B;B	0.17038	0.02;0.012	B;B	0.08055	0.003;0.002	T	0.20874	-1.0262	10	0.87932	D	0	.	11.8566	0.52441	0.0:1.0:0.0:0.0	.	845;812	G3V1Y2;Q12852	.;M3K12_HUMAN	K	812;845;845	ENSP00000267079:E812K;ENSP00000449038:E845K;ENSP00000448689:E845K	ENSP00000267079:E812K	E	-	1	0	MAP3K12	52162039	1.000000	0.71417	0.528000	0.27938	0.030000	0.12068	2.003000	0.40844	2.526000	0.85167	0.491000	0.48974	GAA		0.562	MAP3K12-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406267.1	NM_006301		71	114	0	0	0	0.00361	0	71	114				
MAP3K12	7786	broad.mit.edu	37	12	53876414	53876414	+	Silent	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr12:53876414G>T	ENST00000267079.2	-	12	2299	c.2074C>A	c.(2074-2076)Cgg>Agg	p.R692R	MAP3K12_ENST00000547488.1_Silent_p.R725R|MAP3K12_ENST00000547035.1_Silent_p.R725R	NM_001193511.1|NM_006301.3	NP_001180440.1|NP_006292.3	Q12852	M3K12_HUMAN	mitogen-activated protein kinase kinase kinase 12	692					histone phosphorylation (GO:0016572)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)	p.R692R(1)|p.R725R(1)		NS(2)|breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	37						GACCCAGCCCGGCTTCCTCCC	0.627																																							uc001sdm.1		NA																	2	Substitution - coding silent(2)		lung(2)	lung(2)|ovary(1)|breast(1)|skin(1)	5						c.(2074-2076)CGG>AGG		mitogen-activated protein kinase kinase kinase							63.0	72.0	69.0					12																	53876414		2201	4298	6499	SO:0001819	synonymous_variant	7786				histone phosphorylation|JNK cascade|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|protein autophosphorylation	cytosol|membrane fraction|plasma membrane	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein kinase binding	g.chr12:53876414G>T	U07358	CCDS8860.1, CCDS55831.1	12q13.13	2013-10-30			ENSG00000139625	ENSG00000139625		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6851	protein-coding gene	gene with protein product	"""dual leucine zipper kinase DLK"""	600447		ZPK		8037767	Standard	NM_006301		Approved	MUK, DLK, ZPKP1, MEKK12	uc001sdn.2	Q12852	OTTHUMG00000169854	ENST00000267079.2:c.2074C>A	12.37:g.53876414G>T						MAP3K12_uc001sdn.1_Silent_p.R725R	p.R692R	NM_006301	NP_006292	Q12852	M3K12_HUMAN			12	2172	-			692					B3KSS9|G3V1Y2|Q86VQ5|Q8WY25	Silent	SNP	ENST00000267079.2	37	c.2074C>A	CCDS8860.1																																																																																				0.627	MAP3K12-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406267.1	NM_006301		124	195	1	0	9.48018e-61	0.00361	1.57285e-60	124	195				
PPM1H	57460	broad.mit.edu	37	12	63042381	63042381	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr12:63042381G>T	ENST00000228705.6	-	10	1733	c.1433C>A	c.(1432-1434)gCc>gAc	p.A478D	snoU13_ENST00000459527.1_RNA|PPM1H_ENST00000551214.1_5'UTR	NM_020700.1	NP_065751.1	Q9ULR3	PPM1H_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1H	478	PP2C-like.						phosphoprotein phosphatase activity (GO:0004721)	p.A478D(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)	18			GBM - Glioblastoma multiforme(1;0.000443)|BRCA - Breast invasive adenocarcinoma(9;0.209)	GBM - Glioblastoma multiforme(28;0.0126)		CACACCCCGGGCACGCATCAC	0.517																																							uc001srk.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|ovary(1)	4						c.(1432-1434)GCC>GAC		protein phosphatase 1H (PP2C domain containing)							57.0	61.0	59.0					12																	63042381		2096	4237	6333	SO:0001583	missense	57460						phosphoprotein phosphatase activity	g.chr12:63042381G>T	AB032983	CCDS44934.1	12q14.1	2012-04-17	2010-03-05	2004-03-26	ENSG00000111110	ENSG00000111110	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	18583	protein-coding gene	gene with protein product	"""neurite extension-related protein phosphatase related to PP2C"""		"""ras homolog gene family, member C like 1"", ""protein phosphatase 1H (PP2C domain containing)"""	ARHCL1			Standard	NM_020700		Approved	KIAA1157, FLJ13253, NERPP-2C	uc001srk.3	Q9ULR3	OTTHUMG00000169990	ENST00000228705.6:c.1433C>A	12.37:g.63042381G>T	ENSP00000228705:p.Ala478Asp						p.A478D	NM_020700	NP_065751	Q9ULR3	PPM1H_HUMAN	GBM - Glioblastoma multiforme(1;0.000443)|BRCA - Breast invasive adenocarcinoma(9;0.209)	GBM - Glioblastoma multiforme(28;0.0126)	10	1582	-			478			PP2C-like.		B1Q2A9|B2RXG4|Q6PI86	Missense_Mutation	SNP	ENST00000228705.6	37	c.1433C>A	CCDS44934.1	.	.	.	.	.	.	.	.	.	.	G	36	5.737565	0.96865	.	.	ENSG00000111110	ENST00000228705	T	0.32023	1.47	5.93	5.93	0.95920	Protein phosphatase 2C-like (4);	0.047540	0.85682	D	0.000000	T	0.70979	0.3286	H	0.96111	3.77	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.79860	-0.1625	9	.	.	.	-0.0043	20.3507	0.98813	0.0:0.0:1.0:0.0	.	478	Q9ULR3	PPM1H_HUMAN	D	478	ENSP00000228705:A478D	.	A	-	2	0	PPM1H	61328648	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	9.117000	0.94347	2.808000	0.96608	0.655000	0.94253	GCC		0.517	PPM1H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406760.2	NM_020700		17	63	1	0	1.96292e-10	0.010504	2.3568e-10	17	63				
GRIP1	23426	broad.mit.edu	37	12	66786504	66786504	+	Missense_Mutation	SNP	T	T	G			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr12:66786504T>G	ENST00000398016.3	-	17	2134	c.2066A>C	c.(2065-2067)cAg>cCg	p.Q689P	GRIP1_ENST00000359742.4_Missense_Mutation_p.Q741P|GRIP1_ENST00000286445.7_Missense_Mutation_p.Q741P|GRIP1_ENST00000542021.1_5'Flank	NM_021150.3	NP_066973.2	Q96DT0	LEG12_HUMAN	glutamate receptor interacting protein 1	0					intrinsic apoptotic signaling pathway (GO:0097193)	nucleus (GO:0005634)	lactose binding (GO:0030395)	p.Q689P(1)		NS(3)|breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(19)|ovary(2)|prostate(2)|skin(1)	50			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		TCCTGCCATCTGTAACAAATG	0.438																																							uc001stk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(2065-2067)CAG>CCG		glutamate receptor interacting protein 1							165.0	153.0	157.0					12																	66786504		1882	4115	5997	SO:0001583	missense	23426				androgen receptor signaling pathway|intracellular signal transduction|positive regulation of transcription, DNA-dependent|synaptic transmission	cell junction|cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|postsynaptic membrane	androgen receptor binding|beta-catenin binding|protein C-terminus binding|receptor signaling complex scaffold activity|transcription coactivator activity	g.chr12:66786504T>G	AJ133439	CCDS41807.1	12q13.13	2008-05-02			ENSG00000155974	ENSG00000155974			18708	protein-coding gene	gene with protein product		604597				10197531	Standard	NM_021150		Approved		uc001stk.3	Q9Y3R0	OTTHUMG00000169019	ENST00000398016.3:c.2066A>C	12.37:g.66786504T>G	ENSP00000381098:p.Gln689Pro					GRIP1_uc010sta.1_Missense_Mutation_p.Q633P|GRIP1_uc001stj.2_Missense_Mutation_p.Q471P|GRIP1_uc001stl.1_Missense_Mutation_p.Q581P|GRIP1_uc001stm.2_Missense_Mutation_p.Q689P	p.Q689P	NM_021150	NP_066973	Q9Y3R0	GRIP1_HUMAN	GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)	17	2307	-			741			PDZ 6.		B2R9N2|G5E970|Q96DS9|Q96PR9|Q9H258|Q9H259|Q9NZ02	Missense_Mutation	SNP	ENST00000398016.3	37	c.2066A>C	CCDS41807.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.298620	0.81025	.	.	ENSG00000155974	ENST00000398016;ENST00000359742;ENST00000286445;ENST00000538211;ENST00000540433;ENST00000536215	T;T;T;T;T;T	0.28069	1.63;1.63;1.63;1.63;1.63;1.63	4.9	4.9	0.64082	PDZ/DHR/GLGF (4);	0.111526	0.64402	D	0.000005	T	0.61825	0.2378	M	0.90542	3.125	0.80722	D	1	D;D;D;D	0.67145	0.991;0.993;0.995;0.996	D;P;D;D	0.70716	0.926;0.904;0.97;0.92	T	0.70641	-0.4816	9	.	.	.	-13.7308	15.0044	0.71501	0.0:0.0:0.0:1.0	.	689;741;689;741	F5H4N6;Q9Y3R0;Q9Y3R0-3;Q9Y3R0-2	.;GRIP1_HUMAN;.;.	P	689;741;741;689;633;581	ENSP00000381098:Q689P;ENSP00000352780:Q741P;ENSP00000286445:Q741P;ENSP00000446047:Q689P;ENSP00000446024:Q633P;ENSP00000446011:Q581P	.	Q	-	2	0	GRIP1	65072771	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.868000	0.87116	2.202000	0.70862	0.379000	0.24179	CAG		0.438	GRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401975.2			28	169	0	0	0	0.012213	0	28	169				
LGR5	8549	broad.mit.edu	37	12	71978097	71978097	+	Silent	SNP	C	C	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr12:71978097C>T	ENST00000266674.5	+	18	2618	c.2307C>T	c.(2305-2307)gcC>gcT	p.A769A	LGR5_ENST00000540815.2_Silent_p.A745A|LGR5_ENST00000536515.1_Silent_p.A697A|RP11-186F10.2_ENST00000546601.1_RNA			O75473	LGR5_HUMAN	leucine-rich repeat containing G protein-coupled receptor 5	769					G-protein coupled receptor signaling pathway (GO:0007186)|inner ear development (GO:0048839)|positive regulation of canonical Wnt signaling pathway (GO:0090263)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)	p.A769A(1)	NUP107/LGR5(2)	endometrium(2)|kidney(3)|large_intestine(2)|lung(24)|ovary(1)|pancreas(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	48						AACACATTGCCCTGTTGCTCT	0.433																																							uc001swl.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(4)|skin(3)|ovary(1)|pancreas(1)	9						c.(2305-2307)GCC>GCT		leucine-rich repeat-containing G protein-coupled							148.0	144.0	146.0					12																	71978097		2203	4300	6503	SO:0001819	synonymous_variant	8549					integral to plasma membrane	protein-hormone receptor activity	g.chr12:71978097C>T	AF062006	CCDS9000.1, CCDS61194.1, CCDS61195.1	12q22-q23	2012-08-21	2011-01-25	2004-11-12				"""GPCR / Class A : Orphans"""	4504	protein-coding gene	gene with protein product		606667	"""G protein-coupled receptor 49"", ""leucine-rich repeat-containing G protein-coupled receptor 5"""	GPR67, GPR49		9642114	Standard	NM_003667		Approved	HG38, FEX	uc001swl.4	O75473	OTTHUMG00000169543	ENST00000266674.5:c.2307C>T	12.37:g.71978097C>T						LGR5_uc001swm.2_Silent_p.A745A|LGR5_uc001swn.1_Intron	p.A769A	NM_003667	NP_003658	O75473	LGR5_HUMAN			18	2355	+			769			Helical; Name=6; (Potential).		D8MCT0|Q4VAM0|Q4VAM2|Q9UP75	Silent	SNP	ENST00000266674.5	37	c.2307C>T	CCDS9000.1	.	.	.	.	.	.	.	.	.	.	C	6.685	0.495067	0.12762	.	.	ENSG00000139292	ENST00000451585	.	.	.	5.85	-11.7	0.00046	.	.	.	.	.	T	0.39886	0.1095	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50242	-0.8851	5	0.12766	T	0.61	.	12.05	0.53501	0.0783:0.6226:0.1578:0.1413	.	.	.	.	S	749	.	ENSP00000414152:P749S	P	+	1	0	LGR5	70264364	0.535000	0.26370	0.021000	0.16686	0.976000	0.68499	-0.180000	0.09754	-2.925000	0.00303	0.655000	0.94253	CCT		0.433	LGR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404744.1	NM_003667		104	143	0	0	0	0.00361	0	104	143				
USP44	84101	broad.mit.edu	37	12	95927916	95927916	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr12:95927916C>A	ENST00000258499.3	-	2	405	c.117G>T	c.(115-117)tgG>tgT	p.W39C	USP44_ENST00000537435.2_Missense_Mutation_p.W39C|USP44_ENST00000552440.1_Missense_Mutation_p.W39C|USP44_ENST00000393091.2_Missense_Mutation_p.W39C	NM_001278393.1|NM_032147.2	NP_001265322.1|NP_115523.2	Q9H0E7	UBP44_HUMAN	ubiquitin specific peptidase 44	39					mitotic nuclear division (GO:0007067)|negative regulation of mitotic anaphase-promoting complex activity (GO:0060564)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein deubiquitination (GO:0016579)|regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090266)|regulation of spindle checkpoint (GO:0090231)	nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.W39C(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(5)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	36						TAAGGCAAGCCCAAATGGACT	0.507											OREG0022039	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001teg.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|breast(1)|central_nervous_system(1)	3						c.(115-117)TGG>TGT		ubiquitin thiolesterase 44							158.0	130.0	140.0					12																	95927916		2203	4300	6503	SO:0001583	missense	84101				anaphase|cell division|mitosis|negative regulation of mitotic anaphase-promoting complex activity|protein deubiquitination|regulation of spindle checkpoint|ubiquitin-dependent protein catabolic process	nucleus	protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding	g.chr12:95927916C>A	AK027434	CCDS9053.1	12q21.33	2005-08-08	2005-08-08			ENSG00000136014		"""Ubiquitin-specific peptidases"""	20064	protein-coding gene	gene with protein product		610993	"""ubiquitin specific protease 44"""			12838346	Standard	NM_001278393		Approved	FLJ14528	uc001teg.3	Q9H0E7		ENST00000258499.3:c.117G>T	12.37:g.95927916C>A	ENSP00000258499:p.Trp39Cys		OREG0022039	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1316	USP44_uc001teh.2_Missense_Mutation_p.W39C|USP44_uc009zte.2_Missense_Mutation_p.W36C	p.W39C	NM_001042403	NP_001035862	Q9H0E7	UBP44_HUMAN			2	261	-			39			UBP-type.		B2RDW3	Missense_Mutation	SNP	ENST00000258499.3	37	c.117G>T	CCDS9053.1	.	.	.	.	.	.	.	.	.	.	C	16.43	3.120557	0.56613	.	.	ENSG00000136014	ENST00000258499;ENST00000393091;ENST00000552440;ENST00000537435;ENST00000551837;ENST00000549639	T;T;T;T;T;T	0.64803	-0.12;-0.12;-0.12;-0.12;-0.12;-0.12	5.27	4.37	0.52481	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, UBP-type (3);	0.000000	0.85682	D	0.000000	D	0.85831	0.5788	H	0.97390	3.995	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90562	0.4516	10	0.87932	D	0	.	14.0039	0.64451	0.0:0.9267:0.0:0.0733	.	39	Q9H0E7	UBP44_HUMAN	C	39	ENSP00000258499:W39C;ENSP00000376806:W39C;ENSP00000448670:W39C;ENSP00000442629:W39C;ENSP00000448601:W39C;ENSP00000449635:W39C	ENSP00000258499:W39C	W	-	3	0	USP44	94452047	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.744000	0.68664	1.352000	0.45808	0.561000	0.74099	TGG		0.507	USP44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408312.1	NM_032147		28	125	1	0	2.65835e-16	0.007291	3.59369e-16	28	125				
SVOP	55530	broad.mit.edu	37	12	109332689	109332689	+	Silent	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr12:109332689G>T	ENST00000299134.5	-	7	614	c.615C>A	c.(613-615)acC>acA	p.T205T		NM_018711.2	NP_061181.1	Q8N4V2	SVOP_HUMAN	SV2 related protein homolog (rat)	0						cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	ion transmembrane transporter activity (GO:0015075)	p.N205K(2)		breast(2)|lung(4)	6						GCCTTTTCCTGGTTCCCTGAC	0.557																																							uc010sxh.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(811-813)CAG>AAG		SV2 related protein							236.0	236.0	236.0					12																	109332689		2051	4193	6244	SO:0001819	synonymous_variant	55530					cell junction|integral to membrane|synaptic vesicle membrane	ion transmembrane transporter activity	g.chr12:109332689G>T	BC033587	CCDS73520.1	12q24.11	2011-07-12				ENSG00000166111			25417	protein-coding gene	gene with protein product		611699					Standard	NM_018711		Approved	DKFZp761H039	uc010sxh.1	Q8N4V2		ENST00000299134.5:c.615C>A	12.37:g.109332689G>T							p.Q271K	NM_018711	NP_061181	Q8N4V2	SVOP_HUMAN			8	983	-			271			Cytoplasmic (Potential).		Q9NPW5	Missense_Mutation	SNP	ENST00000299134.5	37	c.811C>A																																																																																					0.557	SVOP-001	KNOWN	mRNA_start_NF|cds_start_NF|basic	protein_coding	protein_coding	OTTHUMT00000403982.1	NM_018711		128	139	1	0	4.09656e-53	0.00361	6.73534e-53	128	139				
HECTD4	283450	broad.mit.edu	37	12	112654685	112654685	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr12:112654685C>A	ENST00000430131.2	-	46	7156	c.6011G>T	c.(6010-6012)gGa>gTa	p.G2004V	HECTD4_ENST00000550722.1_Missense_Mutation_p.G2280V|HECTD4_ENST00000377560.5_Missense_Mutation_p.G2254V			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	2004					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.G2254V(1)|p.G2004V(1)									ATCGGTGTCTCCATAGGAAAC	0.507																																							uc009zwc.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|lung(1)	2						c.(6010-6012)GGA>GTA		chromosome 12 open reading frame 51							87.0	84.0	85.0					12																	112654685		1890	4120	6010	SO:0001583	missense	283450							g.chr12:112654685C>A	AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.6011G>T	12.37:g.112654685C>A	ENSP00000404379:p.Gly2004Val					C12orf51_uc001ttr.1_Missense_Mutation_p.G179V	p.G2004V	NM_001109662	NP_001103132					40	6029	-								L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	ENST00000430131.2	37	c.6011G>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.1|28.1	4.889340|4.889340	0.91889|0.91889	.|.	.|.	ENSG00000173064|ENSG00000173064	ENST00000550968|ENST00000377560;ENST00000430131;ENST00000550722	.|T;T;T	.|0.58060	.|0.36;0.37;0.36	5.81|5.81	5.81|5.81	0.92471|0.92471	.|.	.|.	.|.	.|.	.|.	.|T	.|0.60483	.|0.2272	N|N	0.14661|0.14661	0.345|0.345	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.83275	.|0.996	.|T	.|0.66598	.|-0.5883	.|9	.|0.87932	.|D	.|0	.|.	20.0833|20.0833	0.97789|0.97789	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|2004	.|Q9Y4D8	.|K0614_HUMAN	X|V	171|2254;2004;2280	.|ENSP00000366783:G2254V;ENSP00000404379:G2004V;ENSP00000449784:G2280V	.|ENSP00000366783:G2254V	E|G	-|-	1|2	0|0	C12orf51|C12orf51	111139068|111139068	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.848000|0.848000	0.48234|0.48234	7.487000|7.487000	0.81328|0.81328	2.756000|2.756000	0.94617|0.94617	0.655000|0.655000	0.94253|0.94253	GAG|GGA		0.507	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813		28	121	1	0	8.58068e-18	0.007291	1.18634e-17	28	121				
GCN1L1	10985	broad.mit.edu	37	12	120613618	120613618	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr12:120613618G>C	ENST00000300648.6	-	11	985	c.973C>G	c.(973-975)Ctg>Gtg	p.L325V		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	325					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)	p.L325V(1)		NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TGGCGTGCCAGGTTCCGCAGT	0.572																																							uc001txo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)	4						c.(973-975)CTG>GTG		GCN1 general control of amino-acid synthesis							50.0	52.0	51.0					12																	120613618		2061	4205	6266	SO:0001583	missense	10985				regulation of translation	ribosome	protein binding|translation factor activity, nucleic acid binding	g.chr12:120613618G>C	U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.973C>G	12.37:g.120613618G>C	ENSP00000300648:p.Leu325Val						p.L325V	NM_006836	NP_006827	Q92616	GCN1L_HUMAN			11	986	-	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)		325			HEAT 2.		A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Missense_Mutation	SNP	ENST00000300648.6	37	c.973C>G	CCDS41847.1	.	.	.	.	.	.	.	.	.	.	G	18.07	3.541374	0.65085	.	.	ENSG00000089154	ENST00000300648	T	0.08102	3.13	5.66	3.85	0.44370	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000001	T	0.09992	0.0245	M	0.68317	2.08	0.80722	D	1	P	0.48503	0.911	B	0.39840	0.311	T	0.08743	-1.0707	10	0.41790	T	0.15	-1.2045	8.6074	0.33782	0.287:0.0:0.713:0.0	.	325	Q92616	GCN1L_HUMAN	V	325	ENSP00000300648:L325V	ENSP00000300648:L325V	L	-	1	2	GCN1L1	119098001	1.000000	0.71417	1.000000	0.80357	0.844000	0.47949	3.850000	0.55918	0.761000	0.33130	0.563000	0.77884	CTG		0.572	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403592.1			21	31	0	0	0	0.00278	0	21	31				
ZNF664	144348	broad.mit.edu	37	12	124496938	124496938	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr12:124496938G>T	ENST00000539644.1	+	6	2077	c.247G>T	c.(247-249)Gtg>Ttg	p.V83L	ZNF664_ENST00000538932.2_Missense_Mutation_p.V83L|ZNF664_ENST00000337815.4_Missense_Mutation_p.V83L|FAM101A_ENST00000545615.1_Intron|ZNF664_ENST00000392404.3_Missense_Mutation_p.V83L			Q8N3J9	ZN664_HUMAN	zinc finger protein 664	83					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V83L(1)		breast(1)|large_intestine(5)|lung(6)|skin(1)	13	all_neural(191;0.101)|Medulloblastoma(191;0.163)			Epithelial(86;0.000239)|OV - Ovarian serous cystadenocarcinoma(86;0.000247)|all cancers(50;0.00155)|BRCA - Breast invasive adenocarcinoma(302;0.249)		AATCCACACAGTGGAGAAGCC	0.388																																							uc001ufz.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(247-249)GTG>TTG		zinc finger protein 664							73.0	82.0	79.0					12																	124496938		2203	4300	6503	SO:0001583	missense	144348				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr12:124496938G>T		CCDS9257.1	12q24.31	2013-05-10			ENSG00000179195	ENSG00000179195		"""Zinc fingers, C2H2-type"""	25406	protein-coding gene	gene with protein product			"""zinc finger protein 176"""	ZNF176		12477932	Standard	NM_001204298		Approved	ZFOC1, DKFZp761B128	uc001uga.3	Q8N3J9	OTTHUMG00000168596	ENST00000539644.1:c.247G>T	12.37:g.124496938G>T	ENSP00000441405:p.Val83Leu					ZNF664_uc001uga.2_Missense_Mutation_p.V83L|ZNF664_uc001ugb.2_Missense_Mutation_p.V83L	p.V83L	NM_152437	NP_689650	Q8N3J9	ZN664_HUMAN		Epithelial(86;0.000239)|OV - Ovarian serous cystadenocarcinoma(86;0.000247)|all cancers(50;0.00155)|BRCA - Breast invasive adenocarcinoma(302;0.249)	6	2077	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		83					B3KP97|Q15914|Q3ZCQ7	Missense_Mutation	SNP	ENST00000539644.1	37	c.247G>T	CCDS9257.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.68|18.68	3.675188|3.675188	0.67928|0.67928	.|.	.|.	ENSG00000179195|ENSG00000179195	ENST00000535937|ENST00000539644;ENST00000392404;ENST00000538932;ENST00000337815	.|T;T;T;T	.|0.58652	.|0.32;0.32;0.32;0.32	4.25|4.25	4.25|4.25	0.50352|0.50352	.|Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.|0.000000	.|0.36591	.|N	.|0.002502	T|T	0.46034|0.46034	0.1372|0.1372	N|N	0.16567|0.16567	0.415|0.415	0.46564|0.46564	D|D	0.999103|0.999103	.|P	.|0.39717	.|0.684	.|B	.|0.43838	.|0.433	T|T	0.35475|0.35475	-0.9787|-0.9787	5|9	.|.	.|.	.|.	-28.8618|-28.8618	14.9673|14.9673	0.71204|0.71204	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|83	.|Q8N3J9	.|ZN664_HUMAN	H|L	21|83	.|ENSP00000441405:V83L;ENSP00000376205:V83L;ENSP00000440645:V83L;ENSP00000337320:V83L	.|.	Q|V	+|+	3|1	2|0	ZNF664|ZNF664	123062891|123062891	1.000000|1.000000	0.71417|0.71417	0.969000|0.969000	0.41365|0.41365	0.995000|0.995000	0.86356|0.86356	7.713000|7.713000	0.84693|0.84693	2.651000|2.651000	0.90000|0.90000	0.655000|0.655000	0.94253|0.94253	CAG|GTG		0.388	ZNF664-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400365.1	NM_152437		70	88	1	0	1.58458e-29	0.00361	2.47168e-29	70	88				
TMEM132B	114795	broad.mit.edu	37	12	125834059	125834059	+	Silent	SNP	C	C	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr12:125834059C>T	ENST00000299308.3	+	2	122	c.114C>T	c.(112-114)ctC>ctT	p.L38L	TMEM132B_ENST00000418253.2_3'UTR	NM_052907.2	NP_443139.2	Q14DG7	T132B_HUMAN	transmembrane protein 132B	38						integral component of membrane (GO:0016021)		p.L38L(1)		NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(45)|ovary(5)|pancreas(1)|prostate(4)|skin(15)|upper_aerodigestive_tract(3)|urinary_tract(1)	107	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		CTGCTTACCTCCCCACGAACT	0.507																																							uc001uhe.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(11)|ovary(5)|large_intestine(1)|pancreas(1)|breast(1)	19						c.(112-114)CTC>CTT		transmembrane protein 132B							139.0	138.0	138.0					12																	125834059		1946	4157	6103	SO:0001819	synonymous_variant	114795					integral to membrane		g.chr12:125834059C>T	AB067493	CCDS41859.1, CCDS66501.1	12q24.31	2006-03-02							29397	protein-coding gene	gene with protein product						11572484	Standard	NM_001286219		Approved	KIAA1906, KIAA1786	uc001uhe.1	Q14DG7		ENST00000299308.3:c.114C>T	12.37:g.125834059C>T							p.L38L	NM_052907	NP_443139	Q14DG7	T132B_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)	2	122	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		38			Extracellular (Potential).		A2RRG8|Q8NA73|Q96JN9|Q96PY1	Silent	SNP	ENST00000299308.3	37	c.114C>T	CCDS41859.1																																																																																				0.507	TMEM132B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400043.1	NM_052907		40	235	0	0	0	0.007835	0	40	235				
TMEM132D	121256	broad.mit.edu	37	12	129559341	129559341	+	Silent	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr12:129559341G>T	ENST00000422113.2	-	9	2705	c.2379C>A	c.(2377-2379)atC>atA	p.I793I	TMEM132D_ENST00000389441.4_Silent_p.I331I	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	793					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)		p.I793I(1)		NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		ATTTAACTTTGATGTTTGCCG	0.483																																							uc009zyl.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14						c.(2377-2379)ATC>ATA		transmembrane protein 132D precursor							190.0	153.0	166.0					12																	129559341		2203	4300	6503	SO:0001819	synonymous_variant	121256					integral to membrane		g.chr12:129559341G>T	AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.2379C>A	12.37:g.129559341G>T						TMEM132D_uc001uia.2_Silent_p.I331I	p.I793I	NM_133448	NP_597705	Q14C87	T132D_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)	9	2707	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)	793			Extracellular (Potential).		Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Silent	SNP	ENST00000422113.2	37	c.2379C>A	CCDS9266.1																																																																																				0.483	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	NM_133448		94	144	1	0	2.68873e-43	0.00361	4.36172e-43	94	144				
GPR133	283383	broad.mit.edu	37	12	131590398	131590398	+	Silent	SNP	C	C	G			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr12:131590398C>G	ENST00000261654.5	+	17	2434	c.1875C>G	c.(1873-1875)ctC>ctG	p.L625L	GPR133_ENST00000543617.1_Silent_p.L144L|GPR133_ENST00000376682.4_Silent_p.L311L|GPR133_ENST00000535015.1_Silent_p.L657L	NM_198827.3	NP_942122.2	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133	625					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.L625L(1)		NS(2)|breast(2)|endometrium(6)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|pancreas(6)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	67	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		GTTTCCGCCTCGAGCCGGGCA	0.632																																							uc001uit.3		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(5)|ovary(3)|skin(2)	10						c.(1873-1875)CTC>CTG		G protein-coupled receptor 133 precursor							123.0	81.0	95.0					12																	131590398		2203	4300	6503	SO:0001819	synonymous_variant	283383				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr12:131590398C>G	AY278561	CCDS9272.1	12q24.33	2014-08-08			ENSG00000111452	ENSG00000111452		"""-"", ""GPCR / Class B : Orphans"""	19893	protein-coding gene	gene with protein product		613639					Standard	NM_198827		Approved	DKFZp434B1272, PGR25	uc001uit.4	Q6QNK2	OTTHUMG00000168339	ENST00000261654.5:c.1875C>G	12.37:g.131590398C>G						GPR133_uc010tbm.1_Silent_p.L657L|GPR133_uc009zyo.2_Intron|GPR133_uc001uiv.1_Silent_p.L144L|GPR133_uc009zyp.2_RNA	p.L625L	NM_198827	NP_942122	Q6QNK2	GP133_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)	17	2434	+	all_neural(191;0.0982)|Medulloblastoma(191;0.163)		625			Extracellular (Potential).		B2CKK9|B7ZLF7|Q2M1L3|Q6ZMQ1|Q7Z7M2|Q86SM4	Silent	SNP	ENST00000261654.5	37	c.1875C>G	CCDS9272.1																																																																																				0.632	GPR133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399356.1	NM_198827		8	16	0	0	0	0.008291	0	8	16				
TEX26	122046	broad.mit.edu	37	13	31513891	31513891	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr13:31513891C>T	ENST00000380473.3	+	2	135	c.122C>T	c.(121-123)aCa>aTa	p.T41I		NM_152325.1	NP_689538.1	Q8N6G2	TEX26_HUMAN	testis expressed 26	41								p.T41I(1)									ACGCCTAAAACAGGAGCAGTG	0.383																																							uc001uti.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(121-123)ACA>ATA		hypothetical protein LOC122046							142.0	113.0	123.0					13																	31513891		2203	4300	6503	SO:0001583	missense	122046							g.chr13:31513891C>T	BC030277	CCDS9339.1	13q12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000175664	ENSG00000175664			28622	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 26"""	C13orf26		12477932	Standard	NM_152325		Approved	MGC40178	uc001uti.3	Q8N6G2	OTTHUMG00000016682	ENST00000380473.3:c.122C>T	13.37:g.31513891C>T	ENSP00000369840:p.Thr41Ile						p.T41I	NM_152325	NP_689538	Q8N6G2	CM026_HUMAN		all cancers(112;0.0176)|Epithelial(112;0.0768)|OV - Ovarian serous cystadenocarcinoma(117;0.0852)	2	141	+		Lung SC(185;0.0281)	41						Missense_Mutation	SNP	ENST00000380473.3	37	c.122C>T	CCDS9339.1	.	.	.	.	.	.	.	.	.	.	C	9.423	1.083614	0.20309	.	.	ENSG00000175664	ENST00000380473	T	0.46819	0.86	5.01	1.99	0.26369	.	0.807036	0.11340	N	0.574134	T	0.38665	0.1049	L	0.43152	1.355	0.09310	N	1	P	0.45634	0.863	P	0.44990	0.466	T	0.18903	-1.0322	10	0.35671	T	0.21	-0.7408	3.0449	0.06151	0.1632:0.4884:0.2506:0.0979	.	41	Q8N6G2	CM026_HUMAN	I	41	ENSP00000369840:T41I	ENSP00000369840:T41I	T	+	2	0	C13orf26	30411891	0.002000	0.14202	0.001000	0.08648	0.001000	0.01503	0.269000	0.18589	0.707000	0.31934	-0.150000	0.13652	ACA		0.383	TEX26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044380.2	NM_152325		9	38	0	0	0	0.004482	0	9	38				
PDS5B	23047	broad.mit.edu	37	13	33344830	33344830	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr13:33344830A>T	ENST00000315596.10	+	33	4289	c.4103A>T	c.(4102-4104)cAg>cTg	p.Q1368L		NM_015032.3	NP_055847.1	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)	1368					cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of cell proliferation (GO:0008285)|regulation of cell proliferation (GO:0042127)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)	p.Q1368L(1)		NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|lung(14)|ovary(5)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	62		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		GAATCCACACAGTCCACACCA	0.368																																							uc010abf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(1)|pancreas(1)	4						c.(4102-4104)CAG>CTG		PDS5, regulator of cohesion maintenance, homolog							72.0	74.0	73.0					13																	33344830		1953	4142	6095	SO:0001583	missense	23047				cell division|cell proliferation|mitotic sister chromatid cohesion|negative regulation of cell proliferation	chromatin|nucleus	ATP binding|DNA binding|identical protein binding	g.chr13:33344830A>T	AB023196	CCDS41878.1	13q12.3	2008-02-05	2007-07-18	2007-07-18	ENSG00000083642	ENSG00000083642			20418	protein-coding gene	gene with protein product		605333	"""androgen-induced proliferation inhibitor"""	APRIN		8812419, 10215036	Standard	NM_015032		Approved	AS3, KIAA0979, FLJ23236, CG008	uc010abf.3	Q9NTI5	OTTHUMG00000016704	ENST00000315596.10:c.4103A>T	13.37:g.33344830A>T	ENSP00000313851:p.Gln1368Leu					PDS5B_uc010abg.2_RNA	p.Q1368L	NM_015032	NP_055847	Q9NTI5	PDS5B_HUMAN		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)	33	4261	+		Lung SC(185;0.0367)	1368					Q5R3S3|Q5W0K8|Q6NSC3|Q8IXT6|Q9H5N8|Q9Y2I5|Q9Y451	Missense_Mutation	SNP	ENST00000315596.10	37	c.4103A>T	CCDS41878.1	.	.	.	.	.	.	.	.	.	.	A	15.25	2.778556	0.49786	.	.	ENSG00000083642	ENST00000315596	.	.	.	6.07	3.57	0.40892	.	0.176930	0.49916	D	0.000135	T	0.42607	0.1210	N	0.19112	0.55	0.43426	D	0.99558	B	0.18310	0.027	B	0.18871	0.023	T	0.17471	-1.0368	9	0.42905	T	0.14	-8.7653	13.276	0.60188	0.7787:0.2213:0.0:0.0	.	1368	Q9NTI5	PDS5B_HUMAN	L	1368	.	ENSP00000313851:Q1368L	Q	+	2	0	PDS5B	32242830	1.000000	0.71417	0.659000	0.29680	0.971000	0.66376	4.899000	0.63245	0.499000	0.27970	0.477000	0.44152	CAG		0.368	PDS5B-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044428.3	NM_015032		4	20	0	0	0	0.001984	0	4	20				
FREM2	341640	broad.mit.edu	37	13	39261752	39261752	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr13:39261752C>T	ENST00000280481.7	+	1	487	c.271C>T	c.(271-273)Ccc>Tcc	p.P91S		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	91					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P91S(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		CTGGCTGGATCCCCTGCATGA	0.692																																							uc001uwv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|pancreas(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	11						c.(271-273)CCC>TCC		FRAS1-related extracellular matrix protein 2							17.0	18.0	18.0					13																	39261752		2202	4299	6501	SO:0001583	missense	341640				cell communication|homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding	g.chr13:39261752C>T	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.271C>T	13.37:g.39261752C>T	ENSP00000280481:p.Pro91Ser						p.P91S	NM_207361	NP_997244	Q5SZK8	FREM2_HUMAN		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)	1	580	+		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)	91			Extracellular (Potential).		Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	37	c.271C>T	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	C	35	5.426133	0.96131	.	.	ENSG00000150893	ENST00000280481	T	0.19105	2.17	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.51618	0.1685	M	0.79693	2.465	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.55711	-0.8098	10	0.72032	D	0.01	.	19.3044	0.94155	0.0:1.0:0.0:0.0	.	91	Q5SZK8	FREM2_HUMAN	S	91	ENSP00000280481:P91S	ENSP00000280481:P91S	P	+	1	0	FREM2	38159752	1.000000	0.71417	0.998000	0.56505	0.981000	0.71138	7.579000	0.82511	2.551000	0.86045	0.655000	0.94253	CCC		0.692	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361		16	17	0	0	0	0.00499	0	16	17				
MYCBP2	23077	broad.mit.edu	37	13	77656020	77656020	+	Missense_Mutation	SNP	T	T	G			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr13:77656020T>G	ENST00000544440.2	-	64	11048	c.11031A>C	c.(11029-11031)gaA>gaC	p.E3677D	MYCBP2_ENST00000407578.2_Missense_Mutation_p.E3715D|MYCBP2-AS1_ENST00000593933.1_RNA|MYCBP2-AS1_ENST00000450627.2_RNA|MYCBP2-AS1_ENST00000422231.2_RNA|MYCBP2-AS2_ENST00000428716.2_RNA|MYCBP2-AS1_ENST00000448470.2_RNA|MYCBP2_ENST00000357337.6_Missense_Mutation_p.E3677D					MYC binding protein 2, E3 ubiquitin protein ligase									p.E3715D(1)|p.E3677D(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		TAAAACTCTCTTCACTATCGC	0.373																																							uc001vkf.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14						c.(11029-11031)GAA>GAC		MYC binding protein 2							129.0	118.0	122.0					13																	77656020		2203	4300	6503	SO:0001583	missense	23077				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding	g.chr13:77656020T>G	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.11031A>C	13.37:g.77656020T>G	ENSP00000444596:p.Glu3677Asp					MYCBP2_uc010aev.2_Missense_Mutation_p.E3081D|MYCBP2_uc001vke.2_Missense_Mutation_p.E297D	p.E3677D	NM_015057	NP_055872	O75592	MYCB2_HUMAN		GBM - Glioblastoma multiforme(99;0.109)	65	11122	-		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)	3677						Missense_Mutation	SNP	ENST00000544440.2	37	c.11031A>C		.	.	.	.	.	.	.	.	.	.	T	15.49	2.849804	0.51270	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	T;T;T	0.62498	0.02;0.02;0.02	5.39	3.94	0.45596	Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	T	0.30665	0.0772	N	0.01576	-0.805	0.51012	D	0.9999	B	0.20780	0.048	B	0.22386	0.039	T	0.04870	-1.0921	10	0.24483	T	0.36	.	7.6561	0.28375	0.0:0.1997:0.0:0.8003	.	3677	O75592	MYCB2_HUMAN	D	3677;3715;3677	ENSP00000349892:E3677D;ENSP00000384288:E3715D;ENSP00000444596:E3677D	ENSP00000349892:E3677D	E	-	3	2	MYCBP2	76554021	0.999000	0.42202	1.000000	0.80357	0.993000	0.82548	0.614000	0.24314	0.756000	0.33013	0.533000	0.62120	GAA		0.373	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057		25	64	0	0	0	0.00333	0	25	64				
STK24	8428	broad.mit.edu	37	13	99127205	99127205	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr13:99127205C>T	ENST00000376547.3	-	5	648	c.503G>A	c.(502-504)gGc>gAc	p.G168D	STK24_ENST00000539966.1_Missense_Mutation_p.G137D|STK24_ENST00000397517.2_Missense_Mutation_p.G156D	NM_003576.3	NP_003567.2	Q9Y6E0	STK24_HUMAN	serine/threonine kinase 24	168	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|execution phase of apoptosis (GO:0097194)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|negative regulation of cell migration (GO:0030336)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of axon regeneration (GO:0048679)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.G168D(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|skin(1)	17	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			CTTCACCTCGCCATGCTCAGA	0.617																																							uc001vnm.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)	2						c.(502-504)GGC>GAC		serine/threonine kinase 24 isoform a							47.0	47.0	47.0					13																	99127205		2203	4300	6503	SO:0001583	missense	8428				cellular component disassembly involved in apoptosis|signal transduction	cytosol|nucleoplasm	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr13:99127205C>T	AF024636	CCDS9488.1, CCDS32001.1, CCDS66573.1	13q31.2-q32.3	2010-06-25	2010-06-25		ENSG00000102572	ENSG00000102572			11403	protein-coding gene	gene with protein product	"""STE20-like kinase 3"", ""sterile 20-like kinase 3"""	604984	"""serine/threonine kinase 24 (Ste20, yeast homolog)"""			9353338, 10644707	Standard	NM_003576		Approved	MST-3, MST3, MST3B, STK3, STE20	uc001vnn.1	Q9Y6E0	OTTHUMG00000017250	ENST00000376547.3:c.503G>A	13.37:g.99127205C>T	ENSP00000365730:p.Gly168Asp					STK24_uc001vnn.1_Missense_Mutation_p.G156D|STK24_uc010tim.1_Missense_Mutation_p.G137D	p.G168D	NM_003576	NP_003567	Q9Y6E0	STK24_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.233)		5	738	-	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		168			Protein kinase.		O14840|Q5JV92	Missense_Mutation	SNP	ENST00000376547.3	37	c.503G>A	CCDS9488.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.8|20.8	4.054809|4.054809	0.75960|0.75960	.|.	.|.	ENSG00000102572|ENSG00000102572	ENST00000397517;ENST00000376547;ENST00000539966;ENST00000376533;ENST00000543110|ENST00000444574	T;T;T|.	0.31510|.	1.49;1.49;1.49|.	4.75|4.75	4.75|4.75	0.60458|0.60458	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.000000|.	0.53938|.	U|.	0.000056|.	T|.	0.76183|.	0.3952|.	M|M	0.75884|0.75884	2.315|2.315	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	1.0;1.0;1.0|.	T|.	0.77199|.	-0.2675|.	10|.	0.87932|.	D|.	0|.	.|.	18.1019|18.1019	0.89508|0.89508	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	137;156;168|.	B4DR80;Q5U0E6;Q9Y6E0|.	.;.;STK24_HUMAN|.	D|X	156;168;137;144;156|73	ENSP00000380651:G156D;ENSP00000365730:G168D;ENSP00000442539:G137D|.	ENSP00000365716:G144D|.	G|W	-|-	2|3	0|0	STK24|STK24	97925206|97925206	1.000000|1.000000	0.71417|0.71417	0.793000|0.793000	0.32043|0.32043	0.222000|0.222000	0.24845|0.24845	7.511000|7.511000	0.81718|0.81718	2.348000|2.348000	0.79779|0.79779	0.549000|0.549000	0.68633|0.68633	GGC|TGG		0.617	STK24-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045549.2	NM_003576		3	24	0	0	0	0.00308	0	3	24				
OR11H12	440153	broad.mit.edu	37	14	19378076	19378076	+	Silent	SNP	A	A	C			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr14:19378076A>C	ENST00000550708.1	+	1	555	c.483A>C	c.(481-483)atA>atC	p.I161I		NM_001013354.1|NM_001197287.1	NP_001013372.1|NP_001184216.1	B2RN74	O11HC_HUMAN	olfactory receptor, family 11, subfamily H, member 12	161						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I161I(1)		NS(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	22	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		AACTGGTCATACTGTGCTGGG	0.473																																							uc010tkp.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(481-483)ATA>ATC		olfactory receptor, family 11, subfamily H,							155.0	168.0	163.0					14																	19378076		2201	4294	6495	SO:0001819	synonymous_variant	440153				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:19378076A>C		CCDS32017.1	14q11.2	2013-01-25			ENSG00000257115	ENSG00000257115		"""GPCR / Class A : Olfactory receptors"""	30738	protein-coding gene	gene with protein product							Standard	NM_001013354		Approved		uc010tkp.2	B2RN74	OTTHUMG00000170298	ENST00000550708.1:c.483A>C	14.37:g.19378076A>C							p.I161I	NM_001013354	NP_001013372	B2RN74	O11HC_HUMAN	Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)	1	483	+	all_cancers(95;0.00108)		161			Helical; Name=4; (Potential).			Silent	SNP	ENST00000550708.1	37	c.483A>C	CCDS32017.1																																																																																				0.473	OR11H12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408402.1	NM_001013354		6	336	0	0	0	0.00245	0	6	336				
OR4Q3	441669	broad.mit.edu	37	14	20216428	20216428	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr14:20216428C>A	ENST00000331723.1	+	1	842	c.842C>A	c.(841-843)cCt>cAt	p.P281H		NM_172194.1	NP_751944.1	Q8NH05	OR4Q3_HUMAN	olfactory receptor, family 4, subfamily Q, member 3	281						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P281H(1)		NS(2)|breast(4)|endometrium(3)|kidney(2)|large_intestine(1)|lung(28)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)	47	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		GTGATTACACCTATGTTGAAC	0.418																																							uc010tkt.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(3)	3						c.(841-843)CCT>CAT		olfactory receptor, family 4, subfamily Q,							128.0	129.0	129.0					14																	20216428		2203	4300	6503	SO:0001583	missense	441669				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20216428C>A	AF179768	CCDS32020.1	14p13	2012-08-09				ENSG00000182652		"""GPCR / Class A : Olfactory receptors"""	15426	protein-coding gene	gene with protein product				OR4Q4			Standard	NM_172194		Approved	C14orf13	uc010tkt.2	Q8NH05		ENST00000331723.1:c.842C>A	14.37:g.20216428C>A	ENSP00000330049:p.Pro281His						p.P281H	NM_172194	NP_751944	Q8NH05	OR4Q3_HUMAN	Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)	1	842	+	all_cancers(95;0.00108)		281			Helical; Name=7; (Potential).		Q6IEX4	Missense_Mutation	SNP	ENST00000331723.1	37	c.842C>A	CCDS32020.1	.	.	.	.	.	.	.	.	.	.	.	18.93	3.728604	0.69074	.	.	ENSG00000182652	ENST00000331723	T	0.00349	7.99	4.35	4.35	0.52113	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39985	U	0.001218	T	0.01800	0.0057	H	0.99117	4.435	0.47698	D	0.999494	D	0.89917	1.0	D	0.97110	1.0	T	0.03212	-1.1060	10	0.87932	D	0	.	14.4174	0.67160	0.0:1.0:0.0:0.0	.	281	Q8NH05	OR4Q3_HUMAN	H	281	ENSP00000330049:P281H	ENSP00000330049:P281H	P	+	2	0	OR4Q3	19286268	0.995000	0.38212	1.000000	0.80357	0.929000	0.56500	5.547000	0.67249	2.254000	0.74563	0.502000	0.49764	CCT		0.418	OR4Q3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409818.2			26	239	1	0	1.42536e-11	0.004656	1.76957e-11	26	239				
OR4N5	390437	broad.mit.edu	37	14	20612554	20612554	+	Silent	SNP	C	C	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr14:20612554C>T	ENST00000333629.1	+	1	660	c.660C>T	c.(658-660)gtC>gtT	p.V220V	RNA5SP381_ENST00000516076.1_RNA	NM_001004724.1	NP_001004724.1	Q8IXE1	OR4N5_HUMAN	olfactory receptor, family 4, subfamily N, member 5	220						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V220V(1)		endometrium(2)|lung(23)|ovary(1)|skin(2)|urinary_tract(1)	29	all_cancers(95;0.00108)		Epithelial(56;7.58e-07)|all cancers(55;3.84e-06)	GBM - Glioblastoma multiforme(265;0.0143)		CCTATGCAGTCATCCTCTGTC	0.507																																							uc010tla.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(658-660)GTC>GTT		olfactory receptor, family 4, subfamily N,							107.0	98.0	101.0					14																	20612554		2203	4300	6503	SO:0001819	synonymous_variant	390437				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20612554C>T		CCDS32031.1	14q11.2	2013-09-23			ENSG00000184394	ENSG00000184394		"""GPCR / Class A : Olfactory receptors"""	15358	protein-coding gene	gene with protein product							Standard	NM_001004724		Approved		uc010tla.2	Q8IXE1	OTTHUMG00000170784	ENST00000333629.1:c.660C>T	14.37:g.20612554C>T							p.V220V	NM_001004724	NP_001004724	Q8IXE1	OR4N5_HUMAN	Epithelial(56;7.58e-07)|all cancers(55;3.84e-06)	GBM - Glioblastoma multiforme(265;0.0143)	1	660	+	all_cancers(95;0.00108)		220			Cytoplasmic (Potential).		Q6IF11	Silent	SNP	ENST00000333629.1	37	c.660C>T	CCDS32031.1																																																																																				0.507	OR4N5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410347.1			33	105	0	0	0	0.010818	0	33	105				
HOMEZ	57594	broad.mit.edu	37	14	23746238	23746238	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr14:23746238T>A	ENST00000357460.5	-	2	363	c.199A>T	c.(199-201)Aat>Tat	p.N67Y	HOMEZ_ENST00000431326.2_Missense_Mutation_p.N69Y|HOMEZ_ENST00000561013.1_Missense_Mutation_p.N69Y	NM_020834.2	NP_065885.2	Q8IX15	HOMEZ_HUMAN	homeobox and leucine zipper encoding	67					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.N67Y(1)|p.N43Y(1)		endometrium(5)|lung(7)	12	all_cancers(95;5.54e-06)			GBM - Glioblastoma multiforme(265;0.00643)		AGGTGTTCATTGCTGTCTAGC	0.527																																							uc001wja.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(199-201)AAT>TAT		homeodomain leucine zipper protein							173.0	168.0	170.0					14																	23746238		2073	4211	6284	SO:0001583	missense	57594					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr14:23746238T>A	AB037864	CCDS45085.1	14q11.2	2011-06-20	2007-02-15	2007-02-15		ENSG00000215271		"""Homeoboxes / ZF class"""	20164	protein-coding gene	gene with protein product		608119	"""KIAA1443"""	KIAA1443		12925734	Standard	NM_020834		Approved		uc001wja.2	Q8IX15		ENST00000357460.5:c.199A>T	14.37:g.23746238T>A	ENSP00000350049:p.Asn67Tyr					HOMEZ_uc001wjb.2_Missense_Mutation_p.N69Y	p.N67Y	NM_020834	NP_065885	Q8IX15	HOMEZ_HUMAN		GBM - Glioblastoma multiforme(265;0.00643)	2	347	-	all_cancers(95;5.54e-06)		67			Homeobox 1.		A1L445|B4DZ80|F8WCA3|Q6P049|Q86XB6|Q9P2A5	Missense_Mutation	SNP	ENST00000357460.5	37	c.199A>T	CCDS45085.1	.	.	.	.	.	.	.	.	.	.	T	17.27	3.347847	0.61183	.	.	ENSG00000215271	ENST00000357460;ENST00000431326	T;T	0.27890	1.64;1.65	6.17	6.17	0.99709	Homeodomain-related (1);Homeobox (1);Homeodomain-like (1);	0.057273	0.64402	D	0.000002	T	0.40322	0.1112	N	0.24115	0.695	0.44469	D	0.997406	D;D	0.76494	0.999;0.999	D;D	0.74023	0.982;0.96	T	0.35176	-0.9799	10	0.72032	D	0.01	-2.787	11.7532	0.51859	0.0:0.0:0.147:0.853	.	69;67	F8WCA3;Q8IX15	.;HOMEZ_HUMAN	Y	67;69	ENSP00000350049:N67Y;ENSP00000406579:N69Y	ENSP00000350049:N67Y	N	-	1	0	HOMEZ	22816078	1.000000	0.71417	0.994000	0.49952	0.991000	0.79684	3.216000	0.51176	2.371000	0.80710	0.533000	0.62120	AAT		0.527	HOMEZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000416939.2	NM_020834		23	92	0	0	0	0.00278	0	23	92				
RNF31	55072	broad.mit.edu	37	14	24620512	24620512	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr14:24620512C>G	ENST00000324103.6	+	9	1981	c.1661C>G	c.(1660-1662)gCc>gGc	p.A554G	RNF31_ENST00000559275.1_Missense_Mutation_p.A403G|RP11-468E2.4_ENST00000558468.1_Missense_Mutation_p.A29G|RNF31_ENST00000382687.3_Missense_Mutation_p.A403G	NM_017999.4	NP_060469.4	Q96EP0	RNF31_HUMAN	ring finger protein 31	554					CD40 signaling pathway (GO:0023035)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein linear polyubiquitination (GO:0097039)|protein polyubiquitination (GO:0000209)|T cell receptor signaling pathway (GO:0050852)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|LUBAC complex (GO:0071797)	ligase activity (GO:0016874)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A554G(1)		breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|prostate(4)|skin(2)|soft_tissue(1)	39				GBM - Glioblastoma multiforme(265;0.00861)		TGTCAGGAGGCCCGGAGAGCC	0.602																																							uc001wmn.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(1660-1662)GCC>GGC		ring finger protein 31							67.0	74.0	72.0					14																	24620512		2115	4235	6350	SO:0001583	missense	55072				CD40 signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|protein linear polyubiquitination|T cell receptor signaling pathway	CD40 receptor complex|internal side of plasma membrane|LUBAC complex	ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr14:24620512C>G	AK000973	CCDS41931.1	14q11.2	2012-09-20			ENSG00000092098	ENSG00000092098		"""RING-type (C3HC4) zinc fingers"""	16031	protein-coding gene	gene with protein product	"""HOIL-1-interacting protein"""	612487				10422847	Standard	NM_017999		Approved	ZIBRA, FLJ10111, FLJ23501, HOIP	uc001wmn.1	Q96EP0	OTTHUMG00000028798	ENST00000324103.6:c.1661C>G	14.37:g.24620512C>G	ENSP00000315112:p.Ala554Gly					RNF31_uc001wml.1_Missense_Mutation_p.A403G|RNF31_uc001wmm.1_Intron|RNF31_uc010alg.1_Missense_Mutation_p.A313G|RNF31_uc001wmo.1_Missense_Mutation_p.A21G|RNF31_uc001wmp.2_RNA	p.A554G	NM_017999	NP_060469	Q96EP0	RNF31_HUMAN		GBM - Glioblastoma multiforme(265;0.00861)	9	1910	+			554					A0A962|Q86VI2|Q8TEI0|Q96GB4|Q96NF1|Q9H5F1|Q9NWD2	Missense_Mutation	SNP	ENST00000324103.6	37	c.1661C>G	CCDS41931.1	.	.	.	.	.	.	.	.	.	.	C	19.51	3.841303	0.71488	.	.	ENSG00000092098	ENST00000324103;ENST00000382687	T;T	0.58506	0.33;0.33	5.31	5.31	0.75309	UBA-like (1);	0.000000	0.85682	D	0.000000	T	0.70474	0.3228	M	0.71581	2.175	0.52099	D	0.999949	D;P;P	0.63046	0.992;0.89;0.933	P;B;P	0.60682	0.878;0.305;0.597	T	0.73238	-0.4046	10	0.87932	D	0	-5.3018	11.9049	0.52705	0.0:0.9167:0.0:0.0833	.	313;554;403	B3KV71;Q96EP0;Q96EP0-3	.;RNF31_HUMAN;.	G	554;403	ENSP00000315112:A554G;ENSP00000372134:A403G	ENSP00000315112:A554G	A	+	2	0	RNF31	23690352	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	3.592000	0.53993	2.760000	0.94817	0.655000	0.94253	GCC		0.602	RNF31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071921.3	NM_017999		22	63	0	0	0	0.00278	0	22	63				
RNF31	55072	broad.mit.edu	37	14	24620762	24620762	+	Silent	SNP	A	A	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr14:24620762A>T	ENST00000324103.6	+	10	2126	c.1806A>T	c.(1804-1806)ggA>ggT	p.G602G	RNF31_ENST00000559275.1_Silent_p.G451G|RP11-468E2.4_ENST00000558468.1_Silent_p.G77G|RNF31_ENST00000382687.3_Silent_p.G451G	NM_017999.4	NP_060469.4	Q96EP0	RNF31_HUMAN	ring finger protein 31	602	Interaction with RBCK1.|UBA. {ECO:0000255|PROSITE- ProRule:PRU00212}.				CD40 signaling pathway (GO:0023035)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein linear polyubiquitination (GO:0097039)|protein polyubiquitination (GO:0000209)|T cell receptor signaling pathway (GO:0050852)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|LUBAC complex (GO:0071797)	ligase activity (GO:0016874)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.G602G(1)		breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|prostate(4)|skin(2)|soft_tissue(1)	39				GBM - Glioblastoma multiforme(265;0.00861)		TCCAGCACGGAGGTGATGTGT	0.637																																							uc001wmn.1		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(1804-1806)GGA>GGT		ring finger protein 31							59.0	62.0	61.0					14																	24620762		2020	4179	6199	SO:0001819	synonymous_variant	55072				CD40 signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|protein linear polyubiquitination|T cell receptor signaling pathway	CD40 receptor complex|internal side of plasma membrane|LUBAC complex	ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr14:24620762A>T	AK000973	CCDS41931.1	14q11.2	2012-09-20			ENSG00000092098	ENSG00000092098		"""RING-type (C3HC4) zinc fingers"""	16031	protein-coding gene	gene with protein product	"""HOIL-1-interacting protein"""	612487				10422847	Standard	NM_017999		Approved	ZIBRA, FLJ10111, FLJ23501, HOIP	uc001wmn.1	Q96EP0	OTTHUMG00000028798	ENST00000324103.6:c.1806A>T	14.37:g.24620762A>T						RNF31_uc001wml.1_Silent_p.G451G|RNF31_uc001wmm.1_Intron|RNF31_uc010alg.1_Silent_p.G361G|RNF31_uc001wmo.1_Silent_p.G69G|RNF31_uc001wmp.2_RNA	p.G602G	NM_017999	NP_060469	Q96EP0	RNF31_HUMAN		GBM - Glioblastoma multiforme(265;0.00861)	10	2055	+			602			Interaction with RBCK1.|UBA.		A0A962|Q86VI2|Q8TEI0|Q96GB4|Q96NF1|Q9H5F1|Q9NWD2	Silent	SNP	ENST00000324103.6	37	c.1806A>T	CCDS41931.1																																																																																				0.637	RNF31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071921.3	NM_017999		17	58	0	0	0	0.007413	0	17	58				
INSM2	84684	broad.mit.edu	37	14	36004201	36004201	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr14:36004201C>A	ENST00000307169.3	+	1	954	c.743C>A	c.(742-744)gCg>gAg	p.A248E		NM_032594.3	NP_115983.3	Q96T92	INSM2_HUMAN	insulinoma-associated 2	248					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A248E(1)		endometrium(3)|kidney(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	10	Breast(36;0.122)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(9;2.16e-07)|Lung(238;2.63e-07)|Epithelial(34;0.00145)|all cancers(34;0.00452)	GBM - Glioblastoma multiforme(112;0.0223)		GAGCCCGGAGCGCCGTCCCGG	0.642																																							uc001wth.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|skin(1)	2						c.(742-744)GCG>GAG		insulinoma-associated protein IA-6																																				SO:0001583	missense	84684				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr14:36004201C>A	AF260323	CCDS9657.1	14q13.1	2013-01-08			ENSG00000168348	ENSG00000168348		"""Zinc fingers, C2H2-type"""	17539	protein-coding gene	gene with protein product	"""mlt 1"""	614027					Standard	NM_032594		Approved	IA-6	uc001wth.1	Q96T92	OTTHUMG00000140223	ENST00000307169.3:c.743C>A	14.37:g.36004201C>A	ENSP00000306523:p.Ala248Glu						p.A248E	NM_032594	NP_115983	Q96T92	INSM2_HUMAN	LUAD - Lung adenocarcinoma(9;2.16e-07)|Lung(238;2.63e-07)|Epithelial(34;0.00145)|all cancers(34;0.00452)	GBM - Glioblastoma multiforme(112;0.0223)	1	954	+	Breast(36;0.122)|Hepatocellular(127;0.158)		248					A1L432|J9Y024|Q8N8K7|Q96Q84	Missense_Mutation	SNP	ENST00000307169.3	37	c.743C>A	CCDS9657.1	.	.	.	.	.	.	.	.	.	.	C	0.020	-1.440459	0.01098	.	.	ENSG00000168348	ENST00000307169	T	0.00856	5.61	4.32	4.32	0.51571	.	.	.	.	.	T	0.00666	0.0022	N	0.11789	0.175	0.09310	N	1	B	0.34372	0.451	B	0.32090	0.14	T	0.48917	-0.8992	9	0.11794	T	0.64	-17.7356	8.0317	0.30470	0.0:0.8909:0.0:0.1091	.	248	Q96T92	INSM2_HUMAN	E	248	ENSP00000306523:A248E	ENSP00000306523:A248E	A	+	2	0	INSM2	35073952	0.000000	0.05858	0.092000	0.20876	0.220000	0.24768	0.411000	0.21115	2.212000	0.71576	0.563000	0.77884	GCG		0.642	INSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276686.1			15	36	1	0	1.96895e-08	0.00278	2.28148e-08	15	36				
SOS2	6655	broad.mit.edu	37	14	50649236	50649236	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr14:50649236G>A	ENST00000216373.5	-	6	1077	c.803C>T	c.(802-804)aCt>aTt	p.T268I	SOS2_ENST00000555794.1_5'Flank|SOS2_ENST00000543680.1_Missense_Mutation_p.T268I	NM_006939.2	NP_008870.2	Q07890	SOS2_HUMAN	son of sevenless homolog 2 (Drosophila)	268	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	DNA binding (GO:0003677)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.T268I(2)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(16)|ovary(2)|skin(1)	39	all_epithelial(31;0.000822)|Breast(41;0.0065)					GCTTTCATCAGTCATTTCAAC	0.338																																							uc001wxs.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(802-804)ACT>ATT		son of sevenless homolog 2							85.0	82.0	83.0					14																	50649236		2203	4300	6503	SO:0001583	missense	6655				apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	DNA binding|protein binding|Rho guanyl-nucleotide exchange factor activity	g.chr14:50649236G>A	L13858	CCDS9697.1	14q21	2013-01-10	2001-12-04		ENSG00000100485	ENSG00000100485		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11188	protein-coding gene	gene with protein product		601247	"""son of sevenless (Drosophilia) homolog 2"""			8276400	Standard	NM_006939		Approved		uc001wxs.4	Q07890	OTTHUMG00000140292	ENST00000216373.5:c.803C>T	14.37:g.50649236G>A	ENSP00000216373:p.Thr268Ile					SOS2_uc010tql.1_Missense_Mutation_p.T268I|SOS2_uc001wxt.2_5'Flank	p.T268I	NM_006939	NP_008870	Q07890	SOS2_HUMAN			6	901	-	all_epithelial(31;0.000822)|Breast(41;0.0065)		268			DH.		B7ZKT6|D3DSB4|Q15503|Q17RN1	Missense_Mutation	SNP	ENST00000216373.5	37	c.803C>T	CCDS9697.1	.	.	.	.	.	.	.	.	.	.	G	32	5.130378	0.94473	.	.	ENSG00000100485	ENST00000216373;ENST00000543680	D;D	0.92495	-3.05;-3.05	5.54	5.54	0.83059	Dbl homology (DH) domain (5);	0.000000	0.85682	D	0.000000	D	0.95424	0.8514	M	0.78049	2.395	0.80722	D	1	P;P	0.50443	0.935;0.929	P;B	0.56788	0.806;0.357	D	0.95644	0.8701	10	0.87932	D	0	.	19.4841	0.95022	0.0:0.0:1.0:0.0	.	268;268	B7ZKT6;Q07890	.;SOS2_HUMAN	I	268	ENSP00000216373:T268I;ENSP00000445328:T268I	ENSP00000216373:T268I	T	-	2	0	SOS2	49718986	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.592000	0.87571	0.650000	0.86243	ACT		0.338	SOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276878.2			14	40	0	0	0	0.004007	0	14	40				
FRMD6	122786	broad.mit.edu	37	14	52186866	52186866	+	Missense_Mutation	SNP	C	C	T	rs371612348		TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr14:52186866C>T	ENST00000344768.5	+	11	1314	c.1118C>T	c.(1117-1119)gCg>gTg	p.A373V	FRMD6_ENST00000356218.4_Missense_Mutation_p.A365V|FRMD6_ENST00000554167.1_Missense_Mutation_p.A296V|FRMD6_ENST00000395718.2_Missense_Mutation_p.A365V|FRMD6_ENST00000553556.1_Missense_Mutation_p.A15V			Q96NE9	FRMD6_HUMAN	FERM domain containing 6	373					apical constriction (GO:0003383)|cellular protein localization (GO:0034613)|regulation of actin filament-based process (GO:0032970)	apical junction complex (GO:0043296)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)		p.A365V(1)		breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_epithelial(31;0.0163)|Breast(41;0.089)					GGGAGCAGTGCGGGCAGCATG	0.607																																							uc001wzd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)|central_nervous_system(1)	3						c.(1117-1119)GCG>GTG		FERM domain containing 6		C	VAL/ALA,VAL/ALA	0,4406		0,0,2203	66.0	62.0	64.0		1094,1094	5.1	0.5	14		64	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	FRMD6	NM_001042481.1,NM_152330.3	64,64	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	365/615,365/615	52186866	1,13005	2203	4300	6503	SO:0001583	missense	122786					cytoskeleton|mitochondrion|plasma membrane	binding	g.chr14:52186866C>T	BI465118	CCDS9704.1, CCDS58318.1, CCDS58319.1	14q22.1	2011-06-22	2005-07-20	2005-07-20	ENSG00000139926	ENSG00000139926			19839	protein-coding gene	gene with protein product	"""expanded homolog"""	614555	"""chromosome 14 open reading frame 31"""	C14orf31			Standard	NM_152330		Approved	MGC17921, willin, EX1	uc001wzd.3	Q96NE9	OTTHUMG00000140294	ENST00000344768.5:c.1118C>T	14.37:g.52186866C>T	ENSP00000343899:p.Ala373Val					FRMD6_uc001wzb.2_Missense_Mutation_p.A365V|FRMD6_uc001wzc.2_Missense_Mutation_p.A365V|FRMD6_uc001wze.2_Missense_Mutation_p.A296V|FRMD6_uc001wzf.2_Missense_Mutation_p.A66V|FRMD6_uc001wzg.2_Missense_Mutation_p.A15V	p.A373V	NM_152330	NP_689543	Q96NE9	FRMD6_HUMAN			11	1403	+	all_epithelial(31;0.0163)|Breast(41;0.089)		373					D3DSB9|Q5HYF2|Q8N2X1|Q8WUH7	Missense_Mutation	SNP	ENST00000344768.5	37	c.1118C>T	CCDS58318.1	.	.	.	.	.	.	.	.	.	.	C	14.57	2.574223	0.45902	0.0	1.16E-4	ENSG00000139926	ENST00000356218;ENST00000395718;ENST00000344768;ENST00000554167;ENST00000555197;ENST00000555703;ENST00000553556	T;T;T;T	0.78003	-1.14;-1.14;-0.91;-0.72	5.98	5.1	0.69264	.	0.056465	0.64402	N	0.000001	T	0.62756	0.2454	N	0.14661	0.345	0.80722	D	1	P;B;P	0.37038	0.579;0.443;0.579	B;B;B	0.33392	0.163;0.078;0.104	T	0.65907	-0.6054	10	0.46703	T	0.11	.	15.226	0.73352	0.0:0.9327:0.0:0.0673	.	296;373;365	G3V4T7;Q96NE9;Q96NE9-2	.;FRMD6_HUMAN;.	V	365;365;373;296;103;15;15	ENSP00000348550:A365V;ENSP00000379068:A365V;ENSP00000343899:A373V;ENSP00000451977:A296V	ENSP00000343899:A373V	A	+	2	0	FRMD6	51256616	0.208000	0.23494	0.510000	0.27712	0.148000	0.21650	0.918000	0.28678	1.538000	0.49270	0.591000	0.81541	GCG		0.607	FRMD6-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276881.1	NM_152330		12	46	0	0	0	0.010729	0	12	46				
C14orf37	145407	broad.mit.edu	37	14	58471506	58471506	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr14:58471506C>T	ENST00000267485.7	-	8	2467	c.2273G>A	c.(2272-2274)aGc>aAc	p.S758N		NM_001001872.2	NP_001001872.2	Q86TY3	CN037_HUMAN	chromosome 14 open reading frame 37	758						integral component of membrane (GO:0016021)		p.S758N(1)		breast(7)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(16)|pancreas(1)|skin(1)	33						ATCTTGCATGCTGTTGAATTC	0.388																																							uc001xdc.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2272-2274)AGC>AAC		hypothetical protein LOC145407 precursor							122.0	125.0	124.0					14																	58471506		2203	4300	6503	SO:0001583	missense	145407					integral to membrane	binding	g.chr14:58471506C>T		CCDS32089.1	14q23.1	2012-09-03			ENSG00000139971	ENSG00000139971			19846	protein-coding gene	gene with protein product							Standard	NM_001001872		Approved		uc001xdc.3	Q86TY3	OTTHUMG00000171173	ENST00000267485.7:c.2273G>A	14.37:g.58471506C>T	ENSP00000267485:p.Ser758Asn					C14orf37_uc010tro.1_Missense_Mutation_p.S796N|C14orf37_uc001xdd.2_Missense_Mutation_p.S757N	p.S758N	NM_001001872	NP_001001872	Q86TY3	CN037_HUMAN			8	2384	-			758			Cytoplasmic (Potential).		A8K8Z8|Q6P5Q1|Q86TY1	Missense_Mutation	SNP	ENST00000267485.7	37	c.2273G>A	CCDS32089.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.396643	0.83011	.	.	ENSG00000139971	ENST00000267485;ENST00000438670	T	0.42900	0.96	5.64	5.64	0.86602	.	0.105356	0.64402	D	0.000004	T	0.63450	0.2512	L	0.58101	1.795	0.44627	D	0.997604	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	T	0.64575	-0.6375	10	0.87932	D	0	-9.3321	18.7057	0.91637	0.0:1.0:0.0:0.0	.	796;758;758	B4DMS4;A8K990;Q86TY3	.;.;CN037_HUMAN	N	758;796	ENSP00000267485:S758N	ENSP00000267485:S758N	S	-	2	0	C14orf37	57541259	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.991000	0.63883	2.662000	0.90505	0.655000	0.94253	AGC		0.388	C14orf37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412059.1	NM_001001872		29	116	0	0	0	0.007291	0	29	116				
ZFYVE26	23503	broad.mit.edu	37	14	68272236	68272236	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr14:68272236C>A	ENST00000347230.4	-	7	1255	c.1117G>T	c.(1117-1119)Ggc>Tgc	p.G373C	ZFYVE26_ENST00000555452.1_Missense_Mutation_p.G373C	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	373					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)	p.G373C(1)		NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		TGTGTCCAGCCCAGGAGTACA	0.532																																							uc001xka.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(9)|breast(2)	11						c.(1117-1119)GGC>TGC		zinc finger, FYVE domain containing 26							78.0	79.0	79.0					14																	68272236		2203	4300	6503	SO:0001583	missense	23503				cell cycle|cell death|cytokinesis|double-strand break repair via homologous recombination	centrosome|midbody	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding	g.chr14:68272236C>A	AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.1117G>T	14.37:g.68272236C>A	ENSP00000251119:p.Gly373Cys					ZFYVE26_uc010tsz.1_RNA|ZFYVE26_uc001xkc.3_Missense_Mutation_p.G373C|ZFYVE26_uc010tta.1_Missense_Mutation_p.G373C	p.G373C	NM_015346	NP_056161	Q68DK2	ZFY26_HUMAN		all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)	7	1256	-			373					B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Missense_Mutation	SNP	ENST00000347230.4	37	c.1117G>T	CCDS9788.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.452818	0.84209	.	.	ENSG00000072121	ENST00000347230;ENST00000411699;ENST00000555452	T;T	0.55234	0.71;0.53	6.03	6.03	0.97812	.	0.053997	0.64402	D	0.000001	T	0.73583	0.3605	M	0.66939	2.045	0.58432	D	0.999997	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.996;0.985	T	0.73688	-0.3904	10	0.87932	D	0	-23.3798	20.5666	0.99351	0.0:1.0:0.0:0.0	.	373;373;373	Q68DK2-4;G3V2D8;Q68DK2	.;.;ZFY26_HUMAN	C	373;352;373	ENSP00000251119:G373C;ENSP00000450603:G373C	ENSP00000251119:G373C	G	-	1	0	ZFYVE26	67341989	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.223000	0.65283	2.854000	0.98071	0.655000	0.94253	GGC		0.532	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2	NM_015346		29	69	1	0	1.45844e-13	0.002836	1.8744e-13	29	69				
DPF3	8110	broad.mit.edu	37	14	73220047	73220047	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr14:73220047C>G	ENST00000556509.1	-	3	225	c.226G>C	c.(226-228)Gcc>Ccc	p.A76P	DPF3_ENST00000546183.1_Missense_Mutation_p.A86P|DPF3_ENST00000541685.1_Missense_Mutation_p.A76P	NM_001280542.1	NP_001267471.1	Q92784	DPF3_HUMAN	D4, zinc and double PHD fingers, family 3	76					chromatin modification (GO:0016568)|nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)	zinc ion binding (GO:0008270)	p.A76P(2)|p.A75P(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)	22				BRCA - Breast invasive adenocarcinoma(234;0.00649)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)		CAGCAGCGGGCAGGGTATGTA	0.557																																							uc001xnc.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(1)	1						c.(226-228)GCC>CCC		D4, zinc and double PHD fingers, family 3							47.0	46.0	47.0					14																	73220047		1881	4114	5995	SO:0001583	missense	8110				chromatin modification|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nBAF complex	nucleic acid binding|zinc ion binding	g.chr14:73220047C>G	U43919	CCDS45133.1, CCDS61495.1, CCDS61496.1, CCDS61497.1	14q24.2	2014-05-13			ENSG00000205683	ENSG00000205683		"""Zinc fingers, PHD-type"""	17427	protein-coding gene	gene with protein product		601672				11845289, 8812431	Standard	NM_012074		Approved	cer-d4, Cerd4, FLJ14079, BAF45c	uc010ari.1	Q92784		ENST00000556509.1:c.226G>C	14.37:g.73220047C>G	ENSP00000450518:p.Ala76Pro					DPF3_uc001xnf.2_RNA|DPF3_uc010ari.1_Missense_Mutation_p.A76P|DPF3_uc010ttq.1_Missense_Mutation_p.A86P	p.A76P	NM_012074	NP_036206	Q92784	DPF3_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.00649)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)	3	239	-			76					A8MSI3|B7Z276|F5H575|Q32UJ0|Q6P9E6|Q6ZT41|Q9H7Y5	Missense_Mutation	SNP	ENST00000556509.1	37	c.226G>C		.	.	.	.	.	.	.	.	.	.	C	21.9	4.210162	0.79240	.	.	ENSG00000205683	ENST00000540281;ENST00000556509;ENST00000398816;ENST00000541685;ENST00000546183	D;T;T	0.91631	-2.88;-0.36;-0.44	5.58	5.58	0.84498	.	.	.	.	.	D	0.95579	0.8563	M	0.72894	2.215	0.80722	D	1	P;P;D	0.76494	0.652;0.454;0.999	B;B;D	0.81914	0.399;0.137;0.995	D	0.95789	0.8823	9	0.87932	D	0	.	16.4812	0.84158	0.0:1.0:0.0:0.0	.	86;76;76	F5H575;Q92784-2;Q92784	.;.;DPF3_HUMAN	P	76;76;75;76;86	ENSP00000450518:A76P;ENSP00000441640:A76P;ENSP00000444662:A86P	ENSP00000381791:A131P	A	-	1	0	DPF3	72289800	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.726000	0.68515	2.633000	0.89246	0.561000	0.74099	GCC		0.557	DPF3-004	NOVEL	basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000413152.2			4	23	0	0	0	0.001168	0	4	23				
NRXN3	9369	broad.mit.edu	37	14	79175581	79175581	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr14:79175581A>T	ENST00000554719.1	+	4	615	c.124A>T	c.(124-126)Atc>Ttc	p.I42F	RP11-232C2.2_ENST00000555680.1_RNA|NRXN3_ENST00000335750.5_Missense_Mutation_p.I42F	NM_004796.4	NP_004787.2	Q9HDB5	NRX3B_HUMAN	neurexin 3	0					adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)	p.I42F(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		GAATAATGACATCCGTCTGGA	0.468																																							uc001xun.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10						c.(124-126)ATC>TTC		neurexin 3 isoform 1 precursor							78.0	79.0	79.0					14																	79175581		2203	4300	6503	SO:0001583	missense	9369				axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity	g.chr14:79175581A>T	AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000554719.1:c.124A>T	14.37:g.79175581A>T	ENSP00000451648:p.Ile42Phe					NRXN3_uc001xum.1_RNA|NRXN3_uc010asv.1_Missense_Mutation_p.I176F	p.I42F	NM_004796	NP_004787	Q9Y4C0	NRX3A_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)	4	615	+		Renal(4;0.00876)	415			Laminin G-like 2.|Extracellular (Potential).		A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Missense_Mutation	SNP	ENST00000554719.1	37	c.124A>T	CCDS9870.1	.	.	.	.	.	.	.	.	.	.	A	8.440	0.850591	0.17034	.	.	ENSG00000021645	ENST00000330071;ENST00000332068;ENST00000554719;ENST00000335750	T;T	0.79653	-1.29;-1.29	5.52	5.52	0.82312	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.054388	0.64402	D	0.000001	D	0.88340	0.6410	.	.	.	0.58432	D	0.999997	D;B	0.76494	0.999;0.049	D;B	0.64410	0.925;0.022	D	0.88675	0.3198	8	.	.	.	.	15.642	0.77012	1.0:0.0:0.0:0.0	.	415;42	Q9Y4C0;Q9Y4C0-3	NRX3A_HUMAN;.	F	415;413;42;42	ENSP00000451648:I42F;ENSP00000338349:I42F	.	I	+	1	0	NRXN3	78245334	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.078000	0.71282	2.106000	0.64143	0.460000	0.39030	ATC		0.468	NRXN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413787.1	NM_001105250		16	57	0	0	0	0.010504	0	16	57				
KCNK10	54207	broad.mit.edu	37	14	88652442	88652442	+	Silent	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr14:88652442G>T	ENST00000340700.5	-	7	1505	c.1054C>A	c.(1054-1056)Cgg>Agg	p.R352R	KCNK10_ENST00000312350.5_Silent_p.R357R|KCNK10_ENST00000319231.5_Silent_p.R357R	NM_021161.4	NP_066984.1	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	352					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)	p.R357R(2)|p.R352R(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	47						CGTGTCTCCCGGAACTCAGCC	0.622																																							uc001xwo.2		NA																	3	Substitution - coding silent(3)		lung(3)	ovary(2)|skin(2)|pancreas(1)	5						c.(1054-1056)CGG>AGG		potassium channel, subfamily K, member 10							35.0	23.0	27.0					14																	88652442		2175	4260	6435	SO:0001819	synonymous_variant	54207				signal transduction	integral to membrane	potassium channel activity|voltage-gated ion channel activity	g.chr14:88652442G>T	AF279890	CCDS9880.1, CCDS9881.1, CCDS9882.1	14q31	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6273	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 97"""	605873				10880510, 16382106	Standard	NM_021161		Approved	K2p10.1, TREK-2, TREK2, PPP1R97	uc001xwn.3	P57789		ENST00000340700.5:c.1054C>A	14.37:g.88652442G>T						KCNK10_uc001xwm.2_Silent_p.R357R|KCNK10_uc001xwn.2_Silent_p.R357R	p.R352R	NM_021161	NP_066984	P57789	KCNKA_HUMAN			7	1511	-			352			Cytoplasmic (Potential).		B2R8T4|B2RCT3|B5TJL4|Q6B014|Q8TDK7|Q8TDK8|Q9HB59	Silent	SNP	ENST00000340700.5	37	c.1054C>A	CCDS9880.1																																																																																				0.622	KCNK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410167.1	NM_021161		3	17	1	0	0.000157383	0.00308	0.000166991	3	17				
KCNK10	54207	broad.mit.edu	37	14	88729728	88729728	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr14:88729728A>G	ENST00000340700.5	-	2	656	c.205T>C	c.(205-207)Tgg>Cgg	p.W69R	KCNK10_ENST00000312350.5_Missense_Mutation_p.W74R|KCNK10_ENST00000319231.5_Missense_Mutation_p.W74R	NM_021161.4	NP_066984.1	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	69					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)	p.W74R(2)|p.W69R(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	47						ACCGTCTTCCACTTCATGACG	0.592																																							uc001xwo.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(2)|skin(2)|pancreas(1)	5						c.(205-207)TGG>CGG		potassium channel, subfamily K, member 10							116.0	100.0	105.0					14																	88729728		2203	4300	6503	SO:0001583	missense	54207				signal transduction	integral to membrane	potassium channel activity|voltage-gated ion channel activity	g.chr14:88729728A>G	AF279890	CCDS9880.1, CCDS9881.1, CCDS9882.1	14q31	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6273	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 97"""	605873				10880510, 16382106	Standard	NM_021161		Approved	K2p10.1, TREK-2, TREK2, PPP1R97	uc001xwn.3	P57789		ENST00000340700.5:c.205T>C	14.37:g.88729728A>G	ENSP00000343104:p.Trp69Arg					KCNK10_uc001xwm.2_Missense_Mutation_p.W74R|KCNK10_uc001xwn.2_Missense_Mutation_p.W74R	p.W69R	NM_021161	NP_066984	P57789	KCNKA_HUMAN			2	662	-			69			Cytoplasmic (Potential).		B2R8T4|B2RCT3|B5TJL4|Q6B014|Q8TDK7|Q8TDK8|Q9HB59	Missense_Mutation	SNP	ENST00000340700.5	37	c.205T>C	CCDS9880.1	.	.	.	.	.	.	.	.	.	.	A	24.0	4.476917	0.84640	.	.	ENSG00000100433	ENST00000340700;ENST00000312350;ENST00000319231;ENST00000556282	T;T;T;D	0.97256	2.0;2.0;2.0;-4.31	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	D	0.93792	0.8015	L	0.40543	1.245	0.80722	D	1	B;B;B	0.32245	0.361;0.361;0.361	B;B;B	0.31547	0.132;0.132;0.132	D	0.92454	0.5972	10	0.06757	T	0.87	.	16.5764	0.84681	1.0:0.0:0.0:0.0	.	69;74;74	P57789;B2R8T4;Q6B014	KCNKA_HUMAN;.;.	R	69;74;74;57	ENSP00000343104:W69R;ENSP00000310568:W74R;ENSP00000312811:W74R;ENSP00000452587:W57R	ENSP00000310568:W74R	W	-	1	0	KCNK10	87799481	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.282000	0.95840	2.371000	0.80710	0.533000	0.62120	TGG		0.592	KCNK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410167.1	NM_021161		20	88	0	0	0	0.002299	0	20	88				
BCL11B	64919	broad.mit.edu	37	14	99724120	99724120	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr14:99724120C>T	ENST00000357195.3	-	2	124	c.115G>A	c.(115-117)Gag>Aag	p.E39K	BCL11B_ENST00000443726.2_Intron|BCL11B_ENST00000345514.2_Missense_Mutation_p.E39K	NM_001282237.1|NM_138576.2	NP_001269166.1|NP_612808.1	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B (zinc finger protein)	39					alpha-beta T cell differentiation (GO:0046632)|epithelial cell morphogenesis (GO:0003382)|keratinocyte development (GO:0003334)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|odontogenesis of dentin-containing tooth (GO:0042475)|olfactory bulb axon guidance (GO:0071678)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive T cell selection (GO:0043368)|post-embryonic camera-type eye development (GO:0031077)|regulation of keratinocyte proliferation (GO:0010837)|regulation of lipid metabolic process (GO:0019216)|regulation of neuron differentiation (GO:0045664)|striatal medium spiny neuron differentiation (GO:0021773)|T cell differentiation in thymus (GO:0033077)|T cell receptor V(D)J recombination (GO:0033153)|thymus development (GO:0048538)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.E39K(1)		NS(3)|breast(1)|central_nervous_system(9)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(9)|prostate(2)|skin(2)	34		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)		CTTGGCTCCTCTATCTCCAGA	0.587			T	TLX3	T-ALL																																		uc001yga.2		NA		Dom	yes		14	14q32.1	64919	T	B-cell CLL/lymphoma 11B  (CTIP2)			L	TLX3		T-ALL		1	Substitution - Missense(1)		lung(1)	central_nervous_system(8)|large_intestine(1)|lung(1)	10						c.(115-117)GAG>AAG		B-cell CLL/lymphoma 11B isoform 1							44.0	49.0	48.0					14																	99724120		2203	4300	6503	SO:0001583	missense	64919					nucleus	zinc ion binding	g.chr14:99724120C>T	AJ404614	CCDS9949.1, CCDS9950.1	14q32	2013-01-08			ENSG00000127152	ENSG00000127152		"""Zinc fingers, C2H2-type"""	13222	protein-coding gene	gene with protein product		606558		ZNF856B		11719382, 16950772	Standard	NM_138576		Approved	CTIP-2, CTIP2, hRIT1-alpha	uc001yga.3	Q9C0K0	OTTHUMG00000028967	ENST00000357195.3:c.115G>A	14.37:g.99724120C>T	ENSP00000349723:p.Glu39Lys					BCL11B_uc001ygb.2_Missense_Mutation_p.E39K	p.E39K	NM_138576	NP_612808	Q9C0K0	BC11B_HUMAN		COAD - Colon adenocarcinoma(157;0.103)	2	382	-		Melanoma(154;0.0866)|all_epithelial(191;0.241)	39					Q9H162	Missense_Mutation	SNP	ENST00000357195.3	37	c.115G>A	CCDS9950.1	.	.	.	.	.	.	.	.	.	.	C	10.06	1.246317	0.22796	.	.	ENSG00000127152	ENST00000357195;ENST00000345514	T;T	0.10763	2.85;2.84	6.08	6.08	0.98989	.	1.368430	0.05316	N	0.525606	T	0.10637	0.0260	N	0.22421	0.69	0.80722	D	1	B;B	0.19817	0.006;0.039	B;B	0.17433	0.012;0.018	T	0.31696	-0.9934	10	0.09084	T	0.74	-15.6517	16.0688	0.80909	0.0:0.8668:0.1332:0.0	.	39;39	Q9C0K0-2;Q9C0K0	.;BC11B_HUMAN	K	39	ENSP00000349723:E39K;ENSP00000280435:E39K	ENSP00000280435:E39K	E	-	1	0	BCL11B	98793873	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.580000	0.36547	2.894000	0.99253	0.655000	0.94253	GAG		0.587	BCL11B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000072332.2	NM_138576		16	36	0	0	0	0.006122	0	16	36				
DIO3	1735	broad.mit.edu	37	14	102028496	102028497	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr14:102028496_102028497CC>AA	ENST00000510508.4	+	1	809_810	c.663_664CC>AA	c.(661-666)agCCtg>agAAtg	p.221_222SL>RM	DIO3OS_ENST00000408206.1_lincRNA|DIO3_ENST00000359323.3_Missense_Mutation_p.195_196SL>RM			P55073	IOD3_HUMAN	deiodinase, iodothyronine, type III	221					cellular nitrogen compound metabolic process (GO:0034641)|hormone biosynthetic process (GO:0042446)|positive regulation of multicellular organism growth (GO:0040018)|small molecule metabolic process (GO:0044281)|thyroid hormone catabolic process (GO:0042404)|thyroid hormone generation (GO:0006590)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	thyroxine 5'-deiodinase activity (GO:0004800)|thyroxine 5-deiodinase activity (GO:0033798)	p.S221_L222>RM(1)|p.S195_L196>RM(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(8)|ovary(3)|skin(1)	22		all_neural(303;0.185)				AGCACCGGAGCCTGGAGGACCG	0.649																																							uc010txq.1		NA																	2	Complex - compound substitution(2)		lung(2)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(583-588)AGCCTG>AGAATG		deiodinase, iodothyronine, type III																																				SO:0001583	missense	1735				cellular nitrogen compound metabolic process|hormone biosynthetic process	endosome membrane|integral to membrane|plasma membrane	thyroxine 5'-deiodinase activity|thyroxine 5-deiodinase activity	g.chr14:102028496_102028497CC>AA	S79854	CCDS41992.1, CCDS41992.2	14q32	2012-10-08			ENSG00000197406	ENSG00000197406			2885	protein-coding gene	gene with protein product		601038		TXDI3		9787088, 7593630	Standard	NM_001362		Approved		uc021sdx.1	P55073	OTTHUMG00000160681	Exception_encountered	14.37:g.102028496_102028497delinsAA	ENSP00000427336:p.S221_L222delinsRM					DIO3OS_uc001ykd.1_5'Flank|uc001yke.2_5'Flank|uc001ykf.2_5'Flank|uc001ykg.2_5'Flank|uc001ykh.3_5'Flank|MIR1247_hsa-mir-1247|MI0006382_5'Flank	p.195_196SL>RM	NM_001362	NP_001353	P55073	IOD3_HUMAN			2	809_810	+		all_neural(303;0.185)	195_196			Extracellular (Potential).		G3XAM0|Q8WVN5	Missense_Mutation	DNP	ENST00000510508.4	37	c.585_586CC>AA	CCDS41992.2																																																																																				0.649	DIO3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000361712.4	NM_001362		41	178	0	0	0	0.004672	0	41	178				
GOLGA8CP	729786	broad.mit.edu	37	15	20777905	20777905	+	RNA	SNP	C	C	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr15:20777905C>T	ENST00000408427.1	+	0	83				RN7SL759P_ENST00000485130.2_RNA														p.D378D(1)									GCCTCACTGACAGCGTGGAGC	0.637																																							uc010tzc.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(1144-1146)GAC>GAT		golgi autoantigen, golgin subfamily a, 8E																																						729786							g.chr15:20777905C>T																													15.37:g.20777905C>T						uc001ytq.2_5'Flank	p.D382D	NM_001012423	NP_001012423					18	2161	+									Silent	SNP	ENST00000408427.1	37	c.1146C>T																																																																																					0.637	AC131280.1-201	NOVEL	basic	miRNA	miRNA				5	53	0	0	0	0.000602	0	5	53				
GABRA5	2558	broad.mit.edu	37	15	27185181	27185181	+	Silent	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr15:27185181C>A	ENST00000335625.5	+	9	1722	c.834C>A	c.(832-834)tcC>tcA	p.S278S	GABRB3_ENST00000541819.2_5'Flank|GABRA5_ENST00000400081.3_Silent_p.S278S|GABRA5_ENST00000355395.5_Silent_p.S278S	NM_000810.3	NP_000801.1	P31644	GBRA5_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 5	278					associative learning (GO:0008306)|behavioral fear response (GO:0001662)|brain development (GO:0007420)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.S278S(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(1)|upper_aerodigestive_tract(1)	49		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zopiclone(DB01198)	CACAGGTGTCCTTTTGGCTGA	0.507																																							uc001zbd.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(832-834)TCC>TCA		gamma-aminobutyric acid A receptor, alpha 5	Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)						101.0	96.0	98.0					15																	27185181		1957	4165	6122	SO:0001819	synonymous_variant	2558				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity	g.chr15:27185181C>A		CCDS45194.1	15q12	2012-06-22			ENSG00000186297	ENSG00000186297		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4079	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 5"""	137142				1321750	Standard	NM_000810		Approved		uc021sgi.1	P31644	OTTHUMG00000171824	ENST00000335625.5:c.834C>A	15.37:g.27185181C>A						GABRB3_uc001zbb.2_5'Flank	p.S278S	NM_000810	NP_000801	P31644	GBRA5_HUMAN		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	10	1173	+		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)	278			Helical; (Potential).		A8K338|Q14DC2|Q53XL6|Q9NYT3|Q9NYT4|Q9NYT5	Silent	SNP	ENST00000335625.5	37	c.834C>A	CCDS45194.1																																																																																				0.507	GABRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415234.1			10	36	1	0	1.58986e-06	0.008291	1.76383e-06	10	36				
MGA	23269	broad.mit.edu	37	15	42041781	42041781	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr15:42041781G>T	ENST00000570161.1	+	16	5976	c.5976G>T	c.(5974-5976)aaG>aaT	p.K1992N	MGA_ENST00000545763.1_Missense_Mutation_p.K1783N|MGA_ENST00000389936.4_Missense_Mutation_p.K1953N|MGA_ENST00000566586.1_Missense_Mutation_p.K1783N|MGA_ENST00000219905.7_Missense_Mutation_p.K1992N			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.K2041N(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	AAACGAAGAAGGTTCTACAGT	0.413																																							uc010ucy.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|kidney(3)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	12						c.(5974-5976)AAG>AAT		MAX-interacting protein isoform 1							70.0	69.0	70.0					15																	42041781		1851	4087	5938	SO:0001583	missense	23269					MLL1 complex	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr15:42041781G>T	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.5976G>T	15.37:g.42041781G>T	ENSP00000457035:p.Lys1992Asn					MGA_uc010ucz.1_Missense_Mutation_p.K1783N|MGA_uc010uda.1_Missense_Mutation_p.K608N|MGA_uc001zoi.2_Missense_Mutation_p.K206N	p.K1992N	NM_001164273	NP_001157745	Q8IWI9	MGAP_HUMAN		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	17	6157	+		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)	1953			Basic motif.		Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000570161.1	37	c.5976G>T	CCDS55959.1	.	.	.	.	.	.	.	.	.	.	G	1.856	-0.463761	0.04476	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	T;T;T	0.23147	1.92;1.92;1.92	5.19	-1.53	0.08611	.	0.726119	0.12041	N	0.505096	T	0.14700	0.0355	L	0.29908	0.895	0.09310	N	1	B;B;B;B	0.24963	0.011;0.006;0.115;0.057	B;B;B;B	0.20767	0.008;0.012;0.031;0.015	T	0.20874	-1.0262	10	0.38643	T	0.18	.	5.8019	0.18417	0.328:0.0:0.5512:0.1209	.	608;1783;1992;1953	B4DVS1;F5H7K2;E7ENI0;Q8IWI9	.;.;.;MGAP_HUMAN	N	1992;1953;1783	ENSP00000219905:K1992N;ENSP00000374586:K1953N;ENSP00000442467:K1783N	ENSP00000219905:K1992N	K	+	3	2	MGA	39829073	0.810000	0.29049	0.041000	0.18516	0.182000	0.23217	1.045000	0.30341	-0.126000	0.11682	-0.251000	0.11542	AAG		0.413	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1		23	51	1	0	6.32553e-13	0.004656	8.01673e-13	23	51				
DUOX2	50506	broad.mit.edu	37	15	45391598	45391598	+	Missense_Mutation	SNP	G	G	T	rs368746258		TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr15:45391598G>T	ENST00000603300.1	-	26	3700	c.3498C>A	c.(3496-3498)aaC>aaA	p.N1166K	DUOX2_ENST00000389039.6_Missense_Mutation_p.N1166K	NM_014080.4	NP_054799.4	Q9NRD8	DUOX2_HUMAN	dual oxidase 2	1166	Ferric oxidoreductase.|Interaction with TXNDC11. {ECO:0000250}.				adenohypophysis morphogenesis (GO:0048855)|bone mineralization (GO:0030282)|cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|fertilization (GO:0009566)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|inner ear development (GO:0048839)|multicellular organism growth (GO:0035264)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|response to virus (GO:0009615)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|peroxidase activity (GO:0004601)	p.N1166K(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	63		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		TCACAAAGACGTTGGGGAATA	0.532																																							uc010bea.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)|pancreas(1)	5						c.(3496-3498)AAC>AAA		dual oxidase 2 precursor							79.0	67.0	71.0					15																	45391598		2198	4298	6496	SO:0001583	missense	50506				cuticle development|cytokine-mediated signaling pathway|hormone biosynthetic process|hydrogen peroxide catabolic process|response to cAMP|response to virus	apical plasma membrane|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|peroxidase activity	g.chr15:45391598G>T	AF181972	CCDS10117.1	15q15.3-q21	2013-01-10			ENSG00000140279	ENSG00000140279		"""EF-hand domain containing"""	13273	protein-coding gene	gene with protein product	"""dual oxidase-like domains 2"", ""nicotinamide adenine dinucleotide phosphate oxidase"", ""flavoprotein NADPH oxidase"", ""NADPH thyroid oxidase 2"", ""NADH/NADPH thyroid oxidase p138-tox"", ""NADPH oxidase/peroxidase DUOX2"""	606759				10601291, 10806195	Standard	NM_014080		Approved	P138-TOX, P138(TOX), THOX2, LNOX2	uc010bea.3	Q9NRD8	OTTHUMG00000131355	ENST00000603300.1:c.3498C>A	15.37:g.45391598G>T	ENSP00000475084:p.Asn1166Lys					DUOX2_uc001zun.2_Missense_Mutation_p.N1166K	p.N1166K	NM_014080	NP_054799	Q9NRD8	DUOX2_HUMAN		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)	26	3701	-		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)	1166			Interaction with TXNDC11 (By similarity).|Helical; (Potential).|Ferric oxidoreductase.		A8MQ13|D2XI64|Q9NR02|Q9UHF9	Missense_Mutation	SNP	ENST00000603300.1	37	c.3498C>A	CCDS10117.1	.	.	.	.	.	.	.	.	.	.	G	7.670	0.686705	0.14973	.	.	ENSG00000140279	ENST00000389039	.	.	.	5.44	-3.23	0.05109	Flavoprotein transmembrane component (1);	0.546561	0.22845	N	0.054931	T	0.06872	0.0175	N	0.01091	-1.02	0.22591	N	0.998954	B	0.02656	0.0	B	0.09377	0.004	T	0.37865	-0.9687	9	0.10377	T	0.69	-3.173	6.9925	0.24763	0.5686:0.0:0.3134:0.1179	.	1166	Q9NRD8	DUOX2_HUMAN	K	1166	.	ENSP00000373691:N1166K	N	-	3	2	DUOX2	43178890	0.000000	0.05858	0.261000	0.24466	0.985000	0.73830	-1.232000	0.02936	-0.489000	0.06716	0.563000	0.77884	AAC		0.532	DUOX2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_014080		16	39	1	0	4.75885e-15	0.00499	6.27069e-15	16	39				
SEMA6D	80031	broad.mit.edu	37	15	48063266	48063266	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr15:48063266G>T	ENST00000316364.5	+	19	2945	c.2506G>T	c.(2506-2508)Gac>Tac	p.D836Y	SEMA6D_ENST00000537942.1_Missense_Mutation_p.D774Y|SEMA6D_ENST00000355997.3_3'UTR|SEMA6D_ENST00000389428.3_Missense_Mutation_p.D761Y|SEMA6D_ENST00000358066.4_Missense_Mutation_p.D774Y|SEMA6D_ENST00000558816.1_3'UTR|SEMA6D_ENST00000389433.2_Missense_Mutation_p.D817Y|SEMA6D_ENST00000354744.4_Missense_Mutation_p.D780Y|SEMA6D_ENST00000558014.1_Missense_Mutation_p.D774Y|SEMA6D_ENST00000536845.2_Missense_Mutation_p.D836Y|SEMA6D_ENST00000389432.2_Missense_Mutation_p.D793Y	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	836					axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.D774Y(1)|p.D836Y(1)		biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		TGCTACCCATGACTACAACAC	0.443																																							uc010bek.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(3)|breast(1)	4						c.(2506-2508)GAC>TAC		semaphorin 6D isoform 4 precursor							108.0	100.0	103.0					15																	48063266		2198	4297	6495	SO:0001583	missense	80031				axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity	g.chr15:48063266G>T	AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.2506G>T	15.37:g.48063266G>T	ENSP00000324857:p.Asp836Tyr					SEMA6D_uc001zvw.2_Missense_Mutation_p.D774Y|SEMA6D_uc001zvy.2_Missense_Mutation_p.D836Y|SEMA6D_uc001zvz.2_Missense_Mutation_p.D780Y|SEMA6D_uc001zwa.2_3'UTR|SEMA6D_uc001zwb.2_Missense_Mutation_p.D774Y|SEMA6D_uc001zwc.2_Missense_Mutation_p.D761Y	p.D836Y	NM_153618	NP_705871	Q8NFY4	SEM6D_HUMAN		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)	19	2866	+		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)	836			Cytoplasmic (Potential).		A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Missense_Mutation	SNP	ENST00000316364.5	37	c.2506G>T	CCDS32225.1	.	.	.	.	.	.	.	.	.	.	G	17.45	3.393752	0.62066	.	.	ENSG00000137872	ENST00000537942;ENST00000536845;ENST00000316364;ENST00000389433;ENST00000389432;ENST00000354744;ENST00000358066;ENST00000389428	T;T;T;T;T;T;T;T	0.18502	2.21;2.23;2.23;2.23;2.21;2.21;2.21;2.21	5.58	5.58	0.84498	.	0.977550	0.08337	N	0.961508	T	0.34221	0.0890	N	0.22421	0.69	0.80722	D	1	P;D;D;P	0.76494	0.933;0.999;0.972;0.799	P;D;P;B	0.70935	0.571;0.971;0.781;0.23	T	0.21280	-1.0250	10	0.59425	D	0.04	.	19.5679	0.95403	0.0:0.0:1.0:0.0	.	761;780;836;774	Q8NFY4-3;Q8NFY4-4;Q8NFY4;Q8NFY4-2	.;.;SEM6D_HUMAN;.	Y	774;836;836;817;793;780;774;761	ENSP00000442040:D774Y;ENSP00000446152:D836Y;ENSP00000324857:D836Y;ENSP00000374084:D817Y;ENSP00000374083:D793Y;ENSP00000346786:D780Y;ENSP00000350770:D774Y;ENSP00000374079:D761Y	ENSP00000324857:D836Y	D	+	1	0	SEMA6D	45850558	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.476000	0.97823	2.613000	0.88420	0.563000	0.77884	GAC		0.443	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416868.1	NM_024966		40	93	1	0	1.57019e-19	0.007835	2.2214e-19	40	93				
CEP152	22995	broad.mit.edu	37	15	49030736	49030736	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr15:49030736C>A	ENST00000380950.2	-	27	5030	c.4843G>T	c.(4843-4845)Ggt>Tgt	p.G1615C	CEP152_ENST00000399334.3_Missense_Mutation_p.G1559C	NM_001194998.1|NM_014985.3	NP_001181927.1|NP_055800.2	O94986	CE152_HUMAN	centrosomal protein 152kDa	1615					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)	p.G1559C(1)		breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(16)|lung(30)|ovary(1)|prostate(2)|skin(2)	63		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		GAAAGATAACCGGATGGTGAA	0.378																																							uc001zwy.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)	2						c.(4675-4677)GGT>TGT		centrosomal protein 152kDa							101.0	100.0	100.0					15																	49030736		1908	4131	6039	SO:0001583	missense	22995				centrosome duplication|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein kinase binding	g.chr15:49030736C>A	AB020719	CCDS42033.1, CCDS58361.1	15q21.1	2014-02-20							29298	protein-coding gene	gene with protein product	"""asterless"""	613529	"""microcephaly, primary autosomal recessive 4"""	MCPH4		14654843, 21131973	Standard	NM_014985		Approved	KIAA0912, SCKL5	uc001zwz.3	O94986		ENST00000380950.2:c.4843G>T	15.37:g.49030736C>A	ENSP00000370337:p.Gly1615Cys					CEP152_uc001zwz.2_Missense_Mutation_p.G1615C	p.G1559C	NM_014985	NP_055800	O94986	CE152_HUMAN		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)	26	4709	-		all_lung(180;0.0428)	1559					E7ER66|Q17RV1|Q6NTA0	Missense_Mutation	SNP	ENST00000380950.2	37	c.4675G>T	CCDS58361.1	.	.	.	.	.	.	.	.	.	.	C	13.17	2.158455	0.38119	.	.	ENSG00000103995	ENST00000399334	T	0.53640	0.61	4.7	2.24	0.28232	.	1.307600	0.05227	N	0.509634	T	0.27967	0.0689	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.23440	-1.0188	10	0.56958	D	0.05	-0.0219	3.939	0.09318	0.1473:0.2519:0.0:0.6007	.	1559	O94986	CE152_HUMAN	C	1559	ENSP00000382271:G1559C	ENSP00000382271:G1559C	G	-	1	0	CEP152	46818028	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.202000	0.09451	0.307000	0.22880	-0.455000	0.05494	GGT		0.378	CEP152-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417365.1	NM_014985		16	53	1	0	2.94398e-08	0.007413	3.38976e-08	16	53				
MYO9A	4649	broad.mit.edu	37	15	72146723	72146723	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr15:72146723T>C	ENST00000356056.5	-	35	6813	c.6341A>G	c.(6340-6342)gAt>gGt	p.D2114G	MYO9A_ENST00000444904.1_Missense_Mutation_p.D2095G|MYO9A_ENST00000564571.1_Missense_Mutation_p.D2114G|MYO9A_ENST00000424560.1_Missense_Mutation_p.D2185G	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	2114	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.|Tail.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)	p.D2114G(1)		NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						CTTACCTGTATCTAGACCCTG	0.333																																							uc002atl.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)|skin(1)	3						c.(6340-6342)GAT>GGT		myosin IXA							121.0	122.0	122.0					15																	72146723		2199	4297	6496	SO:0001583	missense	4649				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|visual perception	cytosol|integral to membrane|unconventional myosin complex	actin binding|ATP binding|GTPase activator activity|metal ion binding|motor activity	g.chr15:72146723T>C	AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.6341A>G	15.37:g.72146723T>C	ENSP00000348349:p.Asp2114Gly					MYO9A_uc002atj.2_Missense_Mutation_p.D27G|MYO9A_uc002atk.2_Missense_Mutation_p.D909G	p.D2114G	NM_006901	NP_008832	B2RTY4	MYO9A_HUMAN			35	6814	-			2114			Phorbol-ester/DAG-type 2.|Tail.|Rho-GAP.		B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Missense_Mutation	SNP	ENST00000356056.5	37	c.6341A>G	CCDS10239.1	.	.	.	.	.	.	.	.	.	.	T	26.4	4.731531	0.89390	.	.	ENSG00000066933	ENST00000356056;ENST00000424560;ENST00000444904	T;T;T	0.51325	0.71;0.71;0.71	5.99	5.99	0.97316	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	.	.	.	.	T	0.74465	0.3720	M	0.88842	2.985	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.79836	-0.1635	9	0.87932	D	0	.	16.4719	0.84113	0.0:0.0:0.0:1.0	.	2114;1878	B2RTY4;B2RTY4-5	MYO9A_HUMAN;.	G	2114;2185;2095	ENSP00000348349:D2114G;ENSP00000399162:D2185G;ENSP00000398250:D2095G	ENSP00000348349:D2114G	D	-	2	0	MYO9A	69933777	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	8.013000	0.88655	2.292000	0.77174	0.482000	0.46254	GAT		0.333	MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257308.1	NM_006901		55	152	0	0	0	0.00361	0	55	152				
MAN2C1	4123	broad.mit.edu	37	15	75652055	75652055	+	Silent	SNP	C	C	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr15:75652055C>T	ENST00000267978.5	-	16	1900	c.1854G>A	c.(1852-1854)gaG>gaA	p.E618E	MAN2C1_ENST00000563622.1_Silent_p.E519E|MAN2C1_ENST00000563539.1_5'Flank|MAN2C1_ENST00000565683.1_Silent_p.E618E|MAN2C1_ENST00000569482.1_Silent_p.E618E	NM_006715.3	NP_006706.2	Q9NTJ4	MA2C1_HUMAN	mannosidase, alpha, class 2C, member 1	618					mannose metabolic process (GO:0006013)		alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)	p.E618E(1)		central_nervous_system(4)|endometrium(4)|kidney(6)|large_intestine(6)|lung(20)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	44						CAGGACCTGGCTCCCCAGCAC	0.627																																							uc002baf.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1852-1854)GAG>GAA		mannosidase, alpha, class 2C, member 1							47.0	46.0	46.0					15																	75652055		2197	4294	6491	SO:0001819	synonymous_variant	4123				mannose metabolic process		alpha-mannosidase activity|carbohydrate binding|protein binding|zinc ion binding	g.chr15:75652055C>T	AF044414	CCDS32298.1, CCDS58389.1, CCDS58390.1, CCDS58391.1	15q24.2	2013-09-19			ENSG00000140400	ENSG00000140400	3.2.1.24		6827	protein-coding gene	gene with protein product		154580		MANA1, MANA		1757461, 752528	Standard	NM_006715		Approved		uc002bah.4	Q9NTJ4	OTTHUMG00000172698	ENST00000267978.5:c.1854G>A	15.37:g.75652055C>T						MAN2C1_uc002bag.2_Silent_p.E618E|MAN2C1_uc002bah.2_Silent_p.E618E|MAN2C1_uc010bkk.2_Silent_p.E519E|MAN2C1_uc010umi.1_Silent_p.E400E	p.E618E	NM_006715	NP_006706	Q9NTJ4	MA2C1_HUMAN			16	1871	-			618					H3BMX2|H3BQY8|H3BUT6|Q13358|Q68EM8|Q9UL64	Silent	SNP	ENST00000267978.5	37	c.1854G>A	CCDS32298.1																																																																																				0.627	MAN2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419965.1			15	49	0	0	0	0.00499	0	15	49				
CSPG4	1464	broad.mit.edu	37	15	75975009	75975009	+	Silent	SNP	C	C	G			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr15:75975009C>G	ENST00000308508.5	-	7	4814	c.4722G>C	c.(4720-4722)gtG>gtC	p.V1574V		NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	1574	Gly/Ser-rich (glycosaminoglycan attachment domain).				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)	p.V1574V(1)		breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						TCTGGGCCGTCACTCGGAAGA	0.632																																							uc002baw.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(4720-4722)GTG>GTC		chondroitin sulfate proteoglycan 4 precursor							58.0	55.0	56.0					15																	75975009		2197	4293	6490	SO:0001819	synonymous_variant	1464				angiogenesis|cell differentiation|intracellular signal transduction|positive regulation of peptidyl-tyrosine phosphorylation|tissue remodeling	apical plasma membrane|cell surface|integral to plasma membrane|intracellular|lamellipodium membrane	protein kinase binding|signal transducer activity	g.chr15:75975009C>G	X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.4722G>C	15.37:g.75975009C>G							p.V1574V	NM_001897	NP_001888	Q6UVK1	CSPG4_HUMAN			7	4815	-			1574			Extracellular (Potential).|Gly/Ser-rich (glycosaminoglycan attachment domain).		D3DW77|Q92675	Silent	SNP	ENST00000308508.5	37	c.4722G>C	CCDS10284.1																																																																																				0.632	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286472.1	NM_001897		27	81	0	0	0	0.005443	0	27	81				
DET1	55070	broad.mit.edu	37	15	89070888	89070888	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr15:89070888C>T	ENST00000268148.8	-	3	1358	c.1213G>A	c.(1213-1215)Gaa>Aaa	p.E405K	DET1_ENST00000564406.1_Missense_Mutation_p.E416K|DET1_ENST00000444300.1_Missense_Mutation_p.E416K	NM_001144074.1	NP_001137546.1	Q7L5Y6	DET1_HUMAN	de-etiolated homolog 1 (Arabidopsis)	405						nucleus (GO:0005634)		p.E416K(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(10)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	Lung NSC(78;0.105)|all_lung(78;0.182)		BRCA - Breast invasive adenocarcinoma(143;0.188)			AACTGAACTTCACTGTGCAGG	0.448																																							uc002bmr.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|pancreas(1)	2						c.(1213-1215)GAA>AAA		de-etiolated 1 isoform 2							87.0	85.0	86.0					15																	89070888		1905	4125	6030	SO:0001583	missense	55070					nucleus		g.chr15:89070888C>T	BC001242	CCDS45343.1, CCDS45344.1	15q25.3	2004-12-13				ENSG00000140543			25477	protein-coding gene	gene with protein product		608727				14739464	Standard	NM_001144074		Approved	FLJ10103	uc002bmq.2	Q7L5Y6		ENST00000268148.8:c.1213G>A	15.37:g.89070888C>T	ENSP00000268148:p.Glu405Lys					DET1_uc002bmp.3_RNA|DET1_uc010bnk.2_Intron|DET1_uc002bmq.2_Missense_Mutation_p.E416K	p.E405K	NM_001144074	NP_001137546	Q7L5Y6	DET1_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.188)		3	1365	-	Lung NSC(78;0.105)|all_lung(78;0.182)		405					B3KNN6|Q2VPC0|Q9NWD5	Missense_Mutation	SNP	ENST00000268148.8	37	c.1213G>A	CCDS45344.1	.	.	.	.	.	.	.	.	.	.	C	11.81	1.749542	0.30955	.	.	ENSG00000140543	ENST00000444300;ENST00000268148	.	.	.	5.91	5.91	0.95273	.	0.047190	0.85682	D	0.000000	T	0.53334	0.1790	L	0.29908	0.895	0.42593	D	0.993258	B;B	0.23650	0.089;0.089	B;B	0.29176	0.063;0.099	T	0.47959	-0.9076	9	0.12103	T	0.63	-29.7779	19.2867	0.94077	0.0:1.0:0.0:0.0	.	405;416	Q7L5Y6;B3KNN6	DET1_HUMAN;.	K	416;405	.	ENSP00000268148:E405K	E	-	1	0	DET1	86871892	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.801000	0.69115	2.793000	0.96121	0.655000	0.94253	GAA		0.448	DET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415442.2	NM_017996		17	40	0	0	0	0.002299	0	17	40				
MSLNL	401827	broad.mit.edu	37	16	823017	823017	+	Missense_Mutation	SNP	T	T	G			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr16:823017T>G	ENST00000442466.1	-	10	1114	c.1115A>C	c.(1114-1116)cAg>cCg	p.Q372P	MIR662_ENST00000384847.1_RNA|MSLNL_ENST00000293892.3_Missense_Mutation_p.Q723P			Q96KJ4	MSLNL_HUMAN	mesothelin-like	372					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.Q723P(1)		breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(15)|ovary(2)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	36						GAGCCGCAGCTGATCCTCCGG	0.672																																							uc002cjz.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(3)|ovary(1)	4						c.(2167-2169)CAG>CCG		mesothelin-like							91.0	110.0	103.0					16																	823017		2185	4268	6453	SO:0001583	missense	401827				cell adhesion	integral to membrane		g.chr16:823017T>G			16p13.3	2008-08-06	2008-07-04	2008-07-04	ENSG00000162006	ENSG00000162006			14170	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 37"""	C16orf37			Standard	NG_032123		Approved	MPFL		Q96KJ4		ENST00000442466.1:c.1115A>C	16.37:g.823017T>G	ENSP00000415767:p.Gln372Pro						p.Q723P	NM_001025190	NP_001020361	Q96KJ4	MSLNL_HUMAN			11	2168	-			372			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000442466.1	37	c.2168A>C		.	.	.	.	.	.	.	.	.	.	T	11.24	1.579587	0.28180	.	.	ENSG00000162006	ENST00000543963;ENST00000442466;ENST00000293892	T;T;T	0.11169	2.8;2.8;2.8	4.57	2.24	0.28232	.	0.000000	0.64402	D	0.000001	T	0.25680	0.0625	.	.	.	0.40895	D	0.984101	D	0.76494	0.999	D	0.79784	0.993	T	0.01528	-1.1332	9	0.62326	D	0.03	-28.3286	4.4417	0.11577	0.1719:0.0952:0.0:0.7329	.	372	Q96KJ4	MSLNL_HUMAN	P	422;372;723	ENSP00000441381:Q422P;ENSP00000415767:Q372P;ENSP00000293892:Q723P	ENSP00000293892:Q723P	Q	-	2	0	MSLNL	763018	1.000000	0.71417	0.513000	0.27749	0.266000	0.26442	2.673000	0.46858	0.252000	0.21531	0.448000	0.29417	CAG		0.672	MSLNL-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_001025190		14	149	0	0	0	0.010504	0	14	149				
TNRC6A	27327	broad.mit.edu	37	16	24802953	24802953	+	Missense_Mutation	SNP	G	G	T	rs368712374		TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr16:24802953G>T	ENST00000395799.3	+	6	3119	c.2990G>T	c.(2989-2991)cGc>cTc	p.R997L	TNRC6A_ENST00000315183.7_Missense_Mutation_p.R997L	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	997	Sufficient for interaction with AGO1 and AGO4.				cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R997L(1)		breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		TCTATACGTCGCAAAATGGAG	0.483																																							uc002dmm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(2989-2991)CGC>CTC		trinucleotide repeat containing 6A							56.0	54.0	54.0					16																	24802953		2197	4300	6497	SO:0001583	missense	27327				negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|micro-ribonucleoprotein complex	nucleotide binding|RNA binding	g.chr16:24802953G>T	U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.2990G>T	16.37:g.24802953G>T	ENSP00000379144:p.Arg997Leu					TNRC6A_uc010bxs.2_Missense_Mutation_p.R744L|TNRC6A_uc010vcc.1_Missense_Mutation_p.R744L|TNRC6A_uc002dmn.2_Missense_Mutation_p.R744L|TNRC6A_uc002dmo.2_Missense_Mutation_p.R744L	p.R997L	NM_014494	NP_055309	Q8NDV7	TNR6A_HUMAN		GBM - Glioblastoma multiforme(48;0.0394)	6	3104	+			997			Sufficient for interaction with EIF2C1 and EIF2C4.		C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Missense_Mutation	SNP	ENST00000395799.3	37	c.2990G>T	CCDS10624.2	.	.	.	.	.	.	.	.	.	.	G	29.3	4.994156	0.93167	.	.	ENSG00000090905	ENST00000315183;ENST00000395799	T;T	0.39056	1.1;1.14	5.44	5.44	0.79542	.	0.073357	0.64402	D	0.000009	T	0.67951	0.2948	M	0.76838	2.35	0.80722	D	1	D;D;D	0.89917	0.994;1.0;1.0	D;D;D	0.87578	0.978;0.998;0.995	T	0.70033	-0.4983	10	0.62326	D	0.03	-5.2849	19.6173	0.95639	0.0:0.0:1.0:0.0	.	744;997;997	Q8NDV7-2;Q8NDV7-6;Q8NDV7	.;.;TNR6A_HUMAN	L	997	ENSP00000326900:R997L;ENSP00000379144:R997L	ENSP00000326900:R997L	R	+	2	0	TNRC6A	24710454	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.358000	0.97109	2.700000	0.92200	0.655000	0.94253	CGC		0.483	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214081.1	NM_020847		13	73	1	0	2.31682e-05	0.003163	2.49451e-05	13	73				
KIAA0556	23247	broad.mit.edu	37	16	27772805	27772805	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr16:27772805G>T	ENST00000261588.4	+	19	3722	c.3703G>T	c.(3703-3705)Ggc>Tgc	p.G1235C		NM_015202.2	NP_056017.2	O60303	K0556_HUMAN	KIAA0556	1235						extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.G1235C(2)		breast(4)|endometrium(7)|kidney(8)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	76						GGAAGTGGTGGGCAAGGAGGG	0.602																																							uc002dow.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|large_intestine(2)|upper_aerodigestive_tract(1)|skin(1)	8						c.(3703-3705)GGC>TGC		hypothetical protein LOC23247							78.0	70.0	73.0					16																	27772805		2197	4300	6497	SO:0001583	missense	23247							g.chr16:27772805G>T	AB011128	CCDS32415.1	16p12.1-p11.2	2012-11-30			ENSG00000047578	ENSG00000047578			29068	protein-coding gene	gene with protein product						9628581	Standard	NM_015202		Approved		uc002dow.3	O60303	OTTHUMG00000176780	ENST00000261588.4:c.3703G>T	16.37:g.27772805G>T	ENSP00000261588:p.Gly1235Cys						p.G1235C	NM_015202	NP_056017	O60303	K0556_HUMAN			19	3727	+			1235					A7E2C2	Missense_Mutation	SNP	ENST00000261588.4	37	c.3703G>T	CCDS32415.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.942771	0.73672	.	.	ENSG00000047578	ENST00000261588	T	0.16196	2.36	4.56	3.56	0.40772	.	0.106552	0.64402	D	0.000005	T	0.43322	0.1242	M	0.85710	2.77	0.51233	D	0.999916	D	0.89917	1.0	D	0.81914	0.995	T	0.44097	-0.9350	10	0.87932	D	0	-19.3973	10.8254	0.46629	0.1002:0.0:0.8998:0.0	.	1235	O60303	K0556_HUMAN	C	1235	ENSP00000261588:G1235C	ENSP00000261588:G1235C	G	+	1	0	KIAA0556	27680306	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	6.595000	0.74109	0.830000	0.34757	0.561000	0.74099	GGC		0.602	KIAA0556-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433724.1	NM_015202		11	55	1	0	1.58986e-06	0.008291	1.76383e-06	11	55				
SETD1A	9739	broad.mit.edu	37	16	30991099	30991099	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr16:30991099C>T	ENST00000262519.8	+	14	4678	c.3992C>T	c.(3991-3993)cCa>cTa	p.P1331L		NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A	1331					histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.P1331L(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						TTCAGTTCCCCAGCTGATGAG	0.716																																							uc002ead.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(3991-3993)CCA>CTA		SET domain containing 1A							6.0	8.0	7.0					16																	30991099		2064	4051	6115	SO:0001583	missense	9739				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nuclear speck|Set1C/COMPASS complex	histone-lysine N-methyltransferase activity|nucleotide binding|protein binding|RNA binding	g.chr16:30991099C>T	AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.3992C>T	16.37:g.30991099C>T	ENSP00000262519:p.Pro1331Leu						p.P1331L	NM_014712	NP_055527	O15047	SET1A_HUMAN			14	4678	+			1331					A6NP62|Q6PIF3|Q8TAJ6	Missense_Mutation	SNP	ENST00000262519.8	37	c.3992C>T	CCDS32435.1	.	.	.	.	.	.	.	.	.	.	C	12.80	2.047789	0.36085	.	.	ENSG00000099381	ENST00000262519	D	0.94046	-3.34	4.81	4.81	0.61882	.	0.063219	0.64402	D	0.000005	D	0.87653	0.6231	L	0.27053	0.805	0.49389	D	0.999789	B	0.15473	0.013	B	0.11329	0.006	D	0.83903	0.0291	10	0.45353	T	0.12	.	11.0212	0.47720	0.0:0.9082:0.0:0.0918	.	1331	O15047	SET1A_HUMAN	L	1331	ENSP00000262519:P1331L	ENSP00000262519:P1331L	P	+	2	0	SETD1A	30898600	0.993000	0.37304	0.929000	0.37066	0.755000	0.42902	4.317000	0.59184	2.220000	0.72140	0.563000	0.77884	CCA		0.716	SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318244.2	NM_014712		4	7	0	0	0	0.001168	0	4	7				
ITGAX	3687	broad.mit.edu	37	16	31374568	31374568	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr16:31374568T>A	ENST00000268296.4	+	14	1704	c.1583T>A	c.(1582-1584)cTg>cAg	p.L528Q	ITGAX_ENST00000562522.1_Missense_Mutation_p.L528Q	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	528					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)	p.L528Q(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						CTGACAGTGCTGGGGGATGTG	0.602																																							uc002ebu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)|pancreas(1)	4						c.(1582-1584)CTG>CAG		integrin alpha X precursor							121.0	130.0	127.0					16																	31374568		2197	4300	6497	SO:0001583	missense	3687				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration|organ morphogenesis	integrin complex	protein binding|receptor activity	g.chr16:31374568T>A	BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.1583T>A	16.37:g.31374568T>A	ENSP00000268296:p.Leu528Gln					ITGAX_uc002ebt.2_Missense_Mutation_p.L528Q|ITGAX_uc010vfk.1_Missense_Mutation_p.L178Q	p.L528Q	NM_000887	NP_000878	P20702	ITAX_HUMAN			14	1650	+			528			Extracellular (Potential).|FG-GAP 6.		Q8IVA6	Missense_Mutation	SNP	ENST00000268296.4	37	c.1583T>A	CCDS10711.1	.	.	.	.	.	.	.	.	.	.	T	19.88	3.909894	0.72983	.	.	ENSG00000140678	ENST00000268296	T	0.68025	-0.3	4.03	4.03	0.46877	.	.	.	.	.	D	0.86306	0.5901	H	0.97023	3.925	0.43994	D	0.996699	D	0.89917	1.0	D	0.91635	0.999	D	0.89293	0.3620	9	0.87932	D	0	.	10.7789	0.46367	0.0:0.0:0.0:1.0	.	528	P20702	ITAX_HUMAN	Q	528	ENSP00000268296:L528Q	ENSP00000268296:L528Q	L	+	2	0	ITGAX	31282069	0.994000	0.37717	1.000000	0.80357	0.870000	0.49936	3.733000	0.55029	1.589000	0.49982	0.377000	0.23210	CTG		0.602	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255628.2	NM_000887		62	203	0	0	0	0.00361	0	62	203				
TGFB1I1	7041	broad.mit.edu	37	16	31484820	31484820	+	Silent	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr16:31484820C>A	ENST00000394863.3	+	2	202	c.72C>A	c.(70-72)ccC>ccA	p.P24P	TGFB1I1_ENST00000361773.3_Silent_p.P7P|TGFB1I1_ENST00000567607.1_Silent_p.P7P|TGFB1I1_ENST00000394858.2_Silent_p.P7P	NM_001042454.2	NP_001035919.1	O43294	TGFI1_HUMAN	transforming growth factor beta 1 induced transcript 1	24	Interaction with PTK2B/PYK2.|Transcription activation. {ECO:0000250}.				androgen receptor signaling pathway (GO:0030521)|cell adhesion (GO:0007155)|cell fate commitment (GO:0045165)|epithelial cell differentiation (GO:0030855)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|response to heat (GO:0009408)|transcription from RNA polymerase II promoter (GO:0006366)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)|intracellular (GO:0005622)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|I-SMAD binding (GO:0070411)|Roundabout binding (GO:0048495)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.P24P(1)|p.P7P(1)		lung(8)|upper_aerodigestive_tract(1)	9						CAGGGGCTCCCAAAGAGCGCC	0.637																																							uc002ecd.1		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(70-72)CCC>CCA		transforming growth factor beta 1 induced							47.0	51.0	50.0					16																	31484820		2197	4300	6497	SO:0001819	synonymous_variant	7041				androgen receptor signaling pathway|cell adhesion|negative regulation of cell proliferation|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription, DNA-dependent|positive regulation of transforming growth factor beta receptor signaling pathway|transcription from RNA polymerase II promoter|ubiquitin-dependent SMAD protein catabolic process|Wnt receptor signaling pathway	cytoplasm|cytoskeleton|focal adhesion|nuclear matrix	androgen receptor binding|I-SMAD binding|Roundabout binding|transcription coactivator activity|zinc ion binding	g.chr16:31484820C>A	AB007836	CCDS10713.1, CCDS42156.1	16p11	2008-02-05			ENSG00000140682	ENSG00000140682			11767	protein-coding gene	gene with protein product		602353				9422762, 10075738	Standard	NM_015927		Approved	Hic-5, TSC-5, ARA55, HIC-5	uc002ecd.2	O43294	OTTHUMG00000132467	ENST00000394863.3:c.72C>A	16.37:g.31484820C>A						TGFB1I1_uc002ece.1_Silent_p.P7P|TGFB1I1_uc010caq.1_5'UTR	p.P24P	NM_001042454	NP_001035919	O43294	TGFI1_HUMAN			2	98	+			24			Transcription activation (By similarity).|Interaction with PTK2B.		B2R8D5|Q9BPW3|Q9Y2V5	Silent	SNP	ENST00000394863.3	37	c.72C>A	CCDS42156.1																																																																																				0.637	TGFB1I1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255630.3			10	54	1	0	1.41608e-15	0.001855	1.90025e-15	10	54				
GPT2	84706	broad.mit.edu	37	16	46962902	46962902	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr16:46962902A>G	ENST00000340124.4	+	12	1677	c.1565A>G	c.(1564-1566)tAc>tGc	p.Y522C	GPT2_ENST00000440783.2_Missense_Mutation_p.Y422C	NM_133443.2	NP_597700.1	Q8TD30	ALAT2_HUMAN	glutamic pyruvate transaminase (alanine aminotransferase) 2	522					2-oxoglutarate metabolic process (GO:0006103)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-alanine catabolic process (GO:0042853)|L-alanine metabolic process (GO:0042851)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	L-alanine:2-oxoglutarate aminotransferase activity (GO:0004021)|pyridoxal phosphate binding (GO:0030170)	p.Y522C(1)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(2)	23		all_cancers(37;0.0276)|all_epithelial(9;0.0498)|all_lung(18;0.0522)			L-Alanine(DB00160)|Phenelzine(DB00780)	CTGGAGAAGTACGCGTGAGGA	0.597																																							uc002eel.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1564-1566)TAC>TGC		glutamic pyruvate transaminase 2 isoform 1	L-Alanine(DB00160)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)						110.0	84.0	93.0					16																	46962902		2203	4300	6503	SO:0001583	missense	84706				2-oxoglutarate metabolic process|cellular amino acid biosynthetic process|L-alanine metabolic process	mitochondrial matrix	L-alanine:2-oxoglutarate aminotransferase activity|pyridoxal phosphate binding	g.chr16:46962902A>G		CCDS10725.1, CCDS45478.1	16q12.1	2008-02-05			ENSG00000166123	ENSG00000166123	2.6.1.2		18062	protein-coding gene	gene with protein product		138210					Standard	NM_133443		Approved	ALT2	uc002eel.3	Q8TD30	OTTHUMG00000132541	ENST00000340124.4:c.1565A>G	16.37:g.46962902A>G	ENSP00000345282:p.Tyr522Cys					GPT2_uc002eem.2_Missense_Mutation_p.Y422C|GPT2_uc002een.2_Missense_Mutation_p.Y165C	p.Y522C	NM_133443	NP_597700	Q8TD30	ALAT2_HUMAN			12	1659	+		all_cancers(37;0.0276)|all_epithelial(9;0.0498)|all_lung(18;0.0522)	522					Q8N9E2	Missense_Mutation	SNP	ENST00000340124.4	37	c.1565A>G	CCDS10725.1	.	.	.	.	.	.	.	.	.	.	A	11.94	1.789912	0.31685	.	.	ENSG00000166123	ENST00000340124;ENST00000440783	D;D	0.90504	-2.68;-2.42	4.59	2.25	0.28309	.	0.139445	0.49916	D	0.000125	D	0.96046	0.8712	H	0.96547	3.84	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.70227	0.968;0.931	D	0.94834	0.7999	10	0.87932	D	0	.	9.6235	0.39737	0.721:0.0:0.0:0.279	.	422;522	Q8TD30-2;Q8TD30	.;ALAT2_HUMAN	C	522;422	ENSP00000345282:Y522C;ENSP00000413804:Y422C	ENSP00000345282:Y522C	Y	+	2	0	GPT2	45520403	0.990000	0.36364	0.263000	0.24496	0.062000	0.15995	2.911000	0.48774	0.242000	0.21303	-0.468000	0.05107	TAC		0.597	GPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255741.2			15	43	0	0	0	0.004007	0	15	43				
ZFHX3	463	broad.mit.edu	37	16	72830619	72830619	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr16:72830619A>T	ENST00000268489.5	-	9	6634	c.5962T>A	c.(5962-5964)Tgc>Agc	p.C1988S	ZFHX3_ENST00000397992.5_Missense_Mutation_p.C1074S	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	1988					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.C1988S(1)		NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				AACTTGCCGCAGGAGTCACAC	0.433																																							uc002fck.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)	4						c.(5962-5964)TGC>AGC		zinc finger homeobox 3 isoform A							109.0	105.0	106.0					16																	72830619		2198	4300	6498	SO:0001583	missense	463				muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding	g.chr16:72830619A>T	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.5962T>A	16.37:g.72830619A>T	ENSP00000268489:p.Cys1988Ser					ZFHX3_uc002fcl.2_Missense_Mutation_p.C1074S	p.C1988S	NM_006885	NP_008816	Q15911	ZFHX3_HUMAN			9	6635	-		Ovarian(137;0.13)	1988			C2H2-type 17.		D3DWS8|O15101|Q13719	Missense_Mutation	SNP	ENST00000268489.5	37	c.5962T>A	CCDS10908.1	.	.	.	.	.	.	.	.	.	.	A	15.04	2.715573	0.48622	.	.	ENSG00000140836	ENST00000268489;ENST00000397992	T;T	0.59083	0.29;1.06	5.75	5.75	0.90469	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.53938	D	0.000042	T	0.73837	0.3638	M	0.64404	1.975	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.76380	-0.2980	10	0.72032	D	0.01	.	16.056	0.80805	1.0:0.0:0.0:0.0	.	1988	Q15911	ZFHX3_HUMAN	S	1988;1074	ENSP00000268489:C1988S;ENSP00000438926:C1074S	ENSP00000268489:C1988S	C	-	1	0	ZFHX3	71388120	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.329000	0.96413	2.178000	0.69098	0.533000	0.62120	TGC		0.433	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885		49	165	0	0	0	0.00361	0	49	165				
IRF8	3394	broad.mit.edu	37	16	85945192	85945192	+	Silent	SNP	A	A	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr16:85945192A>T	ENST00000268638.5	+	4	797	c.375A>T	c.(373-375)gcA>gcT	p.A125A	IRF8_ENST00000562492.1_5'Flank	NM_002163.2	NP_002154.1	Q02556	IRF8_HUMAN	interferon regulatory factor 8	125					cellular response to lipopolysaccharide (GO:0071222)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|myeloid cell differentiation (GO:0030099)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phagocytosis (GO:0006909)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)	p.A125A(1)		breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	24		Prostate(104;0.0771)				TAGGCGTGGCAACTGCTGGCT	0.507																																							uc002fjh.2		NA																	1	Substitution - coding silent(1)		lung(1)	breast(2)|ovary(1)	3						c.(373-375)GCA>GCT		interferon regulatory factor 8							138.0	118.0	125.0					16																	85945192		2198	4300	6498	SO:0001819	synonymous_variant	3394				interferon-gamma-mediated signaling pathway|negative regulation of transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	nucleus	DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity	g.chr16:85945192A>T	M91196	CCDS10956.1	16q24.1	2014-09-17	2004-11-12	2004-11-12	ENSG00000140968	ENSG00000140968			5358	protein-coding gene	gene with protein product		601565	"""interferon consensus sequence binding protein 1"""	ICSBP1		1460054, 11997525	Standard	NM_002163		Approved	IRF-8, ICSBP	uc002fjh.3	Q02556	OTTHUMG00000137648	ENST00000268638.5:c.375A>T	16.37:g.85945192A>T						IRF8_uc010chp.2_RNA	p.A125A	NM_002163	NP_002154	Q02556	IRF8_HUMAN			4	432	+		Prostate(104;0.0771)	125					A0AV82	Silent	SNP	ENST00000268638.5	37	c.375A>T	CCDS10956.1																																																																																				0.507	IRF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269100.2	NM_002163		7	56	0	0	0	0.001855	0	7	56				
VPS53	55275	broad.mit.edu	37	17	600720	600720	+	Missense_Mutation	SNP	G	G	T	rs138068150		TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr17:600720G>T	ENST00000571805.1	-	4	359	c.223C>A	c.(223-225)Ctg>Atg	p.L75M	VPS53_ENST00000291074.5_Missense_Mutation_p.L75M|VPS53_ENST00000437048.2_Missense_Mutation_p.L75M|VPS53_ENST00000574029.1_Intron|VPS53_ENST00000401468.3_Missense_Mutation_p.L75M|VPS53_ENST00000446250.2_De_novo_Start_OutOfFrame			Q5VIR6	VPS53_HUMAN	vacuolar protein sorting 53 homolog (S. cerevisiae)	75					protein transport (GO:0015031)	endosome (GO:0005768)|GARP complex (GO:0000938)|membrane (GO:0016020)		p.L75M(2)		breast(1)|endometrium(4)|large_intestine(5)|lung(8)|prostate(1)	19				UCEC - Uterine corpus endometrioid carcinoma (25;0.0265)		TTGTCATCCAGTCTCCTAGCA	0.378																																							uc002frn.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(223-225)CTG>ATG		vacuolar protein sorting 53 isoform 2							182.0	145.0	158.0					17																	600720		2203	4300	6503	SO:0001583	missense	55275				protein transport	endosome membrane|Golgi apparatus		g.chr17:600720G>T		CCDS10995.1, CCDS45558.1	17p13.3	2007-07-13	2006-12-19			ENSG00000141252			25608	protein-coding gene	gene with protein product		615850	"""vacuolar protein sorting 53 (yeast)"""			15878329	Standard	NM_018289		Approved	FLJ10979, HCCS1	uc010cjo.2	Q5VIR6		ENST00000571805.1:c.223C>A	17.37:g.600720G>T	ENSP00000459312:p.Leu75Met					VPS53_uc010cjo.1_Missense_Mutation_p.L75M|VPS53_uc002frl.2_RNA|VPS53_uc002frm.2_Missense_Mutation_p.L75M|VPS53_uc002fro.2_Translation_Start_Site|VPS53_uc010cjp.1_Missense_Mutation_p.L75M	p.L75M	NM_018289	NP_060759	Q5VIR6	VPS53_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (25;0.0265)	4	370	-			75			Potential.		A8K2S8|B3FH42|Q8WYW3|Q9BRR2|Q9BY02|Q9NV25	Missense_Mutation	SNP	ENST00000571805.1	37	c.223C>A		.	.	.	.	.	.	.	.	.	.	G	19.79	3.892262	0.72524	.	.	ENSG00000141252	ENST00000437048;ENST00000291074;ENST00000401468;ENST00000389040	T;T;T;T	0.43688	1.3;0.94;1.3;1.3	5.95	5.95	0.96441	Vps53-like, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.65428	0.2690	M	0.83953	2.67	0.80722	D	1	D;D;D;D	0.71674	0.997;0.998;0.998;0.998	D;D;D;D	0.80764	0.992;0.982;0.994;0.99	T	0.68914	-0.5283	10	0.72032	D	0.01	-14.2493	11.3044	0.49325	0.0823:0.0:0.9177:0.0	.	75;75;75;75	E7EVT8;Q5VIR6-4;Q5VIR6;Q5VIR6-2	.;.;VPS53_HUMAN;.	M	75	ENSP00000401435:L75M;ENSP00000291074:L75M;ENSP00000384294:L75M;ENSP00000373692:L75M	ENSP00000291074:L75M	L	-	1	2	VPS53	547470	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	3.051000	0.49885	2.827000	0.97445	0.650000	0.86243	CTG		0.378	VPS53-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000436940.2	NM_018289		46	112	1	0	2.14674e-31	0.00361	3.40678e-31	46	112				
VPS53	55275	broad.mit.edu	37	17	600722	600722	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr17:600722C>T	ENST00000571805.1	-	4	357	c.221G>A	c.(220-222)aGa>aAa	p.R74K	VPS53_ENST00000291074.5_Missense_Mutation_p.R74K|VPS53_ENST00000437048.2_Missense_Mutation_p.R74K|VPS53_ENST00000574029.1_Intron|VPS53_ENST00000401468.3_Missense_Mutation_p.R74K|VPS53_ENST00000446250.2_5'UTR			Q5VIR6	VPS53_HUMAN	vacuolar protein sorting 53 homolog (S. cerevisiae)	74					protein transport (GO:0015031)	endosome (GO:0005768)|GARP complex (GO:0000938)|membrane (GO:0016020)		p.R74K(2)		breast(1)|endometrium(4)|large_intestine(5)|lung(8)|prostate(1)	19				UCEC - Uterine corpus endometrioid carcinoma (25;0.0265)		GTCATCCAGTCTCCTAGCAAA	0.383																																							uc002frn.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(220-222)AGA>AAA		vacuolar protein sorting 53 isoform 2							179.0	143.0	155.0					17																	600722		2203	4300	6503	SO:0001583	missense	55275				protein transport	endosome membrane|Golgi apparatus		g.chr17:600722C>T		CCDS10995.1, CCDS45558.1	17p13.3	2007-07-13	2006-12-19			ENSG00000141252			25608	protein-coding gene	gene with protein product		615850	"""vacuolar protein sorting 53 (yeast)"""			15878329	Standard	NM_018289		Approved	FLJ10979, HCCS1	uc010cjo.2	Q5VIR6		ENST00000571805.1:c.221G>A	17.37:g.600722C>T	ENSP00000459312:p.Arg74Lys					VPS53_uc010cjo.1_Missense_Mutation_p.R74K|VPS53_uc002frl.2_RNA|VPS53_uc002frm.2_Missense_Mutation_p.R74K|VPS53_uc002fro.2_5'UTR|VPS53_uc010cjp.1_Missense_Mutation_p.R74K	p.R74K	NM_018289	NP_060759	Q5VIR6	VPS53_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (25;0.0265)	4	368	-			74			Potential.		A8K2S8|B3FH42|Q8WYW3|Q9BRR2|Q9BY02|Q9NV25	Missense_Mutation	SNP	ENST00000571805.1	37	c.221G>A		.	.	.	.	.	.	.	.	.	.	C	8.956	0.969466	0.18659	.	.	ENSG00000141252	ENST00000437048;ENST00000291074;ENST00000401468;ENST00000389040	T;T;T;T	0.28666	1.6;2.07;1.6;1.6	5.95	4.98	0.66077	Vps53-like, N-terminal (1);	0.131508	0.64402	D	0.000004	T	0.18882	0.0453	L	0.31120	0.905	0.80722	D	1	B;B;B;B	0.06786	0.001;0.0;0.0;0.0	B;B;B;B	0.10450	0.001;0.002;0.005;0.003	T	0.04427	-1.0952	10	0.05351	T	0.99	-25.8568	11.5705	0.50830	0.0:0.9182:0.0:0.0818	.	74;74;74;74	E7EVT8;Q5VIR6-4;Q5VIR6;Q5VIR6-2	.;.;VPS53_HUMAN;.	K	74	ENSP00000401435:R74K;ENSP00000291074:R74K;ENSP00000384294:R74K;ENSP00000373692:R74K	ENSP00000291074:R74K	R	-	2	0	VPS53	547472	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	3.038000	0.49783	2.827000	0.97445	0.650000	0.86243	AGA		0.383	VPS53-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000436940.2	NM_018289		44	111	0	0	0	0.00361	0	44	111				
OR1D5	8386	broad.mit.edu	37	17	2966252	2966252	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr17:2966252G>T	ENST00000575751.1	-	1	649	c.650C>A	c.(649-651)tCc>tAc	p.S217Y		NM_014566.1	NP_055381.1	P58170	OR1D5_HUMAN	olfactory receptor, family 1, subfamily D, member 5	217					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S217F(4)|p.S217Y(2)		kidney(1)|lung(10)	11						ACGTACATAGGATGTGGTCAT	0.507																																							uc010vra.1		NA																	6	Substitution - Missense(6)		lung(6)		0						c.(703-705)TCC>TAC		olfactory receptor, family 1, subfamily D,							67.0	78.0	74.0					17																	2966252		2161	4280	6441	SO:0001583	missense	8385							g.chr17:2966252G>T	AF087923	CCDS58499.1	17p13.3	2012-10-09			ENSG00000262628	ENSG00000262628		"""GPCR / Class A : Olfactory receptors"""	8186	protein-coding gene	gene with protein product						10673334	Standard	NM_014566		Approved	OR17-31	uc021tns.1	P58170	OTTHUMG00000177676	ENST00000575751.1:c.650C>A	17.37:g.2966252G>T	ENSP00000459028:p.Ser217Tyr						p.S235Y	NM_003552	NP_003543					1	704	-								Q96RA6	Missense_Mutation	SNP	ENST00000575751.1	37	c.704C>A	CCDS58499.1																																																																																				0.507	OR1D5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438410.2	NM_014566		12	50	1	0	9.31168e-06	0.001855	1.01154e-05	12	50				
OR3A4P	390756	broad.mit.edu	37	17	3213643	3213643	+	RNA	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr17:3213643C>A	ENST00000573491.1	-	0	359																		p.T13T(1)									CAGTTGTGACCAAGTTTGTCC	0.537																																							uc002fvi.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(37-39)ACC>ACA		RecName: Full=Olfactory receptor 3A4; AltName: Full=Olfactory receptor 17-24;          Short=OR17-24;							188.0	160.0	169.0					17																	3213643		2203	4300	6503			390756							g.chr17:3213643C>A																													17.37:g.3213643C>A							p.T13T	NR_024128						1	105	+									Silent	SNP	ENST00000573491.1	37	c.39C>A																																																																																					0.537	RP11-64J4.2-001	KNOWN	basic	sense_overlapping	sense_overlapping	OTTHUMT00000438371.1			28	104	1	0	1.30897e-18	0.009535	1.83759e-18	28	104				
POLR2A	5430	broad.mit.edu	37	17	7405880	7405880	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr17:7405880G>A	ENST00000322644.6	+	16	3015	c.2616G>A	c.(2614-2616)atG>atA	p.M872I		NM_000937.4	NP_000928	P24928	RPB1_HUMAN	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	872					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA-directed RNA polymerase activity (GO:0003968)|ubiquitin protein ligase binding (GO:0031625)	p.M872I(1)		breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(17)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	50		Prostate(122;0.173)				AGTCAGTGATGGTGAAGTACG	0.582																																							uc002ghf.3		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(2614-2616)ATG>ATA		DNA-directed RNA polymerase II A							94.0	83.0	87.0					17																	7405880		2203	4300	6503	SO:0001583	missense	5430				mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|RNA-directed RNA polymerase activity|ubiquitin protein ligase binding	g.chr17:7405880G>A			17p13.1	2013-01-21	2002-08-29		ENSG00000181222	ENSG00000181222	2.7.7.6	"""RNA polymerase subunits"""	9187	protein-coding gene	gene with protein product	"""DNA-directed RNA polymerase II largest subunit, RNA polymerase II 220 kd subunit"", ""RNA polymerase II subunit B1"""	180660	"""polymerase (RNA) II (DNA directed) polypeptide A (220kD)"""	POLR2			Standard	NM_000937		Approved	POLRA, RPB1	uc002ghf.4	P24928	OTTHUMG00000177594	ENST00000322644.6:c.2616G>A	17.37:g.7405880G>A	ENSP00000314949:p.Met872Ile						p.M872I	NM_000937	NP_000928	P24928	RPB1_HUMAN			16	2850	+		Prostate(122;0.173)	872					A6NN93|B9EH88|Q6NX41	Missense_Mutation	SNP	ENST00000322644.6	37	c.2616G>A	CCDS32548.1	.	.	.	.	.	.	.	.	.	.	G	35	5.596897	0.96602	.	.	ENSG00000181222	ENST00000535204;ENST00000322644	T	0.75938	-0.98	5.82	5.82	0.92795	RNA polymerase Rpb1, domain 5 (1);	0.000000	0.85682	D	0.000000	T	0.80793	0.4691	M	0.82433	2.59	0.80722	D	1	P	0.42757	0.789	B	0.43194	0.411	D	0.83837	0.0255	10	0.87932	D	0	-15.4911	18.8608	0.92271	0.0:0.0:1.0:0.0	.	872	P24928	RPB1_HUMAN	I	828;872	ENSP00000314949:M872I	ENSP00000314949:M872I	M	+	3	0	SLC35G6	7346604	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	9.171000	0.94802	2.761000	0.94854	0.655000	0.94253	ATG		0.582	POLR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437967.1	NM_000937		19	63	0	0	0	0.010504	0	19	63				
POLR2A	5430	broad.mit.edu	37	17	7405883	7405883	+	Silent	SNP	G	G	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr17:7405883G>A	ENST00000322644.6	+	16	3018	c.2619G>A	c.(2617-2619)gtG>gtA	p.V873V		NM_000937.4	NP_000928	P24928	RPB1_HUMAN	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	873					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA-directed RNA polymerase activity (GO:0003968)|ubiquitin protein ligase binding (GO:0031625)	p.V873V(1)		breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(17)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	50		Prostate(122;0.173)				CAGTGATGGTGAAGTACGACG	0.587																																							uc002ghf.3		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(1)	1						c.(2617-2619)GTG>GTA		DNA-directed RNA polymerase II A							96.0	85.0	89.0					17																	7405883		2203	4300	6503	SO:0001819	synonymous_variant	5430				mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|RNA-directed RNA polymerase activity|ubiquitin protein ligase binding	g.chr17:7405883G>A			17p13.1	2013-01-21	2002-08-29		ENSG00000181222	ENSG00000181222	2.7.7.6	"""RNA polymerase subunits"""	9187	protein-coding gene	gene with protein product	"""DNA-directed RNA polymerase II largest subunit, RNA polymerase II 220 kd subunit"", ""RNA polymerase II subunit B1"""	180660	"""polymerase (RNA) II (DNA directed) polypeptide A (220kD)"""	POLR2			Standard	NM_000937		Approved	POLRA, RPB1	uc002ghf.4	P24928	OTTHUMG00000177594	ENST00000322644.6:c.2619G>A	17.37:g.7405883G>A							p.V873V	NM_000937	NP_000928	P24928	RPB1_HUMAN			16	2853	+		Prostate(122;0.173)	873					A6NN93|B9EH88|Q6NX41	Silent	SNP	ENST00000322644.6	37	c.2619G>A	CCDS32548.1																																																																																				0.587	POLR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437967.1	NM_000937		20	66	0	0	0	0.012319	0	20	66				
GAS7	8522	broad.mit.edu	37	17	9820602	9820602	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr17:9820602C>G	ENST00000432992.2	-	14	1534	c.1374G>C	c.(1372-1374)gaG>gaC	p.E458D	GAS7_ENST00000437099.2_Missense_Mutation_p.E394D|GAS7_ENST00000583882.1_Intron|GAS7_ENST00000585266.1_Missense_Mutation_p.E398D|GAS7_ENST00000323816.4_Missense_Mutation_p.E398D|GAS7_ENST00000580865.1_Missense_Mutation_p.E318D|GAS7_ENST00000540214.1_Missense_Mutation_p.E163D|GAS7_ENST00000396115.2_Missense_Mutation_p.E163D|GAS7_ENST00000542249.1_Missense_Mutation_p.E394D|GAS7_ENST00000579158.1_Missense_Mutation_p.E394D	NM_201433.1	NP_958839.1	O60861	GAS7_HUMAN	growth arrest-specific 7	458					actin filament bundle assembly (GO:0051017)|actin filament polymerization (GO:0030041)|cell cycle arrest (GO:0007050)|neuron projection morphogenesis (GO:0048812)|regulation of cell shape (GO:0008360)|regulation of transcription, DNA-templated (GO:0006355)	actin filament (GO:0005884)|cytoplasm (GO:0005737)|ruffle (GO:0001726)	sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E318D(1)|p.E458D(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(7)|lung(18)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	39						TGACCCACAGCTCCCTGTCTT	0.612			T	MLL	AML*																																		uc002gmg.1		NA		Dom	yes		17	17p	8522	T	growth arrest-specific 7			L	MLL		AML*		2	Substitution - Missense(2)		lung(2)	lung(1)|pancreas(1)	2						c.(1372-1374)GAG>GAC		growth arrest-specific 7 isoform c							149.0	114.0	126.0					17																	9820602		2203	4300	6503	SO:0001583	missense	8522				cell cycle arrest	cytoplasm	sequence-specific DNA binding transcription factor activity	g.chr17:9820602C>G	AB007854	CCDS11152.1, CCDS42263.1, CCDS45611.1, CCDS58518.1	17p13.1	2004-02-18							4169	protein-coding gene	gene with protein product		603127				9736752	Standard	NM_001130831		Approved	KIAA0394, MGC1348	uc002gmg.1	O60861		ENST00000432992.2:c.1374G>C	17.37:g.9820602C>G	ENSP00000407552:p.Glu458Asp					GAS7_uc010vvc.1_Missense_Mutation_p.E272D|GAS7_uc002gmh.1_Missense_Mutation_p.E318D|GAS7_uc010vvd.1_Missense_Mutation_p.E410D|GAS7_uc002gmi.2_Missense_Mutation_p.E394D|GAS7_uc002gmj.1_Missense_Mutation_p.E398D|GAS7_uc010coh.1_Missense_Mutation_p.E398D	p.E458D	NM_201433	NP_958839	O60861	GAS7_HUMAN			14	1535	-			458					A8KAC2|B2RCK9|O43144|Q53Y77|Q7Z571	Missense_Mutation	SNP	ENST00000432992.2	37	c.1374G>C	CCDS11152.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.336322	0.81801	.	.	ENSG00000007237	ENST00000323816;ENST00000396115;ENST00000437099;ENST00000432992;ENST00000540214;ENST00000537970;ENST00000542249;ENST00000541114	T;T	0.44083	0.93;0.93	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	T	0.48095	0.1481	L	0.32530	0.975	0.53688	D	0.999975	D;D;D;D	0.76494	0.996;0.999;0.993;0.999	D;D;D;D	0.78314	0.932;0.991;0.915;0.991	T	0.39482	-0.9612	10	0.39692	T	0.17	-13.0323	7.661	0.28402	0.0:0.8292:0.0:0.1708	.	410;398;318;458	B7Z2L1;A8KAC2;O60861-2;O60861	.;.;.;GAS7_HUMAN	D	458;398;397;318;163;398;107;272	ENSP00000379421:E398D;ENSP00000446214:E163D	ENSP00000322608:E458D	E	-	3	2	GAS7	9761327	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.983000	0.49345	2.700000	0.92200	0.561000	0.74099	GAG		0.612	GAS7-017	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439883.1	NM_003644, NM_201432, NM_201433		36	95	0	0	0	0.009718	0	36	95				
MYH13	8735	broad.mit.edu	37	17	10210316	10210316	+	Silent	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr17:10210316C>A	ENST00000418404.3	-	35	5398	c.5235G>T	c.(5233-5235)gtG>gtT	p.V1745V	RP11-401O9.4_ENST00000609088.1_RNA|MYH13_ENST00000252172.4_Silent_p.V1745V			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	1745					cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.V1745V(2)		breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						TCGAGTTCTCCACCTCTGCCT	0.493																																							uc002gmk.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(4)|skin(2)	6						c.(5233-5235)GTG>GTT		myosin, heavy polypeptide 13, skeletal muscle							96.0	100.0	99.0					17																	10210316		2200	4300	6500	SO:0001819	synonymous_variant	8735				muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity	g.chr17:10210316C>A	AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.5235G>T	17.37:g.10210316C>A							p.V1745V	NM_003802	NP_003793	Q9UKX3	MYH13_HUMAN			36	5325	-			1745			Potential.		O95252|Q9P0U8	Silent	SNP	ENST00000418404.3	37	c.5235G>T	CCDS45613.1																																																																																				0.493	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442255.1	NM_003802		22	67	1	0	1.50039e-11	0.012319	1.85642e-11	22	67				
MYH8	4626	broad.mit.edu	37	17	10314198	10314198	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr17:10314198G>T	ENST00000403437.2	-	15	1577	c.1483C>A	c.(1483-1485)Cac>Aac	p.H495N	RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	495	Myosin motor.				ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)	p.H495N(1)		NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						ACAAACATGTGGTGGTTGAAA	0.448									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																														uc002gmm.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(6)|ovary(3)|breast(2)	11						c.(1483-1485)CAC>AAC		myosin, heavy chain 8, skeletal muscle,							199.0	167.0	178.0					17																	10314198		2203	4300	6503	SO:0001583	missense	4626	Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling	Familial Cancer Database	Carney Complex Variant	muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle	g.chr17:10314198G>T		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.1483C>A	17.37:g.10314198G>T	ENSP00000384330:p.His495Asn					uc002gml.1_Intron	p.H495N	NM_002472	NP_002463	P13535	MYH8_HUMAN			15	1578	-			495			Myosin head-like.		Q14910	Missense_Mutation	SNP	ENST00000403437.2	37	c.1483C>A	CCDS11153.1	.	.	.	.	.	.	.	.	.	.	G	16.07	3.018220	0.54576	.	.	ENSG00000133020	ENST00000252173;ENST00000403437	T	0.73469	-0.75	5.02	4.04	0.47022	Myosin head, motor domain (2);	0.000000	0.44097	U	0.000490	D	0.85784	0.5777	M	0.86097	2.795	0.47214	D	0.999357	B	0.33299	0.407	P	0.51516	0.672	D	0.87693	0.2555	10	0.87932	D	0	.	15.5445	0.76086	0.0:0.1385:0.8615:0.0	.	495	P13535	MYH8_HUMAN	N	495	ENSP00000384330:H495N	ENSP00000252173:H495N	H	-	1	0	MYH8	10254923	1.000000	0.71417	1.000000	0.80357	0.528000	0.34623	7.669000	0.83911	1.334000	0.45468	-0.176000	0.13171	CAC		0.448	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252724.2	NM_002472		50	148	1	0	2.29192e-23	0.00361	3.40061e-23	50	148				
MYO15A	51168	broad.mit.edu	37	17	18058480	18058480	+	Missense_Mutation	SNP	G	G	A	rs367717396		TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr17:18058480G>A	ENST00000205890.5	+	46	8619	c.8281G>A	c.(8281-8283)Gtg>Atg	p.V2761M	MYO15A_ENST00000585180.1_Missense_Mutation_p.V25M|MYO15A_ENST00000418233.3_Missense_Mutation_p.V25M	NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	2761	Tail.				inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.V2761M(1)		breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					GAAGCGGGCCGTGGTCAGCAC	0.632													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18625	0.0		0.0	False		,,,				2504	0.0						uc010vxh.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(4)|ovary(2)|pancreas(1)|breast(1)|central_nervous_system(1)	9						c.(8281-8283)GTG>ATG		myosin XV		G	MET/VAL	0,4220		0,0,2110	45.0	55.0	52.0		8281	4.1	0.5	17		52	1,8447		0,1,4223	no	missense	MYO15A	NM_016239.3	21	0,1,6333	AA,AG,GG		0.0118,0.0,0.0079	possibly-damaging	2761/3531	18058480	1,12667	2110	4224	6334	SO:0001583	missense	51168				sensory perception of sound	cytoplasm|myosin complex|stereocilium	actin binding|ATP binding|calmodulin binding|motor activity	g.chr17:18058480G>A	AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.8281G>A	17.37:g.18058480G>A	ENSP00000205890:p.Val2761Met					MYO15A_uc010vxi.1_Missense_Mutation_p.V25M|MYO15A_uc010vxj.1_Translation_Start_Site|MYO15A_uc010vxk.1_Intron|MYO15A_uc010vxl.1_5'Flank	p.V2761M	NM_016239	NP_057323	Q9UKN7	MYO15_HUMAN			45	8619	+	all_neural(463;0.228)		2761			Tail.		B4DFC7	Missense_Mutation	SNP	ENST00000205890.5	37	c.8281G>A	CCDS42271.1	.	.	.	.	.	.	.	.	.	.	G	8.308	0.821400	0.16678	0.0	1.18E-4	ENSG00000091536	ENST00000205890	D	0.89939	-2.59	5.1	4.12	0.48240	.	.	.	.	.	D	0.90631	0.7062	M	0.78049	2.395	0.80722	D	1	P;D	0.64830	0.951;0.994	P;P	0.54965	0.726;0.765	D	0.90331	0.4352	9	0.72032	D	0.01	.	4.8201	0.13387	0.3075:0.0:0.6925:0.0	.	25;2761	B4DFC7;Q9UKN7	.;MYO15_HUMAN	M	2761	ENSP00000205890:V2761M	ENSP00000205890:V2761M	V	+	1	0	MYO15A	17999205	1.000000	0.71417	0.484000	0.27391	0.113000	0.19764	4.470000	0.60175	2.363000	0.80096	0.561000	0.74099	GTG		0.632	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132048.1	NM_016239		17	36	0	0	0	0.00278	0	17	36				
NOS2	4843	broad.mit.edu	37	17	26114745	26114745	+	Silent	SNP	T	T	C			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr17:26114745T>C	ENST00000313735.6	-	5	659	c.426A>G	c.(424-426)caA>caG	p.Q142Q		NM_000625.4	NP_000616.3	P35228	NOS2_HUMAN	nitric oxide synthase 2, inducible	142					arginine catabolic process (GO:0006527)|blood coagulation (GO:0007596)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|circadian rhythm (GO:0007623)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|peptidyl-cysteine S-nitrosylation (GO:0018119)|phagosome maturation (GO:0090382)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of leukocyte mediated cytotoxicity (GO:0001912)|positive regulation of vasodilation (GO:0045909)|regulation of cell proliferation (GO:0042127)|regulation of cellular respiration (GO:0043457)|regulation of insulin secretion (GO:0050796)|response to bacterium (GO:0009617)|response to hypoxia (GO:0001666)|superoxide metabolic process (GO:0006801)	cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	arginine binding (GO:0034618)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric-oxide synthase activity (GO:0004517)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|tetrahydrobiopterin binding (GO:0034617)	p.Q142Q(1)		autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(28)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	56					Dexamethasone(DB01234)|Doxorubicin(DB00997)|L-Arginine(DB00125)|L-Citrulline(DB00155)|Miconazole(DB01110)|Triflusal(DB08814)	ATTCGATAGCTTGAGGTAGAA	0.532																																							uc002gzu.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|ovary(1)|breast(1)	4						c.(424-426)CAA>CAG		nitric oxide synthase 2A	Dexamethasone(DB01234)|Hydrocortisone(DB00741)|L-Arginine(DB00125)|L-Citrulline(DB00155)						149.0	153.0	152.0					17																	26114745		2203	4300	6503	SO:0001819	synonymous_variant	4843				arginine catabolic process|defense response to Gram-negative bacterium|innate immune response in mucosa|nitric oxide biosynthetic process|peptidyl-cysteine S-nitrosylation|platelet activation|positive regulation of killing of cells of other organism|positive regulation of leukocyte mediated cytotoxicity|regulation of cellular respiration|regulation of insulin secretion|superoxide metabolic process	cytosol|nucleus	arginine binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|protein homodimerization activity|tetrahydrobiopterin binding	g.chr17:26114745T>C	U20141	CCDS11223.1	17q11.2	2014-06-12	2008-09-16	2008-09-16	ENSG00000007171	ENSG00000007171	1.14.13.39		7873	protein-coding gene	gene with protein product		163730	"""nitric oxide synthase 2A (inducible, hepatocytes)"""	NOS2A		7682706	Standard	NM_000625		Approved	iNOS, NOS, HEP-NOS	uc002gzu.3	P35228	OTTHUMG00000132445	ENST00000313735.6:c.426A>G	17.37:g.26114745T>C						NOS2_uc010crh.1_Silent_p.Q142Q|NOS2_uc010wab.1_Silent_p.Q142Q	p.Q142Q	NM_000625	NP_000616	P35228	NOS2_HUMAN			5	690	-			142					A1L3U5|B7ZLY2|O60757|O94994|Q16263|Q16692|Q4TTS5|Q9UD42	Silent	SNP	ENST00000313735.6	37	c.426A>G	CCDS11223.1																																																																																				0.532	NOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255597.1	NM_000625		66	216	0	0	0	0.00361	0	66	216				
NOS2	4843	broad.mit.edu	37	17	26114747	26114747	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr17:26114747G>C	ENST00000313735.6	-	5	657	c.424C>G	c.(424-426)Caa>Gaa	p.Q142E		NM_000625.4	NP_000616.3	P35228	NOS2_HUMAN	nitric oxide synthase 2, inducible	142					arginine catabolic process (GO:0006527)|blood coagulation (GO:0007596)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|circadian rhythm (GO:0007623)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|peptidyl-cysteine S-nitrosylation (GO:0018119)|phagosome maturation (GO:0090382)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of leukocyte mediated cytotoxicity (GO:0001912)|positive regulation of vasodilation (GO:0045909)|regulation of cell proliferation (GO:0042127)|regulation of cellular respiration (GO:0043457)|regulation of insulin secretion (GO:0050796)|response to bacterium (GO:0009617)|response to hypoxia (GO:0001666)|superoxide metabolic process (GO:0006801)	cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	arginine binding (GO:0034618)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric-oxide synthase activity (GO:0004517)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|tetrahydrobiopterin binding (GO:0034617)	p.Q142E(1)		autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(28)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	56					Dexamethasone(DB01234)|Doxorubicin(DB00997)|L-Arginine(DB00125)|L-Citrulline(DB00155)|Miconazole(DB01110)|Triflusal(DB08814)	TCGATAGCTTGAGGTAGAAGC	0.527																																							uc002gzu.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)|breast(1)	4						c.(424-426)CAA>GAA		nitric oxide synthase 2A	Dexamethasone(DB01234)|Hydrocortisone(DB00741)|L-Arginine(DB00125)|L-Citrulline(DB00155)						151.0	155.0	154.0					17																	26114747		2203	4300	6503	SO:0001583	missense	4843				arginine catabolic process|defense response to Gram-negative bacterium|innate immune response in mucosa|nitric oxide biosynthetic process|peptidyl-cysteine S-nitrosylation|platelet activation|positive regulation of killing of cells of other organism|positive regulation of leukocyte mediated cytotoxicity|regulation of cellular respiration|regulation of insulin secretion|superoxide metabolic process	cytosol|nucleus	arginine binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|protein homodimerization activity|tetrahydrobiopterin binding	g.chr17:26114747G>C	U20141	CCDS11223.1	17q11.2	2014-06-12	2008-09-16	2008-09-16	ENSG00000007171	ENSG00000007171	1.14.13.39		7873	protein-coding gene	gene with protein product		163730	"""nitric oxide synthase 2A (inducible, hepatocytes)"""	NOS2A		7682706	Standard	NM_000625		Approved	iNOS, NOS, HEP-NOS	uc002gzu.3	P35228	OTTHUMG00000132445	ENST00000313735.6:c.424C>G	17.37:g.26114747G>C	ENSP00000327251:p.Gln142Glu					NOS2_uc010crh.1_Missense_Mutation_p.Q142E|NOS2_uc010wab.1_Missense_Mutation_p.Q142E	p.Q142E	NM_000625	NP_000616	P35228	NOS2_HUMAN			5	688	-			142					A1L3U5|B7ZLY2|O60757|O94994|Q16263|Q16692|Q4TTS5|Q9UD42	Missense_Mutation	SNP	ENST00000313735.6	37	c.424C>G	CCDS11223.1	.	.	.	.	.	.	.	.	.	.	G	14.96	2.690491	0.48097	.	.	ENSG00000007171	ENST00000313735;ENST00000379105;ENST00000302153	T	0.20332	2.08	5.64	5.64	0.86602	Nitric oxide synthase, oxygenase domain (3);	0.133249	0.51477	D	0.000100	T	0.30230	0.0758	N	0.26130	0.795	0.40324	D	0.978853	B;P	0.48350	0.003;0.909	B;P	0.56278	0.013;0.795	T	0.01242	-1.1408	10	0.32370	T	0.25	.	18.6964	0.91603	0.0:0.0:1.0:0.0	.	142;142	F8WEM3;P35228	.;NOS2_HUMAN	E	142	ENSP00000327251:Q142E	ENSP00000305638:Q142E	Q	-	1	0	NOS2	23138874	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.341000	0.79300	2.676000	0.91093	0.557000	0.71058	CAA		0.527	NOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255597.1	NM_000625		68	220	0	0	0	0.00361	0	68	220				
CPD	1362	broad.mit.edu	37	17	28791816	28791816	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr17:28791816A>G	ENST00000225719.4	+	21	4203	c.4127A>G	c.(4126-4128)tAt>tGt	p.Y1376C	CPD_ENST00000543464.2_Missense_Mutation_p.Y1129C	NM_001304.4	NP_001295.2	O75976	CBPD_HUMAN	carboxypeptidase D	1376						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metallocarboxypeptidase activity (GO:0004181)|serine-type carboxypeptidase activity (GO:0004185)|zinc ion binding (GO:0008270)	p.Y1376C(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(13)|skin(5)|stomach(1)|urinary_tract(1)	36						GAAACATTATATTCTAGCAAA	0.403																																							uc002hfb.1		NA																	1	Substitution - Missense(1)		lung(1)	liver(1)|skin(1)	2						c.(4126-4128)TAT>TGT		carboxypeptidase D precursor							107.0	103.0	104.0					17																	28791816		2203	4300	6503	SO:0001583	missense	1362				proteolysis	integral to membrane	metallocarboxypeptidase activity|serine-type carboxypeptidase activity|zinc ion binding	g.chr17:28791816A>G	U65090	CCDS11257.1, CCDS56025.1	17q11.2	2012-02-10			ENSG00000108582	ENSG00000108582	3.4.17.22		2301	protein-coding gene	gene with protein product	"""metallocarboxypeptidase D"""	603102				9628828, 9355738	Standard	NM_001304		Approved	GP180	uc002hfb.2	O75976	OTTHUMG00000132797	ENST00000225719.4:c.4127A>G	17.37:g.28791816A>G	ENSP00000225719:p.Tyr1376Cys					CPD_uc010wbo.1_Missense_Mutation_p.Y1129C|CPD_uc010wbp.1_RNA	p.Y1376C	NM_001304	NP_001295	O75976	CBPD_HUMAN			21	4142	+			1376			Cytoplasmic (Potential).		B7Z7T9|B7ZAU4|F5GZH6|O15377|Q86SH9|Q86XE6	Missense_Mutation	SNP	ENST00000225719.4	37	c.4127A>G	CCDS11257.1	.	.	.	.	.	.	.	.	.	.	A	17.73	3.461277	0.63513	.	.	ENSG00000108582	ENST00000225719;ENST00000543464	T;T	0.28069	1.63;2.8	5.63	5.63	0.86233	.	2.672440	0.01001	N	0.003669	T	0.50309	0.1608	N	0.24115	0.695	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.06373	-1.0830	10	0.87932	D	0	-3.8113	15.028	0.71684	1.0:0.0:0.0:0.0	.	1129;1376	F5GZH6;O75976	.;CBPD_HUMAN	C	1376;1129	ENSP00000225719:Y1376C;ENSP00000444443:Y1129C	ENSP00000225719:Y1376C	Y	+	2	0	CPD	25815942	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.480000	0.90434	2.122000	0.65172	0.533000	0.62120	TAT		0.403	CPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256214.3	NM_001304		17	56	0	0	0	0.008871	0	17	56				
TNS4	84951	broad.mit.edu	37	17	38636951	38636951	+	Splice_Site	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr17:38636951C>A	ENST00000254051.6	-	9	1900		c.e9+1			NM_032865.5	NP_116254.4	Q8IZW8	TENS4_HUMAN	tensin 4						apoptotic process (GO:0006915)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)		p.?(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	30		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)			GTACCACTCACCCGCAGATTT	0.622																																							uc010cxb.2		NA																	1	Unknown(1)		lung(1)	large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4						c.e9+1		tensin 4 precursor							53.0	49.0	50.0					17																	38636951		2203	4300	6503	SO:0001630	splice_region_variant	84951				apoptosis|protein localization	cytoplasm|cytoskeleton|focal adhesion	actin binding	g.chr17:38636951C>A	AF417488	CCDS11368.1	17q21.2	2013-02-14			ENSG00000131746	ENSG00000131746		"""SH2 domain containing"""	24352	protein-coding gene	gene with protein product	"""C terminal tensin like"""	608385				12154022, 12711115	Standard	NM_032865		Approved	CTEN	uc010cxb.3	Q8IZW8	OTTHUMG00000133330	ENST00000254051.6:c.1741+1G>T	17.37:g.38636951C>A						TNS4_uc002huu.3_Intron	p.G581_splice	NM_032865	NP_116254	Q8IZW8	TENS4_HUMAN	STAD - Stomach adenocarcinoma(5;5.91e-05)		9	1905	-		Breast(137;0.000496)						A6NMJ7|Q71RB7|Q8WV64|Q96JV4	Splice_Site	SNP	ENST00000254051.6	37	c.1741_splice	CCDS11368.1	.	.	.	.	.	.	.	.	.	.	C	8.737	0.918066	0.17982	.	.	ENSG00000131746	ENST00000377816;ENST00000394072;ENST00000254051	.	.	.	4.29	4.29	0.51040	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.4166	0.55496	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TNS4	35890477	1.000000	0.71417	0.995000	0.50966	0.098000	0.18820	3.298000	0.51818	2.386000	0.81285	0.462000	0.41574	.		0.622	TNS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257154.3	NM_032865	Intron	10	60	1	0	1.3612e-06	0.003163	1.51939e-06	10	60				
KRTAP4-2	85291	broad.mit.edu	37	17	39334304	39334304	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr17:39334304G>A	ENST00000377726.2	-	1	156	c.113C>T	c.(112-114)cCc>cTc	p.P38L		NM_033062.3	NP_149051	Q9BYR5	KRA42_HUMAN	keratin associated protein 4-2	38	20 X 5 AA repeats OF C-C-[GRQVS]-[SPT]- [VSTQ].					keratin filament (GO:0045095)		p.P155L(1)|p.P38L(1)		kidney(2)|lung(4)|upper_aerodigestive_tract(1)	7		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			ACAGCAGCTGGGGCGGCAGCA	0.657																																							uc002hwd.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(112-114)CCC>CTC		keratin associated protein 4-2							42.0	47.0	46.0					17																	39334304		2198	4287	6485	SO:0001583	missense	85291					keratin filament		g.chr17:39334304G>A	AJ406934	CCDS11384.1	17q21.2	2013-06-25			ENSG00000244537	ENSG00000244537		"""Keratin associated proteins"""	18900	protein-coding gene	gene with protein product						11279113	Standard	NM_033062		Approved	KAP4.2	uc002hwd.3	Q9BYR5	OTTHUMG00000133437	ENST00000377726.2:c.113C>T	17.37:g.39334304G>A	ENSP00000366955:p.Pro38Leu						p.P38L	NM_033062	NP_149051	Q9BYR5	KRA42_HUMAN	STAD - Stomach adenocarcinoma(17;0.000449)		1	157	-		Breast(137;0.000496)	38			5.|20 X 5 AA repeats OF C-C-[GRQVS]-[SPT]- [VSTQ].		A0JP64	Missense_Mutation	SNP	ENST00000377726.2	37	c.113C>T	CCDS11384.1	.	.	.	.	.	.	.	.	.	.	.	11.23	1.576827	0.28092	.	.	ENSG00000244537	ENST00000377726;ENST00000458321	T	0.01787	4.64	4.52	4.52	0.55395	.	0.247233	0.20590	U	0.089361	T	0.08403	0.0209	H	0.94698	3.57	0.33287	D	0.563004	P	0.37914	0.611	B	0.41036	0.346	T	0.02560	-1.1141	10	0.87932	D	0	.	15.0798	0.72106	0.0:0.0:1.0:0.0	.	38	Q9BYR5	KRA42_HUMAN	L	38;155	ENSP00000366955:P38L	ENSP00000366955:P38L	P	-	2	0	KRTAP4-2	36587830	0.599000	0.26891	0.597000	0.28824	0.108000	0.19459	1.616000	0.36933	2.194000	0.70268	0.514000	0.50259	CCC		0.657	KRTAP4-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257305.1			20	69	0	0	0	0.005524	0	20	69				
CRHR1	1394	broad.mit.edu	37	17	43907550	43907550	+	Silent	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr17:43907550C>A	ENST00000398285.3	+	7	612	c.612C>A	c.(610-612)acC>acA	p.T204T	CRHR1_ENST00000314537.5_Silent_p.T175T|CRHR1_ENST00000293493.7_De_novo_Start_InFrame|CRHR1_ENST00000339069.5_Silent_p.T74T|CRHR1_ENST00000352855.5_Silent_p.T135T|CRHR1_ENST00000577353.1_Silent_p.T175T	NM_001145146.1	NP_001138618.1	P34998	CRFR1_HUMAN	corticotropin releasing hormone receptor 1	204					activation of adenylate cyclase activity (GO:0007190)|adrenal gland development (GO:0030325)|behavioral response to cocaine (GO:0048148)|behavioral response to ethanol (GO:0048149)|behavioral response to pain (GO:0048266)|cellular response to corticotropin-releasing hormone stimulus (GO:0071376)|corticotropin secretion (GO:0051458)|epithelial cell differentiation (GO:0030855)|fear response (GO:0042596)|female pregnancy (GO:0007565)|general adaptation syndrome, behavioral process (GO:0051867)|hypothalamus development (GO:0021854)|immune response (GO:0006955)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neuron death (GO:1901215)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|neuropeptide signaling pathway (GO:0007218)|parturition (GO:0007567)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mast cell degranulation (GO:0043306)|regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010578)|regulation of corticosterone secretion (GO:2000852)|response to hypoxia (GO:0001666)|response to immobilization stress (GO:0035902)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|vesicle (GO:0031982)	corticotrophin-releasing factor receptor activity (GO:0015056)|corticotropin-releasing hormone binding (GO:0051424)|corticotropin-releasing hormone receptor activity (GO:0043404)	p.T175T(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(15)|pancreas(1)|skin(1)	24	Colorectal(2;0.0416)			BRCA - Breast invasive adenocarcinoma(366;0.161)		TCCAGCTAACCATGAGCCCCG	0.647																																					Ovarian(110;57 1568 10207 38216 49865)	Ovarian(110;57 1568 10207 38216 49865)	uc010dap.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(3)	3						c.(610-612)ACC>ACA		corticotropin releasing hormone receptor 1							85.0	87.0	86.0					17																	43907550		2178	4262	6440	SO:0001819	synonymous_variant	1394				female pregnancy|immune response|parturition	integral to plasma membrane	corticotrophin-releasing factor receptor activity|protein binding	g.chr17:43907550C>A	L23332	CCDS42350.1, CCDS45712.1, CCDS45713.1, CCDS45714.1	17q12-q22	2012-08-14			ENSG00000120088	ENSG00000120088		"""GPCR / Class B : Corticotropin-releasing factor receptors"""	2357	protein-coding gene	gene with protein product	"""corticotropin-releasing factor receptor"""	122561		CRHR		7590738	Standard	NM_004382		Approved	CRF-R, CRF1	uc010dap.3	P34998		ENST00000398285.3:c.612C>A	17.37:g.43907550C>A						CRHR1_uc010wjx.1_5'UTR|CRHR1_uc002ijp.2_Silent_p.T74T|CRHR1_uc002ijm.2_Silent_p.T175T|CRHR1_uc002ijn.2_Silent_p.T135T|CRHR1_uc010dar.2_Silent_p.T175T|CRHR1_uc010dao.2_Silent_p.T74T|CRHR1_uc010daq.2_5'UTR|CRHR1_uc010das.1_RNA|CRHR1_uc002ijo.1_RNA	p.T204T	NM_001145146	NP_001138618	P34998	CRFR1_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.161)	7	877	+	Colorectal(2;0.0416)		204			Extracellular (Potential).		B4DIE9|Q13008|Q4QRJ1|Q9UK64	Silent	SNP	ENST00000398285.3	37	c.612C>A	CCDS45712.1																																																																																				0.647	CRHR1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000441241.3			35	72	1	0	1.99505e-19	0.012213	2.81156e-19	35	72				
AXIN2	8313	broad.mit.edu	37	17	63534419	63534419	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr17:63534419C>G	ENST00000375702.5	-	4	1210	c.1102G>C	c.(1102-1104)Gcc>Ccc	p.A368P	CTD-2535L24.2_ENST00000577662.1_3'UTR|AXIN2_ENST00000307078.5_Missense_Mutation_p.A368P			Q9Y2T1	AXIN2_HUMAN	axin 2	368	Interaction with GSK3B. {ECO:0000250}.				bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to organic cyclic compound (GO:0071407)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|dorsal/ventral axis specification (GO:0009950)|intramembranous ossification (GO:0001957)|maintenance of DNA repeat elements (GO:0043570)|mRNA stabilization (GO:0048255)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoblast differentiation (GO:0045668)|odontogenesis (GO:0042476)|positive regulation of cell death (GO:0010942)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein phosphorylation (GO:0001934)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of chondrocyte development (GO:0061181)|regulation of mismatch repair (GO:0032423)|secondary heart field specification (GO:0003139)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)	p.A368P(1)		NS(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	34						GCAAAGGTGGCGGGTTCCACG	0.627									Oligodontia, Ectodermal Dysplasia and Colorectal Polyp syndrome																														uc002jfi.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(1102-1104)GCC>CCC		axin 2							64.0	59.0	61.0					17																	63534419		2203	4300	6503	SO:0001583	missense	8313	Oligodontia_Ectodermal_Dysplasia_and_Colorectal_Polyp_syndrome	Familial Cancer Database	Oligodontia-Colorectal Cancer syndrome, Tooth Agenesis-Colorectal Cancer Syndrome	cellular protein localization|cellular response to organic cyclic compound|dorsal/ventral axis specification|intramembranous ossification|maintenance of DNA repeat elements|mRNA stabilization|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of cell proliferation|negative regulation of osteoblast differentiation|odontogenesis|positive regulation of cell death|positive regulation of epithelial to mesenchymal transition|positive regulation of protein phosphorylation|regulation of centromeric sister chromatid cohesion|regulation of mismatch repair|Wnt receptor signaling pathway involved in somitogenesis	Axin-APC-beta-catenin-GSK3B complex|cell cortex|centrosome|cytoplasmic membrane-bounded vesicle|cytoplasmic microtubule|nucleus|plasma membrane|postsynaptic density	armadillo repeat domain binding|beta-catenin binding|GTPase activator activity|protein kinase binding|signal transducer activity|ubiquitin protein ligase binding	g.chr17:63534419C>G	AF078165	CCDS11662.1	17q24.1	2014-09-17	2008-08-01		ENSG00000168646				904	protein-coding gene	gene with protein product	"""conductin"", ""axil"""	604025				10049590	Standard	NM_004655		Approved	MGC126582, DKFZp781B0869	uc002jfi.3	Q9Y2T1	OTTHUMG00000179353	ENST00000375702.5:c.1102G>C	17.37:g.63534419C>G	ENSP00000364854:p.Ala368Pro					AXIN2_uc010den.1_Missense_Mutation_p.A368P|AXIN2_uc002jfh.2_Missense_Mutation_p.A368P	p.A368P	NM_004655	NP_004646	Q9Y2T1	AXIN2_HUMAN			5	1391	-			368			Interaction with GSK3B (By similarity).		Q3MJ88|Q9H3M6|Q9UH84	Missense_Mutation	SNP	ENST00000375702.5	37	c.1102G>C		.	.	.	.	.	.	.	.	.	.	C	17.75	3.467383	0.63625	.	.	ENSG00000168646	ENST00000307078;ENST00000375702	D;D	0.83914	-1.78;-1.78	5.3	4.3	0.51218	.	0.106552	0.64402	D	0.000007	D	0.89008	0.6593	M	0.71581	2.175	0.58432	D	0.999998	D;D;D	0.76494	0.994;0.986;0.999	P;P;D	0.66716	0.854;0.839;0.946	D	0.88755	0.3253	10	0.48119	T	0.1	-8.3427	13.0986	0.59208	0.0:0.9192:0.0:0.0808	.	368;368;368	B7ZKL5;Q9Y2T1;E7ES00	.;AXIN2_HUMAN;.	P	368	ENSP00000302625:A368P;ENSP00000364854:A368P	ENSP00000302625:A368P	A	-	1	0	AXIN2	60964881	0.902000	0.30710	0.494000	0.27515	0.977000	0.68977	1.878000	0.39608	1.168000	0.42723	0.555000	0.69702	GCC		0.627	AXIN2-004	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000445901.1	NM_004655		16	67	0	0	0	0.00499	0	16	67				
PRKCA	5578	broad.mit.edu	37	17	64770156	64770156	+	Missense_Mutation	SNP	G	G	A	rs563946455		TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr17:64770156G>A	ENST00000413366.3	+	14	1602	c.1576G>A	c.(1576-1578)Gtc>Atc	p.V526I		NM_002737.2	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha	526	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|chondrocyte differentiation (GO:0002062)|desmosome assembly (GO:0002159)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|histone H3-T6 phosphorylation (GO:0035408)|inactivation of MAPK activity (GO:0000188)|induction of positive chemotaxis (GO:0050930)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|mRNA metabolic process (GO:0016071)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|peptidyl-serine autophosphorylation (GO:0036289)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of dense core granule biogenesis (GO:2000707)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of inflammatory response (GO:0050729)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein phosphorylation (GO:0001934)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|regulation of muscle contraction (GO:0006937)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of the force of heart contraction (GO:0002026)|response to interleukin-1 (GO:0070555)|rhodopsin mediated signaling pathway (GO:0016056)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|enzyme binding (GO:0019899)|histone kinase activity (H3-T6 specific) (GO:0035403)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|zinc ion binding (GO:0008270)	p.V526I(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Ingenol Mebutate(DB05013)|Phosphatidylserine(DB00144)|Tamoxifen(DB00675)|Vitamin E(DB00163)	GGCCTATGGCGTCCTGTTGTA	0.423																																							uc002jfp.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(4)|large_intestine(1)|stomach(1)|lung(1)|breast(1)|ovary(1)	9						c.(1576-1578)GTC>ATC		protein kinase C, alpha	Phosphatidylserine(DB00144)|Vitamin E(DB00163)						308.0	275.0	287.0					17																	64770156		2203	4300	6503	SO:0001583	missense	5578				activation of phospholipase C activity|energy reserve metabolic process|induction of apoptosis by extracellular signals|intracellular signal transduction|mRNA metabolic process|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of blood vessel endothelial cell migration|regulation of insulin secretion|response to interleukin-1|synaptic transmission	cytosol|endoplasmic reticulum|membrane fraction|nucleoplasm|plasma membrane	ATP binding|enzyme binding|histone kinase activity (H3-T6 specific)|protein kinase C activity|zinc ion binding	g.chr17:64770156G>A		CCDS11664.1	17q22-q24	2009-07-10				ENSG00000154229	2.7.11.1		9393	protein-coding gene	gene with protein product		176960		PKCA			Standard	NM_002737		Approved		uc002jfp.1	P17252		ENST00000413366.3:c.1576G>A	17.37:g.64770156G>A	ENSP00000408695:p.Val526Ile					PRKCA_uc002jfo.1_Missense_Mutation_p.V397I	p.V526I	NM_002737	NP_002728	P17252	KPCA_HUMAN	BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		14	1620	+			526			Protein kinase.		B5BU22|Q15137|Q32M72|Q96RE4	Missense_Mutation	SNP	ENST00000413366.3	37	c.1576G>A	CCDS11664.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.473454	0.84640	.	.	ENSG00000154229	ENST00000413366;ENST00000284384	T	0.27890	1.64	5.61	5.61	0.85477	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	U	0.000002	T	0.33265	0.0857	L	0.43152	1.355	0.80722	D	1	P;P	0.49961	0.93;0.847	B;B	0.43301	0.325;0.415	T	0.11203	-1.0597	10	0.72032	D	0.01	.	18.4403	0.90664	0.0:0.0:1.0:0.0	.	526;437	P17252;Q59FI5	KPCA_HUMAN;.	I	526;433	ENSP00000408695:V526I	ENSP00000284384:V433I	V	+	1	0	PRKCA	62200618	1.000000	0.71417	1.000000	0.80357	0.794000	0.44872	8.882000	0.92420	2.643000	0.89663	0.643000	0.83706	GTC		0.423	PRKCA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446976.1			15	202	0	0	0	0.003163	0	15	202				
CEP131	22994	broad.mit.edu	37	17	79182788	79182788	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr17:79182788T>C	ENST00000269392.4	-	3	459	c.212A>G	c.(211-213)aAc>aGc	p.N71S	AZI1_ENST00000374782.3_Missense_Mutation_p.N71S|AZI1_ENST00000450824.2_Missense_Mutation_p.N71S|AZI1_ENST00000575907.1_Missense_Mutation_p.N71S	NM_014984.2	NP_055799.2	Q9UPN4	CP131_HUMAN		71					cell differentiation (GO:0030154)|G2/M transition of mitotic cell cycle (GO:0000086)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|mitotic cell cycle (GO:0000278)|multicellular organismal development (GO:0007275)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular protein transport (GO:0090316)|regulation of centrosome duplication (GO:0010824)|spermatogenesis (GO:0007283)	BBSome (GO:0034464)|cell projection (GO:0042995)|centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)	protein homodimerization activity (GO:0042803)	p.N71S(2)		breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(1)|lung(12)|ovary(2)|prostate(3)|urinary_tract(5)	36	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			TCTAAGGTTGTTGATGGCCTG	0.592																																							uc002jzp.1		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(2)|large_intestine(1)|ovary(1)	4						c.(211-213)AAC>AGC		5-azacytidine induced 1 isoform a							74.0	73.0	73.0					17																	79182788		2203	4300	6503	SO:0001583	missense	22994				cell differentiation|G2/M transition of mitotic cell cycle|multicellular organismal development|spermatogenesis	centrosome|cytosol|intracellular membrane-bounded organelle		g.chr17:79182788T>C																												ENST00000269392.4:c.212A>G	17.37:g.79182788T>C	ENSP00000269392:p.Asn71Ser					AZI1_uc002jzn.1_Missense_Mutation_p.N71S|AZI1_uc002jzo.1_Missense_Mutation_p.N71S|AZI1_uc010wum.1_Missense_Mutation_p.N71S	p.N71S	NM_014984	NP_055799	Q9UPN4	AZI1_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)		3	412	-	all_neural(118;0.0804)|Melanoma(429;0.242)		71					A6NHI8|B2RN11|Q96F50	Missense_Mutation	SNP	ENST00000269392.4	37	c.212A>G		.	.	.	.	.	.	.	.	.	.	T	13.51	2.257722	0.39896	.	.	ENSG00000141577	ENST00000450824;ENST00000374782;ENST00000269392	T;T;T	0.23147	1.92;1.92;1.92	4.75	3.65	0.41850	.	0.056599	0.64402	D	0.000002	T	0.27933	0.0688	L	0.59436	1.845	0.32142	N	0.585422	P;P;P;B	0.51791	0.948;0.948;0.94;0.129	P;P;P;B	0.45276	0.475;0.475;0.461;0.046	T	0.40997	-0.9533	10	0.66056	D	0.02	-28.0163	8.9357	0.35697	0.0:0.088:0.0:0.912	.	71;71;71;71	B2RN10;Q9UPN4;Q9UPN4-3;Q9UPN4-2	.;AZI1_HUMAN;.;.	S	71	ENSP00000393583:N71S;ENSP00000363914:N71S;ENSP00000269392:N71S	ENSP00000269392:N71S	N	-	2	0	AZI1	76797383	1.000000	0.71417	1.000000	0.80357	0.167000	0.22549	4.605000	0.61119	0.644000	0.30656	0.403000	0.27427	AAC		0.592	AZI1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000256070.1			16	44	0	0	0	0.010504	0	16	44				
YES1	7525	broad.mit.edu	37	18	724522	724522	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr18:724522C>A	ENST00000584307.1	-	12	1704	c.1534G>T	c.(1534-1536)Gac>Tac	p.D512Y	YES1_ENST00000577961.1_Missense_Mutation_p.D517Y|YES1_ENST00000314574.4_Missense_Mutation_p.D512Y			P07947	YES_HUMAN	YES proto-oncogene 1, Src family tyrosine kinase	512	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood coagulation (GO:0007596)|cellular protein modification process (GO:0006464)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|glucose transport (GO:0015758)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|regulation of vascular permeability (GO:0043114)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)	p.D512Y(1)		endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(1)	17					Dasatinib(DB01254)	TCATCAGGGTCCTTCTTCCAA	0.448																																							uc002kky.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|ovary(1)	3						c.(1534-1536)GAC>TAC		viral oncogene yes-1 homolog 1	Dasatinib(DB01254)						90.0	87.0	88.0					18																	724522		2203	4300	6503	SO:0001583	missense	7525				blood coagulation|leukocyte migration|regulation of vascular permeability|T cell costimulation	cytosol|plasma membrane	ATP binding|ion channel binding|non-membrane spanning protein tyrosine kinase activity	g.chr18:724522C>A	M15990	CCDS11824.1	18p11.31-p11.21	2014-06-26	2014-06-26		ENSG00000176105	ENSG00000176105		"""SH2 domain containing"""	12841	protein-coding gene	gene with protein product		164880	"""v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1"""			2983418	Standard	NM_005433		Approved	Yes, c-yes, HsT441	uc002kky.3	P07947	OTTHUMG00000131472	ENST00000584307.1:c.1534G>T	18.37:g.724522C>A	ENSP00000462468:p.Asp512Tyr					YES1_uc002kkz.2_Missense_Mutation_p.D512Y	p.D512Y	NM_005433	NP_005424	P07947	YES_HUMAN			12	1755	-			512			Protein kinase.		A6NLB3|D3DUH1	Missense_Mutation	SNP	ENST00000584307.1	37	c.1534G>T	CCDS11824.1	.	.	.	.	.	.	.	.	.	.	C	18.61	3.661023	0.67700	.	.	ENSG00000176105	ENST00000359834;ENST00000314574	T	0.15372	2.43	4.81	4.81	0.61882	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.092627	0.64402	D	0.000001	T	0.46852	0.1414	M	0.87456	2.885	0.80722	D	1	D	0.67145	0.996	D	0.63192	0.912	T	0.57785	-0.7751	10	0.87932	D	0	.	18.2307	0.89934	0.0:1.0:0.0:0.0	.	512	P07947	YES_HUMAN	Y	512	ENSP00000324740:D512Y	ENSP00000324740:D512Y	D	-	1	0	YES1	714522	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.544000	0.82117	2.380000	0.81148	0.591000	0.81541	GAC		0.448	YES1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440827.2	NM_005433		21	60	1	0	1.96292e-10	0.010504	2.3568e-10	21	60				
SOCS6	9306	broad.mit.edu	37	18	67993064	67993064	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr18:67993064G>A	ENST00000397942.3	+	2	1476	c.1160G>A	c.(1159-1161)gGa>gAa	p.G387E	SOCS6_ENST00000582322.1_Missense_Mutation_p.G387E	NM_004232.3	NP_004223.2	O14544	SOCS6_HUMAN	suppressor of cytokine signaling 6	387	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				defense response (GO:0006952)|JAK-STAT cascade (GO:0007259)|negative regulation of signal transduction (GO:0009968)|negative regulation of T cell activation (GO:0050868)|proteasomal protein catabolic process (GO:0010498)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)	cytoplasm (GO:0005737)|immunological synapse (GO:0001772)		p.G387E(1)		NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)	22		Esophageal squamous(42;0.129)|Colorectal(73;0.152)				TGGTACTGGGGACCAATCACA	0.478																																					Melanoma(84;1024 1361 24382 36583 42651)	Melanoma(84;1024 1361 24382 36583 42651)	uc002lkr.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|lung(1)	2						c.(1159-1161)GGA>GAA		suppressor of cytokine signaling 6							137.0	128.0	131.0					18																	67993064		2203	4300	6503	SO:0001583	missense	9306				defense response|JAK-STAT cascade|negative regulation of signal transduction|regulation of growth	cytoplasm		g.chr18:67993064G>A	AB006968	CCDS11998.1	18q22	2013-02-14	2004-02-25	2004-02-27	ENSG00000170677	ENSG00000170677		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	16833	protein-coding gene	gene with protein product		605118	"""suppressor of cytokine signaling 4"""	SOCS4		9344848, 11042152	Standard	NM_004232		Approved	CIS4, SSI4, HSPC060, STATI4, STAI4, Cish4	uc002lkr.1	O14544	OTTHUMG00000132816	ENST00000397942.3:c.1160G>A	18.37:g.67993064G>A	ENSP00000381034:p.Gly387Glu					SOCS6_uc010dqq.2_Missense_Mutation_p.G387E	p.G387E	NM_004232	NP_004223	O14544	SOCS6_HUMAN			2	1476	+		Esophageal squamous(42;0.129)|Colorectal(73;0.152)	387			SH2.		Q8WUM3	Missense_Mutation	SNP	ENST00000397942.3	37	c.1160G>A	CCDS11998.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.573565	0.86542	.	.	ENSG00000170677	ENST00000397942	D	0.91295	-2.82	5.82	5.82	0.92795	SH2 motif (4);	0.000000	0.85682	D	0.000000	D	0.96068	0.8719	M	0.86178	2.8	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95936	0.8942	10	0.72032	D	0.01	-10.594	20.093	0.97828	0.0:0.0:1.0:0.0	.	387	O14544	SOCS6_HUMAN	E	387	ENSP00000381034:G387E	ENSP00000381034:G387E	G	+	2	0	SOCS6	66144044	1.000000	0.71417	0.966000	0.40874	0.986000	0.74619	9.716000	0.98752	2.756000	0.94617	0.561000	0.74099	GGA		0.478	SOCS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256270.2			27	80	0	0	0	0.005443	0	27	80				
PIP5K1C	23396	broad.mit.edu	37	19	3664855	3664855	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr19:3664855C>A	ENST00000335312.3	-	3	272	c.184G>T	c.(184-186)Ggt>Tgt	p.G62C	PIP5K1C_ENST00000537021.1_Missense_Mutation_p.G62C|PIP5K1C_ENST00000589578.1_Missense_Mutation_p.G62C|PIP5K1C_ENST00000587482.1_5'UTR|PIP5K1C_ENST00000539785.1_Missense_Mutation_p.G62C	NM_001195733.1|NM_012398.2	NP_001182662.1|NP_036530.1	O60331	PI51C_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type I, gamma	62					actin cytoskeleton organization (GO:0030036)|adherens junction assembly (GO:0034333)|axon guidance (GO:0007411)|clathrin-mediated endocytosis (GO:0072583)|cytoskeletal anchoring at plasma membrane (GO:0007016)|neutrophil chemotaxis (GO:0030593)|phagocytosis (GO:0006909)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet aggregation (GO:0070527)|single organismal cell-cell adhesion (GO:0016337)|small molecule metabolic process (GO:0044281)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle exocytosis (GO:0016079)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|uropod (GO:0001931)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)	p.G62C(1)		large_intestine(3)|ovary(1)|skin(3)|stomach(2)	9		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.95e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0026)|STAD - Stomach adenocarcinoma(1328;0.183)		GCGTCCACACCTCGATGGCCC	0.622																																					Esophageal Squamous(135;99 1744 12852 27186 39851)	Esophageal Squamous(135;99 1744 12852 27186 39851)	uc002lyj.1		NA																	1	Substitution - Missense(1)		lung(1)	stomach(2)|skin(2)	4						c.(184-186)GGT>TGT		phosphatidylinositol-4-phosphate 5-kinase, type							120.0	100.0	107.0					19																	3664855		2203	4300	6503	SO:0001583	missense	23396				axon guidance	cytosol|plasma membrane	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding	g.chr19:3664855C>A	AB011161	CCDS32872.1, CCDS56074.1, CCDS74257.1	19p13.3	2012-10-02			ENSG00000186111	ENSG00000186111			8996	protein-coding gene	gene with protein product		606102				9535851	Standard	NM_001195733		Approved	PIP5Kgamma, KIAA0589, LCCS3	uc002lyj.2	O60331	OTTHUMG00000180870	ENST00000335312.3:c.184G>T	19.37:g.3664855C>A	ENSP00000335333:p.Gly62Cys					PIP5K1C_uc010xhq.1_Missense_Mutation_p.G62C|PIP5K1C_uc010xhr.1_Missense_Mutation_p.G62C	p.G62C	NM_012398	NP_036530	O60331	PI51C_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.95e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0026)|STAD - Stomach adenocarcinoma(1328;0.183)	3	241	-		Hepatocellular(1079;0.137)	62					B7Z9E7|C6GIJ7|C6GIJ8|Q7LE07	Missense_Mutation	SNP	ENST00000335312.3	37	c.184G>T	CCDS32872.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.080922	0.76528	.	.	ENSG00000186111	ENST00000335312;ENST00000539785;ENST00000537021	T;T;T	0.28255	1.65;1.66;1.62	4.58	3.54	0.40534	.	0.195975	0.43579	U	0.000546	T	0.46386	0.1390	M	0.67953	2.075	0.38861	D	0.956472	D;D	0.65815	0.995;0.984	D;P	0.63703	0.917;0.765	T	0.45086	-0.9285	10	0.48119	T	0.1	-14.1375	8.1957	0.31396	0.0:0.7913:0.0:0.2087	.	62;62	O60331-3;O60331	.;PI51C_HUMAN	C	62	ENSP00000335333:G62C;ENSP00000445992:G62C;ENSP00000444779:G62C	ENSP00000335333:G62C	G	-	1	0	PIP5K1C	3615855	0.869000	0.29996	0.999000	0.59377	0.993000	0.82548	1.801000	0.38843	0.922000	0.37019	0.491000	0.48974	GGT		0.622	PIP5K1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453432.2	NM_012398		47	84	1	0	9.72345e-25	0.00361	1.45453e-24	47	84				
CCDC94	55702	broad.mit.edu	37	19	4267771	4267771	+	Splice_Site	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr19:4267771G>T	ENST00000262962.7	+	7	927	c.859G>T	c.(859-861)Gga>Tga	p.G287*		NM_018074.4	NP_060544.2	Q9BW85	CCD94_HUMAN	coiled-coil domain containing 94	287								p.G287*(1)		NS(1)|endometrium(1)|lung(2)|ovary(1)|stomach(2)	7				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0348)|STAD - Stomach adenocarcinoma(1328;0.183)		CCCCACCCCAGGTAAGGTCAC	0.657											OREG0025164	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002lzv.3		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(859-861)GGA>TGA		coiled-coil domain containing 94							9.0	13.0	11.0					19																	4267771		2183	4288	6471	SO:0001630	splice_region_variant	55702							g.chr19:4267771G>T	AK001236	CCDS12124.1	19p13.3	2008-02-05				ENSG00000105248			25518	protein-coding gene	gene with protein product						12477932	Standard	NM_018074		Approved	FLJ10374	uc002lzv.4	Q9BW85		ENST00000262962.7:c.859+1G>T	19.37:g.4267771G>T			OREG0025164	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	617		p.G287*	NM_018074	NP_060544	Q9BW85	CCD94_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0348)|STAD - Stomach adenocarcinoma(1328;0.183)	7	892	+			287					O75270|Q9H862|Q9NW16	Nonsense_Mutation	SNP	ENST00000262962.7	37	c.859G>T	CCDS12124.1	.	.	.	.	.	.	.	.	.	.	G	18.66	3.672406	0.67928	.	.	ENSG00000105248	ENST00000262962	.	.	.	3.87	2.82	0.32997	.	5.379370	0.00969	U	0.003216	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.17832	T	0.49	-19.7201	8.6272	0.33897	0.1124:0.0:0.8876:0.0	.	.	.	.	X	287	.	ENSP00000262962:G287X	G	+	1	0	CCDC94	4218771	0.998000	0.40836	0.129000	0.21949	0.097000	0.18754	3.267000	0.51577	0.763000	0.33175	0.485000	0.47835	GGA		0.657	CCDC94-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458007.2	NM_018074	Nonsense_Mutation	7	12	1	0	8.12818e-05	0.001984	8.67482e-05	7	12				
DPP9	91039	broad.mit.edu	37	19	4685763	4685763	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr19:4685763G>A	ENST00000598800.1	-	18	2324	c.1819C>T	c.(1819-1821)Cct>Tct	p.P607S	DPP9_ENST00000594671.1_Missense_Mutation_p.P607S|DPP9_ENST00000262960.9_Missense_Mutation_p.P636S|AC005594.3_ENST00000381796.1_RNA|DPP9_ENST00000601173.1_5'Flank			Q86TI2	DPP9_HUMAN	dipeptidyl-peptidase 9	607						cytoplasm (GO:0005737)|membrane (GO:0016020)	aminopeptidase activity (GO:0004177)|identical protein binding (GO:0042802)|serine-type peptidase activity (GO:0008236)	p.P715S(1)		cervix(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00884)		ATCTCTGGAGGAACATAATCC	0.627																																							uc002mba.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1906-1908)CCT>TCT		dipeptidylpeptidase 9							38.0	43.0	42.0					19																	4685763		2001	4158	6159	SO:0001583	missense	91039				proteolysis	cytosol|membrane	aminopeptidase activity|serine-type peptidase activity	g.chr19:4685763G>A	AF452102	CCDS45928.1	19p13.3	2014-06-11	2006-01-12		ENSG00000142002	ENSG00000142002			18648	protein-coding gene	gene with protein product		608258	"""dipeptidylpeptidase 9"""				Standard	NM_139159		Approved		uc002mba.3	Q86TI2	OTTHUMG00000182040	ENST00000598800.1:c.1819C>T	19.37:g.4685763G>A	ENSP00000469603:p.Pro607Ser						p.P636S	NM_139159	NP_631898	Q86TI2	DPP9_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00884)	17	2164	-		Hepatocellular(1079;0.137)	607					O75273|O75868|Q1ZZB8|Q6AI37|Q6UAL0|Q6ZMT2|Q6ZNJ5|Q8N2J7|Q8N3F5|Q8WXD8|Q96NT8|Q9BVR3	Missense_Mutation	SNP	ENST00000598800.1	37	c.1906C>T		.	.	.	.	.	.	.	.	.	.	G	14.28	2.486874	0.44249	.	.	ENSG00000142002	ENST00000357909;ENST00000381797;ENST00000262960	T	0.44881	0.91	3.83	3.83	0.44106	.	0.000000	0.85682	D	0.000000	T	0.56804	0.2010	M	0.63428	1.95	0.80722	D	1	D	0.64830	0.994	P	0.62435	0.902	T	0.56396	-0.7986	10	0.33141	T	0.24	-21.8125	14.9688	0.71217	0.0:0.0:1.0:0.0	.	636	Q1ZZB8	.	S	715;577;636	ENSP00000262960:P636S	ENSP00000262960:P636S	P	-	1	0	DPP9	4636763	1.000000	0.71417	0.982000	0.44146	0.024000	0.10985	7.552000	0.82192	1.991000	0.58162	0.456000	0.33151	CCT		0.627	DPP9-026	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000459343.2			10	23	0	0	0	0.010729	0	10	23				
MUC16	94025	broad.mit.edu	37	19	9077163	9077163	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr19:9077163G>T	ENST00000397910.4	-	3	10486	c.10283C>A	c.(10282-10284)tCt>tAt	p.S3428Y		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	3429	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.S3428Y(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ATCTGACCAAGAACTAGTTGA	0.458																																							uc002mkp.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(10282-10284)TCT>TAT		mucin 16							213.0	202.0	206.0					19																	9077163		2038	4193	6231	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9077163G>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.10283C>A	19.37:g.9077163G>T	ENSP00000381008:p.Ser3428Tyr						p.S3428Y	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN			3	10487	-			3429			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.10283C>A	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	3.468	-0.108530	0.06924	.	.	ENSG00000181143	ENST00000397910	T	0.02737	4.18	2.04	2.04	0.26737	.	.	.	.	.	T	0.03520	0.0101	N	0.08118	0	.	.	.	D	0.53462	0.96	P	0.56865	0.808	T	0.42447	-0.9451	8	0.87932	D	0	.	7.6196	0.28177	0.0:0.0:1.0:0.0	.	3428	B5ME49	.	Y	3428	ENSP00000381008:S3428Y	ENSP00000381008:S3428Y	S	-	2	0	MUC16	8938163	0.000000	0.05858	0.001000	0.08648	0.025000	0.11179	-0.041000	0.12084	1.436000	0.47453	0.313000	0.20887	TCT		0.458	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		79	122	1	0	3.71121e-27	0.00361	5.71557e-27	79	122				
KEAP1	9817	broad.mit.edu	37	19	10600477	10600477	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr19:10600477T>C	ENST00000171111.5	-	4	1925	c.1378A>G	c.(1378-1380)Agg>Ggg	p.R460G	KEAP1_ENST00000588024.1_5'Flank|KEAP1_ENST00000393623.2_Missense_Mutation_p.R460G|CTC-429L19.3_ENST00000592671.1_RNA	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	460					cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)		p.R460G(1)		breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	ACCCCGATCCTTCGTGTCAGC	0.552																																							uc002moq.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(12)|breast(3)|ovary(1)|pancreas(1)	17						c.(1378-1380)AGG>GGG		kelch-like ECH-associated protein 1							60.0	51.0	54.0					19																	10600477		2203	4300	6503	SO:0001583	missense	9817				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding	g.chr19:10600477T>C	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.1378A>G	19.37:g.10600477T>C	ENSP00000171111:p.Arg460Gly					KEAP1_uc002mop.1_Missense_Mutation_p.R178G|KEAP1_uc002mor.1_Missense_Mutation_p.R460G	p.R460G	NM_012289	NP_036421	Q14145	KEAP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		4	1534	-			460			Kelch 3.		B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Missense_Mutation	SNP	ENST00000171111.5	37	c.1378A>G	CCDS12239.1	.	.	.	.	.	.	.	.	.	.	T	26.7	4.765345	0.90020	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	D;D	0.85556	-2.0;-2.0	5.79	4.71	0.59529	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	D	0.95376	0.8499	H	0.99487	4.59	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.95729	0.8773	10	0.87932	D	0	.	9.8352	0.40965	0.0:0.0:0.2902:0.7097	.	460	Q14145	KEAP1_HUMAN	G	460	ENSP00000171111:R460G;ENSP00000377245:R460G	ENSP00000171111:R460G	R	-	1	2	KEAP1	10461477	1.000000	0.71417	0.942000	0.38095	0.986000	0.74619	3.634000	0.54302	2.221000	0.72209	0.456000	0.33151	AGG		0.552	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289		14	24	0	0	0	0.00499	0	14	24				
ZNF676	163223	broad.mit.edu	37	19	22363270	22363270	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr19:22363270C>A	ENST00000397121.2	-	3	1566	c.1249G>T	c.(1249-1251)Gga>Tga	p.G417*		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	417					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G417*(1)		NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				GGTTTCTCTCCAGTATGAATT	0.433																																							uc002nqs.1		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(1249-1251)GGA>TGA		zinc finger protein 676							67.0	68.0	68.0					19																	22363270		2099	4242	6341	SO:0001587	stop_gained	163223				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:22363270C>A	AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.1249G>T	19.37:g.22363270C>A	ENSP00000380310:p.Gly417*						p.G417*	NM_001001411	NP_001001411	Q8N7Q3	ZN676_HUMAN			3	1567	-		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)	417					A8MVX5	Nonsense_Mutation	SNP	ENST00000397121.2	37	c.1249G>T	CCDS42539.1	.	.	.	.	.	.	.	.	.	.	.	31	5.093670	0.94149	.	.	ENSG00000196109	ENST00000397121	.	.	.	0.81	0.81	0.18732	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	8.393	0.32540	0.0:1.0:0.0:0.0	.	.	.	.	X	417	.	ENSP00000380310:G417X	G	-	1	0	ZNF676	22155110	0.089000	0.21612	0.104000	0.21259	0.104000	0.19210	2.785000	0.47782	0.181000	0.19994	0.184000	0.17185	GGA		0.433	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464392.1	NM_001001411		27	47	1	0	1.88708e-17	0.008361	2.58942e-17	27	47				
ZNF536	9745	broad.mit.edu	37	19	30934586	30934586	+	Silent	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr19:30934586C>A	ENST00000355537.3	+	2	264	c.117C>A	c.(115-117)atC>atA	p.I39I		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	39					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)	p.I39I(1)		NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					TGCACCAGATCACCTCCCAGC	0.657																																							uc002nsu.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(7)|large_intestine(2)|skin(2)	11						c.(115-117)ATC>ATA		zinc finger protein 536							89.0	87.0	88.0					19																	30934586		2203	4300	6503	SO:0001819	synonymous_variant	9745				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr19:30934586C>A		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.117C>A	19.37:g.30934586C>A						ZNF536_uc010edd.1_Silent_p.I39I	p.I39I	NM_014717	NP_055532	O15090	ZN536_HUMAN			2	255	+	Esophageal squamous(110;0.0834)		39					A2RU18	Silent	SNP	ENST00000355537.3	37	c.117C>A	CCDS32984.1																																																																																				0.657	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717		36	124	1	0	1.57019e-19	0.007835	2.2214e-19	36	124				
UBA2	10054	broad.mit.edu	37	19	34922808	34922808	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr19:34922808A>G	ENST00000246548.4	+	3	335	c.265A>G	c.(265-267)Atc>Gtc	p.I89V	UBA2_ENST00000439527.2_5'UTR	NM_005499.2	NP_005490.1	Q9UBT2	SAE2_HUMAN	ubiquitin-like modifier activating enzyme 2	89					cellular protein metabolic process (GO:0044267)|positive regulation of catalytic activity (GO:0043085)|post-translational protein modification (GO:0043687)|protein sumoylation (GO:0016925)|SMT3-dependent protein catabolic process (GO:0019950)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|SUMO activating enzyme complex (GO:0031510)	ATP binding (GO:0005524)|enzyme activator activity (GO:0008047)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|SUMO activating enzyme activity (GO:0019948)	p.I89V(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	20	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.211)			GAAAGCTAATATCGTTGCCTA	0.353																																							uc002nvk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(265-267)ATC>GTC		SUMO-1 activating enzyme subunit 2							202.0	192.0	196.0					19																	34922808		2203	4300	6503	SO:0001583	missense	10054				protein sumoylation	nucleus	ATP binding|enzyme activator activity|ligase activity|metal ion binding|protein heterodimerization activity|SUMO activating enzyme activity	g.chr19:34922808A>G	BC003153	CCDS12439.1	19q13.11	2008-02-05	2007-11-30	2007-11-30		ENSG00000126261		"""Ubiquitin-like modifier activating enzymes"""	30661	protein-coding gene	gene with protein product	"""UBA2, ubiquitin-activating enzyme E1 homolog (yeast)"""	613295	"""SUMO1 activating enzyme subunit 2"""	SAE2		10187858, 9920803	Standard	NM_005499		Approved	FLJ13058, HRIHFB2115, ARX	uc002nvk.3	Q9UBT2		ENST00000246548.4:c.265A>G	19.37:g.34922808A>G	ENSP00000246548:p.Ile89Val					UBA2_uc010xrx.1_Intron|UBA2_uc002nvl.2_Translation_Start_Site	p.I89V	NM_005499	NP_005490	Q9UBT2	SAE2_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.211)		3	335	+	Esophageal squamous(110;0.162)		89					B3KWB9|O95605|Q59H87|Q6IBP6|Q9NTJ1|Q9UED2	Missense_Mutation	SNP	ENST00000246548.4	37	c.265A>G	CCDS12439.1	.	.	.	.	.	.	.	.	.	.	A	19.76	3.888229	0.72524	.	.	ENSG00000126261	ENST00000246548	T	0.27890	1.64	5.52	4.5	0.54988	UBA/THIF-type NAD/FAD binding fold (1);Molybdenum cofactor biosynthesis, MoeB (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.36799	0.0980	L	0.32530	0.975	0.80722	D	1	P	0.50710	0.938	P	0.57548	0.823	T	0.04565	-1.0942	10	0.38643	T	0.18	-9.3928	11.0613	0.47948	0.8608:0.0:0.0:0.1392	.	89	Q9UBT2	SAE2_HUMAN	V	89	ENSP00000246548:I89V	ENSP00000246548:I89V	I	+	1	0	UBA2	39614648	1.000000	0.71417	0.500000	0.27589	0.979000	0.70002	8.660000	0.91121	0.896000	0.36366	0.460000	0.39030	ATC		0.353	UBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459257.3	NM_005499		66	195	0	0	0	0.00361	0	66	195				
SPTBN4	57731	broad.mit.edu	37	19	41081361	41081361	+	Silent	SNP	G	G	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr19:41081361G>A	ENST00000352632.3	+	36	7667	c.7581G>A	c.(7579-7581)gcG>gcA	p.A2527A	SHKBP1_ENST00000291842.5_5'Flank|SPTBN4_ENST00000598249.1_Silent_p.A2527A|SHKBP1_ENST00000600733.1_5'Flank|SPTBN4_ENST00000593816.1_3'UTR|SPTBN4_ENST00000392025.1_Silent_p.A1270A			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	2527	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.A2527A(1)		breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CCTCGGTGGCGGAACACGCAG	0.592																																							uc002ony.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|central_nervous_system(1)|skin(1)	5						c.(7579-7581)GCG>GCA		spectrin, beta, non-erythrocytic 4 isoform							37.0	31.0	33.0					19																	41081361		2203	4300	6503	SO:0001819	synonymous_variant	57731				actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton	g.chr19:41081361G>A	AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.7581G>A	19.37:g.41081361G>A						SPTBN4_uc002onz.2_Silent_p.A2527A|SPTBN4_uc010egx.2_Silent_p.A1270A|SHKBP1_uc002oob.2_5'Flank|SHKBP1_uc002ooc.2_5'Flank|SHKBP1_uc002ood.2_5'Flank|SHKBP1_uc010xvl.1_5'Flank|SHKBP1_uc002ooe.2_5'Flank|SHKBP1_uc002oof.2_5'Flank	p.A2527A	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)		36	7667	+			2527			PH.		E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Silent	SNP	ENST00000352632.3	37	c.7581G>A	CCDS12559.1																																																																																				0.592	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462559.2			8	14	0	0	0	0.008291	0	8	14				
ZNF221	7638	broad.mit.edu	37	19	44470819	44470819	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr19:44470819A>T	ENST00000251269.5	+	6	1493	c.1165A>T	c.(1165-1167)Aca>Tca	p.T389S	ZNF221_ENST00000592350.1_Missense_Mutation_p.T389S|ZNF221_ENST00000587682.1_Missense_Mutation_p.T389S	NM_013359.2	NP_037491	Q9UK13	ZN221_HUMAN	zinc finger protein 221	389					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T389S(1)		central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(11)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	30		Prostate(69;0.0352)				GATGGTCCACACAGGAGAGAA	0.413																																							uc002oxx.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1165-1167)ACA>TCA		zinc finger protein 221							101.0	98.0	99.0					19																	44470819		2203	4300	6503	SO:0001583	missense	7638				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:44470819A>T	AF187987	CCDS12633.1	19q13.31	2013-01-08				ENSG00000159905		"""Zinc fingers, C2H2-type"", ""-"""	13014	protein-coding gene	gene with protein product							Standard	NM_013359		Approved		uc002oxx.2	Q9UK13		ENST00000251269.5:c.1165A>T	19.37:g.44470819A>T	ENSP00000251269:p.Thr389Ser					ZNF221_uc010ejb.1_Missense_Mutation_p.T389S|ZNF221_uc010xws.1_Missense_Mutation_p.T389S	p.T389S	NM_013359	NP_037491	Q9UK13	ZN221_HUMAN			6	1493	+		Prostate(69;0.0352)	389					B2RAI6|Q2M2H2|Q9P1U8	Missense_Mutation	SNP	ENST00000251269.5	37	c.1165A>T	CCDS12633.1	.	.	.	.	.	.	.	.	.	.	a	26.5	4.745713	0.89663	.	.	ENSG00000159905	ENST00000251269	T	0.24151	1.87	2.44	1.37	0.22104	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.32436	0.0829	L	0.35644	1.08	0.22842	N	0.998669	D	0.53885	0.963	P	0.61003	0.882	T	0.11060	-1.0603	9	0.62326	D	0.03	.	6.4739	0.22024	0.8668:0.0:0.1332:0.0	.	389	Q9UK13	ZN221_HUMAN	S	389	ENSP00000251269:T389S	ENSP00000251269:T389S	T	+	1	0	ZNF221	49162659	0.955000	0.32602	0.874000	0.34290	0.990000	0.78478	2.270000	0.43355	0.191000	0.20236	0.379000	0.24179	ACA		0.413	ZNF221-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460068.1			42	111	0	0	0	0.007835	0	42	111				
MARK4	57787	broad.mit.edu	37	19	45762388	45762388	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr19:45762388A>T	ENST00000262891.4	+	2	524	c.193A>T	c.(193-195)Att>Ttt	p.I65F	MARK4_ENST00000300843.4_Missense_Mutation_p.I65F	NM_001199867.1	NP_001186796.1	Q96L34	MARK4_HUMAN	MAP/microtubule affinity-regulating kinase 4	65	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|nervous system development (GO:0007399)|positive regulation of programmed cell death (GO:0043068)|protein phosphorylation (GO:0006468)	centrosome (GO:0005813)|microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|microtubule binding (GO:0008017)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)|ubiquitin binding (GO:0043130)	p.I65F(2)		NS(1)|biliary_tract(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	31		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0102)		GCTGAGGACCATTGGGAAGGG	0.652																																							uc002pbb.1		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(2)|large_intestine(1)	3						c.(193-195)ATT>TTT		RecName: Full=MAP/microtubule affinity-regulating kinase 4;          EC=2.7.11.1; AltName: Full=MAP/microtubule affinity-regulating kinase-like 1;							46.0	40.0	42.0					19																	45762388		2203	4300	6503	SO:0001583	missense	57787				microtubule bundle formation|nervous system development|positive regulation of programmed cell death	centrosome|neuron projection	ATP binding|gamma-tubulin binding|microtubule binding|protein serine/threonine kinase activity|tau-protein kinase activity|ubiquitin binding	g.chr19:45762388A>T	AB049127	CCDS12658.1, CCDS56097.1	19q13.32	2014-04-07	2002-06-12	2002-06-14	ENSG00000007047	ENSG00000007047	2.7.11.1		13538	protein-coding gene	gene with protein product		606495	"""MAP/microtubule affinity-regulating kinase like 1"""	MARKL1		23400999, 11326310, 9108484	Standard	NM_001199867		Approved	Nbla00650, FLJ90097, KIAA1860, PAR-1D	uc002paz.2	Q96L34	OTTHUMG00000181769	ENST00000262891.4:c.193A>T	19.37:g.45762388A>T	ENSP00000262891:p.Ile65Phe					MARK4_uc002paz.1_Intron|MARK4_uc002pba.1_Missense_Mutation_p.I65F	p.I65F			Q96L34	MARK4_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.0102)	2	198	+		all_neural(266;0.224)|Ovarian(192;0.231)	65			ATP (By similarity).|Protein kinase.		Q8NG37|Q96JG7|Q96SQ2|Q9BYD8	Missense_Mutation	SNP	ENST00000262891.4	37	c.193A>T	CCDS56097.1	.	.	.	.	.	.	.	.	.	.	A	19.20	3.780757	0.70222	.	.	ENSG00000007047	ENST00000262893;ENST00000262891;ENST00000300843	T;T	0.35048	1.33;1.33	4.3	4.3	0.51218	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000001	T	0.47451	0.1446	M	0.90814	3.15	0.80722	D	1	P;P	0.50066	0.931;0.733	B;B	0.42361	0.385;0.151	T	0.62393	-0.6864	10	0.87932	D	0	.	11.7466	0.51823	1.0:0.0:0.0:0.0	.	65;65	Q96L34;Q96L34-2	MARK4_HUMAN;.	F	65	ENSP00000262891:I65F;ENSP00000300843:I65F	ENSP00000262891:I65F	I	+	1	0	MARK4	50454228	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.836000	0.75349	1.955000	0.56771	0.454000	0.30748	ATT		0.652	MARK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457537.1	NM_031417		16	43	0	0	0	0.007413	0	16	43				
KLK7	5650	broad.mit.edu	37	19	51483646	51483646	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr19:51483646G>T	ENST00000391807.1	-	4	420	c.319C>A	c.(319-321)Cag>Aag	p.Q107K	KLK7_ENST00000595638.1_5'Flank|KLK7_ENST00000597707.1_Missense_Mutation_p.Q35K|CTB-147C22.9_ENST00000594512.1_RNA|KLK7_ENST00000336317.4_5'UTR|KLK7_ENST00000595820.1_Missense_Mutation_p.Q107K	NM_139277.2	NP_644806.1	P49862	KLK7_HUMAN	kallikrein-related peptidase 7	107	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	epidermal lamellar body (GO:0097209)|extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.Q107K(1)		NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(11)|ovary(2)	19		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00382)|GBM - Glioblastoma multiforme(134;0.00895)		ACATGGGTCTGTGTGGAGTAG	0.592																																							uc002puo.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(319-321)CAG>AAG		stratum corneum chymotryptic enzyme							130.0	100.0	110.0					19																	51483646		2203	4300	6503	SO:0001583	missense	5650				epidermis development|proteolysis	extracellular region	serine-type endopeptidase activity	g.chr19:51483646G>T	L33404	CCDS12812.1, CCDS59414.1	19q13.33	2011-09-07	2006-10-27			ENSG00000169035		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6368	protein-coding gene	gene with protein product		604438	"""kallikrein 7 (chymotryptic, stratum corneum)"""	PRSS6		8034709, 16800724, 16800723	Standard	NM_005046		Approved	SCCE	uc021uyj.1	P49862		ENST00000391807.1:c.319C>A	19.37:g.51483646G>T	ENSP00000375683:p.Gln107Lys					KLK7_uc002pup.2_Missense_Mutation_p.Q107K|KLK7_uc010yco.1_5'UTR|KLK7_uc010eok.2_Missense_Mutation_p.Q35K	p.Q107K	NM_139277	NP_644806	P49862	KLK7_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00382)|GBM - Glioblastoma multiforme(134;0.00895)	4	421	-		all_neural(266;0.026)	107			Peptidase S1.		A8K0U5|Q8N5N9|Q8NFV7	Missense_Mutation	SNP	ENST00000391807.1	37	c.319C>A	CCDS12812.1	.	.	.	.	.	.	.	.	.	.	g	2.495	-0.316595	0.05422	.	.	ENSG00000169035	ENST00000304045;ENST00000391807	D	0.87966	-2.32	4.6	-4.54	0.03452	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	2.049170	0.03125	N	0.164388	T	0.65616	0.2708	N	0.02973	-0.45	0.09310	N	0.999998	B	0.10296	0.003	B	0.10450	0.005	T	0.66555	-0.5894	10	0.02654	T	1	.	7.695	0.28590	0.0:0.1935:0.2026:0.6039	.	107	P49862	KLK7_HUMAN	K	107	ENSP00000375683:Q107K	ENSP00000304791:Q107K	Q	-	1	0	KLK7	56175458	0.000000	0.05858	0.000000	0.03702	0.289000	0.27227	-0.446000	0.06837	-0.107000	0.12088	0.448000	0.29417	CAG		0.592	KLK7-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464344.1	NM_005046		25	65	1	0	1.77063e-15	0.005443	2.35869e-15	25	65				
VN1R2	317701	broad.mit.edu	37	19	53762540	53762540	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr19:53762540C>A	ENST00000341702.3	+	1	996	c.912C>A	c.(910-912)taC>taA	p.Y304*	VN1R2_ENST00000598458.1_3'UTR	NM_173856.2	NP_776255.2	Q8NFZ6	VN1R2_HUMAN	vomeronasal 1 receptor 2	304					response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	pheromone receptor activity (GO:0016503)	p.Y304*(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(134;0.00301)		ACAATCTCTACCCCAACTCTT	0.483																																							uc002qbi.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(910-912)TAC>TAA		vomeronasal 1 receptor 2							183.0	165.0	171.0					19																	53762540		2203	4300	6503	SO:0001587	stop_gained	317701				response to pheromone	integral to membrane|plasma membrane	pheromone receptor activity	g.chr19:53762540C>A	AF370359	CCDS12862.1	19q13.42	2012-08-22			ENSG00000196131	ENSG00000196131		"""Vomeronasal receptors / Type 1"", ""GPCR / Unclassified : Vomeronasal receptors, type 1"""	19872	protein-coding gene	gene with protein product						12123587	Standard	NM_173856		Approved	V1RL2	uc002qbi.2	Q8NFZ6		ENST00000341702.3:c.912C>A	19.37:g.53762540C>A	ENSP00000351244:p.Tyr304*						p.Y304*	NM_173856	NP_776255	Q8NFZ6	VN1R2_HUMAN		GBM - Glioblastoma multiforme(134;0.00301)	1	996	+			304			Cytoplasmic (Potential).		A1L411|Q8TDU4	Nonsense_Mutation	SNP	ENST00000341702.3	37	c.912C>A	CCDS12862.1	.	.	.	.	.	.	.	.	.	.	C	15.26	2.781031	0.49891	.	.	ENSG00000196131	ENST00000341702	.	.	.	2.93	0.7	0.18099	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	.	3.5641	0.07893	0.2463:0.6166:0.0:0.1371	.	.	.	.	X	304	.	ENSP00000351244:Y304X	Y	+	3	2	VN1R2	58454352	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.822000	0.04448	0.288000	0.22398	-0.225000	0.12378	TAC		0.483	VN1R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464285.1	NM_173856		60	162	1	0	6.60958e-23	0.00361	9.76719e-23	60	162				
ZNF761	388561	broad.mit.edu	37	19	53952872	53952872	+	RNA	SNP	T	T	C			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr19:53952872T>C	ENST00000454407.1	+	0	576							Q86XN6	ZN761_HUMAN	zinc finger protein 761						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	30				GBM - Glioblastoma multiforme(134;0.00786)		TGGAGAATTATAGGAACCTGG	0.473																																							uc010eqp.2		NA																	0				ovary(1)	1						c.(121-123)TAT>TAC		zinc finger protein 761							35.0	42.0	40.0					19																	53952872		875	1981	2856			388561				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53952872T>C	AB107355		19q13.42	2007-10-05	2006-08-11	2006-08-11	ENSG00000160336	ENSG00000160336		"""Zinc fingers, C2H2-type"""	23179	protein-coding gene	gene with protein product							Standard	NM_001008401		Approved	KIAA2033, FLJ16231, FLJ35333	uc010eqp.3	Q86XN6	OTTHUMG00000156999		19.37:g.53952872T>C						ZNF761_uc002qbr.2_RNA|ZNF761_uc010ydy.1_5'UTR|ZNF761_uc002qbs.2_RNA|ZNF761_uc002qbt.1_5'Flank	p.Y41Y	NM_001008401	NP_001008401	Q86XN6	ZN761_HUMAN		GBM - Glioblastoma multiforme(134;0.00786)	5	581	+			41			KRAB.		Q6ZNB9	Silent	SNP	ENST00000454407.1	37	c.123T>C																																																																																					0.473	ZNF761-203	KNOWN	basic	processed_transcript	processed_transcript		NM_001008401		19	40	0	0	0	0.00278	0	19	40				
KIR3DL1	3811	broad.mit.edu	37	19	55340905	55340905	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr19:55340905T>A	ENST00000391728.4	+	7	1123	c.1090T>A	c.(1090-1092)Tgc>Agc	p.C364S	KIR3DL1_ENST00000402254.2_Intron|KIR3DL1_ENST00000541392.1_Missense_Mutation_p.C347S|KIR3DL1_ENST00000358178.4_Missense_Mutation_p.C269S|KIR3DL1_ENST00000538269.1_Missense_Mutation_p.C364S|KIR3DL1_ENST00000326542.7_Missense_Mutation_p.C347S	NM_013289.2	NP_037421.2	P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1	364					immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)	p.C364S(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		tcatctcTGGTGCTCCAACAA	0.532																																							uc002qhk.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|skin(1)	5						c.(1090-1092)TGC>AGC		killer cell immunoglobulin-like receptor, three							183.0	141.0	155.0					19																	55340905		2171	4147	6318	SO:0001583	missense	3811				immune response|regulation of immune response	integral to plasma membrane	HLA-B specific inhibitory MHC class I receptor activity	g.chr19:55340905T>A	L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000391728.4:c.1090T>A	19.37:g.55340905T>A	ENSP00000375608:p.Cys364Ser					KIR2DS4_uc010yfj.1_Intron|KIR2DS4_uc010yfk.1_Intron|KIR3DL1_uc010yfn.1_Missense_Mutation_p.C289S|KIR3DL1_uc010esf.2_Missense_Mutation_p.C269S|KIR3DL1_uc010yfo.1_Missense_Mutation_p.C306S|KIR3DL1_uc002qhl.3_Intron	p.C364S	NM_013289	NP_037421	P43629	KI3L1_HUMAN		GBM - Glioblastoma multiforme(193;0.0192)	7	1153	+			364			Cytoplasmic (Potential).		O43473|Q14946|Q16541	Missense_Mutation	SNP	ENST00000391728.4	37	c.1090T>A	CCDS42621.1	.	.	.	.	.	.	.	.	.	.	-	6.643	0.487042	0.12641	.	.	ENSG00000167633	ENST00000538269;ENST00000541392;ENST00000355608;ENST00000391728;ENST00000326542;ENST00000358178	T;T;T;T;T	0.00481	7.12;7.19;7.12;7.19;7.11	0.743	-0.421	0.12332	.	4.446860	0.01420	U	0.014336	T	0.01765	0.0056	M	0.93062	3.375	0.09310	N	1	P;D;D	0.67145	0.882;0.996;0.973	P;D;P	0.67900	0.497;0.954;0.893	T	0.41448	-0.9508	10	0.87932	D	0	.	2.8735	0.05624	0.0:0.3487:0.0:0.6513	.	347;269;364	Q15702;Q14946;P43629	.;.;KI3L1_HUMAN	S	364;347;342;364;347;269	ENSP00000443350:C364S;ENSP00000442355:C347S;ENSP00000375608:C364S;ENSP00000326868:C347S;ENSP00000350901:C269S	ENSP00000326868:C347S	C	+	1	0	KIR3DL1	60032717	0.051000	0.20477	0.002000	0.10522	0.030000	0.12068	1.396000	0.34531	-0.194000	0.10399	0.155000	0.16302	TGC		0.532	KIR3DL1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000141238.1	NM_013289		39	38	0	0	0	0.004878	0	39	38				
ZNF135	7694	broad.mit.edu	37	19	58579319	58579319	+	Silent	SNP	A	A	G	rs546609935	byFrequency	TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr19:58579319A>G	ENST00000313434.5	+	5	1568	c.1467A>G	c.(1465-1467)acA>acG	p.T489T	ZNF135_ENST00000439855.2_Silent_p.T489T|ZNF135_ENST00000511556.1_Silent_p.T501T|ZNF135_ENST00000359978.6_Intron|RN7SL526P_ENST00000469492.2_RNA|ZNF135_ENST00000506786.1_Silent_p.T447T|ZNF135_ENST00000401053.4_Silent_p.T513T	NM_003436.3	NP_003427.3	P52742	ZN135_HUMAN	zinc finger protein 135	489					cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T513T(1)|p.T489T(1)		breast(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(26)|ovary(1)|skin(1)|urinary_tract(1)	41		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0161)		GAATCCACACAGGGGAGAAGC	0.567													A|||	2	0.000399361	0.0008	0.0	5008	,	,		21384	0.0		0.001	False		,,,				2504	0.0						uc010yhq.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(1501-1503)ACA>ACG		zinc finger protein 135 isoform 2							88.0	79.0	82.0					19																	58579319		2203	4300	6503	SO:0001819	synonymous_variant	7694				regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding	g.chr19:58579319A>G	U09413	CCDS12970.1, CCDS12970.2, CCDS54329.1, CCDS54330.1, CCDS74471.1, CCDS74472.1	19q13.4	2013-01-08	2006-05-12			ENSG00000176293		"""Zinc fingers, C2H2-type"", ""-"""	12919	protein-coding gene	gene with protein product		604077	"""zinc finger protein 61"", ""zinc finger protein 135 (clone pHZ-17)"""	ZNF61, ZNF78L1		7557990, 1505991	Standard	NM_003436		Approved	pHZ-17	uc002qrg.3	P52742		ENST00000313434.5:c.1467A>G	19.37:g.58579319A>G						ZNF135_uc002qre.2_Silent_p.T489T|ZNF135_uc002qrd.1_Intron|ZNF135_uc002qrf.2_Silent_p.T447T|ZNF135_uc002qrg.2_Silent_p.T459T|ZNF135_uc010yhr.1_Silent_p.T310T	p.T501T	NM_003436	NP_003427	B4DHH9	B4DHH9_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0161)	5	1599	+		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.147)|Ovarian(87;0.156)	501					B4DHH9|E9PEV2|F5GYY9|I3L0B3|Q5U5L3|Q8N1I7	Silent	SNP	ENST00000313434.5	37	c.1503A>G		.	.	.	.	.	.	.	.	.	.	A	0.008	-1.913413	0.00503	.	.	ENSG00000176293	ENST00000391699	.	.	.	3.18	-6.36	0.01969	.	.	.	.	.	T	0.44030	0.1274	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61662	-0.7017	4	.	.	.	.	3.492	0.07641	0.1535:0.1504:0.426:0.2701	.	.	.	.	R	507	.	.	Q	+	2	0	ZNF135	63271131	0.000000	0.05858	0.049000	0.19019	0.014000	0.08584	-20.000000	0.00000	-5.570000	0.00012	-1.756000	0.00673	CAG		0.567	ZNF135-003	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000361899.2	NM_003436		15	78	0	0	0	0.004007	0	15	78				
ZNF135	7694	broad.mit.edu	37	19	58579321	58579321	+	Missense_Mutation	SNP	G	G	T	rs376710476		TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr19:58579321G>T	ENST00000313434.5	+	5	1570	c.1469G>T	c.(1468-1470)gGg>gTg	p.G490V	ZNF135_ENST00000439855.2_Missense_Mutation_p.G490V|ZNF135_ENST00000511556.1_Missense_Mutation_p.G502V|ZNF135_ENST00000359978.6_Intron|RN7SL526P_ENST00000469492.2_RNA|ZNF135_ENST00000506786.1_Missense_Mutation_p.G448V|ZNF135_ENST00000401053.4_Missense_Mutation_p.G514V	NM_003436.3	NP_003427.3	P52742	ZN135_HUMAN	zinc finger protein 135	490					cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G490V(1)|p.G514V(1)		breast(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(26)|ovary(1)|skin(1)|urinary_tract(1)	41		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0161)		ATCCACACAGGGGAGAAGCCC	0.567																																							uc010yhq.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1504-1506)GGG>GTG		zinc finger protein 135 isoform 2							88.0	79.0	82.0					19																	58579321		2203	4300	6503	SO:0001583	missense	7694				regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding	g.chr19:58579321G>T	U09413	CCDS12970.1, CCDS12970.2, CCDS54329.1, CCDS54330.1, CCDS74471.1, CCDS74472.1	19q13.4	2013-01-08	2006-05-12			ENSG00000176293		"""Zinc fingers, C2H2-type"", ""-"""	12919	protein-coding gene	gene with protein product		604077	"""zinc finger protein 61"", ""zinc finger protein 135 (clone pHZ-17)"""	ZNF61, ZNF78L1		7557990, 1505991	Standard	NM_003436		Approved	pHZ-17	uc002qrg.3	P52742		ENST00000313434.5:c.1469G>T	19.37:g.58579321G>T	ENSP00000321406:p.Gly490Val					ZNF135_uc002qre.2_Missense_Mutation_p.G490V|ZNF135_uc002qrd.1_Intron|ZNF135_uc002qrf.2_Missense_Mutation_p.G448V|ZNF135_uc002qrg.2_Missense_Mutation_p.G460V|ZNF135_uc010yhr.1_Missense_Mutation_p.G311V	p.G502V	NM_003436	NP_003427	B4DHH9	B4DHH9_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0161)	5	1601	+		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.147)|Ovarian(87;0.156)	502					B4DHH9|E9PEV2|F5GYY9|I3L0B3|Q5U5L3|Q8N1I7	Missense_Mutation	SNP	ENST00000313434.5	37	c.1505G>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.40|10.40	1.340476|1.340476	0.24339|0.24339	.|.	.|.	ENSG00000176293|ENSG00000176293	ENST00000401053;ENST00000439855;ENST00000313434;ENST00000511556;ENST00000506786|ENST00000391699	T;T;T;T;T|.	0.01599|.	4.74;4.74;4.74;4.74;4.74|.	3.18|3.18	3.18|3.18	0.36537|0.36537	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);|.	.|.	.|.	.|.	.|.	T|T	0.59959|0.59959	0.2232|0.2232	M|M	0.63208|0.63208	1.945|1.945	0.58432|0.58432	D|D	0.999995|0.999995	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	T|T	0.63594|0.63594	-0.6602|-0.6602	9|6	0.87932|0.87932	D|D	0|0	.|.	4.052|4.052	0.09800|0.09800	0.127:0.0:0.6385:0.2345|0.127:0.0:0.6385:0.2345	.|.	502;490|.	E9PEV2;P52742|.	.;ZN135_HUMAN|.	V|W	514;490;490;502;448|508	ENSP00000441410:G514V;ENSP00000444828:G490V;ENSP00000321406:G490V;ENSP00000422074:G502V;ENSP00000427691:G448V|.	ENSP00000321406:G490V|ENSP00000375580:G508W	G|G	+|+	2|1	0|0	ZNF135|ZNF135	63271133|63271133	1.000000|1.000000	0.71417|0.71417	0.685000|0.685000	0.30070|0.30070	0.017000|0.017000	0.09413|0.09413	3.410000|3.410000	0.52664|0.52664	1.782000|1.782000	0.52362|0.52362	0.557000|0.557000	0.71058|0.71058	GGG|GGG		0.567	ZNF135-003	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000361899.2	NM_003436		15	78	1	0	7.05477e-17	0.00499	9.60817e-17	15	78				
PXDN	7837	broad.mit.edu	37	2	1667444	1667444	+	Silent	SNP	G	G	A	rs376728530		TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr2:1667444G>A	ENST00000252804.4	-	12	1550	c.1500C>T	c.(1498-1500)taC>taT	p.Y500Y	PXDN_ENST00000483018.1_5'Flank	NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	500	Ig-like C2-type 3.				extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.Y500Y(1)		breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		CCTGGCATTCGTACTGGCCCT	0.602																																							uc002qxa.2		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(6)|ovary(2)	8						c.(1498-1500)TAC>TAT		peroxidasin precursor		G		0,4118		0,0,2059	88.0	96.0	93.0		1500	-5.4	0.8	2		93	1,8359		0,1,4179	no	coding-synonymous	PXDN	NM_012293.1		0,1,6238	AA,AG,GG		0.012,0.0,0.0080		500/1480	1667444	1,12477	2059	4180	6239	SO:0001819	synonymous_variant	7837				extracellular matrix organization|hydrogen peroxide catabolic process|immune response	endoplasmic reticulum|extracellular space|proteinaceous extracellular matrix	extracellular matrix structural constituent|heme binding|interleukin-1 receptor antagonist activity|peroxidase activity	g.chr2:1667444G>A	AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.1500C>T	2.37:g.1667444G>A						PXDN_uc002qxb.1_Silent_p.Y500Y	p.Y500Y	NM_012293	NP_036425	Q92626	PXDN_HUMAN		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)	12	1564	-	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)	500			Ig-like C2-type 3.		A8QM65|D6W4Y0|Q4KMG2	Silent	SNP	ENST00000252804.4	37	c.1500C>T	CCDS46221.1	.	.	.	.	.	.	.	.	.	.	G	6.595	0.478137	0.12521	0.0	1.2E-4	ENSG00000130508	ENST00000433670	.	.	.	5.79	-5.42	0.02640	.	.	.	.	.	T	0.65302	0.2678	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.66913	-0.5803	4	.	.	.	-41.2775	16.6362	0.85060	0.849:0.0:0.151:0.0	.	.	.	.	M	496	.	.	T	-	2	0	PXDN	1646451	0.361000	0.24972	0.847000	0.33407	0.633000	0.38033	-0.194000	0.09559	-1.020000	0.03354	-1.202000	0.01658	ACG		0.602	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322505.1	XM_056455		12	161	0	0	0	0.001855	0	12	161				
APOB	338	broad.mit.edu	37	2	21230206	21230206	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr2:21230206C>G	ENST00000233242.1	-	26	9661	c.9534G>C	c.(9532-9534)aaG>aaC	p.K3178N		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	3178	Basic (possible receptor binding region).|Heparin-binding.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.K3178N(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTTTGTTTTTCTTATACTGAG	0.358																																							uc002red.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27						c.(9532-9534)AAG>AAC		apolipoprotein B precursor	Atorvastatin(DB01076)						70.0	70.0	70.0					2																	21230206		2203	4300	6503	SO:0001583	missense	338				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity	g.chr2:21230206C>G	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.9534G>C	2.37:g.21230206C>G	ENSP00000233242:p.Lys3178Asn						p.K3178N	NM_000384	NP_000375	P04114	APOB_HUMAN			26	9662	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		3178			Heparin-binding.|Basic (possible receptor binding region).		O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	c.9534G>C	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	C	14.65	2.598980	0.46318	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.44881	0.91	5.45	1.26	0.21427	.	0.296610	0.29172	N	0.012926	T	0.51295	0.1666	M	0.90705	3.14	0.80722	D	1	P	0.41475	0.751	P	0.45343	0.477	T	0.53265	-0.8463	10	0.46703	T	0.11	.	7.158	0.25649	0.0:0.6683:0.1223:0.2093	.	3178	P04114	APOB_HUMAN	N	3178	ENSP00000233242:K3178N	ENSP00000233242:K3178N	K	-	3	2	APOB	21083711	0.627000	0.27129	1.000000	0.80357	0.863000	0.49368	-0.109000	0.10840	0.647000	0.30713	0.563000	0.77884	AAG		0.358	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1			26	71	0	0	0	0.008361	0	26	71				
APOB	338	broad.mit.edu	37	2	21246397	21246397	+	Splice_Site	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr2:21246397G>T	ENST00000233242.1	-	17	2731	c.2604C>A	c.(2602-2604)aaC>aaA	p.N868K		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	868					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.N868K(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGAATCTTACGTTGGCTACTT	0.403																																							uc002red.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27						c.(2602-2604)AAC>AAA		apolipoprotein B precursor	Atorvastatin(DB01076)						109.0	103.0	105.0					2																	21246397		2203	4300	6503	SO:0001630	splice_region_variant	338				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity	g.chr2:21246397G>T	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.2604+1C>A	2.37:g.21246397G>T							p.N868K	NM_000384	NP_000375	P04114	APOB_HUMAN			17	2732	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		868					O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	c.2604C>A	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	G	5.533	0.283276	0.10458	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.15718	2.4	5.35	-10.7	0.00240	Lipid transport protein, beta-sheet shell (1);Vitellinogen, open beta-sheet (1);Vitellinogen, open beta-sheet, subdomain 2 (1);	0.565142	0.17890	N	0.158558	T	0.06826	0.0174	L	0.38838	1.175	0.80722	D	1	B	0.11235	0.004	B	0.12837	0.008	T	0.37526	-0.9702	9	.	.	.	.	2.1244	0.03734	0.3273:0.088:0.3278:0.2569	.	868	P04114	APOB_HUMAN	K	868	ENSP00000233242:N868K	.	N	-	3	2	APOB	21099902	0.043000	0.20138	0.000000	0.03702	0.124000	0.20399	-0.500000	0.06405	-2.545000	0.00483	-2.852000	0.00102	AAC		0.403	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		Missense_Mutation	26	82	1	0	1.74197e-06	0.00632	1.92673e-06	26	82				
APOB	338	broad.mit.edu	37	2	21260849	21260849	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr2:21260849G>T	ENST00000233242.1	-	5	645	c.518C>A	c.(517-519)gCc>gAc	p.A173D	APOB_ENST00000399256.4_Missense_Mutation_p.A173D	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	173	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.A173D(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CACTTGCTTGGCTTCTTCTGT	0.463																																							uc002red.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27						c.(517-519)GCC>GAC		apolipoprotein B precursor	Atorvastatin(DB01076)						128.0	129.0	128.0					2																	21260849		2203	4300	6503	SO:0001583	missense	338				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity	g.chr2:21260849G>T	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.518C>A	2.37:g.21260849G>T	ENSP00000233242:p.Ala173Asp						p.A173D	NM_000384	NP_000375	P04114	APOB_HUMAN			5	646	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		173			Vitellogenin.		O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	c.518C>A	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	G	11.29	1.595403	0.28445	.	.	ENSG00000084674	ENST00000233242;ENST00000535079;ENST00000399256	T;T	0.39787	1.06;1.06	5.85	-7.09	0.01553	Lipid transport protein, beta-sheet shell (1);Lipid transport protein, N-terminal (3);Vitellinogen, beta-sheet N-terminal (1);	0.717391	0.12746	N	0.442639	T	0.16300	0.0392	N	0.02111	-0.68	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.34428	-0.9829	10	0.08599	T	0.76	.	22.3807	0.99971	0.0:0.0:0.1989:0.8011	.	173	P04114	APOB_HUMAN	D	173	ENSP00000233242:A173D;ENSP00000382200:A173D	ENSP00000233242:A173D	A	-	2	0	APOB	21114354	0.000000	0.05858	0.000000	0.03702	0.074000	0.17049	0.060000	0.14342	-0.843000	0.04189	-0.182000	0.12963	GCC		0.463	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1			39	131	1	0	1.00776e-21	0.00361	1.47723e-21	39	131				
OTOF	9381	broad.mit.edu	37	2	26691312	26691312	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr2:26691312C>A	ENST00000272371.2	-	33	4180	c.4054G>T	c.(4054-4056)Gac>Tac	p.D1352Y	OTOF_ENST00000403946.3_Missense_Mutation_p.D1352Y|OTOF_ENST00000338581.6_Missense_Mutation_p.D585Y|OTOF_ENST00000402415.3_Missense_Mutation_p.D662Y|OTOF_ENST00000339598.3_Missense_Mutation_p.D585Y	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	1352					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)	p.D1352Y(1)|p.D585Y(1)|p.D662Y(1)		NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCCTCCAAGTCAATTCCAGAG	0.557																																					GBM(102;732 1451 20652 24062 31372)	GBM(102;732 1451 20652 24062 31372)	uc002rhk.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(3)|breast(2)|central_nervous_system(1)|pancreas(1)	7						c.(4054-4056)GAC>TAC		otoferlin isoform a							177.0	152.0	160.0					2																	26691312		2203	4300	6503	SO:0001583	missense	9381				cellular membrane fusion|sensory perception of sound|synaptic vesicle exocytosis	basolateral plasma membrane|cell junction|cytosol|endoplasmic reticulum membrane|integral to membrane|membrane fraction|synaptic vesicle membrane	calcium ion binding	g.chr2:26691312C>A	AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.4054G>T	2.37:g.26691312C>A	ENSP00000272371:p.Asp1352Tyr					OTOF_uc010yla.1_Missense_Mutation_p.D82Y|OTOF_uc002rhh.2_Missense_Mutation_p.D585Y|OTOF_uc002rhi.2_Missense_Mutation_p.D662Y|OTOF_uc002rhj.2_Missense_Mutation_p.D585Y	p.D1352Y	NM_194248	NP_919224	Q9HC10	OTOF_HUMAN			33	4181	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		1352			Cytoplasmic (Potential).		B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	ENST00000272371.2	37	c.4054G>T	CCDS1725.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.118974	0.77323	.	.	ENSG00000115155	ENST00000338581;ENST00000339598;ENST00000402415;ENST00000272371;ENST00000403946	T;T;T;T;T	0.80566	-1.16;-1.16;-1.14;-1.39;-1.39	5.62	5.62	0.85841	.	0.409619	0.17195	U	0.183342	D	0.83008	0.5161	L	0.59436	1.845	0.48395	D	0.999648	P;D;P;B	0.53885	0.94;0.963;0.955;0.338	B;B;P;B	0.54312	0.417;0.409;0.748;0.346	T	0.77981	-0.2383	10	0.02654	T	1	-45.8385	18.2396	0.89963	0.0:1.0:0.0:0.0	.	1352;585;662;585	Q9HC10;Q9HC10-2;Q9HC10-3;Q9HC10-4	OTOF_HUMAN;.;.;.	Y	585;585;662;1352;1352	ENSP00000345137:D585Y;ENSP00000344521:D585Y;ENSP00000383906:D662Y;ENSP00000272371:D1352Y;ENSP00000385255:D1352Y	ENSP00000272371:D1352Y	D	-	1	0	OTOF	26544816	0.997000	0.39634	0.937000	0.37676	0.930000	0.56654	5.250000	0.65432	2.644000	0.89710	0.561000	0.74099	GAC		0.557	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214047.3			40	110	1	0	3.77016e-25	0.013114	5.6864e-25	40	110				
GCKR	2646	broad.mit.edu	37	2	27731038	27731039	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr2:27731038_27731039CC>AA	ENST00000264717.2	+	16	1405_1406	c.1342_1343CC>AA	c.(1342-1344)CCt>AAt	p.P448N	GCKR_ENST00000424318.2_Missense_Mutation_p.P258N	NM_001486.3	NP_001477.2	Q14397	GCKR_HUMAN	glucokinase (hexokinase 4) regulator	448	SIS 2. {ECO:0000255|PROSITE- ProRule:PRU00797}.				carbohydrate metabolic process (GO:0005975)|cellular glucose homeostasis (GO:0001678)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|negative regulation of glucokinase activity (GO:0033132)|positive regulation of glucokinase activity (GO:0033133)|protein import into nucleus, translocation (GO:0000060)|regulation of glucose transport (GO:0010827)|response to fructose (GO:0009750)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|triglyceride homeostasis (GO:0070328)|urate metabolic process (GO:0046415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)	carbohydrate binding (GO:0030246)|enzyme inhibitor activity (GO:0004857)|fructose-6-phosphate binding (GO:0070095)	p.P448N(1)		breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|liver(2)|lung(13)|ovary(2)	29	Acute lymphoblastic leukemia(172;0.155)					TCTCCAGATCCCTCTGAAGAAG	0.535																																							uc002rky.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1342-1344)CCT>AAT		glucokinase regulatory protein																																				SO:0001583	missense	2646				carbohydrate metabolic process|glucose transport|negative regulation of glucokinase activity|positive regulation of gene expression|protein import into nucleus, translocation|regulation of glucose transport|response to fructose stimulus|transmembrane transport|triglyceride homeostasis|urate metabolic process	cytosol|nucleoplasm	fructose-6-phosphate binding|protein binding	g.chr2:27731038_27731039CC>AA	Z48475	CCDS1757.1	2p23	2008-05-21	2004-05-20		ENSG00000084734	ENSG00000084734			4196	protein-coding gene	gene with protein product		600842	"""glucokinase (hexokinase 4) regulatory protein"""			9570959, 8662230	Standard	NM_001486		Approved		uc002rky.3	Q14397	OTTHUMG00000128426	Exception_encountered	2.37:g.27731038_27731039delinsAA	ENSP00000264717:p.Pro448Asn					GCKR_uc010ezd.2_Missense_Mutation_p.P446N|GCKR_uc010ylu.1_Missense_Mutation_p.P258N	p.P448N	NM_001486	NP_001477	Q14397	GCKR_HUMAN			16	1408_1409	+	Acute lymphoblastic leukemia(172;0.155)		448			SIS 2.		A1L4C2|B4DPQ2|Q53RY6|Q99522	Missense_Mutation	DNP	ENST00000264717.2	37	c.1342_1343CC>AA	CCDS1757.1																																																																																				0.535	GCKR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250214.1	NM_001486		18	81	0	0	0	0.004672	0	18	81				
SPAST	6683	broad.mit.edu	37	2	32289089	32289089	+	Silent	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr2:32289089G>T	ENST00000315285.3	+	1	314	c.189G>T	c.(187-189)ctG>ctT	p.L63L	SPAST_ENST00000345662.1_Silent_p.L63L	NM_014946.3	NP_055761.2			spastin									p.L63L(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(8)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					GCTTCGCGCTGCTGCGTTTGG	0.701																																							uc002roc.2		NA																	1	Substitution - coding silent(1)		lung(1)	breast(1)	1						c.(187-189)CTG>CTT		spastin isoform 1							42.0	40.0	41.0					2																	32289089		2203	4300	6503	SO:0001819	synonymous_variant	6683				cell cycle|cell death|cell differentiation|cytokinesis, completion of separation|ER to Golgi vesicle-mediated transport|microtubule bundle formation|microtubule severing|nervous system development|protein hexamerization|protein homooligomerization	endoplasmic reticulum|endosome|integral to membrane|microtubule|microtubule organizing center|nucleus|perinuclear region of cytoplasm|spindle	alpha-tubulin binding|ATP binding|beta-tubulin binding|microtubule binding|microtubule-severing ATPase activity	g.chr2:32289089G>T	AJ246001	CCDS1778.1, CCDS1779.1	2p24-p21	2014-09-17	2005-03-15	2005-03-17	ENSG00000021574	ENSG00000021574		"""ATPases / AAA-type"""	11233	protein-coding gene	gene with protein product		604277	"""spastic paraplegia 4 (autosomal dominant; spastin)"""	SPG4		10493830, 10610178	Standard	NM_014946		Approved	FSP2, ADPSP, KIAA1083	uc002roc.3	Q9UBP0	OTTHUMG00000128455	ENST00000315285.3:c.189G>T	2.37:g.32289089G>T						SPAST_uc002rod.2_Silent_p.L63L	p.L63L	NM_014946	NP_055761	Q9UBP0	SPAST_HUMAN			1	410	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)		63			Required for interaction with SSNA1 and microtubules.|Required for interaction with RTN1.|Nuclear export signal.|Required for interaction with ATL1.|Helical; (Potential).|Required for midbody localization.			Silent	SNP	ENST00000315285.3	37	c.189G>T	CCDS1778.1																																																																																				0.701	SPAST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250253.1	NM_199436		13	39	1	0	1.5739e-10	0.004007	1.91491e-10	13	39				
ABCG5	64240	broad.mit.edu	37	2	44051409	44051409	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr2:44051409A>G	ENST00000260645.1	-	8	1206	c.1067T>C	c.(1066-1068)tTc>tCc	p.F356S	ABCG5_ENST00000543989.1_Intron|ABCG5_ENST00000405322.1_Missense_Mutation_p.F185S	NM_022436.2	NP_071881.1	Q9H222	ABCG5_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 5	356					ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|excretion (GO:0007588)|intestinal cholesterol absorption (GO:0030299)|negative regulation of intestinal cholesterol absorption (GO:0045796)|negative regulation of intestinal phytosterol absorption (GO:0010949)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cholesterol transporter activity (GO:0017127)|protein heterodimerization activity (GO:0046982)	p.F356S(1)		breast(1)|kidney(2)|large_intestine(4)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	33		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)			Ezetimibe(DB00973)	TTTGGTTTTGAAAGGAACCAT	0.378																																							uc002rtn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1066-1068)TTC>TCC		ATP-binding cassette sub-family G member 5							121.0	124.0	123.0					2																	44051409		2203	4300	6503	SO:0001583	missense	64240				cholesterol efflux|cholesterol homeostasis|excretion|lipid metabolic process|negative regulation of intestinal cholesterol absorption|negative regulation of intestinal phytosterol absorption	apical plasma membrane|integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity	g.chr2:44051409A>G	T93792	CCDS1814.1	2p21	2012-03-14	2008-07-31		ENSG00000138075	ENSG00000138075		"""ATP binding cassette transporters / subfamily G"""	13886	protein-coding gene	gene with protein product	"""sterolin 1"""	605459				11099417, 11452359	Standard	NM_022436		Approved	STSL	uc002rtn.3	Q9H222	OTTHUMG00000128758	ENST00000260645.1:c.1067T>C	2.37:g.44051409A>G	ENSP00000260645:p.Phe356Ser					ABCG5_uc002rtm.2_Intron|ABCG5_uc002rto.2_Missense_Mutation_p.F185S|ABCG5_uc002rtp.2_Intron	p.F356S	NM_022436	NP_071881	Q9H222	ABCG5_HUMAN			8	1207	-		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	356			Cytoplasmic (Potential).		Q2T9G2|Q96QZ2|Q96QZ3	Missense_Mutation	SNP	ENST00000260645.1	37	c.1067T>C	CCDS1814.1	.	.	.	.	.	.	.	.	.	.	A	20.1	3.939440	0.73557	.	.	ENSG00000138075	ENST00000260645;ENST00000405322	D;T	0.90444	-2.67;-1.26	5.91	5.91	0.95273	.	0.970549	0.08557	N	0.928080	D	0.89280	0.6670	N	0.19112	0.55	0.80722	D	1	P;D	0.63880	0.456;0.993	B;P	0.56343	0.134;0.796	T	0.80420	-0.1390	10	0.06365	T	0.9	.	16.0098	0.80391	1.0:0.0:0.0:0.0	.	185;356	E7EX35;Q9H222	.;ABCG5_HUMAN	S	356;185	ENSP00000260645:F356S;ENSP00000384513:F185S	ENSP00000260645:F356S	F	-	2	0	ABCG5	43904913	1.000000	0.71417	1.000000	0.80357	0.695000	0.40330	6.437000	0.73421	2.254000	0.74563	0.533000	0.62120	TTC		0.378	ABCG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250675.1	NM_022436		49	175	0	0	0	0.00361	0	49	175				
MSH6	2956	broad.mit.edu	37	2	48027856	48027856	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr2:48027856T>C	ENST00000234420.5	+	4	2886	c.2734T>C	c.(2734-2736)Tgg>Cgg	p.W912R	MSH6_ENST00000540021.1_Missense_Mutation_p.W782R|MSH6_ENST00000538136.1_Missense_Mutation_p.W610R|FBXO11_ENST00000405808.1_Intron	NM_000179.2	NP_000170.1	P52701	MSH6_HUMAN	mutS homolog 6	912					ATP catabolic process (GO:0006200)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|response to UV (GO:0009411)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|MutSalpha complex (GO:0032301)|nuclear chromatin (GO:0000790)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|guanine/thymine mispair binding (GO:0032137)|methylated histone binding (GO:0035064)|mismatched DNA binding (GO:0030983)	p.0?(2)|p.W912R(1)		breast(8)|central_nervous_system(29)|cervix(1)|endometrium(32)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(75)|lung(25)|ovary(3)|prostate(3)|skin(10)|stomach(22)|thyroid(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	229		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			ATTGAACCGATGGGATACAGC	0.418			"""Mis, N, F, S"""		colorectal	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																														uc002rwd.3		NA	yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p16	2956	Mis|N|F|S	mutS homolog 6 (E. coli)			E		colorectal|endometrial|ovarian	colorectal		3	Whole gene deletion(2)|Substitution - Missense(1)		haematopoietic_and_lymphoid_tissue(2)|lung(1)	large_intestine(53)|central_nervous_system(28)|endometrium(28)|stomach(22)|haematopoietic_and_lymphoid_tissue(9)|lung(7)|skin(6)|urinary_tract(5)|breast(5)|ovary(3)|thyroid(1)|upper_aerodigestive_tract(1)	168						c.(2734-2736)TGG>CGG	MMR	mutS homolog 6							80.0	82.0	81.0					2																	48027856		2203	4300	6503	SO:0001583	missense	2956	Lynch_syndrome|Muir-Torre_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	determination of adult lifespan|DNA damage response, signal transduction resulting in induction of apoptosis|isotype switching|meiotic mismatch repair|negative regulation of DNA recombination|positive regulation of helicase activity|reciprocal meiotic recombination|response to UV|somatic hypermutation of immunoglobulin genes	MutSalpha complex	ATP binding|DNA-dependent ATPase activity|protein binding	g.chr2:48027856T>C	U54777	CCDS1836.1, CCDS62906.1, CCDS62907.1	2p16	2014-09-17	2013-09-12		ENSG00000116062	ENSG00000116062			7329	protein-coding gene	gene with protein product		600678	"""mutS (E. coli) homolog 6"", ""mutS homolog 6 (E. coli)"""	GTBP		7604266	Standard	NM_000179		Approved		uc002rwd.4	P52701	OTTHUMG00000129129	ENST00000234420.5:c.2734T>C	2.37:g.48027856T>C	ENSP00000234420:p.Trp912Arg					MSH6_uc002rwc.2_Missense_Mutation_p.W912R|MSH6_uc010fbj.2_Missense_Mutation_p.W610R|MSH6_uc010yoi.1_Missense_Mutation_p.W782R|MSH6_uc010yoj.1_Missense_Mutation_p.W610R	p.W912R	NM_000179	NP_000170	P52701	MSH6_HUMAN	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		4	2886	+		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	912					B4DF41|B4E3I4|F5H2F9|O43706|O43917|Q8TCX4|Q9BTB5	Missense_Mutation	SNP	ENST00000234420.5	37	c.2734T>C	CCDS1836.1	.	.	.	.	.	.	.	.	.	.	T	16.87	3.242885	0.58995	.	.	ENSG00000116062	ENST00000234420;ENST00000544857;ENST00000540021;ENST00000538136	D;D;D	0.90563	-2.69;-2.69;-2.69	5.66	5.66	0.87406	DNA mismatch repair protein MutS, core (3);	0.000000	0.85682	D	0.000000	D	0.95853	0.8650	M	0.87381	2.88	0.80722	D	1	D;D;D	0.89917	0.995;0.999;1.0	D;D;D	0.91635	0.979;0.986;0.999	D	0.96517	0.9383	10	0.87932	D	0	-9.3446	15.9019	0.79384	0.0:0.0:0.0:1.0	.	782;912;912	B4DF41;P52701;P52701-2	.;MSH6_HUMAN;.	R	912;910;782;610	ENSP00000234420:W912R;ENSP00000446475:W782R;ENSP00000438580:W610R	ENSP00000234420:W912R	W	+	1	0	MSH6	47881360	1.000000	0.71417	1.000000	0.80357	0.802000	0.45316	8.013000	0.88655	2.158000	0.67659	0.383000	0.25322	TGG		0.418	MSH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251180.4	NM_000179		49	121	0	0	0	0.00361	0	49	121				
GKN1	56287	broad.mit.edu	37	2	69204898	69204898	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr2:69204898T>A	ENST00000377938.2	+	3	301	c.238T>A	c.(238-240)Tat>Aat	p.Y80N		NM_019617.3	NP_062563.3	Q9NS71	GKN1_HUMAN	gastrokine 1	80	BRICHOS. {ECO:0000255|PROSITE- ProRule:PRU00255}.				digestion (GO:0007586)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)	extracellular region (GO:0005576)|secretory granule (GO:0030141)		p.Y80N(1)		breast(2)|large_intestine(4)|lung(5)	11						CATCTGGGATTATGGAAATGT	0.363																																							uc002sfc.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(238-240)TAT>AAT		18 kDa antrum mucosa protein precursor							122.0	115.0	118.0					2																	69204898		2203	4300	6503	SO:0001583	missense	56287				digestion|positive regulation of cell division	extracellular region		g.chr2:69204898T>A	AY139182	CCDS1891.2	2p13.3	2012-10-10			ENSG00000169605	ENSG00000169605		"""BRICHOS domain containing"""	23217	protein-coding gene	gene with protein product	"""BRICHOS domain containing 1"""	606402				12851218, 11562744	Standard	NM_019617		Approved	AMP18, CA11, BRICD1	uc002sfc.3	Q9NS71	OTTHUMG00000129574	ENST00000377938.2:c.238T>A	2.37:g.69204898T>A	ENSP00000367172:p.Tyr80Asn						p.Y80N	NM_019617	NP_062563	Q9NS71	GKN1_HUMAN			3	301	+			80			BRICHOS.		Q8IUA9	Missense_Mutation	SNP	ENST00000377938.2	37	c.238T>A	CCDS1891.2	.	.	.	.	.	.	.	.	.	.	T	14.37	2.514895	0.44763	.	.	ENSG00000169605	ENST00000377938	D	0.84730	-1.89	5.37	5.37	0.77165	BRICHOS (2);	0.085063	0.50627	D	0.000106	D	0.91971	0.7457	M	0.81802	2.56	0.38521	D	0.948712	D	0.89917	1.0	D	0.81914	0.995	D	0.93726	0.7037	10	0.87932	D	0	-36.3557	13.3807	0.60766	0.0:0.0:0.0:1.0	.	80	Q9NS71	GKN1_HUMAN	N	80	ENSP00000367172:Y80N	ENSP00000367172:Y80N	Y	+	1	0	GKN1	69058402	0.924000	0.31332	0.884000	0.34674	0.069000	0.16628	2.921000	0.48852	2.257000	0.74773	0.528000	0.53228	TAT		0.363	GKN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251769.2	NM_019617		27	54	0	0	0	0.010818	0	27	54				
GNLY	10578	broad.mit.edu	37	2	85924772	85924772	+	Silent	SNP	G	G	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr2:85924772G>A	ENST00000263863.4	+	4	527	c.399G>A	c.(397-399)gaG>gaA	p.E133E	GNLY_ENST00000524600.1_Silent_p.E160E|GNLY_ENST00000409696.3_Silent_p.E118E	NM_006433.3	NP_006424.2	P22749	GNLY_HUMAN	granulysin	133	Saposin B-type. {ECO:0000255|PROSITE- ProRule:PRU00415}.				cellular defense response (GO:0006968)|defense response to bacterium (GO:0042742)|defense response to fungus (GO:0050832)|killing of cells of other organism (GO:0031640)	extracellular space (GO:0005615)		p.E133E(1)		endometrium(4)|kidney(10)|large_intestine(1)|lung(1)|skin(2)|upper_aerodigestive_tract(1)	19						AGATCTGTGAGGACCTCAGGT	0.542																																							uc002sql.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(397-399)GAG>GAA		granulysin isoform NKG5							80.0	73.0	75.0					2																	85924772		2203	4300	6503	SO:0001819	synonymous_variant	10578				cellular defense response|defense response to bacterium|defense response to fungus|killing of cells of other organism	extracellular space		g.chr2:85924772G>A	X54101	CCDS1984.1, CCDS46354.1	2p12-q11	2008-02-05			ENSG00000115523	ENSG00000115523			4414	protein-coding gene	gene with protein product	"""T-lymphocyte activation gene 519"""	188855		LAG2		2212946, 2434598	Standard	NM_012483		Approved	NKG5, LAG-2, D2S69E, TLA519	uc002sql.4	P22749	OTTHUMG00000130179	ENST00000263863.4:c.399G>A	2.37:g.85924772G>A						GNLY_uc010fgp.2_Silent_p.E118E|GNLY_uc010ysx.1_Silent_p.E160E	p.E133E	NM_006433	NP_006424	P22749	GNLY_HUMAN			4	527	+			133			Saposin B-type.		P09325|Q6GU08	Silent	SNP	ENST00000263863.4	37	c.399G>A	CCDS1984.1	.	.	.	.	.	.	.	.	.	.	G	1.601	-0.526462	0.04141	.	.	ENSG00000115523	ENST00000526018	.	.	.	2.03	0.168	0.15012	.	.	.	.	.	T	0.23492	0.0568	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.24941	-1.0146	4	.	.	.	.	4.0828	0.09934	0.3847:0.0:0.6153:0.0	.	.	.	.	K	100	.	.	R	+	2	0	GNLY	85778283	0.822000	0.29219	0.014000	0.15608	0.079000	0.17450	0.374000	0.20501	0.029000	0.15352	0.467000	0.42956	AGG		0.542	GNLY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252497.1	NM_006433		29	59	0	0	0	0.009535	0	29	59				
RANBP2	5903	broad.mit.edu	37	2	109399221	109399221	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr2:109399221G>T	ENST00000283195.6	+	28	9398	c.9272G>T	c.(9271-9273)cGg>cTg	p.R3091L		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	3091	PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.R3091L(2)	RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						ATTGTTCCTCGGACTGCTGAG	0.408																																							uc002tem.3		NA																RANBP2/ALK(16)	2	Substitution - Missense(2)		lung(2)	soft_tissue(16)|lung(1)|pancreas(1)	18						c.(9271-9273)CGG>CTG		RAN binding protein 2							137.0	137.0	137.0					2																	109399221		2203	4300	6503	SO:0001583	missense	5903				carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding	g.chr2:109399221G>T	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.9272G>T	2.37:g.109399221G>T	ENSP00000283195:p.Arg3091Leu						p.R3091L	NM_006267	NP_006258	P49792	RBP2_HUMAN			28	9398	+			3091			PPIase cyclophilin-type.		Q13074|Q15280|Q53TE2|Q59FH7	Missense_Mutation	SNP	ENST00000283195.6	37	c.9272G>T	CCDS2079.1	.	.	.	.	.	.	.	.	.	.	G	14.16	2.451745	0.43531	.	.	ENSG00000153201	ENST00000409491;ENST00000283195	T	0.38887	1.11	5.64	-11.3	0.00108	Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (4);Cyclophilin-like (1);	.	.	.	.	T	0.25121	0.0610	L	0.33093	0.98	0.09310	N	0.999999	B	0.09022	0.002	B	0.10450	0.005	T	0.39820	-0.9595	9	0.72032	D	0.01	0.2688	8.4018	0.32590	0.1474:0.0:0.2134:0.6393	.	3091	P49792	RBP2_HUMAN	L	2115;3091	ENSP00000283195:R3091L	ENSP00000283195:R3091L	R	+	2	0	RANBP2	108765653	0.216000	0.23585	0.001000	0.08648	0.973000	0.67179	0.818000	0.27295	-2.071000	0.00880	-0.485000	0.04761	CGG		0.408	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267		69	219	1	0	4.37588e-27	0.00361	6.71091e-27	69	219				
ACOXL	55289	broad.mit.edu	37	2	111556667	111556667	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr2:111556667G>A	ENST00000389811.4	+	7	761	c.537G>A	c.(535-537)atG>atA	p.M179I	ACOXL_ENST00000340561.4_Missense_Mutation_p.M179I|ACOXL_ENST00000439055.1_Missense_Mutation_p.M179I			Q9NUZ1	ACOXL_HUMAN	acyl-CoA oxidase-like	179					fatty acid beta-oxidation (GO:0006635)	peroxisome (GO:0005777)	acyl-CoA dehydrogenase activity (GO:0003995)|acyl-CoA oxidase activity (GO:0003997)	p.M179I(2)		kidney(1)|large_intestine(4)|lung(10)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(1)	21						TTGATATGATGTACAAGGAGG	0.502																																							uc002tgr.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(535-537)ATG>ATA		acyl-Coenzyme A oxidase-like 2							185.0	147.0	160.0					2																	111556667		2203	4300	6503	SO:0001583	missense	55289				fatty acid beta-oxidation	peroxisome	acyl-CoA dehydrogenase activity|acyl-CoA oxidase activity	g.chr2:111556667G>A		CCDS46389.1	2q13	2010-06-30	2010-04-30		ENSG00000153093	ENSG00000153093			25621	protein-coding gene	gene with protein product			"""acyl-Coenzyme A oxidase-like"""				Standard	NM_001142807		Approved	FLJ11042	uc010yxk.1	Q9NUZ1	OTTHUMG00000131257	ENST00000389811.4:c.537G>A	2.37:g.111556667G>A	ENSP00000374461:p.Met179Ile					ACOXL_uc010fkc.2_Missense_Mutation_p.M179I|ACOXL_uc010yxk.1_Missense_Mutation_p.M179I	p.M179I	NM_001105516	NP_001098986	Q9NUZ1	ACOXL_HUMAN			7	761	+			179					A2RRB7|B7WPB3|B7WPP7|E9PB20|Q53R27|Q53R31|Q53SC6|Q8TCE7	Missense_Mutation	SNP	ENST00000389811.4	37	c.537G>A		.	.	.	.	.	.	.	.	.	.	G	5.507	0.278538	0.10403	.	.	ENSG00000153093	ENST00000389811;ENST00000439055;ENST00000422487;ENST00000340561;ENST00000417074	D;D;D;D	0.98777	-5.13;-5.13;-5.13;-5.13	5.65	1.23	0.21249	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA oxidase/dehydrogenase, central domain (1);	0.394048	0.24059	N	0.041925	D	0.91751	0.7391	N	0.02158	-0.66	0.23232	N	0.99807	B;B;B	0.23249	0.049;0.082;0.001	B;B;B	0.17098	0.01;0.013;0.017	D	0.87628	0.2514	10	0.72032	D	0.01	-35.4494	5.148	0.14994	0.3078:0.1565:0.5357:0.0	.	179;179;179	E9PB20;Q9NUZ1-2;Q9NUZ1	.;.;ACOXL_HUMAN	I	179;179;30;179;17	ENSP00000374461:M179I;ENSP00000407761:M179I;ENSP00000343717:M179I;ENSP00000387832:M17I	ENSP00000343717:M179I	M	+	3	0	ACOXL	111273138	0.552000	0.26505	0.441000	0.26858	0.033000	0.12548	0.392000	0.20801	0.319000	0.23209	-0.143000	0.13931	ATG		0.502	ACOXL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000254024.2	NM_018308		46	95	0	0	0	0.00361	0	46	95				
MYO7B	4648	broad.mit.edu	37	2	128389269	128389269	+	Silent	SNP	G	G	T	rs375353272		TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr2:128389269G>T	ENST00000409816.2	+	36	5144	c.5112G>T	c.(5110-5112)ccG>ccT	p.P1704P	MYO7B_ENST00000389524.4_Silent_p.P1705P|MYO7B_ENST00000428314.1_Silent_p.P1704P|MYO7B_ENST00000409090.1_Silent_p.P557P			Q6PIF6	MYO7B_HUMAN	myosin VIIB	1704	MyTH4 2. {ECO:0000255|PROSITE- ProRule:PRU00359}.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.P1948P(1)|p.P1704P(1)		breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		TGCAGCACCCGGCCCTCCAGG	0.667																																							uc002top.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)|pancreas(1)	2						c.(5110-5112)CCG>CCT		myosin VIIB							38.0	46.0	44.0					2																	128389269		2150	4248	6398	SO:0001819	synonymous_variant	4648					apical plasma membrane|myosin complex	actin binding|ATP binding|motor activity	g.chr2:128389269G>T		CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.5112G>T	2.37:g.128389269G>T						MYO7B_uc002tos.1_5'Flank|MYO7B_uc002tot.2_5'Flank	p.P1704P	NM_001080527	NP_001073996	Q6PIF6	MYO7B_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0753)	37	5165	+	Colorectal(110;0.1)		1704			MyTH4 2.		Q14786|Q8TEE1	Silent	SNP	ENST00000409816.2	37	c.5112G>T	CCDS46405.1																																																																																				0.667	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331124.3	XM_291001		5	32	1	0	5.9392e-07	0.001168	6.69077e-07	5	32				
LOC401010	401010	broad.mit.edu	37	2	132200903	132200903	+	IGR	SNP	C	C	G			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr2:132200903C>G								AC073869.19 (34281 upstream) : RP11-109E12.1 (18490 downstream)																							TCCACCAGGCCGTCCTGGTAC	0.632																																							uc002tst.2		NA																	0					0						c.(1099-1101)GGC>CGC		SubName: Full=cDNA FLJ12694 fis, clone NT2RP1000358, highly similar to Homo sapiens mRNA; cDNA DKFZp564C186 (from clone DKFZp564C186);																																				SO:0001628	intergenic_variant	401010							g.chr2:132200903C>G																													2.37:g.132200903C>G							p.G367R	NR_002826						1	1565	-									Missense_Mutation	SNP		37	c.1099G>C																																																																																				0	0.632									10	32	0	0	0	0.00245	0	10	32				
LRP1B	53353	broad.mit.edu	37	2	142004803	142004803	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr2:142004803G>A	ENST00000389484.3	-	5	1555	c.584C>T	c.(583-585)gCt>gTt	p.A195V		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	195					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.A195V(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ACCAATTTTAGCCTTGCAAGA	0.378										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(583-585)GCT>GTT		low density lipoprotein-related protein 1B							133.0	121.0	125.0					2																	142004803		2203	4300	6503	SO:0001583	missense	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:142004803G>A	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.584C>T	2.37:g.142004803G>A	ENSP00000374135:p.Ala195Val	TSP Lung(27;0.18)				LRP1B_uc010fnl.1_Intron	p.A195V	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	5	1556	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	195			Extracellular (Potential).		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	c.584C>T	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	G	12.67	2.008239	0.35415	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.97430	-4.38	5.53	-1.07	0.09968	Growth factor, receptor (1);	0.138450	0.48286	N	0.000200	D	0.91985	0.7461	N	0.20986	0.625	0.33486	D	0.588026	B	0.06786	0.001	B	0.09377	0.004	D	0.84497	0.0614	10	0.59425	D	0.04	.	11.1181	0.48273	0.4835:0.0:0.5165:0.0	.	195	Q9NZR2	LRP1B_HUMAN	V	195;133	ENSP00000374135:A195V	ENSP00000374135:A195V	A	-	2	0	LRP1B	141721273	1.000000	0.71417	0.081000	0.20488	0.051000	0.14879	2.914000	0.48797	-0.433000	0.07286	-0.781000	0.03364	GCT		0.378	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		15	50	0	0	0	0.004007	0	15	50				
UBR3	130507	broad.mit.edu	37	2	170871812	170871812	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr2:170871812G>T	ENST00000272793.5	+	30	4439	c.4389G>T	c.(4387-4389)ttG>ttT	p.L1463F	UBR3_ENST00000465630.1_3'UTR|UBR3_ENST00000418381.1_Missense_Mutation_p.L1463F|UBR3_ENST00000392631.1_Missense_Mutation_p.L284F			Q6ZT12	UBR3_HUMAN	ubiquitin protein ligase E3 component n-recognin 3 (putative)	1463					embryo development (GO:0009790)|in utero embryonic development (GO:0001701)|olfactory behavior (GO:0042048)|sensory perception of smell (GO:0007608)|suckling behavior (GO:0001967)|ubiquitin-dependent protein catabolic process (GO:0006511)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.L316F(1)|p.L1463F(1)		breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(3)|stomach(1)	33						AACTTGAATTGATTCATCGAG	0.318																																							uc010zdi.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(4387-4389)TTG>TTT		E3 ubiquitin-protein ligase UBR3							81.0	83.0	82.0					2																	170871812		2203	4300	6503	SO:0001583	missense	130507				sensory perception of smell|suckling behavior|ubiquitin-dependent protein catabolic process	integral to membrane	ubiquitin-protein ligase activity|zinc ion binding	g.chr2:170871812G>T	AL834144	CCDS2238.2	2q31.1	2008-06-23	2008-06-23	2007-11-29	ENSG00000144357	ENSG00000144357		"""Ubiquitin protein ligase E3 component n-recognins"""	30467	protein-coding gene	gene with protein product		613831	"""zinc finger protein 650"""	ZNF650		17462990	Standard	NM_172070		Approved	KIAA2024, DKFZp434P117, FLJ37422	uc010zdi.2	Q6ZT12	OTTHUMG00000132229	ENST00000272793.5:c.4389G>T	2.37:g.170871812G>T	ENSP00000272793:p.Leu1463Phe					UBR3_uc002ufr.3_RNA|UBR3_uc010fqa.2_Missense_Mutation_p.L284F|UBR3_uc002uft.3_Missense_Mutation_p.L320F|UBR3_uc010zdj.1_Missense_Mutation_p.L125F|UBR3_uc002ufu.3_5'UTR	p.L1463F	NM_172070	NP_742067	Q6ZT12	UBR3_HUMAN			30	4389	+			1463					B4DZR7|Q2KHN5|Q6ZR55|Q6ZSC2|Q8IVE7|Q8ND96	Missense_Mutation	SNP	ENST00000272793.5	37	c.4389G>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.08|16.08	3.020723|3.020723	0.54576|0.54576	.|.	.|.	ENSG00000144357|ENSG00000144357	ENST00000272793;ENST00000442603;ENST00000418381;ENST00000392631;ENST00000439681|ENST00000392632	T;T;T;T|.	0.53857|.	0.6;0.6;0.6;0.6|.	5.93|5.93	1.64|1.64	0.23874|0.23874	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.54759|.	0.1878|.	M|M	0.65498|0.65498	2.005|2.005	0.34555|0.34555	D|D	0.711701|0.711701	D;D;D|.	0.89917|.	0.999;1.0;0.998|.	D;D;D|.	0.85130|.	0.994;0.997;0.991|.	T|.	0.61397|.	-0.7071|.	10|.	0.38643|.	T|.	0.18|.	.|.	6.4475|6.4475	0.21885|0.21885	0.2092:0.0:0.6306:0.1602|0.2092:0.0:0.6306:0.1602	.|.	1463;284;1463|.	Q6ZT12;Q6ZT12-2;E7EVK3|.	UBR3_HUMAN;.;.|.	F|L	1463;1463;1463;284;134|525	ENSP00000272793:L1463F;ENSP00000396068:L1463F;ENSP00000376408:L284F;ENSP00000389097:L134F|.	ENSP00000272793:L1463F|.	L|X	+|+	3|2	2|2	UBR3|UBR3	170580058|170580058	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	0.767000|0.767000	0.26575|0.26575	0.653000|0.653000	0.30826|0.30826	0.655000|0.655000	0.94253|0.94253	TTG|TGA		0.318	UBR3-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000255290.2	NM_172070		9	20	1	0	0.000442599	0.006214	0.000468257	9	20				
ITGA6	3655	broad.mit.edu	37	2	173340413	173340413	+	Splice_Site	SNP	G	G	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr2:173340413G>A	ENST00000264106.6	+	9	1589	c.1386G>A	c.(1384-1386)caG>caA	p.Q462Q	ITGA6_ENST00000264107.7_Splice_Site_p.Q423Q|ITGA6_ENST00000409532.1_Splice_Site_p.Q304Q|ITGA6_ENST00000409080.1_Splice_Site_p.Q423Q|ITGA6_ENST00000343713.4_Splice_Site_p.Q418Q|ITGA6_ENST00000375221.2_Splice_Site_p.Q462Q			P23229	ITA6_HUMAN	integrin, alpha 6	462					amelogenesis (GO:0097186)|blood coagulation (GO:0007596)|brown fat cell differentiation (GO:0050873)|cell adhesion mediated by integrin (GO:0033627)|cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|cellular response to extracellular stimulus (GO:0031668)|cellular response to organic cyclic compound (GO:0071407)|digestive tract development (GO:0048565)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|nail development (GO:0035878)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|renal system development (GO:0072001)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|external side of plasma membrane (GO:0009897)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integrin alpha6-beta4 complex (GO:0034676)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)	p.Q423Q(2)		NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	44			OV - Ovarian serous cystadenocarcinoma(117;0.0979)			AACCAACACAGGTAACCAAAT	0.343																																							uc002uhp.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)|lung(1)	2						c.(1267-1269)CAG>CAA		integrin alpha chain, alpha 6 isoform a							111.0	118.0	115.0					2																	173340413		2203	4300	6503	SO:0001630	splice_region_variant	3655				blood coagulation|cell adhesion|hemidesmosome assembly|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|positive regulation of apoptosis|positive regulation of phosphorylation|positive regulation of transcription from RNA polymerase II promoter	integrin complex	protein binding|receptor activity	g.chr2:173340413G>A		CCDS2249.1, CCDS46451.1	2q31.1	2010-09-20			ENSG00000091409	ENSG00000091409		"""CD molecules"", ""Integrins"""	6142	protein-coding gene	gene with protein product		147556					Standard	NM_001079818		Approved	CD49f	uc002uhp.1	P23229	OTTHUMG00000132277	ENST00000264106.6:c.1386+1G>A	2.37:g.173340413G>A						ITGA6_uc010zdy.1_Silent_p.Q304Q|ITGA6_uc002uho.1_Silent_p.Q423Q|ITGA6_uc010fqm.1_Silent_p.Q69Q	p.Q423Q	NM_001079818	NP_001073286	P23229	ITA6_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0979)		8	1472	+			462			Extracellular (Potential).|FG-GAP 7.		B2RMU9|B4DG69|B4DKB8|C4AM96|G5E9H1|Q08443|Q0MRC7|Q14646|Q16508|Q53RX7|Q59HB7|Q86VL6|Q9UCT1|Q9UN03	Silent	SNP	ENST00000264106.6	37	c.1269G>A																																																																																					0.343	ITGA6-201	KNOWN	basic	protein_coding	protein_coding			Silent	38	97	0	0	0	0.004878	0	38	97				
TTN	7273	broad.mit.edu	37	2	179421984	179421984	+	Silent	SNP	A	A	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr2:179421984A>T	ENST00000591111.1	-	279	83306	c.83082T>A	c.(83080-83082)gcT>gcA	p.A27694A	TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000589042.1_Silent_p.A29335A|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Silent_p.A20395A|TTN_ENST00000460472.2_Silent_p.A20270A|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000342175.6_Silent_p.A20462A|TTN_ENST00000342992.6_Silent_p.A26767A			Q8WZ42	TITIN_HUMAN	titin	27694	Fibronectin type-III 101. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.A20462A(1)|p.A20395A(1)|p.A20270A(1)|p.A26767A(1)|p.A26765A(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACGTACCACAAGCATCAATTG	0.413																																							uc010zfg.1		NA																	5	Substitution - coding silent(5)		lung(5)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(80299-80301)GCT>GCA		titin isoform N2-A							78.0	70.0	73.0					2																	179421984		1905	4139	6044	SO:0001819	synonymous_variant	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179421984A>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.83082T>A	2.37:g.179421984A>T						uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.A20462A|TTN_uc010zfi.1_Silent_p.A20395A|TTN_uc010zfj.1_Silent_p.A20270A	p.A26767A	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		278	80525	-			27694					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37	c.80301T>A																																																																																					0.413	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		15	35	0	0	0	0.004007	0	15	35				
FASTKD2	22868	broad.mit.edu	37	2	207631989	207631989	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr2:207631989T>C	ENST00000236980.6	+	2	920	c.572T>C	c.(571-573)aTt>aCt	p.I191T	MDH1B_ENST00000374412.3_5'Flank|MDH1B_ENST00000392214.2_5'Flank|FASTKD2_ENST00000402774.3_Missense_Mutation_p.I191T|MDH1B_ENST00000454776.2_5'Flank|MDH1B_ENST00000449792.1_5'Flank|FASTKD2_ENST00000403094.3_Missense_Mutation_p.I191T	NM_014929.3	NP_055744.2	Q9NYY8	FAKD2_HUMAN	FAST kinase domains 2	191					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)	p.I191T(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(2)	21				LUSC - Lung squamous cell carcinoma(261;0.0718)|Epithelial(149;0.119)|Lung(261;0.138)		ATGTGGACAATTGCCAAAAGA	0.418																																							uc002vbu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(571-573)ATT>ACT		FAST kinase domains 2							122.0	121.0	121.0					2																	207631989		2203	4300	6503	SO:0001583	missense	22868				apoptosis|cellular respiration	mitochondrion	ATP binding|protein kinase activity	g.chr2:207631989T>C	BC001544	CCDS2371.1	2q33.3	2008-02-05	2006-07-07	2006-07-07	ENSG00000118246	ENSG00000118246			29160	protein-coding gene	gene with protein product		612322	"""KIAA0971"""	KIAA0971			Standard	NM_014929		Approved		uc002vbx.3	Q9NYY8	OTTHUMG00000132917	ENST00000236980.6:c.572T>C	2.37:g.207631989T>C	ENSP00000236980:p.Ile191Thr					MDH1B_uc010ziw.1_5'Flank|MDH1B_uc002vbs.2_5'Flank|MDH1B_uc010fui.2_5'Flank|MDH1B_uc010fuj.2_5'Flank|MDH1B_uc002vbt.2_5'Flank|FASTKD2_uc002vbv.2_Missense_Mutation_p.I191T|FASTKD2_uc002vbx.2_Missense_Mutation_p.I191T|FASTKD2_uc002vbw.1_Missense_Mutation_p.I191T	p.I191T	NM_001136193	NP_001129665	Q9NYY8	FAKD2_HUMAN		LUSC - Lung squamous cell carcinoma(261;0.0718)|Epithelial(149;0.119)|Lung(261;0.138)	2	982	+			191					Q9NVX6|Q9Y2H7	Missense_Mutation	SNP	ENST00000236980.6	37	c.572T>C	CCDS2371.1	.	.	.	.	.	.	.	.	.	.	T	16.73	3.202816	0.58234	.	.	ENSG00000118246	ENST00000236980;ENST00000402774;ENST00000403094	T;T;T	0.16597	2.33;2.33;2.33	5.31	5.31	0.75309	.	0.418959	0.23481	N	0.047715	T	0.29684	0.0741	L	0.52573	1.65	0.30313	N	0.788333	D;B	0.69078	0.997;0.038	P;B	0.61132	0.884;0.02	T	0.15549	-1.0433	10	0.49607	T	0.09	-32.0879	9.7357	0.40386	0.0:0.0776:0.0:0.9224	.	191;191	Q9NYY8-2;Q9NYY8	.;FAKD2_HUMAN	T	191	ENSP00000236980:I191T;ENSP00000385990:I191T;ENSP00000384929:I191T	ENSP00000236980:I191T	I	+	2	0	FASTKD2	207340234	1.000000	0.71417	0.991000	0.47740	0.950000	0.60333	3.877000	0.56123	1.999000	0.58509	0.459000	0.35465	ATT		0.418	FASTKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256428.2	NM_014929		63	152	0	0	0	0.00361	0	63	152				
VIL1	7429	broad.mit.edu	37	2	219295487	219295487	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr2:219295487G>T	ENST00000248444.5	+	10	1076	c.988G>T	c.(988-990)Gtg>Ttg	p.V330L	VIL1_ENST00000440053.1_Missense_Mutation_p.V330L|VIL1_ENST00000392114.2_Missense_Mutation_p.V19L	NM_007127.2	NP_009058.2	P09327	VILI_HUMAN	villin 1	330	Core.				actin filament capping (GO:0051693)|actin filament depolymerization (GO:0030042)|actin filament polymerization (GO:0030041)|actin filament severing (GO:0051014)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cytoplasmic actin-based contraction involved in cell motility (GO:0060327)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell differentiation (GO:0030855)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell migration (GO:0010634)|protein complex assembly (GO:0006461)|regulation of actin nucleation (GO:0051125)|regulation of cell shape (GO:0008360)|regulation of lamellipodium morphogenesis (GO:2000392)|regulation of wound healing (GO:0061041)|response to bacterium (GO:0009617)	actin filament bundle (GO:0032432)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|microvillus (GO:0005902)|ruffle (GO:0001726)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|identical protein binding (GO:0042802)|lysophosphatidic acid binding (GO:0035727)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)	p.V330L(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(20)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Renal(207;0.0474)		Epithelial(149;6.88e-07)|all cancers(144;0.00013)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AAGCACACAGGTGGAGGTGCA	0.567																																							uc002via.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(988-990)GTG>TTG		villin 1							85.0	78.0	80.0					2																	219295487		2203	4300	6503	SO:0001583	missense	7429				actin filament capping|actin filament depolymerization|actin filament polymerization|actin filament severing|apoptosis|cellular response to epidermal growth factor stimulus|cytoplasmic actin-based contraction involved in cell motility|epidermal growth factor receptor signaling pathway|positive regulation of actin filament bundle assembly|positive regulation of epithelial cell migration|regulation of actin nucleation|regulation of cell shape|regulation of lamellipodium morphogenesis|regulation of wound healing|response to bacterium	actin filament bundle|cytoplasm|filopodium tip|intracellular membrane-bounded organelle|lamellipodium|microvillus|ruffle	actin filament binding|calcium ion binding|caspase inhibitor activity|lysophosphatidic acid binding|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity	g.chr2:219295487G>T	X12901	CCDS2417.1	2q35	2012-10-02			ENSG00000127831	ENSG00000127831			12690	protein-coding gene	gene with protein product		193040		VIL		2846586	Standard	NM_007127		Approved	D2S1471	uc002via.3	P09327	OTTHUMG00000133112	ENST00000248444.5:c.988G>T	2.37:g.219295487G>T	ENSP00000248444:p.Val330Leu					VIL1_uc010zke.1_Missense_Mutation_p.V19L|VIL1_uc002vib.2_Missense_Mutation_p.V330L|VIL1_uc002vic.1_Missense_Mutation_p.V330L	p.V330L	NM_007127	NP_009058	P09327	VILI_HUMAN		Epithelial(149;6.88e-07)|all cancers(144;0.00013)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	10	1053	+		Renal(207;0.0474)	330			Core.		B2R9A7|Q53S11|Q96AC8	Missense_Mutation	SNP	ENST00000248444.5	37	c.988G>T	CCDS2417.1	.	.	.	.	.	.	.	.	.	.	G	11.92	1.781784	0.31502	.	.	ENSG00000127831	ENST00000248444;ENST00000392114;ENST00000440053	T;T;T	0.52983	0.64;0.98;0.64	4.02	1.19	0.21007	Gelsolin domain (1);	0.195770	0.34046	N	0.004305	T	0.46580	0.1400	L	0.48362	1.52	0.45634	D	0.998567	P;B	0.40032	0.699;0.448	P;B	0.48598	0.583;0.314	T	0.33059	-0.9883	10	0.51188	T	0.08	-2.3642	8.3962	0.32559	0.3368:0.0:0.6632:0.0	.	330;330	Q96AC8;P09327	.;VILI_HUMAN	L	330;19;330	ENSP00000248444:V330L;ENSP00000375962:V19L;ENSP00000409270:V330L	ENSP00000248444:V330L	V	+	1	0	VIL1	219003731	1.000000	0.71417	0.995000	0.50966	0.293000	0.27360	5.513000	0.67037	0.053000	0.16036	-0.379000	0.06801	GTG		0.567	VIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256778.3	NM_007127		27	109	1	0	4.74835e-14	0.010818	6.14592e-14	27	109				
CHRND	1144	broad.mit.edu	37	2	233398943	233398943	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr2:233398943C>A	ENST00000258385.3	+	11	1294	c.1262C>A	c.(1261-1263)cCa>cAa	p.P421Q	CHRND_ENST00000543200.1_Missense_Mutation_p.P406Q|CHRND_ENST00000457943.2_Missense_Mutation_p.P227Q	NM_000751.2	NP_000742.1	Q07001	ACHD_HUMAN	cholinergic receptor, nicotinic, delta (muscle)	421					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|muscle contraction (GO:0006936)|musculoskeletal movement (GO:0050881)|neuromuscular process (GO:0050905)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)	p.P421Q(1)		breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)	34		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;1.89e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00078)|Lung(119;0.00579)|LUSC - Lung squamous cell carcinoma(224;0.00754)	Galantamine(DB00674)	GGCCGGCCCCCAGCAAGCTCT	0.597																																							uc002vsw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)|skin(1)	3						c.(1261-1263)CCA>CAA		nicotinic acetylcholine receptor delta							47.0	50.0	49.0					2																	233398943		2203	4300	6503	SO:0001583	missense	1144				muscle contraction|musculoskeletal movement|neuromuscular process|skeletal muscle tissue growth|synaptic transmission	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	nicotinic acetylcholine-activated cation-selective channel activity|receptor activity	g.chr2:233398943C>A	X55019	CCDS2494.1, CCDS58754.1	2q37.1	2012-02-11	2012-02-07		ENSG00000135902	ENSG00000135902		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1965	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, delta (muscle)"""	100720	"""cholinergic receptor, nicotinic, delta"""	ACHRD			Standard	NM_000751		Approved		uc002vsw.4	Q07001	OTTHUMG00000133261	ENST00000258385.3:c.1262C>A	2.37:g.233398943C>A	ENSP00000258385:p.Pro421Gln					CHRND_uc010zmg.1_Missense_Mutation_p.P406Q|CHRND_uc010fyc.2_Missense_Mutation_p.P294Q|CHRND_uc010zmh.1_Missense_Mutation_p.P227Q	p.P421Q	NM_000751	NP_000742	Q07001	ACHD_HUMAN		Epithelial(121;1.89e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00078)|Lung(119;0.00579)|LUSC - Lung squamous cell carcinoma(224;0.00754)	11	1266	+		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)	421			Cytoplasmic (Potential).		A8K661|B4DT92|Q52LH4	Missense_Mutation	SNP	ENST00000258385.3	37	c.1262C>A	CCDS2494.1	.	.	.	.	.	.	.	.	.	.	c	18.13	3.554836	0.65425	.	.	ENSG00000135902	ENST00000543200;ENST00000258385;ENST00000457943	D;D;D	0.84944	-1.92;-1.92;-1.92	5.43	5.43	0.79202	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.975892	0.08180	U	0.985601	D	0.89952	0.6864	L	0.55103	1.725	0.49915	D	0.999838	D;D;D;D	0.71674	0.998;0.991;0.975;0.975	D;P;P;P	0.68621	0.959;0.877;0.877;0.877	T	0.81297	-0.0996	10	0.13108	T	0.6	.	14.7475	0.69499	0.0:1.0:0.0:0.0	.	227;406;421;421	B4E3W4;B4DT92;A8K661;Q07001	.;.;.;ACHD_HUMAN	Q	406;421;227	ENSP00000438380:P406Q;ENSP00000258385:P421Q;ENSP00000391055:P227Q	ENSP00000258385:P421Q	P	+	2	0	CHRND	233107187	0.864000	0.29904	0.992000	0.48379	0.869000	0.49853	3.396000	0.52565	2.547000	0.85894	0.457000	0.33378	CCA		0.597	CHRND-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257038.2			22	56	1	0	2.39556e-15	0.00278	3.16805e-15	22	56				
TMEM74B	55321	broad.mit.edu	37	20	1161882	1161882	+	Silent	SNP	G	G	A	rs371763334		TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr20:1161882G>A	ENST00000381894.3	-	2	1052	c.381C>T	c.(379-381)ctC>ctT	p.L127L	TMEM74B_ENST00000481747.1_5'Flank	NM_018354.1	NP_060824.1	Q9NUR3	TM74B_HUMAN	transmembrane protein 74B	127						integral component of membrane (GO:0016021)		p.L127L(1)									CCAGGAAAACGAGGGCGGAAA	0.612																																							uc010gaa.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(379-381)CTC>CTT		hypothetical protein LOC55321							91.0	91.0	91.0					20																	1161882		2203	4300	6503	SO:0001819	synonymous_variant	55321					integral to membrane	protein binding	g.chr20:1161882G>A	AK002052	CCDS13011.1	20p13	2011-11-23	2011-11-23	2011-11-23	ENSG00000125895	ENSG00000125895			15893	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 46"""	C20orf46			Standard	XM_005260748		Approved	FLJ11190	uc002weq.1	Q9NUR3	OTTHUMG00000031655	ENST00000381894.3:c.381C>T	20.37:g.1161882G>A						C20orf46_uc002weq.1_Silent_p.L127L	p.L127L	NM_018354	NP_060824	Q9NUR3	CT046_HUMAN			3	600	-			127			Helical; (Potential).		D3DVW5	Silent	SNP	ENST00000381894.3	37	c.381C>T	CCDS13011.1																																																																																				0.612	TMEM74B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077496.2	NM_018354		39	84	0	0	0	0.005524	0	39	84				
VPS16	64601	broad.mit.edu	37	20	2846896	2846898	+	Nonsense_Mutation	TNP	CGA	CGA	ATT	rs141400236		TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	CGA	CGA	-	-	CGA	CGA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr20:2846896_2846898CGA>ATT	ENST00000380445.3	+	23	2382_2384	c.2310_2312CGA>ATT	c.(2308-2313)taCGAa>taATTa	p.770_771YE>*L	PTPRA_ENST00000380393.3_Intron|VPS16_ENST00000380443.3_Nonsense_Mutation_p.456_457YE>*L|VPS16_ENST00000380469.3_Nonsense_Mutation_p.626_627YE>*L	NM_022575.2	NP_072097.2	Q9H269	VPS16_HUMAN	vacuolar protein sorting 16 homolog (S. cerevisiae)	770					intracellular protein transport (GO:0006886)|viral entry into host cell (GO:0046718)	actin filament (GO:0005884)|axon (GO:0030424)|early endosome (GO:0005769)|HOPS complex (GO:0030897)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|recycling endosome (GO:0055037)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	37						ATAACAAATACGAAGCCAAGAAG	0.547																																							uc002whe.2		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(2308-2313)TACGAA>TAATTA		vacuolar protein sorting 16 isoform 1																																				SO:0001587	stop_gained	64601				intracellular protein transport	early endosome|HOPS complex|late endosome membrane|lysosomal membrane|recycling endosome		g.chr20:2846896_2846898CGA>ATT	AF308801	CCDS13036.1, CCDS13037.1	20p13	2009-07-07	2009-07-07	2009-07-07	ENSG00000215305	ENSG00000215305			14584	protein-coding gene	gene with protein product		608550					Standard	NM_022575		Approved		uc002whe.3	Q9H269	OTTHUMG00000031714	ENST00000380445.3:c.2310_2312CGA>ATT	20.37:g.2846896CGA>ATT	ENSP00000369810:p.Y770_E771delins*L					VPS16_uc002whh.2_Intron|PTPRA_uc002whj.2_Intron|VPS16_uc002whf.2_Nonsense_Mutation_p.626_627YE>*L|VPS16_uc002whd.2_RNA|VPS16_uc002whg.2_Nonsense_Mutation_p.456_457YE>*L|VPS16_uc002whi.2_Nonsense_Mutation_p.254_255YE>*L	p.770_771YE>*L	NM_022575	NP_072097	Q9H269	VPS16_HUMAN			23	2358_2360	+			770_771					Q5JUB1|Q8WU31|Q96EE7|Q96N92|Q9H1Q4|Q9H1Q5	Nonsense_Mutation	TNP	ENST00000380445.3	37	c.2310_2312CGA>ATT	CCDS13036.1																																																																																				0.547	VPS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077658.2	NM_022575		13	62	0	0	0	0.004672	0	13	62				
CST9	128822	broad.mit.edu	37	20	23586393	23586393	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr20:23586393C>A	ENST00000376971.3	-	1	120	c.109G>T	c.(109-111)Ggt>Tgt	p.G37C		NM_001008693.2	NP_001008693.2	Q5W186	CST9_HUMAN	cystatin 9 (testatin)	37						extracellular region (GO:0005576)	cysteine-type endopeptidase inhibitor activity (GO:0004869)	p.G37C(1)		central_nervous_system(2)|large_intestine(4)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	12	Colorectal(13;0.0993)					TTATTATTACCACCCATTTCC	0.517																																							uc002wtl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(109-111)GGT>TGT		cystatin 9 precursor							185.0	167.0	173.0					20																	23586393		2203	4300	6503	SO:0001583	missense	128822					extracellular region	cysteine-type endopeptidase inhibitor activity	g.chr20:23586393C>A	AF494536	CCDS33450.1	20p11.21	2012-08-14			ENSG00000173335	ENSG00000173335			13261	protein-coding gene	gene with protein product						20565543	Standard	NM_001008693		Approved	CLM, CTES7A	uc002wtl.3	Q5W186	OTTHUMG00000032076	ENST00000376971.3:c.109G>T	20.37:g.23586393C>A	ENSP00000366170:p.Gly37Cys						p.G37C	NM_001008693	NP_001008693	Q5W186	CST9_HUMAN			1	218	-	Colorectal(13;0.0993)		37					B2RP76|Q8TD53	Missense_Mutation	SNP	ENST00000376971.3	37	c.109G>T	CCDS33450.1	.	.	.	.	.	.	.	.	.	.	C	6.253	0.414799	0.11870	.	.	ENSG00000173335	ENST00000376971	T	0.19105	2.17	3.06	-4.46	0.03536	.	2.614030	0.01930	N	0.041146	T	0.09158	0.0226	N	0.08118	0	0.09310	N	1	B	0.11235	0.004	B	0.10450	0.005	T	0.15378	-1.0439	10	0.36615	T	0.2	.	1.1124	0.01707	0.1751:0.3561:0.1791:0.2897	.	37	Q5W186	CST9_HUMAN	C	37	ENSP00000366170:G37C	ENSP00000366170:G37C	G	-	1	0	CST9	23534393	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.321000	0.01119	-0.930000	0.03752	-0.438000	0.05819	GGT		0.517	CST9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078341.1	NM_001008693.1		52	227	1	0	1.4374e-25	0.00361	2.17697e-25	52	227				
SUN5	140732	broad.mit.edu	37	20	31587901	31587901	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr20:31587901T>C	ENST00000356173.3	-	5	411	c.319A>G	c.(319-321)Att>Gtt	p.I107V	SUN5_ENST00000375519.2_Silent_p.A84A|SUN5_ENST00000375523.3_Missense_Mutation_p.I82V	NM_080675.3	NP_542406.2	Q8TC36	SUN5_HUMAN	Sad1 and UNC84 domain containing 5	107					spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.I107V(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	25						AGGAGCAGAATGCCTGTCTTC	0.597																																							uc002wyi.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(319-321)ATT>GTT		sperm associated antigen 4-like							119.0	86.0	97.0					20																	31587901		2203	4299	6502	SO:0001583	missense	140732				spermatogenesis			g.chr20:31587901T>C	AL121756	CCDS13209.1	20q11.21	2010-01-27	2010-01-27	2010-01-27	ENSG00000167098	ENSG00000167098			16252	protein-coding gene	gene with protein product	"""testis and spermatogenesis related gene 4"""	613942	"""sperm associated antigen 4-like"""	SPAG4L		9691178, 10373309	Standard	NM_080675		Approved	dJ726C3.1, TSARG4	uc002wyi.3	Q8TC36	OTTHUMG00000032239	ENST00000356173.3:c.319A>G	20.37:g.31587901T>C	ENSP00000348496:p.Ile107Val						p.I107V	NM_080675	NP_542406	Q8TC36	SUN5_HUMAN			5	412	-			107					A6NJ82|Q5T9R0	Missense_Mutation	SNP	ENST00000356173.3	37	c.319A>G	CCDS13209.1	.	.	.	.	.	.	.	.	.	.	T	0.004	-2.299856	0.00243	.	.	ENSG00000167098	ENST00000356173;ENST00000375523;ENST00000420875	T;T;T	0.32515	2.84;2.83;1.45	4.11	-2.06	0.07298	.	0.936471	0.08790	N	0.893379	T	0.07413	0.0187	N	0.01267	-0.92	0.19300	N	0.999979	B	0.02656	0.0	B	0.04013	0.001	T	0.34229	-0.9837	10	0.02654	T	1	-3.0424	4.4324	0.11535	0.0:0.2611:0.2473:0.4917	.	107	Q8TC36	SUN5_HUMAN	V	107;82;96	ENSP00000348496:I107V;ENSP00000364673:I82V;ENSP00000400089:I96V	ENSP00000348496:I107V	I	-	1	0	SUN5	31051562	0.000000	0.05858	0.016000	0.15963	0.235000	0.25334	-0.898000	0.04105	-0.354000	0.08212	-0.248000	0.11899	ATT		0.597	SUN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078659.1	NM_080675		9	21	0	0	0	0.001368	0	9	21				
PHACTR3	116154	broad.mit.edu	37	20	58322818	58322818	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr20:58322818G>C	ENST00000371015.1	+	3	753	c.286G>C	c.(286-288)Gag>Cag	p.E96Q	PHACTR3_ENST00000359926.3_Missense_Mutation_p.E93Q|PHACTR3_ENST00000395639.4_Missense_Mutation_p.E55Q|PHACTR3_ENST00000355648.4_Missense_Mutation_p.E55Q|PHACTR3_ENST00000395636.2_Missense_Mutation_p.E55Q|PHACTR3_ENST00000541461.1_Missense_Mutation_p.E55Q|PHACTR3_ENST00000361300.4_Missense_Mutation_p.E55Q	NM_001281507.1|NM_080672.3	NP_001268436.1|NP_542403.1	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3	96						nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)	p.E96Q(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|liver(2)|lung(32)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	59	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)			GGCAGCGCTGGAGAAGAAGAT	0.587																																							uc002yau.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(286-288)GAG>CAG		phosphatase and actin regulator 3 isoform 1							137.0	127.0	130.0					20																	58322818		2203	4300	6503	SO:0001583	missense	116154					nuclear matrix	actin binding|protein phosphatase inhibitor activity	g.chr20:58322818G>C	AJ311122	CCDS13480.1, CCDS13481.1, CCDS42895.1, CCDS56202.1	20q13.32-q13.33	2014-06-13	2004-05-20	2004-05-20	ENSG00000087495	ENSG00000087495		"""Phosphatase and actin regulators"""	15833	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 123"""	608725	"""chromosome 20 open reading frame 101"""	C20orf101		15107502	Standard	NM_001199505		Approved	PPP1R123	uc002yau.3	Q96KR7	OTTHUMG00000032869	ENST00000371015.1:c.286G>C	20.37:g.58322818G>C	ENSP00000360054:p.Glu96Gln					PHACTR3_uc002yat.2_Missense_Mutation_p.E93Q|PHACTR3_uc010zzw.1_Missense_Mutation_p.E55Q|PHACTR3_uc002yav.2_Missense_Mutation_p.E55Q|PHACTR3_uc002yaw.2_Missense_Mutation_p.E55Q|PHACTR3_uc002yax.2_Missense_Mutation_p.E55Q	p.E96Q	NM_080672	NP_542403	Q96KR7	PHAR3_HUMAN	BRCA - Breast invasive adenocarcinoma(7;2.76e-09)		3	753	+	all_lung(29;0.00344)		96			RPEL 1.		B1AKX0|B1AN68|B1AN69|B2RB46|Q32P33|Q707P6|Q9H4T4	Missense_Mutation	SNP	ENST00000371015.1	37	c.286G>C	CCDS13480.1	.	.	.	.	.	.	.	.	.	.	G	19.67	3.870220	0.72065	.	.	ENSG00000087495	ENST00000359926;ENST00000371015;ENST00000395639;ENST00000541461;ENST00000355648;ENST00000395636;ENST00000361300	T;T;T;T;T;T;T	0.39406	1.35;1.39;1.08;1.4;1.4;1.4;1.08	4.26	4.26	0.50523	.	0.000000	0.85682	D	0.000000	T	0.59252	0.2180	M	0.76938	2.355	0.58432	D	0.999997	B;D;D	0.64830	0.123;0.994;0.994	B;P;P	0.55055	0.034;0.767;0.69	T	0.68164	-0.5481	10	0.87932	D	0	-24.4635	15.9984	0.80268	0.0:0.0:1.0:0.0	.	55;96;93	Q96KR7-3;Q96KR7;B1AKX0	.;PHAR3_HUMAN;.	Q	93;96;55;55;55;55;55	ENSP00000353002:E93Q;ENSP00000360054:E96Q;ENSP00000379001:E55Q;ENSP00000442483:E55Q;ENSP00000347866:E55Q;ENSP00000378998:E55Q;ENSP00000354555:E55Q	ENSP00000347866:E55Q	E	+	1	0	PHACTR3	57756213	1.000000	0.71417	0.999000	0.59377	0.673000	0.39480	8.611000	0.90905	2.069000	0.61940	0.563000	0.77884	GAG		0.587	PHACTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079923.3	NM_080672		48	187	0	0	0	0.00361	0	48	187				
C20orf166-AS1	253868	broad.mit.edu	37	20	61143804	61143804	+	RNA	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr20:61143804G>T	ENST00000475015.1	-	0	534				C20orf166-AS1_ENST00000412495.1_RNA|C20orf166-AS1_ENST00000436101.1_RNA			Q96NR2	C2AS1_HUMAN	C20orf166 antisense RNA 1									p.S15*(1)									CTTGTGTGGTGAACTCCCCTC	0.672																																							uc002ycz.1		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(43-45)TCA>TAA		hypothetical protein LOC253868							111.0	101.0	104.0					20																	61143804		2203	4300	6503			253868							g.chr20:61143804G>T	AK054875		20q13.33	2012-10-12	2012-08-15	2011-08-10	ENSG00000174403	ENSG00000174403		"""Long non-coding RNAs"""	26393	non-coding RNA	RNA, long non-coding			"""chromosome 20 open reading frame 200"", ""non-protein coding RNA 335"", ""C20orf166 antisense RNA 1 (non-protein coding)"""	C20orf200, NCRNA00335			Standard	NR_033263		Approved	FLJ30313	uc002ycz.3	Q96NR2	OTTHUMG00000048002		20.37:g.61143804G>T						C20orf200_uc002ycy.2_RNA	p.S15*	NM_152757	NP_689970			BRCA - Breast invasive adenocarcinoma(19;7.17e-06)		3	535	-	Breast(26;2.05e-08)							Q52LN1	Nonsense_Mutation	SNP	ENST00000475015.1	37	c.44C>A																																																																																					0.672	C20orf166-AS1-002	KNOWN	basic	antisense	antisense	OTTHUMT00000109266.2	NR_033263		49	155	1	0	5.86059e-21	0.00361	8.55646e-21	49	155				
DIDO1	11083	broad.mit.edu	37	20	61542643	61542643	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr20:61542643C>A	ENST00000266070.4	-	3	647	c.322G>T	c.(322-324)Gag>Tag	p.E108*	DIDO1_ENST00000395343.1_Nonsense_Mutation_p.E108*|DIDO1_ENST00000266071.5_Nonsense_Mutation_p.E108*|DIDO1_ENST00000395335.2_Nonsense_Mutation_p.E108*|DIDO1_ENST00000370368.1_Nonsense_Mutation_p.E108*|DIDO1_ENST00000354665.4_Nonsense_Mutation_p.E108*|DIDO1_ENST00000370366.1_Nonsense_Mutation_p.E108*|DIDO1_ENST00000395340.1_Nonsense_Mutation_p.E108*|DIDO1_ENST00000370371.4_Nonsense_Mutation_p.E108*	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	108					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.E108*(2)		NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					GAGGCTGTCTCGGCGTCTGTG	0.642																																					Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	uc002ydr.1		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(3)|skin(3)	6						c.(322-324)GAG>TAG		death inducer-obliterator 1 isoform c							29.0	26.0	27.0					20																	61542643		2201	4298	6499	SO:0001587	stop_gained	11083				apoptosis|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding	g.chr20:61542643C>A	AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.322G>T	20.37:g.61542643C>A	ENSP00000266070:p.Glu108*					DIDO1_uc002yds.1_Nonsense_Mutation_p.E108*|DIDO1_uc002ydt.1_Nonsense_Mutation_p.E108*|DIDO1_uc002ydu.1_Nonsense_Mutation_p.E108*|DIDO1_uc002ydv.1_Nonsense_Mutation_p.E108*|DIDO1_uc002ydw.1_Nonsense_Mutation_p.E108*|DIDO1_uc002ydx.1_Nonsense_Mutation_p.E108*|DIDO1_uc011aao.1_Nonsense_Mutation_p.E108*	p.E108*	NM_033081	NP_149072	Q9BTC0	DIDO1_HUMAN			3	586	-	Breast(26;5.68e-08)		108					A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Nonsense_Mutation	SNP	ENST00000266070.4	37	c.322G>T	CCDS33506.1	.	.	.	.	.	.	.	.	.	.	C	33	5.234313	0.95207	.	.	ENSG00000101191	ENST00000266070;ENST00000395343;ENST00000395340;ENST00000395335;ENST00000370371;ENST00000370368;ENST00000354665;ENST00000370366;ENST00000266071	.	.	.	5.83	5.83	0.93111	.	0.000000	0.42294	U	0.000733	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-33.746	20.1184	0.97949	0.0:1.0:0.0:0.0	.	.	.	.	X	108	.	ENSP00000266070:E108X	E	-	1	0	DIDO1	61013088	1.000000	0.71417	0.088000	0.20740	0.002000	0.02628	7.321000	0.79088	2.769000	0.95229	0.655000	0.94253	GAG		0.642	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2	NM_080796		10	29	1	0	1.5842e-08	0.001855	1.84739e-08	10	29				
KCNQ2	3785	broad.mit.edu	37	20	62038665	62038665	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr20:62038665G>A	ENST00000359125.2	-	17	2125	c.1951C>T	c.(1951-1953)Ccc>Tcc	p.P651S	KCNQ2_ENST00000354587.3_Missense_Mutation_p.P659S|KCNQ2_ENST00000360480.3_Missense_Mutation_p.P623S|KCNQ2_ENST00000344462.4_Missense_Mutation_p.P620S|KCNQ2_ENST00000359689.1_Missense_Mutation_p.P651S|KCNQ2_ENST00000370224.1_Missense_Mutation_p.P659S|KCNQ2_ENST00000357249.2_Missense_Mutation_p.P633S	NM_172107.2	NP_742105.1	O43526	KCNQ2_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 2	651					axon guidance (GO:0007411)|nervous system development (GO:0007399)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)	p.P651S(1)		biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|liver(1)|lung(30)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	TCTGTCGGGGGGATGCCCATC	0.647																																							uc002yey.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)	2						c.(1951-1953)CCC>TCC		potassium voltage-gated channel KQT-like protein	Amitriptyline(DB00321)						28.0	32.0	31.0					20																	62038665		2200	4299	6499	SO:0001583	missense	3785				axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr20:62038665G>A	AF033348	CCDS13518.1, CCDS13519.1, CCDS13520.1, CCDS13521.1, CCDS46629.1	20q13.33	2012-07-05			ENSG00000075043	ENSG00000075043		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6296	protein-coding gene	gene with protein product		602235		EBN, EBN1		9425895, 16382104	Standard	NM_172107		Approved	Kv7.2, ENB1, BFNC, KCNA11, HNSPC	uc002yex.3	O43526	OTTHUMG00000033049	ENST00000359125.2:c.1951C>T	20.37:g.62038665G>A	ENSP00000352035:p.Pro651Ser					KCNQ2_uc002yez.1_Missense_Mutation_p.P620S|KCNQ2_uc002yfa.1_Missense_Mutation_p.P633S|KCNQ2_uc002yfb.1_Missense_Mutation_p.P623S	p.P651S	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		17	2128	-	all_cancers(38;1.24e-11)		651			Cytoplasmic (Potential).		O43796|O75580|O95845|Q4VXP4|Q4VXR6|Q5VYT8|Q96J59|Q99454	Missense_Mutation	SNP	ENST00000359125.2	37	c.1951C>T	CCDS13520.1	.	.	.	.	.	.	.	.	.	.	G	10.40	1.339253	0.24339	.	.	ENSG00000075043	ENST00000357249;ENST00000359125;ENST00000370226;ENST00000354587;ENST00000359689;ENST00000430658;ENST00000360480;ENST00000344462;ENST00000370224	D;D;D;D;D;D;D;D;D	0.99574	-6.2;-6.2;-6.2;-6.2;-6.2;-6.2;-6.2;-6.2;-6.2	5.06	4.08	0.47627	Potassium channel, voltage dependent, KCNQ, C-terminal (1);	0.127388	0.53938	D	0.000050	D	0.99190	0.9719	L	0.56769	1.78	0.44745	D	0.997743	D;D;D;D	0.71674	0.994;0.998;0.998;0.998	P;P;P;D	0.64321	0.801;0.801;0.801;0.924	D	0.99977	1.2271	10	0.06365	T	0.9	-25.8804	15.2323	0.73401	0.0:0.1415:0.8585:0.0	.	623;633;620;651	O43526-3;O43526-2;O43526-4;O43526	.;.;.;KCNQ2_HUMAN	S	633;651;621;659;651;620;623;647;659	ENSP00000349789:P633S;ENSP00000352035:P651S;ENSP00000359246:P621S;ENSP00000346601:P659S;ENSP00000352718:P651S;ENSP00000399612:P620S;ENSP00000353668:P623S;ENSP00000339611:P647S;ENSP00000359244:P659S	ENSP00000339611:P647S	P	-	1	0	KCNQ2	61509109	1.000000	0.71417	0.998000	0.56505	0.755000	0.42902	3.611000	0.54132	1.088000	0.41272	0.491000	0.48974	CCC		0.647	KCNQ2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080353.1	NM_172109		17	58	0	0	0	0.007413	0	17	58				
ADAMTS5	11096	broad.mit.edu	37	21	28296423	28296423	+	Silent	SNP	A	A	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr21:28296423A>T	ENST00000284987.5	-	8	2863	c.2742T>A	c.(2740-2742)ccT>ccA	p.P914P	AP001601.2_ENST00000426771.1_RNA	NM_007038.3	NP_008969.2	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 5	914	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.P914P(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	72						TTTGGGAGAGAGGACATCCTT	0.507																																					Esophageal Squamous(53;683 1080 10100 14424 45938)	Esophageal Squamous(53;683 1080 10100 14424 45938)	uc002ymg.2		NA																	1	Substitution - coding silent(1)		lung(1)	upper_aerodigestive_tract(2)|ovary(1)|pancreas(1)	4						c.(2740-2742)CCT>CCA		ADAM metallopeptidase with thrombospondin type 1							92.0	75.0	81.0					21																	28296423		2203	4300	6503	SO:0001819	synonymous_variant	11096				proteolysis	proteinaceous extracellular matrix	integrin binding|metalloendopeptidase activity|zinc ion binding	g.chr21:28296423A>T	AF142099	CCDS13579.1	21q21.3	2008-07-31	2008-07-31		ENSG00000154736	ENSG00000154736		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	221	protein-coding gene	gene with protein product	"""aggrecanase-2"""	605007	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)"""			10438522	Standard	NM_007038		Approved	ADMP-2, ADAMTS11	uc002ymg.3	Q9UNA0	OTTHUMG00000078686	ENST00000284987.5:c.2742T>A	21.37:g.28296423A>T							p.P914P	NM_007038	NP_008969	Q9UNA0	ATS5_HUMAN			8	3471	-			914			TSP type-1 2.		Q52LV4|Q9UKP2	Silent	SNP	ENST00000284987.5	37	c.2742T>A	CCDS13579.1																																																																																				0.507	ADAMTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171648.1			15	53	0	0	0	0.003163	0	15	53				
RIPK4	54101	broad.mit.edu	37	21	43161537	43161537	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr21:43161537T>C	ENST00000352483.2	-	9	2024	c.1960A>G	c.(1960-1962)Acg>Gcg	p.T654A	RIPK4_ENST00000332512.3_Missense_Mutation_p.T606A|RIPK4_ENST00000544709.1_Missense_Mutation_p.T543A|RIPK4_ENST00000542057.1_Missense_Mutation_p.T543A|AP001615.9_ENST00000423276.1_RNA			P57078	RIPK4_HUMAN	receptor-interacting serine-threonine kinase 4	654					morphogenesis of an epithelium (GO:0002009)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.T606A(1)|p.T654A(1)		NS(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						TGCAATGGCGTCCTCCCATCC	0.677																																							uc002yzn.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|central_nervous_system(2)|large_intestine(1)|lung(1)|skin(1)	7						c.(1816-1818)ACG>GCG		ankyrin repeat domain 3							60.0	60.0	60.0					21																	43161537		2203	4298	6501	SO:0001583	missense	54101					cytoplasm|nucleus	ATP binding|protein serine/threonine kinase activity	g.chr21:43161537T>C	AJ278016	CCDS13675.1	21q22.3	2013-01-10	2004-07-06	2004-07-06	ENSG00000183421	ENSG00000183421		"""Ankyrin repeat domain containing"""	496	protein-coding gene	gene with protein product	"""protein kinase C-associated kinase"", ""PKC-delta-interacting protein kinase"""	605706	"""ankyrin repeat domain 3"""	ANKRD3		10830953	Standard	NM_020639		Approved	DIK, ANKK2, RIP4, PKK	uc002yzn.1	P57078	OTTHUMG00000086770	ENST00000352483.2:c.1960A>G	21.37:g.43161537T>C	ENSP00000330161:p.Thr654Ala						p.T606A	NM_020639	NP_065690	P57078	RIPK4_HUMAN			8	1864	-			606					Q96KH0	Missense_Mutation	SNP	ENST00000352483.2	37	c.1816A>G		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.19|13.19	2.162333|2.162333	0.38217|0.38217	.|.	.|.	ENSG00000183421|ENSG00000183421	ENST00000330470|ENST00000332512;ENST00000352483;ENST00000544709;ENST00000542057	.|T;T;T;T	.|0.75477	.|-0.87;-0.94;1.73;1.73	4.98|4.98	3.82|3.82	0.43975|0.43975	.|.	.|0.000000	.|0.64402	.|D	.|0.000005	T|T	0.77772|0.77772	0.4180|0.4180	M|M	0.88570|0.88570	2.965|2.965	0.46725|0.46725	D|D	0.999174|0.999174	.|P	.|0.48350	.|0.909	.|B	.|0.43274	.|0.414	T|T	0.79135|0.79135	-0.1928|-0.1928	6|10	0.62326|0.62326	D|D	0.03|0.03	-18.5343|-18.5343	9.888|9.888	0.41272|0.41272	0.0:0.0812:0.0:0.9188|0.0:0.0812:0.0:0.9188	.|.	.|606	.|P57078-2	.|.	G|A	342|606;654;543;543	.|ENSP00000332454:T606A;ENSP00000330161:T654A;ENSP00000441754:T543A;ENSP00000442901:T543A	ENSP00000330975:D342G|ENSP00000332454:T606A	D|T	-|-	2|1	0|0	RIPK4|RIPK4	42034606|42034606	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.081000|0.081000	0.17604|0.17604	2.532000|2.532000	0.45659|0.45659	0.736000|0.736000	0.32559|0.32559	0.533000|0.533000	0.62120|0.62120	GAC|ACG		0.677	RIPK4-201	KNOWN	basic	protein_coding	protein_coding		NM_020639		41	125	0	0	0	0.011902	0	41	125				
EFCAB6	64800	broad.mit.edu	37	22	43936185	43936185	+	Missense_Mutation	SNP	T	T	G			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr22:43936185T>G	ENST00000262726.7	-	28	3954	c.3701A>C	c.(3700-3702)tAc>tCc	p.Y1234S	EFCAB6_ENST00000461800.1_5'UTR|EFCAB6_ENST00000396231.2_Missense_Mutation_p.Y1082S	NM_022785.3	NP_073622.2	Q5THR3	EFCB6_HUMAN	EF-hand calcium binding domain 6	1234	EF-hand 14. {ECO:0000255|PROSITE- ProRule:PRU00448}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.Y1234S(1)		breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(16)|lung(25)|ovary(4)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68		Ovarian(80;0.0247)|all_neural(38;0.025)				GAAGTCCGGGTATTTCAGCCT	0.572																																							uc003bdy.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	7						c.(3700-3702)TAC>TCC		CAP-binding protein complex interacting protein							97.0	78.0	84.0					22																	43936185		2203	4300	6503	SO:0001583	missense	64800				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	calcium ion binding	g.chr22:43936185T>G	Z82201	CCDS14049.1, CCDS14050.1	22q13.2	2013-01-10			ENSG00000186976	ENSG00000186976		"""EF-hand domain containing"""	24204	protein-coding gene	gene with protein product						11258795, 12612053	Standard	NM_022785		Approved	FLJ23588, DJBP, HSCBCIP1, KIAA1672, dJ185D5.1	uc003bdy.2	Q5THR3	OTTHUMG00000150522	ENST00000262726.7:c.3701A>C	22.37:g.43936185T>G	ENSP00000262726:p.Tyr1234Ser					EFCAB6_uc003bdz.1_Missense_Mutation_p.Y1082S|EFCAB6_uc010gzi.1_Missense_Mutation_p.Y1082S|EFCAB6_uc010gzj.1_3'UTR	p.Y1234S	NM_022785	NP_073622	Q5THR3	EFCB6_HUMAN			28	3916	-		Ovarian(80;0.0247)|all_neural(38;0.025)	1234			EF-hand 14.		A8K8P6|A8K8Y3|B0QYI4|B0QYI6|Q5U5T6|Q9BY88|Q9H5C4|Q9NSF5	Missense_Mutation	SNP	ENST00000262726.7	37	c.3701A>C	CCDS14049.1	.	.	.	.	.	.	.	.	.	.	T	13.93	2.384052	0.42308	.	.	ENSG00000186976	ENST00000396231;ENST00000262726	T;T	0.79141	-1.24;-1.24	5.49	2.25	0.28309	EF-hand calcium-binding domain-containing protein 6 (1);EF-hand-like domain (1);	0.592892	0.16557	N	0.209219	T	0.78521	0.4296	M	0.69823	2.125	0.80722	D	1	B	0.31459	0.324	B	0.41174	0.349	T	0.73541	-0.3950	10	0.59425	D	0.04	-12.8644	8.2061	0.31456	0.0:0.2251:0.0:0.7749	.	1234	Q5THR3	EFCB6_HUMAN	S	1082;1234	ENSP00000379533:Y1082S;ENSP00000262726:Y1234S	ENSP00000262726:Y1234S	Y	-	2	0	EFCAB6	42267518	1.000000	0.71417	0.665000	0.29768	0.198000	0.23893	0.785000	0.26830	0.135000	0.18707	-1.069000	0.02264	TAC		0.572	EFCAB6-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353176.1	NM_022785		23	50	0	0	0	0.003954	0	23	50				
GRAMD4	23151	broad.mit.edu	37	22	47058939	47058939	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr22:47058939C>T	ENST00000406902.1	+	6	682	c.469C>T	c.(469-471)Cgc>Tgc	p.R157C	GRAMD4_ENST00000361034.3_Missense_Mutation_p.R157C			Q6IC98	GRAM4_HUMAN	GRAM domain containing 4	157					apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)		p.R157C(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)	12		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|BRCA - Breast invasive adenocarcinoma(115;0.166)		CCCTGCAGAGCGCCGGAGCCA	0.677																																							uc003bhx.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(469-471)CGC>TGC		death-inducing-protein							30.0	34.0	33.0					22																	47058939		2202	4299	6501	SO:0001583	missense	23151				apoptosis	integral to membrane|mitochondrial membrane		g.chr22:47058939C>T		CCDS33672.1	22q13.31	2008-03-03			ENSG00000075240	ENSG00000075240			29113	protein-coding gene	gene with protein product	"""death-inducing-protein"""	613691				15565177	Standard	NM_015124		Approved	KIAA0767, DIP	uc003bhx.3	Q6IC98	OTTHUMG00000150402	ENST00000406902.1:c.469C>T	22.37:g.47058939C>T	ENSP00000385689:p.Arg157Cys					GRAMD4_uc010had.2_Missense_Mutation_p.R96C	p.R157C	NM_015124	NP_055939	Q6IC98	GRAM4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|BRCA - Breast invasive adenocarcinoma(115;0.166)	5	508	+		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)	157					A9IN51|A9IN57|Q68EN0|Q9UGE6|Q9Y4B9	Missense_Mutation	SNP	ENST00000406902.1	37	c.469C>T	CCDS33672.1	.	.	.	.	.	.	.	.	.	.	C	19.16	3.774348	0.69992	.	.	ENSG00000075240	ENST00000406902;ENST00000361034	T;T	0.44482	0.92;0.92	4.11	4.11	0.48088	.	0.164203	0.36409	N	0.002610	T	0.29190	0.0726	N	0.08118	0	0.48632	D	0.999688	D	0.69078	0.997	P	0.46339	0.513	T	0.32640	-0.9899	10	0.87932	D	0	-28.028	14.7074	0.69200	0.0:1.0:0.0:0.0	.	157	Q6IC98	GRAM4_HUMAN	C	157	ENSP00000385689:R157C;ENSP00000354313:R157C	ENSP00000354313:R157C	R	+	1	0	GRAMD4	45437603	0.310000	0.24527	0.896000	0.35187	0.908000	0.53690	1.407000	0.34657	2.602000	0.87976	0.558000	0.71614	CGC		0.677	GRAMD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317969.1	NM_015124		26	46	0	0	0	0.003271	0	26	46				
CHL1	10752	broad.mit.edu	37	3	424293	424293	+	Silent	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr3:424293G>T	ENST00000256509.2	+	18	2757	c.2115G>T	c.(2113-2115)gtG>gtT	p.V705V	CHL1-AS1_ENST00000417612.1_RNA|CHL1_ENST00000397491.2_Silent_p.V689V	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	0					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.V705V(1)		NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		TCATAGCCGTGAACGAAGTAG	0.473																																							uc003bou.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(5)|central_nervous_system(4)|large_intestine(2)|ovary(1)	12						c.(2065-2067)GTG>GTT		cell adhesion molecule with homology to L1CAM							80.0	84.0	83.0					3																	424293		2203	4300	6503	SO:0001819	synonymous_variant	10752				axon guidance|cell adhesion|signal transduction	integral to membrane|plasma membrane|proteinaceous extracellular matrix		g.chr3:424293G>T	AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.2115G>T	3.37:g.424293G>T						CHL1_uc003bot.2_Silent_p.V705V|CHL1_uc003bow.1_Silent_p.V689V|CHL1_uc011asi.1_Silent_p.V705V|uc003box.1_RNA	p.V689V	NM_006614	NP_006605	O00533	CHL1_HUMAN		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)	17	2338	+		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)	689			Fibronectin type-III 1.|Extracellular (Potential).		Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Silent	SNP	ENST00000256509.2	37	c.2067G>T	CCDS2556.1																																																																																				0.473	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207155.2	NM_006614		10	41	1	0	7.03913e-09	0.001368	8.26135e-09	10	41				
GRM7	2917	broad.mit.edu	37	3	7620718	7620718	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr3:7620718T>A	ENST00000357716.4	+	8	2399	c.2125T>A	c.(2125-2127)Tta>Ata	p.L709I	GRM7_ENST00000389336.4_Missense_Mutation_p.L709I|GRM7_ENST00000486284.1_Missense_Mutation_p.L709I|GRM7_ENST00000458641.2_3'UTR|GRM7_ENST00000402647.2_Missense_Mutation_p.L709I|GRM7_ENST00000403881.1_Missense_Mutation_p.L709I	NM_000844.3	NP_000835.1	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7	709					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|adult behavior (GO:0030534)|conditioned taste aversion (GO:0001661)|multicellular organismal response to stress (GO:0033555)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of glutamate secretion (GO:0014050)|regulation of cyclase activity (GO:0031279)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|short-term memory (GO:0007614)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)	adenylate cyclase inhibitor activity (GO:0010855)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|glutamate binding (GO:0016595)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|PDZ domain binding (GO:0030165)|serine binding (GO:0070905)|voltage-gated calcium channel activity (GO:0005245)	p.L709I(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(35)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	76						CACTTCCAGTTTAATATCAGT	0.418																																							uc003bqm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|lung(3)	7						c.(2125-2127)TTA>ATA		glutamate receptor, metabotropic 7 isoform a	L-Glutamic Acid(DB00142)						128.0	111.0	117.0					3																	7620718		2203	4300	6503	SO:0001583	missense	2917				negative regulation of adenylate cyclase activity|negative regulation of cAMP biosynthetic process|negative regulation of glutamate secretion|sensory perception of smell|sensory perception of sound|synaptic transmission	asymmetric synapse|axon|cell cortex|dendritic shaft|integral to plasma membrane|postsynaptic membrane|presynaptic active zone	adenylate cyclase inhibitor activity|calcium ion binding|glutamate binding|group III metabotropic glutamate receptor activity|PDZ domain binding|serine binding	g.chr3:7620718T>A	U92458	CCDS43042.1	3p26-p25	2014-06-12			ENSG00000196277	ENSG00000196277		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 87"""	604101				8288585, 8840028	Standard	NM_000844		Approved	GLUR7, GPRC1G, mGlu7, MGLUR7, PPP1R87	uc003bql.2	Q14831	OTTHUMG00000125549	ENST00000357716.4:c.2125T>A	3.37:g.7620718T>A	ENSP00000350348:p.Leu709Ile					GRM7_uc011ata.1_RNA|GRM7_uc011atb.1_RNA|GRM7_uc010hcf.2_RNA|GRM7_uc011atc.1_RNA|GRM7_uc010hcg.2_Missense_Mutation_p.L709I|GRM7_uc003bql.2_Missense_Mutation_p.L709I|GRM7_uc003bqn.1_Missense_Mutation_p.L292I|GRM7_uc010hch.1_Missense_Mutation_p.L220I	p.L709I	NM_000844	NP_000835	Q14831	GRM7_HUMAN			8	2399	+			709			Helical; Name=4; (Potential).		Q8NFS2|Q8NFS3|Q8NFS4	Missense_Mutation	SNP	ENST00000357716.4	37	c.2125T>A	CCDS43042.1	.	.	.	.	.	.	.	.	.	.	T	11.67	1.708734	0.30322	.	.	ENSG00000196277	ENST00000357716;ENST00000486284;ENST00000389336;ENST00000403881;ENST00000525747;ENST00000402647;ENST00000413492	D;D;D;D;D	0.90197	-2.63;-2.63;-2.63;-2.63;-2.63	6.17	3.75	0.43078	GPCR, family 3, C-terminal (2);	0.000000	0.64402	D	0.000001	D	0.92424	0.7595	L	0.49455	1.56	0.44417	D	0.997338	P;D;D;D;P	0.76494	0.754;0.996;0.999;0.979;0.923	P;D;D;D;P	0.80764	0.557;0.986;0.994;0.982;0.73	D	0.90623	0.4561	10	0.52906	T	0.07	.	9.1444	0.36923	0.0:0.1566:0.0:0.8434	.	709;709;464;709;709	B7ZKK0;Q14831-5;Q59G95;Q14831;Q14831-2	.;.;.;GRM7_HUMAN;.	I	709	ENSP00000350348:L709I;ENSP00000417536:L709I;ENSP00000373987:L709I;ENSP00000385664:L709I;ENSP00000384585:L709I	ENSP00000350348:L709I	L	+	1	2	GRM7	7595718	0.997000	0.39634	0.990000	0.47175	0.180000	0.23129	1.376000	0.34306	0.532000	0.28657	-0.408000	0.06270	TTA		0.418	GRM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246895.3	NM_000844		5	60	0	0	0	0.001984	0	5	60				
SSUH2	51066	broad.mit.edu	37	3	8667996	8667996	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr3:8667996C>A	ENST00000317371.4	-	16	1845	c.620G>T	c.(619-621)tGc>tTc	p.C207F	SSUH2_ENST00000544814.1_Missense_Mutation_p.C229F|SSUH2_ENST00000415132.1_Missense_Mutation_p.C207F|SSUH2_ENST00000341795.3_Missense_Mutation_p.C207F			Q9Y2M2	SSUH2_HUMAN	ssu-2 homolog (C. elegans)	207	Cys-rich.					cytoplasm (GO:0005737)		p.C207F(1)									TCTCCCTGAGCAAGTGCTGCA	0.572																																							uc003bqu.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(619-621)TGC>TTC		hypothetical protein LOC51066							191.0	154.0	167.0					3																	8667996		2203	4300	6503	SO:0001583	missense	51066							g.chr3:8667996C>A	AB024705	CCDS2568.1, CCDS58815.1	3p25.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000125046	ENSG00000125046			24809	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 32"""	C3orf32		20205943	Standard	NM_001256748		Approved	fls485, ssu-2	uc011atg.3	Q9Y2M2	OTTHUMG00000122075	ENST00000317371.4:c.620G>T	3.37:g.8667996C>A	ENSP00000324551:p.Cys207Phe					C3orf32_uc003bqz.2_Missense_Mutation_p.C207F|C3orf32_uc003bqt.2_Missense_Mutation_p.C156F|C3orf32_uc011atg.1_Missense_Mutation_p.C229F|C3orf32_uc003bqv.2_Missense_Mutation_p.C156F|C3orf32_uc003bqw.2_RNA|C3orf32_uc003bqx.2_RNA|C3orf32_uc003bqy.2_Missense_Mutation_p.C207F	p.C207F	NM_015931	NP_057015	Q9Y2M2	CC032_HUMAN			9	866	-			207			Cys-rich.		A6NFA9|B3KS84|B7Z6E3|F5H2S5|Q7Z7K4	Missense_Mutation	SNP	ENST00000317371.4	37	c.620G>T	CCDS2568.1	.	.	.	.	.	.	.	.	.	.	C	12.96	2.094696	0.36952	.	.	ENSG00000125046	ENST00000341795;ENST00000317371;ENST00000415132;ENST00000544814	D;D;D;D	0.88818	-2.34;-2.34;-2.43;-2.37	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	D	0.94205	0.8140	M	0.84683	2.71	0.53688	D	0.999979	D;D	0.76494	0.999;0.998	D;D	0.69479	0.964;0.947	D	0.94557	0.7759	10	0.56958	D	0.05	-20.1716	13.5949	0.61984	0.0:1.0:0.0:0.0	.	229;207	F5H2S5;Q9Y2M2	.;CC032_HUMAN	F	207;207;207;229	ENSP00000339150:C207F;ENSP00000324551:C207F;ENSP00000410757:C207F;ENSP00000439378:C229F	ENSP00000324551:C207F	C	-	2	0	C3orf32	8642996	1.000000	0.71417	0.997000	0.53966	0.029000	0.11900	4.377000	0.59562	2.270000	0.75569	0.591000	0.81541	TGC		0.572	SSUH2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337900.1	NM_015931		54	131	1	0	6.81593e-30	0.00361	1.06773e-29	54	131				
SLC6A1	6529	broad.mit.edu	37	3	11060301	11060301	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr3:11060301G>C	ENST00000287766.4	+	5	809	c.388G>C	c.(388-390)Gct>Cct	p.A130P	SLC6A1-AS1_ENST00000414969.2_RNA|SLC6A1_ENST00000536032.1_5'UTR	NM_003042.3	NP_003033.3	P30531	SC6A1_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 1	130					gamma-aminobutyric acid import (GO:0051939)|learning (GO:0007612)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neurotransmitter secretion (GO:0007269)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|protein homooligomerization (GO:0051260)|response to calcium ion (GO:0051592)|response to cocaine (GO:0042220)|response to estradiol (GO:0032355)|response to lead ion (GO:0010288)|response to purine-containing compound (GO:0014074)|response to sucrose (GO:0009744)|response to toxic substance (GO:0009636)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)	p.A130P(1)		breast(1)|endometrium(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	26		Ovarian(110;0.0392)		OV - Ovarian serous cystadenocarcinoma(96;0.00099)	Clobazam(DB00349)|Tiagabine(DB00906)	CCTTGCGGCTGCTGTGCTATC	0.502																																							uc010hdq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(388-390)GCT>CCT		solute carrier family 6 (neurotransmitter	Cocaine(DB00907)|Tiagabine(DB00906)						156.0	134.0	141.0					3																	11060301		2203	4300	6503	SO:0001583	missense	6529				neurotransmitter secretion	integral to plasma membrane	gamma-aminobutyric acid:sodium symporter activity|neurotransmitter:sodium symporter activity	g.chr3:11060301G>C		CCDS2603.1	3p25.3	2013-07-19	2013-07-19		ENSG00000157103	ENSG00000157103		"""Solute carriers"""	11042	protein-coding gene	gene with protein product	"""GABA transporter 1"""	137165	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 1"""			8530094	Standard	NM_003042		Approved	GAT1, GABATR, GABATHG	uc010hdq.3	P30531	OTTHUMG00000044208	ENST00000287766.4:c.388G>C	3.37:g.11060301G>C	ENSP00000287766:p.Ala130Pro						p.A130P	NM_003042	NP_003033	P30531	SC6A1_HUMAN		OV - Ovarian serous cystadenocarcinoma(96;0.00099)	5	799	+		Ovarian(110;0.0392)	130			Helical; Name=3; (Potential).		Q8N4K8	Missense_Mutation	SNP	ENST00000287766.4	37	c.388G>C	CCDS2603.1	.	.	.	.	.	.	.	.	.	.	G	34	5.385019	0.95967	.	.	ENSG00000157103	ENST00000287766	T	0.74737	-0.87	4.21	4.21	0.49690	.	0.000000	0.64402	D	0.000003	D	0.83866	0.5347	M	0.76170	2.325	0.80722	D	1	D	0.60575	0.988	P	0.60886	0.88	D	0.85421	0.1143	10	0.49607	T	0.09	.	17.1183	0.86695	0.0:0.0:1.0:0.0	.	130	P30531	SC6A1_HUMAN	P	130	ENSP00000287766:A130P	ENSP00000287766:A130P	A	+	1	0	SLC6A1	11035301	1.000000	0.71417	0.090000	0.20809	0.862000	0.49288	9.463000	0.97652	2.347000	0.79759	0.491000	0.48974	GCT		0.502	SLC6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102767.2	NM_003042		13	28	0	0	0	0.003954	0	13	28				
TRIM71	131405	broad.mit.edu	37	3	32860298	32860298	+	Silent	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr3:32860298G>T	ENST00000383763.5	+	1	789	c.726G>T	c.(724-726)ccG>ccT	p.P242P		NM_001039111.1	NP_001034200.1	Q2Q1W2	LIN41_HUMAN	tripartite motif containing 71, E3 ubiquitin protein ligase	242					fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|miRNA metabolic process (GO:0010586)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neural tube closure (GO:0001843)|neural tube development (GO:0021915)|positive regulation of gene silencing by miRNA (GO:2000637)|protein autoubiquitination (GO:0051865)|regulation of gene silencing by miRNA (GO:0060964)|regulation of neural precursor cell proliferation (GO:2000177)|stem cell proliferation (GO:0072089)	cytoplasmic mRNA processing body (GO:0000932)	ligase activity (GO:0016874)|miRNA binding (GO:0035198)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P242P(1)		breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						AGCGCGGCCCGCCGGGTCCCG	0.721																																							uc003cff.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|large_intestine(1)	3						c.(724-726)CCG>CCT		tripartite motif-containing 71							11.0	12.0	12.0					3																	32860298		1658	3720	5378	SO:0001819	synonymous_variant	131405				multicellular organismal development	cytoplasm	zinc ion binding	g.chr3:32860298G>T		CCDS43060.1	3p22.3	2014-02-17	2012-02-29		ENSG00000206557	ENSG00000206557		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	32669	protein-coding gene	gene with protein product			"""tripartite motif-containing 71"", ""tripartite motif containing 71"""				Standard	NM_001039111		Approved	LIN41, LIN-41	uc003cff.3	Q2Q1W2	OTTHUMG00000155778	ENST00000383763.5:c.726G>T	3.37:g.32860298G>T							p.P242P	NM_001039111	NP_001034200	Q2Q1W2	LIN41_HUMAN			1	789	+			242						Silent	SNP	ENST00000383763.5	37	c.726G>T	CCDS43060.1																																																																																				0.721	TRIM71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341565.3	NM_001039111		14	25	1	0	1.56452e-12	0.007413	1.96914e-12	14	25				
ACKR2	1238	broad.mit.edu	37	3	42906917	42906917	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr3:42906917C>T	ENST00000422265.1	+	3	1098	c.923C>T	c.(922-924)tCc>tTc	p.S308F	RP11-141M3.5_ENST00000471537.1_RNA|ACKR2_ENST00000273145.2_Missense_Mutation_p.S308F|CYP8B1_ENST00000437102.1_Intron|ACKR2_ENST00000442925.1_Missense_Mutation_p.S308F|KRBOX1_ENST00000426937.1_Intron	NM_001296.4	NP_001287.2	O00590	ACKR2_HUMAN	atypical chemokine receptor 2	308					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|multicellular organismal development (GO:0007275)|neutrophil activation (GO:0042119)|receptor-mediated endocytosis (GO:0006898)	actin filament (GO:0005884)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|C-X-C chemokine receptor activity (GO:0016494)|chemokine receptor activity (GO:0004950)|scavenger receptor activity (GO:0005044)	p.S308F(1)									TGCTGCTTTTCCCCCATCCTG	0.577																																							uc003cme.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(4)|skin(1)	5						c.(922-924)TCC>TTC		chemokine binding protein 2							207.0	158.0	175.0					3																	42906917		2203	4300	6503	SO:0001583	missense	1238				chemotaxis|immune response|multicellular organismal development	integral to plasma membrane	C-X-C chemokine receptor activity	g.chr3:42906917C>T	U94888	CCDS2706.1	3p21.3	2013-07-17	2013-07-16	2013-07-16	ENSG00000144648	ENSG00000144648		"""GPCR / Class A : Chemokine receptors : Atypical"""	1565	protein-coding gene	gene with protein product		602648	"""chemokine binding protein 2"""	CMKBR9, CCBP2		9364936, 9405404, 16148	Standard	NM_001296		Approved	CCR10, D6, CCR9	uc003cme.3	O00590	OTTHUMG00000133040	ENST00000422265.1:c.923C>T	3.37:g.42906917C>T	ENSP00000416996:p.Ser308Phe					CCBP2_uc003cmd.1_Intron|CCBP2_uc003cmf.2_Missense_Mutation_p.S308F|CCBP2_uc003cmg.2_Intron|CYP8B1_uc010hif.2_Intron	p.S308F	NM_001296	NP_001287	O00590	CCBP2_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.241)	3	1102	+			308			Helical; Name=7; (Potential).		B2R8Y8|O00537|Q53YA1|Q86UN9|Q96A02	Missense_Mutation	SNP	ENST00000422265.1	37	c.923C>T	CCDS2706.1	.	.	.	.	.	.	.	.	.	.	C	12.80	2.047540	0.36085	.	.	ENSG00000144648	ENST00000442925;ENST00000422265;ENST00000273145	T;T;T	0.72051	-0.62;-0.62;-0.62	4.96	4.96	0.65561	GPCR, rhodopsin-like superfamily (1);	0.301300	0.23241	N	0.050349	T	0.63896	0.2550	L	0.34521	1.04	0.80722	D	1	P	0.42941	0.794	P	0.45998	0.5	T	0.61422	-0.7066	9	.	.	.	.	10.9172	0.47144	0.2958:0.7042:0.0:0.0	.	308	O00590	CCBP2_HUMAN	F	308	ENSP00000396150:S308F;ENSP00000416996:S308F;ENSP00000273145:S308F	.	S	+	2	0	CCBP2	42881921	0.996000	0.38824	0.907000	0.35723	0.029000	0.11900	3.892000	0.56235	2.302000	0.77476	0.655000	0.94253	TCC		0.577	ACKR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256645.2	NM_001296		39	205	0	0	0	0.009718	0	39	205				
TGM4	7047	broad.mit.edu	37	3	44916184	44916184	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr3:44916184C>T	ENST00000296125.4	+	1	82	c.14C>T	c.(13-15)tCa>tTa	p.S5L	TGM4_ENST00000471637.1_3'UTR	NM_003241.3	NP_003232.2	P49221	TGM4_HUMAN	transglutaminase 4	5					mating plug formation (GO:0042628)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.S5L(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(9)|lung(21)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	38				BRCA - Breast invasive adenocarcinoma(193;0.00963)|KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0686)	L-Glutamine(DB00130)	ATGGATGCATCAAAAGGTGAG	0.567																																							uc003coc.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(13-15)TCA>TTA		transglutaminase 4 (prostate)	L-Glutamine(DB00130)						106.0	91.0	96.0					3																	44916184		2203	4300	6503	SO:0001583	missense	7047				peptide cross-linking|protein polyamination		acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity	g.chr3:44916184C>T	BC007003	CCDS2723.1	3p22-p21.33	2013-05-02	2013-05-02		ENSG00000163810	ENSG00000163810	2.3.2.13	"""Transglutaminases"""	11780	protein-coding gene	gene with protein product		600585	"""transglutaminase 4 (prostate)"""			7665178, 7916568	Standard	NM_003241		Approved	TGP	uc003coc.4	P49221	OTTHUMG00000133096	ENST00000296125.4:c.14C>T	3.37:g.44916184C>T	ENSP00000296125:p.Ser5Leu					TGM4_uc003coa.2_Missense_Mutation_p.S5L|TGM4_uc003cob.2_RNA	p.S5L	NM_003241	NP_003232	P49221	TGM4_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.00963)|KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0686)	1	87	+			5					Q16707|Q96QN4	Missense_Mutation	SNP	ENST00000296125.4	37	c.14C>T	CCDS2723.1	.	.	.	.	.	.	.	.	.	.	C	7.929	0.740338	0.15642	.	.	ENSG00000163810	ENST00000296125	D	0.85702	-2.02	1.56	-0.89	0.10577	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.66036	0.2749	N	0.14661	0.345	0.09310	N	1	B;B	0.31581	0.329;0.007	B;B	0.25987	0.065;0.008	T	0.53606	-0.8415	9	0.31617	T	0.26	.	3.2688	0.06874	0.0:0.3655:0.4146:0.2199	.	5;5	P49221;B4YUQ1	TGM4_HUMAN;.	L	5	ENSP00000296125:S5L	ENSP00000296125:S5L	S	+	2	0	TGM4	44891188	0.030000	0.19436	0.000000	0.03702	0.080000	0.17528	2.044000	0.41241	-0.264000	0.09365	-0.384000	0.06662	TCA		0.567	TGM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256755.2	NM_003241		14	53	0	0	0	0.001855	0	14	53				
PRSS50	29122	broad.mit.edu	37	3	46758935	46758935	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr3:46758935G>T	ENST00000460241.1	-	7	1969	c.299C>A	c.(298-300)cCa>cAa	p.P100Q	PRSS50_ENST00000315170.7_Missense_Mutation_p.P100Q			Q9UI38	TSP50_HUMAN	protease, serine, 50	100	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)	serine-type endopeptidase activity (GO:0004252)|threonine-type endopeptidase activity (GO:0004298)	p.P100Q(1)		endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	11						ACAGCGGTATGGGTCGACTTT	0.617																																					Pancreas(41;915 1239 11561 17469)	Pancreas(41;915 1239 11561 17469)	uc003cqe.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(298-300)CCA>CAA		testes-specific protease 50 precursor							176.0	155.0	162.0					3																	46758935		2203	4300	6503	SO:0001583	missense	29122				proteolysis	endoplasmic reticulum	serine-type endopeptidase activity|threonine-type endopeptidase activity	g.chr3:46758935G>T	AF100707	CCDS2745.1	3p21.31	2011-05-24			ENSG00000206549	ENSG00000206549		"""Serine peptidases / Serine peptidases"""	17910	protein-coding gene	gene with protein product	"""cancer/testis antigen 20"", ""testes specific protease 50"""	607950				10397268	Standard	NM_013270		Approved	TSP50, CT20	uc003cqe.1	Q9UI38	OTTHUMG00000164067	ENST00000460241.1:c.299C>A	3.37:g.46758935G>T	ENSP00000418875:p.Pro100Gln					PRSS50_uc003cqf.1_Missense_Mutation_p.P14Q	p.P100Q	NM_013270	NP_037402	Q9UI38	TSP50_HUMAN			2	358	-			100			Peptidase S1.			Missense_Mutation	SNP	ENST00000460241.1	37	c.299C>A	CCDS2745.1	.	.	.	.	.	.	.	.	.	.	G	8.507	0.865507	0.17250	.	.	ENSG00000206549	ENST00000455218;ENST00000315170;ENST00000460241	D;D	0.81499	-1.5;-1.5	3.5	-5.9	0.02275	Peptidase S1/S6, chymotrypsin/Hap (1);	.	.	.	.	T	0.62732	0.2452	L	0.43923	1.385	0.09310	N	1	B	0.30361	0.277	B	0.25291	0.059	T	0.50816	-0.8783	9	0.13853	T	0.58	.	4.2619	0.10745	0.2457:0.0:0.4334:0.3209	.	100	Q9UI38	TSP50_HUMAN	Q	14;100;100	ENSP00000326598:P100Q;ENSP00000418875:P100Q	ENSP00000326598:P100Q	P	-	2	0	PRSS50	46733939	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.556000	0.02168	-1.123000	0.02940	-1.355000	0.01225	CCA		0.617	PRSS50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354544.1			28	74	1	0	4.74835e-14	0.010818	6.14592e-14	28	74				
LAMB2	3913	broad.mit.edu	37	3	49165960	49165961	+	Missense_Mutation	DNP	GC	GC	CA			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	GC	GC	-	-	GC	GC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr3:49165960_49165961GC>CA	ENST00000418109.1	-	16	2112_2113	c.1948_1949GC>TG	c.(1948-1950)GCc>TGc	p.A650C	LAMB2_ENST00000464891.1_5'Flank|LAMB2_ENST00000305544.4_Missense_Mutation_p.A650C	NM_002292.3	NP_002283.3	P55268	LAMB2_HUMAN	laminin, beta 2 (laminin S)	650	Laminin IV type B. {ECO:0000255|PROSITE- ProRule:PRU00462}.				astrocyte development (GO:0014002)|axon extension involved in regeneration (GO:0048677)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|metanephric glomerular basement membrane development (GO:0072274)|metanephric glomerular visceral epithelial cell development (GO:0072249)|neuromuscular junction development (GO:0007528)|retina development in camera-type eye (GO:0060041)|Schwann cell development (GO:0014044)|visual perception (GO:0007601)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-11 complex (GO:0043260)|laminin-3 complex (GO:0005608)|synapse (GO:0045202)	structural molecule activity (GO:0005198)	p.A650C(1)		NS(1)|breast(1)|endometrium(15)|kidney(3)|large_intestine(6)|lung(21)|ovary(4)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CAGGCTGTGGGCAGGCACAGGC	0.589																																							uc003cwe.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(1948-1950)GCC>TGC		laminin, beta 2 precursor																																				SO:0001583	missense	3913				cell adhesion	laminin-11 complex|laminin-3 complex	structural molecule activity	g.chr3:49165960_49165961GC>CA		CCDS2789.1	3p21.3-p21.2	2013-03-01			ENSG00000172037	ENSG00000172037		"""Laminins"""	6487	protein-coding gene	gene with protein product	"""laminin S"""	150325		LAMS		2922051, 10393422	Standard	NM_002292		Approved		uc003cwe.3	P55268	OTTHUMG00000156807	ENST00000418109.1:c.1948_1949delinsCA	3.37:g.49165960_49165961delinsCA	ENSP00000388325:p.Ala650Cys					LAMB2_uc003cwf.1_Missense_Mutation_p.A650C	p.A650C	NM_002292	NP_002283	P55268	LAMB2_HUMAN		BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	15	2247_2248	-			650			Laminin IV type B.		Q16321	Missense_Mutation	DNP	ENST00000418109.1	37	c.1948_1949GC>TG	CCDS2789.1																																																																																				0.589	LAMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345939.1	NM_002292		10	55	0	0	0	0.004672	0	10	55				
SLC38A3	10991	broad.mit.edu	37	3	50256083	50256083	+	RNA	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr3:50256083G>T	ENST00000420502.1	+	0	1248									solute carrier family 38, member 3									p.L365L(1)		breast(1)|cervix(1)|endometrium(1)|lung(3)	6				BRCA - Breast invasive adenocarcinoma(193;0.000275)|KIRC - Kidney renal clear cell carcinoma(197;0.00548)|Kidney(197;0.00615)		TTGACGTCCTGATCCTGTGTG	0.637																																							uc003cyn.3		NA																	1	Substitution - coding silent(1)		lung(1)	breast(1)	1						c.(1093-1095)CTG>CTT		solute carrier family 38, member 3	L-Asparagine(DB00174)|L-Glutamine(DB00130)|L-Histidine(DB00117)						79.0	86.0	83.0					3																	50256083		2191	4282	6473			10991				cellular nitrogen compound metabolic process|sodium ion transport	integral to plasma membrane	antiporter activity|L-alanine transmembrane transporter activity|L-asparagine transmembrane transporter activity|L-glutamine transmembrane transporter activity|L-histidine transmembrane transporter activity|symporter activity	g.chr3:50256083G>T	U49082	CCDS74940.1	3p21.3	2013-05-22			ENSG00000188338	ENSG00000188338		"""Solute carriers"""	18044	protein-coding gene	gene with protein product		604437				10619430, 10823827	Standard	XM_006712954		Approved	G17, SN1	uc003cyn.4	Q99624	OTTHUMG00000156764		3.37:g.50256083G>T							p.L365L	NM_006841	NP_006832	Q99624	S38A3_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000275)|KIRC - Kidney renal clear cell carcinoma(197;0.00548)|Kidney(197;0.00615)	13	1236	+			365						Silent	SNP	ENST00000420502.1	37	c.1095G>T																																																																																					0.637	SLC38A3-001	KNOWN	sequence_error|basic	processed_transcript	processed_transcript	OTTHUMT00000345635.2	NM_006841		10	50	1	0	1.76689e-08	0.006214	2.05387e-08	10	50				
GRM2	2912	broad.mit.edu	37	3	51743114	51743114	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr3:51743114C>T	ENST00000395052.3	+	2	349	c.115C>T	c.(115-117)Cca>Tca	p.P39S	GRM2_ENST00000475478.1_Intron|GRM2_ENST00000442933.2_Missense_Mutation_p.P39S	NM_000839.3	NP_000830.2	Q14416	GRM2_HUMAN	glutamate receptor, metabotropic 2	39					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|glutamate secretion (GO:0014047)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)	p.P39S(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(1)|lung(11)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		TGGGCTGTTCCCAGTGCACCA	0.642																																							uc010hlv.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)	1						c.(115-117)CCA>TCA		glutamate receptor, metabotropic 2 isoform a	Acamprosate(DB00659)|Nicotine(DB00184)						59.0	61.0	60.0					3																	51743114		2202	4300	6502	SO:0001583	missense	2912				synaptic transmission	integral to plasma membrane		g.chr3:51743114C>T	L35318	CCDS2834.1	3p21.2	2013-09-20			ENSG00000164082	ENSG00000164082		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4594	protein-coding gene	gene with protein product		604099				7620613	Standard	NM_000839		Approved	GPRC1B, mGlu2, MGLUR2	uc010hlv.3	Q14416	OTTHUMG00000156902	ENST00000395052.3:c.115C>T	3.37:g.51743114C>T	ENSP00000378492:p.Pro39Ser					GRM2_uc003dbo.3_Intron|GRM2_uc010hlu.2_RNA	p.P39S	NM_000839	NP_000830	Q14416	GRM2_HUMAN		BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	2	354	+			39			Extracellular (Potential).		B0M0K7|Q14CU5|Q52MC6|Q9H3N6	Missense_Mutation	SNP	ENST00000395052.3	37	c.115C>T	CCDS2834.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.205930	0.79127	.	.	ENSG00000164082	ENST00000395052;ENST00000419928;ENST00000442933	D;D;D	0.82803	-1.65;-1.65;-1.65	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	D	0.88779	0.6529	L	0.49778	1.585	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87745	0.2588	10	0.39692	T	0.17	.	18.2567	0.90022	0.0:1.0:0.0:0.0	.	39	Q14416	GRM2_HUMAN	S	39	ENSP00000378492:P39S;ENSP00000404797:P39S;ENSP00000408906:P39S	ENSP00000296479:P39S	P	+	1	0	GRM2	51718154	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.070000	0.71220	2.498000	0.84270	0.561000	0.74099	CCA		0.642	GRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346542.1			24	59	0	0	0	0.00278	0	24	59				
GUCA1C	9626	broad.mit.edu	37	3	108634993	108634993	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr3:108634993C>G	ENST00000261047.3	-	3	555	c.423G>C	c.(421-423)aaG>aaC	p.K141N	GUCA1C_ENST00000393963.3_Missense_Mutation_p.K141N|GUCA1C_ENST00000471108.1_Missense_Mutation_p.K141N	NM_005459.3	NP_005450.3	O95843	GUC1C_HUMAN	guanylate cyclase activator 1C	141	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.				phototransduction, visible light (GO:0007603)|positive regulation of guanylate cyclase activity (GO:0031284)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)	calcium ion binding (GO:0005509)|calcium sensitive guanylate cyclase activator activity (GO:0008048)	p.K141N(1)		endometrium(2)|large_intestine(1)|liver(1)|lung(8)|pancreas(1)|skin(1)	14						TTATATCGATCTTATGGAACA	0.413																																					NSCLC(157;1360 1999 30631 40189 44208)	NSCLC(157;1360 1999 30631 40189 44208)	uc003dxj.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(421-423)AAG>AAC		guanylate cyclase activator 1C							167.0	162.0	164.0					3																	108634993		2203	4300	6503	SO:0001583	missense	9626				signal transduction|visual perception		calcium ion binding|calcium sensitive guanylate cyclase activator activity	g.chr3:108634993C>G	AF110002	CCDS2954.1	3q13.1	2013-01-10			ENSG00000138472	ENSG00000138472		"""EF-hand domain containing"""	4680	protein-coding gene	gene with protein product	"""guanylyl cyclase-activating protein 3"""	605128				10037746, 11860507	Standard	NM_005459		Approved	GCAP3	uc003dxj.2	O95843	OTTHUMG00000159204	ENST00000261047.3:c.423G>C	3.37:g.108634993C>G	ENSP00000261047:p.Lys141Asn					GUCA1C_uc003dxk.2_Missense_Mutation_p.K141N	p.K141N	NM_005459	NP_005450	O95843	GUC1C_HUMAN			3	491	-			141			EF-hand 4.		O95844|Q9UNM0	Missense_Mutation	SNP	ENST00000261047.3	37	c.423G>C	CCDS2954.1	.	.	.	.	.	.	.	.	.	.	c	16.19	3.051976	0.55218	.	.	ENSG00000138472	ENST00000393963;ENST00000261047;ENST00000471108	T;T;T	0.71222	-0.55;-0.55;-0.55	4.32	3.41	0.39046	EF-hand-like domain (1);	0.330265	0.34531	N	0.003897	T	0.80899	0.4712	M	0.71871	2.18	0.46241	D	0.998949	D;D	0.89917	1.0;1.0	D;P	0.75020	0.985;0.79	T	0.81084	-0.1093	10	0.59425	D	0.04	.	11.1082	0.48216	0.1938:0.8062:0.0:0.0	.	141;141	C9JNI2;O95843	.;GUC1C_HUMAN	N	141	ENSP00000377535:K141N;ENSP00000261047:K141N;ENSP00000417761:K141N	ENSP00000261047:K141N	K	-	3	2	GUCA1C	110117683	1.000000	0.71417	0.015000	0.15790	0.738000	0.42128	3.415000	0.52700	0.869000	0.35703	0.651000	0.88453	AAG		0.413	GUCA1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353819.1	NM_005459		24	93	0	0	0	0.00632	0	24	93				
DNAJC13	23317	broad.mit.edu	37	3	132218040	132218040	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr3:132218040C>A	ENST00000260818.6	+	37	4475	c.4227C>A	c.(4225-4227)gaC>gaA	p.D1409E		NM_015268.3	NP_056083.3	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	1409					osteoblast differentiation (GO:0001649)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|urinary_tract(1)	34						CTTCAGATGACCTCCTTTTCT	0.408																																							uc003eor.2		NA																	0				ovary(1)|breast(1)	2						c.(4225-4227)GAC>GAA		DnaJ (Hsp40) homolog, subfamily C, member 13							99.0	95.0	96.0					3																	132218040		2203	4300	6503	SO:0001583	missense	23317						heat shock protein binding	g.chr3:132218040C>A	AB014578	CCDS33857.1	3q22.1	2011-09-02			ENSG00000138246	ENSG00000138246		"""Heat shock proteins / DNAJ (HSP40)"""	30343	protein-coding gene	gene with protein product		614334				12438707	Standard	NM_015268		Approved	RME8, KIAA0678	uc003eor.3	O75165	OTTHUMG00000159674	ENST00000260818.6:c.4227C>A	3.37:g.132218040C>A	ENSP00000260818:p.Asp1409Glu						p.D1409E	NM_015268	NP_056083	O75165	DJC13_HUMAN			37	4292	+			1409					Q3L0T1|Q6PI82|Q6UJ77|Q6ZSW1|Q6ZUT5|Q86XG3|Q96DC1|Q9BWK9	Missense_Mutation	SNP	ENST00000260818.6	37	c.4227C>A	CCDS33857.1	.	.	.	.	.	.	.	.	.	.	C	10.41	1.342033	0.24339	.	.	ENSG00000138246	ENST00000260818;ENST00000538066	T	0.44083	0.93	5.32	4.45	0.53987	Armadillo-type fold (1);	0.132562	0.53938	D	0.000050	T	0.25269	0.0614	N	0.17922	0.545	0.44946	D	0.997965	B	0.06786	0.001	B	0.04013	0.001	T	0.06607	-1.0817	10	0.19147	T	0.46	.	9.4187	0.38536	0.1419:0.7854:0.0:0.0727	.	1409	O75165	DJC13_HUMAN	E	1409;56	ENSP00000260818:D1409E	ENSP00000260818:D1409E	D	+	3	2	DNAJC13	133700730	0.996000	0.38824	1.000000	0.80357	0.988000	0.76386	0.317000	0.19487	1.390000	0.46547	-0.263000	0.10527	GAC		0.408	DNAJC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356807.2	NM_015268		23	71	1	0	9.57634e-11	0.00333	1.16902e-10	23	71				
MME	4311	broad.mit.edu	37	3	154884701	154884701	+	Silent	SNP	C	C	A	rs199570214		TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr3:154884701C>A	ENST00000460393.1	+	18	1791	c.1671C>A	c.(1669-1671)gcC>gcA	p.A557A	MME_ENST00000493237.1_Silent_p.A557A|MME-AS1_ENST00000484721.1_RNA|MME_ENST00000360490.2_Silent_p.A557A|MME_ENST00000462745.1_Silent_p.A557A|MME_ENST00000492661.1_Silent_p.A557A	NM_000902.3|NM_007287.2	NP_000893.2|NP_009218.2	P08473	NEP_HUMAN	membrane metallo-endopeptidase	557					angiotensin maturation (GO:0002003)|beta-amyloid metabolic process (GO:0050435)|cellular protein metabolic process (GO:0044267)|cellular response to cytokine stimulus (GO:0071345)|cellular response to UV-A (GO:0071492)|cellular response to UV-B (GO:0071493)|creatinine metabolic process (GO:0046449)|kidney development (GO:0001822)|peptide metabolic process (GO:0006518)|proteolysis (GO:0006508)|replicative senescence (GO:0090399)|sensory perception of pain (GO:0019233)	axon (GO:0030424)|brush border (GO:0005903)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|zinc ion binding (GO:0008270)	p.A557A(1)		central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(31)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)|Liraglutide(DB06655)	TCTTCCCAGCCGGCATTCTGC	0.463																																							uc010hvr.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(1669-1671)GCC>GCA		membrane metallo-endopeptidase	Candoxatril(DB00616)						141.0	140.0	140.0					3																	154884701		2203	4300	6503	SO:0001819	synonymous_variant	4311				cell-cell signaling|proteolysis	integral to plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding	g.chr3:154884701C>A		CCDS3172.1	3q25.2	2012-01-31	2007-02-21		ENSG00000196549	ENSG00000196549	3.4.24.11	"""CD molecules"""	7154	protein-coding gene	gene with protein product	"""neutral endopeptidase"", ""enkephalinase"", ""neprilysin"""	120520					Standard	NM_007287		Approved	CALLA, CD10, NEP	uc003fad.1	P08473	OTTHUMG00000158455	ENST00000460393.1:c.1671C>A	3.37:g.154884701C>A						MME_uc003fab.1_Silent_p.A557A|MME_uc003fac.1_Silent_p.A557A|MME_uc003fad.1_Silent_p.A557A|MME_uc003fae.1_Silent_p.A557A	p.A557A	NM_007289	NP_009220	P08473	NEP_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		18	1882	+		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	557			Extracellular (Potential).		A8K6U6|D3DNJ9|Q3MIX4	Silent	SNP	ENST00000460393.1	37	c.1671C>A	CCDS3172.1																																																																																				0.463	MME-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351076.1	NM_000902		38	122	1	0	1.69901e-12	0.005524	2.13106e-12	38	122				
IGF2BP2	10644	broad.mit.edu	37	3	185363402	185363402	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr3:185363402G>A	ENST00000382199.2	-	16	1812	c.1717C>T	c.(1717-1719)Cgc>Tgc	p.R573C	IGF2BP2_ENST00000421047.2_Missense_Mutation_p.R516C|IGF2BP2_ENST00000346192.3_Missense_Mutation_p.R530C|IGF2BP2_ENST00000457616.2_Missense_Mutation_p.R579C	NM_006548.4	NP_006539.3	Q9Y6M1	IF2B2_HUMAN	insulin-like growth factor 2 mRNA binding protein 2	573	KH 4. {ECO:0000255|PROSITE- ProRule:PRU00117}.				anatomical structure morphogenesis (GO:0009653)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|translation regulator activity (GO:0045182)	p.R573C(1)		breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(3)	20	all_cancers(143;5.84e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)			CTGATCTTGCGCTGTGCAGTC	0.577																																							uc003fpo.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1717-1719)CGC>TGC		insulin-like growth factor 2 mRNA binding							77.0	62.0	67.0					3																	185363402		2203	4300	6503	SO:0001583	missense	10644				anatomical structure morphogenesis|negative regulation of translation	cytoskeletal part|cytosol|nucleus	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity	g.chr3:185363402G>A	BC021290	CCDS3273.2, CCDS33903.1	3q27.2	2013-02-12			ENSG00000073792	ENSG00000073792		"""RNA binding motif (RRM) containing"""	28867	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 2"""	608289				10190901, 9891060	Standard	NM_001007225		Approved	IMP-2	uc003fpo.3	Q9Y6M1	OTTHUMG00000074025	ENST00000382199.2:c.1717C>T	3.37:g.185363402G>A	ENSP00000371634:p.Arg573Cys					IGF2BP2_uc010hyi.2_Missense_Mutation_p.R516C|IGF2BP2_uc010hyj.2_Missense_Mutation_p.R510C|IGF2BP2_uc010hyk.2_Missense_Mutation_p.R437C|IGF2BP2_uc010hyl.2_Missense_Mutation_p.R467C|IGF2BP2_uc003fpp.2_Missense_Mutation_p.R530C|IGF2BP2_uc003fpq.2_Missense_Mutation_p.R578C	p.R573C	NM_006548	NP_006539	Q9Y6M1	IF2B2_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)		16	1796	-	all_cancers(143;5.84e-11)|Ovarian(172;0.0386)		573			KH 4.		A0A4Z0|B3FTN2|B3FTN3|B3FTN4	Missense_Mutation	SNP	ENST00000382199.2	37	c.1717C>T	CCDS3273.2	.	.	.	.	.	.	.	.	.	.	G	10.82	1.457296	0.26161	.	.	ENSG00000073792	ENST00000382199;ENST00000421047;ENST00000457616;ENST00000346192	T;T;T;T	0.32753	1.44;1.44;1.44;1.44	4.9	4.0	0.46444	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.122583	0.53938	D	0.000060	T	0.56804	0.2010	M	0.83118	2.625	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.996;0.996;0.996;0.996;0.998;0.999	T	0.62530	-0.6835	10	0.72032	D	0.01	-7.3344	12.0307	0.53396	0.0:0.0:0.8268:0.1732	.	467;510;516;579;530;573	Q9Y6M1-5;Q9Y6M1-3;Q9Y6M1-4;F8W930;Q9Y6M1-1;Q9Y6M1	.;.;.;.;.;IF2B2_HUMAN	C	573;516;579;530	ENSP00000371634:R573C;ENSP00000413787:R516C;ENSP00000410242:R579C;ENSP00000320204:R530C	ENSP00000320204:R530C	R	-	1	0	IGF2BP2	186846096	1.000000	0.71417	0.999000	0.59377	0.122000	0.20287	5.802000	0.69122	1.152000	0.42452	0.638000	0.83543	CGC		0.577	IGF2BP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000157087.2	NM_006548		11	106	0	0	0	0.001855	0	11	106				
MUC4	4585	broad.mit.edu	37	3	195511959	195511959	+	Silent	SNP	G	G	A	rs369770584		TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr3:195511959G>A	ENST00000463781.3	-	2	6951	c.6492C>T	c.(6490-6492)acC>acT	p.T2164T	MUC4_ENST00000475231.1_Silent_p.T2164T|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGAAGTGTCGGTGACAGGAA	0.577																																							uc011bto.1		NA																	0					0						c.(6490-6492)ACC>ACT		mucin 4 isoform a							15.0	15.0	15.0					3																	195511959		676	1556	2232	SO:0001819	synonymous_variant	4585				cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity	g.chr3:195511959G>A	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6492C>T	3.37:g.195511959G>A						MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	p.T2164T	NM_018406	NP_060876	Q99102	MUC4_HUMAN	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)	2	6952	-	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	45					O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	c.6492C>T	CCDS54700.1																																																																																				0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406		2	2	0	0	0	0.004672	0	2	2				
ZNF718	255403	broad.mit.edu	37	4	155375	155375	+	lincRNA	SNP	A	A	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr4:155375A>T	ENST00000510175.1	+	0	810							Q3SXZ3	ZN718_HUMAN	zinc finger protein 718						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)						all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0681)|Epithelial(2;0.0838)|all cancers(2;0.135)|LUSC - Lung squamous cell carcinoma(95;0.18)		CCCTTAATGAACATAAGAGAA	0.368																																							uc003fzt.3		NA																	0					0						c.(898-900)GAA>GAT		zinc finger protein 718							34.0	38.0	36.0					4																	155375		2100	4256	6356			255403				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr4:155375A>T	AK096662	CCDS75078.1, CCDS75079.1	4p16.3	2011-05-24			ENSG00000250312	ENSG00000250312		"""Zinc fingers, C2H2-type"""	26889	protein-coding gene	gene with protein product							Standard	XM_005278364		Approved	FLJ90036	uc003fzt.4	Q3SXZ3	OTTHUMG00000159873		4.37:g.155375A>T						ZNF595_uc003fzu.1_Intron|ZNF718_uc010iaz.2_RNA|ZNF718_uc003fzw.3_Missense_Mutation_p.N80I	p.E300D	NM_001039127	NP_001034216	Q3SXZ3	ZN718_HUMAN		Lung(54;0.0681)|Epithelial(2;0.0838)|all cancers(2;0.135)|LUSC - Lung squamous cell carcinoma(95;0.18)	8	1033	+		all_cancers(4;0.0738)|all_epithelial(65;0.139)	300			C2H2-type 5.		Q3SXZ4|Q3SXZ5	Missense_Mutation	SNP	ENST00000510175.1	37	c.900A>T																																																																																					0.368	ZNF718-002	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000357865.3	NM_001039127		6	25	0	0	0	0.001168	0	6	25				
KIAA1211	57482	broad.mit.edu	37	4	57179457	57179457	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr4:57179457C>T	ENST00000504228.1	+	5	554	c.449C>T	c.(448-450)gCt>gTt	p.A150V	KIAA1211_ENST00000541073.1_Missense_Mutation_p.A143V|KIAA1211_ENST00000264229.6_Missense_Mutation_p.A150V			Q6ZU35	K1211_HUMAN	KIAA1211	150								p.A150V(1)		endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					CTGGCCATCGCTCGCCTGGAC	0.552																																							uc003hbk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(448-450)GCT>GTT		hypothetical protein LOC57482							131.0	139.0	137.0					4																	57179457		2052	4174	6226	SO:0001583	missense	57482							g.chr4:57179457C>T	AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.449C>T	4.37:g.57179457C>T	ENSP00000423366:p.Ala150Val					KIAA1211_uc010iha.2_Missense_Mutation_p.A143V|KIAA1211_uc011bzz.1_Missense_Mutation_p.A60V|KIAA1211_uc003hbm.1_Missense_Mutation_p.A36V	p.A150V	NM_020722	NP_065773	Q6ZU35	K1211_HUMAN			7	840	+	Glioma(25;0.08)|all_neural(26;0.101)		150					Q9NTE2|Q9NTP8|Q9ULK9	Missense_Mutation	SNP	ENST00000504228.1	37	c.449C>T	CCDS43230.1	.	.	.	.	.	.	.	.	.	.	C	18.68	3.675776	0.67928	.	.	ENSG00000109265	ENST00000264229;ENST00000504228;ENST00000541073;ENST00000546221	T;T;T	0.15017	2.46;2.46;2.49	5.4	5.4	0.78164	.	.	.	.	.	T	0.36276	0.0961	M	0.69823	2.125	0.39846	D	0.973178	D;D;D	0.67145	0.996;0.977;0.977	P;P;P	0.59948	0.866;0.691;0.621	T	0.08046	-1.0741	9	0.40728	T	0.16	-15.0899	14.061	0.64800	0.1507:0.8492:0.0:0.0	.	143;143;150	B7ZVZ4;F5H1N7;Q6ZU35	.;.;K1211_HUMAN	V	150;150;143;60	ENSP00000264229:A150V;ENSP00000423366:A150V;ENSP00000444006:A143V	ENSP00000264229:A150V	A	+	2	0	KIAA1211	56874214	1.000000	0.71417	0.990000	0.47175	0.957000	0.61999	4.539000	0.60657	2.547000	0.85894	0.491000	0.48974	GCT		0.552	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362097.2	NM_020722		63	158	0	0	0	0.00361	0	63	158				
AMTN	401138	broad.mit.edu	37	4	71390668	71390668	+	Missense_Mutation	SNP	T	T	G			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr4:71390668T>G	ENST00000339336.4	+	5	414	c.284T>G	c.(283-285)cTg>cGg	p.L95R	AMTN_ENST00000504451.1_Missense_Mutation_p.L94R	NM_212557.2	NP_997722.1	Q6UX39	AMTN_HUMAN	amelotin	95					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|odontogenesis of dentin-containing tooth (GO:0042475)	basal lamina (GO:0005605)|cell-cell junction (GO:0005911)|proteinaceous extracellular matrix (GO:0005578)		p.L95R(1)		NS(3)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|prostate(3)|skin(1)	19			Lung(101;0.235)			CAACAGCAACTGCACCCACAT	0.448																																							uc003hfk.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|central_nervous_system(1)	2						c.(283-285)CTG>CGG		amelotin precursor							84.0	79.0	81.0					4																	71390668		2203	4300	6503	SO:0001583	missense	401138				biomineral tissue development|cell adhesion|odontogenesis of dentine-containing tooth	basal lamina|cell-cell junction		g.chr4:71390668T>G	AY358528	CCDS3542.1, CCDS68716.1	4q13.3	2006-12-12			ENSG00000187689	ENSG00000187689			33188	protein-coding gene	gene with protein product		610912				16304441	Standard	NM_001286731		Approved	UNQ689, RSTI689	uc003hfk.1	Q6UX39	OTTHUMG00000129906	ENST00000339336.4:c.284T>G	4.37:g.71390668T>G	ENSP00000341013:p.Leu95Arg					AMTN_uc010ihy.1_Missense_Mutation_p.L94R	p.L95R	NM_212557	NP_997722	Q6UX39	AMTN_HUMAN	Lung(101;0.235)		5	373	+			95					Q0P503|Q0P506	Missense_Mutation	SNP	ENST00000339336.4	37	c.284T>G	CCDS3542.1	.	.	.	.	.	.	.	.	.	.	T	14.96	2.691288	0.48097	.	.	ENSG00000187689	ENST00000339336;ENST00000504451	T;T	0.46451	0.87;0.87	5.19	5.19	0.71726	.	0.160475	0.29876	N	0.010965	T	0.50582	0.1624	L	0.29908	0.895	0.33494	D	0.589094	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.992	T	0.63928	-0.6526	10	0.87932	D	0	-4.5383	11.3582	0.49627	0.0:0.0:0.0:1.0	.	94;95	Q6UX39-2;Q6UX39	.;AMTN_HUMAN	R	95;94	ENSP00000341013:L95R;ENSP00000422452:L94R	ENSP00000341013:L95R	L	+	2	0	AMTN	71425257	0.994000	0.37717	1.000000	0.80357	0.138000	0.21146	1.986000	0.40677	2.183000	0.69458	0.533000	0.62120	CTG		0.448	AMTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252157.1	NM_212557		18	30	0	0	0	0.008871	0	18	30				
MTHFD2L	441024	broad.mit.edu	37	4	75065547	75065547	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr4:75065547C>T	ENST00000395759.2	+	4	515	c.488C>T	c.(487-489)gCc>gTc	p.A163V	MTHFD2L_ENST00000325278.6_Missense_Mutation_p.A105V|MTHFD2L_ENST00000433372.1_Missense_Mutation_p.A28V|MTHFD2L_ENST00000331145.6_Missense_Mutation_p.A105V	NM_001144978.1	NP_001138450.1	Q9H903	MTD2L_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like	163					folic acid-containing compound biosynthetic process (GO:0009396)|histidine biosynthetic process (GO:0000105)|methionine biosynthetic process (GO:0009086)|one-carbon metabolic process (GO:0006730)|purine nucleotide biosynthetic process (GO:0006164)|tetrahydrofolate interconversion (GO:0035999)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NAD+) activity (GO:0004487)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)	p.A105V(1)		central_nervous_system(1)|endometrium(1)|lung(4)|ovary(2)	8			all cancers(17;0.0101)|Lung(101;0.196)			AATGGAATTGCCCCAGAAAAA	0.343																																							uc003hhn.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(313-315)GCC>GTC		methylenetetrahydrofolate dehydrogenase 2-like							83.0	87.0	85.0					4																	75065547		2203	4300	6503	SO:0001583	missense	441024				folic acid-containing compound biosynthetic process|histidine biosynthetic process|methionine biosynthetic process|one-carbon metabolic process|purine nucleotide biosynthetic process		binding|methenyltetrahydrofolate cyclohydrolase activity|methylenetetrahydrofolate dehydrogenase (NAD+) activity	g.chr4:75065547C>T	BC065771	CCDS47075.1	4q13.3	2011-08-03			ENSG00000163738	ENSG00000163738			31865	protein-coding gene	gene with protein product		614047				21163947	Standard	NM_001144978		Approved	MGC72244	uc011cbk.2	Q9H903	OTTHUMG00000157135	ENST00000395759.2:c.488C>T	4.37:g.75065547C>T	ENSP00000379108:p.Ala163Val					MTHFD2L_uc011cbj.1_Missense_Mutation_p.A105V|MTHFD2L_uc011cbk.1_Missense_Mutation_p.A163V	p.A105V	NM_001144978	NP_001138450	Q9H903	MTD2L_HUMAN	all cancers(17;0.0101)|Lung(101;0.196)		7	832	+			105					Q6P079|Q8N560	Missense_Mutation	SNP	ENST00000395759.2	37	c.314C>T	CCDS47075.1	.	.	.	.	.	.	.	.	.	.	C	13.04	2.117446	0.37339	.	.	ENSG00000163738	ENST00000433372;ENST00000395759;ENST00000331145;ENST00000359107;ENST00000325278	T;T;T;T;T	0.32753	1.46;1.84;1.44;1.47;1.85	5.2	4.36	0.52297	Tetrahydrofolate dehydrogenase/cyclohydrolase, NAD(P)-binding domain (1);NAD(P)-binding domain (1);	0.172948	0.50627	D	0.000115	T	0.25457	0.0619	L	0.48260	1.515	0.30875	N	0.732094	B;B	0.20368	0.044;0.001	B;B	0.21360	0.034;0.005	T	0.18147	-1.0346	10	0.48119	T	0.1	.	7.2619	0.26207	0.0:0.7396:0.172:0.0884	.	163;105	Q9H903;Q9H903-3	MTD2L_HUMAN;.	V	28;163;105;105;105	ENSP00000405692:A28V;ENSP00000379108:A163V;ENSP00000330982:A105V;ENSP00000352012:A105V;ENSP00000321984:A105V	ENSP00000321984:A105V	A	+	2	0	MTHFD2L	75284411	0.981000	0.34729	0.981000	0.43875	0.920000	0.55202	3.517000	0.53443	1.412000	0.46977	0.655000	0.94253	GCC		0.343	MTHFD2L-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001004346		4	81	0	0	0	0.001984	0	4	81				
ANXA3	306	broad.mit.edu	37	4	79522696	79522696	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr4:79522696G>A	ENST00000264908.6	+	11	1142	c.763G>A	c.(763-765)Gcc>Acc	p.A255T	ANXA3_ENST00000512884.1_Missense_Mutation_p.A216T|ANXA3_ENST00000503570.2_Missense_Mutation_p.A216T	NM_005139.2	NP_005130.1	P12429	ANXA3_HUMAN	annexin A3	255					defense response to bacterium (GO:0042742)|neutrophil degranulation (GO:0043312)|phagocytosis (GO:0006909)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|specific granule (GO:0042581)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|phospholipase A2 inhibitor activity (GO:0019834)	p.A255T(1)		NS(1)|breast(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15						GGCCTTTTTAGCCGAAAGACT	0.393																																					GBM(2;126 157 27790 28920 42492)	GBM(2;126 157 27790 28920 42492)	uc003hld.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(763-765)GCC>ACC		annexin A3							129.0	121.0	123.0					4																	79522696		2203	4300	6503	SO:0001583	missense	306				defense response to bacterium|neutrophil degranulation|phagocytosis|positive regulation of angiogenesis|positive regulation of endothelial cell migration|positive regulation of sequence-specific DNA binding transcription factor activity	phagocytic vesicle membrane|plasma membrane|specific granule	calcium ion binding|calcium-dependent phospholipid binding|phospholipase A2 inhibitor activity	g.chr4:79522696G>A	M63310	CCDS3584.1	4q21.21	2009-07-10			ENSG00000138772	ENSG00000138772	3.1.4.43	"""Annexins"""	541	protein-coding gene	gene with protein product		106490		ANX3		1830024	Standard	XM_005262973		Approved		uc003hld.3	P12429	OTTHUMG00000130198	ENST00000264908.6:c.763G>A	4.37:g.79522696G>A	ENSP00000264908:p.Ala255Thr					ANXA3_uc003hle.2_Missense_Mutation_p.A216T|ANXA3_uc010ijk.2_Missense_Mutation_p.A216T	p.A255T	NM_005139	NP_005130	P12429	ANXA3_HUMAN			11	1073	+			255					B2R9W6|Q6LET2	Missense_Mutation	SNP	ENST00000264908.6	37	c.763G>A	CCDS3584.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.460090	0.84317	.	.	ENSG00000138772	ENST00000264908;ENST00000512884;ENST00000503570	T;T;T	0.32988	1.43;1.43;1.43	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.65417	0.2689	M	0.92317	3.295	0.80722	D	1	D	0.89917	1.0	D	0.71870	0.975	T	0.74497	-0.3646	10	0.87932	D	0	.	17.7034	0.88302	0.0:0.0:1.0:0.0	.	255	P12429	ANXA3_HUMAN	T	255;216;216	ENSP00000264908:A255T;ENSP00000423068:A216T;ENSP00000421015:A216T	ENSP00000264908:A255T	A	+	1	0	ANXA3	79741720	1.000000	0.71417	0.993000	0.49108	0.397000	0.30659	7.992000	0.88273	2.708000	0.92522	0.585000	0.79938	GCC		0.393	ANXA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252516.3	NM_005139		40	67	0	0	0	0.00361	0	40	67				
GK2	2712	broad.mit.edu	37	4	80328679	80328679	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr4:80328679G>A	ENST00000358842.3	-	1	693	c.676C>T	c.(676-678)Cca>Tca	p.P226S		NM_033214.2	NP_149991.2	Q01415	GALK2_HUMAN	glycerol kinase 2	413					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|galactokinase activity (GO:0004335)|N-acetylgalactosamine kinase activity (GO:0033858)	p.P226S(1)		autonomic_ganglia(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	39						AGGTCCATTGGAATTTCAAAA	0.408																																							uc003hlu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)	4						c.(676-678)CCA>TCA		glycerol kinase 2							66.0	69.0	68.0					4																	80328679		2203	4300	6503	SO:0001583	missense	2712				glycerol-3-phosphate metabolic process	mitochondrial outer membrane	ATP binding|glycerol kinase activity	g.chr4:80328679G>A	BC029820	CCDS3585.1	4q13	2008-02-05	2002-10-03	2002-10-04	ENSG00000196475	ENSG00000196475		"""Glycerol kinases"""	4291	protein-coding gene	gene with protein product		600148	"""glycerol kinase pseudogene 2"""	GKP2		7987308	Standard	NM_033214		Approved	GKTA	uc003hlu.3	Q14410	OTTHUMG00000130199	ENST00000358842.3:c.676C>T	4.37:g.80328679G>A	ENSP00000351706:p.Pro226Ser						p.P226S	NM_033214	NP_149991	Q14410	GLPK2_HUMAN			1	694	-			226					Q7Z4Q4	Missense_Mutation	SNP	ENST00000358842.3	37	c.676C>T	CCDS3585.1	.	.	.	.	.	.	.	.	.	.	G	10.40	1.338714	0.24253	.	.	ENSG00000196475	ENST00000358842	T	0.60920	0.15	3.92	3.92	0.45320	Carbohydrate kinase, FGGY, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.76154	0.3948	M	0.85777	2.775	0.51767	D	0.999936	D	0.89917	1.0	D	0.97110	1.0	T	0.79729	-0.1681	10	0.87932	D	0	-6.4082	11.7305	0.51735	0.0:0.0:1.0:0.0	.	226	Q14410	GLPK2_HUMAN	S	226	ENSP00000351706:P226S	ENSP00000351706:P226S	P	-	1	0	GK2	80547703	1.000000	0.71417	0.927000	0.36925	0.192000	0.23643	3.042000	0.49815	2.496000	0.84212	0.585000	0.79938	CCA		0.408	GK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252517.2	NM_033214		5	133	0	0	0	0.001168	0	5	133				
SEC24D	9871	broad.mit.edu	37	4	119745843	119745843	+	Silent	SNP	A	A	G			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr4:119745843A>G	ENST00000280551.6	-	3	418	c.180T>C	c.(178-180)ggT>ggC	p.G60G	SEC24D_ENST00000379735.5_Silent_p.G60G|SEC24D_ENST00000419654.2_5'UTR			O94855	SC24D_HUMAN	SEC24 family member D	60	Pro-rich.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)	p.G60G(1)		breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(13)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37						GAGGTGGGGGACCCGGAGGCA	0.542																																							uc003ici.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(178-180)GGT>GGC		Sec24-related protein D							103.0	113.0	110.0					4																	119745843		2203	4300	6503	SO:0001819	synonymous_variant	9871				COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	zinc ion binding	g.chr4:119745843A>G	AB018298	CCDS3710.1	4q26	2013-10-21	2013-10-21		ENSG00000150961	ENSG00000150961			10706	protein-coding gene	gene with protein product		607186	"""SEC24 (S. cerevisiae) related gene family, member D"", ""SEC24 family, member D (S. cerevisiae)"""			9872452, 10075675	Standard	NM_014822		Approved	KIAA0755	uc003ici.4	O94855	OTTHUMG00000132957	ENST00000280551.6:c.180T>C	4.37:g.119745843A>G						SEC24D_uc003icj.3_Silent_p.G60G|SEC24D_uc003icl.2_RNA|SEC24D_uc010imz.1_RNA|SEC24D_uc011cgg.1_RNA	p.G60G	NM_014822	NP_055637	O94855	SC24D_HUMAN			3	452	-			60			Pro-rich.		Q8IYI7	Silent	SNP	ENST00000280551.6	37	c.180T>C	CCDS3710.1																																																																																				0.542	SEC24D-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256514.4			55	162	0	0	0	0.00361	0	55	162				
TRPC3	7222	broad.mit.edu	37	4	122853479	122853479	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr4:122853479G>T	ENST00000379645.3	-	2	1007	c.934C>A	c.(934-936)Cta>Ata	p.L312I	TRPC3_ENST00000513531.1_Missense_Mutation_p.L239I|TRPC3_ENST00000264811.5_Missense_Mutation_p.L239I	NM_001130698.1	NP_001124170.1	Q13507	TRPC3_HUMAN	transient receptor potential cation channel, subfamily C, member 3	227					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|phototransduction (GO:0007602)|platelet activation (GO:0030168)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cardiac muscle hypertrophy in response to stress (GO:1903244)|response to ATP (GO:0033198)|response to calcium ion (GO:0051592)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.L239I(1)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(12)|lung(13)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						CTGAGCTCTAGGGCCGTAAGC	0.592																																							uc003ieg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(934-936)CTA>ATA		transient receptor potential cation channel,							48.0	40.0	42.0					4																	122853479		2203	4300	6503	SO:0001583	missense	7222				axon guidance|phototransduction|platelet activation	integral to plasma membrane	protein binding|store-operated calcium channel activity	g.chr4:122853479G>T	Y13758	CCDS3725.1, CCDS47130.1	4q27	2011-12-14			ENSG00000138741	ENSG00000138741		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12335	protein-coding gene	gene with protein product		602345				8646775, 16382100	Standard	NM_003305		Approved		uc003ieg.2	Q13507	OTTHUMG00000133069	ENST00000379645.3:c.934C>A	4.37:g.122853479G>T	ENSP00000368966:p.Leu312Ile					TRPC3_uc010inr.2_Missense_Mutation_p.L239I|TRPC3_uc003ief.2_Missense_Mutation_p.L239I|TRPC3_uc011cgl.1_5'UTR	p.L312I	NM_001130698	NP_001124170	Q13507	TRPC3_HUMAN			2	1008	-			227			Cytoplasmic (Potential).		A7VJS1|E9PCJ9|O00593|Q15660|Q52M35|Q5G1L5	Missense_Mutation	SNP	ENST00000379645.3	37	c.934C>A	CCDS47130.1	.	.	.	.	.	.	.	.	.	.	G	17.19	3.326310	0.60743	.	.	ENSG00000138741	ENST00000264811;ENST00000379645;ENST00000513531	T;T;T	0.78924	-1.22;-1.22;-1.22	5.24	4.4	0.53042	.	0.000000	0.64402	D	0.000010	D	0.86226	0.5882	M	0.65975	2.015	0.45118	D	0.998133	D;D	0.89917	0.987;1.0	D;D	0.91635	0.96;0.999	D	0.87507	0.2437	10	0.87932	D	0	-4.562	13.9722	0.64247	0.0733:0.0:0.9267:0.0	.	239;312	E9PCJ9;Q5G1L5	.;.	I	239;312;239	ENSP00000264811:L239I;ENSP00000368966:L312I;ENSP00000426899:L239I	ENSP00000264811:L239I	L	-	1	2	TRPC3	123072929	0.987000	0.35691	0.989000	0.46669	0.591000	0.36615	1.857000	0.39399	1.202000	0.43218	0.591000	0.81541	CTA		0.592	TRPC3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364252.1	NM_003305		7	30	1	0	2.17888e-05	0.006214	2.35991e-05	7	30				
PLK4	10733	broad.mit.edu	37	4	128814717	128814717	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr4:128814717G>A	ENST00000270861.5	+	12	2646	c.2372G>A	c.(2371-2373)aGg>aAg	p.R791K	RNU6-583P_ENST00000516012.1_RNA|PLK4_ENST00000514379.1_Missense_Mutation_p.R750K|PLK4_ENST00000515069.1_Missense_Mutation_p.R713K|PLK4_ENST00000513090.1_Missense_Mutation_p.R759K|PLK4_ENST00000507249.1_Missense_Mutation_p.R730K	NM_014264.4	NP_055079.3	O00444	PLK4_HUMAN	polo-like kinase 4	791					centriole replication (GO:0007099)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of centriole replication (GO:0046601)|protein phosphorylation (GO:0006468)|trophoblast giant cell differentiation (GO:0060707)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.R791K(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	31						GAAGAGGAAAGGAAAACTAGG	0.328																																					Colon(135;508 1718 19061 31832 42879)	Colon(135;508 1718 19061 31832 42879)	uc003ifo.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2371-2373)AGG>AAG		polo-like kinase 4							79.0	82.0	81.0					4																	128814717		2203	4300	6503	SO:0001583	missense	10733				G2/M transition of mitotic cell cycle|positive regulation of centriole replication|trophoblast giant cell differentiation	centriole|cleavage furrow|cytosol|nucleolus	ATP binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr4:128814717G>A	Y13115	CCDS3735.1, CCDS54803.1, CCDS54804.1	4q27-q28	2013-01-18	2010-06-24	2004-01-28	ENSG00000142731	ENSG00000142731			11397	protein-coding gene	gene with protein product		605031	"""serine/threonine kinase 18"", ""polo-like kinase 4 (Drosophila)"""	STK18			Standard	NM_014264		Approved	Sak	uc003ifo.3	O00444	OTTHUMG00000133301	ENST00000270861.5:c.2372G>A	4.37:g.128814717G>A	ENSP00000270861:p.Arg791Lys					PLK4_uc011cgs.1_Missense_Mutation_p.R759K|PLK4_uc011cgt.1_Missense_Mutation_p.R750K	p.R791K	NM_014264	NP_055079	O00444	PLK4_HUMAN			12	2617	+			791					B2RAL0|B7Z837|B7Z8G7|Q8IYF0|Q96Q95|Q9UD84|Q9UDE2	Missense_Mutation	SNP	ENST00000270861.5	37	c.2372G>A	CCDS3735.1	.	.	.	.	.	.	.	.	.	.	G	3.265	-0.150264	0.06585	.	.	ENSG00000142731	ENST00000270861;ENST00000515069;ENST00000513090;ENST00000507249;ENST00000514379;ENST00000508113	T;T;T;T;T;T	0.39787	1.6;1.6;1.6;1.6;1.6;1.06	5.08	-3.01	0.05463	.	0.445267	0.27266	N	0.020141	T	0.07369	0.0186	N	0.00289	-1.7	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.41805	-0.9488	10	0.02654	T	1	-0.8421	7.7976	0.29156	0.4828:0.1213:0.3959:0.0	.	759;791	O00444-2;O00444	.;PLK4_HUMAN	K	791;713;759;730;750;37	ENSP00000270861:R791K;ENSP00000421774:R713K;ENSP00000427554:R759K;ENSP00000423412:R730K;ENSP00000423582:R750K;ENSP00000427568:R37K	ENSP00000270861:R791K	R	+	2	0	PLK4	129034167	0.999000	0.42202	0.116000	0.21606	0.950000	0.60333	2.073000	0.41519	-0.349000	0.08274	0.655000	0.94253	AGG		0.328	PLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257095.3			15	42	0	0	0	0.004007	0	15	42				
DCHS2	54798	broad.mit.edu	37	4	155278377	155278377	+	Missense_Mutation	SNP	T	T	G			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr4:155278377T>G	ENST00000357232.4	-	6	793	c.794A>C	c.(793-795)cAc>cCc	p.H265P	DCHS2_ENST00000339452.1_Intron	NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	265	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.H265P(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		ctacttgaagtgccttagcag	0.403																																							uc003inw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|pancreas(1)	4						c.(793-795)CAC>CCC		dachsous 2 isoform 1							152.0	162.0	159.0					4																	155278377		2203	4300	6503	SO:0001583	missense	54798				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:155278377T>G	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.794A>C	4.37:g.155278377T>G	ENSP00000349768:p.His265Pro					DCHS2_uc003inx.2_Intron	p.H265P	NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN		LUSC - Lung squamous cell carcinoma(193;0.107)	6	794	-	all_hematologic(180;0.208)	Renal(120;0.0854)	265			Cadherin 2.		B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000357232.4	37	c.794A>C	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	T	0.772	-0.765254	0.02996	.	.	ENSG00000197410	ENST00000357232	T	0.55234	0.53	0.392	0.392	0.16288	Cadherin (1);	.	.	.	.	T	0.33265	0.0857	N	0.22421	0.69	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.18871	-1.0323	8	0.30078	T	0.28	.	.	.	.	.	265	Q6V1P9	PCD23_HUMAN	P	265	ENSP00000349768:H265P	ENSP00000349768:H265P	H	-	2	0	DCHS2	155497827	0.069000	0.21087	0.139000	0.22197	0.131000	0.20780	0.471000	0.22100	0.363000	0.24346	0.352000	0.21897	CAC		0.403	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552		52	140	0	0	0	0.00361	0	52	140				
FSTL5	56884	broad.mit.edu	37	4	162376242	162376242	+	Silent	SNP	C	C	A	rs544088580	byFrequency	TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr4:162376242C>A	ENST00000306100.5	-	15	2191	c.1755G>T	c.(1753-1755)acG>acT	p.T585T	FSTL5_ENST00000536695.1_Silent_p.T584T|FSTL5_ENST00000379164.4_Silent_p.T584T|FSTL5_ENST00000427802.2_Silent_p.T575T	NM_001128427.2|NM_020116.4	NP_001121899.1|NP_064501.2	Q8N475	FSTL5_HUMAN	follistatin-like 5	585						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.T585T(1)		central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(18)|lung(43)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	91	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		GGGTGTGGATCGTGTGGTGAG	0.433																																							uc003iqh.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|skin(1)	8						c.(1753-1755)ACG>ACT		follistatin-like 5 isoform a							149.0	112.0	124.0					4																	162376242		2203	4300	6503	SO:0001819	synonymous_variant	56884					extracellular region	calcium ion binding	g.chr4:162376242C>A	BC036502	CCDS3802.1, CCDS47157.1, CCDS47158.1	4q32.3	2013-01-11			ENSG00000168843	ENSG00000168843		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	21386	protein-coding gene	gene with protein product						10574462, 15527507	Standard	NM_020116		Approved	DKFZp566D234, KIAA1263	uc003iqh.4	Q8N475	OTTHUMG00000161397	ENST00000306100.5:c.1755G>T	4.37:g.162376242C>A						FSTL5_uc003iqi.2_Silent_p.T584T|FSTL5_uc010iqv.2_Silent_p.T575T	p.T585T	NM_020116	NP_064501	Q8N475	FSTL5_HUMAN		COAD - Colon adenocarcinoma(41;0.179)	15	2191	-	all_hematologic(180;0.24)		585					E9PCP6|Q9NSW7|Q9ULF7	Silent	SNP	ENST00000306100.5	37	c.1755G>T	CCDS3802.1																																																																																				0.433	FSTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364773.2	NM_020116		4	19	1	0	2.0095e-06	0.001984	2.20924e-06	4	19				
FBXL7	23194	broad.mit.edu	37	5	15936997	15936997	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr5:15936997G>T	ENST00000504595.1	+	4	1659	c.1178G>T	c.(1177-1179)gGt>gTt	p.G393V	MIR887_ENST00000401258.1_RNA|FBXL7_ENST00000329673.7_Missense_Mutation_p.G381V|FBXL7_ENST00000510662.1_Missense_Mutation_p.G346V	NM_001278317.1|NM_012304.3	NP_001265246.1|NP_036436.1	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7	393					cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)	p.G393V(1)		cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(13)|lung(33)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	60						ACGGACCACGGTGTGGAGTAC	0.622																																							uc003jfn.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(1)	3						c.(1177-1179)GGT>GTT		F-box and leucine-rich repeat protein 7							88.0	96.0	93.0					5																	15936997		2175	4258	6433	SO:0001583	missense	23194				ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity	g.chr5:15936997G>T	AB020647	CCDS54833.1, CCDS64129.1	5p15.1	2011-06-09				ENSG00000183580		"""F-boxes / Leucine-rich repeats"""	13604	protein-coding gene	gene with protein product		605656				10048485, 10531035	Standard	NM_012304		Approved	KIAA0840, FBL7, FBL6	uc003jfn.1	Q9UJT9		ENST00000504595.1:c.1178G>T	5.37:g.15936997G>T	ENSP00000423630:p.Gly393Val						p.G393V	NM_012304	NP_036436	Q9UJT9	FBXL7_HUMAN			4	1659	+			393			LRR 9.		B9EGF1|D6RDY7|O94926	Missense_Mutation	SNP	ENST00000504595.1	37	c.1178G>T	CCDS54833.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.397297	0.83120	.	.	ENSG00000183580	ENST00000504595;ENST00000510662;ENST00000329673	T;T;T	0.27890	1.64;4.31;1.64	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.65688	0.2715	M	0.91140	3.18	0.80722	D	1	D	0.76494	0.999	D	0.72625	0.978	T	0.74194	-0.3744	10	0.72032	D	0.01	.	19.109	0.93309	0.0:0.0:1.0:0.0	.	393	Q9UJT9	FBXL7_HUMAN	V	393;346;381	ENSP00000423630:G393V;ENSP00000425184:G346V;ENSP00000329632:G381V	ENSP00000329632:G381V	G	+	2	0	FBXL7	15989997	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	9.624000	0.98398	2.525000	0.85131	0.655000	0.94253	GGT		0.622	FBXL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366117.1	NM_012304		6	19	1	0	0.00116845	0.001168	0.00122906	6	19				
BASP1	10409	broad.mit.edu	37	5	17275921	17275921	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr5:17275921C>T	ENST00000322611.3	+	2	856	c.596C>T	c.(595-597)gCc>gTc	p.A199V		NM_001271606.1|NM_006317.3	NP_001258535.1|NP_006308.3	P80723	BASP1_HUMAN	brain abundant, membrane attached signal protein 1	199					diaphragm development (GO:0060539)|glomerular visceral epithelial cell differentiation (GO:0072112)|gonad development (GO:0008406)|mesenchymal to epithelial transition (GO:0060231)|metanephric mesenchyme development (GO:0072075)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of heart growth (GO:0060421)|positive regulation of metanephric ureteric bud development (GO:2001076)|substantia nigra development (GO:0021762)|thorax and anterior abdomen determination (GO:0007356)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)	p.A199V(1)		endometrium(1)|lung(8)	9						ACACCCAAGGCCCAGGGCCCC	0.652																																							uc003jfx.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(595-597)GCC>GTC		brain abundant, membrane attached signal protein							14.0	19.0	17.0					5																	17275921		2192	4290	6482	SO:0001583	missense	10409				glomerular visceral epithelial cell differentiation|negative regulation of transcription, DNA-dependent	cytoplasm|cytoskeleton|growth cone|nuclear speck|plasma membrane	protein domain specific binding|transcription corepressor activity|transcription regulatory region DNA binding	g.chr5:17275921C>T	AF039656	CCDS3888.1	5p15.1	2010-12-03			ENSG00000176788	ENSG00000176788			957	protein-coding gene	gene with protein product		605940				9310187, 9749536	Standard	NM_001271606		Approved	NAP-22, NAP22, CAP23, CAP-23	uc031siz.1	P80723	OTTHUMG00000131061	ENST00000322611.3:c.596C>T	5.37:g.17275921C>T	ENSP00000319281:p.Ala199Val						p.A199V	NM_006317	NP_006308	P80723	BASP1_HUMAN			2	775	+			199					B4DJA8|D3DTD5|O43596|Q5U0S0|Q9BWA5	Missense_Mutation	SNP	ENST00000322611.3	37	c.596C>T	CCDS3888.1	.	.	.	.	.	.	.	.	.	.	C	14.92	2.679912	0.47886	.	.	ENSG00000176788	ENST00000322611;ENST00000447228	T	0.58506	0.33	4.69	4.69	0.59074	.	0.000000	0.50627	U	0.000108	T	0.63426	0.2510	L	0.48642	1.525	0.47511	D	0.999443	P	0.47253	0.892	P	0.51974	0.686	T	0.67364	-0.5689	10	0.62326	D	0.03	-5.6581	16.1994	0.82060	0.0:1.0:0.0:0.0	.	199	P80723	BASP1_HUMAN	V	199;145	ENSP00000319281:A199V	ENSP00000319281:A199V	A	+	2	0	BASP1	17328921	1.000000	0.71417	0.999000	0.59377	0.894000	0.52154	2.026000	0.41069	2.157000	0.67596	0.491000	0.48974	GCC		0.652	BASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253716.2			8	39	0	0	0	0.004482	0	8	39				
CDH6	1004	broad.mit.edu	37	5	31323229	31323229	+	Silent	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr5:31323229C>A	ENST00000265071.2	+	12	2452	c.2187C>A	c.(2185-2187)gcC>gcA	p.A729A		NM_004932.3	NP_004923.1	P55285	CADH6_HUMAN	cadherin 6, type 2, K-cadherin (fetal kidney)	729					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A729A(1)		NS(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(42)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						ACCCCACTGCCCCGCCATACG	0.557																																							uc003jhe.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|skin(2)|large_intestine(1)	7						c.(2185-2187)GCC>GCA		cadherin 6, type 2 preproprotein							43.0	44.0	44.0					5																	31323229		2203	4300	6503	SO:0001819	synonymous_variant	1004				adherens junction organization|cell junction assembly|homophilic cell adhesion	cytoplasm|integral to membrane|nucleus|plasma membrane	calcium ion binding	g.chr5:31323229C>A	D31784	CCDS3894.1	5p13.3	2010-01-26			ENSG00000113361	ENSG00000113361		"""Cadherins / Major cadherins"""	1765	protein-coding gene	gene with protein product	"""K-Cadherin"""	603007				7743525, 10191097	Standard	NM_004932		Approved		uc003jhe.2	P55285	OTTHUMG00000090673	ENST00000265071.2:c.2187C>A	5.37:g.31323229C>A							p.A729A	NM_004932	NP_004923	P55285	CADH6_HUMAN			12	2513	+			729			Cytoplasmic (Potential).		A8K5H5|Q9BWS0	Silent	SNP	ENST00000265071.2	37	c.2187C>A	CCDS3894.1																																																																																				0.557	CDH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207355.2	NM_004932		12	35	1	0	1.15088e-07	0.004007	1.30863e-07	12	35				
SPEF2	79925	broad.mit.edu	37	5	35700681	35700681	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr5:35700681C>T	ENST00000356031.3	+	16	2379	c.2225C>T	c.(2224-2226)aCa>aTa	p.T742I	CTD-2113L7.1_ENST00000510433.1_RNA|SPEF2_ENST00000440995.2_Missense_Mutation_p.T737I|SPEF2_ENST00000509059.1_Missense_Mutation_p.T737I	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	742					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)		p.T742I(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GAAGCTCTTACAGGCTGCAAT	0.403																																							uc003jjo.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)|central_nervous_system(1)	4						c.(2224-2226)ACA>ATA		KPL2 protein isoform 1							89.0	80.0	83.0					5																	35700681		1818	4077	5895	SO:0001583	missense	79925				nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|protein dimerization activity	g.chr5:35700681C>T	AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.2225C>T	5.37:g.35700681C>T	ENSP00000348314:p.Thr742Ile					SPEF2_uc003jjq.3_Missense_Mutation_p.T737I|SPEF2_uc003jjp.1_Missense_Mutation_p.T228I	p.T742I	NM_024867	NP_079143	Q9C093	SPEF2_HUMAN	Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)		16	2336	+	all_lung(31;7.56e-05)		742			Potential.		Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Missense_Mutation	SNP	ENST00000356031.3	37	c.2225C>T	CCDS43309.1	.	.	.	.	.	.	.	.	.	.	C	13.58	2.278890	0.40294	.	.	ENSG00000152582	ENST00000356031;ENST00000509059;ENST00000440995;ENST00000504054	T;T;T;T	0.76709	-1.04;-1.04;-1.04;-1.04	5.79	5.79	0.91817	.	0.210998	0.42548	D	0.000693	T	0.76212	0.3956	L	0.46819	1.47	0.80722	D	1	B;P;P	0.50528	0.235;0.936;0.817	B;P;B	0.46320	0.146;0.512;0.426	T	0.78971	-0.1993	10	0.72032	D	0.01	.	14.3402	0.66619	0.0:0.8521:0.1479:0.0	.	737;737;742	D6REZ4;Q9C093-2;Q9C093	.;.;SPEF2_HUMAN	I	742;737;737;248	ENSP00000348314:T742I;ENSP00000421593:T737I;ENSP00000412125:T737I;ENSP00000421744:T248I	ENSP00000348314:T742I	T	+	2	0	SPEF2	35736438	0.402000	0.25311	0.975000	0.42487	0.124000	0.20399	1.061000	0.30542	2.736000	0.93811	0.655000	0.94253	ACA		0.403	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367199.1	NM_144722		25	72	0	0	0	0.005443	0	25	72				
UGT3A1	133688	broad.mit.edu	37	5	35968187	35968187	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr5:35968187G>C	ENST00000274278.3	-	3	602	c.245C>G	c.(244-246)cCt>cGt	p.P82R	UGT3A1_ENST00000503189.1_Missense_Mutation_p.P82R|UGT3A1_ENST00000513233.1_Intron|UGT3A1_ENST00000333811.4_Missense_Mutation_p.P28R|UGT3A1_ENST00000507113.1_Missense_Mutation_p.P48R	NM_152404.3	NP_689617.3	Q6NUS8	UD3A1_HUMAN	UDP glycosyltransferase 3 family, polypeptide A1	82						integral component of membrane (GO:0016021)|UDP-N-acetylglucosamine transferase complex (GO:0043541)	glucuronosyltransferase activity (GO:0015020)|UDP-glycosyltransferase activity (GO:0008194)	p.P82R(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|skin(4)	46	all_lung(31;0.000197)		Epithelial(62;0.107)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			ATGATCTTCAGGTGAAAACCA	0.318																																							uc003jjv.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(244-246)CCT>CGT		UDP glycosyltransferase 3 family, polypeptide A1							97.0	96.0	96.0					5																	35968187		2203	4299	6502	SO:0001583	missense	133688					integral to membrane	glucuronosyltransferase activity	g.chr5:35968187G>C		CCDS3913.1, CCDS54841.1	5p13.2	2014-05-20			ENSG00000145626	ENSG00000145626		"""UDP glucuronosyltransferases"""	26625	protein-coding gene	gene with protein product							Standard	NM_152404		Approved	FLJ34658	uc003jjv.2	Q6NUS8	OTTHUMG00000131107	ENST00000274278.3:c.245C>G	5.37:g.35968187G>C	ENSP00000274278:p.Pro82Arg					UGT3A1_uc003jjw.1_RNA|UGT3A1_uc011coq.1_Missense_Mutation_p.P82R|UGT3A1_uc011cor.1_Missense_Mutation_p.P48R|UGT3A1_uc003jjy.1_Missense_Mutation_p.P28R	p.P82R	NM_152404	NP_689617	Q6NUS8	UD3A1_HUMAN	Epithelial(62;0.107)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)		3	402	-	all_lung(31;0.000197)		82			Extracellular (Potential).		G5E961|Q8IYS9|Q8NAW4|Q96DM6	Missense_Mutation	SNP	ENST00000274278.3	37	c.245C>G	CCDS3913.1	.	.	.	.	.	.	.	.	.	.	G	9.981	1.228171	0.22542	.	.	ENSG00000145626	ENST00000274278;ENST00000503189;ENST00000507113;ENST00000333811	T;T;T;T	0.63744	0.33;0.33;-0.06;-0.06	2.7	1.63	0.23807	.	1.152040	0.06930	U	0.810987	T	0.61324	0.2338	N	0.17723	0.515	0.09310	N	1	D;B;P;B	0.65815	0.995;0.24;0.749;0.24	D;B;B;B	0.68192	0.956;0.309;0.228;0.403	T	0.55211	-0.8176	10	0.23302	T	0.38	.	6.572	0.22543	0.0:0.3045:0.6955:0.0	.	48;82;28;82	E9PD17;B7Z8Q8;G5E961;Q6NUS8	.;.;.;UD3A1_HUMAN	R	82;82;48;28	ENSP00000274278:P82R;ENSP00000427079:P82R;ENSP00000426100:P48R;ENSP00000328033:P28R	ENSP00000274278:P82R	P	-	2	0	UGT3A1	36003944	0.525000	0.26290	0.035000	0.18076	0.024000	0.10985	1.206000	0.32321	1.432000	0.47375	0.455000	0.32223	CCT		0.318	UGT3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253770.2	NM_152404		8	33	0	0	0	0.004482	0	8	33				
NNT	23530	broad.mit.edu	37	5	43656049	43656049	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr5:43656049A>G	ENST00000264663.5	+	15	2388	c.2167A>G	c.(2167-2169)Att>Gtt	p.I723V	NNT_ENST00000344920.4_Missense_Mutation_p.I723V|NNT_ENST00000512996.2_Missense_Mutation_p.I592V	NM_012343.3	NP_036475.3	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase	723					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidation-reduction process (GO:0055114)|proton transport (GO:0015992)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)	NAD binding (GO:0051287)|NAD(P)+ transhydrogenase (AB-specific) activity (GO:0008750)|NAD(P)+ transhydrogenase (B-specific) activity (GO:0003957)|NAD(P)+ transhydrogenase activity (GO:0008746)|NADP binding (GO:0050661)	p.I723V(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(7)|large_intestine(6)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(6;2.58e-06)					AGCTGAGTACATTATAGAATA	0.438																																							uc003joe.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(2167-2169)ATT>GTT		nicotinamide nucleotide transhydrogenase	NADH(DB00157)						127.0	115.0	119.0					5																	43656049		2203	4300	6503	SO:0001583	missense	23530				tricarboxylic acid cycle	integral to membrane|mitochondrial respiratory chain	NAD binding|NAD(P)+ transhydrogenase (AB-specific) activity|NAD(P)+ transhydrogenase (B-specific) activity|NADP binding	g.chr5:43656049A>G	U40490	CCDS3949.1	5p12	2008-02-05			ENSG00000112992	ENSG00000112992	1.6.1.1		7863	protein-coding gene	gene with protein product		607878				9271681, 9524818	Standard	NM_182977		Approved		uc003jof.3	Q13423	OTTHUMG00000096961	ENST00000264663.5:c.2167A>G	5.37:g.43656049A>G	ENSP00000264663:p.Ile723Val					NNT_uc003jof.2_Missense_Mutation_p.I723V	p.I723V	NM_012343	NP_036475	Q13423	NNTM_HUMAN			15	2422	+	Lung NSC(6;2.58e-06)		723			Cytoplasmic.		Q16796|Q2TB60|Q8N3V4	Missense_Mutation	SNP	ENST00000264663.5	37	c.2167A>G	CCDS3949.1	.	.	.	.	.	.	.	.	.	.	A	15.62	2.886965	0.52014	.	.	ENSG00000112992	ENST00000542759;ENST00000264663;ENST00000344920;ENST00000512996	D;D;D	0.91521	-2.86;-2.86;-2.86	5.91	4.76	0.60689	.	0.072434	0.85682	N	0.000000	D	0.84406	0.5465	N	0.25992	0.78	0.47009	D	0.999283	B	0.13594	0.008	B	0.23852	0.049	T	0.77978	-0.2384	10	0.33141	T	0.24	-16.1797	11.8725	0.52529	0.9321:0.0:0.0679:0.0	.	723	Q13423	NNTM_HUMAN	V	238;723;723;592	ENSP00000264663:I723V;ENSP00000343873:I723V;ENSP00000426343:I592V	ENSP00000264663:I723V	I	+	1	0	NNT	43691806	1.000000	0.71417	0.994000	0.49952	0.989000	0.77384	7.174000	0.77620	1.071000	0.40834	0.533000	0.62120	ATT		0.438	NNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214026.1	NM_182977		16	47	0	0	0	0.00499	0	16	47				
SKIV2L2	23517	broad.mit.edu	37	5	54618257	54618257	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr5:54618257G>T	ENST00000230640.5	+	2	491	c.237G>T	c.(235-237)aaG>aaT	p.K79N	SKIV2L2_ENST00000504388.1_3'UTR|SKIV2L2_ENST00000545714.1_Intron	NM_015360.4	NP_056175.3	P42285	SK2L2_HUMAN	superkiller viralicidic activity 2-like 2 (S. cerevisiae)	79					maturation of 5.8S rRNA (GO:0000460)|mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)	p.K79N(1)		NS(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)				TTGGAAAGAAGCCCAGGATAG	0.318																																					Melanoma(2;92 134 23744 29976 33782)	Melanoma(2;92 134 23744 29976 33782)	uc003jpy.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(235-237)AAG>AAT		superkiller viralicidic activity 2-like 2							119.0	125.0	123.0					5																	54618257		2203	4300	6503	SO:0001583	missense	23517				maturation of 5.8S rRNA	catalytic step 2 spliceosome|nucleolus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding	g.chr5:54618257G>T	D29641	CCDS3967.1	5q11.2	2008-11-25	2005-02-18	2005-02-18	ENSG00000039123	ENSG00000039123			18734	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 118"""		"""KIAA0052"""	KIAA0052			Standard	NM_015360		Approved	Mtr4, Dob1, fSAP118	uc003jpy.4	P42285	OTTHUMG00000097019	ENST00000230640.5:c.237G>T	5.37:g.54618257G>T	ENSP00000230640:p.Lys79Asn					SKIV2L2_uc011cqi.1_Intron	p.K79N	NM_015360	NP_056175	P42285	SK2L2_HUMAN			2	503	+		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)	79					Q2M386|Q6MZZ8|Q6P170|Q8N5R0|Q8TAG2	Missense_Mutation	SNP	ENST00000230640.5	37	c.237G>T	CCDS3967.1	.	.	.	.	.	.	.	.	.	.	G	18.18	3.567154	0.65651	.	.	ENSG00000039123	ENST00000230640	T	0.32988	1.43	5.66	-0.208	0.13185	.	0.104763	0.64402	D	0.000004	T	0.27384	0.0672	M	0.62723	1.935	0.80722	D	1	B	0.15141	0.012	B	0.17098	0.017	T	0.08391	-1.0724	10	0.33141	T	0.24	-9.849	10.132	0.42685	0.4997:0.0:0.5003:0.0	.	79	P42285	SK2L2_HUMAN	N	79	ENSP00000230640:K79N	ENSP00000230640:K79N	K	+	3	2	SKIV2L2	54654014	0.892000	0.30473	0.630000	0.29268	0.948000	0.59901	0.247000	0.18179	-0.126000	0.11682	0.563000	0.77884	AAG		0.318	SKIV2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214108.1			20	78	1	0	3.62473e-10	0.012319	4.33779e-10	20	78				
GPBP1	65056	broad.mit.edu	37	5	56527069	56527069	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr5:56527069A>T	ENST00000506184.2	+	5	1437	c.332A>T	c.(331-333)cAt>cTt	p.H111L	GPBP1_ENST00000538707.1_Missense_Mutation_p.H118L|GPBP1_ENST00000511209.1_Missense_Mutation_p.H118L|GPBP1_ENST00000264779.6_Missense_Mutation_p.H118L|GPBP1_ENST00000454432.2_Missense_Mutation_p.H111L|GPBP1_ENST00000424459.3_Missense_Mutation_p.H111L|GPBP1_ENST00000514387.2_De_novo_Start_OutOfFrame			Q86WP2	GPBP1_HUMAN	GC-rich promoter binding protein 1	111					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H111L(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	19		Lung NSC(810;0.000861)|Prostate(74;0.0305)|Breast(144;0.222)		OV - Ovarian serous cystadenocarcinoma(10;7.64e-39)		CAAGGACTACATGAAAACAAC	0.393																																							uc003jrh.3		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|central_nervous_system(1)	2						c.(331-333)CAT>CTT		GC-rich promoter binding protein 1 isoform 1							109.0	102.0	104.0					5																	56527069		2203	4300	6503	SO:0001583	missense	65056				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding	g.chr5:56527069A>T		CCDS34162.1, CCDS47211.1, CCDS47212.1, CCDS47212.2, CCDS56368.1	5q11.2	2008-02-05				ENSG00000062194			29520	protein-coding gene	gene with protein product		608412				12842993	Standard	NM_022913		Approved	DKFZp761C169, vasculin	uc003jrk.4	Q86WP2		ENST00000506184.2:c.332A>T	5.37:g.56527069A>T	ENSP00000421202:p.His111Leu					GPBP1_uc010iwg.2_Missense_Mutation_p.H111L|GPBP1_uc003jri.3_5'UTR|GPBP1_uc003jrj.3_Missense_Mutation_p.H118L|GPBP1_uc003jrk.3_Missense_Mutation_p.H118L|GPBP1_uc003jrl.3_RNA	p.H111L	NM_022913	NP_075064	Q86WP2	GPBP1_HUMAN		OV - Ovarian serous cystadenocarcinoma(10;7.64e-39)	5	1606	+		Lung NSC(810;0.000861)|Prostate(74;0.0305)|Breast(144;0.222)	111					A6NKW3|Q6NSH6|Q9H0D4|Q9H785|Q9NSN4	Missense_Mutation	SNP	ENST00000506184.2	37	c.332A>T	CCDS34162.1	.	.	.	.	.	.	.	.	.	.	A	18.38	3.611144	0.66558	.	.	ENSG00000062194	ENST00000424459;ENST00000506184;ENST00000454432;ENST00000511209;ENST00000264779;ENST00000538707	T;T;T;T;T;T	0.43688	0.94;0.94;0.94;0.94;0.94;0.94	5.76	4.61	0.57282	.	0.165062	0.56097	D	0.000039	T	0.55097	0.1899	L	0.51422	1.61	0.38758	D	0.954254	D;D;P;D	0.76494	0.999;0.991;0.936;0.991	D;P;P;P	0.83275	0.996;0.889;0.785;0.889	T	0.58858	-0.7562	10	0.62326	D	0.03	-17.6619	8.8318	0.35089	0.8563:0.0:0.1437:0.0	.	111;118;118;111	D4PHA4;Q86WP2-2;Q86WP2-3;Q86WP2	.;.;.;GPBP1_HUMAN	L	111;111;111;118;118;118	ENSP00000401596:H111L;ENSP00000421202:H111L;ENSP00000403522:H111L;ENSP00000422337:H118L;ENSP00000264779:H118L;ENSP00000440090:H118L	ENSP00000264779:H118L	H	+	2	0	GPBP1	56562826	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.216000	0.51176	1.019000	0.39547	-0.326000	0.08463	CAT		0.393	GPBP1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000374496.1	NM_022913		22	64	0	0	0	0.00632	0	22	64				
SV2C	22987	broad.mit.edu	37	5	75505590	75505590	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr5:75505590C>A	ENST00000502798.2	+	4	1233	c.791C>A	c.(790-792)tCg>tAg	p.S264*	SV2C_ENST00000322285.7_Nonsense_Mutation_p.S264*	NM_014979.1	NP_055794.1	Q496J9	SV2C_HUMAN	synaptic vesicle glycoprotein 2C	264					neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	transmembrane transporter activity (GO:0022857)	p.S264*(1)		NS(1)|breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)		ACTGTGTTCTCGTACTTTGCT	0.557																																							uc003kei.1		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(1)	1						c.(790-792)TCG>TAG		synaptic vesicle glycoprotein 2C							109.0	114.0	112.0					5																	75505590		2174	4292	6466	SO:0001587	stop_gained	22987				neurotransmitter transport	cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity	g.chr5:75505590C>A	AB028977	CCDS43331.1, CCDS75261.1	5q13	2008-02-05			ENSG00000122012	ENSG00000122012			30670	protein-coding gene	gene with protein product		610291				10470851, 9801366	Standard	XM_005248470		Approved		uc003kei.1	Q496J9	OTTHUMG00000162384	ENST00000502798.2:c.791C>A	5.37:g.75505590C>A	ENSP00000423541:p.Ser264*						p.S264*	NM_014979	NP_055794	Q496J9	SV2C_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)	4	925	+		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)	264			Helical; (Potential).		Q496K1|Q9UPU8	Nonsense_Mutation	SNP	ENST00000502798.2	37	c.791C>A	CCDS43331.1	.	.	.	.	.	.	.	.	.	.	C	42	9.539703	0.99199	.	.	ENSG00000122012	ENST00000502798;ENST00000322285	.	.	.	5.14	5.14	0.70334	.	0.057271	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.1157	18.2536	0.90012	0.0:1.0:0.0:0.0	.	.	.	.	X	264	.	ENSP00000316983:S264X	S	+	2	0	SV2C	75541346	1.000000	0.71417	1.000000	0.80357	0.833000	0.47200	7.684000	0.84104	2.392000	0.81423	0.591000	0.81541	TCG		0.557	SV2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368700.4			22	62	1	0	1.36615e-20	0.002836	1.97874e-20	22	62				
RASGRF2	5924	broad.mit.edu	37	5	80376481	80376481	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr5:80376481A>G	ENST00000265080.4	+	7	1101	c.1034A>G	c.(1033-1035)tAc>tGc	p.Y345C	RASGRF2_ENST00000502677.1_3'UTR	NM_006909.2	NP_008840.1	O14827	RGRF2_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 2	345	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.Y345C(1)		biliary_tract(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(28)|ovary(5)|prostate(3)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		AATCACCAGTACAGCCTGCAA	0.428																																							uc003kha.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(5)|ovary(3)|large_intestine(2)|central_nervous_system(1)|skin(1)	12						c.(1033-1035)TAC>TGC		Ras protein-specific guanine							118.0	115.0	116.0					5																	80376481		2203	4300	6503	SO:0001583	missense	5924				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|endoplasmic reticulum membrane|plasma membrane	protein binding|Rho guanyl-nucleotide exchange factor activity	g.chr5:80376481A>G	AF023130	CCDS4052.1	5q13	2013-01-10			ENSG00000113319	ENSG00000113319		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9876	protein-coding gene	gene with protein product		606614					Standard	NM_006909		Approved	GRF2, Ras-GRF2	uc003kha.2	O14827	OTTHUMG00000119015	ENST00000265080.4:c.1034A>G	5.37:g.80376481A>G	ENSP00000265080:p.Tyr345Cys					RASGRF2_uc011ctn.1_RNA|RASGRF2_uc003khb.1_Missense_Mutation_p.Y173C	p.Y345C	NM_006909	NP_008840	O14827	RGRF2_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)	7	1034	+		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)	345			DH.		B9EG89|Q9UK56	Missense_Mutation	SNP	ENST00000265080.4	37	c.1034A>G	CCDS4052.1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.269760	0.80469	.	.	ENSG00000113319	ENST00000265080	T	0.63255	-0.03	5.7	5.7	0.88788	Dbl homology (DH) domain (5);	0.000000	0.85682	D	0.000000	T	0.76335	0.3973	L	0.60455	1.87	0.58432	D	0.999998	D;D	0.89917	1.0;0.998	D;D	0.76575	0.988;0.975	T	0.78513	-0.2175	10	0.72032	D	0.01	.	15.9707	0.80013	1.0:0.0:0.0:0.0	.	345;345	D6RAS9;O14827	.;RGRF2_HUMAN	C	345	ENSP00000265080:Y345C	ENSP00000265080:Y345C	Y	+	2	0	RASGRF2	80412237	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.339000	0.96797	2.177000	0.69029	0.459000	0.35465	TAC		0.428	RASGRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239215.2	NM_006909		46	149	0	0	0	0.00361	0	46	149				
RASGRF2	5924	broad.mit.edu	37	5	80503114	80503114	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr5:80503114T>C	ENST00000265080.4	+	21	3084	c.3017T>C	c.(3016-3018)cTg>cCg	p.L1006P	CKMT2-AS1_ENST00000503483.2_RNA|CKMT2-AS1_ENST00000511495.1_RNA	NM_006909.2	NP_008840.1	O14827	RGRF2_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 2	1006	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.L1006P(1)		biliary_tract(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(28)|ovary(5)|prostate(3)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		GCCATGGAGCTGGCAGAACAG	0.572																																							uc003kha.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(5)|ovary(3)|large_intestine(2)|central_nervous_system(1)|skin(1)	12						c.(3016-3018)CTG>CCG		Ras protein-specific guanine							110.0	96.0	101.0					5																	80503114		2203	4300	6503	SO:0001583	missense	5924				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|endoplasmic reticulum membrane|plasma membrane	protein binding|Rho guanyl-nucleotide exchange factor activity	g.chr5:80503114T>C	AF023130	CCDS4052.1	5q13	2013-01-10			ENSG00000113319	ENSG00000113319		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9876	protein-coding gene	gene with protein product		606614					Standard	NM_006909		Approved	GRF2, Ras-GRF2	uc003kha.2	O14827	OTTHUMG00000119015	ENST00000265080.4:c.3017T>C	5.37:g.80503114T>C	ENSP00000265080:p.Leu1006Pro					RNU5E_uc011cto.1_Intron|RASGRF2_uc011ctn.1_RNA	p.L1006P	NM_006909	NP_008840	O14827	RGRF2_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)	21	3017	+		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)	1006			Ras-GEF.		B9EG89|Q9UK56	Missense_Mutation	SNP	ENST00000265080.4	37	c.3017T>C	CCDS4052.1	.	.	.	.	.	.	.	.	.	.	T	21.8	4.200201	0.79015	.	.	ENSG00000113319	ENST00000265080	T	0.40756	1.02	5.26	5.26	0.73747	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.070608	0.64402	D	0.000016	T	0.66665	0.2812	M	0.83774	2.66	0.80722	D	1	D	0.67145	0.996	D	0.70016	0.967	T	0.72877	-0.4159	10	0.87932	D	0	.	14.8437	0.70243	0.0:0.0:0.0:1.0	.	1006	O14827	RGRF2_HUMAN	P	1006	ENSP00000265080:L1006P	ENSP00000265080:L1006P	L	+	2	0	RASGRF2	80538870	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	8.040000	0.89188	1.993000	0.58246	0.454000	0.30748	CTG		0.572	RASGRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239215.2	NM_006909		5	70	0	0	0	0.000602	0	5	70				
ATP6AP1L	92270	broad.mit.edu	37	5	81608494	81608494	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr5:81608494A>G	ENST00000380167.4	+	9	1521	c.196A>G	c.(196-198)Atc>Gtc	p.I66V	ATP6AP1L_ENST00000508366.1_3'UTR|ATP6AP1L_ENST00000439350.1_Missense_Mutation_p.I66V			Q52LC2	VAS1L_HUMAN	ATPase, H+ transporting, lysosomal accessory protein 1-like	66					ATP hydrolysis coupled proton transport (GO:0015991)	integral component of membrane (GO:0016021)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)	p.I66V(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|urinary_tract(1)	12						CCGAGTCGAGATCATTTCCAA	0.453											OREG0016689	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003khv.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(196-198)ATC>GTC		ATPase, H+ transporting, lysosomal accessory							202.0	195.0	198.0					5																	81608494		2203	4300	6503	SO:0001583	missense	92270				ATP hydrolysis coupled proton transport	integral to membrane|proton-transporting V-type ATPase, V1 domain	hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism	g.chr5:81608494A>G	AK022625	CCDS34196.1	5q14.2	2010-03-10				ENSG00000205464			28091	protein-coding gene	gene with protein product							Standard	XR_112744		Approved		uc003khw.3	Q52LC2		ENST00000380167.4:c.196A>G	5.37:g.81608494A>G	ENSP00000369513:p.Ile66Val		OREG0016689	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1207	ATP6AP1L_uc003khw.2_Missense_Mutation_p.I66V	p.I66V	NM_001017971	NP_001017971	Q52LC2	VAS1L_HUMAN			9	1521	+			66						Missense_Mutation	SNP	ENST00000380167.4	37	c.196A>G	CCDS34196.1	.	.	.	.	.	.	.	.	.	.	A	7.687	0.690221	0.15039	.	.	ENSG00000205464	ENST00000380167;ENST00000439350	.	.	.	5.68	3.19	0.36642	.	0.283334	0.33272	N	0.005084	T	0.56396	0.1982	M	0.86178	2.8	0.34132	D	0.665375	B	0.14012	0.009	B	0.15484	0.013	T	0.58115	-0.7693	9	0.34782	T	0.22	.	6.4129	0.21700	0.6721:0.1684:0.1595:0.0	.	66	Q52LC2	VAS1L_HUMAN	V	66	.	ENSP00000369513:I66V	I	+	1	0	ATP6AP1L	81644250	0.997000	0.39634	0.856000	0.33681	0.048000	0.14542	0.699000	0.25586	0.381000	0.24851	0.533000	0.62120	ATC		0.453	ATP6AP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369562.3	NM_001017971		81	209	0	0	0	0.00361	0	81	209				
SLCO6A1	133482	broad.mit.edu	37	5	101748746	101748746	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr5:101748746A>T	ENST00000506729.1	-	9	1745	c.1574T>A	c.(1573-1575)tTt>tAt	p.F525Y	SLCO6A1_ENST00000513675.1_Missense_Mutation_p.F272Y|SLCO6A1_ENST00000389019.3_Missense_Mutation_p.F463Y|SLCO6A1_ENST00000379807.3_Missense_Mutation_p.F525Y|SLCO6A1_ENST00000379810.1_Missense_Mutation_p.F272Y			Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family, member 6A1	525	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.F525Y(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(17)|lung(22)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	60		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		GCAGGGAGAAAAATATTCAAT	0.303																																							uc003knn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(3)|central_nervous_system(1)	7						c.(1573-1575)TTT>TAT		solute carrier organic anion transporter family,							30.0	31.0	31.0					5																	101748746		2199	4296	6495	SO:0001583	missense	133482					integral to membrane|plasma membrane	transporter activity	g.chr5:101748746A>T	AF505657	CCDS34206.1, CCDS75282.1	5q21.2	2013-05-22			ENSG00000205359	ENSG00000205359		"""Solute carriers"""	23613	protein-coding gene	gene with protein product	"""cancer/testis antigen 48"""	613365					Standard	XM_005271874		Approved	OATP6A1, OATPY, MGC26949, CT48	uc003knp.3	Q86UG4	OTTHUMG00000162759	ENST00000506729.1:c.1574T>A	5.37:g.101748746A>T	ENSP00000421339:p.Phe525Tyr					SLCO6A1_uc003kno.2_Missense_Mutation_p.F272Y|SLCO6A1_uc003knp.2_Missense_Mutation_p.F525Y|SLCO6A1_uc003knq.2_Missense_Mutation_p.F463Y	p.F525Y	NM_173488	NP_775759	Q86UG4	SO6A1_HUMAN		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)	9	1746	-		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)	525			Extracellular (Potential).|Kazal-like.		A6NHC1|Q6ZMY5|Q86UV2|Q8IYU5	Missense_Mutation	SNP	ENST00000506729.1	37	c.1574T>A	CCDS34206.1	.	.	.	.	.	.	.	.	.	.	A	16.12	3.033205	0.54896	.	.	ENSG00000205359	ENST00000506729;ENST00000379807;ENST00000389019;ENST00000513675;ENST00000379810	T;T;T;T;T	0.04406	3.63;3.63;3.63;3.63;3.63	5.25	5.25	0.73442	Major facilitator superfamily domain, general substrate transporter (1);Protease inhibitor, Kazal-type (1);	0.000000	0.64402	D	0.000003	T	0.16342	0.0393	L	0.57536	1.79	0.36671	D	0.878517	D;P;D	0.89917	1.0;0.891;0.992	D;P;D	0.74023	0.982;0.895;0.936	T	0.03139	-1.1068	10	0.42905	T	0.14	.	12.7614	0.57367	1.0:0.0:0.0:0.0	.	463;272;525	Q86UG4-2;C9J020;Q86UG4	.;.;SO6A1_HUMAN	Y	525;525;463;272;272	ENSP00000421339:F525Y;ENSP00000369135:F525Y;ENSP00000373671:F463Y;ENSP00000421990:F272Y;ENSP00000369138:F272Y	ENSP00000369135:F525Y	F	-	2	0	SLCO6A1	101776645	1.000000	0.71417	0.991000	0.47740	0.242000	0.25591	5.464000	0.66719	2.195000	0.70347	0.533000	0.62120	TTT		0.303	SLCO6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370335.1	NM_173488		6	17	0	0	0	0.004482	0	6	17				
ACSL6	23305	broad.mit.edu	37	5	131308464	131308464	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr5:131308464T>C	ENST00000379240.1	-	13	1369	c.1216A>G	c.(1216-1218)Atc>Gtc	p.I406V	ACSL6_ENST00000379246.1_Missense_Mutation_p.I417V|ACSL6_ENST00000379249.3_Missense_Mutation_p.I406V|ACSL6_ENST00000379264.2_Missense_Mutation_p.I431V|ACSL6_ENST00000379255.1_Missense_Mutation_p.I331V|ACSL6_ENST00000379272.2_Missense_Mutation_p.I421V|ACSL6_ENST00000296869.4_Missense_Mutation_p.I431V|ACSL6_ENST00000544770.1_Missense_Mutation_p.I315V|ACSL6_ENST00000431707.1_Missense_Mutation_p.I386V|ACSL6_ENST00000379244.1_Missense_Mutation_p.I406V|ACSL6_ENST00000357096.1_Missense_Mutation_p.I331V|ACSL6_ENST00000543479.1_Missense_Mutation_p.I406V			Q9UKU0	ACSL6_HUMAN	acyl-CoA synthetase long-chain family member 6	406					acyl-CoA metabolic process (GO:0006637)|cellular lipid metabolic process (GO:0044255)|cellular response to insulin stimulus (GO:0032869)|fatty acid transport (GO:0015908)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|neuroblast proliferation (GO:0007405)|neuron development (GO:0048666)|phospholipid biosynthetic process (GO:0008654)|positive regulation of neuron projection development (GO:0010976)|positive regulation of plasma membrane long-chain fatty acid transport (GO:0010747)|positive regulation of triglyceride biosynthetic process (GO:0010867)|response to gravity (GO:0009629)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|long-chain fatty acid-CoA ligase activity (GO:0004467)|protein homodimerization activity (GO:0042803)	p.I431V(2)		NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	35		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TCATTCCTGATGATTCCACTC	0.438																																							uc010jdo.1		NA																	2	Substitution - Missense(2)		lung(2)	upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						c.(1216-1218)ATC>GTC		acyl-CoA synthetase long-chain family member 6							99.0	98.0	98.0					5																	131308464		2203	4300	6503	SO:0001583	missense	23305				fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane|plasma membrane	ATP binding|long-chain fatty acid-CoA ligase activity	g.chr5:131308464T>C	AB020644	CCDS34228.1, CCDS34229.1, CCDS56381.1, CCDS56382.1, CCDS56383.1	5q31	2008-02-05	2004-02-19	2004-02-20	ENSG00000164398	ENSG00000164398		"""Acyl-CoA synthetase family"""	16496	protein-coding gene	gene with protein product		604443	"""fatty-acid-Coenzyme A ligase, long-chain 6"""	FACL6		10502316, 10548543	Standard	NM_015256		Approved	KIAA0837, ACS2, LACS5, LACS2	uc003kvy.2	Q9UKU0	OTTHUMG00000150692	ENST00000379240.1:c.1216A>G	5.37:g.131308464T>C	ENSP00000368542:p.Ile406Val					ACSL6_uc003kvv.1_RNA|ACSL6_uc003kvx.1_Missense_Mutation_p.I431V|ACSL6_uc003kvy.1_Missense_Mutation_p.I431V|ACSL6_uc003kwb.2_Missense_Mutation_p.I396V|ACSL6_uc003kvz.1_Missense_Mutation_p.I331V|ACSL6_uc003kwa.1_Missense_Mutation_p.I417V|ACSL6_uc003kvw.1_Missense_Mutation_p.I52V|ACSL6_uc010jdn.1_Missense_Mutation_p.I421V	p.I406V	NM_015256	NP_056071	Q9UKU0	ACSL6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		13	1299	-		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	406			Cytoplasmic (Potential).		J3KPG3|O94924|O95829|Q108M9|Q108N0|Q4G191|Q86TN7	Missense_Mutation	SNP	ENST00000379240.1	37	c.1216A>G		.	.	.	.	.	.	.	.	.	.	T	5.552	0.286683	0.10513	.	.	ENSG00000164398	ENST00000379249;ENST00000379264;ENST00000379272;ENST00000357096;ENST00000379255;ENST00000296869;ENST00000379246;ENST00000379244;ENST00000544770;ENST00000379240;ENST00000431707;ENST00000543479	T;T;T;T;T;T;T;T;T;T;T;T	0.21361	2.01;2.01;2.01;2.01;2.01;2.01;2.01;2.01;2.01;2.01;2.01;2.01	6.04	3.6	0.41247	AMP-dependent synthetase/ligase (1);	0.181068	0.64402	N	0.000018	T	0.10680	0.0261	N	0.11341	0.13	0.43372	D	0.995469	B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B	0.16289	0.009;0.002;0.003;0.015;0.002;0.002;0.002	T	0.15235	-1.0444	10	0.19147	T	0.46	.	10.576	0.45227	0.0:0.1312:0.0:0.8688	.	406;421;396;406;331;431;431	Q9UKU0-3;Q9UKU0-6;B4DFW3;Q9UKU0;Q9UKU0-7;Q9UKU0-1;Q9UKU0-8	.;.;.;ACSL6_HUMAN;.;.;.	V	406;431;421;331;331;431;417;406;315;406;386;406	ENSP00000368551:I406V;ENSP00000368566:I431V;ENSP00000368574:I421V;ENSP00000349608:I331V;ENSP00000368557:I331V;ENSP00000296869:I431V;ENSP00000368548:I417V;ENSP00000368546:I406V;ENSP00000445154:I315V;ENSP00000368542:I406V;ENSP00000413329:I386V;ENSP00000442124:I406V	ENSP00000296869:I431V	I	-	1	0	ACSL6	131336363	1.000000	0.71417	1.000000	0.80357	0.017000	0.09413	2.797000	0.47877	0.509000	0.28195	0.529000	0.55759	ATC		0.438	ACSL6-004	NOVEL	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000132622.1	NM_015256		36	91	0	0	0	0.009718	0	36	91				
SLC25A48	153328	broad.mit.edu	37	5	135188390	135188390	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr5:135188390C>A	ENST00000420621.1	+	4	473	c.301C>A	c.(301-303)Cgc>Agc	p.R101S	SLC25A48_ENST00000412661.2_Missense_Mutation_p.R101S|SLC25A48_ENST00000433282.2_Missense_Mutation_p.R47S|SLC25A48_ENST00000274513.5_Missense_Mutation_p.R101S|SLC25A48_ENST00000425402.1_Intron			Q6ZT89	S2548_HUMAN	solute carrier family 25, member 48	101					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)		p.R101S(4)		NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	10						CAGTCCTCCCCGCACGCTGTC	0.647																																							uc003laz.1		NA																	4	Substitution - Missense(4)		lung(4)		0						c.(301-303)CGC>AGC		RecName: Full=Putative mitochondrial carrier protein FLJ44862;							60.0	67.0	64.0					5																	135188390		1965	4136	6101	SO:0001583	missense	153328				transmembrane transport	integral to membrane|mitochondrial inner membrane	binding	g.chr5:135188390C>A		CCDS43366.2	5q31.1	2013-05-22			ENSG00000145832	ENSG00000145832		"""Solute carriers"""	30451	protein-coding gene	gene with protein product	"""HCC-down-regulated mitochondrial carrier protein"""					15322095, 19303656	Standard	NM_145282		Approved	FLJ44862, HDMCP	uc003lba.3	Q6ZT89	OTTHUMG00000157007	ENST00000420621.1:c.301C>A	5.37:g.135188390C>A	ENSP00000407973:p.Arg101Ser					LOC153328_uc003lba.2_Missense_Mutation_p.R101S	p.R101S			Q6ZT89	S2548_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)		4	473	+			101			Solcar 2.		Q8TAV9	Missense_Mutation	SNP	ENST00000420621.1	37	c.301C>A		.	.	.	.	.	.	.	.	.	.	C	0.813	-0.751223	0.03041	.	.	ENSG00000145832	ENST00000274513;ENST00000420621;ENST00000433282;ENST00000412661	T;T;T;T	0.77620	-1.11;-1.11;-1.11;-1.11	5.08	3.21	0.36854	.	0.230538	0.45361	D	0.000379	T	0.59418	0.2192	N	0.14661	0.345	0.09310	N	1	B;P	0.39157	0.151;0.662	B;B	0.32583	0.065;0.148	T	0.51841	-0.8654	10	0.30854	T	0.27	-24.2126	15.3759	0.74605	0.0:0.737:0.263:0.0	.	101;101	Q6ZT89-3;Q6ZT89-2	.;.	S	101;101;47;101	ENSP00000274513:R101S;ENSP00000407973:R101S;ENSP00000399834:R47S;ENSP00000413049:R101S	ENSP00000274513:R101S	R	+	1	0	SLC25A48	135216289	0.001000	0.12720	0.004000	0.12327	0.006000	0.05464	1.505000	0.35736	1.118000	0.41863	0.462000	0.41574	CGC		0.647	SLC25A48-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_145282		20	91	1	0	6.45866e-13	0.00874	8.15713e-13	20	91				
HNRNPA0	10949	broad.mit.edu	37	5	137089549	137089549	+	Silent	SNP	G	G	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr5:137089549G>A	ENST00000314940.4	-	1	490	c.207C>T	c.(205-207)ccC>ccT	p.P69P		NM_006805.3	NP_006796.1	Q13151	ROA0_HUMAN	heterogeneous nuclear ribonucleoprotein A0	69	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|gene expression (GO:0010467)|inflammatory response (GO:0006954)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|response to lipopolysaccharide (GO:0032496)|RNA splicing (GO:0008380)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|RNA binding (GO:0003723)	p.P69P(1)		large_intestine(1)|lung(2)|skin(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CCACGGCATGGGGCGAGGCGG	0.662																																							uc003lbt.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(205-207)CCC>CCT		heterogeneous nuclear ribonucleoprotein A0							43.0	46.0	45.0					5																	137089549		2203	4298	6501	SO:0001819	synonymous_variant	10949				nuclear mRNA splicing, via spliceosome	heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|RNA binding	g.chr5:137089549G>A	U23803	CCDS4193.1	5q31	2013-02-12		2007-08-16	ENSG00000177733	ENSG00000177733		"""RNA binding motif (RRM) containing"""	5030	protein-coding gene	gene with protein product		609409		HNRPA0		7585247	Standard	NM_006805		Approved	hnRNPA0	uc003lbt.3	Q13151	OTTHUMG00000129156	ENST00000314940.4:c.207C>T	5.37:g.137089549G>A						MYOT_uc011cye.1_Intron|HNRNPA0_uc010jeo.2_Intron	p.P69P	NM_006805	NP_006796	Q13151	ROA0_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)		1	491	-			69			RRM 1.		Q6IB18	Silent	SNP	ENST00000314940.4	37	c.207C>T	CCDS4193.1																																																																																				0.662	HNRNPA0-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251221.1	NM_006805		25	79	0	0	0	0.004656	0	25	79				
PCDHA6	56142	broad.mit.edu	37	5	140207895	140207895	+	Missense_Mutation	SNP	C	C	A	rs544173556		TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr5:140207895C>A	ENST00000529310.1	+	1	333	c.219C>A	c.(217-219)gaC>gaA	p.D73E	PCDHA5_ENST00000529859.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000527624.1_Missense_Mutation_p.D73E|PCDHA5_ENST00000529619.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	73	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.D73E(2)		NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACCGCGAGGACCTTCTGGAGG	0.632																																							uc003lho.2		NA																	2	Substitution - Missense(2)		lung(2)	haematopoietic_and_lymphoid_tissue(1)|skin(1)	2						c.(217-219)GAC>GAA		protocadherin alpha 6 isoform 1 precursor							111.0	127.0	121.0					5																	140207895		2203	4300	6503	SO:0001583	missense	56142				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140207895C>A	AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.219C>A	5.37:g.140207895C>A	ENSP00000433378:p.Asp73Glu					PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Missense_Mutation_p.D73E|PCDHA6_uc011dab.1_Missense_Mutation_p.D73E	p.D73E	NM_018909	NP_061732	Q9UN73	PCDA6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	246	+			73			Cadherin 1.|Extracellular (Potential).		O75283|Q9NRT8	Missense_Mutation	SNP	ENST00000529310.1	37	c.219C>A	CCDS47281.1	.	.	.	.	.	.	.	.	.	.	C	3.825	-0.036873	0.07497	.	.	ENSG00000081842	ENST00000529310;ENST00000527624	T;T	0.25912	1.77;1.77	3.87	2.0	0.26442	Cadherin, N-terminal (1);Cadherin (4);Cadherin-like (1);	0.000000	0.38663	U	0.001602	T	0.16599	0.0399	N	0.26162	0.8	0.18873	N	0.999988	B;B;B	0.11235	0.004;0.001;0.002	B;B;B	0.13407	0.007;0.006;0.009	T	0.19353	-1.0308	10	0.59425	D	0.04	.	8.4875	0.33080	0.0:0.4905:0.4195:0.09	.	73;73;73	Q9UN73-3;Q9UN73;Q9UN73-2	.;PCDA6_HUMAN;.	E	73	ENSP00000433378:D73E;ENSP00000434113:D73E	ENSP00000434113:D73E	D	+	3	2	PCDHA6	140188079	0.000000	0.05858	1.000000	0.80357	0.393000	0.30537	-1.617000	0.02051	0.376000	0.24707	0.313000	0.20887	GAC		0.632	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372829.3	NM_018909		90	263	1	0	1.37074e-43	0.00361	2.23357e-43	90	263				
PCDHA12	56137	broad.mit.edu	37	5	140255747	140255747	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr5:140255747A>G	ENST00000398631.2	+	1	690	c.690A>G	c.(688-690)atA>atG	p.I230M	PCDHA4_ENST00000530339.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA8_ENST00000531613.1_Intron	NM_018903.2|NM_031864.2	NP_061726.1|NP_114070.1	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12	230	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.I230M(1)		NS(4)|breast(2)|cervix(1)|endometrium(19)|kidney(8)|large_intestine(8)|liver(2)|lung(25)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGATTCAAATAACCGTCCTGG	0.433																																					Pancreas(113;759 1672 13322 24104 50104)	Pancreas(113;759 1672 13322 24104 50104)	uc003lic.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(688-690)ATA>ATG		protocadherin alpha 12 isoform 1 precursor							100.0	96.0	97.0					5																	140255747		1878	4116	5994	SO:0001583	missense	56137				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding	g.chr5:140255747A>G	AF152477	CCDS47285.1, CCDS75327.1	5q31	2010-11-26			ENSG00000251664	ENSG00000251664		"""Cadherins / Protocadherins : Clustered"""	8666	other	complex locus constituent	"""KIAA0345-like 2"""	606318				10380929	Standard	NM_018903		Approved	PCDH-ALPHA12	uc003lic.2	Q9UN75	OTTHUMG00000163366	ENST00000398631.2:c.690A>G	5.37:g.140255747A>G	ENSP00000381628:p.Ile230Met					PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc011daf.1_Missense_Mutation_p.I230M	p.I230M	NM_018903	NP_061726	Q9UN75	PCDAC_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	817	+			230			Extracellular (Potential).|Cadherin 2.		O75278|Q2M1N8	Missense_Mutation	SNP	ENST00000398631.2	37	c.690A>G	CCDS47285.1	.	.	.	.	.	.	.	.	.	.	A	13.28	2.188741	0.38609	.	.	ENSG00000251664	ENST00000398631	T	0.69685	-0.42	5.07	1.27	0.21489	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	.	.	.	.	D	0.87771	0.6261	H	0.97962	4.115	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.991;0.998	T	0.80144	-0.1505	9	0.87932	D	0	.	13.9643	0.64199	0.2857:0.7143:0.0:0.0	.	230;230	Q9UN75-2;Q9UN75	.;PCDAC_HUMAN	M	230	ENSP00000381628:I230M	ENSP00000381628:I230M	I	+	3	3	PCDHA12	140235931	0.000000	0.05858	0.005000	0.12908	0.961000	0.63080	-2.818000	0.00751	0.236000	0.21180	0.482000	0.46254	ATA		0.433	PCDHA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372882.2	NM_018903		39	83	0	0	0	0.00874	0	39	83				
PCDHB4	56131	broad.mit.edu	37	5	140502904	140502904	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr5:140502904G>T	ENST00000194152.1	+	1	1324	c.1324G>T	c.(1324-1326)Gac>Tac	p.D442Y	AC005754.8_ENST00000606030.1_lincRNA	NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	442	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D442Y(1)		autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCAGGTCTCCGACGTCAATGA	0.607																																							uc003lip.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						c.(1324-1326)GAC>TAC		protocadherin beta 4 precursor							110.0	101.0	104.0					5																	140502904		2203	4300	6503	SO:0001583	missense	56131				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	cytoplasm|integral to plasma membrane|intermediate filament cytoskeleton	calcium ion binding	g.chr5:140502904G>T	AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.1324G>T	5.37:g.140502904G>T	ENSP00000194152:p.Asp442Tyr						p.D442Y	NM_018938	NP_061761	Q9Y5E5	PCDB4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1324	+			442			Cadherin 4.|Extracellular (Potential).		Q4V761	Missense_Mutation	SNP	ENST00000194152.1	37	c.1324G>T	CCDS4246.1	.	.	.	.	.	.	.	.	.	.	G	19.62	3.861469	0.71949	.	.	ENSG00000081818	ENST00000194152	T	0.69175	-0.38	3.97	3.97	0.46021	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);	.	.	.	.	D	0.90086	0.6903	H	0.99764	4.76	0.58432	D	0.999995	D	0.89917	1.0	D	0.97110	1.0	D	0.94844	0.8007	9	0.87932	D	0	.	16.6801	0.85290	0.0:0.0:1.0:0.0	.	442	Q9Y5E5	PCDB4_HUMAN	Y	442	ENSP00000194152:D442Y	ENSP00000194152:D442Y	D	+	1	0	PCDHB4	140483088	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	7.189000	0.77747	2.238000	0.73509	0.558000	0.71614	GAC		0.607	PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251812.2	NM_018938		36	162	1	0	6.86731e-36	0.006999	1.10421e-35	36	162				
PCDHB5	26167	broad.mit.edu	37	5	140517152	140517152	+	Silent	SNP	G	G	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr5:140517152G>A	ENST00000231134.5	+	1	2353	c.2136G>A	c.(2134-2136)ctG>ctA	p.L712L		NM_015669.2	NP_056484.1	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5	712					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L712L(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|kidney(1)|large_intestine(18)|lung(25)|ovary(3)|prostate(6)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	81			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CAGTGCGGCTGTGCAGGAGGA	0.677																																							uc003liq.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(3)|ovary(2)	5						c.(2134-2136)CTG>CTA		protocadherin beta 5 precursor							80.0	90.0	86.0					5																	140517152		2202	4299	6501	SO:0001819	synonymous_variant	26167				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding|protein binding	g.chr5:140517152G>A	AF152498	CCDS4247.1	5q31	2010-01-26			ENSG00000113209	ENSG00000113209		"""Cadherins / Protocadherins : Clustered"""	8690	other	protocadherin		606331				10380929	Standard	NM_015669		Approved	DKFZp586B0217, PCDH-BETA5	uc003liq.3	Q9Y5E4	OTTHUMG00000129616	ENST00000231134.5:c.2136G>A	5.37:g.140517152G>A							p.L712L	NM_015669	NP_056484	Q9Y5E4	PCDB5_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	2353	+			712			Cytoplasmic (Potential).		Q549F4|Q9UFU9	Silent	SNP	ENST00000231134.5	37	c.2136G>A	CCDS4247.1																																																																																				0.677	PCDHB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251811.1	NM_015669		48	188	0	0	0	0.00361	0	48	188				
PCDHB7	56129	broad.mit.edu	37	5	140553013	140553013	+	Silent	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr5:140553013G>T	ENST00000231137.3	+	1	771	c.597G>T	c.(595-597)gtG>gtT	p.V199V		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	199	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V199V(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGAATCAAGTGCTGGATCGGG	0.517																																							uc003lit.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|central_nervous_system(1)|skin(1)	6						c.(595-597)GTG>GTT		protocadherin beta 7 precursor							74.0	71.0	72.0					5																	140553013		2203	4300	6503	SO:0001819	synonymous_variant	56129				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140553013G>T	AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.597G>T	5.37:g.140553013G>T							p.V199V	NM_018940	NP_061763	Q9Y5E2	PCDB7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	771	+			199			Extracellular (Potential).|Cadherin 2.		A1L3Y8	Silent	SNP	ENST00000231137.3	37	c.597G>T	CCDS4249.1																																																																																				0.517	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	NM_018940		19	70	1	0	8.10497e-08	0.010504	9.27371e-08	19	70				
PCDHGA4	56111	broad.mit.edu	37	5	140736243	140736243	+	Silent	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr5:140736243C>A	ENST00000571252.1	+	1	1476	c.1476C>A	c.(1474-1476)gcC>gcA	p.A492A	PCDHGB1_ENST00000523390.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018917.2	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4	492	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACTCCCTGGCCGAAGACACCT	0.493																																							uc003ljq.1		NA																	0					0						c.(1474-1476)GCC>GCA		protocadherin gamma subfamily A, 4 isoform 1							132.0	137.0	136.0					5																	140736243		2078	4239	6317	SO:0001819	synonymous_variant	56111				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140736243C>A	AF152511	CCDS58979.1, CCDS58979.2, CCDS75331.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8702	other	protocadherin		606291				10380929	Standard	NM_018917		Approved	PCDH-GAMMA-A4		Q9Y5G9		ENST00000571252.1:c.1476C>A	5.37:g.140736243C>A						PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljp.1_Silent_p.A492A	p.A492A	NM_018917	NP_061740	Q9Y5G9	PCDG4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1476	+			492			Extracellular (Potential).|Cadherin 5.		Q9Y5D3	Silent	SNP	ENST00000571252.1	37	c.1476C>A	CCDS58979.1																																																																																				0.493	PCDHGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437959.1	NM_018917		54	185	1	0	3.07002e-29	0.00361	4.76832e-29	54	185				
PCDHGA9	56107	broad.mit.edu	37	5	140784669	140784669	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr5:140784669G>A	ENST00000573521.1	+	1	2150	c.2150G>A	c.(2149-2151)aGg>aAg	p.R717K	PCDHGA4_ENST00000571252.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron	NM_018921.2|NM_032089.1	NP_061744.1|NP_114478.1	Q9Y5G4	PCDG9_HUMAN	protocadherin gamma subfamily A, 9	717					homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCAGGCTGAGGCACTGGCAC	0.592																																							uc003lkh.1		NA																	0					0						c.(2149-2151)AGG>AAG		protocadherin gamma subfamily A, 9 isoform 1							76.0	83.0	80.0					5																	140784669		2164	4286	6450	SO:0001583	missense	56107				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140784669G>A	AF152516	CCDS58981.1, CCDS75341.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8707	other	protocadherin		606296				10380929	Standard	NM_018921		Approved	PCDH-GAMMA-A9		Q9Y5G4		ENST00000573521.1:c.2150G>A	5.37:g.140784669G>A	ENSP00000460274:p.Arg717Lys					PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc011dax.1_Missense_Mutation_p.R717K	p.R717K	NM_018921	NP_061744	Q9Y5G4	PCDG9_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2150	+			717			Cytoplasmic (Potential).		A2RU65|Q9Y5C9	Missense_Mutation	SNP	ENST00000573521.1	37	c.2150G>A	CCDS58981.1																																																																																				0.592	PCDHGA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437105.1	NM_018921		22	106	0	0	0	0.002299	0	22	106				
PCDH12	51294	broad.mit.edu	37	5	141335023	141335023	+	Silent	SNP	C	C	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr5:141335023C>T	ENST00000231484.3	-	1	3604	c.2394G>A	c.(2392-2394)gtG>gtA	p.V798V	PCDH12_ENST00000512221.1_5'Flank|AC005740.6_ENST00000607378.1_RNA	NM_016580.2	NP_057664.1	Q9NPG4	PCD12_HUMAN	protocadherin 12	798					calcium-dependent cell-cell adhesion (GO:0016339)|glycogen metabolic process (GO:0005977)|homophilic cell adhesion (GO:0007156)|labyrinthine layer development (GO:0060711)|neuron recognition (GO:0008038)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V798V(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(3)|prostate(2)|skin(1)	38		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTCCTTGTCCACATCTTTGT	0.612																																							uc003llx.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)	3						c.(2392-2394)GTG>GTA		protocadherin 12 precursor							37.0	33.0	35.0					5																	141335023		2203	4300	6503	SO:0001819	synonymous_variant	51294				neuron recognition	integral to plasma membrane	calcium ion binding	g.chr5:141335023C>T	AF231025	CCDS4269.1	5q31.3	2010-01-26			ENSG00000113555	ENSG00000113555		"""Cadherins / Protocadherins : Non-clustered"""	8657	protein-coding gene	gene with protein product		605622				10716726, 10380929	Standard	NM_016580		Approved	VE-cadherin-2	uc003llx.3	Q9NPG4	OTTHUMG00000129658	ENST00000231484.3:c.2394G>A	5.37:g.141335023C>T							p.V798V	NM_016580	NP_057664	Q9NPG4	PCD12_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	3605	-		all_hematologic(541;0.0999)	798			Cytoplasmic (Potential).		Q6UXB6|Q96KB8|Q9H7Y6|Q9H8E0	Silent	SNP	ENST00000231484.3	37	c.2394G>A	CCDS4269.1																																																																																				0.612	PCDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251858.1	NM_016580		21	34	0	0	0	0.010504	0	21	34				
TNIP1	10318	broad.mit.edu	37	5	150407000	150407000	+	IGR	SNP	C	C	G			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr5:150407000C>G	ENST00000389378.2	-	0	3268				GPX3_ENST00000517973.1_Silent_p.S71S|GPX3_ENST00000388825.4_Missense_Mutation_p.R123G	NM_001252385.1|NM_001252393.1|NM_001258454.1|NM_006058.4	NP_001239314.1|NP_001239322.1|NP_001245383.1|NP_006049.3	Q15025	TNIP1_HUMAN	TNFAIP3 interacting protein 1						defense response (GO:0006952)|glycoprotein biosynthetic process (GO:0009101)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|modulation by symbiont of host I-kappaB kinase/NF-kappaB cascade (GO:0085032)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of viral genome replication (GO:0045071)|positive regulation of inflammatory response (GO:0050729)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|translation (GO:0006412)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	mitogen-activated protein kinase binding (GO:0051019)	p.R123G(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(5)|ovary(2)|prostate(2)|skin(3)	23		Medulloblastoma(196;0.0911)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CAGGTATGTCCGACCAGGTGG	0.493																																							uc011dcm.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(367-369)CGA>GGA		glutathione peroxidase 3 precursor	Glutathione(DB00143)						79.0	80.0	80.0					5																	150407000		1987	4178	6165	SO:0001628	intergenic_variant	2878				hydrogen peroxide catabolic process|protein homotetramerization|response to lipid hydroperoxide	extracellular space	glutathione peroxidase activity|selenium binding|transcription factor binding	g.chr5:150407000C>G	AJ011895	CCDS34280.1, CCDS58982.1, CCDS58983.1, CCDS58984.1, CCDS58985.1, CCDS75359.1	5q32-q33.1	2008-07-18							16903	protein-coding gene	gene with protein product	"""virion-associated nuclear-shuttling protein"", ""Nef-associated factor 1 SNP"""	607714				9923610, 11090181	Standard	NM_001252385		Approved	NAF1, KIAA0113, ABIN-1, VAN	uc003ltj.3	Q15025			5.37:g.150407000C>G						GPX3_uc003ltc.2_RNA|GPX3_uc003ltd.2_RNA	p.R123G	NM_002084	NP_002075	P22352	GPX3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		5	584	+		Medulloblastoma(196;0.091)|all_hematologic(541;0.207)	123					A4F1W8|A4F1W9|A4F1X2|A4F1X4|A4F1X5|A4F1X6|A4F1X7|A4F1X9|B7Z699|E7EPY1|E7ET96|O76008|Q05KP3|Q05KP4|Q6N077|Q96EL9|Q99833|Q9H1J3	Missense_Mutation	SNP	ENST00000389378.2	37	c.367C>G	CCDS34280.1	.	.	.	.	.	.	.	.	.	.	C	14.25	2.478301	0.44044	.	.	ENSG00000211445	ENST00000388825;ENST00000521650	T;T	0.08984	3.74;3.03	5.59	4.72	0.59763	Thioredoxin-like fold (2);	0.000000	0.85682	D	0.000000	T	0.40040	0.1101	H	0.94345	3.525	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.56691	-0.7937	10	0.87932	D	0	.	14.3101	0.66410	0.2701:0.7299:0.0:0.0	.	123	P22352	GPX3_HUMAN	G	123;132	ENSP00000373477:R123G;ENSP00000427873:R132G	ENSP00000373477:R123G	R	+	1	2	GPX3	150387193	0.096000	0.21769	0.864000	0.33941	0.266000	0.26442	0.526000	0.22971	1.333000	0.45449	0.655000	0.94253	CGA		0.493	TNIP1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374914.1	NM_006058		38	111	0	0	0	0.009718	0	38	111				
PPP1R2P3	153743	broad.mit.edu	37	5	156277687	156277687	+	IGR	SNP	G	G	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr5:156277687G>A								RNU6-556P (36442 upstream) : TIMD4 (68605 downstream)														p.E38E(1)									GTGTCGACGAGGAGCTGAGCA	0.512																																							uc003lwf.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(112-114)GAG>GAA		RecName: Full=Putative protein phosphatase inhibitor 2-like protein 3; AltName: Full=Protein phosphatase 1, regulatory subunit 2 pseudogene 3;																																				SO:0001628	intergenic_variant	153743							g.chr5:156277687G>A																													5.37:g.156277687G>A							p.E38E	NR_002168						1	139	+									Silent	SNP		37	c.114G>A																																																																																				0	0.512									8	29	0	0	0	0.006214	0	8	29				
SOX30	11063	broad.mit.edu	37	5	157078599	157078599	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr5:157078599G>A	ENST00000265007.6	-	1	829	c.488C>T	c.(487-489)tCc>tTc	p.S163F	SOX30_ENST00000519442.1_Intron|SOX30_ENST00000311371.5_Missense_Mutation_p.S163F	NM_178424.1	NP_848511.1	O94993	SOX30_HUMAN	SRY (sex determining region Y)-box 30	163					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to corticosteroid (GO:0031960)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.S163F(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	23	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GACCACCCTGGAGGCTCTAGG	0.662																																					Esophageal Squamous(31;525 799 19355 21125 41744)	Esophageal Squamous(31;525 799 19355 21125 41744)	uc003lxb.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(487-489)TCC>TTC		SRY (sex determining region Y)-box 30 isoform a							24.0	28.0	27.0					5																	157078599		2191	4276	6467	SO:0001583	missense	11063				regulation of transcription from RNA polymerase II promoter|regulation of transcription, DNA-dependent|response to corticosteroid stimulus|transcription, DNA-dependent	nucleus|nucleus	sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity	g.chr5:157078599G>A	AB022083	CCDS4339.1, CCDS4340.1	5q33	2010-10-21			ENSG00000039600	ENSG00000039600		"""SRY (sex determining region Y)-boxes"""	30635	protein-coding gene	gene with protein product		606698				15019997, 11678506	Standard	NM_178424		Approved		uc003lxb.1	O94993	OTTHUMG00000130247	ENST00000265007.6:c.488C>T	5.37:g.157078599G>A	ENSP00000265007:p.Ser163Phe					SOX30_uc003lxc.1_Missense_Mutation_p.S163F|SOX30_uc011dds.1_Intron	p.S163F	NM_178424	NP_848511	O94993	SOX30_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		1	830	-	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	163					O94995|Q8IYX6	Missense_Mutation	SNP	ENST00000265007.6	37	c.488C>T	CCDS4339.1	.	.	.	.	.	.	.	.	.	.	G	11.12	1.543772	0.27563	.	.	ENSG00000039600	ENST00000311371;ENST00000265007	D;D	0.98493	-4.96;-4.54	4.62	0.325	0.15903	.	0.571439	0.14638	N	0.307390	D	0.94108	0.8111	L	0.27053	0.805	0.09310	N	0.999999	P;P	0.43094	0.799;0.553	B;B	0.38755	0.281;0.102	D	0.89337	0.3651	10	0.87932	D	0	.	7.1723	0.25724	0.1577:0.3948:0.4474:0.0	.	163;163	O94993-2;O94993	.;SOX30_HUMAN	F	163	ENSP00000309343:S163F;ENSP00000265007:S163F	ENSP00000265007:S163F	S	-	2	0	SOX30	157011177	0.001000	0.12720	0.002000	0.10522	0.246000	0.25737	0.897000	0.28390	0.029000	0.15352	0.305000	0.20034	TCC		0.662	SOX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252571.2	NM_007017		42	63	0	0	0	0.00361	0	42	63				
LSM11	134353	broad.mit.edu	37	5	157181018	157181018	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr5:157181018A>G	ENST00000286307.5	+	3	651	c.595A>G	c.(595-597)Act>Gct	p.T199A		NM_173491.2	NP_775762.1	P83369	LSM11_HUMAN	LSM11, U7 small nuclear RNA associated	199	SM 1.				gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	histone pre-mRNA 3'end processing complex (GO:0071204)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U7 snRNP (GO:0005683)	U7 snRNA binding (GO:0071209)	p.T199A(1)		breast(1)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)	7	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CTAGGCACTTACTGATGTGGA	0.403																																							uc003lxe.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(595-597)ACT>GCT		LSM11, U7 small nuclear RNA associated							128.0	112.0	117.0					5																	157181018		2203	4300	6503	SO:0001583	missense	134353				histone mRNA 3'-end processing|S phase of mitotic cell cycle|termination of RNA polymerase II transcription	histone pre-mRNA 3'end processing complex|nucleoplasm|U7 snRNP	protein binding|U7 snRNA binding	g.chr5:157181018A>G	AK095592	CCDS4342.1	5q33.3	2008-02-05	2004-04-28		ENSG00000155858	ENSG00000155858			30860	protein-coding gene	gene with protein product			"""LSM11 homolog, U7 small nuclear RNA associated (S. cerevisiae)"""			12975319	Standard	NM_173491		Approved	FLJ38273	uc003lxe.1	P83369	OTTHUMG00000130255	ENST00000286307.5:c.595A>G	5.37:g.157181018A>G	ENSP00000286307:p.Thr199Ala					LSM11_uc003lxf.1_5'Flank	p.T199A	NM_173491	NP_775762	P83369	LSM11_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		3	599	+	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	199			SM 1.		A0AVQ1|Q7Z7P0|Q8N975	Missense_Mutation	SNP	ENST00000286307.5	37	c.595A>G	CCDS4342.1	.	.	.	.	.	.	.	.	.	.	.	21.7	4.189715	0.78789	.	.	ENSG00000155858	ENST00000286307	T	0.42900	0.96	6.17	6.17	0.99709	Like-Sm ribonucleoprotein (LSM) domain (1);Like-Sm ribonucleoprotein (LSM)-related domain (2);	0.119448	0.64402	D	0.000009	T	0.33614	0.0869	N	0.25890	0.77	0.39311	D	0.965083	P	0.39094	0.659	B	0.40565	0.333	T	0.29792	-1.0000	10	0.59425	D	0.04	-9.4563	11.0511	0.47889	0.9315:0.0:0.0685:0.0	.	199	P83369	LSM11_HUMAN	A	199	ENSP00000286307:T199A	ENSP00000286307:T199A	T	+	1	0	LSM11	157113596	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.979000	0.76154	2.371000	0.80710	0.533000	0.62120	ACT		0.403	LSM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252580.2	NM_173491		27	65	0	0	0	0.012213	0	27	65				
GABRA1	2554	broad.mit.edu	37	5	161324188	161324188	+	Silent	SNP	T	T	C			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr5:161324188T>C	ENST00000428797.2	+	11	1486	c.1131T>C	c.(1129-1131)ccT>ccC	p.P377P	GABRA1_ENST00000444819.1_Silent_p.P377P|GABRA1_ENST00000437025.2_Silent_p.P377P|GABRA1_ENST00000393943.4_Silent_p.P377P|GABRA1_ENST00000420560.1_Silent_p.P377P|GABRA1_ENST00000023897.6_Silent_p.P377P	NM_001127643.1	NP_001121115.1	P14867	GBRA1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 1	377					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|drug binding (GO:0008144)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.P377P(1)		NS(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(1)|lung(22)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(1)	42	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zaleplon(DB00962)|Zolpidem(DB00425)|Zopiclone(DB01198)	GCTACACCCCTAATTTGGCCA	0.453																																							uc010jiw.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(1129-1131)CCT>CCC		gamma-aminobutyric acid (GABA) A receptor, alpha	Alprazolam(DB00404)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Halazepam(DB00801)|Halothane(DB01159)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Metharbital(DB00463)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Picrotoxin(DB00466)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Zaleplon(DB00962)|Zolpidem(DB00425)						103.0	115.0	111.0					5																	161324188		2203	4300	6503	SO:0001819	synonymous_variant	2554				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity	g.chr5:161324188T>C		CCDS4357.1	5q34	2012-06-22			ENSG00000022355	ENSG00000022355		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4075	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 1"""	137160				1330891	Standard	NM_000806		Approved	EJM5	uc003lyx.4	P14867	OTTHUMG00000163586	ENST00000428797.2:c.1131T>C	5.37:g.161324188T>C						GABRA1_uc010jix.2_Silent_p.P377P|GABRA1_uc010jiy.2_Silent_p.P377P|GABRA1_uc003lyx.3_Silent_p.P377P|GABRA1_uc010jiz.2_Silent_p.P377P|GABRA1_uc010jja.2_Silent_p.P377P|GABRA1_uc010jjb.2_Silent_p.P377P	p.P377P	NM_000806	NP_000797	P14867	GBRA1_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	11	1599	+	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	377			Cytoplasmic (Probable).		D3DQK6|Q8N629	Silent	SNP	ENST00000428797.2	37	c.1131T>C	CCDS4357.1																																																																																				0.453	GABRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252702.2	NM_000806.5		34	108	0	0	0	0.012213	0	34	108				
HK3	3101	broad.mit.edu	37	5	176308305	176308305	+	Silent	SNP	C	C	G			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr5:176308305C>G	ENST00000292432.5	-	18	2716	c.2625G>C	c.(2623-2625)ccG>ccC	p.P875P		NM_002115.2	NP_002106.2	P52790	HXK3_HUMAN	hexokinase 3 (white cell)	875	Catalytic.|Hexokinase type-2 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|hormone binding (GO:0042562)|mannokinase activity (GO:0019158)	p.P875P(2)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47	all_cancers(89;0.000104)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AGACTCACCGCGGGTGCAGCT	0.672																																							uc003mfa.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)|skin(1)	7						c.(2623-2625)CCG>CCC		hexokinase 3							76.0	86.0	83.0					5																	176308305		2203	4300	6503	SO:0001819	synonymous_variant	3101				glucose transport|glycolysis|transmembrane transport	cytosol|membrane	ATP binding|glucokinase activity	g.chr5:176308305C>G		CCDS4407.1	5q35.2	2008-02-05			ENSG00000160883	ENSG00000160883	2.7.1.1		4925	protein-coding gene	gene with protein product		142570				8812439	Standard	NM_002115		Approved		uc003mfa.3	P52790	OTTHUMG00000130855	ENST00000292432.5:c.2625G>C	5.37:g.176308305C>G						HK3_uc003mez.2_Silent_p.P431P	p.P875P	NM_002115	NP_002106	P52790	HXK3_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		18	2717	-	all_cancers(89;0.000104)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	875			Catalytic.		Q8N1E7	Silent	SNP	ENST00000292432.5	37	c.2625G>C	CCDS4407.1																																																																																				0.672	HK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253428.1			39	130	0	0	0	0.00361	0	39	130				
MAPK9	5601	broad.mit.edu	37	5	179666965	179666965	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr5:179666965G>A	ENST00000452135.2	-	10	1317	c.1019C>T	c.(1018-1020)gCc>gTc	p.A340V	MAPK9_ENST00000343111.6_Missense_Mutation_p.A340V|MAPK9_ENST00000393360.3_Missense_Mutation_p.A340V|MAPK9_ENST00000397072.3_3'UTR|MAPK9_ENST00000347470.4_Missense_Mutation_p.A255V|MAPK9_ENST00000524170.1_5'Flank|MAPK9_ENST00000455781.1_Missense_Mutation_p.A340V			P45984	MK09_HUMAN	mitogen-activated protein kinase 9	340					cellular response to growth factor stimulus (GO:0071363)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to UV (GO:0034644)|central nervous system development (GO:0007417)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neuron projection development (GO:0031175)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell morphogenesis involved in differentiation (GO:0010770)|positive regulation of chemokine production (GO:0032722)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of prostaglandin secretion (GO:0032308)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription, DNA-templated (GO:0045893)|protein targeting to mitochondrion (GO:0006626)|regulation of JNK cascade (GO:0046328)|regulation of protein ubiquitination (GO:0031396)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|release of cytochrome c from mitochondria (GO:0001836)|response to amine (GO:0014075)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to mechanical stimulus (GO:0009612)|response to stress (GO:0006950)|response to toxic substance (GO:0009636)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|JUN kinase activity (GO:0004705)|transcription factor binding (GO:0008134)	p.A340V(3)		central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(89;6.54e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0236)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TTCCAACTGGGCATCATAAAT	0.343																																							uc003mls.3		NA																	3	Substitution - Missense(3)		lung(3)	central_nervous_system(2)|upper_aerodigestive_tract(1)|large_intestine(1)	4						c.(1018-1020)GCC>GTC		mitogen-activated protein kinase 9 isoform JNK2							163.0	150.0	154.0					5																	179666965		2203	4300	6503	SO:0001583	missense	5601				innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of gene expression|positive regulation of macrophage derived foam cell differentiation|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|JUN kinase activity|protein binding|protein binding	g.chr5:179666965G>A	U09759	CCDS4453.1, CCDS4454.1, CCDS43409.1, CCDS43410.1, CCDS47356.1	5q35	2011-06-09			ENSG00000050748	ENSG00000050748	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6886	protein-coding gene	gene with protein product	"""Jun kinase"""	602896		PRKM9		8001819	Standard	NM_002752		Approved	JNK2, p54a, SAPK	uc003mls.4	P45984	OTTHUMG00000130934	ENST00000452135.2:c.1019C>T	5.37:g.179666965G>A	ENSP00000394560:p.Ala340Val					MAPK9_uc003mlt.3_Missense_Mutation_p.A340V|MAPK9_uc010jlc.2_Missense_Mutation_p.A340V|MAPK9_uc003mlv.3_Missense_Mutation_p.A340V	p.A340V	NM_002752	NP_002743	P45984	MK09_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		10	1290	-	all_cancers(89;6.54e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0236)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)	340					A8K0S3|B5BU66|B5M0B4|D3DWQ8|D3DWQ9|Q15708|Q15710|Q15711|Q8N5C5	Missense_Mutation	SNP	ENST00000452135.2	37	c.1019C>T	CCDS4453.1	.	.	.	.	.	.	.	.	.	.	G	16.02	3.003998	0.54254	.	.	ENSG00000050748	ENST00000452135;ENST00000393360;ENST00000455781;ENST00000343111;ENST00000347470	D;D;D;D;D	0.82344	-1.6;-1.6;-1.6;-1.6;-1.6	5.57	5.57	0.84162	Protein kinase-like domain (1);	0.124211	0.56097	D	0.000031	T	0.76926	0.4056	L	0.29908	0.895	0.80722	D	1	B;B;B;B	0.11235	0.002;0.004;0.004;0.001	B;B;B;B	0.06405	0.002;0.001;0.001;0.001	T	0.71764	-0.4494	10	0.54805	T	0.06	-13.4677	17.7387	0.88402	0.0:0.0:1.0:0.0	.	340;340;340;340	P45984-4;P45984-3;P45984-2;P45984	.;.;.;MK09_HUMAN	V	340;340;340;340;255	ENSP00000394560:A340V;ENSP00000377028:A340V;ENSP00000389338:A340V;ENSP00000345524:A340V;ENSP00000321410:A255V	ENSP00000345524:A340V	A	-	2	0	MAPK9	179599571	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.911000	0.69939	2.614000	0.88457	0.655000	0.94253	GCC		0.343	MAPK9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253530.3			25	76	0	0	0	0.009535	0	25	76				
FHL5	9457	broad.mit.edu	37	6	97053871	97053871	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr6:97053871T>A	ENST00000326771.2	+	5	808	c.428T>A	c.(427-429)aTc>aAc	p.I143N	FHL5_ENST00000541107.1_Missense_Mutation_p.I143N	NM_020482.4	NP_065228.4	Q5TD97	FHL5_HUMAN	four and a half LIM domains 5	143	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.I143N(1)		endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(2)|urinary_tract(1)	27		all_cancers(76;1.57e-07)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00266)|Colorectal(196;0.0341)|Lung NSC(302;0.204)		BRCA - Breast invasive adenocarcinoma(108;0.0948)		AAGCCTTTGATCTCCAAAGAG	0.413																																							uc003pos.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(427-429)ATC>AAC		activator of cAMP-responsive element modulator							110.0	99.0	103.0					6																	97053871		2203	4300	6503	SO:0001583	missense	9457					nucleus	zinc ion binding	g.chr6:97053871T>A	AF278541	CCDS5035.1	6q16.1-q16.3	2008-02-05			ENSG00000112214	ENSG00000112214			17371	protein-coding gene	gene with protein product		605126					Standard	NM_020482		Approved	FLJ33049, ACT, dJ393D12.2	uc003pot.2	Q5TD97	OTTHUMG00000015239	ENST00000326771.2:c.428T>A	6.37:g.97053871T>A	ENSP00000326022:p.Ile143Asn					FHL5_uc003pot.1_Missense_Mutation_p.I143N	p.I143N	NM_020482	NP_065228	Q5TD97	FHL5_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0948)	5	833	+		all_cancers(76;1.57e-07)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00266)|Colorectal(196;0.0341)|Lung NSC(302;0.204)	143			LIM zinc-binding 2.		B2RBD1|E1P526|Q5TD98|Q8WW21|Q9NQU2	Missense_Mutation	SNP	ENST00000326771.2	37	c.428T>A	CCDS5035.1	.	.	.	.	.	.	.	.	.	.	T	26.5	4.748070	0.89663	.	.	ENSG00000112214	ENST00000541107;ENST00000326771;ENST00000450218	D;D;D	0.87650	-2.28;-2.28;-2.28	6.06	6.06	0.98353	Zinc finger, LIM-type (4);	0.000000	0.46145	D	0.000310	D	0.92766	0.7700	M	0.82823	2.61	0.80722	D	1	D	0.69078	0.997	D	0.69142	0.962	D	0.93749	0.7057	10	0.87932	D	0	.	16.6245	0.84952	0.0:0.0:0.0:1.0	.	143	Q5TD97	FHL5_HUMAN	N	143	ENSP00000442357:I143N;ENSP00000326022:I143N;ENSP00000396390:I143N	ENSP00000326022:I143N	I	+	2	0	FHL5	97160592	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.994000	0.88315	2.323000	0.78572	0.528000	0.53228	ATC		0.413	FHL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041559.1	NM_020482		6	77	0	0	0	0.001984	0	6	77				
FOXO3	2309	broad.mit.edu	37	6	108985039	108985039	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr6:108985039G>A	ENST00000343882.6	+	3	1307	c.1003G>A	c.(1003-1005)Gaa>Aaa	p.E335K	FOXO3_ENST00000540898.1_Missense_Mutation_p.E115K|FOXO3_ENST00000406360.1_Missense_Mutation_p.E335K	NM_201559.2	NP_963853.1	O43524	FOXO3_HUMAN	forkhead box O3	335					antral ovarian follicle growth (GO:0001547)|cellular response to oxidative stress (GO:0034599)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|initiation of primordial ovarian follicle growth (GO:0001544)|innate immune response (GO:0045087)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oocyte maturation (GO:0001556)|ovulation from ovarian follicle (GO:0001542)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of translation (GO:0006417)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E335K(1)		central_nervous_system(5)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	26		all_cancers(87;1.78e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;3.88e-05)|Colorectal(196;0.0294)|all_lung(197;0.0487)|Lung SC(18;0.152)		Epithelial(106;0.000759)|all cancers(137;0.00121)|BRCA - Breast invasive adenocarcinoma(108;0.00163)|OV - Ovarian serous cystadenocarcinoma(136;0.00718)		AGAGTTGGATGAAGTCCAGGA	0.592																																							uc003psk.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(4)|lung(2)	6						c.(1003-1005)GAA>AAA		forkhead box O3A							68.0	58.0	61.0					6																	108985039		2203	4300	6503	SO:0001583	missense	2309				antral ovarian follicle growth|apoptosis|embryo development|glucose homeostasis|induction of apoptosis|initiation of primordial ovarian follicle growth|insulin receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|oocyte maturation|ovulation from ovarian follicle|pattern specification process|phosphatidylinositol-mediated signaling|positive regulation of erythrocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|regulation of cell proliferation|regulation of sequence-specific DNA binding transcription factor activity|tissue development	cytosol|transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein kinase binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription factor binding	g.chr6:108985039G>A	AF032886	CCDS5068.1	6q21	2008-09-08	2007-05-02	2007-05-02	ENSG00000118689	ENSG00000118689		"""Forkhead boxes"""	3821	protein-coding gene	gene with protein product		602681		FKHRL1, FOXO3A		9479491	Standard	NM_001455		Approved	AF6q21, FOXO2	uc003psm.2	O43524	OTTHUMG00000015327	ENST00000343882.6:c.1003G>A	6.37:g.108985039G>A	ENSP00000339527:p.Glu335Lys					FOXO3_uc003psn.2_Intron|FOXO3_uc003psm.2_Missense_Mutation_p.E335K|FOXO3_uc011ean.1_Missense_Mutation_p.E115K|FOXO3_uc010kdj.1_Missense_Mutation_p.E115K	p.E335K	NM_201559	NP_963853	O43524	FOXO3_HUMAN		Epithelial(106;0.000759)|all cancers(137;0.00121)|BRCA - Breast invasive adenocarcinoma(108;0.00163)|OV - Ovarian serous cystadenocarcinoma(136;0.00718)	3	1319	+		all_cancers(87;1.78e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;3.88e-05)|Colorectal(196;0.0294)|all_lung(197;0.0487)|Lung SC(18;0.152)	335					B4DVZ6|E1P5E6|O15171|Q5T2I7|Q9BZ04	Missense_Mutation	SNP	ENST00000343882.6	37	c.1003G>A	CCDS5068.1	.	.	.	.	.	.	.	.	.	.	G	17.91	3.504149	0.64410	.	.	ENSG00000118689	ENST00000343882;ENST00000406360;ENST00000540258;ENST00000540898	D;D	0.91295	-2.82;-2.82	5.71	5.71	0.89125	.	0.230310	0.51477	D	0.000095	D	0.88127	0.6353	M	0.65975	2.015	0.58432	D	0.999996	P	0.48694	0.914	B	0.40982	0.345	D	0.88949	0.3385	10	0.51188	T	0.08	-17.4653	19.8586	0.96775	0.0:0.0:1.0:0.0	.	335	O43524	FOXO3_HUMAN	K	335;335;115;115	ENSP00000339527:E335K;ENSP00000385824:E335K	ENSP00000339527:E335K	E	+	1	0	FOXO3	109091732	1.000000	0.71417	1.000000	0.80357	0.775000	0.43874	7.628000	0.83189	2.701000	0.92244	0.462000	0.41574	GAA		0.592	FOXO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041722.2			29	42	0	0	0	0.003271	0	29	42				
AMD1	262	broad.mit.edu	37	6	111214177	111214177	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr6:111214177A>T	ENST00000368885.3	+	8	1109	c.773A>T	c.(772-774)aAc>aTc	p.N258I	AMD1_ENST00000451850.2_Missense_Mutation_p.N138I|AMD1_ENST00000368877.5_Missense_Mutation_p.N229I|AMD1_ENST00000368882.3_Missense_Mutation_p.N110I|AMD1_ENST00000368876.1_Missense_Mutation_p.N189I	NM_001634.4	NP_001625.2	P17707	DCAM_HUMAN	adenosylmethionine decarboxylase 1	258					cellular nitrogen compound metabolic process (GO:0034641)|polyamine metabolic process (GO:0006595)|S-adenosylmethioninamine biosynthetic process (GO:0006557)|small molecule metabolic process (GO:0044281)|spermidine biosynthetic process (GO:0008295)|spermine biosynthetic process (GO:0006597)	cytosol (GO:0005829)	adenosylmethionine decarboxylase activity (GO:0004014)	p.N258I(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(2)	8		all_cancers(87;3.83e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0209)		OV - Ovarian serous cystadenocarcinoma(136;0.0522)|Epithelial(106;0.111)|all cancers(137;0.143)	S-Adenosylmethionine(DB00118)	TTTGAAACAAACTTAAGTCAG	0.363																																							uc003puk.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)	1						c.(772-774)AAC>ATC		adenosylmethionine decarboxylase 1 isoform 1	S-Adenosylmethionine(DB00118)						97.0	101.0	100.0					6																	111214177		2203	4300	6503	SO:0001583	missense	262				spermidine biosynthetic process|spermine biosynthetic process	cytosol	adenosylmethionine decarboxylase activity	g.chr6:111214177A>T	M88006	CCDS5086.1, CCDS75504.1, CCDS75505.1	6q21	2014-05-13			ENSG00000123505	ENSG00000123505	4.1.1.50		457	protein-coding gene	gene with protein product		180980	"""S-adenosylmethionine decarboxylase 1"""				Standard	NM_001634		Approved	SAMDC	uc003puk.1	P17707	OTTHUMG00000015369	ENST00000368885.3:c.773A>T	6.37:g.111214177A>T	ENSP00000357880:p.Asn258Ile					AMD1_uc011eay.1_Missense_Mutation_p.N189I|AMD1_uc011eaz.1_Missense_Mutation_p.N229I|AMD1_uc011eba.1_Missense_Mutation_p.N138I|AMD1_uc003pul.1_Missense_Mutation_p.N110I	p.N258I	NM_001634	NP_001625	P17707	DCAM_HUMAN		OV - Ovarian serous cystadenocarcinoma(136;0.0522)|Epithelial(106;0.111)|all cancers(137;0.143)	8	1095	+		all_cancers(87;3.83e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0209)	258					E1P5F7|Q5VXN4|Q5VXN6|Q9BWK4	Missense_Mutation	SNP	ENST00000368885.3	37	c.773A>T	CCDS5086.1	.	.	.	.	.	.	.	.	.	.	A	24.9	4.576928	0.86645	.	.	ENSG00000123505	ENST00000368885;ENST00000368882;ENST00000451850;ENST00000368877;ENST00000368876	.	.	.	5.25	5.25	0.73442	S-adenosylmethionine decarboxylase, core (2);	0.000000	0.85682	D	0.000000	D	0.83344	0.5234	M	0.92880	3.355	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.87906	0.2694	9	0.87932	D	0	.	15.4514	0.75277	1.0:0.0:0.0:0.0	.	138;229;258	B4DZ60;A6NNH3;P17707	.;.;DCAM_HUMAN	I	258;110;138;229;189	.	ENSP00000357870:N189I	N	+	2	0	AMD1	111320870	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.803000	0.91915	2.110000	0.64415	0.482000	0.46254	AAC		0.363	AMD1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041816.1			72	70	0	0	0	0.00361	0	72	70				
GPRC6A	222545	broad.mit.edu	37	6	117121759	117121759	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr6:117121759G>T	ENST00000310357.3	-	4	1557	c.1536C>A	c.(1534-1536)ttC>ttA	p.F512L	GPRC6A_ENST00000368549.3_Intron|GPRC6A_ENST00000530250.1_Missense_Mutation_p.F337L	NM_148963.2	NP_683766.2	Q5T6X5	GPC6A_HUMAN	G protein-coupled receptor, class C, group 6, member A	512					calcium-mediated signaling (GO:0019722)|response to amino acid (GO:0043200)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.F512L(1)		autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|liver(1)|lung(24)|ovary(5)|pancreas(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)	65		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)		TAAGATTCCTGAACTCATTTT	0.428																																							uc003pxj.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)	6						c.(1534-1536)TTC>TTA		G protein-coupled receptor, family C, group 6,							172.0	149.0	157.0					6																	117121759		2203	4300	6503	SO:0001583	missense	222545				response to amino acid stimulus		G-protein coupled receptor activity	g.chr6:117121759G>T	AF502962	CCDS5112.1, CCDS69184.1, CCDS69185.1	6q22.31	2014-01-30	2014-01-30		ENSG00000173612	ENSG00000173612		"""GPCR / Class C : Calcium-sensing receptors"""	18510	protein-coding gene	gene with protein product			"""G protein-coupled receptor, family C, group 6, member A"""				Standard	NM_001286354		Approved	bA86F4.3	uc003pxj.1	Q5T6X5	OTTHUMG00000015447	ENST00000310357.3:c.1536C>A	6.37:g.117121759G>T	ENSP00000309493:p.Phe512Leu					GPRC6A_uc003pxk.1_Missense_Mutation_p.F337L|GPRC6A_uc003pxl.1_Intron	p.F512L	NM_148963	NP_683766	Q5T6X5	GPC6A_HUMAN		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)	4	1558	-		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)	512			Extracellular (Potential).		Q6JK43|Q6JK44|Q8NGU8|Q8NHZ9|Q8TDT6	Missense_Mutation	SNP	ENST00000310357.3	37	c.1536C>A	CCDS5112.1	.	.	.	.	.	.	.	.	.	.	G	5.337	0.247529	0.10130	.	.	ENSG00000173612	ENST00000310357;ENST00000530250	D;D	0.90563	-2.49;-2.69	5.35	4.49	0.54785	.	0.000000	0.56097	D	0.000036	T	0.61813	0.2377	N	0.08118	0	0.35297	D	0.782723	B;B	0.10296	0.003;0.0	B;B	0.12837	0.008;0.001	T	0.53208	-0.8471	10	0.08381	T	0.77	.	8.6746	0.34172	0.2127:0.0:0.7873:0.0	.	337;512	Q5T6X5-2;Q5T6X5	.;GPC6A_HUMAN	L	512;337	ENSP00000309493:F512L;ENSP00000433465:F337L	ENSP00000309493:F512L	F	-	3	2	GPRC6A	117228452	1.000000	0.71417	0.999000	0.59377	0.257000	0.26127	2.556000	0.45862	1.498000	0.48600	0.585000	0.79938	TTC		0.428	GPRC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041966.2			45	42	1	0	4.01344e-20	0.00361	5.76734e-20	45	42				
THEMIS	387357	broad.mit.edu	37	6	128134393	128134393	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr6:128134393C>A	ENST00000368248.2	-	4	1541	c.1393G>T	c.(1393-1395)Gat>Tat	p.D465Y	THEMIS_ENST00000537166.1_Missense_Mutation_p.D430Y|THEMIS_ENST00000543064.1_Missense_Mutation_p.D465Y|THEMIS_ENST00000368250.1_Missense_Mutation_p.D386Y	NM_001010923.2	NP_001010923.1	Q8N1K5	THMS1_HUMAN	thymocyte selection associated	465	CABIT 2.				negative T cell selection (GO:0043383)|positive T cell selection (GO:0043368)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.D465Y(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(3)	60						ATGGAAAGATCCCTGACAGAC	0.468																																							uc003qbi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)	4						c.(1393-1395)GAT>TAT		thymocyte selection pathway associated isoform							80.0	81.0	81.0					6																	128134393		2203	4300	6503	SO:0001583	missense	387357				negative T cell selection|positive T cell selection|T cell receptor signaling pathway	cytoplasm|nucleus		g.chr6:128134393C>A	AK094863	CCDS34534.1, CCDS55055.1	6q22.33	2012-02-08	2009-06-25	2009-06-25	ENSG00000172673	ENSG00000172673			21569	protein-coding gene	gene with protein product	"""thymocyte expressed molecule involved in selection"""	613607	"""chromosome 6 open reading frame 207"", ""chromosome 6 open reading frame 190"", ""thymocyte selection pathway associated"""	C6orf207, C6orf190, TSEPA		19597499, 19597498, 19597497	Standard	NM_001010923		Approved	bA325O24.4, FLJ40584, bA325O24.3	uc011ebt.2	Q8N1K5	OTTHUMG00000015534	ENST00000368248.2:c.1393G>T	6.37:g.128134393C>A	ENSP00000357231:p.Asp465Tyr					THEMIS_uc010kfa.2_Missense_Mutation_p.D368Y|THEMIS_uc011ebt.1_Missense_Mutation_p.D465Y|THEMIS_uc010kfb.2_Missense_Mutation_p.D430Y	p.D465Y	NM_001010923	NP_001010923	Q8N1K5	THMS1_HUMAN			5	1712	-			465			CABIT 2.		A1L4F0|A8K7N1|B3KT31|B3KW32|B3KY07|F5H1J9|Q5T3C4|Q5T3C5|Q6MZT7	Missense_Mutation	SNP	ENST00000368248.2	37	c.1393G>T	CCDS34534.1	.	.	.	.	.	.	.	.	.	.	C	17.33	3.363448	0.61513	.	.	ENSG00000172673	ENST00000368250;ENST00000543064;ENST00000368248;ENST00000537166	T;T;T;T	0.17054	2.3;2.3;2.3;2.3	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.42154	0.1190	M	0.83603	2.65	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.43032	-0.9416	10	0.87932	D	0	-24.119	19.8145	0.96560	0.0:1.0:0.0:0.0	.	465;465	F5H1J9;Q8N1K5	.;THMS1_HUMAN	Y	386;465;465;430	ENSP00000357233:D386Y;ENSP00000439594:D465Y;ENSP00000357231:D465Y;ENSP00000439863:D430Y	ENSP00000357231:D465Y	D	-	1	0	THEMIS	128176086	1.000000	0.71417	1.000000	0.80357	0.713000	0.41058	6.223000	0.72257	2.683000	0.91414	0.563000	0.77884	GAT		0.468	THEMIS-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_001010923		31	58	1	0	4.34311e-12	0.003271	5.41035e-12	31	58				
SLC29A4	222962	broad.mit.edu	37	7	5327485	5327485	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr7:5327485G>T	ENST00000396872.3	+	2	199	c.38G>T	c.(37-39)aGc>aTc	p.S13I	SLC29A4_ENST00000297195.4_Missense_Mutation_p.S13I|SLC29A4_ENST00000406453.3_Missense_Mutation_p.S13I			Q7RTT9	S29A4_HUMAN	solute carrier family 29 (equilibrative nucleoside transporter), member 4	13					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nucleoside transmembrane transporter activity (GO:0005337)	p.S13I(1)		breast(1)|cervix(2)|kidney(7)|large_intestine(1)|liver(1)|lung(7)|urinary_tract(1)	20		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0903)|OV - Ovarian serous cystadenocarcinoma(56;2.65e-15)	Metformin(DB00331)	GAGGAGCCCAGCGTGGCAGGC	0.652																																							uc003sod.2		NA																	1	Substitution - Missense(1)		lung(1)	liver(1)	1						c.(37-39)AGC>ATC		solute carrier family 29 (nucleoside							22.0	23.0	23.0					7																	5327485		2203	4298	6501	SO:0001583	missense	222962				nucleobase, nucleoside and nucleotide metabolic process	apical plasma membrane|integral to membrane	nucleoside transmembrane transporter activity	g.chr7:5327485G>T	AK075422	CCDS5340.1, CCDS75561.1	7p22.2	2013-07-17	2013-07-17		ENSG00000164638	ENSG00000164638		"""Solute carriers"""	23097	protein-coding gene	gene with protein product		609149	"""solute carrier family 29 (nucleoside transporters), member 4"""			12838422	Standard	NM_153247		Approved	FLJ34923, ENT4	uc003soc.3	Q7RTT9	OTTHUMG00000023797	ENST00000396872.3:c.38G>T	7.37:g.5327485G>T	ENSP00000380081:p.Ser13Ile					SLC29A4_uc011jwg.1_RNA|SLC29A4_uc003soc.2_Missense_Mutation_p.S13I|SLC29A4_uc003soe.2_Missense_Mutation_p.S13I	p.S13I	NM_153247	NP_694979	Q7RTT9	S29A4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.0903)|OV - Ovarian serous cystadenocarcinoma(56;2.65e-15)	2	199	+		Ovarian(82;0.0175)	13			Extracellular (Potential).		Q6PJ08|Q86WY8|Q8NAR3|Q8NBM2	Missense_Mutation	SNP	ENST00000396872.3	37	c.38G>T	CCDS5340.1	.	.	.	.	.	.	.	.	.	.	G	11.58	1.680740	0.29872	.	.	ENSG00000164638	ENST00000434816;ENST00000396872;ENST00000444741;ENST00000297195;ENST00000406453	T;T;T;T;T	0.48836	0.8;0.8;0.8;0.8;0.8	3.91	3.91	0.45181	.	0.380544	0.26082	N	0.026456	T	0.47893	0.1470	L	0.57536	1.79	0.21105	N	0.999787	P;P	0.45474	0.859;0.664	B;B	0.43274	0.414;0.117	T	0.50197	-0.8856	10	0.66056	D	0.02	-15.5351	14.0859	0.64957	0.0:0.0:1.0:0.0	.	13;13	Q7RTT9-2;Q7RTT9	.;S29A4_HUMAN	I	13	ENSP00000406803:S13I;ENSP00000380081:S13I;ENSP00000413271:S13I;ENSP00000297195:S13I;ENSP00000385845:S13I	ENSP00000297195:S13I	S	+	2	0	SLC29A4	5294011	0.960000	0.32886	0.140000	0.22221	0.571000	0.35966	1.931000	0.40134	1.733000	0.51620	0.491000	0.48974	AGC		0.652	SLC29A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060118.6	NM_153247		14	37	1	0	4.7546e-09	0.004007	5.61628e-09	14	37				
RNF216	54476	broad.mit.edu	37	7	5800722	5800722	+	De_novo_Start_InFrame	SNP	T	T	C			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr7:5800722T>C	ENST00000425013.2	-	0	203				RNF216_ENST00000389902.3_De_novo_Start_InFrame	NM_207111.3|NM_207116.2	NP_996994.1|NP_996999.1	Q9NWF9	RN216_HUMAN	ring finger protein 216						apoptotic process (GO:0006915)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|regulation of defense response to virus by host (GO:0050691)|regulation of interferon-beta production (GO:0032648)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)		FBXL18/RNF216(2)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)|skin(1)|urinary_tract(4)	33		Ovarian(82;0.07)		UCEC - Uterine corpus endometrioid carcinoma (126;0.135)|OV - Ovarian serous cystadenocarcinoma(56;2.69e-13)		GACATGCATATATGGGACTGC	0.383																																							uc003soy.1		NA																	0				ovary(3)|breast(2)	5						c.(-23--19)ATATA>ATGTA		ring finger protein 216 isoform b							161.0	135.0	144.0					7																	5800722		2203	4300	6503			54476				apoptosis|interspecies interaction between organisms|proteasomal ubiquitin-dependent protein catabolic process|protein K48-linked ubiquitination|regulation of defense response to virus by host|regulation of interferon-beta production	cytoplasm|nucleus|nucleus	ligase activity|protein binding|protein binding|zinc ion binding	g.chr7:5800722T>C	AY062174	CCDS34594.1, CCDS34595.1	7p22.1	2014-02-12	2007-08-20		ENSG00000011275	ENSG00000011275		"""RING-type (C3HC4) zinc fingers"""	21698	protein-coding gene	gene with protein product		609948					Standard	NM_207111		Approved	TRIAD3, UBCE7IP1, ZIN	uc003sox.2	Q9NWF9	OTTHUMG00000155500		7.37:g.5800722T>C						RNF216_uc010ksz.1_Translation_Start_Site|RNF216_uc010kta.1_Translation_Start_Site|RNF216_uc011jwj.1_Translation_Start_Site|RNF216_uc003sox.1_Translation_Start_Site		NM_207116	NP_996999	Q9NWF9	RN216_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.135)|OV - Ovarian serous cystadenocarcinoma(56;2.69e-13)	2	169	-		Ovarian(82;0.07)						Q6Y691|Q75ML7|Q7Z2H7|Q7Z7C1|Q8NHW7|Q9NYT1	Translation_Start_Site	SNP	ENST00000425013.2	37	c.-21A>G	CCDS34595.1																																																																																				0.383	RNF216-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000340374.1	NM_207111		21	61	0	0	0	0.002299	0	21	61				
CBX3	11335	broad.mit.edu	37	7	26248069	26248069	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr7:26248069C>T	ENST00000337620.4	+	4	652	c.224C>T	c.(223-225)gCg>gTg	p.A75V	CBX3_ENST00000396386.2_Missense_Mutation_p.A75V|CBX3_ENST00000497498.1_3'UTR|CBX3_ENST00000409747.1_Intron	NM_007276.4	NP_009207.2	Q13185	CBX3_HUMAN	chromobox homolog 3	75	Chromo 1. {ECO:0000255|PROSITE- ProRule:PRU00053}.				chromatin remodeling (GO:0006338)|negative regulation of transcription, DNA-templated (GO:0045892)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|condensed chromosome, centromeric region (GO:0000779)|nuclear envelope (GO:0005635)|nuclear euchromatin (GO:0005719)|nuclear heterochromatin (GO:0005720)|nuclear inner membrane (GO:0005637)|nuclear pericentric heterochromatin (GO:0031618)|nucleus (GO:0005634)|spindle (GO:0005819)	enzyme binding (GO:0019899)|histone methyltransferase binding (GO:1990226)|identical protein binding (GO:0042802)|protein domain specific binding (GO:0019904)	p.A75V(1)		endometrium(4)|large_intestine(2)|lung(2)|ovary(1)	9						TTGATTGAAGCGTTTCTTAAC	0.308																																							uc003sxt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(223-225)GCG>GTG		chromobox homolog 3							54.0	61.0	59.0					7																	26248069		2201	4299	6500	SO:0001583	missense	11335				chromatin remodeling|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	condensed chromosome, centromeric region|nuclear centromeric heterochromatin|nuclear euchromatin|nuclear inner membrane|spindle	enzyme binding|protein domain specific binding	g.chr7:26248069C>T	U26312	CCDS5398.1	7p15.2	2010-07-06	2010-06-24		ENSG00000122565	ENSG00000122565			1553	protein-coding gene	gene with protein product	"""HP1 gamma homolog (Drosophila)"""	604477	"""chromobox homolog 3 (Drosophila HP1 gamma)"""			8663349	Standard	NM_016587		Approved	HP1Hs-gamma	uc003sxu.3	Q13185	OTTHUMG00000022911	ENST00000337620.4:c.224C>T	7.37:g.26248069C>T	ENSP00000336687:p.Ala75Val					CBX3_uc003sxu.2_Missense_Mutation_p.A75V|CBX3_uc003sxv.2_Intron	p.A75V	NM_007276	NP_009207	Q13185	CBX3_HUMAN			4	335	+			75			Chromo 1.		Q96CD7|Q99409|Q9BVS3|Q9P0Z6	Missense_Mutation	SNP	ENST00000337620.4	37	c.224C>T	CCDS5398.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409835	0.83340	.	.	ENSG00000122565	ENST00000337620;ENST00000396386	T;T	0.74315	-0.83;-0.83	5.35	5.35	0.76521	Chromo domain (1);Chromo domain-like (1);Chromo domain/shadow (2);	0.000000	0.85682	D	0.000000	T	0.81059	0.4744	M	0.89601	3.045	0.80722	D	1	P	0.39696	0.683	B	0.38428	0.273	D	0.84119	0.0405	10	0.49607	T	0.09	.	19.424	0.94734	0.0:1.0:0.0:0.0	.	75	Q13185	CBX3_HUMAN	V	75	ENSP00000336687:A75V;ENSP00000379670:A75V	ENSP00000336687:A75V	A	+	2	0	CBX3	26214594	0.997000	0.39634	1.000000	0.80357	0.994000	0.84299	3.501000	0.53325	2.661000	0.90470	0.655000	0.94253	GCG		0.308	CBX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214117.1	NM_007276		19	77	0	0	0	0.006122	0	19	77				
INHBA	3624	broad.mit.edu	37	7	41730009	41730009	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr7:41730009G>T	ENST00000242208.4	-	3	766	c.520C>A	c.(520-522)Cgc>Agc	p.R174S	INHBA_ENST00000442711.1_Missense_Mutation_p.R174S|INHBA_ENST00000464515.1_5'UTR|AC005027.3_ENST00000416150.1_RNA	NM_002192.2	NP_002183.1	P08476	INHBA_HUMAN	inhibin, beta A	174					activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|defense response (GO:0006952)|endodermal cell differentiation (GO:0035987)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|eyelid development in camera-type eye (GO:0061029)|G1/S transition of mitotic cell cycle (GO:0000082)|growth (GO:0040007)|hair follicle development (GO:0001942)|hematopoietic progenitor cell differentiation (GO:0002244)|hemoglobin biosynthetic process (GO:0042541)|male gonad development (GO:0008584)|mesodermal cell differentiation (GO:0048333)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of phosphorylation (GO:0042326)|nervous system development (GO:0007399)|odontogenesis (GO:0042476)|ovarian follicle development (GO:0001541)|palate development (GO:0060021)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of ovulation (GO:0060279)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of follicle-stimulating hormone secretion (GO:0046880)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)	activin A complex (GO:0043509)|extracellular region (GO:0005576)|inhibin A complex (GO:0043512)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|peptide hormone binding (GO:0017046)|type II activin receptor binding (GO:0070699)	p.R174S(1)		biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(15)|lung(26)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						TGGAAGAGGCGGATGGTGACT	0.582										TSP Lung(11;0.080)																													uc003thq.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(5)|ovary(1)	6						c.(520-522)CGC>AGC		inhibin beta A precursor							106.0	99.0	101.0					7																	41730009		2203	4300	6503	SO:0001583	missense	3624				cell cycle arrest|cell surface receptor linked signaling pathway|defense response|erythrocyte differentiation|eyelid development in camera-type eye|G1/S transition of mitotic cell cycle|growth|hair follicle development|hemoglobin biosynthetic process|hemopoietic progenitor cell differentiation|induction of apoptosis|male gonad development|negative regulation of B cell differentiation|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of follicle-stimulating hormone secretion|negative regulation of interferon-gamma biosynthetic process|negative regulation of macrophage differentiation|negative regulation of phosphorylation|nervous system development|odontogenesis|ovarian follicle development|palate development|positive regulation of erythrocyte differentiation|positive regulation of follicle-stimulating hormone secretion|positive regulation of ovulation|positive regulation of transcription from RNA polymerase II promoter|progesterone secretion|regulation of activin receptor signaling pathway	activin A complex|inhibin A complex	cytokine activity|follistatin binding|growth factor activity|hormone activity|identical protein binding|signal transducer activity	g.chr7:41730009G>T		CCDS5464.1	7p15-p13	2014-01-30	2007-07-30		ENSG00000122641	ENSG00000122641		"""Endogenous ligands"""	6066	protein-coding gene	gene with protein product		147290	"""inhibin, beta A (activin A, activin AB alpha polypeptide)"""			3345731	Standard	NM_002192		Approved		uc003thr.3	P08476	OTTHUMG00000023574	ENST00000242208.4:c.520C>A	7.37:g.41730009G>T	ENSP00000242208:p.Arg174Ser	TSP Lung(11;0.080)				INHBA_uc003thr.2_Missense_Mutation_p.R174S	p.R174S	NM_002192	NP_002183	P08476	INHBA_HUMAN			2	755	-			174					Q14599	Missense_Mutation	SNP	ENST00000242208.4	37	c.520C>A	CCDS5464.1	.	.	.	.	.	.	.	.	.	.	.	29.5	5.011962	0.93346	.	.	ENSG00000122641	ENST00000242208;ENST00000442711	T;T	0.63096	-0.02;-0.02	6.06	5.16	0.70880	Transforming growth factor-beta, N-terminal (1);	0.454650	0.25720	N	0.028753	T	0.77711	0.4171	M	0.67397	2.05	0.53688	D	0.999974	D	0.69078	0.997	D	0.75020	0.985	T	0.80171	-0.1493	10	0.66056	D	0.02	-7.4977	16.6144	0.84903	0.0:0.0:0.8689:0.1311	.	174	P08476	INHBA_HUMAN	S	174	ENSP00000242208:R174S;ENSP00000397197:R174S	ENSP00000242208:R174S	R	-	1	0	INHBA	41696534	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	6.249000	0.72427	1.524000	0.49035	0.655000	0.94253	CGC		0.582	INHBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250793.1			38	101	1	0	1.48734e-19	0.013114	2.12062e-19	38	101				
ZNF716	441234	broad.mit.edu	37	7	57529433	57529433	+	Silent	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr7:57529433C>A	ENST00000420713.1	+	4	1378	c.1266C>A	c.(1264-1266)acC>acA	p.T422T		NM_001159279.1	NP_001152751.1	A6NP11	ZN716_HUMAN	zinc finger protein 716	422					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T422T(2)		breast(1)|kidney(1)|lung(20)|ovary(2)	24						GCTCCTCAACCCTTAAGAAAC	0.383																																							uc011kdi.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)	2						c.(1264-1266)ACC>ACA		zinc finger protein 716							25.0	26.0	26.0					7																	57529433		692	1591	2283	SO:0001819	synonymous_variant	441234							g.chr7:57529433C>A	AK131575	CCDS55112.1	7p11.1	2013-01-08			ENSG00000182111	ENSG00000182111		"""Zinc fingers, C2H2-type"", ""-"""	32458	protein-coding gene	gene with protein product							Standard	NM_001159279		Approved	FLJ46189	uc011kdi.1	A6NP11	OTTHUMG00000156689	ENST00000420713.1:c.1266C>A	7.37:g.57529433C>A							p.T422T	NM_001159279	NP_001152751					4	1378	+									Silent	SNP	ENST00000420713.1	37	c.1266C>A	CCDS55112.1																																																																																				0.383	ZNF716-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345309.1	NM_001159279		5	36	1	0	2.0095e-06	0.001984	2.20924e-06	5	36				
SEMA3A	10371	broad.mit.edu	37	7	83610721	83610721	+	Missense_Mutation	SNP	G	G	C	rs377259138	byFrequency	TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr7:83610721G>C	ENST00000265362.4	-	14	1882	c.1568C>G	c.(1567-1569)gCg>gGg	p.A523G	SEMA3A_ENST00000436949.1_Missense_Mutation_p.A523G	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	523					apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)	p.A523G(1)		breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						CTCAGCACACGCTTTCCCGTA	0.483																																							uc003uhz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(1)|kidney(1)	4						c.(1567-1569)GCG>GGG		semaphorin 3A precursor							79.0	73.0	75.0					7																	83610721		2203	4300	6503	SO:0001583	missense	10371				axon guidance	extracellular region|membrane	receptor activity	g.chr7:83610721G>C	L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.1568C>G	7.37:g.83610721G>C	ENSP00000265362:p.Ala523Gly						p.A523G	NM_006080	NP_006071	Q14563	SEM3A_HUMAN			14	1883	-			523						Missense_Mutation	SNP	ENST00000265362.4	37	c.1568C>G	CCDS5599.1	.	.	.	.	.	.	.	.	.	.	G	32	5.154399	0.94686	.	.	ENSG00000075213	ENST00000265362;ENST00000436949	T;T	0.31247	1.5;1.5	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.60996	0.2312	M	0.79693	2.465	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.63563	-0.6609	10	0.66056	D	0.02	.	19.8579	0.96771	0.0:0.0:1.0:0.0	.	523	Q14563	SEM3A_HUMAN	G	523	ENSP00000265362:A523G;ENSP00000415260:A523G	ENSP00000265362:A523G	A	-	2	0	SEMA3A	83448657	1.000000	0.71417	1.000000	0.80357	0.791000	0.44710	9.807000	0.99171	2.687000	0.91594	0.655000	0.94253	GCG		0.483	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253355.2	NM_006080		11	20	0	0	0	0.001855	0	11	20				
MYL10	93408	broad.mit.edu	37	7	101267507	101267507	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr7:101267507G>T	ENST00000223167.4	-	2	293	c.116C>A	c.(115-117)gCc>gAc	p.A39D		NM_138403.4	NP_612412.2	Q9BUA6	MYL10_HUMAN	myosin, light chain 10, regulatory	39						mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)	p.A39D(1)		breast(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)	12						GTTGGAGCTGGCGGTGCCTTC	0.587																																					Esophageal Squamous(24;575 709 17516 40384 51639)	Esophageal Squamous(24;575 709 17516 40384 51639)	uc003uyr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(115-117)GCC>GAC		myosin, light chain 10, regulatory							129.0	126.0	127.0					7																	101267507		2203	4300	6503	SO:0001583	missense	93408					mitochondrion	calcium ion binding	g.chr7:101267507G>T	BC002778	CCDS34713.1	7q22.1	2013-01-10			ENSG00000106436	ENSG00000106436		"""Myosins / Light chain"", ""EF-hand domain containing"""	29825	protein-coding gene	gene with protein product						1628631	Standard	NM_138403		Approved	MGC3479, MYLC2PL, PLRLC	uc003uyr.3	Q9BUA6	OTTHUMG00000157137	ENST00000223167.4:c.116C>A	7.37:g.101267507G>T	ENSP00000223167:p.Ala39Asp						p.A39D	NM_138403	NP_612412	Q9BUA6	MYL10_HUMAN			2	294	-			39						Missense_Mutation	SNP	ENST00000223167.4	37	c.116C>A	CCDS34713.1	.	.	.	.	.	.	.	.	.	.	G	16.85	3.237425	0.58886	.	.	ENSG00000106436	ENST00000223167	T	0.75367	-0.93	4.85	4.85	0.62838	.	0.079487	0.48286	D	0.000192	D	0.83626	0.5295	M	0.71581	2.175	0.44966	D	0.997988	D	0.63046	0.992	P	0.61477	0.889	D	0.85936	0.1455	10	0.87932	D	0	.	15.8241	0.78683	0.0:0.0:1.0:0.0	.	39	Q9BUA6	MYL10_HUMAN	D	39	ENSP00000223167:A39D	ENSP00000223167:A39D	A	-	2	0	MYL10	101054227	1.000000	0.71417	1.000000	0.80357	0.316000	0.28119	5.072000	0.64389	2.409000	0.81822	0.655000	0.94253	GCC		0.587	MYL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347575.1	NM_138403		35	82	1	0	1.32136e-16	0.00874	1.79292e-16	35	82				
NAMPT	10135	broad.mit.edu	37	7	105903983	105903983	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr7:105903983G>T	ENST00000222553.3	-	7	1131	c.824C>A	c.(823-825)tCt>tAt	p.S275Y	NAMPT_ENST00000354289.4_Missense_Mutation_p.S275Y	NM_005746.2	NP_005737.1	P43490	NAMPT_HUMAN	nicotinamide phosphoribosyltransferase	275					cell-cell signaling (GO:0007267)|circadian regulation of gene expression (GO:0032922)|NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|nicotinamide metabolic process (GO:0006769)|positive regulation of cell proliferation (GO:0008284)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|nicotinamide phosphoribosyltransferase activity (GO:0047280)|nicotinate-nucleotide diphosphorylase (carboxylating) activity (GO:0004514)	p.S275Y(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	14						GCTGACCACAGATACAGGCAC	0.363																																							uc003vdq.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(823-825)TCT>TAT		nicotinamide phosphoribosyltransferase							124.0	118.0	120.0					7																	105903983		2203	4300	6503	SO:0001583	missense	10135				cell-cell signaling|NAD biosynthetic process|nicotinamide metabolic process|positive regulation of cell proliferation|positive regulation of nitric-oxide synthase biosynthetic process|signal transduction|water-soluble vitamin metabolic process	cytosol	cytokine activity|nicotinamide phosphoribosyltransferase activity|nicotinate phosphoribosyltransferase activity|nicotinate-nucleotide diphosphorylase (carboxylating) activity	g.chr7:105903983G>T	U02020	CCDS5737.1	7q22.3	2012-10-02	2008-03-27	2008-03-27	ENSG00000105835	ENSG00000105835			30092	protein-coding gene	gene with protein product	"""visfatin"""	608764	"""pre-B-cell colony enhancing factor 1"""	PBEF1		8289818	Standard	NM_005746		Approved	PBEF	uc003vdq.3	P43490	OTTHUMG00000140388	ENST00000222553.3:c.824C>A	7.37:g.105903983G>T	ENSP00000222553:p.Ser275Tyr					NAMPT_uc003vdr.1_Missense_Mutation_p.S275Y|NAMPT_uc011klu.1_Missense_Mutation_p.S188Y	p.S275Y	NM_005746	NP_005737	P43490	NAMPT_HUMAN			7	1132	-			275					A4D0Q9|A4D0R0|Q3KQV0|Q8WW95	Missense_Mutation	SNP	ENST00000222553.3	37	c.824C>A	CCDS5737.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.667781	0.88348	.	.	ENSG00000105835	ENST00000222553;ENST00000354289	.	.	.	5.54	5.54	0.83059	Quinolinate phosphoribosyl transferase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.85978	0.5823	M	0.90483	3.12	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.993;0.996;0.992	D	0.87786	0.2615	9	0.66056	D	0.02	-18.667	19.8379	0.96666	0.0:0.0:1.0:0.0	.	188;256;275	B7Z8W6;Q5SYT8;P43490	.;.;NAMPT_HUMAN	Y	275	.	ENSP00000222553:S275Y	S	-	2	0	NAMPT	105691219	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.420000	0.97426	2.765000	0.95021	0.655000	0.94253	TCT		0.363	NAMPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277146.1	NM_182790		19	79	1	0	1.2644e-06	0.010504	1.41567e-06	19	79				
CTTNBP2	83992	broad.mit.edu	37	7	117417645	117417645	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr7:117417645C>A	ENST00000160373.3	-	8	2789	c.2698G>T	c.(2698-2700)Gtt>Ttt	p.V900F		NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	900					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)		p.V900F(1)		breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		GCAGGAACAACAGGCTTGGAT	0.493																																							uc003vjf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(1)	5						c.(2698-2700)GTT>TTT		cortactin binding protein 2							140.0	123.0	129.0					7																	117417645		2203	4300	6503	SO:0001583	missense	83992							g.chr7:117417645C>A		CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.2698G>T	7.37:g.117417645C>A	ENSP00000160373:p.Val900Phe						p.V900F	NM_033427	NP_219499	Q8WZ74	CTTB2_HUMAN		LUSC - Lung squamous cell carcinoma(290;0.133)	8	2790	-	Lung NSC(10;0.0018)|all_lung(10;0.002)		900					O43389|Q7LG11|Q9C0A5	Missense_Mutation	SNP	ENST00000160373.3	37	c.2698G>T	CCDS5774.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.92|12.92	2.082715|2.082715	0.36758|0.36758	.|.	.|.	ENSG00000077063|ENSG00000077063	ENST00000446636|ENST00000160373	.|T	.|0.67865	.|-0.29	5.63|5.63	2.77|2.77	0.32553|0.32553	.|Ankyrin repeat-containing domain (1);	.|0.319926	.|0.33553	.|N	.|0.004785	T|T	0.60327|0.60327	0.2260|0.2260	L|L	0.43152|0.43152	1.355|1.355	0.30120|0.30120	N|N	0.805797|0.805797	.|P	.|0.49253	.|0.921	.|P	.|0.48524	.|0.58	T|T	0.61043|0.61043	-0.7142|-0.7142	5|10	.|0.66056	.|D	.|0.02	4.1353|4.1353	5.699|5.699	0.17871|0.17871	0.1361:0.6008:0.0:0.2631|0.1361:0.6008:0.0:0.2631	.|.	.|900	.|Q8WZ74	.|CTTB2_HUMAN	F|F	387|900	.|ENSP00000160373:V900F	.|ENSP00000160373:V900F	C|V	-|-	2|1	0|0	CTTNBP2|CTTNBP2	117204881|117204881	0.985000|0.985000	0.35326|0.35326	0.901000|0.901000	0.35422|0.35422	0.072000|0.072000	0.16883|0.16883	1.065000|1.065000	0.30592|0.30592	0.814000|0.814000	0.34374|0.34374	0.650000|0.650000	0.86243|0.86243	TGT|GTT		0.493	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059201.4	NM_033427		17	60	1	0	1.96292e-10	0.010504	2.3568e-10	17	60				
PDIA4	9601	broad.mit.edu	37	7	148709033	148709033	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr7:148709033T>A	ENST00000286091.4	-	6	1116	c.884A>T	c.(883-885)cAg>cTg	p.Q295L		NM_004911.4	NP_004902.1	P13667	PDIA4_HUMAN	protein disulfide isomerase family A, member 4	295	Thioredoxin 2. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein secretion (GO:0009306)|response to endoplasmic reticulum stress (GO:0034976)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)	poly(A) RNA binding (GO:0044822)|protein disulfide isomerase activity (GO:0003756)	p.Q295L(1)		large_intestine(6)|lung(15)|ovary(2)|prostate(1)	24	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00385)			CTCCTGGACCTGCTTCAGGGT	0.572																																							uc003wff.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(5)|ovary(1)	6						c.(883-885)CAG>CTG		protein disulfide isomerase A4 precursor							96.0	88.0	91.0					7																	148709033		2203	4300	6503	SO:0001583	missense	9601				cell redox homeostasis|glycerol ether metabolic process|protein secretion	endoplasmic reticulum lumen|melanosome	electron carrier activity|protein binding|protein disulfide isomerase activity|protein disulfide oxidoreductase activity	g.chr7:148709033T>A	BC001928	CCDS5893.1	7q35	2009-11-20	2005-06-29		ENSG00000155660	ENSG00000155660	5.3.4.1	"""Protein disulfide isomerases"""	30167	protein-coding gene	gene with protein product			"""protein disulfide isomerase-associated 4"""			2549034, 2002068	Standard	NM_004911		Approved	ERP70, ERP72	uc003wff.2	P13667	OTTHUMG00000150248	ENST00000286091.4:c.884A>T	7.37:g.148709033T>A	ENSP00000286091:p.Gln295Leu						p.Q295L	NM_004911	NP_004902	P13667	PDIA4_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00385)		6	1166	-	Melanoma(164;0.15)		295			Thioredoxin 2.		A8K4K6|Q549T6	Missense_Mutation	SNP	ENST00000286091.4	37	c.884A>T	CCDS5893.1	.	.	.	.	.	.	.	.	.	.	t	21.0	4.083463	0.76642	.	.	ENSG00000155660	ENST00000286091	T	0.77877	-1.13	5.14	5.14	0.70334	Thioredoxin-like fold (3);	0.102562	0.64402	D	0.000002	T	0.68329	0.2989	L	0.33339	1.005	0.80722	D	1	D	0.57899	0.981	B	0.40228	0.323	T	0.73739	-0.3888	10	0.59425	D	0.04	.	15.0432	0.71807	0.0:0.0:0.0:1.0	.	295	P13667	PDIA4_HUMAN	L	295	ENSP00000286091:Q295L	ENSP00000286091:Q295L	Q	-	2	0	PDIA4	148339966	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	7.506000	0.81665	1.962000	0.57031	0.520000	0.50463	CAG		0.572	PDIA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317077.1	NM_004911		25	88	0	0	0	0.00632	0	25	88				
SSPO	23145	broad.mit.edu	37	7	149522402	149522402	+	RNA	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr7:149522402G>T	ENST00000378016.2	+	0	14032							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)	p.W65C(1)				Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			ATTCACCCTGGACTGTGCCAA	0.637																																							uc010lpk.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(14029-14031)GAC>TAC		SCO-spondin precursor							85.0	95.0	92.0					7																	149522402		2123	4242	6365			23145				cell adhesion	extracellular space	peptidase inhibitor activity	g.chr7:149522402G>T	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149522402G>T						SSPO_uc010lpm.1_RNA|SSPO_uc003wgg.2_RNA|SSPO_uc003wgh.2_RNA|SSPO_uc003wgi.1_RNA	p.D4677Y	NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00625)		101	14029	+	Melanoma(164;0.165)|Ovarian(565;0.177)		4677			TIL 6.		Q76B61	Missense_Mutation	SNP	ENST00000378016.2	37	c.14029G>T																																																																																					0.637	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript				28	145	1	0	6.00712e-18	0.012213	8.3687e-18	28	145				
DPP6	1804	broad.mit.edu	37	7	154172027	154172027	+	Missense_Mutation	SNP	A	A	C			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr7:154172027A>C	ENST00000377770.3	+	3	503	c.362A>C	c.(361-363)gAa>gCa	p.E121A	DPP6_ENST00000332007.3_Missense_Mutation_p.E59A|DPP6_ENST00000404039.1_Missense_Mutation_p.E57A|DPP6_ENST00000427557.1_Missense_Mutation_p.E59A|DPP6_ENST00000406326.1_Missense_Mutation_p.E121A|DPP6_ENST00000496611.1_3'UTR			P42658	DPP6_HUMAN	dipeptidyl-peptidase 6	121					cell death (GO:0008219)|neuronal action potential (GO:0019228)|positive regulation of potassium ion transmembrane transport (GO:1901381)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)	p.E121A(2)|p.E57A(1)|p.E59A(1)		NS(3)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(35)|pancreas(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	71	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			TTTCTAGCGGAAGATAATAGT	0.343																																					NSCLC(125;1384 1783 2490 7422 34254)	NSCLC(125;1384 1783 2490 7422 34254)	uc003wlk.2		NA																	4	Substitution - Missense(4)		lung(4)	pancreas(3)|breast(1)	4						c.(361-363)GAA>GCA		dipeptidyl-peptidase 6 isoform 1							63.0	61.0	61.0					7																	154172027		1834	4079	5913	SO:0001583	missense	1804				cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity	g.chr7:154172027A>C	M96859	CCDS75682.1, CCDS75683.1, CCDS75684.1	7q36.2	2006-08-07	2006-01-12		ENSG00000130226	ENSG00000130226			3010	protein-coding gene	gene with protein product		126141	"""dipeptidylpeptidase VI"", ""dipeptidylpeptidase 6"""			1729689	Standard	XM_006715871		Approved	DPPX	uc003wlk.3	P42658	OTTHUMG00000151511	ENST00000377770.3:c.362A>C	7.37:g.154172027A>C	ENSP00000367001:p.Glu121Ala					DPP6_uc003wli.2_Missense_Mutation_p.E57A|DPP6_uc003wlj.2_Missense_Mutation_p.E121A|DPP6_uc010lqh.1_Missense_Mutation_p.E59A|DPP6_uc003wlm.2_Missense_Mutation_p.E59A|DPP6_uc011kvq.1_Missense_Mutation_p.E59A	p.E121A	NM_130797	NP_570629	P42658	DPP6_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0562)		3	491	+	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	121			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000377770.3	37	c.362A>C		.	.	.	.	.	.	.	.	.	.	A	20.5	4.005692	0.74932	.	.	ENSG00000130226	ENST00000404039;ENST00000406326;ENST00000377770;ENST00000332007;ENST00000427557	T;T;T;T;T	0.39406	1.08;1.08;1.08;1.08;1.08	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.63792	0.2541	.	.	.	0.49130	D	0.999759	B;D;D;D;D;D	0.89917	0.188;0.999;1.0;1.0;1.0;1.0	B;D;D;D;D;D	0.91635	0.074;0.997;0.998;0.997;0.999;0.997	T	0.67814	-0.5573	9	0.66056	D	0.02	-20.9396	11.6719	0.51406	1.0:0.0:0.0:0.0	.	59;59;59;121;121;57	E9PDL2;B7Z1K3;P42658-2;P42658;Q8IYG9;E9PF59	.;.;.;DPP6_HUMAN;.;.	A	57;121;121;59;59	ENSP00000385578:E57A;ENSP00000384393:E121A;ENSP00000367001:E121A;ENSP00000328226:E59A;ENSP00000397303:E59A	ENSP00000328226:E59A	E	+	2	0	DPP6	153802960	1.000000	0.71417	1.000000	0.80357	0.728000	0.41692	7.059000	0.76684	2.050000	0.60909	0.528000	0.53228	GAA		0.343	DPP6-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000322932.1	NM_130797		16	40	0	0	0	0.00499	0	16	40				
LMBR1	64327	broad.mit.edu	37	7	156518480	156518480	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr7:156518480C>G	ENST00000353442.5	-	13	1281	c.1045G>C	c.(1045-1047)Gcg>Ccg	p.A349P	LMBR1_ENST00000540390.1_Missense_Mutation_p.A328P|LMBR1_ENST00000359422.4_Missense_Mutation_p.A197P|LMBR1_ENST00000354505.4_Missense_Mutation_p.A390P	NM_022458.3	NP_071903.2	Q8WVP7	LMBR1_HUMAN	limb development membrane protein 1	349				A -> V (in Ref. 1; AAK94061). {ECO:0000305}.	embryonic digit morphogenesis (GO:0042733)	integral component of membrane (GO:0016021)		p.A349P(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(9)|skin(1)	18	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.208)		ATTTCAAGCGCAGCTCCCACA	0.388																																							uc003wmw.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1045-1047)GCG>CCG		limb region 1 protein							72.0	77.0	75.0					7																	156518480		2203	4300	6503	SO:0001583	missense	64327					integral to membrane	receptor activity	g.chr7:156518480C>G	AF107454	CCDS5945.1	7q36.3	2013-08-05	2013-08-05	2005-07-25	ENSG00000105983	ENSG00000105983			13243	protein-coding gene	gene with protein product		605522	"""chromosome 7 open reading frame 2"", ""limb region 1 homolog (mouse)"""	C7orf2		10329000, 11090342	Standard	NM_022458		Approved	ACHP, FLJ11665, ZRS	uc003wmw.4	Q8WVP7	OTTHUMG00000151510	ENST00000353442.5:c.1045G>C	7.37:g.156518480C>G	ENSP00000326604:p.Ala349Pro					LMBR1_uc003wmv.3_Missense_Mutation_p.A197P|LMBR1_uc003wmx.3_Missense_Mutation_p.A197P|LMBR1_uc010lqn.2_Missense_Mutation_p.A390P|LMBR1_uc011kvx.1_Missense_Mutation_p.A328P	p.A349P	NM_022458	NP_071903	Q8WVP7	LMBR1_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.208)	13	1260	-	Ovarian(565;0.218)	all_hematologic(28;0.0592)	349	A -> V (in Ref. 1; AAK94061).		Helical; (Potential).		A4D242|Q8N3E3|Q96QZ5|Q9H5N0|Q9HAG9|Q9UDN5|Q9Y6U2	Missense_Mutation	SNP	ENST00000353442.5	37	c.1045G>C	CCDS5945.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.054810	0.75960	.	.	ENSG00000105983	ENST00000353442;ENST00000359422;ENST00000415428;ENST00000354505;ENST00000540390	T;T;T;T;T	0.35048	1.33;1.33;1.33;1.33;1.33	5.1	5.1	0.69264	LMBR1-like membrane protein (1);	0.105878	0.64402	D	0.000004	T	0.40398	0.1115	L	0.39245	1.2	0.47819	D	0.999529	P;P;P	0.51057	0.918;0.941;0.939	P;P;P	0.52386	0.697;0.648;0.602	T	0.08391	-1.0724	10	0.38643	T	0.18	-14.9431	12.2727	0.54716	0.0:0.9217:0.0:0.0783	.	328;390;349	B7Z633;Q8WVP7-3;Q8WVP7	.;.;LMBR1_HUMAN	P	349;197;388;390;328	ENSP00000326604:A349P;ENSP00000352392:A197P;ENSP00000408256:A388P;ENSP00000346500:A390P;ENSP00000445509:A328P	ENSP00000326604:A349P	A	-	1	0	LMBR1	156211241	1.000000	0.71417	0.997000	0.53966	0.972000	0.66771	5.296000	0.65698	2.527000	0.85204	0.467000	0.42956	GCG		0.388	LMBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347939.3	NM_022458		10	44	0	0	0	0.008291	0	10	44				
CSMD1	64478	broad.mit.edu	37	8	3889486	3889486	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr8:3889486G>A	ENST00000520002.1	-	4	1106	c.551C>T	c.(550-552)aCc>aTc	p.T184I	CSMD1_ENST00000537824.1_Missense_Mutation_p.T184I|CSMD1_ENST00000602557.1_Missense_Mutation_p.T184I|CSMD1_ENST00000602723.1_Missense_Mutation_p.T184I|CSMD1_ENST00000400186.3_Missense_Mutation_p.T184I|CSMD1_ENST00000542608.1_Missense_Mutation_p.T184I|CSMD1_ENST00000539096.1_Missense_Mutation_p.T184I			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	184	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)		p.T184I(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GACGATGCAGGTCAGGATGGC	0.552																																							uc011kwk.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(20)|large_intestine(5)	25						c.(550-552)ACC>ATC		CUB and Sushi multiple domains 1 precursor							107.0	117.0	114.0					8																	3889486		2124	4245	6369	SO:0001583	missense	64478					integral to membrane		g.chr8:3889486G>A			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.551C>T	8.37:g.3889486G>A	ENSP00000430733:p.Thr184Ile						p.T184I	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)	4	941	-		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)	184			Extracellular (Potential).|Sushi 1.		Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37	c.551C>T		.	.	.	.	.	.	.	.	.	.	G	18.56	3.651239	0.67472	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	T;T;T;T;T	0.69175	-0.38;-0.38;-0.38;-0.38;-0.38	5.52	5.52	0.82312	.	0.000000	0.48286	U	0.000198	T	0.80303	0.4598	M	0.72353	2.195	0.47214	D	0.999353	D	0.62365	0.991	P	0.62089	0.898	T	0.81963	-0.0692	10	0.72032	D	0.01	.	18.4147	0.90565	0.0:0.0:1.0:0.0	.	184	E5RIG2	.	I	184;184;46;184;184;184	ENSP00000383047:T184I;ENSP00000430733:T184I;ENSP00000441462:T184I;ENSP00000446243:T184I;ENSP00000441675:T184I	ENSP00000320445:T46I	T	-	2	0	CSMD1	3876894	1.000000	0.71417	0.999000	0.59377	0.122000	0.20287	9.532000	0.98057	2.612000	0.88384	0.655000	0.94253	ACC		0.552	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225		7	33	0	0	0	0.008291	0	7	33				
WRN	7486	broad.mit.edu	37	8	30999102	30999102	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr8:30999102G>C	ENST00000298139.5	+	25	3373	c.3124G>C	c.(3124-3126)Gcc>Ccc	p.A1042P		NM_000553.4	NP_000544.2	Q14191	WRN_HUMAN	Werner syndrome, RecQ helicase-like	1042					aging (GO:0007568)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to starvation (GO:0009267)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|double-strand break repair (GO:0006302)|multicellular organismal aging (GO:0010259)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleolus to nucleoplasm transport (GO:0032066)|positive regulation of hydrolase activity (GO:0051345)|regulation of apoptotic process (GO:0042981)|regulation of growth rate (GO:0040009)|replication fork processing (GO:0031297)|replicative cell aging (GO:0001302)|response to oxidative stress (GO:0006979)|response to UV-C (GO:0010225)|telomere maintenance (GO:0000723)	centrosome (GO:0005813)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	3'-5' DNA helicase activity (GO:0043138)|3'-5' exonuclease activity (GO:0008408)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|exonuclease activity (GO:0004527)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|Y-form DNA binding (GO:0000403)	p.A1042P(1)		central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(13)|lung(28)|ovary(3)|skin(3)|upper_aerodigestive_tract(3)	60		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		GAAGATTTGCGCCCTTACGAA	0.403			"""Mis, N, F, S"""			"""osteosarcoma, meningioma, others"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Werner syndrome																												Ovarian(18;161 598 2706 14834 27543)	Ovarian(18;161 598 2706 14834 27543)	uc003xio.3		NA	yes	Rec		Werner Syndrome	8	8p12-p11.2	7486	Mis|N|F|S	Werner syndrome (RECQL2)			"""L, E, M, O"""		osteosarcoma|meningioma|others			1	Substitution - Missense(1)		lung(1)	ovary(2)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	7						c.(3124-3126)GCC>CCC	Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Werner syndrome protein							103.0	101.0	102.0					8																	30999102		2203	4300	6503	SO:0001583	missense	7486	Werner_syndrome	Familial Cancer Database	WS, Adult Progeria	base-excision repair|cellular response to starvation|DNA recombination|DNA synthesis involved in DNA repair|multicellular organismal aging|nucleolus to nucleoplasm transport|positive regulation of hydrolase activity|regulation of apoptosis|replication fork processing|response to oxidative stress|response to UV-C|telomere maintenance	centrosome|nucleolus|nucleoplasm	3'-5' exonuclease activity|ATP binding|ATP-dependent 3'-5' DNA helicase activity|bubble DNA binding|four-way junction helicase activity|G-quadruplex DNA binding|magnesium ion binding|manganese ion binding|protein complex binding|protein homodimerization activity|Y-form DNA binding	g.chr8:30999102G>C		CCDS6082.1	8p12	2014-09-17	2009-03-19		ENSG00000165392	ENSG00000165392			12791	protein-coding gene	gene with protein product		604611	"""Werner syndrome"""			9288107	Standard	NM_000553		Approved	RECQL2, RECQ3	uc003xio.4	Q14191	OTTHUMG00000163894	ENST00000298139.5:c.3124G>C	8.37:g.30999102G>C	ENSP00000298139:p.Ala1042Pro					WRN_uc010lvk.2_Missense_Mutation_p.A509P	p.A1042P	NM_000553	NP_000544	Q14191	WRN_HUMAN		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)	25	3912	+		Breast(100;0.195)	1042					A1KYY9	Missense_Mutation	SNP	ENST00000298139.5	37	c.3124G>C	CCDS6082.1	.	.	.	.	.	.	.	.	.	.	A	7.009	0.556380	0.13436	.	.	ENSG00000165392	ENST00000298139	T	0.28255	1.62	5.9	3.5	0.40072	RQC domain (2);	0.695761	0.14072	N	0.343299	T	0.27419	0.0673	L	0.39245	1.2	0.09310	N	1	B;B	0.29716	0.024;0.255	B;B	0.40506	0.176;0.331	T	0.34304	-0.9834	10	0.31617	T	0.26	3.0E-4	3.3237	0.07059	0.5201:0.0:0.3006:0.1793	.	452;1042	Q59F09;Q14191	.;WRN_HUMAN	P	1042	ENSP00000298139:A1042P	ENSP00000298139:A1042P	A	+	1	0	WRN	31118644	0.016000	0.18221	0.625000	0.29200	0.005000	0.04900	0.658000	0.24979	0.456000	0.26937	-0.269000	0.10298	GCC		0.403	WRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376248.1			18	47	0	0	0	0.010504	0	18	47				
ANK1	286	broad.mit.edu	37	8	41554022	41554022	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr8:41554022G>T	ENST00000347528.4	-	26	2902	c.2819C>A	c.(2818-2820)cCa>cAa	p.P940Q	ANK1_ENST00000379758.2_Missense_Mutation_p.P940Q|ANK1_ENST00000265709.8_Missense_Mutation_p.P981Q|ANK1_ENST00000352337.4_Missense_Mutation_p.P940Q|ANK1_ENST00000289734.7_Missense_Mutation_p.P940Q|ANK1_ENST00000396942.1_Missense_Mutation_p.P940Q|ANK1_ENST00000396945.1_Missense_Mutation_p.P940Q	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	940	ZU5 1. {ECO:0000255|PROSITE- ProRule:PRU00485}.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.P981Q(1)|p.P940Q(1)		breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			GCACGTCCGTGGCGGGATCAC	0.677																																							uc003xok.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9						c.(2818-2820)CCA>CAA		ankyrin 1 isoform 1							44.0	43.0	43.0					8																	41554022		2203	4300	6503	SO:0001583	missense	286				axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton	g.chr8:41554022G>T	M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.2819C>A	8.37:g.41554022G>T	ENSP00000339620:p.Pro940Gln					NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoh.2_Missense_Mutation_p.P256Q|ANK1_uc003xoi.2_Missense_Mutation_p.P940Q|ANK1_uc003xoj.2_Missense_Mutation_p.P940Q|ANK1_uc003xol.2_Missense_Mutation_p.P940Q|ANK1_uc003xom.2_Missense_Mutation_p.P981Q	p.P940Q	NM_020476	NP_065209	P16157	ANK1_HUMAN	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)		26	2903	-	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	940			ZU5.		A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	ENST00000347528.4	37	c.2819C>A	CCDS6119.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.743203	0.89663	.	.	ENSG00000029534	ENST00000347528;ENST00000289734;ENST00000379758;ENST00000396945;ENST00000396942;ENST00000352337;ENST00000265709;ENST00000358820	T;T;T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82;0.82;0.82	5.67	5.67	0.87782	ZU5 (3);	0.000000	0.85682	D	0.000000	T	0.72684	0.3491	M	0.80183	2.485	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.997;0.996;0.999;0.998;0.997;1.0	T	0.75494	-0.3298	10	0.87932	D	0	.	19.7607	0.96316	0.0:0.0:1.0:0.0	.	981;940;940;940;940;256	P16157-21;P16157-4;P16157;P16157-5;P16157-3;B3KX39	.;.;ANK1_HUMAN;.;.;.	Q	940;940;940;940;940;940;981;940	ENSP00000339620:P940Q;ENSP00000289734:P940Q;ENSP00000369082:P940Q;ENSP00000380149:P940Q;ENSP00000380147:P940Q;ENSP00000309131:P940Q;ENSP00000265709:P981Q	ENSP00000265709:P981Q	P	-	2	0	ANK1	41673179	1.000000	0.71417	0.175000	0.22980	0.707000	0.40811	7.989000	0.88205	2.686000	0.91538	0.561000	0.74099	CCA		0.677	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317297.1	NM_020475		25	50	1	0	8.58068e-18	0.007291	1.18634e-17	25	50				
ST18	9705	broad.mit.edu	37	8	53079434	53079434	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr8:53079434G>T	ENST00000276480.7	-	11	1865	c.1182C>A	c.(1180-1182)caC>caA	p.H394Q		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	394					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.H394Q(1)		NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				CCCGCACTTTGTGGGGGCACC	0.557																																							uc003xqz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(1)	5						c.(1180-1182)CAC>CAA		suppression of tumorigenicity 18							86.0	85.0	85.0					8																	53079434		2203	4300	6503	SO:0001583	missense	9705					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:53079434G>T	AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.1182C>A	8.37:g.53079434G>T	ENSP00000276480:p.His394Gln					ST18_uc011ldq.1_Missense_Mutation_p.H41Q|ST18_uc011ldr.1_Missense_Mutation_p.H359Q|ST18_uc011lds.1_Missense_Mutation_p.H299Q|ST18_uc003xra.2_Missense_Mutation_p.H394Q|ST18_uc003xrb.2_Missense_Mutation_p.H394Q	p.H394Q	NM_014682	NP_055497	O60284	ST18_HUMAN			6	1338	-		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)	394			C2HC-type 1.		Q17RY1	Missense_Mutation	SNP	ENST00000276480.7	37	c.1182C>A	CCDS6149.1	.	.	.	.	.	.	.	.	.	.	G	18.98	3.738585	0.69304	.	.	ENSG00000147488	ENST00000276480;ENST00000517580	T;T	0.52295	0.67;0.68	5.31	3.16	0.36331	.	0.000000	0.85682	D	0.000000	T	0.45856	0.1363	N	0.08118	0	0.54753	D	0.999988	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.52298	-0.8594	10	0.56958	D	0.05	-17.8231	11.1841	0.48646	0.2591:0.0:0.7409:0.0	.	394;394	E5RHS3;O60284	.;ST18_HUMAN	Q	394	ENSP00000276480:H394Q;ENSP00000428521:H394Q	ENSP00000276480:H394Q	H	-	3	2	ST18	53241987	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.449000	0.44935	1.230000	0.43646	0.563000	0.77884	CAC		0.557	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377867.1			37	128	1	0	1.17475e-09	0.00361	1.39669e-09	37	128				
PRDM14	63978	broad.mit.edu	37	8	70982089	70982089	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr8:70982089G>T	ENST00000276594.2	-	2	208	c.7C>A	c.(7-9)Cta>Ata	p.L3I		NM_024504.3	NP_078780.1	Q9GZV8	PRD14_HUMAN	PR domain containing 14	3					cell fate specification (GO:0001708)|cell morphogenesis (GO:0000902)|fertilization (GO:0009566)|germ cell development (GO:0007281)|germ-line stem cell maintenance (GO:0030718)|histone H3-R26 methylation (GO:0034972)|homeostasis of number of cells within a tissue (GO:0048873)|inner cell mass cell fate commitment (GO:0001827)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|regulation of DNA methylation (GO:0044030)|regulation of gene expression, epigenetic (GO:0040029)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)	p.L3I(1)		NS(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Breast(64;0.193)		Epithelial(68;0.00508)|all cancers(69;0.0259)|OV - Ovarian serous cystadenocarcinoma(28;0.0405)			GGCCGGGGTAGAGCCATCCCG	0.711																																					NSCLC(129;99 1813 5906 40656 46114)	NSCLC(129;99 1813 5906 40656 46114)	uc003xym.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(7-9)CTA>ATA		PR domain containing 14							11.0	12.0	12.0					8																	70982089		2117	4253	6370	SO:0001583	missense	63978				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr8:70982089G>T	AF319458	CCDS6206.1	8q13.3	2013-01-08			ENSG00000147596	ENSG00000147596		"""Zinc fingers, C2H2-type"""	14001	protein-coding gene	gene with protein product		611781					Standard	NM_024504		Approved		uc003xym.3	Q9GZV8	OTTHUMG00000150495	ENST00000276594.2:c.7C>A	8.37:g.70982089G>T	ENSP00000276594:p.Leu3Ile						p.L3I	NM_024504	NP_078780	Q9GZV8	PRD14_HUMAN	Epithelial(68;0.00508)|all cancers(69;0.0259)|OV - Ovarian serous cystadenocarcinoma(28;0.0405)		2	209	-	Breast(64;0.193)		3					Q86UX9	Missense_Mutation	SNP	ENST00000276594.2	37	c.7C>A	CCDS6206.1	.	.	.	.	.	.	.	.	.	.	G	15.53	2.859987	0.51482	.	.	ENSG00000147596	ENST00000276594;ENST00000426346	T	0.17691	2.26	5.34	1.34	0.21922	.	0.229512	0.28354	N	0.015654	T	0.10981	0.0268	L	0.34521	1.04	0.09310	N	0.999998	P	0.42908	0.793	B	0.38842	0.283	T	0.15464	-1.0436	10	0.72032	D	0.01	-5.2036	5.7365	0.18069	0.241:0.1443:0.6146:0.0	.	3	Q9GZV8	PRD14_HUMAN	I	3	ENSP00000276594:L3I	ENSP00000276594:L3I	L	-	1	2	PRDM14	71144643	0.791000	0.28800	0.108000	0.21378	0.016000	0.09150	1.180000	0.32005	0.227000	0.20999	0.655000	0.94253	CTA		0.711	PRDM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318505.1			6	10	1	0	0.00198382	0.001984	0.00208073	6	10				
VPS13B	157680	broad.mit.edu	37	8	100454673	100454673	+	Silent	SNP	G	G	T	rs371674854		TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr8:100454673G>T	ENST00000358544.2	+	23	3366	c.3255G>T	c.(3253-3255)ctG>ctT	p.L1085L	VPS13B_ENST00000357162.2_Silent_p.L1085L|VPS13B_ENST00000395996.1_Silent_p.L1085L	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	1085					protein transport (GO:0015031)			p.L1085L(2)		NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			ATGATAGCCTGCCTTCCCCAA	0.398																																					Colon(161;2205 2542 7338 31318)	Colon(161;2205 2542 7338 31318)	uc003yiv.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20						c.(3253-3255)CTG>CTT		vacuolar protein sorting 13B isoform 5							177.0	165.0	169.0					8																	100454673		2203	4300	6503	SO:0001819	synonymous_variant	157680				protein transport			g.chr8:100454673G>T	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.3255G>T	8.37:g.100454673G>T						VPS13B_uc003yiw.2_Silent_p.L1085L|VPS13B_uc003yiu.1_Silent_p.L1085L|VPS13B_uc003yix.1_Silent_p.L555L	p.L1085L	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.00636)		23	3366	+	Breast(36;3.73e-07)		1085					C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Silent	SNP	ENST00000358544.2	37	c.3255G>T	CCDS6280.1																																																																																				0.398	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042		30	60	1	0	1.90571e-15	0.004289	2.52939e-15	30	60				
FAM135B	51059	broad.mit.edu	37	8	139164306	139164306	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr8:139164306C>G	ENST00000395297.1	-	13	2582	c.2412G>C	c.(2410-2412)aaG>aaC	p.K804N		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	804								p.K804N(2)		NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			AACCTTGGCTCTTGCTGTGCA	0.517										HNSCC(54;0.14)																													uc003yuy.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(7)|skin(2)	9						c.(2410-2412)AAG>AAC		hypothetical protein LOC51059							64.0	60.0	61.0					8																	139164306		2203	4300	6503	SO:0001583	missense	51059							g.chr8:139164306C>G	AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.2412G>C	8.37:g.139164306C>G	ENSP00000378710:p.Lys804Asn	HNSCC(54;0.14)				FAM135B_uc003yux.2_Missense_Mutation_p.K705N|FAM135B_uc003yuz.2_RNA|FAM135B_uc003yva.2_Missense_Mutation_p.K366N|FAM135B_uc003yvb.2_Missense_Mutation_p.K366N	p.K804N	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0805)		13	2583	-	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		804					B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	ENST00000395297.1	37	c.2412G>C	CCDS6375.2	.	.	.	.	.	.	.	.	.	.	C	10.84	1.464120	0.26335	.	.	ENSG00000147724	ENST00000395297	T	0.15834	2.39	5.45	-0.44	0.12261	.	1.161760	0.05982	N	0.644382	T	0.11367	0.0277	N	0.24115	0.695	0.09310	N	1	B;B;B	0.30361	0.277;0.145;0.026	B;B;B	0.32465	0.146;0.068;0.011	T	0.39781	-0.9597	10	0.24483	T	0.36	-3.1242	6.0227	0.19638	0.0:0.3464:0.4646:0.189	.	804;804;804	Q49AJ0-3;Q49AJ0-4;Q49AJ0	.;.;F135B_HUMAN	N	804	ENSP00000378710:K804N	ENSP00000276737:K804N	K	-	3	2	FAM135B	139233488	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.136000	0.10405	0.218000	0.20820	0.655000	0.94253	AAG		0.517	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912		27	93	0	0	0	0.008361	0	27	93				
COL22A1	169044	broad.mit.edu	37	8	139890410	139890410	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr8:139890410G>A	ENST00000303045.6	-	3	687	c.241C>T	c.(241-243)Cgc>Tgc	p.R81C	COL22A1_ENST00000435777.1_Missense_Mutation_p.R81C	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	81	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.R81C(1)		breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			TCGCTGTAGCGCACGACCCCC	0.687										HNSCC(7;0.00092)																													uc003yvd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(11)|pancreas(1)|skin(1)	13						c.(241-243)CGC>TGC		collagen, type XXII, alpha 1							15.0	18.0	17.0					8																	139890410		2202	4295	6497	SO:0001583	missense	169044				cell adhesion	collagen|cytoplasm	structural molecule activity	g.chr8:139890410G>A	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.241C>T	8.37:g.139890410G>A	ENSP00000303153:p.Arg81Cys	HNSCC(7;0.00092)					p.R81C	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0517)		3	688	-	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		81			VWFA.		B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	ENST00000303045.6	37	c.241C>T	CCDS6376.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.567114	0.86439	.	.	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	D;D	0.83419	-1.72;-1.72	5.28	5.28	0.74379	von Willebrand factor, type A (3);	0.159645	0.30134	U	0.010330	D	0.90089	0.6904	M	0.76170	2.325	0.80722	D	1	D	0.76494	0.999	D	0.63597	0.916	D	0.89997	0.4112	9	.	.	.	.	17.8919	0.88875	0.0:0.0:1.0:0.0	.	81	Q8NFW1	COMA1_HUMAN	C	81	ENSP00000303153:R81C;ENSP00000387655:R81C	.	R	-	1	0	COL22A1	139959592	1.000000	0.71417	1.000000	0.80357	0.831000	0.47069	7.707000	0.84623	2.440000	0.82611	0.585000	0.79938	CGC		0.687	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257		6	12	0	0	0	0.001984	0	6	12				
GPIHBP1	338328	broad.mit.edu	37	8	144297309	144297309	+	Silent	SNP	C	C	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr8:144297309C>T	ENST00000330824.2	+	4	546	c.471C>T	c.(469-471)ccC>ccT	p.P157P		NM_178172.3	NP_835466.1	Q8IV16	HDBP1_HUMAN	glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1	157					cholesterol homeostasis (GO:0042632)|intracellular protein transport (GO:0006886)|positive regulation of chylomicron remnant clearance (GO:0090321)|positive regulation of lipoprotein lipase activity (GO:0051006)|protein import (GO:0017038)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|protein transmembrane transport (GO:0071806)|response to heparin (GO:0071503)|transcytosis (GO:0045056)|triglyceride homeostasis (GO:0070328)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|external side of plasma membrane (GO:0009897)|high-density lipoprotein particle (GO:0034364)	chylomicron binding (GO:0035478)|lipase binding (GO:0035473)|lipid binding (GO:0008289)|lipoprotein particle binding (GO:0071813)|protein transmembrane transporter activity (GO:0008320)	p.P157P(1)		lung(2)	2	all_cancers(97;6.49e-11)|all_epithelial(106;2.77e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					CAGGCGGCCCCCGGGGCAGCT	0.692																																							uc003yxu.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(469-471)CCC>CCT		glycosylphosphatidylinositol anchored high							35.0	39.0	38.0					8																	144297309		2202	4298	6500	SO:0001819	synonymous_variant	338328				cholesterol homeostasis|intracellular protein transport|positive regulation of chylomicron remnant clearance|positive regulation of lipoprotein lipase activity|protein import|protein localization at cell surface|protein stabilization|response to heparin|triglyceride homeostasis	anchored to external side of plasma membrane|apical plasma membrane|basolateral plasma membrane|high-density lipoprotein particle|integral to membrane|intracellular	apolipoprotein binding|chylomicron binding|lipase binding|lipid binding|protein transmembrane transporter activity	g.chr8:144297309C>T	AF088057	CCDS34954.1	8q24.3	2014-07-14	2008-02-07						24945	protein-coding gene	gene with protein product	"""endothelial cell LPL transporter"""	612757	"""GPI anchored high density lipoprotein binding protein 1"""			12496272, 17883852, 17620854, 17403372	Standard	NM_178172		Approved	LOC338328, GPI-HBP1	uc003yxu.2	Q8IV16		ENST00000330824.2:c.471C>T	8.37:g.144297309C>T							p.P157P	NM_178172	NP_835466	Q8IV16	HDBP1_HUMAN			4	546	+	all_cancers(97;6.49e-11)|all_epithelial(106;2.77e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)		157					Q6P3T2|Q86W15	Silent	SNP	ENST00000330824.2	37	c.471C>T	CCDS34954.1																																																																																				0.692	GPIHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381113.1	NM_178172		31	54	0	0	0	0.010818	0	31	54				
ANKRD20A4	728747	broad.mit.edu	37	9	69420407	69420407	+	Silent	SNP	C	C	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr9:69420407C>T	ENST00000357336.3	+	13	1578	c.1297C>T	c.(1297-1299)Ctg>Ttg	p.L433L		NM_001098805.1	NP_001092275.1	Q4UJ75	A20A4_HUMAN	ankyrin repeat domain 20 family, member A4	433								p.L433L(1)		breast(1)|large_intestine(1)|liver(1)|lung(9)|pancreas(2)|skin(2)	16						TCCCAAGAAGCTGAAGGAAGA	0.353																																							uc004afn.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1297-1299)CTG>TTG		ankyrin repeat domain 20 family, member A4							136.0	201.0	177.0					9																	69420407		1338	2302	3640	SO:0001819	synonymous_variant	728747							g.chr9:69420407C>T		CCDS43828.1	9q21.11	2013-01-10			ENSG00000172014	ENSG00000172014		"""Ankyrin repeat domain containing"""	31982	protein-coding gene	gene with protein product							Standard	NM_001098805		Approved	OTTHUMG00000066855	uc004afn.3	Q4UJ75	OTTHUMG00000066855	ENST00000357336.3:c.1297C>T	9.37:g.69420407C>T							p.L433L	NM_001098805	NP_001092275	Q4UJ75	A20A4_HUMAN			13	1409	+			433			Potential.			Silent	SNP	ENST00000357336.3	37	c.1297C>T	CCDS43828.1																																																																																				0.353	ANKRD20A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143287.3	NM_001098805		6	128	0	0	0	0.008291	0	6	128				
SPATA31D5P	347127	broad.mit.edu	37	9	84530750	84530750	+	RNA	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr9:84530750C>A	ENST00000527857.1	+	0	772					NR_026851.1				SPATA31 subfamily D, member 5, pseudogene																		CCCCTTTTCCCACCGCATCAC	0.532																																							uc011lst.1		NA																	0					0						c.(670-672)CCA>CAA		SubName: Full=cDNA FLJ43950 fis, clone TESTI4015293, moderately similar to FAM75-like protein;																																						347127							g.chr9:84530750C>A			9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000240632	ENSG00000240632			38602	pseudogene	pseudogene			"""family with sequence similarity 75, member D5"", ""family with sequence similarity 75, member D5, pseudogene"""	FAM75D5			Standard	NR_026851		Approved	FLJ43950, FAM75D5P	uc011lst.2		OTTHUMG00000020087		9.37:g.84530750C>A							p.P224Q	NR_026851						4	772	+									Missense_Mutation	SNP	ENST00000527857.1	37	c.671C>A																																																																																					0.532	SPATA31D5P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000052810.2	NR_026851		48	96	1	0	1.61863e-15	0.00361	2.1641e-15	48	96				
AUH	549	broad.mit.edu	37	9	94060310	94060310	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr9:94060310C>A	ENST00000375731.4	-	5	577	c.554G>T	c.(553-555)gGt>gTt	p.G185V	AUH_ENST00000478465.1_5'UTR|AUH_ENST00000422391.2_Missense_Mutation_p.G185V|AUH_ENST00000303617.5_Missense_Mutation_p.G156V	NM_001698.2	NP_001689.1	Q13825	AUHM_HUMAN	AU RNA binding protein/enoyl-CoA hydratase	185					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|leucine catabolic process (GO:0006552)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	enoyl-CoA hydratase activity (GO:0004300)|methylglutaconyl-CoA hydratase activity (GO:0004490)|mRNA 3'-UTR binding (GO:0003730)	p.G185V(1)		endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)	11						AAGACCACCACCTAAAGCGAG	0.348																																							uc004arf.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(553-555)GGT>GTT		AU RNA binding protein/enoyl-Coenzyme A							111.0	105.0	107.0					9																	94060310		2203	4300	6503	SO:0001583	missense	549				branched chain family amino acid catabolic process|mRNA catabolic process	mitochondrial matrix	enoyl-CoA hydratase activity|methylglutaconyl-CoA hydratase activity|mRNA 3'-UTR binding	g.chr9:94060310C>A	X79888	CCDS6689.1	9q22	2014-09-17	2010-04-30		ENSG00000148090	ENSG00000148090			890	protein-coding gene	gene with protein product		600529	"""AU RNA-binding protein/enoyl-Coenzyme A hydratase"", ""AU RNA binding protein/enoyl-Coenzyme A hydratase"""			7892223	Standard	NM_001698		Approved		uc004arf.4	Q13825	OTTHUMG00000020207	ENST00000375731.4:c.554G>T	9.37:g.94060310C>A	ENSP00000364883:p.Gly185Val					AUH_uc004arg.3_Missense_Mutation_p.G156V|AUH_uc011ltu.1_Missense_Mutation_p.G185V	p.G185V	NM_001698	NP_001689	Q13825	AUHM_HUMAN			5	589	-			185					B1ALV7|B1ALV8|Q8WUE4	Missense_Mutation	SNP	ENST00000375731.4	37	c.554G>T	CCDS6689.1	.	.	.	.	.	.	.	.	.	.	C	18.71	3.682431	0.68157	.	.	ENSG00000148090	ENST00000375731;ENST00000303617;ENST00000422391	D;D;D	0.89875	-2.58;-2.58;-2.58	4.98	4.09	0.47781	Enoyl-CoA hydratase/isomerase, conserved site (1);Crotonase, core (1);	0.000000	0.85682	D	0.000000	D	0.97049	0.9036	H	0.99770	4.765	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.97885	1.0294	10	0.87932	D	0	.	13.3257	0.60459	0.0:0.9229:0.0:0.0771	.	185;156;185	B4DYI6;Q13825-2;Q13825	.;.;AUHM_HUMAN	V	185;156;185	ENSP00000364883:G185V;ENSP00000307334:G156V;ENSP00000402026:G185V	ENSP00000307334:G156V	G	-	2	0	AUH	93100131	1.000000	0.71417	0.963000	0.40424	0.905000	0.53344	5.940000	0.70187	1.332000	0.45431	0.591000	0.81541	GGT		0.348	AUH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053032.1			26	54	1	0	4.74835e-14	0.010818	6.14592e-14	26	54				
PTPDC1	138639	broad.mit.edu	37	9	96860223	96860223	+	Silent	SNP	C	C	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr9:96860223C>T	ENST00000375360.3	+	7	1553	c.1213C>T	c.(1213-1215)Ctg>Ttg	p.L405L	PTPDC1_ENST00000288976.3_Silent_p.L457L	NM_001253830.1|NM_177995.2	NP_001240759.1|NP_818931.1	A2A3K4	PTPC1_HUMAN	protein tyrosine phosphatase domain containing 1	405					cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)		protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.L405L(1)|p.L457L(1)		endometrium(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	32						CGAGAACCTCCTGGAGCAAGG	0.532																																							uc004auf.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(1213-1215)CTG>TTG		protein tyrosine phosphatase domain containing 1							52.0	53.0	52.0					9																	96860223		2203	4300	6503	SO:0001819	synonymous_variant	138639						protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr9:96860223C>T	BC051654	CCDS6707.1, CCDS6708.1, CCDS75860.1	9q22.32	2011-06-09			ENSG00000158079	ENSG00000158079		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	30184	protein-coding gene	gene with protein product	"""protein tyrosine phosphatase PTP9Q22"""					14702039	Standard	NM_152422		Approved	PTP9Q22, FLJ37312	uc010mrj.2	A2A3K4	OTTHUMG00000020258	ENST00000375360.3:c.1213C>T	9.37:g.96860223C>T						PTPDC1_uc004aug.1_Silent_p.L405L|PTPDC1_uc004auh.1_Silent_p.L457L|PTPDC1_uc010mrj.1_Silent_p.L459L|PTPDC1_uc010mri.1_Silent_p.L457L	p.L405L	NM_177995	NP_818931	A2A3K4	PTPC1_HUMAN			7	1553	+			405					Q5T3M4|Q6NXE8|Q8IWM1|Q8N1X4|Q8N9F5	Silent	SNP	ENST00000375360.3	37	c.1213C>T	CCDS6707.1																																																																																				0.532	PTPDC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000215007.1	NM_177995, NM_152422		20	40	0	0	0	0.00278	0	20	40				
OR1J1	347168	broad.mit.edu	37	9	125239348	125239348	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr9:125239348G>T	ENST00000259357.2	-	1	887	c.858C>A	c.(856-858)aaC>aaA	p.N286K	RP11-542K23.9_ENST00000412262.2_RNA	NM_001004451.1	NP_001004451.1	Q8NGS3	OR1J1_HUMAN	olfactory receptor, family 1, subfamily J, member 1	286						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.N286K(1)		endometrium(1)|large_intestine(4)|lung(6)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	16						AAATGAATGGGTTCAACATGG	0.423																																							uc011lyu.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(856-858)AAC>AAA		olfactory receptor, family 1, subfamily J,							146.0	137.0	140.0					9																	125239348		2203	4300	6503	SO:0001583	missense	347168				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:125239348G>T	AL353767	CCDS35120.1	9q33.2	2013-09-20			ENSG00000136834	ENSG00000136834		"""GPCR / Class A : Olfactory receptors"""	8208	protein-coding gene	gene with protein product							Standard	NM_001004451		Approved	hg32	uc011lyu.2	Q8NGS3	OTTHUMG00000020603	ENST00000259357.2:c.858C>A	9.37:g.125239348G>T	ENSP00000259357:p.Asn286Lys					OR1J2_uc004bmj.1_Intron	p.N286K	NM_001004451	NP_001004451	Q8NGS3	OR1J1_HUMAN			1	858	-			286			Helical; Name=7; (Potential).		A3KFL8|Q6IF10|Q96R88	Missense_Mutation	SNP	ENST00000259357.2	37	c.858C>A	CCDS35120.1	.	.	.	.	.	.	.	.	.	.	G	11.68	1.711961	0.30322	.	.	ENSG00000136834	ENST00000259357	T	0.59364	0.27	4.93	1.94	0.25998	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000005	T	0.70988	0.3287	M	0.80508	2.5	0.32356	N	0.557804	D	0.76494	0.999	D	0.68621	0.959	T	0.74441	-0.3664	10	0.87932	D	0	.	7.1514	0.25612	0.4731:0.0:0.5269:0.0	.	286	Q8NGS3	OR1J1_HUMAN	K	286	ENSP00000259357:N286K	ENSP00000259357:N286K	N	-	3	2	OR1J1	124279169	0.992000	0.36948	0.999000	0.59377	0.232000	0.25224	0.269000	0.18589	0.324000	0.23333	-0.493000	0.04662	AAC		0.423	OR1J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053931.1			48	102	1	0	2.23044e-30	0.00361	3.50909e-30	48	102				
COL5A1	1289	broad.mit.edu	37	9	137704349	137704349	+	Splice_Site	SNP	G	G	C			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr9:137704349G>C	ENST00000371817.3	+	47	4158		c.e47+1			NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1						axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)	p.?(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		GGGCCAGATGGTAAGTGTGCC	0.537																																							uc004cfe.2		NA																	1	Unknown(1)		lung(1)	skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11						c.e47+1		alpha 1 type V collagen preproprotein							127.0	95.0	106.0					9																	137704349		2203	4300	6503	SO:0001630	splice_region_variant	1289				axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding	g.chr9:137704349G>C	D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.3744+1G>C	9.37:g.137704349G>C							p.M1248_splice	NM_000093	NP_000084	P20908	CO5A1_HUMAN		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)	47	4126	+		Myeloproliferative disorder(178;0.0341)						Q15094|Q5SUX4	Splice_Site	SNP	ENST00000371817.3	37	c.3744_splice	CCDS6982.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.580514	0.86645	.	.	ENSG00000130635	ENST00000371817	.	.	.	4.77	4.77	0.60923	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.7817	0.88526	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	COL5A1	136844170	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	9.747000	0.98863	2.200000	0.70718	0.643000	0.83706	.		0.537	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2	NM_000093	Intron	26	37	0	0	0	0.010818	0	26	37				
SHROOM2	357	broad.mit.edu	37	X	9862711	9862711	+	Missense_Mutation	SNP	G	G	T	rs111899727	byFrequency	TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chrX:9862711G>T	ENST00000380913.3	+	4	853	c.763G>T	c.(763-765)Gca>Tca	p.A255S		NM_001649.2	NP_001640.1	Q13796	SHRM2_HUMAN	shroom family member 2	255					apical protein localization (GO:0045176)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell migration (GO:0016477)|cell-cell junction maintenance (GO:0045217)|cellular pigment accumulation (GO:0043482)|ear development (GO:0043583)|establishment of melanosome localization (GO:0032401)|eye pigment granule organization (GO:0008057)|lens morphogenesis in camera-type eye (GO:0002089)|melanosome organization (GO:0032438)|negative regulation of actin filament depolymerization (GO:0030835)|sodium ion transmembrane transport (GO:0035725)	apical plasma membrane (GO:0016324)|cell cortex (GO:0005938)|cell-cell adherens junction (GO:0005913)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|beta-catenin binding (GO:0008013)|ligand-gated sodium channel activity (GO:0015280)	p.A255S(1)		breast(4)|central_nervous_system(2)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	57		Hepatocellular(5;0.000888)				GGCCCAGGCCGCAGGCGACCC	0.672																																							uc004csu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(3)|upper_aerodigestive_tract(1)|breast(1)	8						c.(763-765)GCA>TCA		apical protein of Xenopus-like							24.0	21.0	22.0					X																	9862711		2197	4298	6495	SO:0001583	missense	357				apical protein localization|brain development|cell migration|cell morphogenesis|cellular pigment accumulation|ear development|establishment of melanosome localization|eye pigment granule organization|lens morphogenesis in camera-type eye|melanosome organization	apical plasma membrane|cell-cell adherens junction|microtubule|tight junction	actin filament binding|beta-catenin binding|ligand-gated sodium channel activity	g.chrX:9862711G>T	X83543	CCDS14135.1	Xp22.3	2008-02-05	2006-07-20	2006-07-20	ENSG00000146950	ENSG00000146950			630	protein-coding gene	gene with protein product		300103	"""apical protein, Xenopus laevis-like"", ""apical protein-like (Xenopus laevis)"""	APXL		7795590, 16615870	Standard	NM_001649		Approved		uc004csu.1	Q13796	OTTHUMG00000021121	ENST00000380913.3:c.763G>T	X.37:g.9862711G>T	ENSP00000370299:p.Ala255Ser						p.A255S	NM_001649	NP_001640	Q13796	SHRM2_HUMAN			4	853	+		Hepatocellular(5;0.000888)	255					B9EIQ7	Missense_Mutation	SNP	ENST00000380913.3	37	c.763G>T	CCDS14135.1	.	.	.	.	.	.	.	.	.	.	G	6.895	0.534723	0.13188	.	.	ENSG00000146950	ENST00000380913	T	0.64260	-0.09	3.87	-6.34	0.01982	.	2.188980	0.01747	N	0.029713	T	0.40222	0.1108	L	0.31294	0.92	0.09310	N	1	B	0.16802	0.019	B	0.09377	0.004	T	0.27606	-1.0069	10	0.09590	T	0.72	-2.3006	2.9451	0.05843	0.5437:0.0977:0.1441:0.2145	.	255	Q13796	SHRM2_HUMAN	S	255	ENSP00000370299:A255S	ENSP00000370299:A255S	A	+	1	0	SHROOM2	9822711	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.658000	0.01977	-1.352000	0.02194	-0.927000	0.02713	GCA		0.672	SHROOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055721.1	NM_001649		20	10	1	0	5.26018e-13	0.012319	6.68977e-13	20	10				
ARHGAP6	395	broad.mit.edu	37	X	11162223	11162223	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chrX:11162223G>T	ENST00000337414.4	-	11	2925	c.2053C>A	c.(2053-2055)Caa>Aaa	p.Q685K	ARHGAP6_ENST00000380736.1_Missense_Mutation_p.Q482K|ARHGAP6_ENST00000303025.6_Missense_Mutation_p.Q482K|ARHGAP6_ENST00000413512.3_3'UTR|ARHGAP6_ENST00000380718.1_Missense_Mutation_p.Q685K|ARHGAP6_ENST00000534860.1_Missense_Mutation_p.Q510K	NM_013427.2	NP_038286.2	O43182	RHG06_HUMAN	Rho GTPase activating protein 6	685					actin filament polymerization (GO:0030041)|activation of phospholipase C activity (GO:0007202)|focal adhesion assembly (GO:0048041)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of signal transduction (GO:0009967)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)	p.Q685K(1)		cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						GCGTCCTCTTGCATAGCCAGC	0.577											OREG0019666	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc004cup.1		NA																	1	Substitution - Missense(1)		lung(1)	urinary_tract(1)|lung(1)	2						c.(2053-2055)CAA>AAA		Rho GTPase activating protein 6 isoform 1							63.0	64.0	64.0					X																	11162223		2203	4300	6503	SO:0001583	missense	395				actin filament polymerization|activation of phospholipase C activity|negative regulation of focal adhesion assembly|negative regulation of stress fiber assembly|Rho protein signal transduction	actin filament|cytosol	phospholipase activator activity|phospholipase binding|Rho GTPase activator activity|SH3 domain binding|SH3/SH2 adaptor activity	g.chrX:11162223G>T	AF012272	CCDS14140.1, CCDS14141.1, CCDS14142.1	Xp22.3	2008-02-05			ENSG00000047648	ENSG00000047648		"""Rho GTPase activating proteins"""	676	protein-coding gene	gene with protein product		300118				9417914	Standard	XM_005274507		Approved	rhoGAPX-1	uc004cup.1	O43182	OTTHUMG00000021134	ENST00000337414.4:c.2053C>A	X.37:g.11162223G>T	ENSP00000338967:p.Gln685Lys		OREG0019666	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	670	ARHGAP6_uc004cuo.1_RNA|ARHGAP6_uc004cur.1_Missense_Mutation_p.Q685K|ARHGAP6_uc004cum.1_Missense_Mutation_p.Q482K|ARHGAP6_uc004cun.1_Missense_Mutation_p.Q505K|ARHGAP6_uc010neb.1_Missense_Mutation_p.Q507K|ARHGAP6_uc011mif.1_3'UTR	p.Q685K	NM_013427	NP_038286	O43182	RHG06_HUMAN			11	2926	-			685					B2RWQ0|O43437|Q9P1B3|Q9UK81|Q9UK82	Missense_Mutation	SNP	ENST00000337414.4	37	c.2053C>A	CCDS14140.1	.	.	.	.	.	.	.	.	.	.	G	15.51	2.855534	0.51376	.	.	ENSG00000047648	ENST00000534860;ENST00000380736;ENST00000303025;ENST00000337414;ENST00000380717;ENST00000380718	T;T;T;T;T;T	0.22539	1.98;2.01;2.01;2.0;1.95;1.97	5.51	5.51	0.81932	.	0.000000	0.50627	D	0.000112	T	0.22781	0.0550	M	0.65975	2.015	0.80722	D	1	B;P;P;P	0.39022	0.4;0.655;0.555;0.555	B;B;B;B	0.35039	0.121;0.194;0.131;0.131	T	0.03325	-1.1048	10	0.25106	T	0.35	.	13.9824	0.64313	0.077:0.0:0.923:0.0	.	482;685;685;685	O43182-5;O43182-2;O43182;A8KAL3	.;.;RHG06_HUMAN;.	K	510;482;482;685;521;685	ENSP00000438135:Q510K;ENSP00000370112:Q482K;ENSP00000302312:Q482K;ENSP00000338967:Q685K;ENSP00000370093:Q521K;ENSP00000370094:Q685K	ENSP00000302312:Q482K	Q	-	1	0	ARHGAP6	11072144	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	4.918000	0.63376	2.329000	0.79093	0.506000	0.49869	CAA		0.577	ARHGAP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055760.2	NM_013427		48	58	1	0	1.81118e-26	0.00361	2.76603e-26	48	58				
GLRA2	2742	broad.mit.edu	37	X	14550471	14550471	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chrX:14550471C>G	ENST00000218075.4	+	2	709	c.179C>G	c.(178-180)gCa>gGa	p.A60G	GLRA2_ENST00000443437.2_5'UTR|GLRA2_ENST00000355020.4_Missense_Mutation_p.A60G	NM_002063.3	NP_002054.1	P23416	GLRA2_HUMAN	glycine receptor, alpha 2	60					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)|synapse assembly (GO:0007416)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|transmitter-gated ion channel activity (GO:0022824)	p.A60G(2)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(22)|ovary(1)|prostate(1)|skin(2)	37	Hepatocellular(33;0.128)				Ethanol(DB00898)|Glycine(DB00145)|Lindane(DB00431)	GGATATGATGCAAGAATCAGG	0.378																																							uc010nep.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|lung(1)	2						c.(178-180)GCA>GGA		glycine receptor, alpha 2 isoform A	Ethanol(DB00898)|Glycine(DB00145)						114.0	111.0	112.0					X																	14550471		2203	4300	6503	SO:0001583	missense	2742				neuropeptide signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|glycine binding|receptor activity|transmitter-gated ion channel activity	g.chrX:14550471C>G		CCDS14160.1, CCDS48085.1, CCDS55371.1	Xp22.2	2012-02-07			ENSG00000101958	ENSG00000101958		"""Ligand-gated ion channels / Glycine receptors"""	4327	protein-coding gene	gene with protein product		305990		GLR			Standard	NM_002063		Approved		uc010nep.3	P23416	OTTHUMG00000021166	ENST00000218075.4:c.179C>G	X.37:g.14550471C>G	ENSP00000218075:p.Ala60Gly					GLRA2_uc010neq.2_Missense_Mutation_p.A60G|GLRA2_uc004cwe.3_Missense_Mutation_p.A60G|GLRA2_uc011mio.1_5'UTR|GLRA2_uc011mip.1_Missense_Mutation_p.A38G	p.A60G	NM_001118885	NP_001112357	P23416	GLRA2_HUMAN			3	511	+	Hepatocellular(33;0.128)		60			Extracellular (Probable).		A8K0J6|B2R6I8|B7Z4F5|J3KQ59|Q53YX7|Q6ICQ0|Q99862	Missense_Mutation	SNP	ENST00000218075.4	37	c.179C>G	CCDS14160.1	.	.	.	.	.	.	.	.	.	.	C	15.81	2.944469	0.53079	.	.	ENSG00000101958	ENST00000218075;ENST00000355020;ENST00000415367	T;T;T	0.79454	-1.27;-1.27;-1.27	5.08	5.08	0.68730	Neurotransmitter-gated ion-channel ligand-binding (3);	0.110536	0.64402	D	0.000009	D	0.82724	0.5099	L	0.37850	1.14	0.80722	D	1	D;D;B	0.60160	0.987;0.978;0.002	D;D;B	0.74348	0.927;0.983;0.007	T	0.82835	-0.0261	10	0.42905	T	0.14	.	16.6823	0.85295	0.0:1.0:0.0:0.0	.	44;60;60	B7Z4E9;P23416;P23416-2	.;GLRA2_HUMAN;.	G	60;60;44	ENSP00000218075:A60G;ENSP00000347123:A60G;ENSP00000391606:A44G	ENSP00000218075:A60G	A	+	2	0	GLRA2	14460392	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.013000	0.76373	2.230000	0.72887	0.594000	0.82650	GCA		0.378	GLRA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055829.1			20	15	0	0	0	0.00333	0	20	15				
SH3KBP1	30011	broad.mit.edu	37	X	19650023	19650023	+	Silent	SNP	A	A	G			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chrX:19650023A>G	ENST00000397821.3	-	8	1146	c.856T>C	c.(856-858)Ttg>Ctg	p.L286L	SH3KBP1_ENST00000379698.4_Silent_p.L249L|SH3KBP1_ENST00000477102.1_5'UTR|SH3KBP1_ENST00000379716.1_Silent_p.L48L|SH3KBP1_ENST00000541422.1_Silent_p.L25L|SH3KBP1_ENST00000379697.3_Silent_p.L330L	NM_031892.2	NP_114098.1	Q96B97	SH3K1_HUMAN	SH3-domain kinase binding protein 1	286	SH3 3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				apoptotic process (GO:0006915)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|cytoskeleton organization (GO:0007010)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|regulation of cell shape (GO:0008360)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.L286L(1)		breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(8)|skin(4)	29						TTGATTGTCAATTCATCATCA	0.353																																							uc004czm.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(856-858)TTG>CTG		SH3-domain kinase binding protein 1 isoform a							223.0	186.0	199.0					X																	19650023		2202	4300	6502	SO:0001819	synonymous_variant	30011				apoptosis|cell-cell signaling|endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway	cytoplasmic vesicle membrane|cytoskeleton|cytosol|focal adhesion|nucleus|synapse|synaptosome	SH3 domain binding	g.chrX:19650023A>G	AF230904	CCDS14193.1, CCDS35213.1, CCDS55383.1	Xp22.1-p21.3	2008-02-05			ENSG00000147010	ENSG00000147010			13867	protein-coding gene	gene with protein product		300374				8889549, 7566098	Standard	NM_031892		Approved	CIN85	uc004czm.3	Q96B97	OTTHUMG00000021227	ENST00000397821.3:c.856T>C	X.37:g.19650023A>G						SH3KBP1_uc011mje.1_Silent_p.L25L|SH3KBP1_uc011mjf.1_Silent_p.L48L|SH3KBP1_uc004czl.2_Silent_p.L249L	p.L286L	NM_031892	NP_114098	Q96B97	SH3K1_HUMAN			8	1172	-			286			SH3 3.		B7Z1D5|Q5JPT4|Q5JPT5|Q8IWX6|Q8IX98|Q96RN4|Q9NYR0	Silent	SNP	ENST00000397821.3	37	c.856T>C	CCDS14193.1																																																																																				0.353	SH3KBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055992.1	NM_031892		40	29	0	0	0	0.011902	0	40	29				
MAGEB16	139604	broad.mit.edu	37	X	35820818	35820818	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chrX:35820818G>T	ENST00000399989.1	+	2	784	c.505G>T	c.(505-507)Gat>Tat	p.D169Y	MAGEB16_ENST00000399985.1_Missense_Mutation_p.D169Y|MAGEB16_ENST00000399988.1_Missense_Mutation_p.D169Y|MAGEB16_ENST00000399987.1_Missense_Mutation_p.D169Y|MAGEB16_ENST00000399992.1_Missense_Mutation_p.D201Y	NM_001099921.1	NP_001093391.1	A2A368	MAGBG_HUMAN	melanoma antigen family B, 16	169	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.D336Y(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(16)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31						ATTTGGCCTTGATGTGGTGGA	0.488																																							uc010ngt.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|ovary(2)|breast(1)|skin(1)	7						c.(505-507)GAT>TAT		melanoma antigen family B, 16							90.0	88.0	88.0					X																	35820818		2108	4214	6322	SO:0001583	missense	139604							g.chrX:35820818G>T		CCDS43927.1	Xp21.1	2010-05-26	2005-11-07		ENSG00000189023	ENSG00000189023			21188	protein-coding gene	gene with protein product		300762	"""melanoma antigen family B, 16 (pseudogene)"""			11454705	Standard	NM_001099921		Approved		uc010ngt.1	A2A368	OTTHUMG00000021348	ENST00000399989.1:c.505G>T	X.37:g.35820818G>T	ENSP00000382871:p.Asp169Tyr						p.D169Y	NM_001099921	NP_001093391	A2A368	MAGBG_HUMAN			2	784	+			169			MAGE.		A8MU30	Missense_Mutation	SNP	ENST00000399989.1	37	c.505G>T	CCDS43927.1	.	.	.	.	.	.	.	.	.	.	G	12.80	2.046088	0.36085	.	.	ENSG00000189023	ENST00000399988;ENST00000399992;ENST00000399987;ENST00000399989;ENST00000399985	T;T;T;T;T	0.05319	3.46;3.46;3.46;3.46;3.46	3.13	2.25	0.28309	.	0.287586	0.37809	N	0.001934	T	0.22322	0.0538	M	0.87381	2.88	0.09310	N	1	D	0.89917	1.0	D	0.72075	0.976	T	0.03193	-1.1062	10	0.72032	D	0.01	.	5.4132	0.16360	0.1604:0.0:0.8396:0.0	.	169	A2A368	MAGBG_HUMAN	Y	169;201;169;169;169	ENSP00000382870:D169Y;ENSP00000382874:D201Y;ENSP00000382869:D169Y;ENSP00000382871:D169Y;ENSP00000382867:D169Y	ENSP00000382867:D169Y	D	+	1	0	MAGEB16	35730739	0.424000	0.25490	0.043000	0.18650	0.100000	0.18952	0.885000	0.28227	0.732000	0.32470	0.521000	0.50471	GAT		0.488	MAGEB16-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251034.1			43	44	1	0	5.78141e-17	0.013114	7.90343e-17	43	44				
RBM10	8241	broad.mit.edu	37	X	47041247	47041247	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chrX:47041247G>T	ENST00000377604.3	+	15	2417	c.1675G>T	c.(1675-1677)Gaa>Taa	p.E559*	RBM10_ENST00000329236.7_Nonsense_Mutation_p.E481*|RBM10_ENST00000345781.6_Nonsense_Mutation_p.E482*	NM_001204467.1|NM_001204468.1|NM_005676.4	NP_001191396.1|NP_001191397.1|NP_005667.2	P98175	RBM10_HUMAN	RNA binding motif protein 10	559					3'-UTR-mediated mRNA stabilization (GO:0070935)|mRNA processing (GO:0006397)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|zinc ion binding (GO:0008270)	p.E559*(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	48						CACTGCCCAGGAATCCTACAG	0.577																																					Melanoma(171;120 2705 19495 39241)	Melanoma(171;120 2705 19495 39241)	uc004dhf.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|large_intestine(1)|prostate(1)|breast(1)|pancreas(1)	5						c.(1675-1677)GAA>TAA		RNA binding motif protein 10 isoform 1							41.0	38.0	39.0					X																	47041247		2202	4300	6502	SO:0001587	stop_gained	8241				mRNA processing|RNA splicing	chromatin remodeling complex	nucleotide binding|RNA binding|zinc ion binding	g.chrX:47041247G>T	U35373	CCDS14274.1, CCDS56600.1, CCDS75969.1	Xp11.3	2014-06-09			ENSG00000182872	ENSG00000182872		"""Zinc fingers, RAN-binding domain containing"", ""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9896	protein-coding gene	gene with protein product		300080				8590280, 8808293	Standard	NM_005676		Approved	DXS8237E, KIAA0122, GPATC9, ZRANB5, GPATCH9	uc004dhi.3	P98175	OTTHUMG00000021432	ENST00000377604.3:c.1675G>T	X.37:g.47041247G>T	ENSP00000366829:p.Glu559*					RBM10_uc004dhg.2_Nonsense_Mutation_p.E481*|RBM10_uc004dhh.2_Nonsense_Mutation_p.E558*|RBM10_uc010nhq.2_Nonsense_Mutation_p.E482*|RBM10_uc004dhi.2_Nonsense_Mutation_p.E624*	p.E559*	NM_005676	NP_005667	P98175	RBM10_HUMAN			15	2054	+			559					C4AM81|Q14136|Q5JRR2|Q9BTE4|Q9BTX0|Q9NTB1	Nonsense_Mutation	SNP	ENST00000377604.3	37	c.1675G>T	CCDS14274.1	.	.	.	.	.	.	.	.	.	.	G	40	8.287366	0.98742	.	.	ENSG00000182872	ENST00000377604;ENST00000329236;ENST00000345781	.	.	.	4.75	4.75	0.60458	.	0.358804	0.29972	N	0.010738	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	-15.9494	12.1129	0.53850	0.0:0.0:1.0:0.0	.	.	.	.	X	559;481;482	.	ENSP00000328848:E481X	E	+	1	0	RBM10	46926191	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	5.386000	0.66238	2.347000	0.79759	0.525000	0.51046	GAA		0.577	RBM10-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056381.1	NM_005676		12	12	1	0	5.50884e-06	0.001368	6.00217e-06	12	12				
NAP1L2	4674	broad.mit.edu	37	X	72434120	72434120	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chrX:72434120C>A	ENST00000373517.3	-	1	564	c.209G>T	c.(208-210)gGg>gTg	p.G70V	NAP1L2_ENST00000536638.1_Intron	NM_021963.3	NP_068798.1	Q9ULW6	NP1L2_HUMAN	nucleosome assembly protein 1-like 2	70					nucleosome assembly (GO:0006334)|positive regulation of histone H3-K14 acetylation (GO:0071442)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of neuron differentiation (GO:0045666)|regulation of stem cell division (GO:2000035)	nucleus (GO:0005634)	chromatin binding (GO:0003682)	p.G70V(1)		NS(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(12)|skin(3)	29	Renal(35;0.156)					CCCATCTTCCCCGGACCCAGC	0.527																																							uc004ebi.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)	1						c.(208-210)GGG>GTG		nucleosome assembly protein 1-like 2							131.0	105.0	114.0					X																	72434120		2203	4300	6503	SO:0001583	missense	4674				nucleosome assembly	chromatin assembly complex		g.chrX:72434120C>A	AF136178	CCDS14423.1	Xq13	2008-02-05			ENSG00000186462	ENSG00000186462			7638	protein-coding gene	gene with protein product		300026				8789438	Standard	NM_021963		Approved	BPX, MGC26243	uc004ebi.3	Q9ULW6	OTTHUMG00000021827	ENST00000373517.3:c.209G>T	X.37:g.72434120C>A	ENSP00000362616:p.Gly70Val					NAP1L2_uc011mqj.1_Intron	p.G70V	NM_021963	NP_068798	Q9ULW6	NP1L2_HUMAN			1	565	-	Renal(35;0.156)		70					B2RE61|B4E161|Q8TAN6	Missense_Mutation	SNP	ENST00000373517.3	37	c.209G>T	CCDS14423.1	.	.	.	.	.	.	.	.	.	.	c	1.842	-0.467094	0.04476	.	.	ENSG00000186462	ENST00000373517	D	0.92099	-2.97	3.17	2.29	0.28610	.	0.167394	0.40469	U	0.001087	T	0.80788	0.4690	N	0.19112	0.55	0.09310	N	0.999999	P	0.38195	0.622	B	0.33568	0.166	T	0.70432	-0.4873	10	0.26408	T	0.33	-7.5421	5.3807	0.16189	0.0:0.8379:0.0:0.1621	.	70	Q9ULW6	NP1L2_HUMAN	V	70	ENSP00000362616:G70V	ENSP00000362616:G70V	G	-	2	0	NAP1L2	72350845	0.011000	0.17503	0.024000	0.17045	0.046000	0.14306	0.455000	0.21843	0.705000	0.31890	0.600000	0.82982	GGG		0.527	NAP1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057225.1	NM_021963		49	32	1	0	6.31075e-24	0.00361	9.40173e-24	49	32				
HTATSF1	27336	broad.mit.edu	37	X	135592243	135592243	+	Silent	SNP	G	G	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chrX:135592243G>A	ENST00000218364.4	+	8	1101	c.927G>A	c.(925-927)agG>agA	p.R309R	HTATSF1_ENST00000535601.1_Silent_p.R309R	NM_014500.4	NP_055315.2	O43719	HTSF1_HUMAN	HIV-1 Tat specific factor 1	309	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R309R(1)		NS(1)|biliary_tract(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(14)|ovary(3)|prostate(1)	30	Acute lymphoblastic leukemia(192;0.000127)					CTTTCTAGAGGCACCCAGATG	0.388																																							uc004ezw.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|breast(1)	3						c.(925-927)AGG>AGA		HIV-1 Tat specific factor 1							95.0	93.0	94.0					X																	135592243		2203	4300	6503	SO:0001819	synonymous_variant	27336				regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent|viral genome replication	nucleus	nucleotide binding|protein binding|RNA binding	g.chrX:135592243G>A	U76992	CCDS14657.1	Xq26.3	2013-02-12	2006-01-09		ENSG00000102241	ENSG00000102241		"""RNA binding motif (RRM) containing"""	5276	protein-coding gene	gene with protein product		300346	"""HIV TAT specific factor 1"""			8849451	Standard	NM_014500		Approved	TAT-SF1	uc004ezx.3	O43719	OTTHUMG00000022510	ENST00000218364.4:c.927G>A	X.37:g.135592243G>A						HTATSF1_uc004ezx.2_Silent_p.R309R	p.R309R	NM_001163280	NP_001156752	O43719	HTSF1_HUMAN			9	1349	+	Acute lymphoblastic leukemia(192;0.000127)		309			RRM 2.		D3DWG9|Q59G06|Q99730	Silent	SNP	ENST00000218364.4	37	c.927G>A	CCDS14657.1																																																																																				0.388	HTATSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058497.1	NM_014500		15	91	0	0	0	0.007413	0	15	91				
AFF2	2334	broad.mit.edu	37	X	148037652	148037652	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chrX:148037652G>T	ENST00000370460.2	+	11	2556	c.2077G>T	c.(2077-2079)Gag>Tag	p.E693*	AFF2_ENST00000342251.3_Nonsense_Mutation_p.E660*|AFF2_ENST00000370457.5_Nonsense_Mutation_p.E660*|AFF2_ENST00000286437.5_Nonsense_Mutation_p.E334*	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	693					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)	p.E693*(2)|p.E334*(1)		breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					TTTGGCTCCCGAGAAGAAGAA	0.498																																							uc004fcp.2		NA																	3	Substitution - Nonsense(3)		lung(3)	ovary(3)|pancreas(2)	5						c.(2077-2079)GAG>TAG		fragile X mental retardation 2							88.0	92.0	91.0					X																	148037652		2203	4300	6503	SO:0001587	stop_gained	2334				brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding	g.chrX:148037652G>T	U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.2077G>T	X.37:g.148037652G>T	ENSP00000359489:p.Glu693*					AFF2_uc004fcq.2_Nonsense_Mutation_p.E683*|AFF2_uc004fcr.2_Nonsense_Mutation_p.E654*|AFF2_uc011mxb.1_Nonsense_Mutation_p.E658*|AFF2_uc004fcs.2_Nonsense_Mutation_p.E660*|AFF2_uc011mxc.1_Nonsense_Mutation_p.E334*	p.E693*	NM_002025	NP_002016	P51816	AFF2_HUMAN			11	2556	+	Acute lymphoblastic leukemia(192;6.56e-05)		693					A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Nonsense_Mutation	SNP	ENST00000370460.2	37	c.2077G>T	CCDS14684.1	.	.	.	.	.	.	.	.	.	.	G	41	9.019908	0.99038	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000286437	.	.	.	5.67	5.67	0.87782	.	0.055916	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	.	18.7499	0.91810	0.0:0.0:1.0:0.0	.	.	.	.	X	693;660;660;334	.	ENSP00000286437:E334X	E	+	1	0	AFF2	147845352	1.000000	0.71417	0.943000	0.38184	0.229000	0.25112	8.855000	0.92236	2.372000	0.80975	0.600000	0.82982	GAG		0.498	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025		68	63	1	0	1.74474e-33	0.00361	2.79312e-33	68	63				
TREX2	11219	broad.mit.edu	37	X	152710691	152710691	+	Silent	SNP	C	C	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chrX:152710691C>A	ENST00000334497.2	-	11	1468	c.327G>T	c.(325-327)ccG>ccT	p.P109P	HAUS7_ENST00000484394.1_5'Flank|TREX2_ENST00000370232.1_Silent_p.P109P|TREX2_ENST00000402951.1_Silent_p.P109P|TREX2_ENST00000393862.2_Silent_p.P66P|TREX2_ENST00000338525.2_Silent_p.P66P|TREX2_ENST00000330912.2_Silent_p.P66P|TREX2_ENST00000370231.2_Silent_p.P66P|TREX2_ENST00000414588.1_Silent_p.P108P			Q9BQ50	TREX2_HUMAN	three prime repair exonuclease 2	109					DNA catabolic process, exonucleolytic (GO:0000738)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)	nucleus (GO:0005634)	3'-5'-exodeoxyribonuclease activity (GO:0008296)|exodeoxyribonuclease III activity (GO:0008853)|magnesium ion binding (GO:0000287)|nucleic acid binding (GO:0003676)|protein homodimerization activity (GO:0042803)	p.P66P(1)|p.P109P(1)		endometrium(4)|large_intestine(2)|lung(3)|ovary(2)	11	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					AGGGGCGCTCCGGGCACATGC	0.667								Editing and processing nucleases																															uc010nue.1		NA																	2	Substitution - coding silent(2)		lung(2)	large_intestine(1)	1						c.(322-324)CCG>CCT	Editing_and_processing_nucleases	three prime repair exonuclease 2							32.0	32.0	32.0					X																	152710691		2199	4296	6495	SO:0001819	synonymous_variant	11219				DNA repair	nucleus	3'-5'-exodeoxyribonuclease activity|exodeoxyribonuclease III activity|nucleic acid binding	g.chrX:152710691C>A	AF151107	CCDS35437.1	Xq28	2012-05-08			ENSG00000183479	ENSG00000183479			12270	protein-coding gene	gene with protein product		300370				10391904	Standard	NM_080701		Approved		uc011myp.2	Q9BQ50	OTTHUMG00000159319	ENST00000334497.2:c.327G>T	X.37:g.152710691C>A						TREX2_uc010nud.1_Silent_p.P66P|TREX2_uc011myp.1_Silent_p.P66P|HAUS7_uc004fhl.2_RNA|HAUS7_uc004fhm.2_RNA	p.P108P	NM_080701	NP_542432	Q9BQ50	TREX2_HUMAN			3	440	-	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		109					Q45F08|Q9UN77	Silent	SNP	ENST00000334497.2	37	c.324G>T																																																																																					0.667	TREX2-001	KNOWN	alternative_5_UTR|basic	protein_coding	protein_coding	OTTHUMT00000060966.1	NM_080701		21	15	1	0	2.44723e-14	0.004656	3.20158e-14	21	15				
ATP2B3	492	broad.mit.edu	37	X	152826288	152826288	+	Silent	SNP	C	C	T			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chrX:152826288C>T	ENST00000349466.2	+	18	3320	c.2994C>T	c.(2992-2994)gaC>gaT	p.D998D	ATP2B3_ENST00000359149.3_Silent_p.D998D|ATP2B3_ENST00000263519.4_Silent_p.D998D|ATP2B3_ENST00000370186.1_Silent_p.D984D|ATP2B3_ENST00000393842.1_Silent_p.D984D|ATP2B3_ENST00000370181.2_Silent_p.D984D			Q16720	AT2B3_HUMAN	ATPase, Ca++ transporting, plasma membrane 3	998					blood coagulation (GO:0007596)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)	p.D998D(3)|p.D984D(1)		NS(2)|breast(5)|endometrium(7)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(3)	50	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					ACGTGTTCGACGGCATCTTCA	0.542																																							uc004fht.1		NA																	4	Substitution - coding silent(4)		lung(4)	pancreas(1)	1						c.(2992-2994)GAC>GAT		plasma membrane calcium ATPase 3 isoform 3b							304.0	217.0	246.0					X																	152826288		2203	4300	6503	SO:0001819	synonymous_variant	492				ATP biosynthetic process|platelet activation	integral to membrane|plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding	g.chrX:152826288C>T	U60414	CCDS14722.1, CCDS35440.1	Xq28	2014-07-18			ENSG00000067842	ENSG00000067842	3.6.3.8	"""ATPases / P-type"""	816	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 3"", ""cilia and flagella associated protein 39"""	300014	"""spinocerebellar ataxia, X-linked 1"", ""cerebellar ataxia 2 (X-linked)"""	SCAX1, CLA2		8187550, 22912398	Standard	NM_021949		Approved	PMCA3, CFAP39	uc004fht.1	Q16720	OTTHUMG00000024202	ENST00000349466.2:c.2994C>T	X.37:g.152826288C>T						ATP2B3_uc004fhs.1_Silent_p.D998D|ATP2B3_uc010nuf.1_Silent_p.D21D|ATP2B3_uc004fhu.1_5'Flank	p.D998D	NM_001001344	NP_001001344	Q16720	AT2B3_HUMAN			17	3120	+	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		998			Cytoplasmic (Potential).		B7WNR8|B7WNY5|Q12995|Q16858	Silent	SNP	ENST00000349466.2	37	c.2994C>T	CCDS35440.1																																																																																				0.542	ATP2B3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060957.1	NM_021949		54	38	0	0	0	0.00361	0	54	38				
KIAA0907	22889	broad.mit.edu	37	1	155886422	155886423	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	CT	CT	-	-	CT	CT	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr1:155886422_155886423delCT	ENST00000368321.3	-	12	1569_1570	c.1546_1547delAG	c.(1546-1548)aggfs	p.R516fs	KIAA0907_ENST00000368320.3_Frame_Shift_Del_p.R516fs	NM_014949.2	NP_055764.2	Q7Z7F0	K0907_HUMAN	KIAA0907	516							RNA binding (GO:0003723)	p.R516fs*21(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|urinary_tract(1)	21	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;8.82e-06)			TTACCTGTCCCTCTCTCTCTCT	0.396																																							uc001fmi.1		NA																	1	Deletion - Frameshift(1)		large_intestine(1)		0						c.(1546-1548)AGGfs		hypothetical protein LOC22889																																				SO:0001589	frameshift_variant	22889							g.chr1:155886422_155886423delCT	BC062637	CCDS30885.1	1q22	2012-11-30			ENSG00000132680	ENSG00000132680			29145	protein-coding gene	gene with protein product						10048485	Standard	NM_014949		Approved	BLOM7	uc001fmi.1	Q7Z7F0	OTTHUMG00000014103	ENST00000368321.3:c.1546_1547delAG	1.37:g.155886432_155886433delCT	ENSP00000357304:p.Arg516fs					KIAA0907_uc001fmj.1_Frame_Shift_Del_p.R516fs|KIAA0907_uc009wrk.1_Frame_Shift_Del_p.R373fs|KIAA0907_uc009wrl.1_RNA	p.R516fs	NM_014949	NP_055764	Q7Z7F0	K0907_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;8.82e-06)		12	1570_1571	-	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		516					O94981|Q7L7Q2|Q7Z7E9|Q8TBQ0	Frame_Shift_Del	DEL	ENST00000368321.3	37	c.1546_1547delAG	CCDS30885.1																																																																																				0.396	KIAA0907-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039583.1	NM_014949		8	393	NA	NA	NA	NA	NA	8	393	---	---	---	---
SIK2	23235	broad.mit.edu	37	11	111594606	111594606	+	Frame_Shift_Del	DEL	C	C	-			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr11:111594606delC	ENST00000304987.3	+	15	2707	c.2534delC	c.(2533-2535)tccfs	p.S845fs		NM_015191.1	NP_056006.1	Q9H0K1	SIK2_HUMAN	salt-inducible kinase 2	845					insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of insulin receptor signaling pathway (GO:0046626)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	30						TTACAGTTCTCCTATCAGACT	0.642																																							uc001plt.2		NA																	0				central_nervous_system(2)|skin(1)	3						c.(2533-2535)TCCfs		SNF1-like kinase 2							32.0	34.0	33.0					11																	111594606		2201	4297	6498	SO:0001589	frameshift_variant	23235				intracellular protein kinase cascade|regulation of insulin receptor signaling pathway	Golgi apparatus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity	g.chr11:111594606delC	AB018324	CCDS8347.1	11q23.1	2008-12-23	2008-12-23	2008-12-23	ENSG00000170145	ENSG00000170145			21680	protein-coding gene	gene with protein product		608973	"""SNF1-like kinase 2"""	SNF1LK2		15067358	Standard	NM_015191		Approved	KIAA0781, QIK, DKFZp434K1115, LOH11CR1I	uc001plt.3	Q9H0K1	OTTHUMG00000150644	ENST00000304987.3:c.2534delC	11.37:g.111594606delC	ENSP00000305976:p.Ser845fs						p.S845fs	NM_015191	NP_056006	Q9H0K1	SIK2_HUMAN			15	2652	+			845					A8K5B8|B0YJ94|O94878|Q17RV0|Q6AZE2|Q76N03|Q8NCV7|Q96CZ8	Frame_Shift_Del	DEL	ENST00000304987.3	37	c.2534delC	CCDS8347.1																																																																																				0.642	SIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319352.3	NM_015191		12	35	NA	NA	NA	NA	NA	12	35	---	---	---	---
ITGBL1	9358	broad.mit.edu	37	13	102105283	102105286	+	Splice_Site	DEL	GTAA	GTAA	-			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	GTAA	GTAA	-	-	GTAA	GTAA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr13:102105283_102105286delGTAA	ENST00000376180.3	+	1	317		c.e1+1		ITGBL1_ENST00000545560.2_Splice_Site	NM_001271756.1|NM_004791.1	NP_001258685.1|NP_004782.1	O95965	ITGBL_HUMAN	integrin, beta-like 1 (with EGF-like repeat domains)						cell adhesion (GO:0007155)	extracellular region (GO:0005576)				breast(1)|large_intestine(6)|lung(16)|ovary(1)|prostate(4)|skin(3)	31	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					CATCTCTGAGGTAAGTTTGGTTTG	0.52																																							uc001vpb.2		NA																	0				ovary(1)|skin(1)	2						c.e1+1		integrin, beta-like 1 (with EGF-like repeat																																				SO:0001630	splice_region_variant	9358				cell-matrix adhesion|integrin-mediated signaling pathway	extracellular region|integrin complex	binding|receptor activity	g.chr13:102105283_102105286delGTAA	AF072752	CCDS9499.1, CCDS61361.1, CCDS61362.1, CCDS73594.1	13q33	2008-07-18			ENSG00000198542	ENSG00000198542			6164	protein-coding gene	gene with protein product	"""ten integrin EGF-like repeat domains protein"", ""ITGBL1, integrin beta-like 1"""	604234				10051402	Standard	NM_004791		Approved	TIED, OSCP	uc001vpb.4	O95965	OTTHUMG00000017296	ENST00000376180.3:c.98+1GTAA>-	13.37:g.102105283_102105286delGTAA						ITGBL1_uc010agb.2_Splice_Site_p.R33_splice|ITGBL1_uc001vpc.3_Splice_Site	p.R33_splice	NM_004791	NP_004782	O95965	ITGBL_HUMAN			1	317	+	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)							A8K5M5|B3KTP1|B4DQ02|Q8N172|Q9NPR0	Splice_Site	DEL	ENST00000376180.3	37	c.98_splice	CCDS9499.1																																																																																				0.520	ITGBL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045669.2	NM_004791	Intron	27	88	NA	NA	NA	NA	NA	27	88	---	---	---	---
ITGA3	3675	broad.mit.edu	37	17	48148712	48148713	+	Frame_Shift_Ins	INS	-	-	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr17:48148712_48148713insA	ENST00000320031.8	+	6	1119_1120	c.789_790insA	c.(790-792)aaafs	p.K264fs	ITGA3_ENST00000544892.1_Frame_Shift_Ins_p.K39fs|ITGA3_ENST00000007722.7_Frame_Shift_Ins_p.K264fs	NM_002204.2|NM_005501.2	NP_002195.1|NP_005492.1	P26006	ITA3_HUMAN	integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)	264					blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|lung development (GO:0030324)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|negative regulation of cell projection organization (GO:0031345)|nephron development (GO:0072006)|neuron migration (GO:0001764)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|regulation of BMP signaling pathway (GO:0030510)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of Wnt signaling pathway (GO:0030111)|renal filtration (GO:0097205)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|skin development (GO:0043588)	basolateral plasma membrane (GO:0016323)|cell periphery (GO:0071944)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integrin alpha3-beta1 complex (GO:0034667)|integrin complex (GO:0008305)|invadopodium membrane (GO:0071438)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	glycoprotein binding (GO:0001948)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)			endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)	31						TCCTGCACCCCAAAAACATCAC	0.574																																							uc010dbl.2		NA																	0				ovary(2)|pancreas(1)	3						c.(787-792)CCCAAAfs		integrin alpha 3 isoform a precursor																																				SO:0001589	frameshift_variant	3675				blood coagulation|cell-matrix adhesion|integrin-mediated signaling pathway|leukocyte migration	cell surface|integrin complex	protein binding|receptor activity	g.chr17:48148712_48148713insA	M59911	CCDS11557.1, CCDS11558.1	17q21.33	2010-03-23	2003-10-13		ENSG00000005884	ENSG00000005884		"""CD molecules"", ""Integrins"""	6139	protein-coding gene	gene with protein product		605025	"""antigen identified by monoclonal antibody J143"""	MSK18		1655803, 9704023	Standard	NM_005501		Approved	CD49c, VLA3a, VCA-2, GAP-B3	uc010dbm.3	P26006	OTTHUMG00000161890	ENST00000320031.8:c.794dupA	17.37:g.48148717_48148717dupA	ENSP00000315190:p.Lys264fs					ITGA3_uc010dbm.2_Frame_Shift_Ins_p.P263fs	p.P263fs	NM_002204	NP_002195	P26006	ITA3_HUMAN			6	1253_1254	+			263_264			FG-GAP 4.|Extracellular (Potential).		A7E246|B7ZM80|B9EGQ1|D3DTX4|D3DTX5	Frame_Shift_Ins	INS	ENST00000320031.8	37	c.789_790insA	CCDS11558.1																																																																																				0.574	ITGA3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000366298.1	NM_005501		19	58	NA	NA	NA	NA	NA	19	58	---	---	---	---
NDUFAF7	55471	broad.mit.edu	37	2	37474741	37474742	+	Frame_Shift_Ins	INS	-	-	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr2:37474741_37474742insA	ENST00000002125.4	+	9	1119_1120	c.1079_1080insA	c.(1078-1083)ttaaaafs	p.LK360fs	NDUFAF7_ENST00000336237.6_Frame_Shift_Ins_p.LK262fs	NM_144736.4	NP_653337.1	Q7L592	NDUF7_HUMAN	NADH dehydrogenase (ubiquinone) complex I, assembly factor 7	360					methylation (GO:0032259)|mitochondrial respiratory chain complex I assembly (GO:0032981)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	enzyme binding (GO:0019899)|methyltransferase activity (GO:0008168)										CACACATTTTTAAAAAATATGG	0.347																																							uc002rqa.3		NA																	0				central_nervous_system(1)	1						c.(1078-1080)TTAfs		hypothetical protein LOC55471 isoform 1																																				SO:0001589	frameshift_variant	55471				mitochondrial respiratory chain complex I assembly	mitochondrion	enzyme binding|methyltransferase activity	g.chr2:37474741_37474742insA		CCDS1788.1, CCDS42673.1	2p22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000003509	ENSG00000003509		"""Mitochondrial respiratory chain complex assembly factors"""	28816	protein-coding gene	gene with protein product	"""mitochondrial dysfunction protein A homolog"""	615898	"""chromosome 2 open reading frame 56"""	C2orf56			Standard	NM_144736		Approved	PRO1853, MidA	uc002rqa.4	Q7L592	OTTHUMG00000128468	ENST00000002125.4:c.1085dupA	2.37:g.37474747_37474747dupA	ENSP00000002125:p.Leu360fs					C2orf56_uc010ynj.1_RNA|C2orf56_uc002rqc.3_Frame_Shift_Ins_p.L262fs|C2orf56_uc010ynk.1_Frame_Shift_Ins_p.L289fs|C2orf56_uc010ynl.1_Frame_Shift_Ins_p.L333fs|C2orf56_uc010fah.2_RNA	p.L360fs	NM_144736	NP_653337	Q7L592	MIDA_HUMAN			9	1154_1155	+		all_hematologic(82;0.21)	360					Q7Z399|Q9P1G3	Frame_Shift_Ins	INS	ENST00000002125.4	37	c.1079_1080insA	CCDS1788.1																																																																																				0.347	NDUFAF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250267.1	NM_144736		31	93	NA	NA	NA	NA	NA	31	93	---	---	---	---
HDLBP	3069	broad.mit.edu	37	2	242194509	242194509	+	Frame_Shift_Del	DEL	T	T	-			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr2:242194509delT	ENST00000391975.1	-	9	1372	c.1145delA	c.(1144-1146)aagfs	p.K383fs	HDLBP_ENST00000391976.2_Frame_Shift_Del_p.K383fs|HDLBP_ENST00000310931.4_Frame_Shift_Del_p.K383fs|HDLBP_ENST00000427183.2_Frame_Shift_Del_p.K350fs	NM_203346.3	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein	383	KH 4. {ECO:0000255|PROSITE- ProRule:PRU00117}.				cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)	cytoplasm (GO:0005737)|high-density lipoprotein particle (GO:0034364)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)			breast(7)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(11)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)		CTGCCCTTTCTTGCCAATGAT	0.478																																							uc002waz.2		NA																	0				breast(3)|skin(1)	4						c.(1144-1146)AAGfs		high density lipoprotein binding protein							198.0	211.0	207.0					2																	242194509		2203	4300	6503	SO:0001589	frameshift_variant	3069				cholesterol metabolic process|lipid transport	cytoplasm|high-density lipoprotein particle|nucleus|plasma membrane	lipid binding|protein binding|RNA binding	g.chr2:242194509delT		CCDS2547.1, CCDS58760.1	2q37.3	2008-07-18	2008-07-18		ENSG00000115677	ENSG00000115677			4857	protein-coding gene	gene with protein product		142695	"""vigilin"""	VGL		1318310, 8390966	Standard	NM_005336		Approved	HBP	uc002waz.3	Q00341	OTTHUMG00000133391	ENST00000391975.1:c.1145delA	2.37:g.242194509delT	ENSP00000375836:p.Lys383fs					HDLBP_uc002wba.2_Frame_Shift_Del_p.K382fs|HDLBP_uc002wbb.2_Frame_Shift_Del_p.K334fs|HDLBP_uc010fzn.1_Frame_Shift_Del_p.K111fs	p.K382fs	NM_203346	NP_976221	Q00341	VIGLN_HUMAN		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)	9	1373	-		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)	382			KH 4.		B4DTQ2|E7EM71|Q53QU2|Q9UCY3	Frame_Shift_Del	DEL	ENST00000391975.1	37	c.1145delA	CCDS2547.1																																																																																				0.478	HDLBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257245.5	NM_203346		147	382	NA	NA	NA	NA	NA	147	382	---	---	---	---
RBM15B	29890	broad.mit.edu	37	3	51431352	51431353	+	Frame_Shift_Ins	INS	-	-	G			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr3:51431352_51431353insG	ENST00000323686.4	+	1	2622_2623	c.2522_2523insG	c.(2521-2526)gtggggfs	p.VG841fs		NM_013286.4	NP_037418.3	Q8NDT2	RB15B_HUMAN	RNA binding motif protein 15B	841	Interaction with Epstein-Barr virus BMLF1.|SPOC. {ECO:0000255|PROSITE- ProRule:PRU00249}.				mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|large_intestine(5)|lung(3)	12				BRCA - Breast invasive adenocarcinoma(193;0.000224)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		AGCTTGCCAGTGGGGGGGTCCA	0.609																																							uc003dbd.2		NA																	0					0						c.(2521-2523)GTGfs		RNA binding motif protein 15B																																				SO:0001589	frameshift_variant	29890				interspecies interaction between organisms|mRNA processing|regulation of alternative nuclear mRNA splicing, via spliceosome|regulation of transcription, DNA-dependent|RNA splicing|transcription, DNA-dependent	nucleoplasm	nucleotide binding|protein binding|RNA binding	g.chr3:51431352_51431353insG	AL831838	CCDS33764.1	3p21.1	2013-02-12			ENSG00000179837	ENSG00000259956		"""RNA binding motif (RRM) containing"""	24303	protein-coding gene	gene with protein product		612602				16129689	Standard	NM_013286		Approved	HUMAGCGB, OTT3	uc003dbd.3	Q8NDT2	OTTHUMG00000156896	ENST00000323686.4:c.2529dupG	3.37:g.51431359_51431359dupG	ENSP00000313890:p.Val841fs						p.V841fs	NM_013286	NP_037418	Q8NDT2	RB15B_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000224)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	1	2622_2623	+			841			Interaction with Epstein-Barr virus BMLF1.|SPOC.		A4QPG7|Q6QE19|Q9BV96	Frame_Shift_Ins	INS	ENST00000323686.4	37	c.2522_2523insG	CCDS33764.1																																																																																				0.609	RBM15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346489.1	NM_013286		24	64	NA	NA	NA	NA	NA	24	64	---	---	---	---
PIGG	54872	broad.mit.edu	37	4	514917	514919	+	In_Frame_Del	DEL	AGC	AGC	-			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	AGC	AGC	-	-	AGC	AGC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr4:514917_514919delAGC	ENST00000453061.2	+	7	1293_1295	c.1187_1189delAGC	c.(1186-1191)aagcat>aat	p.396_397KH>N	PIGG_ENST00000509768.1_In_Frame_Del_p.307_308KH>N|PIGG_ENST00000503111.1_Intron|PIGG_ENST00000296306.7_Intron|PIGG_ENST00000504346.1_In_Frame_Del_p.307_308KH>N|PIGG_ENST00000536264.1_In_Frame_Del_p.274_275KH>N|PIGG_ENST00000310340.5_In_Frame_Del_p.396_397KH>N|PIGG_ENST00000383028.4_In_Frame_Del_p.263_264KH>N	NM_001127178.1	NP_001120650.1	Q5H8A4	PIGG_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class G	396					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	CP2 mannose-ethanolamine phosphotransferase activity (GO:0051267)|phosphotransferase activity, for other substituted phosphate groups (GO:0016780)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	39						TTGGAGGAAAAGCATTCAGAAGT	0.473																																							uc003gak.3		NA																	0				central_nervous_system(2)|ovary(1)|skin(1)	4						c.(1186-1191)AAGCAT>AAT		phosphatidylinositol glycan anchor biosynthesis,																																				SO:0001651	inframe_deletion	54872				C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	CP2 mannose-ethanolamine phosphotransferase activity	g.chr4:514917_514919delAGC		CCDS3336.1, CCDS46992.1, CCDS75080.1, CCDS75081.1, CCDS75082.1, CCDS75083.1	4p16.3	2013-02-26	2006-06-28		ENSG00000174227	ENSG00000174227		"""Phosphatidylinositol glycan anchor biosynthesis"""	25985	protein-coding gene	gene with protein product			"""phosphatidylinositol glycan, class G"""			15632136	Standard	XM_005272287		Approved	FLJ20265, GPI7, LAS21	uc003gak.4	Q5H8A4	OTTHUMG00000112457	ENST00000453061.2:c.1187_1189delAGC	4.37:g.514917_514919delAGC	ENSP00000415203:p.Lys396_His397delinsAsn					PIGG_uc003gaj.3_In_Frame_Del_p.396_397KH>N|PIGG_uc011bux.1_RNA|PIGG_uc010ibf.2_In_Frame_Del_p.263_264KH>N|PIGG_uc003gal.3_In_Frame_Del_p.307_308KH>N|PIGG_uc003gai.2_RNA|PIGG_uc011buw.1_In_Frame_Del_p.274_275KH>N|PIGG_uc003gam.2_Intron|PIGG_uc003gan.2_In_Frame_Del_p.307_308KH>N	p.396_397KH>N	NM_001127178	NP_001120650	Q5H8A4	PIGG_HUMAN			7	1323_1325	+			396_397			Lumenal (Potential).		B4DKC7|Q2TAK5|Q6UX31|Q7L5Y4|Q8N866|Q8NCC9|Q96SY9|Q9BVT7|Q9NXG5	In_Frame_Del	DEL	ENST00000453061.2	37	c.1187_1189delAGC	CCDS46992.1																																																																																				0.473	PIGG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000357494.1	NM_017733		37	162	NA	NA	NA	NA	NA	37	162	---	---	---	---
HAUS3	79441	broad.mit.edu	37	4	2242588	2242591	+	Frame_Shift_Del	DEL	CAGT	CAGT	-			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	CAGT	CAGT	-	-	CAGT	CAGT	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr4:2242588_2242591delCAGT	ENST00000243706.4	-	2	312_315	c.83_86delACTG	c.(82-87)gactggfs	p.DW28fs	POLN_ENST00000511885.2_Intron|HAUS3_ENST00000506763.1_Frame_Shift_Del_p.DW28fs|HAUS3_ENST00000443786.2_Frame_Shift_Del_p.DW28fs|POLN_ENST00000515357.1_Intron	NM_024511.5	NP_078787.2	Q68CZ6	HAUS3_HUMAN	HAUS augmin-like complex, subunit 3	28					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				breast(3)|endometrium(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						CTCAAACAACCAGTCAAAGTCTTC	0.373																																							uc003ges.1		NA																	0				large_intestine(2)|breast(2)	4						c.(82-87)GACTGGfs		HAUS augmin-like complex, subunit 3																																				SO:0001589	frameshift_variant	79441				cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|spindle		g.chr4:2242588_2242591delCAGT	AF040964	CCDS33941.1	4p16.3	2013-10-11	2009-04-20	2009-04-20	ENSG00000214367	ENSG00000214367		"""HAUS augmin-like complex subunits"""	28719	protein-coding gene	gene with protein product		613430	"""chromosome 4 open reading frame 15"""	C4orf15		19427217, 19812674	Standard	NM_024511		Approved	MGC4701, IT1, dgt3	uc003ges.1	Q68CZ6		ENST00000243706.4:c.83_86delACTG	4.37:g.2242588_2242591delCAGT	ENSP00000243706:p.Asp28fs					POLN_uc011bvi.1_Intron|HAUS3_uc011bvj.1_Frame_Shift_Del_p.D28fs|HAUS3_uc003get.1_Frame_Shift_Del_p.D28fs	p.D28fs	NM_024511	NP_078787	Q68CZ6	HAUS3_HUMAN			2	313_316	-			28_29					B4DF64|O43606|Q8TAZ5|Q9BTJ9	Frame_Shift_Del	DEL	ENST00000243706.4	37	c.83_86delACTG	CCDS33941.1																																																																																				0.373	HAUS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357446.1	NM_024511		31	139	NA	NA	NA	NA	NA	31	139	---	---	---	---
HERC3	8916	broad.mit.edu	37	4	89574037	89574038	+	Frame_Shift_Ins	INS	-	-	G			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr4:89574037_89574038insG	ENST00000402738.1	+	6	720_721	c.481_482insG	c.(481-483)tggfs	p.W161fs	HERC3_ENST00000264345.3_Frame_Shift_Ins_p.W161fs|HERC3_ENST00000407637.1_Frame_Shift_Ins_p.W161fs	NM_001271602.1|NM_014606.1	NP_001258531.1|NP_055421.1	Q15034	HERC3_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 3	161					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|prostate(2)|skin(2)	45				OV - Ovarian serous cystadenocarcinoma(123;0.000319)		GTTCTTCACCTGGGGAAAGAAC	0.495																																							uc003hrw.1		NA																	0				lung(2)|prostate(1)|skin(1)	4						c.(481-483)TGGfs		hect domain and RLD 3																																				SO:0001589	frameshift_variant	8916				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasmic membrane-bounded vesicle	ubiquitin-protein ligase activity	g.chr4:89574037_89574038insG	D25215	CCDS34028.1	4q21	2012-02-23	2012-02-23		ENSG00000138641	ENSG00000138641			4876	protein-coding gene	gene with protein product		605200	"""hect domain and RLD 3"""			10702688	Standard	NM_014606		Approved	KIAA0032	uc003hrw.2	Q15034	OTTHUMG00000150436	ENST00000402738.1:c.485dupG	4.37:g.89574041_89574041dupG	ENSP00000385684:p.Trp161fs					HERC3_uc003hrv.2_Frame_Shift_Ins_p.W161fs|HERC3_uc011cdn.1_Frame_Shift_Ins_p.W43fs	p.W161fs	NM_014606	NP_055421	Q15034	HERC3_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000319)	6	647_648	+			161			RCC1 4.		A8K1S5|Q8IXX3	Frame_Shift_Ins	INS	ENST00000402738.1	37	c.481_482insG	CCDS34028.1																																																																																				0.495	HERC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318081.2	NM_014606		12	51	NA	NA	NA	NA	NA	12	51	---	---	---	---
SEC24B	10427	broad.mit.edu	37	4	110454835	110454836	+	Frame_Shift_Ins	INS	-	-	A			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr4:110454835_110454836insA	ENST00000265175.5	+	22	3637_3638	c.3582_3583insA	c.(3583-3585)aaafs	p.K1195fs	SEC24B_ENST00000504968.2_Frame_Shift_Ins_p.K1225fs|SEC24B_ENST00000399100.2_Frame_Shift_Ins_p.K1160fs	NM_006323.2	NP_006314.2	O95487	SC24B_HUMAN	SEC24 family member B	1195					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|aorta morphogenesis (GO:0035909)|auditory receptor cell stereocilium organization (GO:0060088)|cellular protein metabolic process (GO:0044267)|cochlear nucleus development (GO:0021747)|COPII vesicle coating (GO:0048208)|coronary artery morphogenesis (GO:0060982)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|lung lobe morphogenesis (GO:0060463)|membrane organization (GO:0061024)|neural tube closure (GO:0001843)|outflow tract morphogenesis (GO:0003151)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|pulmonary artery morphogenesis (GO:0061156)|regulation of cargo loading into COPII-coated vesicle (GO:1901301)|regulation of establishment of planar polarity involved in neural tube closure (GO:0090178)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|membrane (GO:0016020)	transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(12)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.03e-05)		CAATACCACAGAAAATGGTCAG	0.282																																							uc003hzk.2		NA																	0				ovary(2)|large_intestine(1)	3						c.(3580-3585)CAGAAAfs		SEC24 (S. cerevisiae) homolog B isoform a																																				SO:0001589	frameshift_variant	10427				COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	protein binding|transporter activity|zinc ion binding	g.chr4:110454835_110454836insA	AJ131245	CCDS43260.1, CCDS47124.1, CCDS75179.1	4q25	2013-10-21	2013-10-21		ENSG00000138802	ENSG00000138802			10704	protein-coding gene	gene with protein product		607184	"""SEC24 (S. cerevisiae) related gene family, member B"", ""SEC24 family, member B (S. cerevisiae)"""			10075675, 10329445	Standard	XM_005262688		Approved		uc003hzk.3	O95487	OTTHUMG00000161372	ENST00000265175.5:c.3586dupA	4.37:g.110454839_110454839dupA	ENSP00000265175:p.Lys1195fs					SEC24B_uc003hzl.2_Frame_Shift_Ins_p.Q1159fs|SEC24B_uc011cfp.1_Frame_Shift_Ins_p.Q1224fs|SEC24B_uc011cfq.1_Frame_Shift_Ins_p.Q1193fs|SEC24B_uc011cfr.1_Frame_Shift_Ins_p.Q1158fs	p.Q1194fs	NM_006323	NP_006314	O95487	SC24B_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;3.03e-05)	22	3637_3638	+		Hepatocellular(203;0.217)	1194_1195					B7ZKM8|B7ZKN4|Q0VG08	Frame_Shift_Ins	INS	ENST00000265175.5	37	c.3582_3583insA	CCDS47124.1																																																																																				0.282	SEC24B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364693.2			11	141	NA	NA	NA	NA	NA	11	141	---	---	---	---
SLC39A4	55630	broad.mit.edu	37	8	145637952	145637954	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-05-4418-01A-01D-1265-08	TCGA-05-4418-10A-01D-1265-08	CAG	CAG	-	-	CAG	CAG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b07397ae-592b-4eb4-98b3-7c7e81ecb5e0	87327c8c-1c44-418e-be9e-f19acb730fb5	g.chr8:145637952_145637954delCAG	ENST00000301305.3	-	12	2017_2019	c.1912_1914delCTG	c.(1912-1914)ctgdel	p.L638del	SLC39A4_ENST00000276833.5_In_Frame_Del_p.L613del|SLC39A4_ENST00000531013.1_5'UTR|GS1-393G12.14_ENST00000607491.1_RNA	NM_130849.2	NP_570901	Q6P5W5	S39A4_HUMAN	solute carrier family 39 (zinc transporter), member 4	638					cellular response to zinc ion starvation (GO:0034224)|cellular zinc ion homeostasis (GO:0006882)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	zinc ion transmembrane transporter activity (GO:0005385)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	14	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;1.12e-40)|all cancers(56;8.17e-36)|BRCA - Breast invasive adenocarcinoma(115;0.0407)|Colorectal(110;0.055)			CGTACAGGGACAGCAGCAGCAGG	0.601																																							uc003zcq.2		NA																	0					0						c.(1912-1914)CTGdel		solute carrier family 39 (zinc transporter),																																				SO:0001651	inframe_deletion	55630					cytoplasmic membrane-bounded vesicle|integral to membrane|recycling endosome membrane	zinc ion transmembrane transporter activity	g.chr8:145637952_145637954delCAG	AK025537	CCDS6424.1, CCDS43782.1	8q24.3	2013-05-22			ENSG00000147804	ENSG00000147804		"""Solute carriers"""	17129	protein-coding gene	gene with protein product		607059	"""acrodermatitis enteropathica, zinc-deficiency type"""	AEZ		12801924, 12659941, 14709598	Standard	NM_017767		Approved	ZIP4, AWMS2	uc003zcq.3	Q6P5W5		ENST00000301305.3:c.1912_1914delCTG	8.37:g.145637961_145637963delCAG	ENSP00000301305:p.Leu638del					SLC39A4_uc003zcm.1_3'UTR|SLC39A4_uc003zcn.2_In_Frame_Del_p.L140del|SLC39A4_uc003zco.2_In_Frame_Del_p.L362del|SLC39A4_uc003zcp.2_In_Frame_Del_p.L613del	p.L638del	NM_130849	NP_570901	Q6P5W5	S39A4_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;1.12e-40)|all cancers(56;8.17e-36)|BRCA - Breast invasive adenocarcinoma(115;0.0407)|Colorectal(110;0.055)		12	2012_2014	-	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		638			Helical; Name=6; (Potential).		Q7L5S5|Q9H6T8|Q9NXC4	In_Frame_Del	DEL	ENST00000301305.3	37	c.1912_1914delCTG	CCDS6424.1																																																																																				0.601	SLC39A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382688.1			7	485	NA	NA	NA	NA	NA	7	485	---	---	---	---
