#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
HES4	57801	broad.mit.edu	37	1	935138	935138	+	Silent	SNP	G	G	C	rs140166926	byFrequency	TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr1:935138G>C	ENST00000304952.6	-	2	275	c.138C>G	c.(136-138)cgC>cgG	p.R46R	RP11-54O7.17_ENST00000606034.1_lincRNA|HES4_ENST00000428771.2_Silent_p.R72R|HES4_ENST00000484667.2_Intron			Q9HCC6	HES4_HUMAN	hes family bHLH transcription factor 4	46	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription factor binding (GO:0008134)	p.R46R(1)		lung(2)	2	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;9.36e-38)|OV - Ovarian serous cystadenocarcinoma(86;4.41e-23)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00237)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		TACGCGCTCGGCGCCGCTTCT	0.701																																							uc001aci.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(136-138)CGC>CGG		hairy and enhancer of split 4 isoform 2							25.0	29.0	28.0					1																	935138		2191	4290	6481	SO:0001819	synonymous_variant	57801				cell differentiation|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr1:935138G>C	BC012351	CCDS5.1, CCDS44034.1	1p36	2013-10-17	2013-10-17		ENSG00000188290	ENSG00000188290		"""Basic helix-loop-helix proteins"""	24149	protein-coding gene	gene with protein product		608060	"""hairy and enhancer of split 4 (Drosophila)"""			11260262, 15254753	Standard	NM_021170		Approved	bHLHb42	uc001aci.2	Q9HCC6	OTTHUMG00000040758	ENST00000304952.6:c.138C>G	1.37:g.935138G>C						HES4_uc010nyc.1_Silent_p.R72R	p.R46R	NM_021170	NP_066993	Q9HCC6	HES4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;9.36e-38)|OV - Ovarian serous cystadenocarcinoma(86;4.41e-23)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00237)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)	2	337	-	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)	46			Basic motif.		Q5SVA5	Silent	SNP	ENST00000304952.6	37	c.138C>G	CCDS5.1																																																																																				0.701	HES4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097944.1	NM_021170		8	36	0	0	0	0.004007	0	8	36				
TMEM201	199953	broad.mit.edu	37	1	9658630	9658630	+	Silent	SNP	C	C	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr1:9658630C>T	ENST00000340381.6	+	4	562	c.553C>T	c.(553-555)Ctg>Ttg	p.L185L	TMEM201_ENST00000377376.4_Silent_p.L185L|TMEM201_ENST00000340305.5_Silent_p.L185L	NM_001130924.2	NP_001124396.2	Q5SNT2	TM201_HUMAN	transmembrane protein 201	185					fibroblast migration (GO:0010761)|nuclear migration (GO:0007097)	integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)		p.L185L(2)		lung(3)|upper_aerodigestive_tract(1)	4	all_lung(157;0.222)	all_epithelial(116;2.09e-14)|Renal(390;0.000469)|all_lung(118;0.000521)|Lung NSC(185;0.000744)|Colorectal(325;0.0062)|Breast(348;0.0157)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.5e-08)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|STAD - Stomach adenocarcinoma(132;0.00345)|READ - Rectum adenocarcinoma(331;0.0419)		GCTGCGCGCCCTGTTGCTCAG	0.642																																							uc001apz.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(553-555)CTG>TTG		transmembrane protein 201 isoform 1							54.0	51.0	52.0					1																	9658630		2203	4300	6503	SO:0001819	synonymous_variant	199953					integral to membrane|nuclear inner membrane		g.chr1:9658630C>T		CCDS30579.1, CCDS44055.1, CCDS44055.2	1p36.22	2009-11-06			ENSG00000188807	ENSG00000188807			33719	protein-coding gene	gene with protein product							Standard	NM_001130924		Approved	RP13-15M17.2, NET5	uc021ofy.1	Q5SNT2	OTTHUMG00000057457	ENST00000340381.6:c.553C>T	1.37:g.9658630C>T						TMEM201_uc001apy.2_Silent_p.L185L	p.L185L	NM_001130924	NP_001124396	Q5SNT2	TM201_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.5e-08)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|STAD - Stomach adenocarcinoma(132;0.00345)|READ - Rectum adenocarcinoma(331;0.0419)	4	565	+	all_lung(157;0.222)	all_epithelial(116;2.09e-14)|Renal(390;0.000469)|all_lung(118;0.000521)|Lung NSC(185;0.000744)|Colorectal(325;0.0062)|Breast(348;0.0157)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)	185					B9EH90|Q5SNT3	Silent	SNP	ENST00000340381.6	37	c.553C>T	CCDS44055.2	.	.	.	.	.	.	.	.	.	.	C	10.76	1.442139	0.25987	.	.	ENSG00000188807	ENST00000416541	.	.	.	5.4	4.49	0.54785	.	.	.	.	.	T	0.62708	0.2450	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60806	-0.7190	4	.	.	.	-17.4745	11.2818	0.49199	0.0:0.9161:0.0:0.0839	.	.	.	.	L	94	.	.	P	+	2	0	TMEM201	9581217	0.993000	0.37304	1.000000	0.80357	0.969000	0.65631	2.822000	0.48073	1.285000	0.44548	0.561000	0.74099	CCT		0.642	TMEM201-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127672.1	NM_001010866		24	49	0	0	0	0.004656	0	24	49				
PEX14	5195	broad.mit.edu	37	1	10690005	10690005	+	Silent	SNP	G	G	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr1:10690005G>A	ENST00000356607.4	+	9	1175	c.1095G>A	c.(1093-1095)cgG>cgA	p.R365R	PEX14_ENST00000538836.1_Silent_p.R301R	NM_004565.2	NP_004556.1	O75381	PEX14_HUMAN	peroxisomal biogenesis factor 14	365					microtubule anchoring (GO:0034453)|negative regulation of protein binding (GO:0032091)|negative regulation of protein homotetramerization (GO:1901094)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|peroxisome organization (GO:0007031)|peroxisome transport along microtubule (GO:0036250)|protein complex assembly (GO:0006461)|protein homooligomerization (GO:0051260)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome matrix, substrate release (GO:0044721)|protein import into peroxisome matrix, translocation (GO:0016561)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|protein N-terminus binding (GO:0047485)|receptor binding (GO:0005102)|transcription corepressor activity (GO:0003714)	p.R365R(1)		breast(3)|endometrium(1)|large_intestine(3)|lung(5)|prostate(1)	13	Ovarian(185;0.203)	all_lung(284;6.02e-06)|Lung NSC(185;9.62e-06)|Renal(390;0.000147)|Breast(348;0.000932)|Colorectal(325;0.00215)|Hepatocellular(190;0.00913)|Ovarian(437;0.023)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0292)|Colorectal(212;9.13e-08)|COAD - Colon adenocarcinoma(227;2.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000482)|Kidney(185;0.00174)|KIRC - Kidney renal clear cell carcinoma(229;0.00457)|STAD - Stomach adenocarcinoma(132;0.0249)|READ - Rectum adenocarcinoma(331;0.0419)		AGAAGCTGCGGCGGCCCGAGG	0.677																																							uc001arn.2		NA																	1	Substitution - coding silent(1)		lung(1)	breast(1)	1						c.(1093-1095)CGG>CGA		peroxisomal biogenesis factor 14							101.0	117.0	112.0					1																	10690005		2203	4300	6503	SO:0001819	synonymous_variant	5195				negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription, DNA-dependent|protein homooligomerization|protein import into peroxisome matrix|transmembrane transport	integral to membrane|nucleus|peroxisomal membrane|protein complex	protein N-terminus binding|transcription corepressor activity	g.chr1:10690005G>A	AF045186	CCDS30582.1	1p36.22	2008-05-14			ENSG00000142655	ENSG00000142655			8856	protein-coding gene	gene with protein product		601791				9653144	Standard	NM_004565		Approved		uc001arn.3	O75381	OTTHUMG00000001908	ENST00000356607.4:c.1095G>A	1.37:g.10690005G>A						PEX14_uc009vmv.2_Silent_p.R301R|PEX14_uc010oam.1_Silent_p.R301R|PEX14_uc010oan.1_Silent_p.R322R|PEX14_uc009vmw.2_Silent_p.R301R	p.R365R	NM_004565	NP_004556	O75381	PEX14_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0292)|Colorectal(212;9.13e-08)|COAD - Colon adenocarcinoma(227;2.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000482)|Kidney(185;0.00174)|KIRC - Kidney renal clear cell carcinoma(229;0.00457)|STAD - Stomach adenocarcinoma(132;0.0249)|READ - Rectum adenocarcinoma(331;0.0419)	9	1116	+	Ovarian(185;0.203)	all_lung(284;6.02e-06)|Lung NSC(185;9.62e-06)|Renal(390;0.000147)|Breast(348;0.000932)|Colorectal(325;0.00215)|Hepatocellular(190;0.00913)|Ovarian(437;0.023)|Myeloproliferative disorder(586;0.0255)	365					B2R7N1|B3KML6|B7Z1N2|Q8WX51	Silent	SNP	ENST00000356607.4	37	c.1095G>A	CCDS30582.1																																																																																				0.677	PEX14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005414.1			21	38	0	0	0	0.012319	0	21	38				
PRAMEF12	390999	broad.mit.edu	37	1	12836257	12836257	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr1:12836257C>T	ENST00000357726.4	+	2	886	c.859C>T	c.(859-861)Ctc>Ttc	p.L287F		NM_001080830.1	NP_001074299.1	O95522	PRA12_HUMAN	PRAME family member 12	287					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.L287F(1)		NS(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(9)|ovary(3)|skin(1)|urinary_tract(1)	23	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00818)|Colorectal(212;5.04e-06)|Kidney(185;4.99e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000198)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GGACCAGCTGCTCAGGTGAGG	0.493																																							uc001aui.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(859-861)CTC>TTC		PRAME family member 12							103.0	106.0	105.0					1																	12836257		2203	4300	6503	SO:0001583	missense	390999							g.chr1:12836257C>T		CCDS41254.1	1p36.21	2013-01-17			ENSG00000116726	ENSG00000116726		"""-"""	22125	protein-coding gene	gene with protein product							Standard	NM_001080830		Approved	OTTHUMG00000001927	uc001aui.3	O95522	OTTHUMG00000001927	ENST00000357726.4:c.859C>T	1.37:g.12836257C>T	ENSP00000350358:p.Leu287Phe						p.L287F	NM_001080830	NP_001074299	O95522	PRA12_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00818)|Colorectal(212;5.04e-06)|Kidney(185;4.99e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000198)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)	2	886	+	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)	287						Missense_Mutation	SNP	ENST00000357726.4	37	c.859C>T	CCDS41254.1	.	.	.	.	.	.	.	.	.	.	.	18.55	3.647276	0.67358	.	.	ENSG00000116726	ENST00000357726	T	0.01369	4.97	2.79	1.85	0.25348	.	0.157218	0.40469	N	0.001097	T	0.04452	0.0122	L	0.60012	1.86	0.20873	N	0.999835	D	0.89917	1.0	D	0.91635	0.999	T	0.25710	-1.0124	10	0.49607	T	0.09	.	4.9931	0.14224	0.0:0.8211:0.0:0.1789	.	287	O95522	PRA12_HUMAN	F	287	ENSP00000350358:L287F	ENSP00000350358:L287F	L	+	1	0	PRAMEF12	12758844	0.883000	0.30277	0.532000	0.27989	0.838000	0.47535	0.664000	0.25068	0.697000	0.31718	0.305000	0.20034	CTC		0.493	PRAMEF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005457.1	XM_372760		24	176	0	0	0	0.004656	0	24	176				
PRAMEF4	400735	broad.mit.edu	37	1	12939691	12939691	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr1:12939691C>T	ENST00000235349.5	-	4	1181	c.1111G>A	c.(1111-1113)Gcc>Acc	p.A371T		NM_001009611.2	NP_001009611.1	O60810	PRAM4_HUMAN	PRAME family member 4	371					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.A371T(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(3)|skin(1)	24	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GGCAAGATGGCGTTGACTTGG	0.517																																							uc001aun.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1111-1113)GCC>ACC		PRAME family member 4							94.0	99.0	97.0					1																	12939691		1498	2687	4185	SO:0001583	missense	400735							g.chr1:12939691C>T		CCDS30592.1	1p36.21	2013-01-17			ENSG00000243073	ENSG00000243073		"""-"""	31971	protein-coding gene	gene with protein product							Standard	NM_001009611		Approved	RP5-845O24.6	uc001aun.2	O60810	OTTHUMG00000001987	ENST00000235349.5:c.1111G>A	1.37:g.12939691C>T	ENSP00000235349:p.Ala371Thr						p.A371T	NM_001009611	NP_001009611	O60810	PRAM4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)	4	1182	-	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	371			LRR 5.		Q5LJB5	Missense_Mutation	SNP	ENST00000235349.5	37	c.1111G>A	CCDS30592.1	.	.	.	.	.	.	.	.	.	.	C	5.476	0.272790	0.10349	.	.	ENSG00000243073	ENST00000235349	T	0.10668	2.85	1.48	0.542	0.17174	.	0.727409	0.13028	N	0.419521	T	0.09555	0.0235	L	0.50847	1.595	0.09310	N	1	B	0.14805	0.011	B	0.13407	0.009	T	0.28618	-1.0038	10	0.48119	T	0.1	.	4.8464	0.13516	0.0:0.7909:0.0:0.2091	.	371	O60810	PRAM4_HUMAN	T	371	ENSP00000235349:A371T	ENSP00000235349:A371T	A	-	1	0	PRAMEF4	12862278	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.480000	0.02325	0.123000	0.18342	-1.116000	0.02052	GCC		0.517	PRAMEF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005518.1	NM_001009611		72	381	0	0	0	0.01441	0	72	381				
EPHA2	1969	broad.mit.edu	37	1	16464843	16464843	+	Silent	SNP	C	C	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr1:16464843C>T	ENST00000358432.5	-	4	1060	c.906G>A	c.(904-906)gaG>gaA	p.E302E		NM_004431.3	NP_004422.2	P29317	EPHA2_HUMAN	EPH receptor A2	302	Cys-rich.				activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|axial mesoderm formation (GO:0048320)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|ephrin receptor signaling pathway (GO:0048013)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|keratinocyte differentiation (GO:0030216)|lens fiber cell morphogenesis (GO:0070309)|mammary gland epithelial cell proliferation (GO:0033598)|multicellular organismal development (GO:0007275)|negative regulation of protein kinase B signaling (GO:0051898)|neural tube development (GO:0021915)|neuron differentiation (GO:0030182)|notochord cell development (GO:0060035)|notochord formation (GO:0014028)|osteoblast differentiation (GO:0001649)|osteoclast differentiation (GO:0030316)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|post-anal tail morphogenesis (GO:0036342)|protein kinase B signaling (GO:0043491)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of lamellipodium assembly (GO:0010591)|response to growth factor (GO:0070848)|skeletal system development (GO:0001501)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell projection (GO:0042995)|cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.E302E(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|Colorectal(212;3.63e-07)|COAD - Colon adenocarcinoma(227;2.25e-05)|BRCA - Breast invasive adenocarcinoma(304;9.58e-05)|Kidney(64;0.000175)|KIRC - Kidney renal clear cell carcinoma(64;0.00261)|STAD - Stomach adenocarcinoma(313;0.00669)|READ - Rectum adenocarcinoma(331;0.0649)	Dasatinib(DB01254)|Regorafenib(DB08896)	AGGTGGCACCCTCAGGGGATG	0.612																																							uc001aya.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(3)|central_nervous_system(3)|stomach(2)|ovary(2)	10						c.(904-906)GAG>GAA		ephrin receptor EphA2 precursor	Dasatinib(DB01254)						45.0	43.0	44.0					1																	16464843		2203	4300	6503	SO:0001819	synonymous_variant	1969				activation of Rac GTPase activity|angiogenesis|apoptosis|cell chemotaxis|negative regulation of protein kinase B signaling cascade|positive regulation of establishment of protein localization in plasma membrane|protein kinase B signaling cascade|regulation of blood vessel endothelial cell migration|regulation of cell adhesion mediated by integrin|regulation of lamellipodium assembly|response to growth factor stimulus	focal adhesion|integral to plasma membrane|lamellipodium membrane|ruffle membrane	ATP binding|ephrin receptor activity|protein binding	g.chr1:16464843C>T	BC037166	CCDS169.1	1p36	2013-02-11	2004-10-28		ENSG00000142627	ENSG00000142627	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3386	protein-coding gene	gene with protein product		176946	"""EphA2"""	ECK		9119409	Standard	NM_004431		Approved		uc001aya.2	P29317	OTTHUMG00000009527	ENST00000358432.5:c.906G>A	1.37:g.16464843C>T						EPHA2_uc010oca.1_Silent_p.E302E	p.E302E	NM_004431	NP_004422	P29317	EPHA2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|Colorectal(212;3.63e-07)|COAD - Colon adenocarcinoma(227;2.25e-05)|BRCA - Breast invasive adenocarcinoma(304;9.58e-05)|Kidney(64;0.000175)|KIRC - Kidney renal clear cell carcinoma(64;0.00261)|STAD - Stomach adenocarcinoma(313;0.00669)|READ - Rectum adenocarcinoma(331;0.0649)	4	1043	-		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)	302			Extracellular (Potential).|Cys-rich.		B5A968|Q8N3Z2	Silent	SNP	ENST00000358432.5	37	c.906G>A	CCDS169.1																																																																																				0.612	EPHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026322.1	NM_004431		10	49	0	0	0	0.008291	0	10	49				
HP1BP3	50809	broad.mit.edu	37	1	21071463	21071463	+	Nonsense_Mutation	SNP	T	T	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr1:21071463T>A	ENST00000312239.5	-	13	1628	c.1489A>T	c.(1489-1491)Aaa>Taa	p.K497*	RP5-930J4.4_ENST00000413451.1_RNA|HP1BP3_ENST00000375003.2_Nonsense_Mutation_p.K345*	NM_016287.3	NP_057371.2	Q5SSJ5	HP1B3_HUMAN	heterochromatin protein 1, binding protein 3	497	Lys-rich.				nucleosome assembly (GO:0006334)	nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.K497*(1)		central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|prostate(2)|skin(2)|urinary_tract(1)	16		all_lung(284;6.55e-06)|Lung NSC(340;6.59e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.26e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00015)|GBM - Glioblastoma multiforme(114;0.000521)|Kidney(64;0.000529)|STAD - Stomach adenocarcinoma(196;0.00311)|KIRC - Kidney renal clear cell carcinoma(64;0.00687)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.201)		GGAGGTGCTTTCTTAGGCAAG	0.562																																							uc001bdw.1		NA																	1	Substitution - Nonsense(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(1489-1491)AAA>TAA		HP1-BP74							115.0	109.0	111.0					1																	21071463		2203	4300	6503	SO:0001587	stop_gained	50809				nucleosome assembly	nucleosome|nucleus	DNA binding	g.chr1:21071463T>A	BC053327	CCDS30621.1	1p36.12	2008-02-05			ENSG00000127483	ENSG00000127483			24973	protein-coding gene	gene with protein product						12477932	Standard	NM_016287		Approved	HP1-BP74	uc001bdw.1	Q5SSJ5	OTTHUMG00000002622	ENST00000312239.5:c.1489A>T	1.37:g.21071463T>A	ENSP00000312625:p.Lys497*					HP1BP3_uc001bdv.1_Nonsense_Mutation_p.K459*|HP1BP3_uc010odh.1_Nonsense_Mutation_p.K459*|HP1BP3_uc001bdy.1_Nonsense_Mutation_p.K497*|HP1BP3_uc010odf.1_Nonsense_Mutation_p.K156*|HP1BP3_uc010odg.1_Nonsense_Mutation_p.K345*	p.K497*	NM_016287	NP_057371	Q5SSJ5	HP1B3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.26e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00015)|GBM - Glioblastoma multiforme(114;0.000521)|Kidney(64;0.000529)|STAD - Stomach adenocarcinoma(196;0.00311)|KIRC - Kidney renal clear cell carcinoma(64;0.00687)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.201)	13	1629	-		all_lung(284;6.55e-06)|Lung NSC(340;6.59e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)	497			Lys-rich.		A6NI71|A8K5D7|B3KMZ8|B4E210|Q05BI0|Q5SSJ6|Q5SWC6|Q6PIM9|Q8NDF0|Q9UHY0	Nonsense_Mutation	SNP	ENST00000312239.5	37	c.1489A>T	CCDS30621.1	.	.	.	.	.	.	.	.	.	.	T	37	6.403402	0.97537	.	.	ENSG00000127483	ENST00000312239;ENST00000375004;ENST00000375003	.	.	.	5.87	5.87	0.94306	.	0.088005	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.741	14.5226	0.67863	0.0:0.0:0.0:1.0	.	.	.	.	X	497;459;345	.	ENSP00000312625:K497X	K	-	1	0	HP1BP3	20944050	1.000000	0.71417	1.000000	0.80357	0.799000	0.45148	3.942000	0.56614	2.371000	0.80710	0.533000	0.62120	AAA		0.562	HP1BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007457.2	NM_016287		24	107	0	0	0	0.016522	0	24	107				
PTPRU	10076	broad.mit.edu	37	1	29601961	29601961	+	Splice_Site	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr1:29601961G>T	ENST00000345512.3	+	8	1275	c.1146G>T	c.(1144-1146)gaG>gaT	p.E382D	PTPRU_ENST00000356870.3_Splice_Site_p.E382D|PTPRU_ENST00000373779.3_Splice_Site_p.E382D|PTPRU_ENST00000428026.2_Splice_Site_p.E382D|PTPRU_ENST00000323874.8_Splice_Site_p.E382D|PTPRU_ENST00000460170.2_Splice_Site_p.E382D	NM_005704.4	NP_005695.3	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	382	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|homotypic cell-cell adhesion (GO:0034109)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|organ regeneration (GO:0031100)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|response to glucocorticoid (GO:0051384)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.E382D(3)		breast(4)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(26)|ovary(1)|prostate(3)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	79		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		ATTCTCCAGAGCCCATGAGGG	0.542																																							uc001bru.2		NA																	3	Substitution - Missense(3)		lung(3)	large_intestine(3)|ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	7						c.(1144-1146)GAG>GAT		protein tyrosine phosphatase, receptor type, U							22.0	25.0	24.0					1																	29601961		2203	4299	6502	SO:0001630	splice_region_variant	10076				canonical Wnt receptor signaling pathway|cell differentiation|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transmembrane receptor protein tyrosine phosphatase signaling pathway	cell-cell junction|integral to plasma membrane	beta-catenin binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr1:29601961G>T	U71075	CCDS334.1, CCDS335.1, CCDS44098.1, CCDS44098.2, CCDS53290.1	1p35.3	2013-02-11			ENSG00000060656	ENSG00000060656		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9683	protein-coding gene	gene with protein product	"""pi R-PTP-Psi"""	602454				8700514, 9434160	Standard	NM_133178		Approved	PTPRO, hPTP-J, PCP-2, FMI, PTP	uc001bru.3	Q92729	OTTHUMG00000003699	ENST00000345512.3:c.1145-1G>T	1.37:g.29601961G>T						PTPRU_uc001brv.2_Missense_Mutation_p.E382D|PTPRU_uc001brw.2_Missense_Mutation_p.E382D|PTPRU_uc009vtq.2_Missense_Mutation_p.E382D|PTPRU_uc009vtr.2_Missense_Mutation_p.E382D	p.E382D	NM_005704	NP_005695	Q92729	PTPRU_HUMAN		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)	8	1256	+		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)	382			Extracellular (Potential).		A6H8L1|O00197|P78399|Q59HA4|Q5SYU4|Q5SYU5|Q92735|Q92850	Missense_Mutation	SNP	ENST00000345512.3	37	c.1146G>T	CCDS334.1	.	.	.	.	.	.	.	.	.	.	G	13.60	2.284788	0.40394	.	.	ENSG00000060656	ENST00000345512;ENST00000373779;ENST00000356870;ENST00000323874;ENST00000428026;ENST00000460170	T;T;T;T;T;T	0.54279	0.58;0.58;0.58;0.58;0.58;0.58	5.4	1.29	0.21616	Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.52008	0.1708	L	0.37466	1.105	0.45541	D	0.998499	D;D;D;D;D	0.61697	0.99;0.99;0.99;0.982;0.982	P;P;P;P;P	0.58928	0.848;0.848;0.848;0.708;0.708	T	0.40384	-0.9566	9	.	.	.	.	8.4478	0.32852	0.3943:0.0:0.6057:0.0	.	382;382;382;382;382	Q92729-3;Q92729-4;Q92729-2;E9PH42;Q92729	.;.;.;.;PTPRU_HUMAN	D	382	ENSP00000334941:E382D;ENSP00000362884:E382D;ENSP00000349333:E382D;ENSP00000314987:E382D;ENSP00000392332:E382D;ENSP00000432906:E382D	.	E	+	3	2	PTPRU	29474548	1.000000	0.71417	0.971000	0.41717	0.722000	0.41435	2.568000	0.45965	0.048000	0.15891	-0.152000	0.13540	GAG		0.542	PTPRU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010447.1		Missense_Mutation	31	27	1	0	5.60225e-13	0.009535	7.23905e-13	31	27				
TMEM39B	55116	broad.mit.edu	37	1	32557579	32557579	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr1:32557579C>A	ENST00000336294.5	+	6	1040	c.894C>A	c.(892-894)taC>taA	p.Y298*	TMEM39B_ENST00000487305.1_3'UTR|TMEM39B_ENST00000427288.1_Nonsense_Mutation_p.Y183*|TMEM39B_ENST00000373634.4_Nonsense_Mutation_p.Y99*|TMEM39B_ENST00000456834.2_3'UTR	NM_018056.2	NP_060526.2	Q9GZU3	TM39B_HUMAN	transmembrane protein 39B	298						integral component of membrane (GO:0016021)		p.Y171*(1)|p.Y298*(1)		endometrium(2)|kidney(1)|lung(5)|ovary(1)|prostate(2)	11		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				TGAGCGCCTACTATGTGGCCT	0.582																																							uc010ogv.1		NA																	2	Substitution - Nonsense(2)		lung(2)		0						c.(892-894)TAC>TAA		transmembrane protein 39B							86.0	77.0	80.0					1																	32557579		2203	4300	6503	SO:0001587	stop_gained	55116					integral to membrane		g.chr1:32557579C>A	AL136695	CCDS351.2	1p35.1	2008-02-05			ENSG00000121775	ENSG00000121775			25510	protein-coding gene	gene with protein product						12477932	Standard	NM_018056		Approved	FLJ10315	uc010ogv.2	Q9GZU3	OTTHUMG00000004020	ENST00000336294.5:c.894C>A	1.37:g.32557579C>A	ENSP00000338165:p.Tyr298*					TMEM39B_uc010ogt.1_RNA|TMEM39B_uc010ogu.1_Nonsense_Mutation_p.Y171*|TMEM39B_uc001bue.3_Nonsense_Mutation_p.Y299*|TMEM39B_uc001buf.3_Nonsense_Mutation_p.Y99*|TMEM39B_uc010ogw.1_Nonsense_Mutation_p.Y99*	p.Y298*	NM_018056	NP_060526	Q9GZU3	TM39B_HUMAN			6	1040	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)	298			Helical; (Potential).		B4DKN8|B4DQE6|B4DTN8|D3DPP4|Q6IA44	Nonsense_Mutation	SNP	ENST00000336294.5	37	c.894C>A	CCDS351.2	.	.	.	.	.	.	.	.	.	.	C	28.2	4.901421	0.92035	.	.	ENSG00000121775	ENST00000336294;ENST00000373634;ENST00000427288	.	.	.	5.08	-3.49	0.04724	.	0.124349	0.56097	D	0.000026	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.7803	14.7672	0.69648	0.0:0.7816:0.0:0.2184	.	.	.	.	X	298;99;183	.	ENSP00000338165:Y298X	Y	+	3	2	TMEM39B	32330166	0.834000	0.29399	0.977000	0.42913	0.910000	0.53928	-0.025000	0.12413	-0.474000	0.06862	-0.367000	0.07326	TAC		0.582	TMEM39B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011489.2	NM_018056		23	52	1	0	1.42536e-11	0.004656	1.75712e-11	23	52				
CSMD2	114784	broad.mit.edu	37	1	33985220	33985220	+	Silent	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr1:33985220C>A	ENST00000373381.4	-	70	10970	c.10794G>T	c.(10792-10794)cgG>cgT	p.R3598R		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	3454						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R3454R(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CAAATGTGGCCCGAACATTGG	0.532																																							uc001bxn.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(6)|skin(5)|pancreas(1)	12						c.(10360-10362)CGG>CGT		CUB and Sushi multiple domains 2							321.0	278.0	292.0					1																	33985220		2203	4300	6503	SO:0001819	synonymous_variant	114784					integral to membrane|plasma membrane	protein binding	g.chr1:33985220C>A	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.10794G>T	1.37:g.33985220C>A						CSMD2_uc001bxm.1_Silent_p.R3598R	p.R3454R	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN			69	10391	-		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)	3454			Cytoplasmic (Potential).		B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Silent	SNP	ENST00000373381.4	37	c.10362G>T																																																																																					0.532	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896		109	555	1	0	1.9213e-43	0.01441	3.17014e-43	109	555				
DLGAP3	58512	broad.mit.edu	37	1	35365726	35365726	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr1:35365726G>A	ENST00000373347.1	-	4	1524	c.1256C>T	c.(1255-1257)gCa>gTa	p.A419V	DLGAP3_ENST00000235180.4_Missense_Mutation_p.A419V			O95886	DLGP3_HUMAN	discs, large (Drosophila) homolog-associated protein 3	419					cell-cell signaling (GO:0007267)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)	p.A419V(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(23)|ovary(4)|prostate(3)|skin(3)|urinary_tract(1)	46		Myeloproliferative disorder(586;0.0393)				TCGGGCGACTGCTTTGGGAGA	0.657																																							uc001byc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(1255-1257)GCA>GTA		discs, large (Drosophila) homolog-associated							104.0	95.0	98.0					1																	35365726		2203	4300	6503	SO:0001583	missense	58512				cell-cell signaling	cell junction|postsynaptic density|postsynaptic membrane		g.chr1:35365726G>A	AF131778	CCDS30670.1	1p35.3-p34.1	2008-02-05			ENSG00000116544	ENSG00000116544			30368	protein-coding gene	gene with protein product		611413				8619474, 9110174	Standard	NM_001080418		Approved	SAPAP3, DAP3	uc001byc.3	O95886	OTTHUMG00000004049	ENST00000373347.1:c.1256C>T	1.37:g.35365726G>A	ENSP00000362444:p.Ala419Val						p.A419V	NM_001080418	NP_001073887	O95886	DLGP3_HUMAN			2	1256	-		Myeloproliferative disorder(586;0.0393)	419					Q5TDD5|Q9H3X7	Missense_Mutation	SNP	ENST00000373347.1	37	c.1256C>T	CCDS30670.1	.	.	.	.	.	.	.	.	.	.	G	5.142	0.211781	0.09757	.	.	ENSG00000116544	ENST00000373347;ENST00000235180;ENST00000542913	T;T	0.08282	3.11;3.11	4.44	3.48	0.39840	.	0.465388	0.22557	N	0.058511	T	0.04318	0.0119	N	0.12182	0.205	0.30743	N	0.745952	B	0.16802	0.019	B	0.15484	0.013	T	0.17289	-1.0374	10	0.02654	T	1	-4.7212	13.8515	0.63499	0.0:0.2798:0.7202:0.0	.	419	O95886	DLGP3_HUMAN	V	419;419;102	ENSP00000362444:A419V;ENSP00000235180:A419V	ENSP00000235180:A419V	A	-	2	0	DLGAP3	35138313	1.000000	0.71417	0.929000	0.37066	0.743000	0.42351	1.597000	0.36729	2.296000	0.77279	0.313000	0.20887	GCA		0.657	DLGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011554.1	NM_021234		35	120	0	0	0	0.007835	0	35	120				
KIAA0754	643314	broad.mit.edu	37	1	39878353	39878353	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr1:39878353C>G	ENST00000530275.1	+	1	2203	c.2008C>G	c.(2008-2010)Cta>Gta	p.L670V	MACF1_ENST00000539005.1_Intron|MACF1_ENST00000289893.4_Intron|MACF1_ENST00000372915.3_Intron|MACF1_ENST00000567887.1_Intron|MACF1_ENST00000564288.1_Intron|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000545844.1_Intron|MACF1_ENST00000361689.2_Intron	NM_015038.1	NP_055853.1	O94854	K0754_HUMAN	KIAA0754	670										central_nervous_system(1)|large_intestine(6)|skin(1)	8	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AGATTCATTCCTAAATATTTT	0.453																																							uc009vvt.1		NA																	0					0						c.(2416-2418)CTA>GTA		hypothetical protein LOC643314							53.0	54.0	53.0					1																	39878353		1876	4108	5984	SO:0001583	missense	643314							g.chr1:39878353C>G			1p34.2	2009-07-09				ENSG00000255103			29111	protein-coding gene	gene with protein product						9872452	Standard	NM_015038		Approved		uc009vvt.1	O94854		ENST00000530275.1:c.2008C>G	1.37:g.39878353C>G	ENSP00000431179:p.Leu670Val					MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc010oiu.1_Intron	p.L806V	NM_015038	NP_055853	O94854	K0754_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)		1	3178	+	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	670					E9PMC2|Q6ZSB2	Missense_Mutation	SNP	ENST00000530275.1	37	c.2416C>G		.	.	.	.	.	.	.	.	.	.	C	12.17	1.857182	0.32791	.	.	ENSG00000255103	ENST00000530275	D	0.86627	-2.15	4.35	3.44	0.39384	.	.	.	.	.	D	0.84633	0.5515	L	0.27053	0.805	0.09310	N	1	D	0.60160	0.987	P	0.55087	0.768	T	0.74153	-0.3757	9	0.49607	T	0.09	.	8.1053	0.30881	0.0:0.8895:0.0:0.1105	.	670	O94854	K0754_HUMAN	V	670	ENSP00000431179:L670V	ENSP00000431179:L670V	L	+	1	2	RP4-562N20.1	39650940	0.003000	0.15002	0.052000	0.19188	0.208000	0.24298	1.327000	0.33746	1.205000	0.43262	0.561000	0.74099	CTA		0.453	KIAA0754-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000392100.1	NM_015038		50	38	0	0	0	0.01441	0	50	38				
RLF	6018	broad.mit.edu	37	1	40627278	40627278	+	Silent	SNP	A	A	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr1:40627278A>T	ENST00000372771.4	+	1	234	c.207A>T	c.(205-207)tcA>tcT	p.S69S		NM_012421.3	NP_036553.2	Q13129	RLF_HUMAN	rearranged L-myc fusion	69					chromosome organization (GO:0051276)|DNA integration (GO:0015074)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.S69S(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(18)|lung(18)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(4)|urinary_tract(2)	68	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)			CGGAGGTCTCATCTTTGAACT	0.662																																							uc001cfc.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(205-207)TCA>TCT		rearranged L-myc fusion							80.0	83.0	82.0					1																	40627278		2203	4300	6503	SO:0001819	synonymous_variant	6018				chromosome organization|DNA integration|DNA mediated transformation|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding	g.chr1:40627278A>T		CCDS448.1	1p32	2010-05-07	2005-08-16		ENSG00000117000	ENSG00000117000		"""Zinc fingers, C2H2-type"""	10025	protein-coding gene	gene with protein product		180610	"""rearranged L-myc fusion sequence"""			1649386	Standard	NM_012421		Approved	ZNF292L, Zn-15L	uc001cfc.4	Q13129	OTTHUMG00000005763	ENST00000372771.4:c.207A>T	1.37:g.40627278A>T							p.S69S	NM_012421	NP_036553	Q13129	RLF_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)		1	238	+	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	69					Q14CQ1|Q9NU60	Silent	SNP	ENST00000372771.4	37	c.207A>T	CCDS448.1																																																																																				0.662	RLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015767.1	NM_012421		33	66	0	0	0	0.013726	0	33	66				
GUCA2B	2981	broad.mit.edu	37	1	42619102	42619102	+	5'UTR	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr1:42619102G>T	ENST00000372581.1	+	0	11					NM_007102.2	NP_009033.1	Q16661	GUC2B_HUMAN	guanylate cyclase activator 2B (uroguanylin)						body fluid secretion (GO:0007589)|cGMP biosynthetic process (GO:0006182)|excretion (GO:0007588)|negative regulation of blood pressure (GO:0045776)|positive regulation of guanylate cyclase activity (GO:0031284)	extracellular vesicular exosome (GO:0070062)	calcium sensitive guanylate cyclase activator activity (GO:0008048)			breast(1)|large_intestine(2)	3	Ovarian(52;0.01)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				GACAGCGGCAGGGGGAACCCA	0.642																																							uc001chc.1		NA																	0					0						c.(-21--17)CAGGG>CATGG		guanylate cyclase activator 2B precursor							49.0	45.0	46.0					1																	42619102		2203	4300	6503	SO:0001623	5_prime_UTR_variant	2981				excretion	extracellular region	calcium sensitive guanylate cyclase activator activity	g.chr1:42619102G>T	BC069301	CCDS464.1	1p34-p33	2014-01-30			ENSG00000044012	ENSG00000044012		"""Endogenous ligands"""	4683	protein-coding gene	gene with protein product	"""prepro-uroguanylin"""	601271				8605041, 9268639	Standard	NM_007102		Approved		uc001chc.1	Q16661	OTTHUMG00000007024	ENST00000372581.1:c.-20G>T	1.37:g.42619102G>T								NM_007102	NP_009033	Q16661	GUC2B_HUMAN			1	11	+	Ovarian(52;0.01)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)						Q52LV0	Translation_Start_Site	SNP	ENST00000372581.1	37	c.-19G>T	CCDS464.1																																																																																				0.642	GUCA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000018307.1	NM_007102		44	20	1	0	1.23713e-20	0.01441	1.75158e-20	44	20				
CYP4B1	1580	broad.mit.edu	37	1	47282729	47282730	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr1:47282729_47282730GG>TT	ENST00000271153.4	+	9	1116_1117	c.1080_1081GG>TT	c.(1078-1083)ctGGgc>ctTTgc	p.G361C	CYP4B1_ENST00000452782.2_Missense_Mutation_p.G199C|CYP4B1_ENST00000371923.4_Missense_Mutation_p.G362C|CYP4B1_ENST00000371919.4_Missense_Mutation_p.G347C			P13584	CP4B1_HUMAN	cytochrome P450, family 4, subfamily B, polypeptide 1	361					biphenyl metabolic process (GO:0018879)|exogenous drug catabolic process (GO:0042738)|fluorene metabolic process (GO:0018917)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|drug binding (GO:0008144)|fluorene oxygenase activity (GO:0018585)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)	p.G361C(1)		NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	36	Acute lymphoblastic leukemia(166;0.155)				Midazolam(DB00683)|Phenobarbital(DB01174)|Thiamine(DB00152)	GGGATGATCTGGGCAAAATGAC	0.545																																							uc001cqm.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1078-1083)CTGGGC>CTTTGC		cytochrome P450, family 4, subfamily B,																																				SO:0001583	missense	1580				xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding	g.chr1:47282729_47282730GG>TT	BC017758	CCDS542.1, CCDS41328.1	1p33	2013-11-11	2003-01-14		ENSG00000142973	ENSG00000142973		"""Cytochrome P450s"""	2644	protein-coding gene	gene with protein product		124075	"""cytochrome P450, subfamily IVB, polypeptide 1"""				Standard	NM_000779		Approved		uc001cqn.4	P13584	OTTHUMG00000007984	Exception_encountered	1.37:g.47282729_47282730delinsTT	ENSP00000271153:p.Gly361Cys					CYP4B1_uc001cqn.3_Missense_Mutation_p.G362C|CYP4B1_uc009vym.2_Missense_Mutation_p.G347C|CYP4B1_uc010omk.1_Missense_Mutation_p.G198C	p.G361C	NM_000779	NP_000770	P13584	CP4B1_HUMAN			9	1164_1165	+	Acute lymphoblastic leukemia(166;0.155)		361					Q1HBI2|Q8TD85|Q8WWF2|Q8WWU9|Q8WWV0	Missense_Mutation	DNP	ENST00000271153.4	37	c.1080_1081GG>TT	CCDS542.1																																																																																				0.545	CYP4B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021911.1	NM_000779		32	198	0	0	0	0.004672	0	32	198				
MROH7	374977	broad.mit.edu	37	1	55119167	55119167	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr1:55119167G>T	ENST00000421030.2	+	3	853	c.568G>T	c.(568-570)Ggc>Tgc	p.G190C	MROH7_ENST00000545244.1_Intron|MROH7_ENST00000339553.5_Missense_Mutation_p.G190C|MROH7_ENST00000472987.1_3'UTR|MROH7_ENST00000409996.1_Intron|MROH7-TTC4_ENST00000414150.2_Missense_Mutation_p.G190C|MROH7_ENST00000454855.2_Intron|MROH7_ENST00000395690.2_Missense_Mutation_p.G190C	NM_001039464.2	NP_001034553	Q68CQ1	MROH7_HUMAN	maestro heat-like repeat family member 7	190						extracellular space (GO:0005615)|integral component of membrane (GO:0016021)		p.G190C(2)									TCTGGTTCTGGGCCACTGCAT	0.458																																							uc010ooe.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(568-570)GGC>TGC		hypothetical protein LOC374977							82.0	81.0	81.0					1																	55119167		1933	4144	6077	SO:0001583	missense	374977					integral to membrane	binding	g.chr1:55119167G>T	AL832492	CCDS41342.2	1p32.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000184313	ENSG00000184313		"""maestro heat-like repeat containing"""	24802	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 175"", ""HEAT repeat containing 8"""	C1orf175, HEATR8		12477932	Standard	NM_001039464		Approved	FLJ46354	uc010ooe.1	Q68CQ1	OTTHUMG00000009890	ENST00000421030.2:c.568G>T	1.37:g.55119167G>T	ENSP00000396622:p.Gly190Cys					C1orf175_uc001cxq.2_RNA|C1orf175_uc001cxo.2_Missense_Mutation_p.G190C|C1orf175_uc010ooc.1_Intron|C1orf175_uc001cxs.2_RNA|C1orf175_uc010ood.1_Intron|C1orf175_uc010oof.1_RNA|C1orf175_uc001cxr.1_RNA|C1orf175_uc010oog.1_Missense_Mutation_p.G190C|C1orf175_uc010ooh.1_RNA|C1orf175_uc009vzq.1_RNA|C1orf175_uc001cxt.1_RNA	p.G190C	NM_001039464	NP_001034553	Q68CQ1	HEAT8_HUMAN			3	892	+			190					A0AUX8|Q5TA99|Q6ZP40|Q6ZRH6|Q8N311|Q8NA14	Missense_Mutation	SNP	ENST00000421030.2	37	c.568G>T	CCDS41342.2	.	.	.	.	.	.	.	.	.	.	G	12.35	1.912803	0.33721	.	.	ENSG00000184313	ENST00000421030;ENST00000414867;ENST00000339553;ENST00000395690	T;T;T	0.03004	4.6;4.08;4.09	3.39	0.323	0.15893	.	0.226724	0.22711	N	0.056568	T	0.01976	0.0062	L	0.27053	0.805	0.09310	N	1	B;B;P	0.37636	0.073;0.043;0.603	B;B;B	0.26310	0.043;0.016;0.068	T	0.46803	-0.9165	10	0.87932	D	0	.	2.7731	0.05340	0.2438:0.0:0.5287:0.2275	.	190;190;190	F8W8P2;Q68CQ1;Q68CQ1-4	.;HEAT8_HUMAN;.	C	190	ENSP00000396622:G190C;ENSP00000343211:G190C;ENSP00000379044:G190C	ENSP00000343211:G190C	G	+	1	0	HEATR8	54891755	0.155000	0.22806	0.001000	0.08648	0.006000	0.05464	1.234000	0.32660	0.070000	0.16634	0.561000	0.74099	GGC		0.458	MROH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346978.1	NM_198547		87	50	1	0	2.93434e-44	0.01441	4.87919e-44	87	50				
DAB1	1600	broad.mit.edu	37	1	57489264	57489264	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr1:57489264G>C	ENST00000371231.1	-	12	968	c.934C>G	c.(934-936)Ctt>Gtt	p.L312V	DAB1_ENST00000439789.2_Missense_Mutation_p.L193V|DAB1_ENST00000371234.4_Missense_Mutation_p.L279V|DAB1_ENST00000420954.2_Missense_Mutation_p.L277V|DAB1_ENST00000371236.2_Missense_Mutation_p.L279V|DAB1_ENST00000485760.1_5'UTR|DAB1_ENST00000414851.2_Missense_Mutation_p.L261V			O75553	DAB1_HUMAN	Dab, reelin signal transducer, homolog 1 (Drosophila)	312					adult walking behavior (GO:0007628)|cell-cell adhesion involved in neuronal-glial interactions involved in cerebral cortex radial glia guided migration (GO:0021813)|cerebellum structural organization (GO:0021589)|dendrite development (GO:0016358)|Golgi localization (GO:0051645)|lateral motor column neuron migration (GO:0097477)|midgut development (GO:0007494)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell adhesion (GO:0007162)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein kinase activity (GO:0045860)|radial glia guided migration of Purkinje cell (GO:0021942)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|ventral spinal cord development (GO:0021517)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)		p.L279V(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(5)	64						CTCGCTGGAAGGGTCTGAGAT	0.532																																							uc001cys.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(835-837)CTT>GTT		disabled homolog 1							133.0	122.0	126.0					1																	57489264		2203	4300	6503	SO:0001583	missense	1600				cell differentiation|nervous system development			g.chr1:57489264G>C	BC067445	CCDS607.1	1p32-p31	2013-10-03	2013-10-03		ENSG00000173406	ENSG00000173406			2661	protein-coding gene	gene with protein product		603448	"""disabled (Drosophila) homolog 1"", ""disabled homolog 1 (Drosophila)"", ""Dab, reelin signal transducer, homolog 1 (Drosophila)"", ""Dab reelin signal transducer 1"""			9790777	Standard	NM_021080		Approved		uc001cys.1	O75553	OTTHUMG00000008391	ENST00000371231.1:c.934C>G	1.37:g.57489264G>C	ENSP00000360275:p.Leu312Val					DAB1_uc001cyt.1_Missense_Mutation_p.L277V|DAB1_uc001cyq.1_Missense_Mutation_p.L277V|DAB1_uc001cyr.1_Missense_Mutation_p.L193V|DAB1_uc009vzw.1_Missense_Mutation_p.L261V|DAB1_uc009vzx.1_Missense_Mutation_p.L279V	p.L279V	NM_021080	NP_066566	O75553	DAB1_HUMAN			13	1509	-			312					A4FU90|B3KTG3|Q4LE59|Q5T6M6|Q5T6M9|Q5T835|Q5T836|Q5T837|Q6NWS9|Q6NWT0|Q6NWT1|Q9NYA8	Missense_Mutation	SNP	ENST00000371231.1	37	c.835C>G		.	.	.	.	.	.	.	.	.	.	G	17.39	3.378094	0.61735	.	.	ENSG00000173406	ENST00000371236;ENST00000371233;ENST00000371234;ENST00000420954;ENST00000414851;ENST00000439789;ENST00000371231;ENST00000371232	T;T;T;T;T;T;T	0.48201	0.9;0.9;0.88;0.87;1.91;0.92;0.82	5.49	5.49	0.81192	.	0.189132	0.38005	N	0.001850	T	0.43743	0.1261	L	0.36672	1.1	0.53005	D	0.999969	P;P;P;P;P	0.51791	0.948;0.764;0.911;0.844;0.911	B;B;B;B;B	0.44133	0.442;0.313;0.442;0.399;0.442	T	0.15549	-1.0433	10	0.24483	T	0.36	-11.7147	19.1647	0.93551	0.0:0.0:1.0:0.0	.	261;312;279;193;277	O75553-4;O75553;O75553-6;O75553-3;O75553-5	.;DAB1_HUMAN;.;.;.	V	279;279;279;277;261;193;312;193	ENSP00000360280:L279V;ENSP00000360278:L279V;ENSP00000395296:L277V;ENSP00000387581:L261V;ENSP00000409328:L193V;ENSP00000360275:L312V;ENSP00000360276:L193V	ENSP00000360275:L312V	L	-	1	0	DAB1	57261852	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.202000	0.72131	2.857000	0.98124	0.650000	0.86243	CTT		0.532	DAB1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000027962.1	NM_021080		8	14	0	0	0	0.013537	0	8	14				
FAM73A	374986	broad.mit.edu	37	1	78340618	78340618	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr1:78340618C>A	ENST00000370791.3	+	16	1800	c.1768C>A	c.(1768-1770)Cag>Aag	p.Q590K	FAM73A_ENST00000443751.2_Missense_Mutation_p.Q553K	NM_001270384.1|NM_198549.3	NP_001257313.1|NP_940951.1	Q8NAN2	FA73A_HUMAN	family with sequence similarity 73, member A	590						integral component of membrane (GO:0016021)		p.Q590K(1)		breast(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	19				Colorectal(170;0.226)		AGACCTCATGCAGTTACTCAT	0.408																																							uc001dhx.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1768-1770)CAG>AAG		hypothetical protein LOC374986							105.0	92.0	96.0					1																	78340618		2203	4300	6503	SO:0001583	missense	374986					integral to membrane		g.chr1:78340618C>A		CCDS681.1, CCDS72809.1	1p31.1	2008-02-05			ENSG00000180488	ENSG00000180488			24741	protein-coding gene	gene with protein product							Standard	NM_001270384		Approved	FLJ35093	uc010ork.3	Q8NAN2	OTTHUMG00000009766	ENST00000370791.3:c.1768C>A	1.37:g.78340618C>A	ENSP00000359827:p.Gln590Lys					FAM73A_uc010ork.1_Missense_Mutation_p.Q591K|FAM73A_uc010orl.1_Missense_Mutation_p.Q553K	p.Q590K	NM_198549	NP_940951	Q8NAN2	FA73A_HUMAN		Colorectal(170;0.226)	16	1800	+			590					Q6MZG0	Missense_Mutation	SNP	ENST00000370791.3	37	c.1768C>A	CCDS681.1	.	.	.	.	.	.	.	.	.	.	C	14.35	2.508363	0.44660	.	.	ENSG00000180488	ENST00000370791;ENST00000443751	T;T	0.21932	1.98;1.98	5.59	5.59	0.84812	.	0.163423	0.56097	D	0.000039	T	0.10380	0.0254	L	0.31578	0.945	0.53688	D	0.999971	B;B;B	0.22683	0.073;0.003;0.003	B;B;B	0.20955	0.032;0.008;0.008	T	0.05716	-1.0868	10	0.35671	T	0.21	-0.3267	19.6119	0.95610	0.0:1.0:0.0:0.0	.	553;591;590	F8W7S1;B7ZLZ8;Q8NAN2	.;.;FA73A_HUMAN	K	590;553	ENSP00000359827:Q590K;ENSP00000393675:Q553K	ENSP00000359827:Q590K	Q	+	1	0	FAM73A	78113206	1.000000	0.71417	0.972000	0.41901	0.417000	0.31264	7.194000	0.77789	2.648000	0.89879	0.563000	0.77884	CAG		0.408	FAM73A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000026931.1	NM_198549		43	50	1	0	4.10826e-27	0.01441	6.14092e-27	43	50				
GBP4	115361	broad.mit.edu	37	1	89662923	89662923	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr1:89662923C>A	ENST00000355754.6	-	2	202	c.105G>T	c.(103-105)caG>caT	p.Q35H		NM_052941.4	NP_443173.2	Q96PP9	GBP4_HUMAN	guanylate binding protein 4	35	GTPase domain (Globular). {ECO:0000250}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.Q35H(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(19)|skin(1)|stomach(2)|urinary_tract(1)	33				all cancers(265;0.00723)|Epithelial(280;0.0291)		TCACTGTCAGCTGCTCTTCCT	0.443																																							uc001dnb.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(103-105)CAG>CAT		guanylate binding protein 4							118.0	108.0	112.0					1																	89662923		2203	4300	6503	SO:0001583	missense	115361					cytoplasm	GTP binding|GTPase activity	g.chr1:89662923C>A	AF288814	CCDS721.1	1p22.2	2008-02-05			ENSG00000162654	ENSG00000162654			20480	protein-coding gene	gene with protein product		612466				16689661	Standard	NM_052941		Approved	Mpa2	uc001dnb.3	Q96PP9	OTTHUMG00000010663	ENST00000355754.6:c.105G>T	1.37:g.89662923C>A	ENSP00000359490:p.Gln35His						p.Q35H	NM_052941	NP_443173	Q96PP9	GBP4_HUMAN		all cancers(265;0.00723)|Epithelial(280;0.0291)	2	221	-			35					B2R630|Q05D63|Q6NSL0|Q86T99	Missense_Mutation	SNP	ENST00000355754.6	37	c.105G>T	CCDS721.1	.	.	.	.	.	.	.	.	.	.	C	9.895	1.205281	0.22205	.	.	ENSG00000162654	ENST00000355754	T	0.75050	-0.9	5.18	-4.2	0.03823	Guanylate-binding protein, N-terminal (1);	1.105630	0.06792	N	0.787181	T	0.40222	0.1108	L	0.52126	1.63	0.09310	N	1	B	0.24092	0.097	B	0.27262	0.078	T	0.25222	-1.0138	10	0.32370	T	0.25	.	1.4229	0.02316	0.2203:0.247:0.1081:0.4246	.	35	Q96PP9	GBP4_HUMAN	H	35	ENSP00000359490:Q35H	ENSP00000359490:Q35H	Q	-	3	2	GBP4	89435511	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-0.368000	0.07543	-0.688000	0.05155	0.638000	0.83543	CAG		0.443	GBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029409.1	NM_052941		6	145	1	0	0.00116845	0.001168	0.00123464	6	145				
GBP5	115362	broad.mit.edu	37	1	89735060	89735060	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr1:89735060C>A	ENST00000370459.3	-	2	306	c.179G>T	c.(178-180)gGg>gTg	p.G60V	RP4-620F22.2_ENST00000437128.1_RNA|GBP5_ENST00000343435.5_Missense_Mutation_p.G60V			Q96PP8	GBP5_HUMAN	guanylate binding protein 5	60	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.					cytoplasm (GO:0005737)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)	p.G60V(1)		breast(1)|endometrium(1)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)	24				all cancers(265;0.00784)|Epithelial(280;0.0286)		CTTGTTCTTCCCAGCCAGCTT	0.512																																							uc001dnc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(178-180)GGG>GTG		guanylate-binding protein 5							215.0	180.0	192.0					1																	89735060		2203	4300	6503	SO:0001583	missense	115362					plasma membrane	GTP binding|GTPase activity	g.chr1:89735060C>A	AF430642	CCDS722.1	1p22.2	2008-02-05			ENSG00000154451	ENSG00000154451			19895	protein-coding gene	gene with protein product		611467					Standard	NM_052942		Approved		uc001dnd.3	Q96PP8	OTTHUMG00000010006	ENST00000370459.3:c.179G>T	1.37:g.89735060C>A	ENSP00000359488:p.Gly60Val					GBP5_uc001dnd.2_Missense_Mutation_p.G60V|GBP5_uc001dne.1_Missense_Mutation_p.G60V	p.G60V	NM_052942	NP_443174	Q96PP8	GBP5_HUMAN		all cancers(265;0.00784)|Epithelial(280;0.0286)	3	716	-			60					B2RCE1|Q86TM5	Missense_Mutation	SNP	ENST00000370459.3	37	c.179G>T	CCDS722.1	.	.	.	.	.	.	.	.	.	.	C	15.11	2.737241	0.49045	.	.	ENSG00000154451	ENST00000343435;ENST00000370459;ENST00000443807	T;T;T	0.73789	-0.78;-0.78;-0.78	5.0	4.08	0.47627	Guanylate-binding protein, N-terminal (1);	0.114022	0.64402	D	0.000016	D	0.89136	0.6629	H	0.98577	4.27	0.53005	D	0.999966	D	0.89917	1.0	D	0.87578	0.998	D	0.91921	0.5547	10	0.87932	D	0	-11.1641	11.2228	0.48866	0.0:0.9106:0.0:0.0894	.	60	Q96PP8	GBP5_HUMAN	V	60	ENSP00000340396:G60V;ENSP00000359488:G60V;ENSP00000403010:G60V	ENSP00000340396:G60V	G	-	2	0	GBP5	89507648	0.996000	0.38824	0.977000	0.42913	0.035000	0.12851	3.837000	0.55820	1.466000	0.48025	0.655000	0.94253	GGG		0.512	GBP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027700.1	NM_052942		62	80	1	0	1.48873e-21	0.01441	2.12888e-21	62	80				
AMPD2	271	broad.mit.edu	37	1	110172892	110172892	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr1:110172892T>A	ENST00000256578.3	+	16	2543	c.2183T>A	c.(2182-2184)aTc>aAc	p.I728N	AMPD2_ENST00000358729.4_Missense_Mutation_p.I653N|AMPD2_ENST00000528667.1_Missense_Mutation_p.I728N|AMPD2_ENST00000528454.1_Missense_Mutation_p.I610N|AMPD2_ENST00000393688.3_Missense_Mutation_p.I609N|AMPD2_ENST00000526301.1_3'UTR|RP5-1160K1.6_ENST00000369843.3_RNA|AMPD2_ENST00000342115.4_Missense_Mutation_p.I647N	NM_004037.7	NP_004028.3	Q01433	AMPD2_HUMAN	adenosine monophosphate deaminase 2	728					cell death (GO:0008219)|cyclic purine nucleotide metabolic process (GO:0052652)|energy homeostasis (GO:0097009)|IMP biosynthetic process (GO:0006188)|IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)	p.I728N(1)		breast(1)|large_intestine(3)|ovary(2)|skin(1)	7		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Lung(183;0.0425)|all cancers(265;0.0884)|Colorectal(144;0.109)|Epithelial(280;0.111)|LUSC - Lung squamous cell carcinoma(189;0.228)		CTGGCCCAGATCGGCATCGCC	0.657																																							uc009wfh.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(1)	3						c.(2182-2184)ATC>AAC		adenosine monophosphate deaminase 2 (isoform L)							127.0	130.0	129.0					1																	110172892		2203	4300	6503	SO:0001583	missense	271				purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding	g.chr1:110172892T>A	S47833	CCDS804.1, CCDS805.1, CCDS30796.1, CCDS58016.1	1p13.3	2014-03-03	2010-02-10		ENSG00000116337	ENSG00000116337	3.5.4.6		469	protein-coding gene	gene with protein product	"""AMPD isoform L"""	102771	"""adenosine monophosphate deaminase 2 (isoform L)"""			1400401, 24482476	Standard	NM_004037		Approved	SPG63	uc009wfh.2	Q01433	OTTHUMG00000011649	ENST00000256578.3:c.2183T>A	1.37:g.110172892T>A	ENSP00000256578:p.Ile728Asn					AMPD2_uc009wfg.1_RNA|AMPD2_uc001dyb.1_Missense_Mutation_p.I647N|AMPD2_uc001dyc.1_Missense_Mutation_p.I728N|AMPD2_uc010ovr.1_Missense_Mutation_p.I653N|AMPD2_uc001dyd.1_Missense_Mutation_p.I609N|AMPD2_uc001dye.1_5'UTR	p.I728N	NM_004037	NP_004028	Q01433	AMPD2_HUMAN		Lung(183;0.0425)|all cancers(265;0.0884)|Colorectal(144;0.109)|Epithelial(280;0.111)|LUSC - Lung squamous cell carcinoma(189;0.228)	17	2725	+		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)	728					B4DK50|B4DZI5|E9PNG0|Q14856|Q14857|Q16686|Q16687|Q16688|Q16729|Q5T693|Q5T695|Q96IA1|Q9UDX8|Q9UDX9|Q9UMU4	Missense_Mutation	SNP	ENST00000256578.3	37	c.2183T>A	CCDS805.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	20.5|20.5|20.5	4.002999|4.002999|4.002999	0.74932|0.74932|0.74932	.|.|.	.|.|.	ENSG00000116337|ENSG00000116337|ENSG00000116337	ENST00000369840|ENST00000342115;ENST00000528667;ENST00000256578;ENST00000358729;ENST00000528454;ENST00000393688|ENST00000476688	.|D;D;D;D;D;D|.	.|0.97553|.	.|-4.43;-4.43;-4.43;-4.43;-4.43;-4.43|.	4.66|4.66|4.66	4.66|4.66|4.66	0.58398|0.58398|0.58398	.|Adenosine/AMP deaminase (1);|.	.|0.202953|.	.|0.50627|.	.|D|.	.|0.000110|.	D|D|D	0.83110|0.83110|0.83110	0.5183|0.5183|0.5183	H|H|H	0.94503|0.94503|0.94503	3.545|3.545|3.545	0.52501|0.52501|0.52501	D|D|D	0.99995|0.99995|0.99995	.|D;D;D;D|.	.|0.89917|.	.|0.999;1.0;1.0;1.0|.	.|D;D;D;D|.	.|0.91635|.	.|0.949;0.995;0.999;0.997|.	D|D|D	0.88131|0.88131|0.88131	0.2838|0.2838|0.2838	5|10|5	.|0.87932|.	.|D|.	.|0|.	-8.6198|-8.6198|-8.6198	13.9168|13.9168|13.9168	0.63902|0.63902|0.63902	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.|.	.|653;609;728;647|.	.|Q01433-4;Q01433-3;Q01433;Q01433-2|.	.|.;.;AMPD2_HUMAN;.|.	E|N|T	698|647;728;728;653;610;609|117	.|ENSP00000345498:I647N;ENSP00000436541:I728N;ENSP00000256578:I728N;ENSP00000351573:I653N;ENSP00000437164:I610N;ENSP00000377292:I609N|.	.|ENSP00000256578:I728N|.	D|I|S	+|+|+	3|2|1	2|0|0	AMPD2|AMPD2|AMPD2	109974415|109974415|109974415	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.913000|0.913000|0.913000	0.36048|0.36048|0.36048	0.536000|0.536000|0.536000	0.34869|0.34869|0.34869	7.819000|7.819000|7.819000	0.86621|0.86621|0.86621	1.962000|1.962000|1.962000	0.57031|0.57031|0.57031	0.459000|0.459000|0.459000	0.35465|0.35465|0.35465	GAT|ATC|TCG		0.657	AMPD2-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390615.1			8	327	0	0	0	0.006214	0	8	327				
KCNA10	3744	broad.mit.edu	37	1	111060705	111060705	+	Silent	SNP	C	C	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr1:111060705C>T	ENST00000369771.2	-	1	1092	c.705G>A	c.(703-705)ctG>ctA	p.L235L		NM_005549.2	NP_005540.1	Q16322	KCA10_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 10	235					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|intracellular cyclic nucleotide activated cation channel activity (GO:0005221)	p.L235L(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(3)|skin(1)|urinary_tract(1)	35		all_cancers(81;4.57e-06)|all_epithelial(167;1.52e-05)|all_lung(203;0.000152)|Lung NSC(277;0.000301)		Lung(183;0.0238)|all cancers(265;0.0874)|Colorectal(144;0.103)|Epithelial(280;0.116)|LUSC - Lung squamous cell carcinoma(189;0.134)	Dalfampridine(DB06637)	GCAGTGTCTCCAGGCAGAAGA	0.562																																							uc001dzt.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|large_intestine(1)	4						c.(703-705)CTG>CTA		potassium voltage-gated channel, shaker-related							121.0	106.0	111.0					1																	111060705		2203	4300	6503	SO:0001819	synonymous_variant	3744					voltage-gated potassium channel complex	intracellular cyclic nucleotide activated cation channel activity|voltage-gated potassium channel activity	g.chr1:111060705C>T	U96110	CCDS826.1	1p13.1	2012-07-05			ENSG00000143105	ENSG00000143105		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6219	protein-coding gene	gene with protein product		602420				16382104	Standard	NM_005549		Approved	Kv1.8	uc001dzt.1	Q16322	OTTHUMG00000022785	ENST00000369771.2:c.705G>A	1.37:g.111060705C>T							p.L235L	NM_005549	NP_005540	Q16322	KCA10_HUMAN		Lung(183;0.0238)|all cancers(265;0.0874)|Colorectal(144;0.103)|Epithelial(280;0.116)|LUSC - Lung squamous cell carcinoma(189;0.134)	1	1093	-		all_cancers(81;4.57e-06)|all_epithelial(167;1.52e-05)|all_lung(203;0.000152)|Lung NSC(277;0.000301)	235			Helical; Name=Segment S1; (Potential).			Silent	SNP	ENST00000369771.2	37	c.705G>A	CCDS826.1																																																																																				0.562	KCNA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059081.1	NM_005549		58	93	0	0	0	0.01441	0	58	93				
NGF	4803	broad.mit.edu	37	1	115829306	115829306	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr1:115829306C>A	ENST00000369512.2	-	3	279	c.111G>T	c.(109-111)tgG>tgT	p.W37C	RP4-663N10.1_ENST00000425449.1_RNA	NM_002506.2	NP_002497.2	P01138	NGF_HUMAN	nerve growth factor (beta polypeptide)	37					activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|adult locomotory behavior (GO:0008344)|apoptotic signaling pathway (GO:0097190)|circadian rhythm (GO:0007623)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|inflammatory response (GO:0006954)|memory (GO:0007613)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle (GO:0045786)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|nerve growth factor processing (GO:0032455)|neuron apoptotic process (GO:0051402)|neuron projection morphogenesis (GO:0048812)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axon extension (GO:0045773)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of neurotrophin TRK receptor signaling pathway (GO:0051388)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of stem cell proliferation (GO:2000648)|Ras protein signal transduction (GO:0007265)|regulation of axonogenesis (GO:0050770)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of neurotransmitter secretion (GO:0046928)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to glucocorticoid (GO:0051384)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to nicotine (GO:0035094)|response to ozone (GO:0010193)|response to peptide hormone (GO:0043434)|response to radiation (GO:0009314)|sensory perception of pain (GO:0019233)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)	nerve growth factor receptor binding (GO:0005163)|receptor signaling protein activity (GO:0005057)	p.W37C(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	13	Lung SC(450;0.211)	all_cancers(81;1.07e-06)|all_epithelial(167;4.43e-06)|all_lung(203;2.86e-05)|Lung NSC(69;4.99e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|all cancers(265;0.159)|Epithelial(280;0.179)	Clenbuterol(DB01407)	GAAGTTTAGTCCAGTGGGCTT	0.592																																							uc001efu.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(2)	2						c.(109-111)TGG>TGT		nerve growth factor, beta polypeptide precursor	Clenbuterol(DB01407)						113.0	90.0	98.0					1																	115829306		2203	4300	6503	SO:0001583	missense	4803				activation of MAPKK activity|activation of phospholipase C activity|anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|negative regulation of cell cycle|nerve growth factor processing|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|Ras protein signal transduction	endosome|Golgi lumen	growth factor activity|nerve growth factor receptor binding	g.chr1:115829306C>A		CCDS882.1	1p13.1	2014-09-17	2008-02-07	2008-02-07	ENSG00000134259	ENSG00000134259		"""Endogenous ligands"""	7808	protein-coding gene	gene with protein product		162030		NGFB			Standard	XM_006710663		Approved		uc001efu.1	P01138	OTTHUMG00000011880	ENST00000369512.2:c.111G>T	1.37:g.115829306C>A	ENSP00000358525:p.Trp37Cys						p.W37C	NM_002506	NP_002497	P01138	NGF_HUMAN		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|all cancers(265;0.159)|Epithelial(280;0.179)	3	280	-	Lung SC(450;0.211)	all_cancers(81;1.07e-06)|all_epithelial(167;4.43e-06)|all_lung(203;2.86e-05)|Lung NSC(69;4.99e-05)	37					A1A4E5|Q6FHA0|Q96P60|Q9P2Q8|Q9UKL8	Missense_Mutation	SNP	ENST00000369512.2	37	c.111G>T	CCDS882.1	.	.	.	.	.	.	.	.	.	.	C	14.91	2.676191	0.47886	.	.	ENSG00000134259	ENST00000369512	T	0.61392	0.11	5.36	5.36	0.76844	.	0.249082	0.30455	N	0.009581	T	0.28433	0.0703	N	0.12887	0.27	0.52501	D	0.999956	P	0.51653	0.947	B	0.43103	0.408	T	0.15263	-1.0443	10	0.38643	T	0.18	-15.9225	13.5992	0.62010	0.0:0.8439:0.1561:0.0	.	37	P01138	NGF_HUMAN	C	37	ENSP00000358525:W37C	ENSP00000358525:W37C	W	-	3	0	NGF	115630829	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	3.388000	0.52509	2.507000	0.84556	0.467000	0.42956	TGG		0.592	NGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032832.1	NM_002506		39	70	1	0	1.69901e-12	0.005524	2.15644e-12	39	70				
SPAG17	200162	broad.mit.edu	37	1	118527328	118527328	+	Missense_Mutation	SNP	A	A	C			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr1:118527328A>C	ENST00000336338.5	-	41	5812	c.5747T>G	c.(5746-5748)tTg>tGg	p.L1916W	SPAG17_ENST00000492438.1_5'UTR	NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1916						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)		p.L1916W(1)		NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		TAACTGGTTCAATTCAGATTT	0.284																																							uc001ehk.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6						c.(5746-5748)TTG>TGG		sperm associated antigen 17							154.0	161.0	158.0					1																	118527328		2203	4298	6501	SO:0001583	missense	200162					cilium|flagellar axoneme|microtubule		g.chr1:118527328A>C		CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.5747T>G	1.37:g.118527328A>C	ENSP00000337804:p.Leu1916Trp						p.L1916W	NM_206996	NP_996879	Q6Q759	SPG17_HUMAN		Lung(183;0.0858)	41	5815	-	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)	1916					Q8NAZ1|Q9NT21	Missense_Mutation	SNP	ENST00000336338.5	37	c.5747T>G	CCDS899.1	.	.	.	.	.	.	.	.	.	.	A	15.47	2.842045	0.51057	.	.	ENSG00000155761	ENST00000336338;ENST00000437255	T	0.22336	1.96	5.75	4.64	0.57946	.	0.855723	0.10478	N	0.669898	T	0.25717	0.0626	M	0.65975	2.015	0.09310	N	1	D	0.67145	0.996	P	0.61592	0.891	T	0.10200	-1.0640	10	0.46703	T	0.11	.	8.9473	0.35767	0.9159:0.0:0.0841:0.0	.	1916	Q6Q759	SPG17_HUMAN	W	1916;396	ENSP00000337804:L1916W	ENSP00000337804:L1916W	L	-	2	0	SPAG17	118328851	0.420000	0.25457	0.008000	0.14137	0.002000	0.02628	3.390000	0.52523	2.194000	0.70268	0.533000	0.62120	TTG		0.284	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033723.1	NM_206996		18	89	0	0	0	0.010504	0	18	89				
SPAG17	200162	broad.mit.edu	37	1	118609425	118609425	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr1:118609425C>T	ENST00000336338.5	-	18	2548	c.2483G>A	c.(2482-2484)aGa>aAa	p.R828K		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	828						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)		p.R828K(1)		NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		CAAACGTTGTCTATTCATTGG	0.363																																							uc001ehk.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6						c.(2482-2484)AGA>AAA		sperm associated antigen 17							134.0	122.0	126.0					1																	118609425		2203	4300	6503	SO:0001583	missense	200162					cilium|flagellar axoneme|microtubule		g.chr1:118609425C>T		CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.2483G>A	1.37:g.118609425C>T	ENSP00000337804:p.Arg828Lys						p.R828K	NM_206996	NP_996879	Q6Q759	SPG17_HUMAN		Lung(183;0.0858)	18	2551	-	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)	828					Q8NAZ1|Q9NT21	Missense_Mutation	SNP	ENST00000336338.5	37	c.2483G>A	CCDS899.1	.	.	.	.	.	.	.	.	.	.	C	7.446	0.641601	0.14451	.	.	ENSG00000155761	ENST00000336338	T	0.28255	1.62	5.44	-10.9	0.00192	.	2.296290	0.01672	N	0.025697	T	0.03011	0.0089	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.09335	-1.0679	10	0.21540	T	0.41	.	5.3443	0.16000	0.1115:0.2378:0.4547:0.196	.	828	Q6Q759	SPG17_HUMAN	K	828	ENSP00000337804:R828K	ENSP00000337804:R828K	R	-	2	0	SPAG17	118410948	0.000000	0.05858	0.000000	0.03702	0.394000	0.30568	-1.422000	0.02453	-2.538000	0.00487	-1.083000	0.02208	AGA		0.363	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033723.1	NM_206996		23	65	0	0	0	0.021523	0	23	65				
FLG	2312	broad.mit.edu	37	1	152282747	152282747	+	Missense_Mutation	SNP	T	T	G	rs536230632		TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr1:152282747T>G	ENST00000368799.1	-	3	4650	c.4615A>C	c.(4615-4617)Agt>Cgt	p.S1539R	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1539	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.S1539R(2)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGCTTGCACTTCTGGGTCCT	0.572									Ichthyosis				T|||	1	0.000199681	0.0	0.0	5008	,	,		20676	0.0		0.0	False		,,,				2504	0.001						uc001ezu.1		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)	ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16						c.(4615-4617)AGT>CGT		filaggrin							303.0	293.0	296.0					1																	152282747		2203	4300	6503	SO:0001583	missense	2312	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	g.chr1:152282747T>G	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.4615A>C	1.37:g.152282747T>G	ENSP00000357789:p.Ser1539Arg						p.S1539R	NM_002016	NP_002007	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	4651	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		1539			Ser-rich.		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	c.4615A>C	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	T	9.888	1.203497	0.22121	.	.	ENSG00000143631	ENST00000368799	T	0.01821	4.62	2.67	-0.792	0.10925	.	.	.	.	.	T	0.00784	0.0026	M	0.75447	2.3	0.09310	N	1	B	0.17852	0.024	B	0.15870	0.014	T	0.42050	-0.9474	9	0.25106	T	0.35	.	5.1967	0.15243	0.0:0.4182:0.0:0.5818	.	1539	P20930	FILA_HUMAN	R	1539	ENSP00000357789:S1539R	ENSP00000357789:S1539R	S	-	1	0	FLG	150549371	0.003000	0.15002	0.000000	0.03702	0.169000	0.22640	0.226000	0.17776	-0.281000	0.09141	0.397000	0.26171	AGT		0.572	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		8	686	0	0	0	0.004482	0	8	686				
INSRR	3645	broad.mit.edu	37	1	156810764	156810764	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr1:156810764G>T	ENST00000368195.3	-	22	4191	c.3795C>A	c.(3793-3795)tgC>tgA	p.C1265*	NTRK1_ENST00000392302.2_Intron	NM_014215.2	NP_055030.1	P14616	INSRR_HUMAN	insulin receptor-related receptor	1265					actin cytoskeleton reorganization (GO:0031532)|cellular response to alkaline pH (GO:0071469)|male sex determination (GO:0030238)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.C1265*(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(7)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	42	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					GGGCCCCCCGGCATTCCGGGC	0.637																																							uc010pht.1		NA																	1	Substitution - Nonsense(1)		lung(1)	lung(11)|ovary(5)|skin(2)|kidney(1)|central_nervous_system(1)	20						c.(3793-3795)TGC>TGA		insulin receptor-related receptor precursor							23.0	26.0	25.0					1																	156810764		2203	4300	6503	SO:0001587	stop_gained	3645				protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|insulin receptor substrate binding|metal ion binding|phosphatidylinositol 3-kinase binding|transmembrane receptor protein tyrosine kinase activity	g.chr1:156810764G>T	J05046	CCDS1160.1	1q21-q23	2013-02-11			ENSG00000027644	ENSG00000027644		"""Fibronectin type III domain containing"""	6093	protein-coding gene	gene with protein product		147671				2768234, 2249481	Standard	NM_014215		Approved	IRR	uc010pht.2	P14616	OTTHUMG00000041291	ENST00000368195.3:c.3795C>A	1.37:g.156810764G>T	ENSP00000357178:p.Cys1265*					NTRK1_uc001fqf.1_Intron|NTRK1_uc009wsi.1_Intron	p.C1265*	NM_014215	NP_055030	P14616	INSRR_HUMAN			22	4049	-	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)		1265			Cytoplasmic (Potential).		O60724|Q5VZS3	Nonsense_Mutation	SNP	ENST00000368195.3	37	c.3795C>A	CCDS1160.1	.	.	.	.	.	.	.	.	.	.	G	44	10.700471	0.99452	.	.	ENSG00000027644	ENST00000368195	.	.	.	5.4	3.53	0.40419	.	0.133462	0.34906	N	0.003600	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	.	11.1634	0.48528	0.1515:0.0:0.8485:0.0	.	.	.	.	X	1265	.	ENSP00000357178:C1265X	C	-	3	2	INSRR	155077388	0.999000	0.42202	0.066000	0.19879	0.006000	0.05464	2.091000	0.41691	0.836000	0.34901	-0.136000	0.14681	TGC		0.637	INSRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098929.1	NM_014215		4	25	1	0	2.17888e-05	0.006214	2.41534e-05	4	25				
SPTA1	6708	broad.mit.edu	37	1	158596753	158596753	+	Silent	SNP	T	T	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr1:158596753T>A	ENST00000368147.4	-	41	5889	c.5709A>T	c.(5707-5709)atA>atT	p.I1903I		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1903					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.I1903I(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TCAGAGCCTCTATCTTGGAAG	0.428																																							uc001fst.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8						c.(5707-5709)ATA>ATT		spectrin, alpha, erythrocytic 1							147.0	146.0	146.0					1																	158596753		1849	4094	5943	SO:0001819	synonymous_variant	6708				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158596753T>A	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.5709A>T	1.37:g.158596753T>A							p.I1903I	NM_003126	NP_003117	P02549	SPTA1_HUMAN			41	5908	-	all_hematologic(112;0.0378)		1903			Spectrin 18.		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Silent	SNP	ENST00000368147.4	37	c.5709A>T	CCDS41423.1																																																																																				0.428	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		25	99	0	0	0	0.004656	0	25	99				
OR10J3	441911	broad.mit.edu	37	1	159283979	159283980	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr1:159283979_159283980GG>TT	ENST00000332217.5	-	1	469_470	c.470_471CC>AA	c.(469-471)gCC>gAA	p.A157E		NM_001004467.1	NP_001004467.1	Q5JRS4	O10J3_HUMAN	olfactory receptor, family 10, subfamily J, member 3	157						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A157E(1)		breast(2)|endometrium(7)|kidney(4)|large_intestine(7)|lung(19)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	47	all_hematologic(112;0.0429)					CTTGGACAATGGCCATGCCAAG	0.52																																							uc010piu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(469-471)GCC>GAA		olfactory receptor, family 10, subfamily J,																																				SO:0001583	missense	441911				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:159283979_159283980GG>TT		CCDS30909.1	1q23.2	2012-08-09		2004-03-10	ENSG00000196266	ENSG00000196266		"""GPCR / Class A : Olfactory receptors"""	14992	protein-coding gene	gene with protein product				OR10J3P			Standard	NM_001004467		Approved		uc010piu.2	Q5JRS4	OTTHUMG00000037233	ENST00000332217.5:c.470_471delinsTT	1.37:g.159283979_159283980delinsTT	ENSP00000331789:p.Ala157Glu						p.A157E	NM_001004467	NP_001004467	Q5JRS4	O10J3_HUMAN			1	470_471	-	all_hematologic(112;0.0429)		157			Helical; Name=4; (Potential).			Missense_Mutation	DNP	ENST00000332217.5	37	c.470_471CC>AA	CCDS30909.1																																																																																				0.520	OR10J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090629.1			33	35	0	0	0	0.004672	0	33	35				
ASTN1	460	broad.mit.edu	37	1	176918355	176918355	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr1:176918355C>A	ENST00000367654.3	-	12	2255	c.2044G>T	c.(2044-2046)Gac>Tac	p.D682Y	ASTN1_ENST00000281881.3_5'UTR|ASTN1_ENST00000424564.2_Missense_Mutation_p.D674Y|ASTN1_ENST00000361833.2_Missense_Mutation_p.D674Y|ASTN1_ENST00000367657.3_Missense_Mutation_p.D674Y	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	682	EGF-like 3.				locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)		p.D674Y(1)		NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						AAGGTGGGGTCGTCCGGGAAG	0.612											OREG0014004	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001glc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						c.(2020-2022)GAC>TAC		astrotactin isoform 1							80.0	78.0	79.0					1																	176918355		2203	4300	6503	SO:0001583	missense	460				cell migration|neuron cell-cell adhesion	integral to membrane		g.chr1:176918355C>A	AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.2044G>T	1.37:g.176918355C>A	ENSP00000356626:p.Asp682Tyr		OREG0014004	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1934	ASTN1_uc001glb.1_Missense_Mutation_p.D674Y|ASTN1_uc001gld.1_Missense_Mutation_p.D674Y|ASTN1_uc009wwx.1_Missense_Mutation_p.D674Y	p.D674Y	NM_004319	NP_004310	O14525	ASTN1_HUMAN			12	2232	-			682			EGF-like 3.		A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	ENST00000367654.3	37	c.2020G>T		.	.	.	.	.	.	.	.	.	.	C	19.14	3.770126	0.69992	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	T;T;D;T	0.88124	2.19;2.61;-2.34;2.2	5.3	5.3	0.74995	.	0.139540	0.64402	D	0.000006	D	0.88691	0.6505	L	0.27053	0.805	0.80722	D	1	D;P;P	0.69078	0.997;0.946;0.946	P;P;P	0.61132	0.884;0.758;0.758	D	0.90385	0.4391	10	0.87932	D	0	-17.8235	18.5626	0.91105	0.0:1.0:0.0:0.0	.	682;674;674	O14525;O14525-2;B1AJS1	ASTN1_HUMAN;.;.	Y	674;674;682;674;674	ENSP00000356629:D674Y;ENSP00000354536:D674Y;ENSP00000356626:D682Y;ENSP00000395041:D674Y	ENSP00000354536:D674Y	D	-	1	0	ASTN1	175184978	1.000000	0.71417	0.939000	0.37840	0.146000	0.21551	7.679000	0.84048	2.480000	0.83734	0.655000	0.94253	GAC		0.612	ASTN1-201	KNOWN	basic	protein_coding	protein_coding		NM_004319		34	45	1	0	6.53348e-20	0.017118	9.18971e-20	34	45				
CHRM3	1131	broad.mit.edu	37	1	240072434	240072434	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr1:240072434C>A	ENST00000255380.4	+	5	2462	c.1683C>A	c.(1681-1683)tgC>tgA	p.C561*		NM_000740.2	NP_000731.1	P20309	ACM3_HUMAN	cholinergic receptor, muscarinic 3	561					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|energy reserve metabolic process (GO:0006112)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of insulin secretion (GO:0050796)|regulation of vascular smooth muscle contraction (GO:0003056)|saliva secretion (GO:0046541)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|smooth muscle contraction (GO:0006939)	asymmetric synapse (GO:0032279)|axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|drug binding (GO:0008144)|G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)|receptor activity (GO:0004872)	p.C561*(1)		breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(19)|ovary(4)|prostate(1)|skin(12)|upper_aerodigestive_tract(1)	51	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Brompheniramine(DB00835)|Cevimeline(DB00185)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxepin(DB01142)|Fesoterodine(DB06702)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Isopropamide(DB01625)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Mepenzolate(DB04843)|Methacholine(DB06709)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tramadol(DB00193)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	TGCTGCTGTGCCAGTGTGACA	0.517																																							uc001hyp.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(4)|skin(1)	5						c.(1681-1683)TGC>TGA		cholinergic receptor, muscarinic 3	Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Cevimeline(DB00185)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Darifenacin(DB00496)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Homatropine Methylbromide(DB00725)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Solifenacin(DB01591)|Thiethylperazine(DB00372)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tridihexethyl(DB00505)						53.0	52.0	53.0					1																	240072434		2203	4300	6503	SO:0001587	stop_gained	1131				cell proliferation|energy reserve metabolic process|nervous system development|protein modification process|regulation of insulin secretion	basolateral plasma membrane|cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|phosphatidylinositol phospholipase C activity	g.chr1:240072434C>A	U29589	CCDS1616.1	1q43	2012-09-20			ENSG00000133019	ENSG00000133019		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1952	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 3"""	118494					Standard	XM_005273032		Approved		uc001hyp.3	P20309	OTTHUMG00000039649	ENST00000255380.4:c.1683C>A	1.37:g.240072434C>A	ENSP00000255380:p.Cys561*						p.C561*	NM_000740	NP_000731	P20309	ACM3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		5	2462	+	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	561			Cytoplasmic (By similarity).		Q0VAJ8|Q4QRI3|Q5VXY2|Q9HB60	Nonsense_Mutation	SNP	ENST00000255380.4	37	c.1683C>A	CCDS1616.1	.	.	.	.	.	.	.	.	.	.	C	43	10.139701	0.99345	.	.	ENSG00000133019	ENST00000255380	.	.	.	5.58	2.7	0.31948	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-21.4576	10.0902	0.42443	0.0:0.7284:0.0:0.2716	.	.	.	.	X	561	.	ENSP00000255380:C561X	C	+	3	2	CHRM3	238139057	0.999000	0.42202	1.000000	0.80357	0.961000	0.63080	0.773000	0.26661	0.735000	0.32537	0.655000	0.94253	TGC		0.517	CHRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095644.2	NM_000740		21	51	1	0	1.10923e-09	0.016522	1.30731e-09	21	51				
OR2C3	81472	broad.mit.edu	37	1	247695135	247695135	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr1:247695135A>T	ENST00000366487.3	-	2	1040	c.679T>A	c.(679-681)Ttg>Atg	p.L227M	GCSAML_ENST00000366490.3_Intron|GCSAML_ENST00000366489.1_Intron|GCSAML_ENST00000366491.2_Intron|GCSAML_ENST00000527084.1_Intron|GCSAML_ENST00000463359.1_Intron|GCSAML_ENST00000527541.1_Intron|GCSAML_ENST00000531662.1_Intron	NM_198074.4	NP_932340	Q8N628	OR2C3_HUMAN	olfactory receptor, family 2, subfamily C, member 3	227						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L226M(1)		breast(1)|endometrium(5)|large_intestine(2)|lung(31)|ovary(1)|prostate(1)|skin(2)	43	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0242)	OV - Ovarian serous cystadenocarcinoma(106;0.0241)			CTGATCTTCAACACGGCCCGG	0.537																																							uc009xgy.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(679-681)TTG>ATG		olfactory receptor, family 2, subfamily C,							105.0	100.0	102.0					1																	247695135		2203	4300	6503	SO:0001583	missense	81472				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247695135A>T	BC030717	CCDS1634.2	1q44	2014-02-19	2002-02-28		ENSG00000196242	ENSG00000196242		"""GPCR / Class A : Olfactory receptors"""	15005	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily C, member 4"""	OR2C4, OR2C5P			Standard	NM_198074		Approved	OST742	uc009xgy.3	Q8N628	OTTHUMG00000040579	ENST00000366487.3:c.679T>A	1.37:g.247695135A>T	ENSP00000355443:p.Leu227Met					C1orf150_uc009xgw.2_Intron|C1orf150_uc001ida.3_Intron|C1orf150_uc001idb.3_Intron|C1orf150_uc009xgx.2_Intron|LOC148824_uc001idd.2_5'Flank	p.L227M	NM_198074	NP_932340	Q8N628	OR2C3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0241)		2	1041	-	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0242)	227			Cytoplasmic (Potential).		Q5JQS4|Q6IEZ1|Q8NGW7	Missense_Mutation	SNP	ENST00000366487.3	37	c.679T>A	CCDS1634.2	.	.	.	.	.	.	.	.	.	.	a	3.023	-0.201269	0.06219	.	.	ENSG00000196242	ENST00000366487	T	0.00309	8.16	3.89	-7.79	0.01218	GPCR, rhodopsin-like superfamily (1);	1.045430	0.07752	N	0.948765	T	0.00271	0.0008	M	0.84683	2.71	0.09310	N	1	B	0.22276	0.067	B	0.27076	0.076	T	0.13737	-1.0498	10	0.46703	T	0.11	.	4.0569	0.09821	0.2319:0.1052:0.4621:0.2007	.	227	Q8N628	OR2C3_HUMAN	M	227	ENSP00000355443:L227M	ENSP00000355443:L227M	L	-	1	2	OR2C3	245761758	0.000000	0.05858	0.013000	0.15412	0.124000	0.20399	-0.024000	0.12435	-2.640000	0.00429	-1.001000	0.02504	TTG		0.537	OR2C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097626.2	NM_198074		20	92	0	0	0	0.016522	0	20	92				
ZMYND11	10771	broad.mit.edu	37	10	225956	225956	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr10:225956G>A	ENST00000397962.3	+	2	432	c.4G>A	c.(4-6)Gca>Aca	p.A2T	ZMYND11_ENST00000403354.1_Missense_Mutation_p.A2T|ZMYND11_ENST00000381602.4_5'UTR|ZMYND11_ENST00000602682.1_Missense_Mutation_p.A2T|ZMYND11_ENST00000509513.2_Missense_Mutation_p.A2T|ZMYND11_ENST00000381607.4_5'UTR|ZMYND11_ENST00000381584.1_5'UTR|ZMYND11_ENST00000558098.2_Missense_Mutation_p.A2T|ZMYND11_ENST00000381604.4_5'UTR|ZMYND11_ENST00000381591.1_Missense_Mutation_p.A2T|ZMYND11_ENST00000397959.3_Missense_Mutation_p.A2T|ZMYND11_ENST00000402736.1_Missense_Mutation_p.A2T|ZMYND11_ENST00000309776.4_5'UTR			Q15326	ZMY11_HUMAN	zinc finger, MYND-type containing 11	2					cell cycle (GO:0007049)|cell proliferation (GO:0008283)|chromatin modification (GO:0016568)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription elongation from RNA polymerase II promoter (GO:0034243)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.A2T(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|skin(2)	24		all_cancers(4;1.32e-05)|all_lung(4;3.67e-05)|Lung NSC(4;0.000301)|all_epithelial(10;0.000416)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.132)	Epithelial(11;0.00289)|all cancers(11;0.0108)|Lung(33;0.0689)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		ACAGGTCATGGCACGTTTAAC	0.363																																							uc010pzt.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(4-6)GCA>ACA		zinc finger, MYND domain containing 11 isoform							94.0	84.0	87.0					10																	225956		1568	3582	5150	SO:0001583	missense	10771				cell cycle|cell proliferation|interspecies interaction between organisms|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr10:225956G>A	X86098	CCDS7052.1, CCDS7053.1, CCDS7052.2, CCDS55696.1, CCDS55697.1, CCDS7053.2, CCDS73060.1, CCDS73061.1	10p14	2011-01-26	2011-01-26		ENSG00000015171	ENSG00000015171		"""Zinc fingers, MYND-type"""	16966	protein-coding gene	gene with protein product		608668	"""zinc finger, MYND domain containing 11"""			7621829, 10734313	Standard	NM_006624		Approved	BS69	uc010pzx.2	Q15326	OTTHUMG00000017526	ENST00000397962.3:c.4G>A	10.37:g.225956G>A	ENSP00000381053:p.Ala2Thr					ZMYND11_uc001ifk.2_Missense_Mutation_p.A2T|ZMYND11_uc010pzu.1_Missense_Mutation_p.A2T|ZMYND11_uc010pzv.1_Missense_Mutation_p.A2T|ZMYND11_uc010pzw.1_Missense_Mutation_p.A2T|ZMYND11_uc001ifm.2_Missense_Mutation_p.A2T|ZMYND11_uc010pzx.1_Missense_Mutation_p.A2T|ZMYND11_uc001ifn.2_Missense_Mutation_p.A2T|ZMYND11_uc009xhg.2_5'UTR	p.A2T	NM_006624	NP_006615	Q15326	ZMY11_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;0.132)	Epithelial(11;0.00289)|all cancers(11;0.0108)|Lung(33;0.0689)|OV - Ovarian serous cystadenocarcinoma(14;0.106)	2	432	+		all_cancers(4;1.32e-05)|all_lung(4;3.67e-05)|Lung NSC(4;0.000301)|all_epithelial(10;0.000416)|Colorectal(49;0.14)	Error:Variant_position_missing_in_Q15326_after_alignment					B2R6G8|B7Z293|F6UH50|Q2LD45|Q2LD46|Q2LD47|Q2LD48|Q5VUI1|Q8N4B3	Missense_Mutation	SNP	ENST00000397962.3	37	c.4G>A	CCDS7052.2	.	.	.	.	.	.	.	.	.	.	G	19.09	3.760807	0.69763	.	.	ENSG00000015171	ENST00000439456;ENST00000397962;ENST00000509513;ENST00000397959;ENST00000381591;ENST00000403354;ENST00000402736;ENST00000397955	.	.	.	6.02	6.02	0.97574	.	0.232109	0.28958	U	0.013593	T	0.38427	0.1040	N	0.14661	0.345	0.23620	N	0.997276	B;B;B;B;B;B;B	0.34103	0.02;0.437;0.0;0.006;0.008;0.002;0.006	B;B;B;B;B;B;B	0.23419	0.01;0.046;0.002;0.01;0.007;0.007;0.01	T	0.46219	-0.9207	8	0.62326	D	0.03	-6.8555	20.547	0.99278	0.0:0.0:1.0:0.0	.	2;2;2;2;2;2;2	Q2LD45;B7Z293;B7Z2J6;Q2LD48;Q2LD46;Q2LD47;E7ENI9	.;.;.;.;.;.;.	T	2	.	ENSP00000371003:A2T	A	+	1	0	ZMYND11	215956	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.998000	0.76277	2.850000	0.98022	0.650000	0.86243	GCA		0.363	ZMYND11-206	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046382.4	NM_006624		27	23	0	0	0	0.004656	0	27	23				
GATA3	2625	broad.mit.edu	37	10	8115980	8115980	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr10:8115980G>T	ENST00000346208.3	+	6	1781	c.1326G>T	c.(1324-1326)atG>atT	p.M442I	GATA3_ENST00000461472.1_3'UTR|GATA3_ENST00000379328.3_Missense_Mutation_p.M443I			P23771	GATA3_HUMAN	GATA binding protein 3	442					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.M443I(2)		NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						TCACCGCCATGGGTTAGAGCC	0.607			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																																uc001ika.2		NA		Rec	yes		10	10p15	2625	F|N|S	GATA binding protein 3	yes	HDR syndrome (HYPOPARATHYROIDISM|SENSORINEURAL DEAFNESS|AND RENAL DISEASE)	E			breast		2	Substitution - Missense(2)		lung(2)	breast(17)|ovary(3)|central_nervous_system(2)	22						c.(1324-1326)ATG>ATT		GATA binding protein 3 isoform 2							70.0	58.0	62.0					10																	8115980		2203	4300	6503	SO:0001583	missense	2625				aortic valve morphogenesis|blood coagulation|canonical Wnt receptor signaling pathway involved in metanephric kidney development|cardiac right ventricle morphogenesis|cell fate determination|cellular response to interferon-alpha|cellular response to interleukin-4|cellular response to tumor necrosis factor|defense response|ear development|lymphocyte migration|male gonad development|mesenchymal to epithelial transition|mesonephros development|negative regulation of cell cycle|negative regulation of cell motility|negative regulation of cell proliferation involved in mesonephros development|negative regulation of endothelial cell apoptosis|negative regulation of fat cell differentiation|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation|negative regulation of inflammatory response|negative regulation of mammary gland epithelial cell proliferation|nephric duct formation|norepinephrine biosynthetic process|pharyngeal system development|phosphatidylinositol 3-kinase cascade|positive regulation of endothelial cell migration|positive regulation of interleukin-13 secretion|positive regulation of interleukin-4 production|positive regulation of interleukin-5 secretion|positive regulation of protein kinase B signaling cascade|positive regulation of T cell differentiation|positive regulation of thyroid hormone generation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription regulatory region DNA binding|positive regulation of ureteric bud formation|regulation of cellular response to X-ray|regulation of cytokine biosynthetic process|regulation of nephron tubule epithelial cell differentiation|response to estrogen stimulus|response to virus|sympathetic nervous system development|T cell receptor signaling pathway|TOR signaling cascade|ureteric bud formation|uterus development|ventricular septum development	nuclear chromatin|nucleolus|nucleoplasm	core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|E-box binding|HMG box domain binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|transcription coactivator activity|transcription factor binding|zinc ion binding	g.chr10:8115980G>T	X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.1326G>T	10.37:g.8115980G>T	ENSP00000341619:p.Met442Ile					GATA3_uc001ijz.2_Missense_Mutation_p.M443I	p.M442I	NM_002051	NP_002042	P23771	GATA3_HUMAN			6	1883	+			442					Q5VWG7|Q5VWG8|Q96J16	Missense_Mutation	SNP	ENST00000346208.3	37	c.1326G>T	CCDS7083.1	.	.	.	.	.	.	.	.	.	.	G	17.03	3.284587	0.59867	.	.	ENSG00000107485	ENST00000379328;ENST00000346208	D;D	0.96716	-4.1;-4.07	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	D	0.97532	0.9192	L	0.53249	1.67	0.80722	D	1	B;D	0.69078	0.131;0.997	B;D	0.79784	0.039;0.993	D	0.97596	1.0120	10	0.51188	T	0.08	-14.4418	19.5966	0.95541	0.0:0.0:1.0:0.0	.	442;443	P23771;P23771-2	GATA3_HUMAN;.	I	443;442	ENSP00000368632:M443I;ENSP00000341619:M442I	ENSP00000341619:M442I	M	+	3	0	GATA3	8155986	1.000000	0.71417	1.000000	0.80357	0.370000	0.29829	9.480000	0.97931	2.622000	0.88805	0.561000	0.74099	ATG		0.607	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046719.1	NM_001002295		13	139	1	0	2.32416e-17	0.014323	3.14531e-17	13	139				
SLC39A12	221074	broad.mit.edu	37	10	18254567	18254567	+	Silent	SNP	T	T	C			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr10:18254567T>C	ENST00000377369.2	+	4	972	c.699T>C	c.(697-699)ttT>ttC	p.F233F	SLC39A12_ENST00000377374.4_Silent_p.F233F|SLC39A12_ENST00000377371.3_Silent_p.F233F|SLC39A12_ENST00000539911.1_Silent_p.F99F	NM_001145195.1|NM_001282733.1|NM_001282734.1	NP_001138667.1|NP_001269662.1|NP_001269663.1	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter), member 12	233					regulation of microtubule polymerization (GO:0031113)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)|zinc ion transmembrane import (GO:0071578)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	zinc ion transmembrane transporter activity (GO:0005385)	p.F233F(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(5)|lung(38)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	60						CAGACTACTTTACAGAATATA	0.428																																							uc001ipo.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|breast(1)	2						c.(697-699)TTT>TTC		solute carrier family 39 (zinc transporter),							67.0	65.0	66.0					10																	18254567		2203	4300	6503	SO:0001819	synonymous_variant	221074				zinc ion transport	integral to membrane	metal ion transmembrane transporter activity	g.chr10:18254567T>C		CCDS7124.1, CCDS44362.1, CCDS60493.1, CCDS60494.1	10p12.33	2013-05-22			ENSG00000148482	ENSG00000148482		"""Solute carriers"""	20860	protein-coding gene	gene with protein product		608734	"""solute carrier family 39 (metal ion transporter), member 12"""			12659941	Standard	NM_152725		Approved	FLJ30499	uc001ipo.2	Q504Y0	OTTHUMG00000017759	ENST00000377369.2:c.699T>C	10.37:g.18254567T>C						SLC39A12_uc001ipn.2_Silent_p.F233F|SLC39A12_uc001ipp.2_Silent_p.F233F|SLC39A12_uc010qck.1_Silent_p.F99F	p.F233F	NM_001145195	NP_001138667	Q504Y0	S39AC_HUMAN			4	972	+			233			Cytoplasmic (Potential).		B7ZL35|C9JJL4|Q49AN8|Q4G0L3|Q5VWV8|Q5VWV9|Q6NZY5|Q96NN4	Silent	SNP	ENST00000377369.2	37	c.699T>C	CCDS44362.1																																																																																				0.428	SLC39A12-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_152725		34	102	0	0	0	0.013726	0	34	102				
THNSL1	79896	broad.mit.edu	37	10	25313947	25313947	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr10:25313947C>T	ENST00000524413.1	+	3	2142	c.1795C>T	c.(1795-1797)Cat>Tat	p.H599Y	THNSL1_ENST00000376356.4_Missense_Mutation_p.H599Y			Q8IYQ7	THNS1_HUMAN	threonine synthase-like 1 (S. cerevisiae)	599						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.H599Y(1)		NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(5)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	28					L-Threonine(DB00156)	AAGTCAGCATCATTTCCAGAT	0.388																																							uc001isi.3		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(1795-1797)CAT>TAT		threonine synthase-like 1	L-Threonine(DB00156)|Pyridoxal Phosphate(DB00114)						71.0	78.0	76.0					10																	25313947		2203	4300	6503	SO:0001583	missense	79896				threonine biosynthetic process		ATP binding|pyridoxal phosphate binding|shikimate kinase activity|threonine synthase activity	g.chr10:25313947C>T	AK025655	CCDS7147.1	10p12.31	2008-02-05	2007-06-20		ENSG00000185875	ENSG00000185875			26160	protein-coding gene	gene with protein product		611260	"""threonine synthase-like 1 (bacterial)"""			12477932	Standard	NM_024838		Approved	FLJ22002	uc001isi.4	Q8IYQ7	OTTHUMG00000017828	ENST00000524413.1:c.1795C>T	10.37:g.25313947C>T	ENSP00000434887:p.His599Tyr					ENKUR_uc001ish.1_Intron	p.H599Y	NM_024838	NP_079114	Q8IYQ7	THNS1_HUMAN			3	2124	+			599					B3KWL1|D3DRV3|Q5VV21	Missense_Mutation	SNP	ENST00000524413.1	37	c.1795C>T	CCDS7147.1	.	.	.	.	.	.	.	.	.	.	C	8.210	0.800009	0.16397	.	.	ENSG00000185875	ENST00000524413;ENST00000376356	D;D	0.96716	-4.1;-4.1	5.94	5.94	0.96194	Threonine synthase (1);Pyridoxal phosphate-dependent enzyme, beta subunit (2);	0.051835	0.85682	D	0.000000	D	0.93216	0.7839	L	0.41824	1.3	0.43054	D	0.99466	B	0.13145	0.007	B	0.14023	0.01	D	0.89059	0.3461	10	0.23302	T	0.38	-13.9006	14.5077	0.67764	0.0:0.9303:0.0:0.0697	.	599	Q8IYQ7	THNS1_HUMAN	Y	599	ENSP00000434887:H599Y;ENSP00000365534:H599Y	ENSP00000365534:H599Y	H	+	1	0	THNSL1	25353953	0.997000	0.39634	0.992000	0.48379	0.981000	0.71138	2.967000	0.49216	2.826000	0.97356	0.561000	0.74099	CAT		0.388	THNSL1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394913.1	NM_024838		15	146	0	0	0	0.003163	0	15	146				
ZNF239	8187	broad.mit.edu	37	10	44052539	44052539	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr10:44052539T>C	ENST00000306006.6	-	2	1641	c.989A>G	c.(988-990)cAg>cGg	p.Q330R	ZNF239_ENST00000491188.1_5'Flank|ZNF239_ENST00000374446.2_Missense_Mutation_p.Q330R|ZNF239_ENST00000426961.1_Missense_Mutation_p.Q330R|ZNF239_ENST00000535642.1_Missense_Mutation_p.Q330R	NM_005674.2	NP_005665.2	Q16600	ZN239_HUMAN	zinc finger protein 239	330					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q330R(1)		endometrium(5)|large_intestine(5)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20						GTTTGAGCGCTGACTGAAGCT	0.552																																							uc001jaw.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(988-990)CAG>CGG		zinc finger protein 239							99.0	103.0	102.0					10																	44052539		2203	4300	6503	SO:0001583	missense	8187				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|RNA binding|zinc ion binding	g.chr10:44052539T>C	X82125	CCDS41502.1	10q11.22-q11.23	2013-01-08			ENSG00000196793	ENSG00000196793		"""Zinc fingers, C2H2-type"""	13031	protein-coding gene	gene with protein product		601069				8903737, 8587123	Standard	NM_005674		Approved	MOK2, HOK-2	uc009xmk.3	Q16600	OTTHUMG00000018033	ENST00000306006.6:c.989A>G	10.37:g.44052539T>C	ENSP00000307774:p.Gln330Arg					ZNF239_uc001jax.3_Missense_Mutation_p.Q330R|ZNF239_uc009xmj.2_Missense_Mutation_p.Q330R|ZNF239_uc009xmk.2_Missense_Mutation_p.Q330R	p.Q330R	NM_005674	NP_005665	Q16600	ZN239_HUMAN			2	1642	-			330			C2H2-type 5.		Q5T1G9|Q8TAS5	Missense_Mutation	SNP	ENST00000306006.6	37	c.989A>G	CCDS41502.1	.	.	.	.	.	.	.	.	.	.	T	12.55	1.971120	0.34754	.	.	ENSG00000196793	ENST00000306006;ENST00000374446;ENST00000426961;ENST00000535642;ENST00000339962	T;T;T;T	0.36157	1.27;1.27;1.27;1.27	3.78	3.78	0.43462	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.37489	0.1005	N	0.15975	0.35	0.27908	N	0.938712	D	0.67145	0.996	D	0.77004	0.989	T	0.12400	-1.0549	9	0.21540	T	0.41	-16.0739	9.2109	0.37318	0.0:0.0:0.0:1.0	.	330	Q16600	ZN239_HUMAN	R	330	ENSP00000307774:Q330R;ENSP00000363569:Q330R;ENSP00000398202:Q330R;ENSP00000443907:Q330R	ENSP00000307774:Q330R	Q	-	2	0	ZNF239	43372545	0.000000	0.05858	1.000000	0.80357	0.985000	0.73830	0.360000	0.20250	1.942000	0.56320	0.477000	0.44152	CAG		0.552	ZNF239-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047710.1			34	67	0	0	0	0.015359	0	34	67				
RBP3	5949	broad.mit.edu	37	10	48389941	48389941	+	Silent	SNP	G	G	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr10:48389941G>A	ENST00000224600.4	-	1	1050	c.937C>T	c.(937-939)Ctg>Ttg	p.L313L	AL731561.2_ENST00000581861.1_RNA	NM_002900.2	NP_002891.1	P10745	RET3_HUMAN	retinol binding protein 3, interstitial	313	4 X approximate tandem repeats.				lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transport (GO:0006810)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|interphotoreceptor matrix (GO:0033165)|vesicle (GO:0031982)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|serine-type peptidase activity (GO:0008236)	p.L313L(1)		central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(30)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59					Vitamin A(DB00162)	GCTTTCTCCAGGGCCTGCTCG	0.692																																							uc001jez.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)|central_nervous_system(1)	2						c.(937-939)CTG>TTG		retinol-binding protein 3 precursor	Vitamin A(DB00162)						29.0	29.0	29.0					10																	48389941		2201	4300	6501	SO:0001819	synonymous_variant	5949				lipid metabolic process|proteolysis|transport|visual perception	interphotoreceptor matrix	retinal binding|serine-type peptidase activity	g.chr10:48389941G>A	M22453	CCDS73119.1	10q11.2	2014-05-06	2001-11-28		ENSG00000107618	ENSG00000265203			9921	protein-coding gene	gene with protein product		180290	"""retinol-binding protein 3, interstitial"""				Standard	NM_002900		Approved	D10S64, D10S65, D10S66, RP66	uc001jez.3	P10745	OTTHUMG00000188321	ENST00000224600.4:c.937C>T	10.37:g.48389941G>A							p.L313L	NM_002900	NP_002891	P10745	RET3_HUMAN			1	1051	-			313			4 X approximate tandem repeats.|1.		Q0QD34|Q5VSR0|Q8IXN0	Silent	SNP	ENST00000224600.4	37	c.937C>T	CCDS7218.1																																																																																				0.692	RBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047888.1	NM_002900		16	43	0	0	0	0.003163	0	16	43				
UBE2D1	7321	broad.mit.edu	37	10	60124575	60124575	+	Silent	SNP	T	T	C			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr10:60124575T>C	ENST00000373910.4	+	5	470	c.243T>C	c.(241-243)aaT>aaC	p.N81N		NM_001204880.1|NM_003338.4	NP_001191809.1|NP_003329.1	P51668	UB2D1_HUMAN	ubiquitin-conjugating enzyme E2D 1	81					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|BMP signaling pathway (GO:0030509)|cellular response to hypoxia (GO:0071456)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K48-linked ubiquitination (GO:0070936)|protein polyubiquitination (GO:0000209)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|protein complex (GO:0043234)|ubiquitin ligase complex (GO:0000151)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)	p.N81N(1)		central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|prostate(1)|skin(2)	10						TAAACAGTAATGGAAGTATTT	0.318																																							uc001jke.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)	2						c.(241-243)AAT>AAC		ubiquitin-conjugating enzyme E2D 1							138.0	129.0	132.0					10																	60124575		2203	4300	6503	SO:0001819	synonymous_variant	7321				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|BMP signaling pathway|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K48-linked ubiquitination|transforming growth factor beta receptor signaling pathway	cytosol|nucleoplasm	ATP binding|protein binding|ubiquitin-protein ligase activity	g.chr10:60124575T>C	BC015997	CCDS7252.1, CCDS73139.1	10q21.1	2011-05-19	2011-05-19		ENSG00000072401	ENSG00000072401		"""Ubiquitin-conjugating enzymes E2"""	12474	protein-coding gene	gene with protein product		602961	"""stimulator of Fe transport"", ""ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast)"""	SFT		10072594, 8530467	Standard	NM_003338		Approved	UbcH5A, UBCH5, UBC4/5, E2(17)KB1	uc001jke.2	P51668	OTTHUMG00000018269	ENST00000373910.4:c.243T>C	10.37:g.60124575T>C							p.N81N	NM_003338	NP_003329	P51668	UB2D1_HUMAN			5	466	+			81					A6NLF6|A8K786	Silent	SNP	ENST00000373910.4	37	c.243T>C	CCDS7252.1																																																																																				0.318	UBE2D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048143.2	NM_003338		23	19	0	0	0	0.008361	0	23	19				
SUPV3L1	6832	broad.mit.edu	37	10	70951419	70951419	+	Silent	SNP	A	A	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr10:70951419A>T	ENST00000359655.4	+	6	810	c.750A>T	c.(748-750)ccA>ccT	p.P250P	SUPV3L1_ENST00000483572.1_3'UTR	NM_003171.3	NP_003162.2	Q8IYB8	SUV3_HUMAN	suppressor of var1, 3-like 1 (S. cerevisiae)	250	Helicase ATP-binding.				ATP catabolic process (GO:0006200)|chromatin maintenance (GO:0070827)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|mitochondrial mRNA catabolic process (GO:0000958)|mitochondrial mRNA surveillance (GO:0035946)|mitochondrial ncRNA surveillance (GO:0035945)|mitochondrial RNA 3'-end processing (GO:0000965)|mitochondrial RNA surveillance (GO:2000827)|mitochondrion morphogenesis (GO:0070584)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell growth (GO:0030307)|positive regulation of mitochondrial RNA catabolic process (GO:0000962)|RNA catabolic process (GO:0006401)	mitochondrial degradosome (GO:0045025)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	3'-5' RNA helicase activity (GO:0034458)|ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)	p.P250P(1)		NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						AGGGTGTGCCATGTGACTTGG	0.398																																							uc001jpe.1		NA																	1	Substitution - coding silent(1)		lung(1)	urinary_tract(1)|ovary(1)	2						c.(748-750)CCA>CCT		suppressor of var1, 3-like 1 precursor							179.0	155.0	163.0					10																	70951419		2203	4300	6503	SO:0001819	synonymous_variant	6832				DNA duplex unwinding	mitochondrial nucleoid|nucleus	ATP binding|DNA binding|DNA helicase activity|RNA binding	g.chr10:70951419A>T	AF042169	CCDS7287.1	10q22.1	2008-08-01	2001-11-28		ENSG00000156502	ENSG00000156502			11471	protein-coding gene	gene with protein product		605122	"""suppressor of var1 (S.cerevisiae) 3-like 1"""			9925937, 16176273	Standard	XM_005270068		Approved	SUV3	uc001jpe.1	Q8IYB8	OTTHUMG00000018375	ENST00000359655.4:c.750A>T	10.37:g.70951419A>T						SUPV3L1_uc010qjd.1_Silent_p.P119P	p.P250P	NM_003171	NP_003162	Q8IYB8	SUV3_HUMAN			6	805	+			250			Helicase ATP-binding.		A8K301|O43630	Silent	SNP	ENST00000359655.4	37	c.750A>T	CCDS7287.1																																																																																				0.398	SUPV3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048396.2	NM_003171		11	41	0	0	0	0.010729	0	11	41				
MGEA5	10724	broad.mit.edu	37	10	103560073	103560073	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr10:103560073T>C	ENST00000361464.3	-	8	1516	c.1121A>G	c.(1120-1122)tAt>tGt	p.Y374C	MGEA5_ENST00000482611.1_5'Flank|MGEA5_ENST00000439817.1_Intron|MGEA5_ENST00000357797.5_Intron|MGEA5_ENST00000370094.3_Missense_Mutation_p.Y374C	NM_012215.3	NP_036347.1	O60502	OGA_HUMAN	meningioma expressed antigen 5 (hyaluronidase)	374					aging (GO:0007568)|dATP metabolic process (GO:0046060)|glycoprotein catabolic process (GO:0006516)|N-acetylglucosamine metabolic process (GO:0006044)|necrotic cell death (GO:0070265)|negative regulation of cardiac muscle adaptation (GO:0010616)|negative regulation of protein glycosylation (GO:0060051)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cell killing (GO:0031343)|positive regulation of DNA metabolic process (GO:0051054)|positive regulation of glucose import (GO:0046326)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of protein complex disassembly (GO:0043243)|positive regulation of proteolysis (GO:0045862)|protein targeting to membrane (GO:0006612)|response to steroid hormone (GO:0048545)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|hyalurononglucosaminidase activity (GO:0004415)	p.Y374C(1)		central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	23		Colorectal(252;0.207)		Epithelial(162;4.67e-09)|all cancers(201;2.54e-07)		CTGTGGACTATAGAGTACATC	0.378																																							uc001ktv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(1120-1122)TAT>TGT		meningioma expressed antigen 5 (hyaluronidase)							194.0	166.0	176.0					10																	103560073		2203	4300	6503	SO:0001583	missense	10724				glycoprotein catabolic process	cytoplasm|nucleus	histone acetyltransferase activity|hyalurononglucosaminidase activity	g.chr10:103560073T>C	AF036144	CCDS7520.1, CCDS44471.1	10q24.1-q24.3	2008-08-01			ENSG00000198408	ENSG00000198408			7056	protein-coding gene	gene with protein product	"""nuclear cytoplasmic O-GlcNAcase and acetyltransferase"""	604039				9811929, 16356930	Standard	NM_012215		Approved	MEA5, NCOAT, OGA	uc001ktv.2	O60502	OTTHUMG00000018939	ENST00000361464.3:c.1121A>G	10.37:g.103560073T>C	ENSP00000354850:p.Tyr374Cys					MGEA5_uc001ktu.2_5'Flank|MGEA5_uc010qqe.1_Intron|MGEA5_uc009xws.2_Intron|MGEA5_uc001ktw.2_Missense_Mutation_p.Y374C|MGEA5_uc009xwt.2_Missense_Mutation_p.Y137C	p.Y374C	NM_012215	NP_036347	O60502	NCOAT_HUMAN		Epithelial(162;4.67e-09)|all cancers(201;2.54e-07)	8	1564	-		Colorectal(252;0.207)	374					B7WPB9|D3DR79|E9PGF9|O75166|Q86WV0|Q8IV98|Q9BVA5|Q9HAR0	Missense_Mutation	SNP	ENST00000361464.3	37	c.1121A>G	CCDS7520.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.420600	0.83559	.	.	ENSG00000198408	ENST00000361464;ENST00000370094	T;T	0.61274	0.2;0.12	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.68531	0.3011	L	0.36672	1.1	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.71692	-0.4516	10	0.87932	D	0	-13.8594	16.1485	0.81594	0.0:0.0:0.0:1.0	.	374;374	O60502-3;O60502	.;NCOAT_HUMAN	C	374	ENSP00000354850:Y374C;ENSP00000359112:Y374C	ENSP00000354850:Y374C	Y	-	2	0	MGEA5	103550063	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	7.655000	0.83696	2.281000	0.76405	0.533000	0.62120	TAT		0.378	MGEA5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049987.1	NM_012215		58	153	0	0	0	0.01441	0	58	153				
CALY	50632	broad.mit.edu	37	10	135140380	135140380	+	Splice_Site	SNP	A	A	G			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr10:135140380A>G	ENST00000252939.4	-	4	454		c.e4+1		ZNF511_ENST00000368554.4_Intron|CALY_ENST00000368558.1_Splice_Site|CALY_ENST00000467611.1_5'Flank|CALY_ENST00000368556.2_Splice_Site|RP11-122K13.14_ENST00000605518.1_lincRNA	NM_015722.3	NP_056537.1	Q9NYX4	CALY_HUMAN	calcyon neuron-specific vesicular protein						clathrin coat assembly (GO:0048268)|dopamine receptor signaling pathway (GO:0007212)|endocytosis (GO:0006897)|positive regulation of endocytosis (GO:0045807)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)	clathrin light chain binding (GO:0032051)	p.?(1)		kidney(1)|lung(2)	3		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;6.94e-06)|OV - Ovarian serous cystadenocarcinoma(35;7.8e-06)|Epithelial(32;9.31e-06)	Apomorphine(DB00714)|Clozapine(DB00363)|Trifluoperazine(DB00831)	TGGCCCCCTTACCCGCAGCAG	0.667																																							uc001lmo.2		NA																	1	Unknown(1)		lung(1)		0						c.e4+1		dopamine receptor D1 interacting protein	Apomorphine(DB00714)|Clozapine(DB00363)|Flupenthixol(DB00875)|Trifluoperazine(DB00831)						37.0	31.0	33.0					10																	135140380		2200	4293	6493	SO:0001630	splice_region_variant	50632				clathrin coat assembly|dopamine receptor signaling pathway|endocytosis|positive regulation of endocytosis	cytoplasmic vesicle membrane|integral to plasma membrane	clathrin light chain binding|dopamine receptor binding	g.chr10:135140380A>G	AF225903	CCDS7678.1	10q26.3	2008-07-02	2008-01-16	2008-01-16	ENSG00000130643	ENSG00000130643			17938	protein-coding gene	gene with protein product		604647	"""dopamine receptor D1 interacting protein"""	DRD1IP		10698743, 17623072	Standard	NM_015722		Approved	CALCYON, NSG3	uc001lmo.2	Q9NYX4	OTTHUMG00000019310	ENST00000252939.4:c.360+1T>C	10.37:g.135140380A>G						uc001lmn.2_5'Flank	p.R120_splice	NM_015722	NP_056537	Q9NYX4	CALY_HUMAN		all cancers(32;6.94e-06)|OV - Ovarian serous cystadenocarcinoma(35;7.8e-06)|Epithelial(32;9.31e-06)	4	518	-		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)						Q5VWX3|Q5VWY5|Q5VWY6	Splice_Site	SNP	ENST00000252939.4	37	c.360_splice	CCDS7678.1	.	.	.	.	.	.	.	.	.	.	A	7.166	0.586682	0.13749	.	.	ENSG00000130643	ENST00000252939;ENST00000368558;ENST00000368556	.	.	.	4.14	2.97	0.34412	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.0438	0.25035	0.7992:0.0:0.0:0.2008	.	.	.	.	.	-1	.	.	.	-	.	.	CALY	134990370	1.000000	0.71417	0.831000	0.32960	0.077000	0.17291	4.916000	0.63362	0.716000	0.32124	0.448000	0.29417	.		0.667	CALY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051122.1	NM_015722	Intron	4	12	0	0	0	0.009096	0	4	12				
NLRP6	171389	broad.mit.edu	37	11	280839	280839	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr11:280839G>C	ENST00000312165.5	+	4	1105	c.1105G>C	c.(1105-1107)Gag>Cag	p.E369Q	NLRP6_ENST00000534750.1_Missense_Mutation_p.E369Q	NM_138329.1	NP_612202.2	P59044	NALP6_HUMAN	NLR family, pyrin domain containing 6	369	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|regulation of inflammatory response (GO:0050727)|response to bacterium (GO:0009617)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|vasopressin receptor activity (GO:0005000)	p.E369Q(1)		breast(1)|skin(1)|upper_aerodigestive_tract(2)	4		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.28e-28)|Epithelial(43;2.47e-27)|OV - Ovarian serous cystadenocarcinoma(40;4.66e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.0485)|LUSC - Lung squamous cell carcinoma(625;0.122)		GAGGAGGGCCGAGCGCGCCTA	0.622																																							uc010qvs.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|skin(1)	2						c.(1105-1107)GAG>CAG		NLR family, pyrin domain containing 6							83.0	83.0	83.0					11																	280839		2203	4300	6503	SO:0001583	missense	171389					cytoplasm	ATP binding	g.chr11:280839G>C	AF479748	CCDS7693.1, CCDS60680.1	11p15	2006-12-08	2006-12-08	2006-12-08	ENSG00000174885	ENSG00000174885		"""Nucleotide-binding domain and leucine rich repeat containing"""	22944	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 6"""	609650	"""NACHT, leucine rich repeat and PYD containing 6"""	NALP6		12563287, 12019269	Standard	NM_138329		Approved	PYPAF5, PAN3, CLR11.4	uc010qvs.3	P59044	OTTHUMG00000119070	ENST00000312165.5:c.1105G>C	11.37:g.280839G>C	ENSP00000309767:p.Glu369Gln					NLRP6_uc010qvt.1_Missense_Mutation_p.E369Q	p.E369Q	NM_138329	NP_612202	P59044	NALP6_HUMAN		all cancers(45;4.28e-28)|Epithelial(43;2.47e-27)|OV - Ovarian serous cystadenocarcinoma(40;4.66e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.0485)|LUSC - Lung squamous cell carcinoma(625;0.122)	4	1105	+		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)	369			NACHT.		A8K9F3|E9PJZ8	Missense_Mutation	SNP	ENST00000312165.5	37	c.1105G>C	CCDS7693.1	.	.	.	.	.	.	.	.	.	.	G	9.307	1.054502	0.19907	.	.	ENSG00000174885	ENST00000534750;ENST00000312165	T;T	0.75589	-0.95;-0.93	4.03	-0.701	0.11269	NACHT nucleoside triphosphatase (1);	0.591091	0.14170	N	0.336814	T	0.69324	0.3098	L	0.32530	0.975	0.09310	N	1	D;D	0.67145	0.983;0.996	P;P	0.62014	0.792;0.897	T	0.60037	-0.7341	10	0.14656	T	0.56	.	5.4495	0.16554	0.2005:0.3111:0.4884:0.0	.	369;369	E9PJZ8;P59044	.;NALP6_HUMAN	Q	369	ENSP00000433617:E369Q;ENSP00000309767:E369Q	ENSP00000309767:E369Q	E	+	1	0	NLRP6	270839	0.001000	0.12720	0.043000	0.18650	0.893000	0.52053	1.039000	0.30266	0.070000	0.16634	0.455000	0.32223	GAG		0.622	NLRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239283.1	NM_138329		34	129	0	0	0	0.01441	0	34	129				
RNH1	6050	broad.mit.edu	37	11	500626	500626	+	Silent	SNP	G	G	T	rs149360262		TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr11:500626G>T	ENST00000534797.1	-	2	1537	c.130C>A	c.(130-132)Cgg>Agg	p.R44R	RNH1_ENST00000533592.1_5'Flank|RNH1_ENST00000438658.2_Silent_p.R44R|RNH1_ENST00000356187.5_Silent_p.R44R|RNH1_ENST00000354420.2_Silent_p.R44R|RNH1_ENST00000397614.1_Silent_p.R44R|RNH1_ENST00000397615.2_Silent_p.R44R|RNH1_ENST00000533410.1_Silent_p.R44R|RNH1_ENST00000397604.3_Silent_p.R44R			O60930	RNH1_HUMAN	ribonuclease/angiogenin inhibitor 1	0					mitochondrial DNA replication (GO:0006264)|RNA catabolic process (GO:0006401)|RNA phosphodiester bond hydrolysis (GO:0090501)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	magnesium ion binding (GO:0000287)|nucleic acid binding (GO:0003676)|ribonuclease activity (GO:0004540)|RNA binding (GO:0003723)|RNA-DNA hybrid ribonuclease activity (GO:0004523)	p.R44R(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	10		all_cancers(49;3.02e-09)|all_epithelial(84;2.09e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;1.26e-26)|Epithelial(43;1.34e-25)|OV - Ovarian serous cystadenocarcinoma(40;5.31e-20)|BRCA - Breast invasive adenocarcinoma(625;8.01e-05)|Lung(200;0.0378)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TCCTTGCACCGTGCTTCCGTG	0.632																																							uc001lpk.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(130-132)CGG>AGG		ribonuclease/angiogenin inhibitor							88.0	63.0	71.0					11																	500626		2202	4300	6502	SO:0001819	synonymous_variant	6050				mRNA catabolic process|regulation of angiogenesis	angiogenin-PRI complex|cytoplasm	protein binding|ribonuclease inhibitor activity	g.chr11:500626G>T		CCDS7697.1	11p15.5	2008-02-05	2005-06-01	2005-06-01	ENSG00000023191	ENSG00000023191			10074	protein-coding gene	gene with protein product		173320	"""ribonuclease/angiogenin inhibitor"""	RNH			Standard	NM_203386		Approved	RAI	uc001lpo.1	P13489	OTTHUMG00000119086	ENST00000534797.1:c.130C>A	11.37:g.500626G>T						RNH1_uc001lpl.1_Silent_p.R44R|RNH1_uc001lpm.1_Silent_p.R44R|RNH1_uc001lpn.1_Silent_p.R44R|RNH1_uc001lpo.1_Silent_p.R44R|RNH1_uc009ybw.1_RNA|RNH1_uc001lpp.1_Silent_p.R44R|RNH1_uc001lpt.1_5'UTR|RNH1_uc001lpq.1_Silent_p.R44R|RNH1_uc001lpr.1_Silent_p.R44R|RNH1_uc001lps.1_Silent_p.R44R|RNH1_uc009ybx.1_Silent_p.R44R	p.R44R	NM_203389	NP_976323	P13489	RINI_HUMAN		all cancers(45;1.26e-26)|Epithelial(43;1.34e-25)|OV - Ovarian serous cystadenocarcinoma(40;5.31e-20)|BRCA - Breast invasive adenocarcinoma(625;8.01e-05)|Lung(200;0.0378)|LUSC - Lung squamous cell carcinoma(625;0.0703)	2	1538	-		all_cancers(49;3.02e-09)|all_epithelial(84;2.09e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)	44			LRR 1.		B3KQU4|O60523|O60857|Q57Z93|Q5U0C1|Q6FHD4	Silent	SNP	ENST00000534797.1	37	c.130C>A	CCDS7697.1																																																																																				0.632	RNH1-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384301.1	NM_203389		11	66	1	0	3.27435e-08	0.020292	3.77607e-08	11	66				
HRAS	3265	broad.mit.edu	37	11	533874	533874	+	Missense_Mutation	SNP	T	T	A	rs121913233		TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr11:533874T>A	ENST00000451590.1	-	3	369	c.182A>T	c.(181-183)cAg>cTg	p.Q61L	HRAS_ENST00000311189.7_Missense_Mutation_p.Q61L|HRAS_ENST00000397596.2_Missense_Mutation_p.Q61L|HRAS_ENST00000417302.1_Missense_Mutation_p.Q61L|HRAS_ENST00000468682.2_5'UTR|HRAS_ENST00000397594.1_Missense_Mutation_p.Q61L	NM_001130442.1|NM_005343.2	NP_001123914.1|NP_005334.1	P01112	RASH_HUMAN	Harvey rat sarcoma viral oncogene homolog	61			Q -> K (in follicular thyroid carcinoma samples; somatic mutation; increases transformation of cultured cell lines; dbSNP:rs28933406). {ECO:0000269|PubMed:12727991}.|Q -> L (in melanoma; strongly reduced GTP hydrolysis in the presence of RAF1; increases transformation of cultured cell lines).		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular senescence (GO:0090398)|chemotaxis (GO:0006935)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway (GO:0097193)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of cell differentiation (GO:0045596)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Rho GTPase activity (GO:0034259)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of wound healing (GO:0090303)|protein heterooligomerization (GO:0051291)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|protein C-terminus binding (GO:0008022)	p.Q61R(136)|p.Q61L(117)|p.Q61P(3)		adrenal_gland(1)|bone(3)|breast(7)|cervix(23)|endometrium(4)|haematopoietic_and_lymphoid_tissue(12)|kidney(1)|large_intestine(2)|liver(1)|lung(16)|oesophagus(2)|penis(2)|pituitary(10)|prostate(31)|salivary_gland(24)|skin(184)|soft_tissue(38)|stomach(14)|testis(5)|thymus(1)|thyroid(173)|upper_aerodigestive_tract(122)|urinary_tract(225)	901		all_cancers(49;4.37e-09)|all_epithelial(84;2.09e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;7.63e-28)|Epithelial(43;7.29e-27)|OV - Ovarian serous cystadenocarcinoma(40;7.15e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GTACTCCTCCTGGCCGGCGGT	0.597	Q61L(KNS62_LUNG)|Q61L(KYSE30_OESOPHAGUS)|Q61L(NCIH1915_LUNG)	6	Mis		"""infrequent sarcomas, rare other types"""	"""rhadomyosarcoma, ganglioneuroblastoma, bladder"""			Costello syndrome	HNSCC(11;0.0054)																													uc001lpv.2	Q61L(KNS62_LUNG)|Q61L(NCIH1915_LUNG)|Q61L(KYSE30_OESOPHAGUS)	6	yes	Dom	yes	Costello syndrome	11	11p15.5	3265	Mis	v-Ha-ras Harvey rat sarcoma viral oncogene homolog			"""E, L, M"""		rhadomyosarcoma|ganglioneuroblastoma|bladder	infrequent sarcomas|rare other types		256	Substitution - Missense(256)	p.Q61R(112)|p.Q61L(93)|p.Q61K(39)|p.Q61H(20)|p.Q61P(3)|p.Q61Q(1)|p.Q61E(1)	skin(70)|thyroid(58)|urinary_tract(53)|prostate(23)|upper_aerodigestive_tract(22)|lung(11)|salivary_gland(6)|haematopoietic_and_lymphoid_tissue(5)|testis(3)|liver(2)|cervix(1)|penis(1)|oesophagus(1)	urinary_tract(174)|thyroid(155)|skin(126)|upper_aerodigestive_tract(112)|soft_tissue(37)|prostate(29)|salivary_gland(24)|cervix(23)|stomach(14)|pituitary(10)|lung(9)|haematopoietic_and_lymphoid_tissue(9)|breast(6)|testis(5)|endometrium(4)|bone(3)|large_intestine(2)|oesophagus(2)|penis(2)|kidney(1)|adrenal_gland(1)|thymus(1)	749						c.(181-183)CAG>CTG		v-Ha-ras Harvey rat sarcoma viral oncogene	Sulindac(DB00605)						117.0	102.0	107.0					11																	533874		2203	4300	6503	SO:0001583	missense	3265	Costello_syndrome	Familial Cancer Database	incl.: Facio-Cutaneous-Skeletal syndrome	activation of MAPKK activity|axon guidance|blood coagulation|cell cycle arrest|cellular senescence|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|mitotic cell cycle G1/S transition checkpoint|negative regulation of cell proliferation|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of DNA replication|positive regulation of epithelial cell proliferation|Ras protein signal transduction|synaptic transmission	cytosol|Golgi membrane|plasma membrane	GTP binding|GTPase activity|protein C-terminus binding	g.chr11:533874T>A	AJ437024	CCDS7698.1, CCDS7699.1	11p15.5	2014-09-17	2013-07-08		ENSG00000174775	ENSG00000174775			5173	protein-coding gene	gene with protein product		190020	"""v-Ha-ras Harvey rat sarcoma viral oncogene homolog"""	HRAS1			Standard	NM_176795		Approved		uc010qvx.2	P01112	OTTHUMG00000131919	ENST00000451590.1:c.182A>T	11.37:g.533874T>A	ENSP00000407586:p.Gln61Leu	HNSCC(11;0.0054)				HRAS_uc010qvw.1_Missense_Mutation_p.Q61L|HRAS_uc010qvx.1_Missense_Mutation_p.Q61L|HRAS_uc010qvy.1_RNA	p.Q61L	NM_005343	NP_005334	P01112	RASH_HUMAN		all cancers(45;7.63e-28)|Epithelial(43;7.29e-27)|OV - Ovarian serous cystadenocarcinoma(40;7.15e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)	3	370	-		all_cancers(49;4.37e-09)|all_epithelial(84;2.09e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)	61	Q->V: Strongly increased transformation of cultured cell lines.|Q->I: Moderately increased transformation of cultured cell lines.	Q -> L (in melanoma; strongly reduced GTP hydrolysis in the presence of RAF1; increases transformation of cultured cell lines).	GTP.		B5BUA0|Q14080|Q6FHV9|Q9BR65|Q9UCE2	Missense_Mutation	SNP	ENST00000451590.1	37	c.182A>T	CCDS7698.1	.	.	.	.	.	.	.	.	.	.	T	15.80	2.940577	0.52972	.	.	ENSG00000174775	ENST00000397594;ENST00000397596;ENST00000451590;ENST00000417302;ENST00000311189	D;D;D;D;D	0.83992	-1.79;-1.79;-1.79;-1.79;-1.79	3.64	3.64	0.41730	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.89167	0.6638	H	0.97131	3.945	0.80722	D	1	P;P	0.36412	0.507;0.552	B;B	0.40329	0.145;0.326	D	0.91290	0.5058	10	0.72032	D	0.01	.	11.8872	0.52608	0.0:0.0:0.0:1.0	.	61;61	P01112-2;P01112	.;RASH_HUMAN	L	61	ENSP00000380722:Q61L;ENSP00000380723:Q61L;ENSP00000407586:Q61L;ENSP00000388246:Q61L;ENSP00000309845:Q61L	ENSP00000309845:Q61L	Q	-	2	0	HRAS	523874	1.000000	0.71417	0.985000	0.45067	0.482000	0.33219	7.727000	0.84838	1.662000	0.50781	0.459000	0.35465	CAG		0.597	HRAS-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259403.2	NM_176795		75	117	0	0	0	0.01441	0	75	117				
OR51E2	81285	broad.mit.edu	37	11	4703243	4703243	+	Silent	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr11:4703243C>A	ENST00000396950.3	-	2	938	c.699G>T	c.(697-699)cgG>cgT	p.R233R		NM_030774.3	NP_110401.1	Q9H255	O51E2_HUMAN	olfactory receptor, family 51, subfamily E, member 2	233					cellular response to fatty acid (GO:0071398)|detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|positive regulation of blood pressure (GO:0045777)|positive regulation of renin secretion into blood stream (GO:1900135)|steroid hormone mediated signaling pathway (GO:0043401)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)|signaling receptor activity (GO:0038023)|steroid hormone receptor activity (GO:0003707)	p.R233R(1)		NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(3)	23		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;3e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00476)|LUSC - Lung squamous cell carcinoma(625;0.2)		AGGCCTTGGCCCGCTCTGACT	0.512																																							uc001lzk.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(3)|ovary(2)	5						c.(697-699)CGG>CGT		olfactory receptor, family 51, subfamily E,							113.0	95.0	101.0					11																	4703243		2201	4298	6499	SO:0001819	synonymous_variant	81285				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4703243C>A	AY033942	CCDS7751.1	11p15	2012-08-09			ENSG00000167332	ENSG00000167332		"""GPCR / Class A : Olfactory receptors"""	15195	protein-coding gene	gene with protein product		611268				11118034	Standard	NM_030774		Approved	PSGR	uc001lzk.2	Q9H255	OTTHUMG00000133362	ENST00000396950.3:c.699G>T	11.37:g.4703243C>A							p.R233R	NM_030774	NP_110401	Q9H255	O51E2_HUMAN		Epithelial(150;3e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00476)|LUSC - Lung squamous cell carcinoma(625;0.2)	2	943	-		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)	233			Cytoplasmic (Potential).		B2RA63|Q6IF94	Silent	SNP	ENST00000396950.3	37	c.699G>T	CCDS7751.1																																																																																				0.512	OR51E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257198.1	NM_030774		21	75	1	0	2.89027e-11	0.014323	3.51254e-11	21	75				
OR10A2	341276	broad.mit.edu	37	11	6891431	6891431	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr11:6891431G>T	ENST00000307322.4	+	1	508	c.446G>T	c.(445-447)tGg>tTg	p.W149L		NM_001004460.1	NP_001004460.1	Q9H208	O10A2_HUMAN	olfactory receptor, family 10, subfamily A, member 2	149						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.W149L(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(12)|urinary_tract(1)	24		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.89e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		CAGACCACATGGCTCTTCAGT	0.537																																							uc001meu.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(445-447)TGG>TTG		olfactory receptor, family 10, subfamily A,							127.0	117.0	120.0					11																	6891431		2201	4294	6495	SO:0001583	missense	341276				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:6891431G>T	BK004293	CCDS31415.1	11p15.4	2012-08-09		2004-03-10	ENSG00000170790	ENSG00000170790		"""GPCR / Class A : Olfactory receptors"""	8161	protein-coding gene	gene with protein product				OR10A2P			Standard	NM_001004460		Approved	OST363	uc001meu.1	Q9H208	OTTHUMG00000165739	ENST00000307322.4:c.446G>T	11.37:g.6891431G>T	ENSP00000303862:p.Trp149Leu						p.W149L	NM_001004460	NP_001004460	Q9H208	O10A2_HUMAN		Epithelial(150;4.89e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)	1	446	+		Medulloblastoma(188;0.0523)|all_neural(188;0.236)	149			Extracellular (Potential).		B2RNL9|Q6IFG9	Missense_Mutation	SNP	ENST00000307322.4	37	c.446G>T	CCDS31415.1	.	.	.	.	.	.	.	.	.	.	g	10.96	1.499214	0.26861	.	.	ENSG00000170790	ENST00000307322	T	0.00026	8.94	4.14	4.14	0.48551	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000040	T	0.00073	0.0002	N	0.02802	-0.49	0.29597	N	0.848004	B	0.27498	0.18	B	0.34038	0.174	T	0.14227	-1.0480	10	0.05525	T	0.97	.	14.363	0.66785	0.0:0.0:1.0:0.0	.	149	Q9H208	O10A2_HUMAN	L	149	ENSP00000303862:W149L	ENSP00000303862:W149L	W	+	2	0	OR10A2	6848007	0.189000	0.23263	0.993000	0.49108	0.722000	0.41435	0.589000	0.23939	2.315000	0.78130	0.650000	0.86243	TGG		0.537	OR10A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385984.1	NM_001004460		70	143	1	0	1.34159e-35	0.01441	2.12378e-35	70	143				
FANCF	2188	broad.mit.edu	37	11	22646877	22646877	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr11:22646877G>C	ENST00000327470.3	-	1	510	c.480C>G	c.(478-480)gaC>gaG	p.D160E	AC103801.2_ENST00000428556.2_5'UTR	NM_022725.3	NP_073562.1	Q9NPI8	FANCF_HUMAN	Fanconi anemia, complementation group F	160					DNA repair (GO:0006281)|ovarian follicle development (GO:0001541)|spermatogenesis (GO:0007283)	Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)	ubiquitin-protein transferase activity (GO:0004842)	p.D160E(1)		kidney(3)|large_intestine(3)|lung(6)|skin(1)	13						TCATCAGAGAGTCCTCCTGGA	0.637			"""N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia		OREG0020844	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001mql.1		NA	yes	Rec		Fanconi anaemia F	11	11p15	2188	N|F	"""Fanconi anemia, complementation group F"""			L		AML|leukemia			1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(478-480)GAC>GAG	Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi anemia, complementation group F							88.0	107.0	100.0					11																	22646877		2201	4299	6500	SO:0001583	missense	2188	FanconAnemia	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	DNA repair	nucleoplasm	protein binding	g.chr11:22646877G>C		CCDS7857.1	11p15	2014-09-17				ENSG00000183161		"""Fanconi anemia, complementation groups"""	3587	protein-coding gene	gene with protein product		613897				9382107	Standard	NM_022725		Approved	FAF	uc001mql.1	Q9NPI8		ENST00000327470.3:c.480C>G	11.37:g.22646877G>C	ENSP00000330875:p.Asp160Glu		OREG0020844	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	757		p.D160E	NM_022725	NP_073562	Q9NPI8	FANCF_HUMAN			1	511	-			160					Q52LM0	Missense_Mutation	SNP	ENST00000327470.3	37	c.480C>G	CCDS7857.1	.	.	.	.	.	.	.	.	.	.	G	12.58	1.979211	0.34942	.	.	ENSG00000183161	ENST00000327470	T	0.31769	1.48	5.2	3.33	0.38152	.	0.886074	0.09880	N	0.743804	T	0.33352	0.0860	N	0.19112	0.55	0.09310	N	1	D	0.59767	0.986	P	0.59595	0.86	T	0.19192	-1.0313	10	0.27082	T	0.32	-13.4126	9.2786	0.37714	0.1656:0.0:0.8344:0.0	.	160	Q9NPI8	FANCF_HUMAN	E	160	ENSP00000330875:D160E	ENSP00000330875:D160E	D	-	3	2	FANCF	22603453	0.005000	0.15991	0.006000	0.13384	0.151000	0.21798	0.291000	0.18994	0.770000	0.33336	0.561000	0.74099	GAC		0.637	FANCF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387712.2	NM_022725		6	519	0	0	0	0.001984	0	6	519				
OR4C12	283093	broad.mit.edu	37	11	50003265	50003265	+	Missense_Mutation	SNP	C	C	T	rs141386333	byFrequency	TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr11:50003265C>T	ENST00000335238.4	-	1	806	c.773G>A	c.(772-774)cGc>cAc	p.R258H		NM_001005270.2	NP_001005270.2	Q96R67	OR4CC_HUMAN	olfactory receptor, family 4, subfamily C, member 12	258						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R258L(1)|p.R258P(1)|p.R258H(1)		NS(1)|kidney(4)|large_intestine(3)|liver(1)|lung(19)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	36						GGTCACTGAGCGCAGATACAC	0.433													.|||	2	0.000399361	0.0008	0.0014	5008	,	,		19331	0.0		0.0	False		,,,				2504	0.0						uc010ria.1		NA																	3	Substitution - Missense(3)		lung(3)	ovary(2)|skin(1)	3						c.(772-774)CGC>CAC		olfactory receptor, family 4, subfamily C,		C	HIS/ARG	0,4402		0,0,2201	73.0	67.0	69.0		773	3.0	0.2	11	dbSNP_134	69	1,8591		0,1,4295	yes	missense	OR4C12	NM_001005270.2	29	0,1,6496	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	258/310	50003265	1,12993	2201	4296	6497	SO:0001583	missense	283093				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:50003265C>T	BK004413	CCDS31496.1	11p11.12	2012-08-09			ENSG00000221954	ENSG00000221954		"""GPCR / Class A : Olfactory receptors"""	15168	protein-coding gene	gene with protein product							Standard	NM_001005270		Approved		uc010ria.2	Q96R67	OTTHUMG00000166687	ENST00000335238.4:c.773G>A	11.37:g.50003265C>T	ENSP00000334418:p.Arg258His						p.R258H	NM_001005270	NP_001005270	Q96R67	OR4CC_HUMAN			1	773	-			258			Extracellular (Potential).		B2RNF0|Q6IF49	Missense_Mutation	SNP	ENST00000335238.4	37	c.773G>A	CCDS31496.1	.	.	.	.	.	.	.	.	.	.	.	11.29	1.596540	0.28445	0.0	1.16E-4	ENSG00000221954	ENST00000335238	T	0.37752	1.18	2.98	2.98	0.34508	GPCR, rhodopsin-like superfamily (1);	0.169304	0.27886	U	0.017446	T	0.49525	0.1562	M	0.80746	2.51	0.09310	N	1	D	0.55800	0.973	P	0.51516	0.672	T	0.48479	-0.9032	10	0.72032	D	0.01	.	11.934	0.52864	0.0:1.0:0.0:0.0	.	258	Q96R67	OR4CC_HUMAN	H	258	ENSP00000334418:R258H	ENSP00000334418:R258H	R	-	2	0	OR4C12	49959841	0.001000	0.12720	0.236000	0.24074	0.390000	0.30446	1.308000	0.33528	1.698000	0.51180	0.398000	0.26397	CGC		0.433	OR4C12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391104.1	NM_001005270		14	76	0	0	0	0.020292	0	14	76				
OR4C15	81309	broad.mit.edu	37	11	55321872	55321872	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr11:55321872G>C	ENST00000314644.2	+	1	90	c.90G>C	c.(88-90)aaG>aaC	p.K30N		NM_001001920.1	NP_001001920.1	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C, member 15	0						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.K30N(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(31)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(5)	56						TTGATCTGAAGCAAATTTTCC	0.348										HNSCC(20;0.049)																													uc010rig.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(88-90)AAG>AAC		olfactory receptor, family 4, subfamily C,							158.0	156.0	156.0					11																	55321872		2201	4296	6497	SO:0001583	missense	81309				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55321872G>C	BK004319	CCDS31501.1	11q11	2012-08-09			ENSG00000181939	ENSG00000181939		"""GPCR / Class A : Olfactory receptors"""	15171	protein-coding gene	gene with protein product							Standard	NM_001001920		Approved		uc010rig.2	Q8NGM1	OTTHUMG00000166714	ENST00000314644.2:c.90G>C	11.37:g.55321872G>C	ENSP00000324958:p.Lys30Asn	HNSCC(20;0.049)					p.K30N	NM_001001920	NP_001001920	Q8NGM1	OR4CF_HUMAN			1	90	+			Error:Variant_position_missing_in_Q8NGM1_after_alignment					Q6IFE2	Missense_Mutation	SNP	ENST00000314644.2	37	c.90G>C	CCDS31501.1	.	.	.	.	.	.	.	.	.	.	G	4.400	0.073863	0.08485	.	.	ENSG00000181939	ENST00000314644	T	0.00005	9.77	4.79	-9.57	0.00562	.	.	.	.	.	T	0.00109	0.0003	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.14924	-1.0455	6	0.87932	D	0	.	15.3133	0.74053	0.1521:0.0:0.753:0.0949	.	.	.	.	N	30	ENSP00000324958:K30N	ENSP00000324958:K30N	K	+	3	2	OR4C15	55078448	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.204000	0.03017	-2.228000	0.00721	-1.615000	0.00797	AAG		0.348	OR4C15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391164.1	NM_001001920		65	113	0	0	0	0.01441	0	65	113				
OR5D14	219436	broad.mit.edu	37	11	55563657	55563657	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr11:55563657A>T	ENST00000335605.1	+	1	626	c.626A>T	c.(625-627)gAg>gTg	p.E209V		NM_001004735.1	NP_001004735.1	Q8NGL3	OR5DE_HUMAN	olfactory receptor, family 5, subfamily D, member 14	209						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E209V(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(30)|ovary(2)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	48		all_epithelial(135;0.196)				ACCTTCAATGAGATGTGTACA	0.448																																							uc010rim.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(625-627)GAG>GTG		olfactory receptor, family 5, subfamily D,							209.0	197.0	201.0					11																	55563657		2200	4296	6496	SO:0001583	missense	219436				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55563657A>T	AB065779	CCDS31508.1	11q11	2012-08-09			ENSG00000186113	ENSG00000186113		"""GPCR / Class A : Olfactory receptors"""	15281	protein-coding gene	gene with protein product							Standard	NM_001004735		Approved		uc010rim.2	Q8NGL3	OTTHUMG00000166809	ENST00000335605.1:c.626A>T	11.37:g.55563657A>T	ENSP00000334456:p.Glu209Val						p.E209V	NM_001004735	NP_001004735	Q8NGL3	OR5DE_HUMAN			1	626	+		all_epithelial(135;0.196)	209			Helical; Name=5; (Potential).		Q6IF69|Q6IFD4|Q96RB5	Missense_Mutation	SNP	ENST00000335605.1	37	c.626A>T	CCDS31508.1	.	.	.	.	.	.	.	.	.	.	a	7.247	0.602409	0.13939	.	.	ENSG00000186113	ENST00000335605	T	0.35421	1.31	5.08	5.08	0.68730	GPCR, rhodopsin-like superfamily (1);	0.000000	0.45867	D	0.000323	T	0.22859	0.0552	N	0.20986	0.625	0.33846	D	0.632092	B	0.20368	0.044	B	0.33690	0.168	T	0.26916	-1.0089	10	0.05525	T	0.97	-16.8287	7.6667	0.28434	0.905:0.0:0.095:0.0	.	209	Q8NGL3	OR5DE_HUMAN	V	209	ENSP00000334456:E209V	ENSP00000334456:E209V	E	+	2	0	OR5D14	55320233	0.000000	0.05858	0.938000	0.37757	0.031000	0.12232	0.534000	0.23098	1.916000	0.55485	0.523000	0.50628	GAG		0.448	OR5D14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391513.1	NM_001004735		78	149	0	0	0	0.01441	0	78	149				
OR5T1	390155	broad.mit.edu	37	11	56043831	56043831	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr11:56043831G>T	ENST00000313033.2	+	1	803	c.717G>T	c.(715-717)aaG>aaT	p.K239N		NM_001004745.1	NP_001004745.1	Q8NG75	OR5T1_HUMAN	olfactory receptor, family 5, subfamily T, member 1	239						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.K239N(1)		NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(27)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	43	Esophageal squamous(21;0.00448)					CCATTCTGAAGATGCAGTCTG	0.418																																							uc001nio.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(715-717)AAG>AAT		olfactory receptor, family 5, subfamily T,							214.0	195.0	201.0					11																	56043831		2201	4296	6497	SO:0001583	missense	390155				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56043831G>T	AB065962	CCDS31525.1	11q11	2012-08-09		2004-03-10	ENSG00000181698	ENSG00000181698		"""GPCR / Class A : Olfactory receptors"""	14821	protein-coding gene	gene with protein product				OR5T1P			Standard	NM_001004745		Approved		uc001nio.1	Q8NG75	OTTHUMG00000166853	ENST00000313033.2:c.717G>T	11.37:g.56043831G>T	ENSP00000323612:p.Lys239Asn						p.K239N	NM_001004745	NP_001004745	Q8NG75	OR5T1_HUMAN			1	717	+	Esophageal squamous(21;0.00448)		239			Cytoplasmic (Potential).		B2RNM9	Missense_Mutation	SNP	ENST00000313033.2	37	c.717G>T	CCDS31525.1	.	.	.	.	.	.	.	.	.	.	G	4.733	0.136246	0.09032	.	.	ENSG00000181698	ENST00000313033	T	0.00183	8.6	3.44	-0.774	0.10991	GPCR, rhodopsin-like superfamily (1);	0.768566	0.11477	N	0.560148	T	0.00241	0.0007	M	0.81341	2.54	0.09310	N	1	B	0.15141	0.012	B	0.24006	0.05	T	0.34279	-0.9835	10	0.66056	D	0.02	.	5.0198	0.14356	0.5094:0.1611:0.3295:0.0	.	239	Q8NG75	OR5T1_HUMAN	N	239	ENSP00000323612:K239N	ENSP00000323612:K239N	K	+	3	2	OR5T1	55800407	0.002000	0.14202	0.006000	0.13384	0.333000	0.28666	-0.145000	0.10265	-0.265000	0.09352	-0.385000	0.06624	AAG		0.418	OR5T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391600.1	NM_001004745		88	192	1	0	7.0627e-44	0.01441	1.16985e-43	88	192				
OR10Q1	219960	broad.mit.edu	37	11	57996185	57996185	+	Missense_Mutation	SNP	T	T	G			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr11:57996185T>G	ENST00000316770.2	-	1	205	c.163A>C	c.(163-165)Aca>Cca	p.T55P		NM_001004471.2	NP_001004471.1	Q8NGQ4	O10Q1_HUMAN	olfactory receptor, family 10, subfamily Q, member 1	55						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T55P(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)	35		Breast(21;0.0589)				GTGCTGTGTGTGCACACCACC	0.522																																							uc010rkd.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(163-165)ACA>CCA		olfactory receptor, family 10, subfamily Q,							117.0	120.0	119.0					11																	57996185		2201	4295	6496	SO:0001583	missense	219960				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:57996185T>G	AB065735	CCDS31547.1	11q12.1	2012-08-09			ENSG00000180475	ENSG00000180475		"""GPCR / Class A : Olfactory receptors"""	15134	protein-coding gene	gene with protein product							Standard	NM_001004471		Approved		uc010rkd.2	Q8NGQ4	OTTHUMG00000167542	ENST00000316770.2:c.163A>C	11.37:g.57996185T>G	ENSP00000314324:p.Thr55Pro						p.T55P	NM_001004471	NP_001004471	Q8NGQ4	O10Q1_HUMAN			1	163	-		Breast(21;0.0589)	55			Cytoplasmic (Potential).		Q6IFG4	Missense_Mutation	SNP	ENST00000316770.2	37	c.163A>C	CCDS31547.1	.	.	.	.	.	.	.	.	.	.	T	12.43	1.934749	0.34189	.	.	ENSG00000180475	ENST00000316770	T	0.09350	2.99	5.0	2.69	0.31865	GPCR, rhodopsin-like superfamily (1);	0.158261	0.29544	N	0.011841	T	0.15739	0.0379	M	0.76002	2.32	0.09310	N	1	P	0.45634	0.863	P	0.45276	0.475	T	0.10042	-1.0647	10	0.72032	D	0.01	.	6.502	0.22174	0.0:0.2791:0.0:0.7209	.	55	Q8NGQ4	O10Q1_HUMAN	P	55	ENSP00000314324:T55P	ENSP00000314324:T55P	T	-	1	0	OR10Q1	57752761	0.000000	0.05858	0.005000	0.12908	0.763000	0.43281	-0.178000	0.09782	0.388000	0.25054	0.455000	0.32223	ACA		0.522	OR10Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394706.1	NM_001004471		51	95	0	0	0	0.01441	0	51	95				
MS4A12	54860	broad.mit.edu	37	11	60268654	60268654	+	Splice_Site	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr11:60268654C>A	ENST00000016913.4	+	3	470	c.413C>A	c.(412-414)tCt>tAt	p.S138Y	MS4A12_ENST00000537076.1_Intron	NM_017716.2	NP_060186.2	Q9NXJ0	M4A12_HUMAN	membrane-spanning 4-domains, subfamily A, member 12	138						integral component of membrane (GO:0016021)		p.S138Y(1)		breast(1)|kidney(3)|large_intestine(2)|lung(9)|prostate(2)	17						GGTGGCCTTTCTGTGAGTAGA	0.378																																							uc001npr.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(412-414)TCT>TAT		membrane-spanning 4-domains, subfamily A, member							142.0	135.0	137.0					11																	60268654		2203	4300	6503	SO:0001630	splice_region_variant	54860					integral to membrane	receptor activity	g.chr11:60268654C>A	AK000224	CCDS7988.1, CCDS53638.1	11q12	2008-03-25				ENSG00000071203			13370	protein-coding gene	gene with protein product		606550				11401424, 11486273	Standard	NM_017716		Approved	Ms4a10, FLJ20217	uc001npr.3	Q9NXJ0		ENST00000016913.4:c.414+1C>A	11.37:g.60268654C>A							p.S138Y	NM_017716	NP_060186	Q9NXJ0	M4A12_HUMAN			3	470	+			138			Helical; (Potential).		F5GX98|Q8N6L4	Missense_Mutation	SNP	ENST00000016913.4	37	c.413C>A	CCDS7988.1	.	.	.	.	.	.	.	.	.	.	C	2.455	-0.325537	0.05350	.	.	ENSG00000071203	ENST00000016913	T	0.02369	4.32	4.84	-1.57	0.08506	.	1.407190	0.04133	N	0.318254	T	0.08044	0.0201	M	0.69823	2.125	0.23421	N	0.997712	P	0.51351	0.944	P	0.54664	0.758	T	0.50642	-0.8804	10	0.02654	T	1	.	10.7116	0.45986	0.0:0.2738:0.6284:0.0978	.	138	Q9NXJ0	M4A12_HUMAN	Y	138	ENSP00000016913:S138Y	ENSP00000016913:S138Y	S	+	2	0	MS4A12	60025230	0.001000	0.12720	0.907000	0.35723	0.726000	0.41606	-0.617000	0.05584	-0.134000	0.11516	-0.502000	0.04539	TCT		0.378	MS4A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383627.1		Missense_Mutation	34	123	1	0	4.65686e-17	0.017118	6.24311e-17	34	123				
KDM2A	22992	broad.mit.edu	37	11	67021866	67021866	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr11:67021866C>G	ENST00000529006.2	+	20	3730	c.3284C>G	c.(3283-3285)tCt>tGt	p.S1095C	KDM2A_ENST00000530342.1_Missense_Mutation_p.S656C|KDM2A_ENST00000308783.5_Missense_Mutation_p.S553C|KDM2A_ENST00000398645.2_3'UTR|KDM2A_ENST00000526258.1_3'UTR	NM_012308.2	NP_036440.1	Q9Y2K7	KDM2A_HUMAN	lysine (K)-specific demethylase 2A	1095					histone H3-K36 demethylation (GO:0070544)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)	p.S1095C(1)		NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|urinary_tract(2)	36						ACTCGCTACTCTCTCACAGAG	0.547																																							uc001ojw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|lung(3)|breast(1)|skin(1)	9						c.(3283-3285)TCT>TGT		F-box and leucine-rich repeat protein 11							155.0	152.0	153.0					11																	67021866		2111	4225	6336	SO:0001583	missense	22992				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding	g.chr11:67021866C>G	BC047486	CCDS44657.1, CCDS58148.1	11q13.1	2014-02-18	2009-04-06	2009-04-06	ENSG00000173120	ENSG00000173120		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13606	protein-coding gene	gene with protein product	"""F-box protein FBL11"", ""jumonji C domain-containing histone demethylase 1A"""	605657	"""F-box and leucine-rich repeat protein 11"""	FBXL11		10231032, 10531037	Standard	NM_012308		Approved	KIAA1004, FBL11, LILINA, DKFZP434M1735, FBL7, FLJ00115, CXXC8, JHDM1A	uc001ojw.3	Q9Y2K7	OTTHUMG00000167103	ENST00000529006.2:c.3284C>G	11.37:g.67021866C>G	ENSP00000432786:p.Ser1095Cys					KDM2A_uc001ojx.2_RNA|KDM2A_uc001ojy.2_Missense_Mutation_p.S789C|KDM2A_uc001ojz.1_Missense_Mutation_p.S553C|KDM2A_uc001oka.2_Missense_Mutation_p.S219C	p.S1095C	NM_012308	NP_036440	Q9Y2K7	KDM2A_HUMAN			20	4148	+			1095			LRR 4.		D4QA03|E9PIL6|I3VM55|Q49A21|Q4G0M3|Q69YY8|Q9BVH5|Q9H7H5|Q9UK66	Missense_Mutation	SNP	ENST00000529006.2	37	c.3284C>G	CCDS44657.1	.	.	.	.	.	.	.	.	.	.	C	17.66	3.445565	0.63178	.	.	ENSG00000173120	ENST00000529006;ENST00000530342;ENST00000308783	T;T;T	0.44482	0.92;0.92;0.92	5.17	5.17	0.71159	.	0.056215	0.64402	D	0.000001	T	0.52306	0.1726	M	0.71581	2.175	0.50467	D	0.999872	B;P;P	0.52463	0.228;0.953;0.947	B;P;B	0.46975	0.15;0.533;0.339	T	0.59705	-0.7404	10	0.72032	D	0.01	-13.1195	18.4543	0.90714	0.0:1.0:0.0:0.0	.	656;553;1095	E9PIL6;D4QA03;Q9Y2K7	.;.;KDM2A_HUMAN	C	1095;656;553	ENSP00000432786:S1095C;ENSP00000435776:S656C;ENSP00000309302:S553C	ENSP00000309302:S553C	S	+	2	0	KDM2A	66778442	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.622000	0.83099	2.674000	0.91012	0.655000	0.94253	TCT		0.547	KDM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393140.2	NM_012308		23	155	0	0	0	0.00632	0	23	155				
ANKRD13D	338692	broad.mit.edu	37	11	67058967	67058967	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr11:67058967G>C	ENST00000447274.2	+	4	1286	c.111G>C	c.(109-111)gaG>gaC	p.E37D	ANKRD13D_ENST00000308440.6_Missense_Mutation_p.E37D|ANKRD13D_ENST00000511455.2_Missense_Mutation_p.E124D|ANKRD13D_ENST00000514166.1_Missense_Mutation_p.E37D			Q6ZTN6	AN13D_HUMAN	ankyrin repeat domain 13 family, member D	37						endosome (GO:0005768)|plasma membrane (GO:0005886)		p.E124D(1)|p.E37D(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			TCTACGTTGAGATGAAGTGGG	0.627																																							uc001okc.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(109-111)GAG>GAC		ankyrin repeat domain 13 family, member D							68.0	71.0	70.0					11																	67058967		2200	4295	6495	SO:0001583	missense	338692							g.chr11:67058967G>C	AK027313	CCDS31616.1, CCDS31616.2	11q13.2	2013-01-11		2005-08-09	ENSG00000172932	ENSG00000172932		"""Ankyrin repeat domain containing"""	27880	protein-coding gene	gene with protein product		615126					Standard	NM_207354		Approved		uc001okd.2	Q6ZTN6	OTTHUMG00000162929	ENST00000447274.2:c.111G>C	11.37:g.67058967G>C	ENSP00000402616:p.Glu37Asp					ANKRD13D_uc001okd.1_Missense_Mutation_p.E124D|ANKRD13D_uc001oke.1_Missense_Mutation_p.E37D	p.E37D	NM_207354	NP_997237	Q6ZTN6	AN13D_HUMAN	BRCA - Breast invasive adenocarcinoma(15;2.26e-06)		5	622	+			37					D6RCN6|Q0VAK0|Q0VGC3|Q6ZVD0|Q86SU1	Missense_Mutation	SNP	ENST00000447274.2	37	c.111G>C		.	.	.	.	.	.	.	.	.	.	G	19.95	3.921335	0.73213	.	.	ENSG00000172932	ENST00000447274;ENST00000511455;ENST00000308440;ENST00000514166	T;T;T;T	0.41400	1.0;1.14;1.0;1.0	4.48	2.56	0.30785	.	0.000000	0.64402	D	0.000002	T	0.59783	0.2219	M	0.81497	2.545	0.58432	D	0.999992	D;P	0.69078	0.997;0.942	D;P	0.68483	0.958;0.685	T	0.58719	-0.7587	10	0.59425	D	0.04	-25.37	7.669	0.28447	0.2711:0.0:0.7289:0.0	.	124;37	Q6ZTN6-3;Q6ZTN6	.;AN13D_HUMAN	D	37;124;37;37	ENSP00000402616:E37D;ENSP00000427130:E124D;ENSP00000310874:E37D;ENSP00000444404:E37D	ENSP00000310874:E37D	E	+	3	2	ANKRD13D	66815543	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	2.066000	0.41452	0.437000	0.26423	0.561000	0.74099	GAG		0.627	ANKRD13D-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000371067.2	NM_207354		18	99	0	0	0	0.014323	0	18	99				
CTTN	2017	broad.mit.edu	37	11	70263174	70263174	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr11:70263174G>T	ENST00000301843.8	+	8	719	c.513G>T	c.(511-513)aaG>aaT	p.K171N	CTTN_ENST00000376561.3_Missense_Mutation_p.K171N|CTTN_ENST00000346329.3_Missense_Mutation_p.K171N	NM_005231.3	NP_005222.2	Q14247	SRC8_HUMAN	cortactin	171					negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitotic spindle midzone (GO:1990023)|ruffle (GO:0001726)		p.K171N(2)		breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	31			BRCA - Breast invasive adenocarcinoma(2;4.34e-41)|LUSC - Lung squamous cell carcinoma(11;1.51e-13)|STAD - Stomach adenocarcinoma(18;0.0513)	Lung(977;0.0234)|LUSC - Lung squamous cell carcinoma(976;0.133)		GAGTAGACAAGAGCGCGGTGG	0.602																																							uc001opv.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(511-513)AAG>AAT		cortactin isoform a							138.0	119.0	125.0					11																	70263174		2200	4294	6494	SO:0001583	missense	2017					cell cortex|cytoskeleton|lamellipodium|ruffle|soluble fraction	protein binding	g.chr11:70263174G>T	AJ288897	CCDS8197.1, CCDS41680.1, CCDS53676.1	11q13	2008-02-05	2004-06-08	2004-06-09	ENSG00000085733	ENSG00000085733			3338	protein-coding gene	gene with protein product		164765	"""ems1 sequence (mammary tumor and squamous cell carcinoma-associated (p80/85 src substrate)"""	EMS1		7685625	Standard	NM_005231		Approved		uc001opu.3	Q14247	OTTHUMG00000134307	ENST00000301843.8:c.513G>T	11.37:g.70263174G>T	ENSP00000301843:p.Lys171Asn					CTTN_uc001opu.2_Missense_Mutation_p.K171N|CTTN_uc001opw.3_Missense_Mutation_p.K171N	p.K171N	NM_005231	NP_005222	Q14247	SRC8_HUMAN	BRCA - Breast invasive adenocarcinoma(2;4.34e-41)|LUSC - Lung squamous cell carcinoma(11;1.51e-13)|STAD - Stomach adenocarcinoma(18;0.0513)	Lung(977;0.0234)|LUSC - Lung squamous cell carcinoma(976;0.133)	8	719	+			171			Cortactin 3.		Q8N707|Q96H99	Missense_Mutation	SNP	ENST00000301843.8	37	c.513G>T	CCDS41680.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.47|17.47	3.398119|3.398119	0.62177|0.62177	.|.	.|.	ENSG00000085733|ENSG00000085733	ENST00000346329;ENST00000301843;ENST00000376561|ENST00000415461	T;T;T|.	0.48522|.	0.93;0.98;0.81|.	5.43|5.43	5.43|5.43	0.79202|0.79202	.|.	0.145674|.	0.64402|.	D|.	0.000010|.	D|D	0.84597|0.84597	0.5507|0.5507	M|M	0.88775|0.88775	2.98|2.98	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.91635|.	0.995;0.999;0.995|.	D|D	0.86667|0.86667	0.1908|0.1908	10|5	0.87932|.	D|.	0|.	-27.1871|-27.1871	19.2689|19.2689	0.94000|0.94000	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	171;171;171|.	Q96H99;Q14247;Q8N707|.	.;SRC8_HUMAN;.|.	N|I	171|153	ENSP00000317189:K171N;ENSP00000301843:K171N;ENSP00000365745:K171N|.	ENSP00000301843:K171N|.	K|R	+|+	3|2	2|0	CTTN|CTTN	69940822|69940822	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.187000|0.187000	0.23431|0.23431	6.337000|6.337000	0.72958|0.72958	2.546000|2.546000	0.85860|0.85860	0.655000|0.655000	0.94253|0.94253	AAG|AGA		0.602	CTTN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259233.2	NM_138565		51	119	1	0	7.50695e-29	0.01441	1.13798e-28	51	119				
ARAP1	116985	broad.mit.edu	37	11	72410139	72410139	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr11:72410139A>T	ENST00000393609.3	-	18	2654	c.2452T>A	c.(2452-2454)Ttt>Att	p.F818I	ARAP1_ENST00000393605.3_Missense_Mutation_p.F578I|ARAP1_ENST00000334211.8_Missense_Mutation_p.F573I|ARAP1_ENST00000359373.5_Missense_Mutation_p.F818I|ARAP1_ENST00000495878.1_5'UTR|ARAP1_ENST00000426523.1_Missense_Mutation_p.F573I|ARAP1-AS2_ENST00000500163.2_RNA|ARAP1_ENST00000455638.2_Missense_Mutation_p.F818I|ARAP1_ENST00000429686.1_Missense_Mutation_p.F512I	NM_001040118.2	NP_001035207.1	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1	818	PH 3. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin filament reorganization involved in cell cycle (GO:0030037)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of receptor recycling (GO:0001921)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of cellular component movement (GO:0051270)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)	p.F578I(1)|p.F818I(1)		cervix(2)|endometrium(2)|large_intestine(10)|lung(8)|ovary(1)|skin(3)|urinary_tract(1)	27						TACACCTCAAAGGTGTGCTCA	0.602																																					Ovarian(102;1198 1520 13195 17913 37529)	Ovarian(102;1198 1520 13195 17913 37529)	uc001osu.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(2452-2454)TTT>ATT		ArfGAP with RhoGAP domain, ankyrin repeat and PH							185.0	154.0	165.0					11																	72410139		2200	4293	6493	SO:0001583	missense	116985				actin filament reorganization involved in cell cycle|negative regulation of stress fiber assembly|positive regulation of Cdc42 GTPase activity|positive regulation of filopodium assembly|regulation of ARF GTPase activity|regulation of cell shape|regulation of cellular component movement|small GTPase mediated signal transduction	cytosol|Golgi cisterna membrane|plasma membrane	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|protein binding|Rho GTPase activator activity|zinc ion binding	g.chr11:72410139A>T	AF411983	CCDS8217.2, CCDS41687.1, CCDS44671.1	11q13.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000186635	ENSG00000186635		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16925	protein-coding gene	gene with protein product		606646	"""centaurin, delta 2"""	CENTD2			Standard	NM_001040118		Approved		uc001osu.3	Q96P48	OTTHUMG00000157102	ENST00000393609.3:c.2452T>A	11.37:g.72410139A>T	ENSP00000377233:p.Phe818Ile					ARAP1_uc001osv.2_Missense_Mutation_p.F818I|ARAP1_uc001osr.2_Missense_Mutation_p.F578I|ARAP1_uc001oss.2_Missense_Mutation_p.F573I|ARAP1_uc009yth.2_Missense_Mutation_p.F512I|ARAP1_uc010rre.1_Missense_Mutation_p.F573I|ARAP1_uc001osw.1_Missense_Mutation_p.F106I	p.F818I	NM_001040118	NP_001035207	Q96P48	ARAP1_HUMAN			18	2641	-			818			PH 3.		A3KLL7|B2RTS2|O94879|Q4LDD5|Q59FI7|Q6PHS3|Q8WU51|Q96HP6|Q96L71	Missense_Mutation	SNP	ENST00000393609.3	37	c.2452T>A	CCDS41687.1	.	.	.	.	.	.	.	.	.	.	A	32	5.166808	0.94768	.	.	ENSG00000186635	ENST00000359373;ENST00000455638;ENST00000393605;ENST00000334211;ENST00000393609;ENST00000426523;ENST00000429686;ENST00000427971;ENST00000452383;ENST00000340247	T;T;T;T;T;T;T;T;T	0.37752	1.18;1.18;1.18;1.18;1.18;1.18;1.18;1.18;1.18	5.55	5.55	0.83447	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.56171	0.1967	L	0.58101	1.795	0.44976	D	0.997998	D;D;D;D;D	0.89917	0.988;1.0;0.999;0.994;0.985	D;D;D;D;P	0.91635	0.934;0.999;0.991;0.954;0.891	T	0.56214	-0.8016	10	0.49607	T	0.09	.	14.5249	0.67881	1.0:0.0:0.0:0.0	.	573;512;818;818;578	E7EU13;B2RTS2;Q96P48-3;Q96P48;Q96P48-1	.;.;.;ARAP1_HUMAN;.	I	818;818;578;573;818;573;512;106;106;607	ENSP00000352332:F818I;ENSP00000390461:F818I;ENSP00000377230:F578I;ENSP00000335506:F573I;ENSP00000377233:F818I;ENSP00000392264:F573I;ENSP00000403127:F512I;ENSP00000411452:F106I;ENSP00000399118:F106I	ENSP00000335506:F573I	F	-	1	0	ARAP1	72087787	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.089000	0.89525	2.112000	0.64535	0.379000	0.24179	TTT		0.602	ARAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347428.1	NM_001040118		38	236	0	0	0	0.006999	0	38	236				
ANKRD42	338699	broad.mit.edu	37	11	82938904	82938904	+	Silent	SNP	T	T	C			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr11:82938904T>C	ENST00000393392.2	+	7	981	c.819T>C	c.(817-819)ccT>ccC	p.P273P	ANKRD42_ENST00000531895.1_Silent_p.P301P|ANKRD42_ENST00000533342.1_Silent_p.P301P|ANKRD42_ENST00000260047.6_Silent_p.P300P	NM_182603.2	NP_872409.2	Q8N9B4	ANR42_HUMAN	ankyrin repeat domain 42	273					positive regulation of cytokine production involved in inflammatory response (GO:1900017)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)	nucleus (GO:0005634)		p.P273P(1)		central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(6)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	18						GATCAACTCCTATGCATAAAG	0.373																																							uc001ozz.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(817-819)CCT>CCC		ankyrin repeat domain 42							137.0	123.0	128.0					11																	82938904		2203	4300	6503	SO:0001819	synonymous_variant	338699							g.chr11:82938904T>C	AK095193	CCDS8265.1, CCDS73355.1, CCDS73356.1	11q14.1	2014-06-12			ENSG00000137494	ENSG00000137494		"""Ankyrin repeat domain containing"""	26752	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 79"""						Standard	XM_005273971		Approved	FLJ37874, SARP, PPP1R79	uc001ozz.1	Q8N9B4	OTTHUMG00000167075	ENST00000393392.2:c.819T>C	11.37:g.82938904T>C						ANKRD42_uc010rsv.1_Silent_p.P301P|ANKRD42_uc001paa.2_Silent_p.P301P|ANKRD42_uc001pab.1_Silent_p.P300P	p.P273P	NM_182603	NP_872409	Q8N9B4	ANR42_HUMAN			7	1241	+			273			ANK 8.		Q49A49	Silent	SNP	ENST00000393392.2	37	c.819T>C	CCDS8265.1																																																																																				0.373	ANKRD42-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000392934.1	NM_182603		45	74	0	0	0	0.01441	0	45	74				
KDM4E	390245	broad.mit.edu	37	11	94759362	94759362	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr11:94759362C>A	ENST00000450979.2	+	1	941	c.641C>A	c.(640-642)cCa>cAa	p.P214Q		NM_001161630.1	NP_001155102.1	B2RXH2	KDM4E_HUMAN	lysine (K)-specific demethylase 4E	214	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				histone H3-K9 demethylation (GO:0033169)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)	p.P214Q(2)		breast(1)|endometrium(7)|kidney(1)|lung(3)	12						GTGGTGCCCCCAGAACATGGT	0.577																																							uc010ruf.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(640-642)CCA>CAA		lysine (K)-specific demethylase 4D-like							63.0	59.0	60.0					11																	94759362		692	1591	2283	SO:0001583	missense	390245				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen	g.chr11:94759362C>A	BC157851	CCDS44713.1	11q21	2012-03-30	2012-03-28	2012-03-28		ENSG00000235268		"""Chromatin-modifying enzymes / K-demethylases"""	37098	protein-coding gene	gene with protein product			"""lysine (K)-specific demethylase 4D-like"""	KDM4DL		21076780	Standard	NM_001161630		Approved	JMJD2E	uc010ruf.1	B2RXH2		ENST00000450979.2:c.641C>A	11.37:g.94759362C>A	ENSP00000397239:p.Pro214Gln						p.P214Q	NM_001161630	NP_001155102	B2RXH2	KD4DL_HUMAN			1	941	+			214			JmjC.			Missense_Mutation	SNP	ENST00000450979.2	37	c.641C>A	CCDS44713.1	.	.	.	.	.	.	.	.	.	.	c	10.79	1.448520	0.26074	.	.	ENSG00000235268	ENST00000450979	T	0.79749	-1.3	2.18	1.23	0.21249	Transcription factor jumonji/aspartyl beta-hydroxylase (2);Transcription factor jumonji (1);	.	.	.	.	D	0.84028	0.5382	L	0.60067	1.865	0.34834	D	0.740027	D	0.89917	1.0	D	0.83275	0.996	T	0.82776	-0.0290	9	0.40728	T	0.16	-6.9508	5.9638	0.19315	0.3088:0.6912:0.0:0.0	.	214	B2RXH2	KD4DL_HUMAN	Q	214	ENSP00000397239:P214Q	ENSP00000397239:P214Q	P	+	2	0	KDM4DL	94399010	0.023000	0.18921	0.388000	0.26195	0.078000	0.17371	0.681000	0.25320	0.471000	0.27319	0.455000	0.32223	CCA		0.577	KDM4E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396649.1	NM_001161630		51	68	1	0	1.21353e-23	0.01441	1.7588e-23	51	68				
NPAT	4863	broad.mit.edu	37	11	108043482	108043482	+	Silent	SNP	G	G	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr11:108043482G>A	ENST00000278612.8	-	13	2334	c.2229C>T	c.(2227-2229)atC>atT	p.I743I	NPAT_ENST00000610253.1_5'UTR	NM_002519.2	NP_002510.2	Q14207	NPAT_HUMAN	nuclear protein, ataxia-telangiectasia locus	743					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|Gemini of coiled bodies (GO:0097504)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.I743I(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(21)|ovary(2)|prostate(2)|skin(5)	46		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;1.05e-05)|Epithelial(105;3.01e-05)|all cancers(92;0.000816)|Colorectal(284;0.116)		CATCACTAATGATAACTTTGA	0.383																																							uc001pjz.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(2227-2229)ATC>ATT		nuclear protein,  ataxia-telangiectasia locus							131.0	122.0	125.0					11																	108043482		1882	4110	5992	SO:0001819	synonymous_variant	4863				positive regulation of transcription, DNA-dependent|regulation of transcription involved in G1/S phase of mitotic cell cycle	Cajal body	protein C-terminus binding|protein N-terminus binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity	g.chr11:108043482G>A	X97186	CCDS41710.1	11q22-q23	2008-02-01			ENSG00000149308	ENSG00000149308			7896	protein-coding gene	gene with protein product		601448				9205109	Standard	NM_002519		Approved	E14	uc001pjz.4	Q14207	OTTHUMG00000166385	ENST00000278612.8:c.2229C>T	11.37:g.108043482G>A						NPAT_uc010rvv.1_5'Flank|NPAT_uc001pka.2_Silent_p.I538I	p.I743I	NM_002519	NP_002510	Q14207	NPAT_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.05e-05)|Epithelial(105;3.01e-05)|all cancers(92;0.000816)|Colorectal(284;0.116)	13	2331	-		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)	743					A8K1V5|A8K6M2|Q13632|Q14967|Q16580|Q86W55|Q8IWE9	Silent	SNP	ENST00000278612.8	37	c.2229C>T	CCDS41710.1																																																																																				0.383	NPAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389506.2	NM_002519		51	92	0	0	0	0.01441	0	51	92				
ARHGEF12	23365	broad.mit.edu	37	11	120352136	120352136	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr11:120352136C>A	ENST00000397843.2	+	39	4571	c.4405C>A	c.(4405-4407)Cca>Aca	p.P1469T	ARHGEF12_ENST00000356641.3_Missense_Mutation_p.P1450T|ARHGEF12_ENST00000532993.1_Missense_Mutation_p.P1366T	NM_015313.2	NP_056128.1	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12	1469					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.P1469T(1)		NS(1)|breast(5)|endometrium(6)|kidney(5)|large_intestine(13)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(2)	61		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		GGCAATTTCACCATTCACCCC	0.537			T	MLL	AML																																		uc001pxl.1		NA		Dom	yes		11	11q23.3	23365	T	RHO guanine nucleotide exchange factor (GEF) 12 (LARG)			L	MLL		AML		1	Substitution - Missense(1)		lung(1)	lung(2)|breast(2)|skin(2)|ovary(1)	7						c.(4405-4407)CCA>ACA		Rho guanine nucleotide exchange factor (GEF) 12							93.0	94.0	94.0					11																	120352136		1935	4144	6079	SO:0001583	missense	23365				apoptosis|axon guidance|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity	g.chr11:120352136C>A	AF180681	CCDS41727.1, CCDS55794.1	11q23.3	2011-11-16			ENSG00000196914	ENSG00000196914		"""Rho guanine nucleotide exchange factors"""	14193	protein-coding gene	gene with protein product		604763				10681437, 9205841	Standard	NM_001198665		Approved	KIAA0382, LARG	uc001pxl.2	Q9NZN5	OTTHUMG00000166143	ENST00000397843.2:c.4405C>A	11.37:g.120352136C>A	ENSP00000380942:p.Pro1469Thr					ARHGEF12_uc009zau.1_Missense_Mutation_p.P1366T	p.P1469T	NM_015313	NP_056128	Q9NZN5	ARHGC_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)	39	4412	+		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)	1469					O15086|Q6P526	Missense_Mutation	SNP	ENST00000397843.2	37	c.4405C>A	CCDS41727.1	.	.	.	.	.	.	.	.	.	.	C	16.61	3.170278	0.57584	.	.	ENSG00000196914	ENST00000397843;ENST00000356641;ENST00000532993	T;T;T	0.65364	-0.05;-0.15;-0.04	6.08	6.08	0.98989	.	0.281103	0.25291	N	0.031740	T	0.54983	0.1892	L	0.29908	0.895	0.36493	D	0.868544	P	0.41366	0.747	B	0.38842	0.283	T	0.65508	-0.6151	10	0.87932	D	0	-4.9261	18.8453	0.92203	0.0:1.0:0.0:0.0	.	1469	Q9NZN5	ARHGC_HUMAN	T	1469;1450;1366	ENSP00000380942:P1469T;ENSP00000349056:P1450T;ENSP00000432984:P1366T	ENSP00000349056:P1450T	P	+	1	0	ARHGEF12	119857346	0.365000	0.25006	0.987000	0.45799	0.635000	0.38103	1.745000	0.38278	2.890000	0.99128	0.655000	0.94253	CCA		0.537	ARHGEF12-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388052.1	NM_015313		23	108	1	0	1.50538e-07	0.00632	1.73139e-07	23	108				
OR10S1	219873	broad.mit.edu	37	11	123847563	123847563	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr11:123847563C>A	ENST00000531945.1	-	1	925	c.836G>T	c.(835-837)aGt>aTt	p.S279I		NM_001004474.1	NP_001004474.1	Q8NGN2	O10S1_HUMAN	olfactory receptor, family 10, subfamily S, member 1	279						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S279I(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	36		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		TCCTGCCTCACTGGAGCGAGG	0.587																																							uc001pzm.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(835-837)AGT>ATT		olfactory receptor, family 10, subfamily S,							78.0	82.0	81.0					11																	123847563		2202	4299	6501	SO:0001583	missense	219873				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123847563C>A	BK004509	CCDS31701.1	11q24.1	2012-08-09			ENSG00000196248	ENSG00000196248		"""GPCR / Class A : Olfactory receptors"""	14807	protein-coding gene	gene with protein product							Standard	NM_001004474		Approved		uc001pzm.1	Q8NGN2	OTTHUMG00000165963	ENST00000531945.1:c.836G>T	11.37:g.123847563C>A	ENSP00000431914:p.Ser279Ile						p.S279I	NM_001004474	NP_001004474	Q8NGN2	O10S1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)	1	836	-		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	279			Extracellular (Potential).		B9EH43|Q6IEV3|Q96R78	Missense_Mutation	SNP	ENST00000531945.1	37	c.836G>T	CCDS31701.1	.	.	.	.	.	.	.	.	.	.	C	7.267	0.606350	0.14002	.	.	ENSG00000196248	ENST00000531945	T	0.37584	1.19	4.85	0.357	0.16079	GPCR, rhodopsin-like superfamily (1);	0.457797	0.16218	U	0.224163	T	0.30293	0.0760	L	0.55834	1.745	0.09310	N	1	B	0.19445	0.036	B	0.16722	0.016	T	0.27971	-1.0058	10	0.59425	D	0.04	0.5465	8.1044	0.30877	0.1032:0.3333:0.4928:0.0707	.	279	Q8NGN2	O10S1_HUMAN	I	279	ENSP00000431914:S279I	ENSP00000431914:S279I	S	-	2	0	OR10S1	123352773	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-1.314000	0.02715	0.156000	0.19299	-0.165000	0.13383	AGT		0.587	OR10S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387265.2	NM_001004474		32	263	1	0	6.2361e-21	0.007835	8.85857e-21	32	263				
FLI1	2313	broad.mit.edu	37	11	128680825	128680825	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr11:128680825C>G	ENST00000527786.2	+	9	1790	c.1301C>G	c.(1300-1302)cCc>cGc	p.P434R	FLI1_ENST00000525560.1_Missense_Mutation_p.P241R|FLI1_ENST00000281428.8_Missense_Mutation_p.P368R|FLI1_ENST00000534087.2_Missense_Mutation_p.P401R|FLI1_ENST00000344954.6_Missense_Mutation_p.P401R	NM_001271010.1|NM_002017.4	NP_001257939.1|NP_002008.2	Q01543	FLI1_HUMAN	Fli-1 proto-oncogene, ETS transcription factor	434					blood circulation (GO:0008015)|cell differentiation (GO:0030154)|hemostasis (GO:0007599)|megakaryocyte development (GO:0035855)|organ morphogenesis (GO:0009887)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P434R(1)	EWSR1/FLI1(2569)	NS(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(2)	31	all_hematologic(175;0.0641)	Lung NSC(97;0.00588)|all_lung(97;0.00764)|Breast(109;0.0115)|Medulloblastoma(222;0.0523)|all_neural(223;0.0862)|all_hematologic(192;0.182)		OV - Ovarian serous cystadenocarcinoma(99;0.01)|LUSC - Lung squamous cell carcinoma(976;0.0324)|Lung(977;0.0327)		TACCCCAACCCCAACGTCCCC	0.577			T	EWSR1	Ewing sarcoma																																		uc010sbu.1		NA		Dom	yes		11	11q24	2313	T	Friend leukemia virus integration 1			M	EWSR1		Ewing sarcoma	EWSR1/FLI1(2266)	1	Substitution - Missense(1)		lung(1)	bone(2210)|soft_tissue(48)|autonomic_ganglia(4)|central_nervous_system(4)|lung(3)|ovary(2)|pancreas(2)	2273						c.(1300-1302)CCC>CGC		Friend leukemia virus integration 1							105.0	106.0	106.0					11																	128680825		1982	4144	6126	SO:0001583	missense	2313				hemostasis|organ morphogenesis	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr11:128680825C>G	M98833	CCDS44768.1, CCDS53725.1, CCDS59230.1, CCDS59231.1	11q24.1-q24.3	2014-09-17	2013-08-07		ENSG00000151702	ENSG00000151702			3749	protein-coding gene	gene with protein product		193067	"""Friend leukemia virus integration 1"""			1765382	Standard	NM_001167681		Approved	SIC-1, EWSR2	uc010sbu.2	Q01543	OTTHUMG00000165792	ENST00000527786.2:c.1301C>G	11.37:g.128680825C>G	ENSP00000433488:p.Pro434Arg					FLI1_uc010sbt.1_Missense_Mutation_p.P241R|FLI1_uc010sbv.1_Missense_Mutation_p.P401R|FLI1_uc009zci.2_Missense_Mutation_p.P368R	p.P434R	NM_002017	NP_002008	Q01543	FLI1_HUMAN		OV - Ovarian serous cystadenocarcinoma(99;0.01)|LUSC - Lung squamous cell carcinoma(976;0.0324)|Lung(977;0.0327)	9	1642	+	all_hematologic(175;0.0641)	Lung NSC(97;0.00588)|all_lung(97;0.00764)|Breast(109;0.0115)|Medulloblastoma(222;0.0523)|all_neural(223;0.0862)|all_hematologic(192;0.182)	434					B2R8H2|B4DFV4|B4DTC6|G3V183|Q14319|Q92480|Q9UE07	Missense_Mutation	SNP	ENST00000527786.2	37	c.1301C>G	CCDS44768.1	.	.	.	.	.	.	.	.	.	.	C	18.55	3.648538	0.67358	.	.	ENSG00000151702	ENST00000525560;ENST00000344954;ENST00000429175;ENST00000534087;ENST00000281428	T;T;T;T;T	0.23552	1.9;2.47;2.47;2.47;2.47	5.46	5.46	0.80206	.	0.099811	0.64402	D	0.000001	T	0.38188	0.1031	L	0.29908	0.895	0.80722	D	1	P;P;D	0.62365	0.885;0.882;0.991	P;B;P	0.62014	0.696;0.376;0.897	T	0.02087	-1.1216	10	0.33940	T	0.23	.	19.5125	0.95148	0.0:1.0:0.0:0.0	.	434;241;368	Q01543;B4DFV4;Q01543-2	FLI1_HUMAN;.;.	R	241;401;434;401;368	ENSP00000437124:P241R;ENSP00000339627:P401R;ENSP00000399985:P434R;ENSP00000432950:P401R;ENSP00000281428:P368R	ENSP00000281428:P368R	P	+	2	0	FLI1	128186035	1.000000	0.71417	0.998000	0.56505	0.908000	0.53690	5.874000	0.69652	2.840000	0.97914	0.655000	0.94253	CCC		0.577	FLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386226.2	NM_002017		45	80	0	0	0	0.01441	0	45	80				
OPCML	4978	broad.mit.edu	37	11	132307139	132307139	+	Missense_Mutation	SNP	C	C	G	rs375421247		TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr11:132307139C>G	ENST00000331898.7	-	4	1219	c.641G>C	c.(640-642)cGg>cCg	p.R214P	OPCML_ENST00000529038.1_5'UTR|OPCML_ENST00000541867.1_Missense_Mutation_p.R214P|OPCML_ENST00000374778.4_Missense_Mutation_p.R173P|OPCML_ENST00000524381.1_Missense_Mutation_p.R207P	NM_002545.3	NP_002536.1	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion molecule-like	214	Ig-like C2-type 2.				cell adhesion (GO:0007155)|neuron recognition (GO:0008038)|opioid receptor signaling pathway (GO:0038003)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	opioid receptor activity (GO:0004985)	p.R207P(1)|p.R214P(1)		endometrium(5)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|skin(2)|urinary_tract(8)	47	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)		TTTTACTTTCCGCACATCGGG	0.542																																							uc001qgs.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|skin(1)	3						c.(640-642)CGG>CCG		opioid binding protein/cell adhesion							130.0	118.0	122.0					11																	132307139		2201	4297	6498	SO:0001583	missense	4978				cell adhesion|neuron recognition	anchored to membrane|integral to plasma membrane	opioid receptor activity	g.chr11:132307139C>G	BX537377	CCDS8492.1, CCDS31722.1	11q25	2013-01-11	2001-11-28		ENSG00000183715	ENSG00000183715		"""Immunoglobulin superfamily / I-set domain containing"""	8143	protein-coding gene	gene with protein product	"""IgLON family member 1"""	600632	"""opioid-binding protein/cell adhesion molecule-like"""			8244387	Standard	XM_005271578		Approved	OPCM, OBCAM, IGLON1	uc001qgs.3	Q14982	OTTHUMG00000163658	ENST00000331898.7:c.641G>C	11.37:g.132307139C>G	ENSP00000330862:p.Arg214Pro					OPCML_uc001qgu.2_Missense_Mutation_p.R207P|OPCML_uc010sck.1_Missense_Mutation_p.R214P|OPCML_uc001qgt.2_Missense_Mutation_p.R213P|OPCML_uc010scl.1_Missense_Mutation_p.R173P	p.R214P	NM_002545	NP_002536	Q14982	OPCM_HUMAN		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)	4	691	-	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)	214			Ig-like C2-type 2.		B2CZX2|B7ZLQ1|Q17RN7|Q7Z3W6	Missense_Mutation	SNP	ENST00000331898.7	37	c.641G>C	CCDS8492.1	.	.	.	.	.	.	.	.	.	.	C	33	5.209806	0.95069	.	.	ENSG00000183715	ENST00000331898;ENST00000524381;ENST00000374778;ENST00000416724;ENST00000541867	T;T;T;T	0.60040	0.24;0.22;1.06;1.06	5.95	5.95	0.96441	Immunoglobulin-like (1);	0.000000	0.85682	D	0.000000	T	0.80778	0.4688	M	0.86864	2.845	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.78314	0.991;0.991;0.991;0.991	T	0.82358	-0.0497	10	0.66056	D	0.02	-20.1115	19.9958	0.97383	0.0:1.0:0.0:0.0	.	214;207;213;214	B7ZLQ1;Q7Z3W6;B7ZLQ0;Q14982	.;.;.;OPCM_HUMAN	P	214;207;173;181;214	ENSP00000330862:R214P;ENSP00000434750:R207P;ENSP00000363910:R173P;ENSP00000445496:R214P	ENSP00000330862:R214P	R	-	2	0	OPCML	131812349	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	7.487000	0.81328	2.825000	0.97269	0.655000	0.94253	CGG		0.542	OPCML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374689.3	NM_001012393		55	90	0	0	0	0.01441	0	55	90				
IGSF9B	22997	broad.mit.edu	37	11	133789866	133789866	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr11:133789866T>C	ENST00000321016.8	-	18	3984	c.3754A>G	c.(3754-3756)Acg>Gcg	p.T1252A	IGSF9B_ENST00000533871.2_Missense_Mutation_p.T1252A			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	1252	Pro-rich.				homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)		p.T708A(1)|p.T1252A(1)		breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		GTGGACGGCGTAGACTTTCGA	0.697																																							uc001qgx.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(3754-3756)ACG>GCG		immunoglobulin superfamily, member 9B							19.0	25.0	23.0					11																	133789866		1880	4093	5973	SO:0001583	missense	22997					integral to membrane|plasma membrane		g.chr11:133789866T>C	AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.3754A>G	11.37:g.133789866T>C	ENSP00000317980:p.Thr1252Ala						p.T1252A	NM_014987	NP_055802	Q9UPX0	TUTLB_HUMAN		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)	18	3985	-	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)	1252			Pro-rich.|Cytoplasmic (Potential).		G5EA26	Missense_Mutation	SNP	ENST00000321016.8	37	c.3754A>G		.	.	.	.	.	.	.	.	.	.	T	7.897	0.733553	0.15574	.	.	ENSG00000080854	ENST00000321016;ENST00000533871	T;T	0.66460	0.11;-0.21	5.11	5.11	0.69529	.	0.000000	0.46145	D	0.000318	T	0.44561	0.1299	N	0.08118	0	0.29451	N	0.858475	B	0.21905	0.062	B	0.16722	0.016	T	0.40270	-0.9572	10	0.33141	T	0.24	.	10.6946	0.45892	0.0:0.0:0.1601:0.8399	.	1252	Q9UPX0	TUTLB_HUMAN	A	1252;1094	ENSP00000317980:T1252A;ENSP00000436552:T1094A	ENSP00000317980:T1252A	T	-	1	0	IGSF9B	133295076	1.000000	0.71417	1.000000	0.80357	0.225000	0.24961	4.033000	0.57282	1.928000	0.55862	0.454000	0.30748	ACG		0.697	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_290502		14	38	0	0	0	0.007413	0	14	38				
KDM5A	5927	broad.mit.edu	37	12	498227	498227	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr12:498227C>G	ENST00000399788.2	-	1	393	c.31G>C	c.(31-33)Gcg>Ccg	p.A11P	CCDC77_ENST00000540180.1_5'Flank|KDM5A_ENST00000382815.4_Missense_Mutation_p.A11P|CCDC77_ENST00000422000.1_5'Flank	NM_001042603.1	NP_001036068.1	P29375	KDM5A_HUMAN	lysine (K)-specific demethylase 5A	11					chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|multicellular organismal development (GO:0007275)|negative regulation of histone deacetylase activity (GO:1901726)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.A11P(2)		NS(2)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(29)|ovary(1)|prostate(5)|skin(6)|stomach(1)|urinary_tract(2)	77						ACGAACTCCGCCGCGTAGCCC	0.687			T	NUP98	AML																																		uc001qif.1		NA		Dom	yes		12	12p11	5927	T 	"""lysine (K)-specific demethylase 5A, JARID1A"""			L	NUP98		AML		2	Substitution - Missense(2)		lung(2)	skin(2)|ovary(1)	3						c.(31-33)GCG>CCG		retinoblastoma binding protein 2 isoform 1							14.0	16.0	16.0					12																	498227		1819	4070	5889	SO:0001583	missense	5927				chromatin modification|multicellular organismal development|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleolus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr12:498227C>G		CCDS41736.1	12p13.33	2013-01-28	2009-04-06	2009-04-06	ENSG00000073614	ENSG00000073614		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	9886	protein-coding gene	gene with protein product		180202	"""retinoblastoma-binding protein 2"", ""Jumonji, AT rich interactive domain 1A (RBBP2-like)"", ""jumonji, AT rich interactive domain 1A"""	RBBP2, JARID1A		1857421	Standard	NM_001042603		Approved		uc001qif.1	P29375	OTTHUMG00000168055	ENST00000399788.2:c.31G>C	12.37:g.498227C>G	ENSP00000382688:p.Ala11Pro					KDM5A_uc001qie.1_Missense_Mutation_p.A11P|CCDC77_uc009zdk.2_5'Flank|CCDC77_uc010sdp.1_5'Flank|KDM5A_uc010sdn.1_Missense_Mutation_p.A11P|KDM5A_uc010sdo.1_Missense_Mutation_p.A11P	p.A11P	NM_001042603	NP_001036068	P29375	KDM5A_HUMAN			1	394	-			11					A8MV76|Q4LE72|Q86XZ1	Missense_Mutation	SNP	ENST00000399788.2	37	c.31G>C	CCDS41736.1	.	.	.	.	.	.	.	.	.	.	C	19.10	3.761244	0.69763	.	.	ENSG00000073614	ENST00000261253;ENST00000399787;ENST00000399788;ENST00000382815;ENST00000544760;ENST00000535014;ENST00000543507	D;D;D;T;D	0.85339	-1.97;-1.78;-1.66;-1.14;-1.7	4.9	3.08	0.35506	.	0.304179	0.30028	N	0.010590	T	0.67859	0.2938	N	0.08118	0	0.37623	D	0.921363	B;P;P;P	0.40794	0.38;0.514;0.61;0.729	B;B;B;B	0.38803	0.094;0.193;0.146;0.282	T	0.66428	-0.5926	10	0.31617	T	0.26	.	8.1554	0.31165	0.1566:0.7644:0.0:0.079	.	11;11;11;11	B4DVX3;F5H1F7;P29375;P29375-2	.;.;KDM5A_HUMAN;.	P	11	ENSP00000382688:A11P;ENSP00000372265:A11P;ENSP00000440622:A11P;ENSP00000443854:A11P;ENSP00000444251:A11P	ENSP00000261253:A11P	A	-	1	0	KDM5A	368488	1.000000	0.71417	0.989000	0.46669	0.338000	0.28826	2.224000	0.42945	0.686000	0.31488	-0.326000	0.08463	GCG		0.687	KDM5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397812.1	NM_005056		15	16	0	0	0	0.00499	0	15	16				
CACNA1C	775	broad.mit.edu	37	12	2224599	2224599	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr12:2224599G>T	ENST00000347598.4	+	2	259	c.259G>T	c.(259-261)Ggg>Tgg	p.G87W	CACNA1C_ENST00000399597.1_Missense_Mutation_p.G87W|CACNA1C_ENST00000399595.1_Missense_Mutation_p.G87W|CACNA1C_ENST00000327702.7_Missense_Mutation_p.G87W|CACNA1C_ENST00000335762.5_Missense_Mutation_p.G87W|CACNA1C_ENST00000399655.1_Missense_Mutation_p.G87W|CACNA1C_ENST00000399621.1_Missense_Mutation_p.G87W|CACNA1C_ENST00000399601.1_Missense_Mutation_p.G87W|CACNA1C_ENST00000399591.1_Missense_Mutation_p.G87W|CACNA1C_ENST00000399637.1_Missense_Mutation_p.G87W|CACNA1C_ENST00000399629.1_Missense_Mutation_p.G87W|CACNA1C_ENST00000399634.1_Missense_Mutation_p.G87W|CACNA1C_ENST00000399641.1_Missense_Mutation_p.G87W|CACNA1C_ENST00000480911.1_Missense_Mutation_p.G87W|CACNA1C_ENST00000399606.1_Missense_Mutation_p.G87W|CACNA1C_ENST00000399638.1_Missense_Mutation_p.G87W|CACNA1C_ENST00000399644.1_Missense_Mutation_p.G87W|CACNA1C_ENST00000399603.1_Missense_Mutation_p.G87W|CACNA1C_ENST00000406454.3_Missense_Mutation_p.G87W|CACNA1C_ENST00000344100.3_Missense_Mutation_p.G87W|CACNA1C_ENST00000399617.1_Missense_Mutation_p.G87W|CACNA1C_ENST00000402845.3_Missense_Mutation_p.G87W|CACNA1C_ENST00000399649.1_Missense_Mutation_p.G87W	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	87					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.G87W(3)|p.G117W(1)		NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GCAGCAATATGGGAAACCCAA	0.662																																							uc009zdu.1		NA																	4	Substitution - Missense(4)		lung(4)	ovary(10)|central_nervous_system(1)	11						c.(259-261)GGG>TGG		calcium channel, voltage-dependent, L type,	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)						25.0	33.0	30.0					12																	2224599		2172	4280	6452	SO:0001583	missense	775				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity	g.chr12:2224599G>T	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.259G>T	12.37:g.2224599G>T	ENSP00000266376:p.Gly87Trp					CACNA1C_uc009zdv.1_Missense_Mutation_p.G87W|CACNA1C_uc001qkb.2_Missense_Mutation_p.G87W|CACNA1C_uc001qkc.2_Missense_Mutation_p.G87W|CACNA1C_uc001qke.2_Missense_Mutation_p.G87W|CACNA1C_uc001qkf.2_Missense_Mutation_p.G87W|CACNA1C_uc001qjz.2_Missense_Mutation_p.G87W|CACNA1C_uc001qkd.2_Missense_Mutation_p.G87W|CACNA1C_uc001qkg.2_Missense_Mutation_p.G87W|CACNA1C_uc009zdw.1_Missense_Mutation_p.G87W|CACNA1C_uc001qkh.2_Missense_Mutation_p.G87W|CACNA1C_uc001qkl.2_Missense_Mutation_p.G87W|CACNA1C_uc001qkn.2_Missense_Mutation_p.G87W|CACNA1C_uc001qko.2_Missense_Mutation_p.G87W|CACNA1C_uc001qkp.2_Missense_Mutation_p.G87W|CACNA1C_uc001qkr.2_Missense_Mutation_p.G87W|CACNA1C_uc001qku.2_Missense_Mutation_p.G87W|CACNA1C_uc001qkq.2_Missense_Mutation_p.G87W|CACNA1C_uc001qks.2_Missense_Mutation_p.G87W|CACNA1C_uc001qkt.2_Missense_Mutation_p.G87W	p.G87W	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	2	572	+			87			Cytoplasmic (Potential).		B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	ENST00000347598.4	37	c.259G>T	CCDS44788.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.230469	0.79688	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000480911;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.57273	0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41	5.58	5.58	0.84498	.	0.239506	0.34110	N	0.004245	T	0.57577	0.2063	L	0.27053	0.805	0.35878	D	0.828759	D;D;P;D;D;D;D;P;D;D;D;D;P;D;D;D;D;D;D;D	0.76494	0.988;0.988;0.942;0.999;0.988;0.988;0.99;0.941;0.983;0.988;0.988;0.995;0.878;0.988;0.983;0.988;0.988;0.988;0.988;0.988	P;P;P;D;P;P;D;P;D;P;P;D;P;P;P;P;P;P;P;P	0.71414	0.898;0.898;0.745;0.973;0.898;0.898;0.93;0.673;0.915;0.898;0.898;0.95;0.673;0.898;0.87;0.898;0.898;0.898;0.898;0.898	T	0.62258	-0.6892	9	.	.	.	.	12.8617	0.57918	0.0744:0.0:0.9256:0.0	.	87;87;87;87;87;87;87;87;87;87;87;87;87;87;87;87;87;87;87;87	Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-11;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;Q13936-12	.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	W	87	ENSP00000336982:G87W;ENSP00000382563:G87W;ENSP00000437936:G87W;ENSP00000382552:G87W;ENSP00000382547:G87W;ENSP00000382506:G87W;ENSP00000382530:G87W;ENSP00000382546:G87W;ENSP00000382500:G87W;ENSP00000382549:G87W;ENSP00000266376:G87W;ENSP00000382515:G87W;ENSP00000382510:G87W;ENSP00000341092:G87W;ENSP00000382537:G87W;ENSP00000329877:G87W;ENSP00000382557:G87W;ENSP00000385724:G87W;ENSP00000382512:G87W;ENSP00000382542:G87W;ENSP00000382526:G87W;ENSP00000385896:G87W;ENSP00000382504:G87W	.	G	+	1	0	CACNA1C	2094860	1.000000	0.71417	0.998000	0.56505	0.953000	0.61014	5.100000	0.64560	2.627000	0.88993	0.555000	0.69702	GGG		0.662	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719		7	11	1	0	0.000151284	0.016723	0.000164306	7	11				
SLC2A3	6515	broad.mit.edu	37	12	8074110	8074110	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr12:8074110C>A	ENST00000075120.7	-	10	1630	c.1390G>T	c.(1390-1392)Gcc>Tcc	p.A464S	SLC2A3_ENST00000543435.1_5'Flank	NM_006931.2	NP_008862.1	P11169	GTR3_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 3	464					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|L-ascorbic acid metabolic process (GO:0019852)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)	p.A464S(1)		central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(14)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				Kidney(36;0.0866)		CCTTCAAAGGCCCGTGTGATA	0.502																																					Colon(96;424 1461 14416 20933 23688)	Colon(96;424 1461 14416 20933 23688)	uc001qtr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|pancreas(1)	4						c.(1390-1392)GCC>TCC		solute carrier family 2 (facilitated glucose							164.0	164.0	164.0					12																	8074110		2203	4300	6503	SO:0001583	missense	6515				carbohydrate metabolic process|water-soluble vitamin metabolic process	integral to membrane|plasma membrane	D-glucose transmembrane transporter activity|dehydroascorbic acid transporter activity	g.chr12:8074110C>A	M20681	CCDS8586.1	12p13.3	2013-05-22			ENSG00000059804	ENSG00000059804		"""Solute carriers"""	11007	protein-coding gene	gene with protein product		138170		GLUT3			Standard	NM_006931		Approved		uc001qtr.3	P11169	OTTHUMG00000133685	ENST00000075120.7:c.1390G>T	12.37:g.8074110C>A	ENSP00000075120:p.Ala464Ser						p.A464S	NM_006931	NP_008862	P11169	GTR3_HUMAN		Kidney(36;0.0866)	10	1652	-			464			Cytoplasmic (Potential).		B2R606|D3DUU6|Q6I9U2|Q9UG15	Missense_Mutation	SNP	ENST00000075120.7	37	c.1390G>T	CCDS8586.1	.	.	.	.	.	.	.	.	.	.	C	6.497	0.459959	0.12342	.	.	ENSG00000059804	ENST00000075120;ENST00000540978	T	0.74842	-0.88	3.86	3.86	0.44501	Major facilitator superfamily domain, general substrate transporter (1);	0.743675	0.12821	N	0.436460	T	0.59183	0.2175	N	0.20807	0.61	0.30635	N	0.75707	B	0.16603	0.018	B	0.25405	0.06	T	0.48091	-0.9065	10	0.07813	T	0.8	.	13.6559	0.62338	0.0:1.0:0.0:0.0	.	464	P11169	GTR3_HUMAN	S	464;390	ENSP00000075120:A464S	ENSP00000075120:A464S	A	-	1	0	SLC2A3	7965377	0.985000	0.35326	0.960000	0.40013	0.992000	0.81027	3.412000	0.52679	2.139000	0.66308	0.491000	0.48974	GCC		0.502	SLC2A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257914.1	NM_006931		74	203	1	0	3.20846e-33	0.01441	5.04187e-33	74	203				
A2ML1	144568	broad.mit.edu	37	12	8994049	8994049	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr12:8994049C>A	ENST00000299698.7	+	11	1345	c.1165C>A	c.(1165-1167)Cag>Aag	p.Q389K		NM_001282424.1|NM_144670.4	NP_001269353.1|NP_653271			alpha-2-macroglobulin-like 1									p.Q389K(1)		NS(2)|breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(2)|lung(36)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	80						AACCTTCAACCAGACCCTGGT	0.478																																							uc001quz.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(1165-1167)CAG>AAG		alpha-2-macroglobulin-like 1 precursor							131.0	123.0	126.0					12																	8994049		1916	4133	6049	SO:0001583	missense	144568					extracellular space	endopeptidase inhibitor activity	g.chr12:8994049C>A	AK057908	CCDS8596.2, CCDS73439.1	12p13	2010-12-14	2005-09-01	2005-09-01	ENSG00000166535	ENSG00000166535			23336	protein-coding gene	gene with protein product		610627	"""C3 and PZP-like, alpha-2-macroglobulin domain containing 9"""	CPAMD9		16298998	Standard	NM_144670		Approved	FLJ25179	uc001quz.5	A8K2U0	OTTHUMG00000128499	ENST00000299698.7:c.1165C>A	12.37:g.8994049C>A	ENSP00000299698:p.Gln389Lys					A2ML1_uc001qva.1_5'Flank	p.Q389K	NM_144670	NP_653271	A8K2U0	A2ML1_HUMAN			11	1263	+			233						Missense_Mutation	SNP	ENST00000299698.7	37	c.1165C>A	CCDS8596.2	.	.	.	.	.	.	.	.	.	.	C	0.307	-0.970223	0.02232	.	.	ENSG00000166535	ENST00000299698;ENST00000539161	T	0.29655	1.56	3.81	2.88	0.33553	.	0.767064	0.11171	N	0.592053	T	0.25382	0.0617	L	0.58428	1.81	0.58432	D	0.999999	B	0.15930	0.015	B	0.16722	0.016	T	0.11131	-1.0600	10	0.05525	T	0.97	.	8.5284	0.33319	0.1714:0.6616:0.1671:0.0	.	389	A8K2U0	A2ML1_HUMAN	K	389	ENSP00000299698:Q389K	ENSP00000299698:Q389K	Q	+	1	0	A2ML1	8885316	0.285000	0.24296	0.318000	0.25279	0.026000	0.11368	0.556000	0.23438	1.125000	0.41998	0.655000	0.94253	CAG		0.478	A2ML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250304.3	NM_144670		74	131	1	0	1.12115e-39	0.01441	1.80818e-39	74	131				
KLRC3	3823	broad.mit.edu	37	12	10587093	10587093	+	Missense_Mutation	SNP	G	G	A	rs143264024	byFrequency	TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr12:10587093G>A	ENST00000539033.1	-	3	337	c.323C>T	c.(322-324)aCg>aTg	p.T108M	KLRC2_ENST00000536833.2_Missense_Mutation_p.T49M|KLRC2_ENST00000381902.2_Missense_Mutation_p.T108M|KLRC2_ENST00000381901.1_Intron														p.T108M(1)									ACCTTTCTGCGTTCTTGTATT	0.284													G|||	2	0.000399361	0.0008	0.0014	5008	,	,		20603	0.0		0.0	False		,,,				2504	0.0						uc001qyh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(322-324)ACG>ATG		killer cell lectin-like receptor subfamily C,		G	MET/THR	2,4404	4.2+/-10.8	0,2,2201	86.0	97.0	94.0		323	-1.4	0.0	12	dbSNP_134	94	0,8592		0,0,4296	no	missense	KLRC2	NM_002260.3	81	0,2,6497	AA,AG,GG		0.0,0.0454,0.0154	possibly-damaging	108/232	10587093	2,12996	2203	4296	6499	SO:0001583	missense	3823				cellular defense response	integral to membrane	sugar binding|transmembrane receptor activity	g.chr12:10587093G>A																												ENST00000539033.1:c.323C>T	12.37:g.10587093G>A	ENSP00000437563:p.Thr108Met					KLRC2_uc010she.1_Missense_Mutation_p.T108M|KLRC2_uc001qyk.2_Missense_Mutation_p.T108M	p.T108M	NM_002261	NP_002252	Q07444	NKG2E_HUMAN			3	330	-			108			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000539033.1	37	c.323C>T		.	.	.	.	.	.	.	.	.	.	G	5.615	0.298211	0.10622	4.54E-4	0.0	ENSG00000255641;ENSG00000205809;ENSG00000205809	ENST00000539033;ENST00000381902;ENST00000536833	T;T;T	0.08546	3.08;3.08;3.08	2.51	-1.4	0.08968	C-type lectin fold (1);C-type lectin-like (1);	1.327380	0.05213	N	0.507197	T	0.14270	0.0345	M	0.76002	2.32	0.09310	N	1	P;P;P	0.49696	0.799;0.668;0.927	B;B;P	0.45071	0.245;0.109;0.468	T	0.34204	-0.9838	10	0.59425	D	0.04	.	6.8938	0.24245	0.3223:0.0:0.6777:0.0	.	94;108;108	Q3KQS7;P26717;F5H6K3	.;NKG2C_HUMAN;.	M	108;108;49	ENSP00000437563:T108M;ENSP00000371327:T108M;ENSP00000444754:T49M	ENSP00000371327:T108M	T	-	2	0	KLRC2;RP11-277P12.6	10478360	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.187000	0.01250	-0.427000	0.07350	-1.129000	0.01985	ACG		0.284	NKG2-E-001	KNOWN	basic|appris_principal|readthrough_transcript	protein_coding	protein_coding	OTTHUMT00000400274.1			8	55	0	0	0	0.006214	0	8	55				
CDKN1B	1027	broad.mit.edu	37	12	12870888	12870888	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr12:12870888G>C	ENST00000228872.4	+	1	831	c.115G>C	c.(115-117)Gaa>Caa	p.E39Q	CDKN1B_ENST00000477087.1_Intron|CDKN1B_ENST00000396340.1_Missense_Mutation_p.E39Q	NM_004064.3	NP_004055.1	P46527	CDN1B_HUMAN	cyclin-dependent kinase inhibitor 1B (p27, Kip1)	39					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|autophagic cell death (GO:0048102)|cell cycle arrest (GO:0007050)|cellular response to antibiotic (GO:0071236)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|mitotic cell cycle (GO:0000278)|mitotic cell cycle arrest (GO:0071850)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular component movement (GO:0051271)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of kinase activity (GO:0033673)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell death (GO:0010942)|positive regulation of cell proliferation (GO:0008284)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|potassium ion transport (GO:0006813)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to amino acid (GO:0043200)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|protein phosphatase binding (GO:0019903)|transforming growth factor beta receptor, cytoplasmic mediator activity (GO:0005072)	p.E39Q(1)		breast(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(5)	13		Prostate(47;0.0322)|all_epithelial(100;0.159)		BRCA - Breast invasive adenocarcinoma(232;0.0336)		GGTGGACCACGAAGAGTTAAC	0.602																																							uc001rat.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)	2						c.(115-117)GAA>CAA		cyclin-dependent kinase inhibitor 1B							63.0	73.0	70.0					12																	12870888		2203	4300	6503	SO:0001583	missense	1027	Multiple_Endocrine_Neoplasia_type_1|Multiple_Endocrine_Neoplasia_type_4			autophagic cell death|cell cycle arrest|cellular response to lithium ion|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|negative regulation of transcription, DNA-dependent|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of protein catabolic process|S phase of mitotic cell cycle	cytosol|endosome|nucleoplasm	cyclin-dependent protein kinase inhibitor activity|protein phosphatase binding|transforming growth factor beta receptor, cytoplasmic mediator activity	g.chr12:12870888G>C	AF480891	CCDS8653.1	12p13.1-p12	2008-08-04			ENSG00000111276	ENSG00000111276			1785	protein-coding gene	gene with protein product		600778				8033212	Standard	NM_004064		Approved	KIP1, P27KIP1	uc001rat.2	P46527	OTTHUMG00000149914	ENST00000228872.4:c.115G>C	12.37:g.12870888G>C	ENSP00000228872:p.Glu39Gln						p.E39Q	NM_004064	NP_004055	P46527	CDN1B_HUMAN		BRCA - Breast invasive adenocarcinoma(232;0.0336)	1	587	+		Prostate(47;0.0322)|all_epithelial(100;0.159)	39					Q16307|Q5U0H2|Q9BUS6	Missense_Mutation	SNP	ENST00000228872.4	37	c.115G>C	CCDS8653.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.448077	0.84101	.	.	ENSG00000111276	ENST00000228872;ENST00000396340;ENST00000442489	D;D;D	0.85013	-1.93;-1.93;-1.93	5.15	4.26	0.50523	.	0.066188	0.64402	D	0.000011	D	0.89539	0.6744	M	0.78637	2.42	0.50313	D	0.999862	P	0.50443	0.935	P	0.54924	0.764	D	0.89558	0.3804	10	0.49607	T	0.09	-18.9193	13.4138	0.60958	0.077:0.0:0.923:0.0	.	39	P46527	CDN1B_HUMAN	Q	39;39;32	ENSP00000228872:E39Q;ENSP00000379629:E39Q;ENSP00000407597:E32Q	ENSP00000228872:E39Q	E	+	1	0	CDKN1B	12762155	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.356000	0.97091	1.176000	0.42840	0.655000	0.94253	GAA		0.602	CDKN1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313878.2	NM_004064		84	137	0	0	0	0.01441	0	84	137				
FAR2	55711	broad.mit.edu	37	12	29423409	29423409	+	Silent	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr12:29423409C>A	ENST00000536681.3	+	2	273	c.27C>A	c.(25-27)ggC>ggA	p.G9G	FAR2_ENST00000547116.1_Intron|FAR2_ENST00000182377.4_Silent_p.G9G	NM_001271783.1|NM_001271784.1	NP_001258712.1|NP_001258713.1	Q96K12	FACR2_HUMAN	fatty acyl CoA reductase 2	9					cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	fatty-acyl-CoA reductase (alcohol-forming) activity (GO:0080019)|long-chain-fatty-acyl-CoA reductase activity (GO:0050062)	p.G9G(1)		central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(15)|prostate(1)|stomach(1)	29						CTTTCTATGGCGGCAAGTCCA	0.458																																							uc001ris.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(25-27)GGC>GGA		fatty acyl CoA reductase 2							68.0	69.0	68.0					12																	29423409		2203	4300	6503	SO:0001819	synonymous_variant	55711				ether lipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane|peroxisomal matrix|peroxisomal membrane	binding|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor	g.chr12:29423409C>A	AL136843	CCDS8717.1, CCDS61084.1	12p11.23	2013-07-30	2008-06-06	2008-06-06	ENSG00000064763	ENSG00000064763	1.2.1.-	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	25531	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 10E, member 2"""		"""male sterility domain containing 1"""	MLSTD1		15220348, 15220349, 19027726	Standard	NM_001271783		Approved	FLJ10462, SDR10E2	uc001ris.5	Q96K12	OTTHUMG00000169320	ENST00000536681.3:c.27C>A	12.37:g.29423409C>A						FAR2_uc001rit.2_Silent_p.G9G|FAR2_uc009zjm.2_Intron	p.G9G	NM_018099	NP_060569	Q96K12	FACR2_HUMAN			2	174	+			9					F8VV73|Q9H0D5|Q9NVW8	Silent	SNP	ENST00000536681.3	37	c.27C>A	CCDS8717.1																																																																																				0.458	FAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403479.2	NM_018099		18	33	1	0	3.6726e-16	0.021523	4.893e-16	18	33				
FAR2	55711	broad.mit.edu	37	12	29423423	29423423	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr12:29423423T>C	ENST00000536681.3	+	2	287	c.41T>C	c.(40-42)cTc>cCc	p.L14P	FAR2_ENST00000547116.1_Intron|FAR2_ENST00000182377.4_Missense_Mutation_p.L14P	NM_001271783.1|NM_001271784.1	NP_001258712.1|NP_001258713.1	Q96K12	FACR2_HUMAN	fatty acyl CoA reductase 2	14					cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	fatty-acyl-CoA reductase (alcohol-forming) activity (GO:0080019)|long-chain-fatty-acyl-CoA reductase activity (GO:0050062)	p.L14P(1)		central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(15)|prostate(1)|stomach(1)	29						AAGTCCATTCTCATCACGGGG	0.483																																							uc001ris.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(40-42)CTC>CCC		fatty acyl CoA reductase 2							69.0	70.0	69.0					12																	29423423		2203	4300	6503	SO:0001583	missense	55711				ether lipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane|peroxisomal matrix|peroxisomal membrane	binding|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor	g.chr12:29423423T>C	AL136843	CCDS8717.1, CCDS61084.1	12p11.23	2013-07-30	2008-06-06	2008-06-06	ENSG00000064763	ENSG00000064763	1.2.1.-	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	25531	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 10E, member 2"""		"""male sterility domain containing 1"""	MLSTD1		15220348, 15220349, 19027726	Standard	NM_001271783		Approved	FLJ10462, SDR10E2	uc001ris.5	Q96K12	OTTHUMG00000169320	ENST00000536681.3:c.41T>C	12.37:g.29423423T>C	ENSP00000443291:p.Leu14Pro					FAR2_uc001rit.2_Missense_Mutation_p.L14P|FAR2_uc009zjm.2_Intron	p.L14P	NM_018099	NP_060569	Q96K12	FACR2_HUMAN			2	188	+			14					F8VV73|Q9H0D5|Q9NVW8	Missense_Mutation	SNP	ENST00000536681.3	37	c.41T>C	CCDS8717.1	.	.	.	.	.	.	.	.	.	.	T	14.92	2.680720	0.47886	.	.	ENSG00000064763	ENST00000536681;ENST00000182377	T;T	0.40476	1.03;1.03	5.3	5.3	0.74995	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.74291	0.3697	H	0.95917	3.74	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.82808	-0.0274	10	0.87932	D	0	-12.3547	13.2032	0.59780	0.0:0.0:0.0:1.0	.	14	Q96K12	FACR2_HUMAN	P	14	ENSP00000443291:L14P;ENSP00000182377:L14P	ENSP00000182377:L14P	L	+	2	0	FAR2	29314690	1.000000	0.71417	1.000000	0.80357	0.044000	0.14063	7.574000	0.82434	2.002000	0.58637	0.459000	0.35465	CTC		0.483	FAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403479.2	NM_018099		20	31	0	0	0	0.007291	0	20	31				
TMTC1	83857	broad.mit.edu	37	12	29670472	29670472	+	Missense_Mutation	SNP	A	A	C			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr12:29670472A>C	ENST00000539277.1	-	14	2115	c.2057T>G	c.(2056-2058)tTg>tGg	p.L686W	TMTC1_ENST00000256062.5_Missense_Mutation_p.L578W|TMTC1_ENST00000551659.1_Missense_Mutation_p.L748W|TMTC1_ENST00000319685.8_5'UTR|RP11-310I24.1_ENST00000549070.1_RNA|TMTC1_ENST00000552618.1_Missense_Mutation_p.L710W	NM_001193451.1	NP_001180380.1	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat containing 1	686						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)		p.L578W(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(17)|lung(45)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					CAAAGGTGACAATATCTCAGC	0.463																																							uc001rjb.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1732-1734)TTG>TGG		transmembrane and tetratricopeptide repeat							148.0	138.0	142.0					12																	29670472		2203	4300	6503	SO:0001583	missense	83857					integral to membrane	binding	g.chr12:29670472A>C		CCDS8718.1, CCDS53772.1	12p11.22	2014-06-09	2006-01-06			ENSG00000133687		"""Tetratricopeptide (TTC) repeat domain containing"""	24099	protein-coding gene	gene with protein product		615855				24764305	Standard	NM_001193451		Approved	ARG99, OLF, FLJ31400, FLJ41625	uc021qwi.1	Q8IUR5	OTTHUMG00000169324	ENST00000539277.1:c.2057T>G	12.37:g.29670472A>C	ENSP00000442046:p.Leu686Trp					TMTC1_uc001riz.2_Missense_Mutation_p.L335W|TMTC1_uc001rja.2_Missense_Mutation_p.L422W|TMTC1_uc001riy.2_Missense_Mutation_p.L31W	p.L578W	NM_175861	NP_787057	Q8IUR5	TMTC1_HUMAN			14	2207	-	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)		686			TPR 7.		D0EP37|F5H8B5|Q6PIU4|Q6ZSM5|Q96N52|Q9BXM2	Missense_Mutation	SNP	ENST00000539277.1	37	c.1733T>G	CCDS53772.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.291480	0.80914	.	.	ENSG00000133687	ENST00000540901;ENST00000256062;ENST00000551659;ENST00000552618;ENST00000539277	T;T;T;T	0.55760	0.5;0.5;0.5;0.88	5.63	5.63	0.86233	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.64402	D	0.000001	T	0.68403	0.2997	L	0.58810	1.83	0.80722	D	1	D;D;D	0.89917	0.993;1.0;1.0	P;D;D	0.91635	0.869;0.999;0.993	T	0.68051	-0.5511	9	.	.	.	-12.4931	14.6792	0.69004	1.0:0.0:0.0:0.0	.	686;748;31	Q8IUR5;F8VTQ9;Q8IUR5-4	TMTC1_HUMAN;.;.	W	449;578;748;710;686	ENSP00000256062:L578W;ENSP00000448112:L748W;ENSP00000449043:L710W;ENSP00000442046:L686W	.	L	-	2	0	TMTC1	29561739	0.910000	0.30920	0.037000	0.18230	0.896000	0.52359	8.107000	0.89557	2.141000	0.66446	0.528000	0.53228	TTG		0.463	TMTC1-002	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403509.1	NM_031920		50	118	0	0	0	0.01441	0	50	118				
ADAMTS20	80070	broad.mit.edu	37	12	43846183	43846183	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr12:43846183C>A	ENST00000389420.3	-	14	1972	c.1973G>T	c.(1972-1974)tGt>tTt	p.C658F	ADAMTS20_ENST00000553158.1_Missense_Mutation_p.C658F	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	658	Cys-rich.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.C658F(2)		breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		AGCAACCTGACAATAGAGTTT	0.353																																							uc010skx.1		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19						c.(1972-1974)TGT>TTT		a disintegrin-like and metalloprotease with							89.0	85.0	86.0					12																	43846183		2203	4300	6503	SO:0001583	missense	80070					proteinaceous extracellular matrix	zinc ion binding	g.chr12:43846183C>A	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.1973G>T	12.37:g.43846183C>A	ENSP00000374071:p.Cys658Phe						p.C658F	NM_025003	NP_079279	P59510	ATS20_HUMAN		GBM - Glioblastoma multiforme(48;0.0473)	14	1973	-	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)	658			Cys-rich.		A6NNC9|J3QT00	Missense_Mutation	SNP	ENST00000389420.3	37	c.1973G>T	CCDS31778.2	.	.	.	.	.	.	.	.	.	.	C	15.26	2.780204	0.49891	.	.	ENSG00000173157	ENST00000389420;ENST00000553158;ENST00000389417	T;T	0.74947	-0.89;-0.89	4.97	4.97	0.65823	.	0.000000	0.56097	D	0.000028	D	0.92371	0.7579	H	0.98769	4.325	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.95275	0.8381	10	0.87932	D	0	.	19.1323	0.93413	0.0:1.0:0.0:0.0	.	658	P59510	ATS20_HUMAN	F	658	ENSP00000374071:C658F;ENSP00000448341:C658F	ENSP00000374068:C658F	C	-	2	0	ADAMTS20	42132450	1.000000	0.71417	0.996000	0.52242	0.046000	0.14306	7.370000	0.79589	2.695000	0.91970	0.462000	0.41574	TGT		0.353	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1	NM_025003		10	21	1	0	0.000151284	0.016723	0.000164306	10	21				
HDAC7	51564	broad.mit.edu	37	12	48188624	48188624	+	Silent	SNP	C	C	G			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr12:48188624C>G	ENST00000427332.2	-	12	1416	c.1260G>C	c.(1258-1260)gtG>gtC	p.V420V	HDAC7_ENST00000354334.3_Silent_p.V422V|HDAC7_ENST00000552960.1_Silent_p.V442V|HDAC7_ENST00000380610.4_Silent_p.V476V|HDAC7_ENST00000080059.7_Silent_p.V459V|HDAC7_ENST00000488927.1_5'Flank			Q8WUI4	HDAC7_HUMAN	histone deacetylase 7	420	Transcription repression 2. {ECO:0000250}.				cell-cell junction assembly (GO:0007043)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)	p.V420V(1)		breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25				GBM - Glioblastoma multiforme(48;0.137)		GGCCATCGTCCACCACCTGGC	0.687																																							uc010slo.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(1)|breast(1)	2						c.(1375-1377)GTG>GTC		histone deacetylase 7 isoform a							48.0	55.0	53.0					12																	48188624		2203	4299	6502	SO:0001819	synonymous_variant	51564				negative regulation of interleukin-2 production|negative regulation of osteoblast differentiation|positive regulation of cell migration involved in sprouting angiogenesis|transcription, DNA-dependent	cytoplasm|histone deacetylase complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein kinase C binding|repressing transcription factor binding	g.chr12:48188624C>G	AF239243	CCDS8756.2, CCDS41776.1	12q13.1	2008-02-25	2008-02-25	2008-02-25	ENSG00000061273	ENSG00000061273			14067	protein-coding gene	gene with protein product		606542	"""histone deacetylase 7A"""	HDAC7A		10922406, 10640276	Standard	NM_015401		Approved	DKFZP586J0917	uc010slo.2	Q8WUI4	OTTHUMG00000152968	ENST00000427332.2:c.1260G>C	12.37:g.48188624C>G						HDAC7_uc009zku.2_5'Flank|HDAC7_uc001rqe.2_5'Flank|HDAC7_uc001rqj.3_Silent_p.V422V|HDAC7_uc001rqk.3_Silent_p.V442V	p.V459V	NM_015401	NP_056216	Q8WUI4	HDAC7_HUMAN		GBM - Glioblastoma multiforme(48;0.137)	12	1572	-			420			Transcription repression 2 (By similarity).		B3KY08|B4DWI0|B4E0Q5|Q6P1W9|Q6W9G7|Q7Z4K2|Q7Z5I1|Q96K01|Q9BR73|Q9H7L0|Q9NW41|Q9NWA9|Q9NYK9|Q9UFU7	Silent	SNP	ENST00000427332.2	37	c.1377G>C																																																																																					0.687	HDAC7-013	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000328804.2			38	148	0	0	0	0.019004	0	38	148				
PFDN5	5204	broad.mit.edu	37	12	53691907	53691907	+	Missense_Mutation	SNP	C	C	T	rs146649111		TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr12:53691907C>T	ENST00000551018.1	+	5	638	c.361C>T	c.(361-363)Ctt>Ttt	p.L121F	PFDN5_ENST00000550846.1_Missense_Mutation_p.L51F|C12orf10_ENST00000549488.1_5'Flank|PFDN5_ENST00000351500.3_Missense_Mutation_p.L76F|PFDN5_ENST00000334478.4_Missense_Mutation_p.L121F|RP11-680A11.5_ENST00000550263.1_RNA|C12orf10_ENST00000548632.1_5'Flank|C12orf10_ENST00000267103.5_5'Flank	NM_002624.3	NP_002615.2	Q99471	PFD5_HUMAN	prefoldin subunit 5	121					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription, DNA-templated (GO:0045892)|protein folding (GO:0006457)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|prefoldin complex (GO:0016272)	transcription corepressor activity (GO:0003714)	p.L121F(1)		kidney(1)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(1)	8						CCAACCAGCTCTTCAGGAGAA	0.458																																							uc001scl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(361-363)CTT>TTT		prefoldin subunit 5 isoform alpha		C	PHE/LEU,PHE/LEU	0,4406		0,0,2203	136.0	141.0	139.0		361,226	4.4	1.0	12	dbSNP_134	139	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	PFDN5	NM_002624.3,NM_145897.2	22,22	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	121/155,76/110	53691907	1,13005	2203	4300	6503	SO:0001583	missense	5204				'de novo' posttranslational protein folding|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent	nucleus|prefoldin complex	transcription corepressor activity|unfolded protein binding	g.chr12:53691907C>T	D89667	CCDS8853.1, CCDS8854.1	12q13.13	2008-05-14	2006-02-24						8869	protein-coding gene	gene with protein product		604899	"""prefoldin 5"""			9630229, 9792694	Standard	NM_002624		Approved	PFD5, MM-1	uc001scl.3	Q99471	OTTHUMG00000169675	ENST00000551018.1:c.361C>T	12.37:g.53691907C>T	ENSP00000447942:p.Leu121Phe					PFDN5_uc001scm.2_Missense_Mutation_p.L76F|PFDN5_uc001scn.2_RNA|PFDN5_uc001sco.2_RNA|C12orf10_uc010sof.1_5'Flank|C12orf10_uc001scp.3_5'Flank|C12orf10_uc009zmx.2_5'Flank|C12orf10_uc001scq.3_5'Flank	p.L121F	NM_002624	NP_002615	Q99471	PFD5_HUMAN			5	478	+			121					A8K9A8|Q54AA8|Q9C083|Q9C084	Missense_Mutation	SNP	ENST00000551018.1	37	c.361C>T	CCDS8853.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.153652	0.78114	0.0	1.16E-4	ENSG00000123349	ENST00000551018;ENST00000351500;ENST00000334478	T;T;T	0.53640	0.61;0.61;0.61	5.29	4.4	0.53042	Prefoldin (1);Prefoldin subunit (1);	0.000000	0.85682	D	0.000000	T	0.59224	0.2178	L	0.55103	1.725	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.987	T	0.57670	-0.7771	10	0.40728	T	0.16	.	8.3256	0.32156	0.0:0.8207:0.0:0.1793	.	76;121	Q9C083;Q99471	.;PFD5_HUMAN	F	121;76;121	ENSP00000447942:L121F;ENSP00000266964:L76F;ENSP00000334188:L121F	ENSP00000334188:L121F	L	+	1	0	PFDN5	51978174	0.880000	0.30214	0.991000	0.47740	0.978000	0.69477	1.746000	0.38288	1.379000	0.46325	0.555000	0.69702	CTT		0.458	PFDN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405368.2			139	222	0	0	0	0.01441	0	139	222				
HOXC9	3225	broad.mit.edu	37	12	54394171	54394171	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr12:54394171G>A	ENST00000303450.4	+	1	269	c.199G>A	c.(199-201)Gcg>Acg	p.A67T	HOXC-AS1_ENST00000512427.1_RNA|RP11-834C11.12_ENST00000513209.1_Intron|HOXC-AS1_ENST00000505700.1_RNA|HOXC9_ENST00000508190.1_Missense_Mutation_p.A67T|HOXC9_ENST00000504557.1_Intron	NM_006897.1	NP_008828.1	P31274	HXC9_HUMAN	homeobox C9	67					anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.A67T(1)		large_intestine(3)|liver(1)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	14						CACGTCGTGGGCGCCCGTGCC	0.677																																							uc001sep.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|pancreas(1)|skin(1)	3						c.(199-201)GCG>ACG		homeobox C9							36.0	35.0	35.0					12																	54394171		2202	4297	6499	SO:0001583	missense	3225				multicellular organismal development	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr12:54394171G>A		CCDS8869.1	12q13.13	2011-06-20	2005-12-22			ENSG00000180806		"""Homeoboxes / ANTP class : HOXL subclass"""	5130	protein-coding gene	gene with protein product		142971	"""homeo box C9"""	HOX3, HOX3B		1973146	Standard	NM_006897		Approved		uc001seq.3	P31274		ENST00000303450.4:c.199G>A	12.37:g.54394171G>A	ENSP00000302836:p.Ala67Thr					HOXC9_uc001seq.2_Missense_Mutation_p.A67T	p.A67T	NM_006897	NP_008828	P31274	HXC9_HUMAN			2	297	+			67					B2RCN7|Q9H1I0	Missense_Mutation	SNP	ENST00000303450.4	37	c.199G>A	CCDS8869.1	.	.	.	.	.	.	.	.	.	.	G	13.25	2.180115	0.38511	.	.	ENSG00000180806	ENST00000508190;ENST00000303450	D;D	0.93247	-3.19;-3.19	4.04	4.04	0.47022	Hox9, N-terminal activation domain (1);	0.077242	0.53938	D	0.000051	D	0.87649	0.6230	N	0.20357	0.565	0.58432	D	0.999996	B	0.10296	0.003	B	0.15870	0.014	D	0.83994	0.0339	10	0.39692	T	0.17	.	15.4974	0.75666	0.0:0.0:1.0:0.0	.	67	P31274	HXC9_HUMAN	T	67	ENSP00000423861:A67T;ENSP00000302836:A67T	ENSP00000302836:A67T	A	+	1	0	HOXC9	52680438	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.539000	0.45718	2.268000	0.75426	0.561000	0.74099	GCG		0.677	HOXC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358958.1			13	56	0	0	0	0.004007	0	13	56				
HELB	92797	broad.mit.edu	37	12	66698906	66698906	+	Missense_Mutation	SNP	A	A	C			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr12:66698906A>C	ENST00000247815.4	+	2	642	c.583A>C	c.(583-585)Atg>Ctg	p.M195L		NM_033647.3	NP_387467.2	Q8NG08	HELB_HUMAN	helicase (DNA) B	195					DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication, synthesis of RNA primer (GO:0006269)		ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|single-stranded DNA-dependent ATP-dependent DNA helicase activity (GO:0017116)	p.M195L(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(15)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	40			GBM - Glioblastoma multiforme(2;0.000142)	GBM - Glioblastoma multiforme(28;0.0265)		AGACAATGAGATGAGTCTTCC	0.363																																							uc001sti.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|pancreas(1)	2						c.(583-585)ATG>CTG		helicase (DNA) B							67.0	64.0	65.0					12																	66698906		2203	4300	6503	SO:0001583	missense	92797				DNA replication, synthesis of RNA primer		ATP binding|ATP-dependent 5'-3' DNA helicase activity|single-stranded DNA-dependent ATP-dependent DNA helicase activity	g.chr12:66698906A>C	AF319995	CCDS8976.1	12q14.2	2009-01-15			ENSG00000127311	ENSG00000127311			17196	protein-coding gene	gene with protein product		614539				12181327	Standard	NM_033647		Approved		uc001sti.3	Q8NG08	OTTHUMG00000169006	ENST00000247815.4:c.583A>C	12.37:g.66698906A>C	ENSP00000247815:p.Met195Leu					HELB_uc010ssz.1_RNA|HELB_uc009zqt.1_RNA	p.M195L	NM_033647	NP_387467	Q8NG08	HELB_HUMAN	GBM - Glioblastoma multiforme(2;0.000142)	GBM - Glioblastoma multiforme(28;0.0265)	2	611	+			195					A8K4C9|Q4G0T2|Q9H7L5	Missense_Mutation	SNP	ENST00000247815.4	37	c.583A>C	CCDS8976.1	.	.	.	.	.	.	.	.	.	.	A	0.826	-0.746949	0.03065	.	.	ENSG00000127311	ENST00000247815	T	0.10099	2.91	5.07	3.89	0.44902	.	0.896444	0.09730	N	0.763281	T	0.08447	0.0210	L	0.34521	1.04	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.40403	-0.9565	9	.	.	.	0.0956	5.3604	0.16085	0.7295:0.1798:0.0907:0.0	.	195	Q8NG08	HELB_HUMAN	L	195	ENSP00000247815:M195L	.	M	+	1	0	HELB	64985173	0.000000	0.05858	0.002000	0.10522	0.029000	0.11900	-0.348000	0.07740	0.837000	0.34925	0.454000	0.30748	ATG		0.363	HELB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401919.1			43	52	0	0	0	0.01441	0	43	52				
IFNG	3458	broad.mit.edu	37	12	68549249	68549249	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr12:68549249G>T	ENST00000229135.3	-	4	516	c.385C>A	c.(385-387)Caa>Aaa	p.Q129K	IFNG-AS1_ENST00000536914.1_RNA	NM_000619.2	NP_000610.2	P01579	IFNG_HUMAN	interferon, gamma	129					adaptive immune response (GO:0002250)|antigen processing and presentation (GO:0019882)|apoptotic process (GO:0006915)|CD8-positive, alpha-beta T cell differentiation involved in immune response (GO:0002302)|cell cycle arrest (GO:0007050)|cell surface receptor signaling pathway (GO:0007166)|cellular component movement (GO:0006928)|cellular response to interleukin-18 (GO:0071351)|cellular response to lipopolysaccharide (GO:0071222)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endoplasmic reticulum unfolded protein response (GO:0030968)|extrinsic apoptotic signaling pathway (GO:0097191)|humoral immune response (GO:0006959)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003340)|negative regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072308)|negative regulation of myelination (GO:0031642)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neutrophil apoptotic process (GO:0001781)|neutrophil chemotaxis (GO:0030593)|positive regulation of calcidiol 1-monooxygenase activity (GO:0060559)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of fructose 1,6-bisphosphate 1-phosphatase activity (GO:0060550)|positive regulation of fructose 1,6-bisphosphate metabolic process (GO:0060552)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-23 production (GO:0032747)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of isotype switching to IgG isotypes (GO:0048304)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor (ligand) superfamily member 11 production (GO:2000309)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of vitamin D biosynthetic process (GO:0060557)|protein import into nucleus, translocation (GO:0000060)|regulation of insulin secretion (GO:0050796)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of the force of heart contraction (GO:0002026)|response to drug (GO:0042493)|response to virus (GO:0009615)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|interferon-gamma receptor binding (GO:0005133)	p.Q129K(1)		central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(5)|prostate(1)	12			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000829)	Glucosamine(DB01296)|Olsalazine(DB01250)	GCTTTGCGTTGGACATTCAAG	0.428																																							uc001stw.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(385-387)CAA>AAA		interferon, gamma precursor	Glucosamine(DB01296)|Interferon gamma-1b(DB00033)|Simvastatin(DB00641)						112.0	96.0	101.0					12																	68549249		2203	4300	6503	SO:0001583	missense	3458				cell cycle arrest|interferon-gamma-mediated signaling pathway|negative regulation of interleukin-17 production|negative regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of metanephric nephron tubule epithelial cell differentiation|negative regulation of smooth muscle cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of calcidiol 1-monooxygenase activity|positive regulation of fructose 1,6-bisphosphate 1-phosphatase activity|positive regulation of fructose 1,6-bisphosphate metabolic process|positive regulation of interleukin-12 production|positive regulation of interleukin-23 production|positive regulation of killing of cells of other organism|positive regulation of membrane protein ectodomain proteolysis|positive regulation of mesenchymal cell proliferation|positive regulation of nitric oxide biosynthetic process|positive regulation of osteoclast differentiation|positive regulation of peptidyl-serine phosphorylation of STAT protein|positive regulation of smooth muscle cell apoptosis|positive regulation of tumor necrosis factor (ligand) superfamily member 11 production|positive regulation of tyrosine phosphorylation of Stat1 protein|positive regulation of vitamin D biosynthetic process|protein import into nucleus, translocation|regulation of insulin secretion|regulation of interferon-gamma-mediated signaling pathway|response to virus	extracellular space	cytokine activity|interferon-gamma receptor binding	g.chr12:68549249G>T		CCDS8980.1	12q14	2007-10-17			ENSG00000111537	ENSG00000111537		"""Interferons"""	5438	protein-coding gene	gene with protein product		147570					Standard	NM_000619		Approved		uc001stw.1	P01579	OTTHUMG00000169113	ENST00000229135.3:c.385C>A	12.37:g.68549249G>T	ENSP00000229135:p.Gln129Lys						p.Q129K	NM_000619	NP_000610	P01579	IFNG_HUMAN	Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000829)	4	511	-			129					B5BU88|Q53ZV4	Missense_Mutation	SNP	ENST00000229135.3	37	c.385C>A	CCDS8980.1	.	.	.	.	.	.	.	.	.	.	G	14.22	2.470232	0.43942	.	.	ENSG00000111537	ENST00000229135	T	0.66280	-0.2	4.82	4.82	0.62117	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.000000	0.85682	D	0.000000	T	0.80859	0.4704	M	0.86953	2.85	0.44719	D	0.997718	D	0.69078	0.997	D	0.83275	0.996	T	0.83233	-0.0062	9	.	.	.	-8.9565	14.1282	0.65235	0.0:0.0:1.0:0.0	.	129	P01579	IFNG_HUMAN	K	129	ENSP00000229135:Q129K	.	Q	-	1	0	IFNG	66835516	1.000000	0.71417	0.998000	0.56505	0.012000	0.07955	4.886000	0.63149	2.605000	0.88082	0.655000	0.94253	CAA		0.428	IFNG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402301.1			23	61	1	0	0.000375601	0.016522	0.000404856	23	61				
LGR5	8549	broad.mit.edu	37	12	71960644	71960644	+	Nonsense_Mutation	SNP	C	C	A	rs181911196		TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr12:71960644C>A	ENST00000266674.5	+	11	1333	c.1022C>A	c.(1021-1023)tCa>tAa	p.S341*	LGR5_ENST00000536515.1_Nonsense_Mutation_p.S269*|LGR5_ENST00000540815.2_Nonsense_Mutation_p.S317*			O75473	LGR5_HUMAN	leucine-rich repeat containing G protein-coupled receptor 5	341					G-protein coupled receptor signaling pathway (GO:0007186)|inner ear development (GO:0048839)|positive regulation of canonical Wnt signaling pathway (GO:0090263)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)	p.S341*(1)	NUP107/LGR5(2)	endometrium(2)|kidney(3)|large_intestine(2)|lung(24)|ovary(1)|pancreas(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	48						GCACAGATCTCATCTCTTCCT	0.398																																							uc001swl.2		NA																	1	Substitution - Nonsense(1)		lung(1)	lung(4)|skin(3)|ovary(1)|pancreas(1)	9						c.(1021-1023)TCA>TAA		leucine-rich repeat-containing G protein-coupled							216.0	198.0	204.0					12																	71960644		2203	4300	6503	SO:0001587	stop_gained	8549					integral to plasma membrane	protein-hormone receptor activity	g.chr12:71960644C>A	AF062006	CCDS9000.1, CCDS61194.1, CCDS61195.1	12q22-q23	2012-08-21	2011-01-25	2004-11-12				"""GPCR / Class A : Orphans"""	4504	protein-coding gene	gene with protein product		606667	"""G protein-coupled receptor 49"", ""leucine-rich repeat-containing G protein-coupled receptor 5"""	GPR67, GPR49		9642114	Standard	NM_003667		Approved	HG38, FEX	uc001swl.4	O75473	OTTHUMG00000169543	ENST00000266674.5:c.1022C>A	12.37:g.71960644C>A	ENSP00000266674:p.Ser341*					LGR5_uc001swm.2_Nonsense_Mutation_p.S317*|LGR5_uc001swn.1_RNA	p.S341*	NM_003667	NP_003658	O75473	LGR5_HUMAN			11	1070	+			341			Extracellular (Potential).|LRR 12.		D8MCT0|Q4VAM0|Q4VAM2|Q9UP75	Nonsense_Mutation	SNP	ENST00000266674.5	37	c.1022C>A	CCDS9000.1	.	.	.	.	.	.	.	.	.	.	C	37	6.351087	0.97498	.	.	ENSG00000139292	ENST00000266674;ENST00000451585;ENST00000536515;ENST00000540815	.	.	.	5.67	5.67	0.87782	.	0.099777	0.43747	D	0.000535	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.3485	0.60589	0.0:0.9277:0.0:0.0723	.	.	.	.	X	341;341;269;317	.	ENSP00000266674:S341X	S	+	2	0	LGR5	70246911	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.614000	0.61183	2.825000	0.97269	0.655000	0.94253	TCA		0.398	LGR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404744.1	NM_003667		32	72	1	0	3.93418e-24	0.019004	5.74069e-24	32	72				
TRHDE	29953	broad.mit.edu	37	12	73056896	73056896	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr12:73056896C>G	ENST00000261180.4	+	19	3092	c.2996C>G	c.(2995-2997)aCt>aGt	p.T999S		NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	999					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.T999S(1)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						GCTGTGGAAACTGTCGAAGCC	0.388																																							uc001sxa.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(2995-2997)ACT>AGT		thyrotropin-releasing hormone degrading enzyme							63.0	65.0	65.0					12																	73056896		2203	4300	6503	SO:0001583	missense	29953				cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding	g.chr12:73056896C>G	AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.2996C>G	12.37:g.73056896C>G	ENSP00000261180:p.Thr999Ser						p.T999S	NM_013381	NP_037513	Q9UKU6	TRHDE_HUMAN			19	3026	+			999			Extracellular (Potential).		A5PL19|Q6UWJ4	Missense_Mutation	SNP	ENST00000261180.4	37	c.2996C>G	CCDS9004.1	.	.	.	.	.	.	.	.	.	.	C	15.14	2.745529	0.49151	.	.	ENSG00000072657	ENST00000261180	T	0.05319	3.46	5.35	5.35	0.76521	.	0.051161	0.85682	D	0.000000	T	0.08670	0.0215	L	0.42245	1.32	0.45607	D	0.998547	B	0.22909	0.077	B	0.22601	0.04	T	0.29119	-1.0022	10	0.24483	T	0.36	.	19.4305	0.94762	0.0:1.0:0.0:0.0	.	999	Q9UKU6	TRHDE_HUMAN	S	999	ENSP00000261180:T999S	ENSP00000261180:T999S	T	+	2	0	TRHDE	71343163	1.000000	0.71417	0.958000	0.39756	0.990000	0.78478	4.914000	0.63348	2.673000	0.90976	0.557000	0.71058	ACT		0.388	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405380.1	NM_013381		4	31	0	0	0	0.014758	0	4	31				
OAS3	4940	broad.mit.edu	37	12	113382446	113382446	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr12:113382446G>T	ENST00000228928.7	+	3	805	c.626G>T	c.(625-627)tGg>tTg	p.W209L	OAS3_ENST00000548514.1_Missense_Mutation_p.W209L|OAS3_ENST00000546638.1_3'UTR|RP1-71H24.1_ENST00000552784.1_RNA	NM_006187.2	NP_006178.2	Q9Y6K5	OAS3_HUMAN	2'-5'-oligoadenylate synthetase 3, 100kDa	209	OAS domain 1.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of viral genome replication (GO:0045071)|nucleobase-containing compound metabolic process (GO:0006139)|regulation of ribonuclease activity (GO:0060700)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	2'-5'-oligoadenylate synthetase activity (GO:0001730)|ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)	p.W209L(1)		breast(3)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(8)|lung(6)|ovary(1)|skin(2)	27						GTGAAGCACTGGTACCACCAG	0.507																																							uc001tug.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(625-627)TGG>TTG		2'-5'oligoadenylate synthetase 3							52.0	55.0	54.0					12																	113382446		1986	4166	6152	SO:0001583	missense	4940				interferon-gamma-mediated signaling pathway|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|type I interferon-mediated signaling pathway	microsome	ATP binding|nucleotidyltransferase activity|RNA binding	g.chr12:113382446G>T	AF063613	CCDS44981.1	12q24.2	2008-05-02	2002-08-29			ENSG00000111331			8088	protein-coding gene	gene with protein product		603351	"""2'-5'-oligoadenylate synthetase 3 (100 kD)"""			9790745	Standard	NM_006187		Approved		uc001tug.3	Q9Y6K5	OTTHUMG00000169795	ENST00000228928.7:c.626G>T	12.37:g.113382446G>T	ENSP00000228928:p.Trp209Leu					OAS3_uc001tuf.2_Missense_Mutation_p.W209L	p.W209L	NM_006187	NP_006178	Q9Y6K5	OAS3_HUMAN			3	713	+			209			OAS domain 1.		Q2HJ14|Q9H3P5	Missense_Mutation	SNP	ENST00000228928.7	37	c.626G>T	CCDS44981.1	.	.	.	.	.	.	.	.	.	.	G	18.87	3.716165	0.68844	.	.	ENSG00000111331	ENST00000228928;ENST00000548514;ENST00000323881	T;T	0.79554	-1.28;-1.28	3.66	3.66	0.41972	-oligoadenylate synthetase 1, domain 2/C-terminal (2);-5&apos (2);2&apos (2);	.	.	.	.	D	0.89241	0.6659	M	0.86097	2.795	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.90289	0.4321	9	0.87932	D	0	.	11.045	0.47852	0.0:0.0:1.0:0.0	.	209;209	Q9Y6K5;F8VS35	OAS3_HUMAN;.	L	209	ENSP00000228928:W209L;ENSP00000448388:W209L	ENSP00000228928:W209L	W	+	2	0	OAS3	111866829	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.206000	0.65192	2.018000	0.59344	0.655000	0.94253	TGG		0.507	OAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405920.1			19	29	1	0	3.62473e-10	0.012319	4.30751e-10	19	29				
TMEM120B	144404	broad.mit.edu	37	12	122199586	122199586	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr12:122199586G>C	ENST00000449592.2	+	6	594	c.493G>C	c.(493-495)Gtg>Ctg	p.V165L	TMEM120B_ENST00000540377.1_5'UTR	NM_001080825.2	NP_001074294.2	A0PK00	T120B_HUMAN	transmembrane protein 120B	165						integral component of membrane (GO:0016021)		p.V165L(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(6)	11	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;5.75e-05)|Epithelial(86;0.000128)|BRCA - Breast invasive adenocarcinoma(302;0.238)		CTTCCTGCTGGTGTGGTATTA	0.587																																							uc001ubc.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(493-495)GTG>CTG		transmembrane protein 120B							105.0	101.0	102.0					12																	122199586		2050	4192	6242	SO:0001583	missense	144404					integral to membrane		g.chr12:122199586G>C	BC127768	CCDS41852.1	12q24.31	2007-08-01			ENSG00000188735	ENSG00000188735			32008	protein-coding gene	gene with protein product							Standard	NM_001080825		Approved		uc001ubc.4	A0PK00	OTTHUMG00000169076	ENST00000449592.2:c.493G>C	12.37:g.122199586G>C	ENSP00000404991:p.Val165Leu					TMEM120B_uc009zxh.2_Missense_Mutation_p.V165L	p.V165L	NM_001080825	NP_001074294	A0PK00	T120B_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;5.75e-05)|Epithelial(86;0.000128)|BRCA - Breast invasive adenocarcinoma(302;0.238)	6	637	+	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)		165			Helical; (Potential).		A0PK01|B3KX33	Missense_Mutation	SNP	ENST00000449592.2	37	c.493G>C	CCDS41852.1	.	.	.	.	.	.	.	.	.	.	G	34	5.398376	0.96030	.	.	ENSG00000188735	ENST00000449592;ENST00000541467	T;T	0.35048	1.33;1.33	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.48677	0.1513	L	0.58669	1.825	0.80722	D	1	P	0.41929	0.765	P	0.52957	0.714	T	0.19614	-1.0300	10	0.14252	T	0.57	-24.1111	17.1968	0.86894	0.0:0.0:1.0:0.0	.	165	A0PK00	T120B_HUMAN	L	165;144	ENSP00000404991:V165L;ENSP00000442105:V144L	ENSP00000345152:V165L	V	+	1	0	TMEM120B	120683969	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.463000	0.97652	2.655000	0.90218	0.650000	0.86243	GTG		0.587	TMEM120B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402158.1	NM_001080825		3	159	0	0	0	0.014758	0	3	159				
WDR66	144406	broad.mit.edu	37	12	122369737	122369737	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr12:122369737G>T	ENST00000288912.4	+	4	1687	c.833G>T	c.(832-834)tGt>tTt	p.C278F	WDR66_ENST00000397454.2_Missense_Mutation_p.C278F	NM_144668.5	NP_653269.3	Q8TBY9	WDR66_HUMAN	WD repeat domain 66	278							calcium ion binding (GO:0005509)	p.C278F(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(13)|ovary(2)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)		CTGTATGTTTGTGCTCACACT	0.463																																					Esophageal Squamous(85;849 1794 49757 52143)	Esophageal Squamous(85;849 1794 49757 52143)	uc009zxk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(832-834)TGT>TTT		WD repeat domain 66							166.0	152.0	157.0					12																	122369737		1989	4169	6158	SO:0001583	missense	144406						calcium ion binding	g.chr12:122369737G>T	AL833930	CCDS41853.1, CCDS53840.1	12q24.31	2014-07-31			ENSG00000158023	ENSG00000158023		"""WD repeat domain containing"""	28506	protein-coding gene	gene with protein product						17967944	Standard	NM_001178003		Approved	MGC33630, CaM-IP4	uc009zxk.3	Q8TBY9	OTTHUMG00000168948	ENST00000288912.4:c.833G>T	12.37:g.122369737G>T	ENSP00000288912:p.Cys278Phe						p.C278F	NM_144668	NP_653269	Q8TBY9	WDR66_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)	4	975	+	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)		278					C9J1W2|Q8IYA3|Q8N898|Q8NDE7	Missense_Mutation	SNP	ENST00000288912.4	37	c.833G>T	CCDS41853.1	.	.	.	.	.	.	.	.	.	.	G	14.78	2.636403	0.47049	.	.	ENSG00000158023	ENST00000288912;ENST00000397454	T;T	0.39056	1.1;3.48	4.72	3.83	0.44106	WD40/YVTN repeat-like-containing domain (1);	0.389651	0.27640	N	0.018468	T	0.38983	0.1061	M	0.66939	2.045	0.09310	N	1	P	0.40909	0.732	B	0.37731	0.257	T	0.38887	-0.9640	10	0.66056	D	0.02	.	8.355	0.32324	0.0889:0.1569:0.7542:0.0	.	278	Q8TBY9	WDR66_HUMAN	F	278	ENSP00000288912:C278F;ENSP00000380595:C278F	ENSP00000288912:C278F	C	+	2	0	WDR66	120854120	0.019000	0.18553	0.001000	0.08648	0.811000	0.45836	1.094000	0.30951	0.971000	0.38288	0.491000	0.48974	TGT		0.463	WDR66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401700.1	NM_144668		97	120	1	0	4.31119e-35	0.01441	6.79963e-35	97	120				
TMEM132D	121256	broad.mit.edu	37	12	130184930	130184930	+	Silent	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr12:130184930G>T	ENST00000422113.2	-	2	719	c.393C>A	c.(391-393)gcC>gcA	p.A131A	RP11-174M13.2_ENST00000544036.1_lincRNA	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	131					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)		p.A131A(1)		NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		GCAGGATGTGGGCTTTTAGTT	0.532																																							uc009zyl.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14						c.(391-393)GCC>GCA		transmembrane protein 132D precursor							50.0	50.0	50.0					12																	130184930		2203	4300	6503	SO:0001819	synonymous_variant	121256					integral to membrane		g.chr12:130184930G>T	AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.393C>A	12.37:g.130184930G>T							p.A131A	NM_133448	NP_597705	Q14C87	T132D_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)	2	721	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)	131			Extracellular (Potential).		Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Silent	SNP	ENST00000422113.2	37	c.393C>A	CCDS9266.1																																																																																				0.532	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	NM_133448		29	64	1	0	2.90539e-05	0.008361	3.21241e-05	29	64				
PSPC1	55269	broad.mit.edu	37	13	20346557	20346557	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr13:20346557C>T	ENST00000338910.4	-	2	658	c.499G>A	c.(499-501)Gtt>Att	p.V167I		NM_001042414.2	NP_001035879.1	Q8WXF1	PSPC1_HUMAN	paraspeckle component 1	167	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.|Sufficient for paraspeckles localization.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of circadian rhythm (GO:0042752)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	core promoter binding (GO:0001047)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.V167I(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23		all_cancers(29;1.25e-22)|all_lung(29;1.97e-20)|all_epithelial(30;2.29e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;4.63e-06)|Epithelial(112;2.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00256)|Lung(94;0.00975)|LUSC - Lung squamous cell carcinoma(192;0.0483)		TCATTGGAAACAACTGGAGAA	0.483																																							uc001uml.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(499-501)GTT>ATT		paraspeckle protein 1							113.0	110.0	111.0					13																	20346557		1939	4149	6088	SO:0001583	missense	55269				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nuclear matrix|nucleolus	nucleotide binding|protein binding|RNA binding	g.chr13:20346557C>T	AK001817	CCDS41870.1	13q11	2013-02-12			ENSG00000121390	ENSG00000121390		"""RNA binding motif (RRM) containing"""	20320	protein-coding gene	gene with protein product		612408				11790299	Standard	NM_001042414		Approved	PSP1, FLJ10955	uc021rgx.1	Q8WXF1	OTTHUMG00000016502	ENST00000338910.4:c.499G>A	13.37:g.20346557C>T	ENSP00000343966:p.Val167Ile					PSPC1_uc001umj.1_RNA|PSPC1_uc001umk.1_RNA	p.V167I	NM_001042414	NP_001035879	Q8WXF1	PSPC1_HUMAN		all cancers(112;4.63e-06)|Epithelial(112;2.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00256)|Lung(94;0.00975)|LUSC - Lung squamous cell carcinoma(192;0.0483)	2	685	-		all_cancers(29;1.25e-22)|all_lung(29;1.97e-20)|all_epithelial(30;2.29e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)	167			RRM 2.|Sufficient for paraspeckles localization.		Q5JTQ3|Q8NCZ9|Q8WXE8|Q9NV36	Missense_Mutation	SNP	ENST00000338910.4	37	c.499G>A	CCDS41870.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.593963	0.86953	.	.	ENSG00000121390	ENST00000338910;ENST00000422828;ENST00000427943	T;T	0.16897	2.31;2.31	5.74	5.74	0.90152	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.27731	0.0682	L	0.49778	1.585	0.80722	D	1	P	0.39157	0.662	P	0.49252	0.604	T	0.01252	-1.1405	10	0.09338	T	0.73	-17.6921	19.918	0.97070	0.0:1.0:0.0:0.0	.	167	Q8WXF1	PSPC1_HUMAN	I	167;107;167	ENSP00000343966:V167I;ENSP00000393069:V167I	ENSP00000343966:V167I	V	-	1	0	PSPC1	19244557	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.064000	0.71169	2.716000	0.92895	0.561000	0.74099	GTT		0.483	PSPC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044037.2			69	90	0	0	0	0.01441	0	69	90				
RPL21	6144	broad.mit.edu	37	13	27830439	27830439	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr13:27830439G>T	ENST00000311549.6	+	5	650	c.361G>T	c.(361-363)Gag>Tag	p.E121*	RPL21_ENST00000272274.4_Nonsense_Mutation_p.E121*|RPL21_ENST00000326092.4_Nonsense_Mutation_p.E121*|SNORD102_ENST00000384769.1_RNA|SNORA27_ENST00000384323.1_RNA|RPL21_ENST00000319826.4_Nonsense_Mutation_p.E121*	NM_000982.3	NP_000973.2	P46778	RL21_HUMAN	ribosomal protein L21	121					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)	p.E121*(1)		large_intestine(1)|lung(1)	2		Lung SC(185;0.0156)	Colorectal(13;0.00042)|READ - Rectum adenocarcinoma(15;0.105)	all cancers(112;0.0287)|OV - Ovarian serous cystadenocarcinoma(117;0.118)|Epithelial(112;0.139)|GBM - Glioblastoma multiforme(144;0.21)		AGAAGCCAAAGAGAAAGGTAC	0.388																																							uc001ura.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(361-363)GAG>TAG		ribosomal protein L21							44.0	50.0	48.0					13																	27830439		2203	4300	6503	SO:0001587	stop_gained	6144				endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	RNA binding|structural constituent of ribosome	g.chr13:27830439G>T	AB007176	CCDS9320.1	13q12.2	2008-07-18			ENSG00000122026	ENSG00000122026		"""L ribosomal proteins"""	10313	protein-coding gene	gene with protein product	"""60S ribosomal protein L21"""	603636				3459254, 7772601	Standard	NM_000982		Approved	L21, FLJ27458, MGC71252, MGC104274, MGC104275, DKFZp686C06101	uc001ura.3	P46778	OTTHUMG00000016630	ENST00000311549.6:c.361G>T	13.37:g.27830439G>T	ENSP00000346027:p.Glu121*					RPL21_uc001uqz.1_Nonsense_Mutation_p.E79*	p.E121*	NM_000982	NP_000973	P46778	RL21_HUMAN	Colorectal(13;0.00042)|READ - Rectum adenocarcinoma(15;0.105)	all cancers(112;0.0287)|OV - Ovarian serous cystadenocarcinoma(117;0.118)|Epithelial(112;0.139)|GBM - Glioblastoma multiforme(144;0.21)	5	404	+		Lung SC(185;0.0156)	121					Q16699	Nonsense_Mutation	SNP	ENST00000311549.6	37	c.361G>T	CCDS9320.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.970077	0.74246	.	.	ENSG00000122026	ENST00000311549;ENST00000272274;ENST00000319826;ENST00000326092	.	.	.	4.83	3.92	0.45320	.	0.425937	0.24720	U	0.036146	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	.	14.801	0.69916	0.0:0.1446:0.8554:0.0	.	.	.	.	X	121	.	ENSP00000351021:E121X	E	+	1	0	RPL21	26728439	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.219000	0.51200	2.393000	0.81446	0.561000	0.74099	GAG		0.388	RPL21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044270.1	NM_000982		14	18	1	0	1.56452e-12	0.007413	1.99163e-12	14	18				
POSTN	10631	broad.mit.edu	37	13	38138664	38138664	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr13:38138664T>A	ENST00000379747.4	-	22	2582	c.2465A>T	c.(2464-2466)aAa>aTa	p.K822I	POSTN_ENST00000379742.4_Missense_Mutation_p.K765I|POSTN_ENST00000541179.1_Missense_Mutation_p.K767I|POSTN_ENST00000379743.4_Missense_Mutation_p.K795I|POSTN_ENST00000541481.1_Missense_Mutation_p.K735I|POSTN_ENST00000379749.4_Missense_Mutation_p.K794I	NM_006475.2	NP_006466.2	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor	822					cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of Notch signaling pathway (GO:0008593)|skeletal system development (GO:0001501)|tissue development (GO:0009888)	proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network (GO:0005802)	heparin binding (GO:0008201)	p.K822I(1)		cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(16)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	59		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		ACCTTGAACTTTTTTGTTGGC	0.333																																							uc001uwo.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(2464-2466)AAA>ATA		periostin, osteoblast specific factor isoform 1							173.0	157.0	162.0					13																	38138664		2203	4300	6503	SO:0001583	missense	10631				cell adhesion|skeletal system development	proteinaceous extracellular matrix	heparin binding	g.chr13:38138664T>A	D13665	CCDS9364.1, CCDS45034.1, CCDS53864.1, CCDS66530.1, CCDS66531.1	13q13.3	2008-02-05			ENSG00000133110	ENSG00000133110			16953	protein-coding gene	gene with protein product		608777				8363580, 12235007	Standard	NM_006475		Approved	OSF-2, PN, periostin	uc001uwo.4	Q15063	OTTHUMG00000016751	ENST00000379747.4:c.2465A>T	13.37:g.38138664T>A	ENSP00000369071:p.Lys822Ile					POSTN_uc010tet.1_Missense_Mutation_p.K323I|POSTN_uc001uwp.3_Missense_Mutation_p.K765I|POSTN_uc001uwr.2_Missense_Mutation_p.K767I|POSTN_uc001uwq.2_Missense_Mutation_p.K737I|POSTN_uc010teu.1_Missense_Mutation_p.K795I|POSTN_uc010tev.1_Missense_Mutation_p.K735I|POSTN_uc010tew.1_Missense_Mutation_p.K707I	p.K822I	NM_006475	NP_006466	Q15063	POSTN_HUMAN		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)	22	2583	-		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)	822					B1ALD8|C0IMJ1|C0IMJ2|C0IMJ4|D2KRH7|F5H628|Q15064|Q29XZ0|Q3KPJ5|Q5VSY5|Q8IZF9	Missense_Mutation	SNP	ENST00000379747.4	37	c.2465A>T	CCDS9364.1	.	.	.	.	.	.	.	.	.	.	T	9.888	1.203494	0.22121	.	.	ENSG00000133110	ENST00000541179;ENST00000379749;ENST00000379747;ENST00000379743;ENST00000379742;ENST00000541481	D;D;D;D;D;D	0.91631	-2.88;-2.87;-2.84;-2.87;-2.87;-2.87	5.32	2.65	0.31530	.	0.112232	0.64402	D	0.000016	D	0.84160	0.5411	N	0.08118	0	0.22213	N	0.999286	B;P;P;P;B;P;P	0.46706	0.145;0.883;0.712;0.883;0.031;0.883;0.574	B;B;B;B;B;B;B	0.43018	0.058;0.405;0.229;0.405;0.024;0.405;0.229	T	0.78097	-0.2337	10	0.87932	D	0	.	13.6778	0.62465	0.0:0.8542:0.0:0.1458	.	707;735;795;767;737;765;822	C0IMJ4;F5H628;B1ALD8;Q15063-3;Q15063-4;Q15063-2;Q15063	.;.;.;.;.;.;POSTN_HUMAN	I	767;794;822;795;765;735	ENSP00000437959:K767I;ENSP00000369073:K794I;ENSP00000369071:K822I;ENSP00000369067:K795I;ENSP00000369066:K765I;ENSP00000437953:K735I	ENSP00000369066:K765I	K	-	2	0	POSTN	37036664	0.960000	0.32886	0.958000	0.39756	0.018000	0.09664	0.678000	0.25277	0.330000	0.23485	-1.280000	0.01385	AAA		0.333	POSTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044566.2	NM_006475		17	27	0	0	0	0.007413	0	17	27				
SUGT1	10910	broad.mit.edu	37	13	53241004	53241004	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr13:53241004C>T	ENST00000343788.6	+	11	755	c.673C>T	c.(673-675)Ctt>Ttt	p.L225F	SUGT1_ENST00000535397.1_Missense_Mutation_p.L137F|SUGT1_ENST00000310528.8_Missense_Mutation_p.L193F	NM_001130912.1	NP_001124384.1	Q9Y2Z0	SUGT1_HUMAN	SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae)	225	CS. {ECO:0000255|PROSITE- ProRule:PRU00547}.				innate immune response (GO:0045087)|mitotic nuclear division (GO:0007067)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)		p.L193F(1)|p.L225F(1)		kidney(3)|large_intestine(3)|lung(2)	8		Lung NSC(96;0.00212)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.25e-08)		ACTGGAACTTCTTCATCCTAT	0.299																																							uc001vhc.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(673-675)CTT>TTT		suppressor of G2 allele of SKP1 isoform a							91.0	89.0	90.0					13																	53241004		2203	4293	6496	SO:0001583	missense	10910				mitosis	kinetochore|ubiquitin ligase complex	binding	g.chr13:53241004C>T	AF068289	CCDS9436.1, CCDS45050.1	13q14.3	2014-03-20			ENSG00000165416	ENSG00000165416			16987	protein-coding gene	gene with protein product		604098				10445024	Standard	NM_006704		Approved	SGT1	uc001vhc.2	Q9Y2Z0	OTTHUMG00000016977	ENST00000343788.6:c.673C>T	13.37:g.53241004C>T	ENSP00000367208:p.Leu225Phe					SUGT1_uc001vha.2_RNA|SUGT1_uc001vhb.2_Missense_Mutation_p.L193F|SUGT1_uc010thb.1_Missense_Mutation_p.L137F|SUGT1_uc001vhd.2_Missense_Mutation_p.L82F	p.L225F	NM_001130912	NP_001124384	Q9Y2Z0	SUGT1_HUMAN		GBM - Glioblastoma multiforme(99;3.25e-08)	11	898	+		Lung NSC(96;0.00212)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)	225			CS.		A2A303|Q5JAK5|Q5TAM6|Q6VXY6	Missense_Mutation	SNP	ENST00000343788.6	37	c.673C>T	CCDS45050.1	.	.	.	.	.	.	.	.	.	.	C	1.378	-0.584277	0.03827	.	.	ENSG00000165416	ENST00000343788;ENST00000535397;ENST00000310528	T;T;T	0.12879	2.64;2.64;2.64	6.07	2.36	0.29203	CS-like domain (1);CS domain (1);HSP20-like chaperone (1);	0.057977	0.64402	N	0.000001	T	0.07098	0.0180	N	0.17594	0.5	0.80722	D	1	B;B;B;B	0.21071	0.002;0.013;0.051;0.011	B;B;B;B	0.32022	0.003;0.073;0.139;0.015	T	0.26018	-1.0115	10	0.02654	T	1	-3.5155	6.9066	0.24313	0.1234:0.6741:0.0:0.2025	.	137;137;225;193	F5H5A9;B4DYC6;Q9Y2Z0;Q9Y2Z0-2	.;.;SUGT1_HUMAN;.	F	225;137;193	ENSP00000367208:L225F;ENSP00000443521:L137F;ENSP00000308067:L193F	ENSP00000308067:L193F	L	+	1	0	SUGT1	52139005	1.000000	0.71417	0.960000	0.40013	0.202000	0.24057	3.538000	0.53597	0.465000	0.27167	-0.136000	0.14681	CTT		0.299	SUGT1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045104.2			19	32	0	0	0	0.004656	0	19	32				
PCDH9	5101	broad.mit.edu	37	13	67802047	67802047	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr13:67802047C>A	ENST00000377865.2	-	1	660	c.526G>T	c.(526-528)Gta>Tta	p.V176L	PCDH9_ENST00000544246.1_Missense_Mutation_p.V176L|PCDH9_ENST00000328454.5_Missense_Mutation_p.V176L|PCDH9_ENST00000377861.3_Missense_Mutation_p.V176L|PCDH9_ENST00000456367.1_Missense_Mutation_p.V176L			Q9HC56	PCDH9_HUMAN	protocadherin 9	176	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V176L(1)		breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		TAATGCTGTACACCATTGAAG	0.428																																							uc001vik.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|pancreas(1)|skin(1)	6						c.(526-528)GTA>TTA		protocadherin 9 isoform 1 precursor							119.0	120.0	120.0					13																	67802047		2203	4300	6503	SO:0001583	missense	5101				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr13:67802047C>A	AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.526G>T	13.37:g.67802047C>A	ENSP00000367096:p.Val176Leu					PCDH9_uc001vil.2_Missense_Mutation_p.V176L|PCDH9_uc010thl.1_Missense_Mutation_p.V176L|PCDH9_uc001vin.3_Missense_Mutation_p.V176L	p.V176L	NM_203487	NP_982354	Q9HC56	PCDH9_HUMAN		GBM - Glioblastoma multiforme(99;0.00819)	2	1218	-		Hepatocellular(98;0.0906)|Breast(118;0.107)	176			Extracellular (Potential).|Cadherin 2.		A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Missense_Mutation	SNP	ENST00000377865.2	37	c.526G>T	CCDS9444.1	.	.	.	.	.	.	.	.	.	.	C	18.56	3.649429	0.67358	.	.	ENSG00000184226	ENST00000544246;ENST00000377865;ENST00000456367;ENST00000328454;ENST00000377861	T;T;T;T;T	0.51574	0.7;0.7;0.7;0.7;0.7	6.17	6.17	0.99709	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.38295	0.1035	N	0.04705	-0.18	0.80722	D	1	P;P;P;P	0.42456	0.605;0.78;0.739;0.78	B;P;B;P	0.46917	0.31;0.531;0.396;0.531	T	0.17289	-1.0374	10	0.19590	T	0.45	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	176;176;176;176	B7ZM79;Q5VT82;Q9HC56-2;Q9HC56	.;.;.;PCDH9_HUMAN	L	176	ENSP00000442186:V176L;ENSP00000367096:V176L;ENSP00000401699:V176L;ENSP00000332060:V176L;ENSP00000367092:V176L	ENSP00000332060:V176L	V	-	1	0	PCDH9	66700048	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	GTA		0.428	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276387.1	NM_203487		84	121	1	0	7.83748e-43	0.01441	1.27843e-42	84	121				
SLAIN1	122060	broad.mit.edu	37	13	78327435	78327435	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr13:78327435G>T	ENST00000466548.1	+	6	1316	c.1290G>T	c.(1288-1290)caG>caT	p.Q430H	SLAIN1_ENST00000358679.3_Missense_Mutation_p.Q167H|SLAIN1_ENST00000267219.8_Missense_Mutation_p.Q211H|SLAIN1_ENST00000488699.1_Missense_Mutation_p.Q288H|SLAIN1_ENST00000314070.5_Missense_Mutation_p.Q53H|SLAIN1_ENST00000351546.3_Missense_Mutation_p.Q167H|SLAIN1_ENST00000418532.1_Missense_Mutation_p.Q211H	NM_001242868.1	NP_001229797.1	Q8ND83	SLAI1_HUMAN	SLAIN motif family, member 1	430								p.Q211H(1)		breast(1)|endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0853)		GAAATAGTCAGAGTTTTGACT	0.378																																							uc010thy.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(862-864)CAG>CAT		SLAIN motif family, member 1 B							76.0	73.0	74.0					13																	78327435		2203	4300	6503	SO:0001583	missense	122060							g.chr13:78327435G>T	AK054608	CCDS9460.1, CCDS31995.1, CCDS31995.2, CCDS55901.1, CCDS73588.1, CCDS73589.1	13q22.3	2006-09-12	2006-09-12	2006-09-12	ENSG00000139737	ENSG00000139737			26387	protein-coding gene	gene with protein product		610491	"""chromosome 13 open reading frame 32"""	C13orf32		16546155	Standard	NM_001040153		Approved	FLJ30046	uc001vkk.3	Q8ND83	OTTHUMG00000017110	ENST00000466548.1:c.1290G>T	13.37:g.78327435G>T	ENSP00000419730:p.Gln430His					SLAIN1_uc001vkk.1_Missense_Mutation_p.Q211H|SLAIN1_uc001vkl.1_Missense_Mutation_p.Q167H|SLAIN1_uc010thz.1_Missense_Mutation_p.Q166H|SLAIN1_uc010aex.1_Missense_Mutation_p.Q53H|SLAIN1_uc010aey.1_Missense_Mutation_p.Q53H|SLAIN1_uc001vkm.2_Missense_Mutation_p.Q167H	p.Q288H	NM_144595	NP_653196	Q8ND83	SLAI1_HUMAN		GBM - Glioblastoma multiforme(99;0.0853)	5	907	+		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)	430					A8K0Z9|B7Z209|Q5T6P4|Q5T6P7|Q8ND10|Q96NV0	Missense_Mutation	SNP	ENST00000466548.1	37	c.864G>T		.	.	.	.	.	.	.	.	.	.	G	18.73	3.685926	0.68157	.	.	ENSG00000139737	ENST00000466548;ENST00000389459;ENST00000418532;ENST00000488699;ENST00000267219;ENST00000351546;ENST00000441784;ENST00000314070;ENST00000358679	.	.	.	5.55	4.65	0.58169	.	0.119911	0.64402	D	0.000009	T	0.74966	0.3786	M	0.72894	2.215	0.45139	D	0.998154	D;D;D;D	0.76494	0.999;0.986;0.999;0.987	D;P;D;P	0.68039	0.939;0.742;0.955;0.875	T	0.77115	-0.2707	9	0.72032	D	0.01	-14.753	11.6811	0.51458	0.0:0.1329:0.7295:0.1376	.	166;288;53;430	B7Z326;B7Z209;Q8ND10;Q8ND83	.;.;.;SLAI1_HUMAN	H	430;430;211;288;211;167;167;53;167	.	ENSP00000267219:Q211H	Q	+	3	2	SLAIN1	77225436	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.544000	0.45761	2.616000	0.88540	0.585000	0.79938	CAG		0.378	SLAIN1-009	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000355018.1	NM_144595		14	35	1	0	0.006122	0.006122	0.00639012	14	35				
OR6S1	341799	broad.mit.edu	37	14	21109399	21109399	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr14:21109399C>A	ENST00000320704.3	-	1	451	c.452G>T	c.(451-453)tGg>tTg	p.W151L		NM_001001968.1	NP_001001968.1	Q8NH40	OR6S1_HUMAN	olfactory receptor, family 6, subfamily S, member 1	151						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.W151L(1)		kidney(1)|large_intestine(3)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23	all_cancers(95;0.00304)		Epithelial(56;1.23e-06)|all cancers(55;1.01e-05)	GBM - Glioblastoma multiforme(265;0.0135)		TCCCCCCACCCAGCAGGCCAA	0.597																																							uc001vxv.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(451-453)TGG>TTG		olfactory receptor, family 6, subfamily S,							84.0	68.0	73.0					14																	21109399		2203	4300	6503	SO:0001583	missense	341799				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:21109399C>A	AL163636	CCDS32038.1	14q11.2	2013-09-24			ENSG00000181803	ENSG00000181803		"""GPCR / Class A : Olfactory receptors"""	15363	protein-coding gene	gene with protein product							Standard	NM_001001968		Approved	OR6S1Q	uc001vxv.1	Q8NH40	OTTHUMG00000171010	ENST00000320704.3:c.452G>T	14.37:g.21109399C>A	ENSP00000313110:p.Trp151Leu						p.W151L	NM_001001968	NP_001001968	Q8NH40	OR6S1_HUMAN	Epithelial(56;1.23e-06)|all cancers(55;1.01e-05)	GBM - Glioblastoma multiforme(265;0.0135)	1	452	-	all_cancers(95;0.00304)		151			Helical; Name=4; (Potential).		Q6IFJ9	Missense_Mutation	SNP	ENST00000320704.3	37	c.452G>T	CCDS32038.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.428154	0.83667	.	.	ENSG00000181803	ENST00000320704	T	0.58210	0.35	5.23	5.23	0.72850	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46145	D	0.000301	T	0.70298	0.3208	M	0.63428	1.95	0.46499	D	0.99907	D	0.89917	1.0	D	0.83275	0.996	T	0.72475	-0.4282	10	0.87932	D	0	-7.3316	16.352	0.83215	0.0:1.0:0.0:0.0	.	151	Q8NH40	OR6S1_HUMAN	L	151	ENSP00000313110:W151L	ENSP00000313110:W151L	W	-	2	0	OR6S1	20179239	0.274000	0.24191	1.000000	0.80357	0.918000	0.54935	0.551000	0.23361	2.716000	0.92895	0.655000	0.94253	TGG		0.597	OR6S1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411227.1			16	34	1	0	5.03518e-11	0.007413	6.10196e-11	16	34				
FBXO33	254170	broad.mit.edu	37	14	39870751	39870751	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr14:39870751T>A	ENST00000298097.7	-	3	1362	c.1025A>T	c.(1024-1026)cAc>cTc	p.H342L	FBXO33_ENST00000554190.1_Intron	NM_203301.3	NP_976046.1	Q7Z6M2	FBX33_HUMAN	F-box protein 33	342					protein ubiquitination (GO:0016567)			p.H342L(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(4)|urinary_tract(1)	9	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00121)|Epithelial(34;0.169)	GBM - Glioblastoma multiforme(112;0.0425)		AGAAACATTGTGAACCAGAAG	0.443																																							uc001wvk.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1024-1026)CAC>CTC		F-box protein 33							146.0	129.0	135.0					14																	39870751		2203	4300	6503	SO:0001583	missense	254170							g.chr14:39870751T>A	BI460761	CCDS9677.1	14q13.3	2004-08-24	2004-06-15		ENSG00000165355	ENSG00000165355		"""F-boxes /  ""other"""""	19833	protein-coding gene	gene with protein product		609103	"""F-box only protein 33"""				Standard	NM_203301		Approved	Fbx33	uc001wvk.3	Q7Z6M2	OTTHUMG00000140257	ENST00000298097.7:c.1025A>T	14.37:g.39870751T>A	ENSP00000298097:p.His342Leu						p.H342L	NM_203301	NP_976046	Q7Z6M2	FBX33_HUMAN	LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00121)|Epithelial(34;0.169)	GBM - Glioblastoma multiforme(112;0.0425)	3	1363	-	Hepatocellular(127;0.213)		342					Q6PIR2|Q86TR2|Q86YE0	Missense_Mutation	SNP	ENST00000298097.7	37	c.1025A>T	CCDS9677.1	.	.	.	.	.	.	.	.	.	.	T	18.25	3.581652	0.65992	.	.	ENSG00000165355	ENST00000298097	T	0.00864	5.6	5.87	4.71	0.59529	.	0.045405	0.85682	D	0.000000	T	0.01287	0.0042	L	0.48642	1.525	0.80722	D	1	B	0.12630	0.006	B	0.08055	0.003	T	0.59343	-0.7472	9	.	.	.	-2.9841	12.4532	0.55688	0.1256:0.0:0.0:0.8744	.	342	Q7Z6M2	FBX33_HUMAN	L	342	ENSP00000298097:H342L	.	H	-	2	0	FBXO33	38940502	1.000000	0.71417	1.000000	0.80357	0.795000	0.44927	5.803000	0.69129	1.029000	0.39812	0.482000	0.46254	CAC		0.443	FBXO33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276769.2			82	103	0	0	0	0.01441	0	82	103				
MDGA2	161357	broad.mit.edu	37	14	47426714	47426714	+	Nonsense_Mutation	SNP	A	A	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr14:47426714A>T	ENST00000399232.2	-	9	2109	c.1745T>A	c.(1744-1746)tTa>tAa	p.L582*	MDGA2_ENST00000426342.1_Nonsense_Mutation_p.L353*|SNORA25_ENST00000515926.1_RNA|MDGA2_ENST00000357362.3_Nonsense_Mutation_p.L353*|MDGA2_ENST00000439988.3_Nonsense_Mutation_p.L651*	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	582	Ig-like 6.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.L353*(2)|p.L651*(1)		breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						CGTCCGTAATAATTTATTGCC	0.443																																							uc001wwj.3		NA																	3	Substitution - Nonsense(3)		lung(3)	ovary(4)|large_intestine(1)|pancreas(1)	6						c.(1744-1746)TTA>TAA		MAM domain containing 1 isoform 1							96.0	96.0	96.0					14																	47426714		1945	4147	6092	SO:0001587	stop_gained	161357				spinal cord motor neuron differentiation	anchored to membrane|plasma membrane		g.chr14:47426714A>T	AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.1745T>A	14.37:g.47426714A>T	ENSP00000382178:p.Leu582*					MDGA2_uc001wwi.3_Nonsense_Mutation_p.L353*|MDGA2_uc010ani.2_Nonsense_Mutation_p.L142*	p.L582*	NM_001113498	NP_001106970	Q7Z553	MDGA2_HUMAN			9	1941	-			582			Ig-like 6.		F6W3S7|J3KPX6	Nonsense_Mutation	SNP	ENST00000399232.2	37	c.1745T>A		.	.	.	.	.	.	.	.	.	.	A	44	11.063933	0.99511	.	.	ENSG00000139915	ENST00000439988;ENST00000426342;ENST00000399232;ENST00000357362	.	.	.	5.54	5.54	0.83059	.	0.000000	0.40385	U	0.001110	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.5004	0.67716	1.0:0.0:0.0:0.0	.	.	.	.	X	582;353;651;353	.	ENSP00000349925:L353X	L	-	2	0	MDGA2	46496464	1.000000	0.71417	0.990000	0.47175	0.995000	0.86356	8.589000	0.90817	2.106000	0.64143	0.528000	0.53228	TTA		0.443	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000073352.5	NM_182830		13	52	0	0	0	0.013537	0	13	52				
RPS29	6235	broad.mit.edu	37	14	50053060	50053060	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr14:50053060C>T	ENST00000245458.6	-	1	34	c.5G>A	c.(4-6)gGt>gAt	p.G2D	RN7SL1_ENST00000553637.1_RNA|RPS29_ENST00000396020.3_Missense_Mutation_p.G2D|RPS29_ENST00000557111.1_Intron	NM_001032.3	NP_001023.1	P62273	RS29_HUMAN	ribosomal protein S29	2					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|small ribosomal subunit (GO:0015935)	structural constituent of ribosome (GO:0003735)|zinc ion binding (GO:0008270)	p.G2D(2)		endometrium(1)|kidney(1)|lung(1)|ovary(1)	4	all_epithelial(31;0.00214)|Breast(41;0.0124)					CTGCTGGTGACCCATCTTGCT	0.522																																							uc001wwm.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(4-6)GGT>GAT		ribosomal protein S29 isoform 1							50.0	55.0	53.0					14																	50053060		2203	4300	6503	SO:0001583	missense	6235				endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit	protein binding|structural constituent of ribosome|zinc ion binding	g.chr14:50053060C>T	L31610	CCDS9685.1, CCDS32072.1	14q21.3	2011-04-06			ENSG00000213741	ENSG00000213741		"""S ribosomal proteins"""	10419	protein-coding gene	gene with protein product		603633				8781548, 7772601	Standard	NM_001032		Approved	S29	uc001wwl.4	P62273	OTTHUMG00000140272	ENST00000245458.6:c.5G>A	14.37:g.50053060C>T	ENSP00000245458:p.Gly2Asp					SDCCAG1_uc010anj.1_Intron|RPS29_uc001wwl.2_Missense_Mutation_p.G2D	p.G2D	NM_001032	NP_001023	P62273	RS29_HUMAN			1	35	-	all_epithelial(31;0.00214)|Breast(41;0.0124)		2					A8MZ73|P30054	Missense_Mutation	SNP	ENST00000245458.6	37	c.5G>A	CCDS9685.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.619411	0.87460	.	.	ENSG00000213741	ENST00000396020;ENST00000245458	.	.	.	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.68769	0.3037	.	.	.	0.80722	D	1	P;P	0.45594	0.862;0.783	B;P	0.47786	0.417;0.557	T	0.71527	-0.4566	8	0.62326	D	0.03	-9.9505	17.9357	0.89011	0.0:1.0:0.0:0.0	.	2;2	P62273;A8MZ73	RS29_HUMAN;.	D	2	.	ENSP00000245458:G2D	G	-	2	0	RPS29	49122810	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	7.089000	0.76909	2.816000	0.96949	0.563000	0.77884	GGT		0.522	RPS29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276809.1	NM_001030001		61	65	0	0	0	0.01441	0	61	65				
NID2	22795	broad.mit.edu	37	14	52534674	52534674	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr14:52534674G>A	ENST00000216286.5	-	2	435	c.436C>T	c.(436-438)Cgc>Tgc	p.R146C	NID2_ENST00000541773.1_Missense_Mutation_p.R93C	NM_007361.3	NP_031387.3	Q14112	NID2_HUMAN	nidogen 2 (osteonidogen)	146	NIDO. {ECO:0000255|PROSITE- ProRule:PRU00570}.				basement membrane organization (GO:0071711)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)	p.R146C(1)		NS(1)|breast(5)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(40)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	87	Breast(41;0.0639)|all_epithelial(31;0.123)					CGCGCAGAGCGCGGGAAGCCA	0.706																																							uc001wzo.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(2)|breast(2)|ovary(1)|liver(1)|skin(1)	7						c.(436-438)CGC>TGC		nidogen 2 precursor							35.0	44.0	41.0					14																	52534674		2203	4296	6499	SO:0001583	missense	22795					basement membrane	calcium ion binding|collagen binding	g.chr14:52534674G>A	AB009799	CCDS9706.1	14q22.1	2008-05-14			ENSG00000087303	ENSG00000087303			13389	protein-coding gene	gene with protein product		605399				9733643	Standard	NM_007361		Approved		uc001wzo.3	Q14112	OTTHUMG00000140298	ENST00000216286.5:c.436C>T	14.37:g.52534674G>A	ENSP00000216286:p.Arg146Cys					NID2_uc010tqs.1_Missense_Mutation_p.R146C|NID2_uc010tqt.1_Missense_Mutation_p.R146C|NID2_uc001wzp.2_Missense_Mutation_p.R146C	p.R146C	NM_007361	NP_031387	Q14112	NID2_HUMAN			2	670	-	Breast(41;0.0639)|all_epithelial(31;0.123)		146			NIDO.		A8K6I7|B4DU19|O43710	Missense_Mutation	SNP	ENST00000216286.5	37	c.436C>T	CCDS9706.1	.	.	.	.	.	.	.	.	.	.	G	19.97	3.924813	0.73213	.	.	ENSG00000087303	ENST00000216286;ENST00000541773;ENST00000395707	T;T	0.22539	1.95;1.95	5.47	-0.428	0.12306	Nidogen, extracellular domain (2);	0.831654	0.11380	N	0.569957	T	0.18800	0.0451	L	0.34521	1.04	0.09310	N	1	D;D;P	0.60160	0.981;0.987;0.947	P;B;B	0.46975	0.533;0.409;0.27	T	0.21759	-1.0236	10	0.52906	T	0.07	.	9.996	0.41900	0.0:0.2024:0.3622:0.4354	.	93;148;146	Q14112-2;Q5CZI2;Q14112	.;.;NID2_HUMAN	C	146;93;148	ENSP00000216286:R146C;ENSP00000443730:R93C	ENSP00000216286:R146C	R	-	1	0	NID2	51604424	0.000000	0.05858	0.194000	0.23346	0.984000	0.73092	-0.260000	0.08708	0.227000	0.20999	0.563000	0.77884	CGC		0.706	NID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276888.1			43	142	0	0	0	0.009718	0	43	142				
WDHD1	11169	broad.mit.edu	37	14	55493428	55493428	+	Splice_Site	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr14:55493428C>A	ENST00000360586.3	-	2	143		c.e2+1		SOCS4_ENST00000395472.2_5'Flank|SOCS4_ENST00000339298.2_5'Flank|WDHD1_ENST00000420358.2_Intron|WDHD1_ENST00000421192.1_Splice_Site|SOCS4_ENST00000555846.1_5'Flank	NM_007086.3	NP_009017.1	O75717	WDHD1_HUMAN	WD repeat and HMG-box DNA binding protein 1						heterochromatin maintenance (GO:0070829)|regulation of chromosome organization (GO:0033044)|RNA processing (GO:0006396)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA binding (GO:0003723)	p.?(1)		breast(3)|endometrium(4)|kidney(3)|large_intestine(9)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(2)	42						AAGAACCTTACCTCCCAGAAT	0.403																																							uc001xbm.1		NA																	1	Unknown(1)		lung(1)	skin(1)	1						c.e2+1		WD repeat and HMG-box DNA binding protein 1							159.0	152.0	154.0					14																	55493428		2203	4300	6503	SO:0001630	splice_region_variant	11169					cytoplasm|nucleoplasm	DNA binding	g.chr14:55493428C>A	AJ006266	CCDS9721.1, CCDS41955.1	14q22.2	2013-01-09			ENSG00000198554	ENSG00000198554		"""WD repeat domain containing"""	23170	protein-coding gene	gene with protein product	"""CTF4, chromosome transmission fidelity factor 4 homolog (S. cerevisiae)"""	608126				9175701, 20028748	Standard	NM_007086		Approved	AND-1, CTF4, CHTF4	uc001xbm.2	O75717	OTTHUMG00000140304	ENST00000360586.3:c.77+1G>T	14.37:g.55493428C>A						WDHD1_uc001xbn.1_Intron|SOCS4_uc001xbo.2_5'Flank|SOCS4_uc001xbp.2_5'Flank	p.S26_splice	NM_007086	NP_009017	O75717	WDHD1_HUMAN			2	155	-								C9JW18|F6W0U7	Splice_Site	SNP	ENST00000360586.3	37	c.77_splice	CCDS9721.1	.	.	.	.	.	.	.	.	.	.	C	16.52	3.146606	0.57044	.	.	ENSG00000198554	ENST00000360586;ENST00000455555	.	.	.	5.41	5.41	0.78517	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.915	0.79508	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	WDHD1	54563178	1.000000	0.71417	1.000000	0.80357	0.645000	0.38454	5.046000	0.64226	2.533000	0.85409	0.467000	0.42956	.		0.403	WDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276897.2	NM_007086	Intron	18	168	1	0	3.03874e-20	0.015359	4.28822e-20	18	168				
ZFP36L1	677	broad.mit.edu	37	14	69256985	69256985	+	Silent	SNP	C	C	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr14:69256985C>T	ENST00000439696.2	-	2	583	c.282G>A	c.(280-282)ggG>ggA	p.G94G	ZFP36L1_ENST00000336440.3_Silent_p.G94G|ZFP36L1_ENST00000555997.1_3'UTR	NM_001244701.1|NM_004926.3	NP_001231630.1|NP_004917.2	Q07352	TISB_HUMAN	ZFP36 ring finger protein-like 1	94					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|T cell differentiation in thymus (GO:0033077)|vasculogenesis (GO:0001570)	cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G94G(1)		breast(4)|kidney(1)|large_intestine(1)|liver(2)|lung(9)|ovary(1)|prostate(2)|urinary_tract(1)	21				all cancers(60;0.00203)|BRCA - Breast invasive adenocarcinoma(234;0.00205)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		GCCGCTCGCCCCCTTCCGAGA	0.672											OREG0022753	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001xkh.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(280-282)GGG>GGA		butyrate response factor 1							25.0	30.0	28.0					14																	69256985		2177	4254	6431	SO:0001819	synonymous_variant	677				regulation of mRNA stability	cytosol|nucleus	DNA binding|mRNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr14:69256985C>T	X79066	CCDS9791.1	14q22-q24	2012-11-27	2012-11-27	2001-11-23		ENSG00000185650		"""RING-type (C3HC4) zinc fingers"""	1107	protein-coding gene	gene with protein product		601064	"""zinc finger protein, C3H type, 36-like 1"", ""zinc finger protein 36, C3H type-like 1"""	BRF1		8024689	Standard	NM_004926		Approved	RNF162B, Berg36, ERF1, TIS11B, cMG1	uc021rve.1	Q07352		ENST00000439696.2:c.282G>A	14.37:g.69256985C>T			OREG0022753	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1113	ZFP36L1_uc001xki.1_Silent_p.G94G	p.G94G	NM_004926	NP_004917	Q07352	TISB_HUMAN		all cancers(60;0.00203)|BRCA - Breast invasive adenocarcinoma(234;0.00205)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)	2	412	-			94					Q13851	Silent	SNP	ENST00000439696.2	37	c.282G>A	CCDS9791.1																																																																																				0.672	ZFP36L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413227.1			12	9	0	0	0	0.01441	0	12	9				
ALKBH1	8846	broad.mit.edu	37	14	78174335	78174335	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr14:78174335C>A	ENST00000216489.3	-	1	28	c.13G>T	c.(13-15)Gca>Tca	p.A5S	SLIRP_ENST00000557342.1_5'Flank|SLIRP_ENST00000238688.5_5'Flank|SLIRP_ENST00000557623.1_5'Flank|SLIRP_ENST00000557431.1_5'Flank	NM_006020.2	NP_006011.2	Q13686	ALKB1_HUMAN	alkB, alkylation repair homolog 1 (E. coli)	5					developmental growth (GO:0048589)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA demethylation (GO:0080111)|DNA repair (GO:0006281)|in utero embryonic development (GO:0001701)|negative regulation of neuron apoptotic process (GO:0043524)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|oxidative demethylation (GO:0070989)|placenta development (GO:0001890)|RNA repair (GO:0042245)	mitochondrion (GO:0005739)|nuclear euchromatin (GO:0005719)	chemoattractant activity (GO:0042056)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)	p.A5S(1)		endometrium(2)|lung(4)|ovary(1)|prostate(1)|skin(1)	9			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		ACGGCCGCTGCCATCTTCCCC	0.642																																							uc001xuc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(13-15)GCA>TCA		alkylated DNA repair protein alkB homolog							23.0	26.0	25.0					14																	78174335		2201	4299	6500	SO:0001583	missense	8846				DNA dealkylation involved in DNA repair|DNA demethylation|oxidative demethylation|RNA repair	mitochondrion	DNA-(apurinic or apyrimidinic site) lyase activity|ferrous iron binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen	g.chr14:78174335C>A	X91992	CCDS32127.1	14q24	2014-07-23	2006-02-09	2006-02-09	ENSG00000100601	ENSG00000100601		"""Alkylation repair homologs"""	17911	protein-coding gene	gene with protein product		605345	"""alkB, alkylation repair homolog (E. coli)"""	ALKBH		8600462	Standard	XM_005268165		Approved	hABH, alkB, ABH	uc001xuc.1	Q13686	OTTHUMG00000171542	ENST00000216489.3:c.13G>T	14.37:g.78174335C>A	ENSP00000216489:p.Ala5Ser					ALKBH1_uc001xud.1_RNA|C14orf156_uc001xue.3_5'Flank	p.A5S	NM_006020	NP_006011	Q13686	ALKB1_HUMAN	Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)	1	22	-			5					Q8TAU1|Q9ULA7	Missense_Mutation	SNP	ENST00000216489.3	37	c.13G>T	CCDS32127.1	.	.	.	.	.	.	.	.	.	.	C	19.39	3.817962	0.71028	.	.	ENSG00000100601	ENST00000216489	T	0.32272	1.46	5.96	5.07	0.68467	.	0.514152	0.22193	N	0.063347	T	0.22898	0.0553	L	0.27053	0.805	0.36016	D	0.838376	B	0.14012	0.009	B	0.12837	0.008	T	0.13469	-1.0508	10	0.51188	T	0.08	-13.6642	11.2876	0.49230	0.1423:0.7206:0.1371:0.0	.	5	Q13686	ALKB1_HUMAN	S	5	ENSP00000216489:A5S	ENSP00000216489:A5S	A	-	1	0	ALKBH1	77244088	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	2.930000	0.48924	1.514000	0.48869	0.655000	0.94253	GCA		0.642	ALKBH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414037.1	NM_006020		30	16	1	0	6.18754e-15	0.01441	8.09285e-15	30	16				
SERPINA13P	388007	broad.mit.edu	37	14	95108209	95108209	+	RNA	SNP	G	G	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr14:95108209G>A	ENST00000469935.1	+	0	814					NR_015340.1		Q6UXR4	SPA13_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 13, pseudogene						negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.A185A(1)									AAACCACAGCGGTTCTGGTGA	0.562																																							uc001ydt.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(1)|skin(1)	2						c.(724-726)GCG>GCA		RecName: Full=Serpin A13; Flags: Precursor;							70.0	78.0	75.0					14																	95108209		2202	4299	6501			388007							g.chr14:95108209G>A	AY358238		14q32.13	2014-02-18	2012-10-03	2012-10-03	ENSG00000187483	ENSG00000187483		"""Serine (or cysteine) peptidase inhibitors"""	30909	pseudogene	pseudogene			"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 13"", ""serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 13"""	SERPINA13		15014966, 16395595, 24172014	Standard	NR_015340		Approved	UNQ6121	uc001ydt.3	Q6UXR4	OTTHUMG00000150191		14.37:g.95108209G>A							p.A242A	NR_015340						2	814	+									Silent	SNP	ENST00000469935.1	37	c.726G>A																																																																																					0.562	SERPINA13P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000316754.1	NR_015340		46	129	0	0	0	0.01441	0	46	129				
SEMA6D	80031	broad.mit.edu	37	15	48063502	48063502	+	Silent	SNP	G	G	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr15:48063502G>A	ENST00000316364.5	+	19	3181	c.2742G>A	c.(2740-2742)tcG>tcA	p.S914S	SEMA6D_ENST00000536845.2_Silent_p.S914S|SEMA6D_ENST00000558816.1_3'UTR|SEMA6D_ENST00000558014.1_Silent_p.S852S|SEMA6D_ENST00000355997.3_3'UTR|SEMA6D_ENST00000389433.2_Silent_p.S895S|SEMA6D_ENST00000358066.4_Silent_p.S852S|SEMA6D_ENST00000537942.1_Silent_p.S852S|SEMA6D_ENST00000389428.3_Silent_p.S839S|SEMA6D_ENST00000389432.2_Silent_p.S871S|SEMA6D_ENST00000354744.4_Silent_p.S858S	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	914					axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.S852S(2)|p.S914S(2)		biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		CCATGGGATCGATGTCTGAGG	0.517																																							uc010bek.2		NA																	4	Substitution - coding silent(4)		lung(2)|kidney(2)	skin(3)|breast(1)	4						c.(2740-2742)TCG>TCA		semaphorin 6D isoform 4 precursor							122.0	108.0	113.0					15																	48063502		2198	4297	6495	SO:0001819	synonymous_variant	80031				axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity	g.chr15:48063502G>A	AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.2742G>A	15.37:g.48063502G>A						SEMA6D_uc001zvw.2_Silent_p.S852S|SEMA6D_uc001zvy.2_Silent_p.S914S|SEMA6D_uc001zvz.2_Silent_p.S858S|SEMA6D_uc001zwa.2_3'UTR|SEMA6D_uc001zwb.2_Silent_p.S852S|SEMA6D_uc001zwc.2_Silent_p.S839S	p.S914S	NM_153618	NP_705871	Q8NFY4	SEM6D_HUMAN		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)	19	3102	+		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)	914			Cytoplasmic (Potential).		A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Silent	SNP	ENST00000316364.5	37	c.2742G>A	CCDS32225.1																																																																																				0.517	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416868.1	NM_024966		39	174	0	0	0	0.021022	0	39	174				
USP8	9101	broad.mit.edu	37	15	50769167	50769167	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr15:50769167A>G	ENST00000396444.3	+	9	1309	c.971A>G	c.(970-972)cAg>cGg	p.Q324R	USP8_ENST00000307179.4_Missense_Mutation_p.Q324R|USP8_ENST00000425032.3_Missense_Mutation_p.Q247R|USP8_ENST00000433963.1_Missense_Mutation_p.Q324R	NM_001128610.1|NM_005154.3	NP_001122082.1|NP_005145.3	P40818	UBP8_HUMAN	ubiquitin specific peptidase 8	324					cell proliferation (GO:0008283)|endosome organization (GO:0007032)|mitotic cytokinesis (GO:0000281)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|Ras protein signal transduction (GO:0007265)|ubiquitin-dependent protein catabolic process (GO:0006511)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|midbody (GO:0030496)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)	p.Q324R(1)		central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)		CCACGACGCCAGAATGAAGAG	0.393																																							uc001zym.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|central_nervous_system(1)	2						c.(970-972)CAG>CGG		ubiquitin specific peptidase 8							88.0	76.0	80.0					15																	50769167		2196	4294	6490	SO:0001583	missense	9101				cell cycle|cell proliferation|endosome organization|protein K48-linked deubiquitination|protein K63-linked deubiquitination|ubiquitin-dependent protein catabolic process	cytosol|early endosome|extrinsic to plasma membrane|nucleus	cysteine-type endopeptidase activity|SH3 domain binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr15:50769167A>G	D29956	CCDS10137.1, CCDS61632.1	15q21.1	2014-03-03	2005-08-08		ENSG00000138592	ENSG00000138592		"""Ubiquitin-specific peptidases"""	12631	protein-coding gene	gene with protein product		603158	"""ubiquitin specific protease 8"""			12838346, 9582025, 24482476	Standard	NM_005154		Approved	HumORF8, KIAA0055, UBPY, SPG59	uc001zyl.4	P40818	OTTHUMG00000131645	ENST00000396444.3:c.971A>G	15.37:g.50769167A>G	ENSP00000379721:p.Gln324Arg					USP8_uc001zyk.1_Missense_Mutation_p.R24G|USP8_uc001zyl.3_Missense_Mutation_p.Q324R|USP8_uc001zyn.3_Missense_Mutation_p.Q324R|USP8_uc010ufh.1_Missense_Mutation_p.Q247R|USP8_uc010bev.1_Intron	p.Q324R	NM_001128611	NP_001122083	P40818	UBP8_HUMAN		all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)	10	1471	+			324					B4DKA8|Q2TB31|Q7Z3U2|Q86VA0|Q8IWI7	Missense_Mutation	SNP	ENST00000396444.3	37	c.971A>G	CCDS10137.1	.	.	.	.	.	.	.	.	.	.	A	10.59	1.394275	0.25205	.	.	ENSG00000138592	ENST00000396444;ENST00000433963;ENST00000307179;ENST00000425032	T;T;T;T	0.17054	2.31;2.31;2.31;2.3	4.95	2.63	0.31362	.	0.415179	0.28865	N	0.013887	T	0.05914	0.0154	N	0.03608	-0.345	0.22982	N	0.998474	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.37798	-0.9690	10	0.20046	T	0.44	-7.5478	5.0656	0.14580	0.6158:0.1438:0.2404:0.0	.	247;324	B4DKA8;P40818	.;UBP8_HUMAN	R	324;324;324;247	ENSP00000379721:Q324R;ENSP00000405537:Q324R;ENSP00000302239:Q324R;ENSP00000412682:Q247R	ENSP00000302239:Q324R	Q	+	2	0	USP8	48556459	0.985000	0.35326	0.998000	0.56505	0.989000	0.77384	0.759000	0.26461	0.333000	0.23563	0.377000	0.23210	CAG		0.393	USP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254541.1	NM_005154		38	91	0	0	0	0.00623	0	38	91				
WDR72	256764	broad.mit.edu	37	15	54015097	54015097	+	Silent	SNP	C	C	T	rs545775155		TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr15:54015097C>T	ENST00000396328.1	-	3	401	c.162G>A	c.(160-162)gcG>gcA	p.A54A	WDR72_ENST00000559418.1_Silent_p.A54A|WDR72_ENST00000557913.1_Silent_p.A54A|WDR72_ENST00000360509.5_Silent_p.A54A	NM_001277176.1|NM_182758.2	NP_001264105.1|NP_877435.3	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	54								p.A54A(1)		NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(18)|lung(29)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	71				all cancers(107;0.0511)		GGAGTTCTTTCGCTGAAATCT	0.353													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20229	0.0		0.0	False		,,,				2504	0.0						uc002acj.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(1)|skin(1)	2						c.(160-162)GCG>GCA		WD repeat domain 72							94.0	91.0	92.0					15																	54015097		2194	4293	6487	SO:0001819	synonymous_variant	256764							g.chr15:54015097C>T	BX537884	CCDS10151.1, CCDS73730.1	15q21.3	2013-01-09			ENSG00000166415	ENSG00000166415		"""WD repeat domain containing"""	26790	protein-coding gene	gene with protein product		613214					Standard	NM_182758		Approved	FLJ38736	uc002acj.2	Q3MJ13	OTTHUMG00000131939	ENST00000396328.1:c.162G>A	15.37:g.54015097C>T						WDR72_uc010bfi.1_Silent_p.A54A	p.A54A	NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN		all cancers(107;0.0511)	3	204	-			54			WD 1.		Q7Z3I3|Q8N8X2	Silent	SNP	ENST00000396328.1	37	c.162G>A	CCDS10151.1																																																																																				0.353	WDR72-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254893.2	NM_182758		20	102	0	0	0	0.014323	0	20	102				
RAB8B	51762	broad.mit.edu	37	15	63536975	63536975	+	Missense_Mutation	SNP	A	A	C			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr15:63536975A>C	ENST00000321437.4	+	2	301	c.145A>C	c.(145-147)Acg>Ccg	p.T49P	RAB8B_ENST00000448330.2_Missense_Mutation_p.T49P	NM_016530.2	NP_057614.1	Q92930	RAB8B_HUMAN	RAB8B, member RAS oncogene family	49					adherens junction organization (GO:0034332)|antigen processing and presentation (GO:0019882)|GTP catabolic process (GO:0006184)|positive regulation of cell projection organization (GO:0031346)|positive regulation of corticotropin secretion (GO:0051461)|protein import into peroxisome membrane (GO:0045046)|small GTPase mediated signal transduction (GO:0007264)	cell tip (GO:0051286)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal membrane (GO:0005778)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|receptor binding (GO:0005102)	p.T49P(1)		kidney(3)|large_intestine(2)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	9						TAAAATTAGAACGATAGAACT	0.299																																							uc002alz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|kidney(1)	2						c.(145-147)ACG>CCG		RAB8B, member RAS oncogene family							66.0	68.0	67.0					15																	63536975		2203	4300	6503	SO:0001583	missense	51762				protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity	g.chr15:63536975A>C	AL833365	CCDS10183.1	15q22	2008-11-18			ENSG00000166128	ENSG00000166128		"""RAB, member RAS oncogene"""	30273	protein-coding gene	gene with protein product		613532				9030196, 18772196	Standard	XM_006720569		Approved		uc002alz.3	Q92930	OTTHUMG00000132862	ENST00000321437.4:c.145A>C	15.37:g.63536975A>C	ENSP00000312734:p.Thr49Pro					RAB8B_uc010uih.1_Missense_Mutation_p.T49P	p.T49P	NM_016530	NP_057614	Q92930	RAB8B_HUMAN			2	241	+			49					Q5JPC4|Q9P293	Missense_Mutation	SNP	ENST00000321437.4	37	c.145A>C	CCDS10183.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.985334	0.74474	.	.	ENSG00000166128	ENST00000321437;ENST00000448330	T;T	0.78003	-1.14;-1.14	5.99	5.99	0.97316	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.88284	0.6395	M	0.83603	2.65	0.53688	D	0.999977	D;D	0.89917	0.999;1.0	D;D	0.97110	1.0;1.0	D	0.89715	0.3915	10	0.87932	D	0	.	12.8861	0.58045	1.0:0.0:0.0:0.0	.	49;49	F5GY21;Q92930	.;RAB8B_HUMAN	P	49	ENSP00000312734:T49P;ENSP00000405463:T49P	ENSP00000312734:T49P	T	+	1	0	RAB8B	61324028	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.737000	0.74816	2.291000	0.77112	0.533000	0.62120	ACG		0.299	RAB8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256336.1	NM_016530		4	49	0	0	0	0.001984	0	4	49				
ZNF609	23060	broad.mit.edu	37	15	64966541	64966541	+	Silent	SNP	C	C	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr15:64966541C>T	ENST00000326648.3	+	4	1616	c.1488C>T	c.(1486-1488)gaC>gaT	p.D496D	ZNF609_ENST00000559364.1_3'UTR|RNU6-549P_ENST00000384433.1_RNA	NM_015042.1	NP_055857.1	O15014	ZN609_HUMAN	zinc finger protein 609	496						nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.D496D(1)		breast(3)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TCCTAATTGACTGTCCCCACC	0.532																																							uc002ann.2		NA																	1	Substitution - coding silent(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						c.(1486-1488)GAC>GAT		zinc finger protein 609							99.0	78.0	85.0					15																	64966541		2203	4299	6502	SO:0001819	synonymous_variant	23060					nucleus	zinc ion binding	g.chr15:64966541C>T	BC014251	CCDS32270.1	15q22.1	2008-05-02				ENSG00000180357		"""Zinc fingers, C2H2-type"""	29003	protein-coding gene	gene with protein product						9205841	Standard	NM_015042		Approved	KIAA0295	uc002ann.3	O15014		ENST00000326648.3:c.1488C>T	15.37:g.64966541C>T							p.D496D	NM_015042	NP_055857	O15014	ZN609_HUMAN			4	1488	+			496			C2H2-type.		Q0D2I2	Silent	SNP	ENST00000326648.3	37	c.1488C>T	CCDS32270.1																																																																																				0.532	ZNF609-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418130.1	XM_042833		63	87	0	0	0	0.01441	0	63	87				
MESDC1	59274	broad.mit.edu	37	15	81295659	81295659	+	Silent	SNP	G	G	T	rs373147874		TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr15:81295659G>T	ENST00000267984.2	+	1	2365	c.1047G>T	c.(1045-1047)tcG>tcT	p.S349S		NM_022566.2	NP_072088.1	Q9H1K6	MESD1_HUMAN	mesoderm development candidate 1	349								p.S349S(1)		endometrium(1)|lung(2)	3						AGAGGTCTTCGCCCAGGACTT	0.557																																							uc002bfz.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1045-1047)TCG>TCT		mesoderm development candidate 1							16.0	21.0	20.0					15																	81295659		2110	4245	6355	SO:0001819	synonymous_variant	59274							g.chr15:81295659G>T	AY007810	CCDS10316.1	15q13	2008-07-18			ENSG00000140406	ENSG00000140406			13519	protein-coding gene	gene with protein product		615466				11247670	Standard	NM_022566		Approved	MGC99595	uc002bfz.3	Q9H1K6	OTTHUMG00000144185	ENST00000267984.2:c.1047G>T	15.37:g.81295659G>T							p.S349S	NM_022566	NP_072088	Q9H1K6	MESD1_HUMAN			1	2365	+			349						Silent	SNP	ENST00000267984.2	37	c.1047G>T	CCDS10316.1																																																																																				0.557	MESDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291390.1	NM_022566		5	43	1	0	1.23904e-05	0.014758	1.38424e-05	5	43				
AP3B2	8120	broad.mit.edu	37	15	83350261	83350261	+	Silent	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr15:83350261G>T	ENST00000261722.3	-	5	639	c.432C>A	c.(430-432)ccC>ccA	p.P144P	AP3B2_ENST00000535359.1_Silent_p.P144P|AP3B2_ENST00000535348.1_Silent_p.P112P|RP11-752G15.3_ENST00000560650.1_RNA	NM_004644.3	NP_004635.2	Q13367	AP3B2_HUMAN	adaptor-related protein complex 3, beta 2 subunit	144					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)|post-Golgi vesicle-mediated transport (GO:0006892)	AP-3 adaptor complex (GO:0030123)|COPI-coated vesicle (GO:0030137)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transporter activity (GO:0005215)	p.P144P(1)		breast(4)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(2)	41			BRCA - Breast invasive adenocarcinoma(143;0.229)			GCATCATGATGGGCACTATGA	0.562																																							uc010uoh.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|breast(1)|pancreas(1)	5						c.(430-432)CCC>CCA		adaptor-related protein complex 3, beta 2							112.0	113.0	113.0					15																	83350261		2096	4224	6320	SO:0001819	synonymous_variant	8120				endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport	clathrin coated vesicle membrane|COPI-coated vesicle|membrane coat	binding|protein transporter activity	g.chr15:83350261G>T	U37673	CCDS45331.1, CCDS61736.1, CCDS61737.1	15q	2008-07-07			ENSG00000103723	ENSG00000103723			567	protein-coding gene	gene with protein product		602166				7671305, 1851215	Standard	NM_004644		Approved	NAPTB	uc010uoh.2	Q13367	OTTHUMG00000168009	ENST00000261722.3:c.432C>A	15.37:g.83350261G>T						AP3B2_uc010uoi.1_Silent_p.P144P|AP3B2_uc010uoj.1_Silent_p.P112P|AP3B2_uc010uog.1_5'Flank	p.P144P	NM_004644	NP_004635	Q13367	AP3B2_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.229)		5	609	-			144					A4Z4T7|B7ZKR7|B7ZKS0|O14808|Q52LY8	Silent	SNP	ENST00000261722.3	37	c.432C>A	CCDS45331.1																																																																																				0.562	AP3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397463.1			26	145	1	0	2.12542e-12	0.00632	2.68177e-12	26	145				
FSD2	123722	broad.mit.edu	37	15	83451753	83451753	+	Missense_Mutation	SNP	T	T	G			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr15:83451753T>G	ENST00000334574.8	-	4	941	c.760A>C	c.(760-762)Aac>Cac	p.N254H	FSD2_ENST00000541889.1_Missense_Mutation_p.N254H			A1L4K1	FSD2_HUMAN	fibronectin type III and SPRY domain containing 2	254								p.N254H(1)		breast(2)|central_nervous_system(1)|large_intestine(5)|lung(10)	18						GACTCAAAGTTTTGTTCTTGT	0.358																																							uc002bjd.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(760-762)AAC>CAC		fibronectin type III and SPRY domain containing							109.0	112.0	111.0					15																	83451753		1866	4102	5968	SO:0001583	missense	123722							g.chr15:83451753T>G	AK122875	CCDS45332.1, CCDS61738.1	15q25.2	2013-02-11	2006-01-11	2006-01-11		ENSG00000186628		"""Fibronectin type III domain containing"""	18024	protein-coding gene	gene with protein product			"""SPRY domain containing 1"""	SPRYD1			Standard	NM_001007122		Approved	RP11-127F21	uc002bjd.2	A1L4K1		ENST00000334574.8:c.760A>C	15.37:g.83451753T>G	ENSP00000335651:p.Asn254His					FSD2_uc010uol.1_Missense_Mutation_p.N254H|FSD2_uc010uom.1_Missense_Mutation_p.N254H	p.N254H	NM_001007122	NP_001007123	A1L4K1	FSD2_HUMAN			4	927	-			254			Potential.		B3KVG1|B7ZM02	Missense_Mutation	SNP	ENST00000334574.8	37	c.760A>C	CCDS45332.1	.	.	.	.	.	.	.	.	.	.	T	15.33	2.800858	0.50315	.	.	ENSG00000186628	ENST00000334574;ENST00000541889	T;T	0.44482	0.92;0.92	5.62	3.29	0.37713	.	0.052201	0.85682	D	0.000000	T	0.40297	0.1111	L	0.50333	1.59	0.32191	N	0.579147	B;P	0.48503	0.052;0.911	B;P	0.46885	0.05;0.53	T	0.50030	-0.8875	10	0.41790	T	0.15	-27.5668	8.5742	0.33587	0.1291:0.0:0.1357:0.7352	.	254;254	B7ZM02;A1L4K1	.;FSD2_HUMAN	H	254	ENSP00000335651:N254H;ENSP00000444078:N254H	ENSP00000335651:N254H	N	-	1	0	FSD2	81248807	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	3.453000	0.52978	0.403000	0.25479	-0.367000	0.07326	AAC		0.358	FSD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418385.1	NM_001007122		5	283	0	0	0	0.014758	0	5	283				
ZNF592	9640	broad.mit.edu	37	15	85342390	85342390	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr15:85342390G>T	ENST00000560079.2	+	9	3374	c.3086G>T	c.(3085-3087)cGc>cTc	p.R1029L	ZNF592_ENST00000299927.3_Missense_Mutation_p.R1029L	NM_014630.2	NP_055445.2	Q92610	ZN592_HUMAN	zinc finger protein 592	1029					cell death (GO:0008219)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R1029L(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(143;0.0587)			AACAGCCTGCGCAAACACATC	0.527																																							uc002bld.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)	6						c.(3085-3087)CGC>CTC		zinc finger protein 592							243.0	221.0	228.0					15																	85342390		2203	4299	6502	SO:0001583	missense	9640				cell death|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr15:85342390G>T	D86966	CCDS32317.1	15q25.2	2011-03-15				ENSG00000166716		"""Zinc fingers, C2H2-type"""	28986	protein-coding gene	gene with protein product		613624	"""spinocerebellar ataxia, autosomal recessive 5"""	SCAR5		9039502, 12030328, 20531441	Standard	NM_014630		Approved	KIAA0211, CAMOS	uc002bld.3	Q92610		ENST00000560079.2:c.3086G>T	15.37:g.85342390G>T	ENSP00000452877:p.Arg1029Leu					ZNF592_uc010upb.1_RNA	p.R1029L	NM_014630	NP_055445	Q92610	ZN592_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0587)		9	3422	+			1029			C2H2-type 10.		Q2M1T2|Q504Y9	Missense_Mutation	SNP	ENST00000560079.2	37	c.3086G>T	CCDS32317.1	.	.	.	.	.	.	.	.	.	.	G	33	5.200417	0.94997	.	.	ENSG00000166716	ENST00000299927	T	0.51817	0.69	5.6	5.6	0.85130	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.167304	0.53938	D	0.000045	T	0.51924	0.1703	N	0.20530	0.585	0.49389	D	0.999789	D	0.89917	1.0	D	0.71414	0.973	T	0.40961	-0.9535	10	0.15952	T	0.53	-31.8628	17.1059	0.86663	0.0:0.0:1.0:0.0	.	1029	Q92610	ZN592_HUMAN	L	1029	ENSP00000299927:R1029L	ENSP00000299927:R1029L	R	+	2	0	ZNF592	83143394	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.579000	0.74036	2.628000	0.89032	0.655000	0.94253	CGC		0.527	ZNF592-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418779.2	NM_014630		78	165	1	0	1.85467e-57	0.01441	3.13249e-57	78	165				
ALDH1A3	220	broad.mit.edu	37	15	101447433	101447433	+	Silent	SNP	T	T	C			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr15:101447433T>C	ENST00000329841.5	+	11	1873	c.1341T>C	c.(1339-1341)aaT>aaC	p.N447N	RP11-66B24.4_ENST00000560351.1_RNA|ALDH1A3_ENST00000346623.6_Silent_p.N340N	NM_000693.2	NP_000684.2	P47895	AL1A3_HUMAN	aldehyde dehydrogenase 1 family, member A3	447					embryonic eye morphogenesis (GO:0048048)|face development (GO:0060324)|inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|nucleus accumbens development (GO:0021768)|olfactory pit development (GO:0060166)|optic cup morphogenesis involved in camera-type eye development (GO:0002072)|positive regulation of apoptotic process (GO:0043065)|retinal metabolic process (GO:0042574)|retinoic acid biosynthetic process (GO:0002138)|retinoic acid metabolic process (GO:0042573)|retinol metabolic process (GO:0042572)|righting reflex (GO:0060013)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)|NAD+ binding (GO:0070403)|protein homodimerization activity (GO:0042803)|thyroid hormone binding (GO:0070324)	p.N447N(1)		NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(7)|lung(9)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	27	Lung NSC(78;0.00144)|all_lung(78;0.0018)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)		Vitamin A(DB00162)	TCACAAAAAATCTCGACAAAG	0.458																																							uc002bwn.3		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(2)|lung(1)|pancreas(1)	4						c.(1339-1341)AAT>AAC		aldehyde dehydrogenase 1A3	NADH(DB00157)|Vitamin A(DB00162)						142.0	122.0	128.0					15																	101447433		2203	4300	6503	SO:0001819	synonymous_variant	220				retinal metabolic process	cytoplasm	aldehyde dehydrogenase|protein homodimerization activity	g.chr15:101447433T>C	U07919	CCDS10389.1	15q26	2010-05-07			ENSG00000184254	ENSG00000184254	1.2.1.5	"""Aldehyde dehydrogenases"""	409	protein-coding gene	gene with protein product	"""retinaldehyde dehydrogenase 3"""	600463		ALDH6		7698756	Standard	XR_111558		Approved	RALDH3	uc002bwn.4	P47895	OTTHUMG00000149870	ENST00000329841.5:c.1341T>C	15.37:g.101447433T>C						ALDH1A3_uc010bpb.2_Silent_p.N340N|uc002bwo.1_Intron	p.N447N	NM_000693	NP_000684	P47895	AL1A3_HUMAN	OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)		11	1445	+	Lung NSC(78;0.00144)|all_lung(78;0.0018)|Melanoma(26;0.00852)		447					Q6NT64	Silent	SNP	ENST00000329841.5	37	c.1341T>C	CCDS10389.1																																																																																				0.458	ALDH1A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313620.2			52	107	0	0	0	0.01441	0	52	107				
MAPK8IP3	23162	broad.mit.edu	37	16	1797083	1797083	+	Silent	SNP	C	C	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr16:1797083C>T	ENST00000250894.4	+	6	955	c.798C>T	c.(796-798)ccC>ccT	p.P266P	MAPK8IP3_ENST00000568271.1_3'UTR|MAPK8IP3_ENST00000356010.5_Silent_p.P266P	NM_015133.3	NP_055948.2	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting protein 3	266					activation of JUN kinase activity (GO:0007257)|axon guidance (GO:0007411)|forebrain development (GO:0030900)|in utero embryonic development (GO:0001701)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|positive regulation of neuron differentiation (GO:0045666)|post-embryonic development (GO:0009791)|protein localization (GO:0008104)|regulation of gene expression (GO:0010468)|regulation of JNK cascade (GO:0046328)|respiratory gaseous exchange (GO:0007585)|vesicle-mediated transport (GO:0016192)	axolemma (GO:0030673)|dendrite (GO:0030425)|Golgi membrane (GO:0000139)|smooth endoplasmic reticulum (GO:0005790)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)	p.P267P(1)		NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	42						CCGCCACACCCAGCACCACAG	0.657																																							uc002cmk.2		NA																	1	Substitution - coding silent(1)		lung(1)	breast(2)|central_nervous_system(1)	3						c.(796-798)CCC>CCT		mitogen-activated protein kinase 8 interacting							51.0	76.0	68.0					16																	1797083		2164	4272	6436	SO:0001819	synonymous_variant	23162				vesicle-mediated transport	Golgi membrane	kinesin binding|MAP-kinase scaffold activity|protein kinase binding	g.chr16:1797083C>T	AB028989	CCDS10442.2, CCDS45379.1	16p13.3	2009-11-23			ENSG00000138834	ENSG00000138834			6884	protein-coding gene	gene with protein product	"""homolog of Drosophila Sunday driver 2"""	605431				10523642, 10629060	Standard	XM_005255187		Approved	KIAA1066, JSAP1, JIP3, syd	uc002cmk.3	Q9UPT6	OTTHUMG00000128637	ENST00000250894.4:c.798C>T	16.37:g.1797083C>T						MAPK8IP3_uc002cmj.1_RNA|MAPK8IP3_uc002cml.2_Silent_p.P266P|MAPK8IP3_uc010uvl.1_Silent_p.P267P	p.P266P	NM_015133	NP_055948	Q9UPT6	JIP3_HUMAN			6	918	+			266					A2A2B3|A7E2B3|Q96RY4|Q9H4I4|Q9H7P1|Q9NUG0	Silent	SNP	ENST00000250894.4	37	c.798C>T	CCDS10442.2																																																																																				0.657	MAPK8IP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250508.2	NM_001040439		23	53	0	0	0	0.004656	0	23	53				
CORO7	79585	broad.mit.edu	37	16	4408437	4408437	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr16:4408437C>A	ENST00000251166.4	-	24	2533	c.2388G>T	c.(2386-2388)gaG>gaT	p.E796D	CORO7_ENST00000539968.1_Missense_Mutation_p.E576D|CORO7_ENST00000574025.1_Missense_Mutation_p.E711D|PAM16_ENST00000576217.1_5'Flank|CORO7-PAM16_ENST00000572467.1_Missense_Mutation_p.E796D|CORO7-PAM16_ENST00000572274.1_5'UTR|CORO7_ENST00000537233.2_Missense_Mutation_p.E778D	NM_024535.4	NP_078811.3	P57737	CORO7_HUMAN	coronin 7	796					actin filament polymerization (GO:0030041)|Golgi to endosome transport (GO:0006895)|protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)	p.E796D(1)		breast(3)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(8)|prostate(2)|skin(2)|urinary_tract(2)	23						ACCGCATCAGCTCCACTTCCC	0.697																																							uc002cwh.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2386-2388)GAG>GAT		coronin 7							37.0	38.0	38.0					16																	4408437		2197	4298	6495	SO:0001583	missense	79585					cytoplasmic membrane-bounded vesicle|cytosol|Golgi membrane|integral to membrane of membrane fraction|soluble fraction		g.chr16:4408437C>A	AK097238	CCDS10513.1, CCDS55982.1, CCDS58417.1	16p13.3	2013-01-10			ENSG00000262246	ENSG00000262246		"""Coronins"", ""WD repeat domain containing"""	26161	protein-coding gene	gene with protein product		611668				15327992	Standard	NM_024535		Approved	FLJ22021		P57737	OTTHUMG00000129465	ENST00000251166.4:c.2388G>T	16.37:g.4408437C>A	ENSP00000251166:p.Glu796Asp					CORO7_uc002cwe.2_RNA|CORO7_uc002cwf.2_Missense_Mutation_p.E796D|CORO7_uc002cwg.3_Missense_Mutation_p.E576D|CORO7_uc010uxh.1_Missense_Mutation_p.E778D|CORO7_uc010uxi.1_Missense_Mutation_p.E711D|CORO7_uc002cwi.1_Missense_Mutation_p.E576D	p.E796D	NM_024535	NP_078811	P57737	CORO7_HUMAN			24	2508	-			796					B4DFD6|B4DL18|I3L416|Q17RK4	Missense_Mutation	SNP	ENST00000251166.4	37	c.2388G>T	CCDS10513.1	.	.	.	.	.	.	.	.	.	.	C	16.67	3.188617	0.57909	.	.	ENSG00000103426	ENST00000251166;ENST00000537233;ENST00000539968	T;T	0.54279	0.58;0.58	5.56	4.61	0.57282	Domain of unknown function DUF1900 (1);	2.430850	0.01798	N	0.032716	D	0.83514	0.5271	H	0.96460	3.825	0.80722	D	1	P;D;B;D;P	0.76494	0.905;0.999;0.245;0.999;0.837	P;D;B;D;P	0.80764	0.739;0.994;0.439;0.994;0.657	T	0.65623	-0.6123	10	0.87932	D	0	-28.3248	11.5757	0.50860	0.0:0.9155:0.0:0.0845	.	711;778;576;796;777	P57737-2;B4DFD6;B3KUH7;P57737;B4DKU9	.;.;.;CORO7_HUMAN;.	D	796;711;576	ENSP00000251166:E796D;ENSP00000446221:E576D	ENSP00000251166:E796D	E	-	3	2	CORO7	4348438	1.000000	0.71417	1.000000	0.80357	0.023000	0.10783	3.259000	0.51515	1.353000	0.45828	0.484000	0.47621	GAG		0.697	CORO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251628.2	NM_024535		25	16	1	0	2.70662e-09	0.009535	3.17251e-09	25	16				
PDILT	204474	broad.mit.edu	37	16	20410503	20410503	+	Silent	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr16:20410503C>A	ENST00000302451.4	-	2	368	c.120G>T	c.(118-120)ctG>ctT	p.L40L		NM_174924.1	NP_777584.1	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis expressed	40					cell migration (GO:0016477)|cell redox homeostasis (GO:0045454)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|spermatid development (GO:0007286)	endoplasmic reticulum (GO:0005783)	protein disulfide isomerase activity (GO:0003756)	p.L40L(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(33)|prostate(3)|skin(1)|urinary_tract(1)	61						TGCGTTCCTCCAGGATGTGCA	0.597																																							uc002dhc.1		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)	1						c.(118-120)CTG>CTT		protein disulfide isomerase-like, testis							162.0	147.0	152.0					16																	20410503		2203	4300	6503	SO:0001819	synonymous_variant	204474				cell differentiation|cell redox homeostasis|multicellular organismal development|spermatogenesis	endoplasmic reticulum	isomerase activity	g.chr16:20410503C>A		CCDS10584.1	16p12.3	2011-11-10	2009-02-23		ENSG00000169340	ENSG00000169340		"""Protein disulfide isomerases"""	27338	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 7"", ""protein disulfide isomerase-like protein of the testis"""					15475357	Standard	NM_174924		Approved	PDIA7	uc002dhc.1	Q8N807	OTTHUMG00000131487	ENST00000302451.4:c.120G>T	16.37:g.20410503C>A							p.L40L	NM_174924	NP_777584	Q8N807	PDILT_HUMAN			2	343	-			40					Q8IVQ5	Silent	SNP	ENST00000302451.4	37	c.120G>T	CCDS10584.1																																																																																				0.597	PDILT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254332.1	NM_174924		75	57	1	0	7.83748e-43	0.01441	1.27843e-42	75	57				
IL4R	3566	broad.mit.edu	37	16	27356218	27356218	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr16:27356218G>T	ENST00000395762.2	+	5	497	c.238G>T	c.(238-240)Gga>Tga	p.G80*	IL4R_ENST00000170630.2_Nonsense_Mutation_p.G80*|IL4R_ENST00000449195.1_Nonsense_Mutation_p.G80*|IL4R_ENST00000543915.2_Nonsense_Mutation_p.G80*|IL4R_ENST00000380922.3_Nonsense_Mutation_p.G65*	NM_000418.3	NP_000409.1	P24394	IL4RA_HUMAN	interleukin 4 receptor	80					defense response to protozoan (GO:0042832)|immune response (GO:0006955)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|ovulation (GO:0030728)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of macrophage activation (GO:0043032)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|production of molecular mediator involved in inflammatory response (GO:0002532)|regulation of cell proliferation (GO:0042127)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	interleukin-4 receptor activity (GO:0004913)|receptor signaling protein activity (GO:0005057)	p.G80*(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	33						TGAGAACAACGGAGGCGCGGG	0.627																																							uc002don.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|skin(1)	2						c.(238-240)GGA>TGA		interleukin 4 receptor alpha chain isoform a							95.0	79.0	84.0					16																	27356218		2197	4300	6497	SO:0001587	stop_gained	3566				immune response|production of molecular mediator involved in inflammatory response	integral to plasma membrane	identical protein binding|interleukin-4 receptor activity|receptor signaling protein activity	g.chr16:27356218G>T	X52425	CCDS10629.1, CCDS58441.1	16p12.1-p11.2	2008-05-14			ENSG00000077238	ENSG00000077238		"""Interleukins and interleukin receptors"", ""CD molecules"""	6015	protein-coding gene	gene with protein product		147781				1679753	Standard	NM_000418		Approved	CD124	uc010bxy.4	P24394	OTTHUMG00000097015	ENST00000395762.2:c.238G>T	16.37:g.27356218G>T	ENSP00000379111:p.Gly80*					IL4R_uc002dom.2_Nonsense_Mutation_p.G80*|IL4R_uc002dop.3_Nonsense_Mutation_p.G65*|IL4R_uc010bxy.2_Nonsense_Mutation_p.G80*|IL4R_uc002doo.2_5'UTR	p.G80*	NM_000418	NP_000409	P24394	IL4RA_HUMAN			5	480	+			80			Extracellular (Potential).		B4E076|B9EKU8|H3BSY5|Q96P01|Q9H181|Q9H182|Q9H183|Q9H184|Q9H185|Q9H186|Q9H187|Q9H188	Nonsense_Mutation	SNP	ENST00000395762.2	37	c.238G>T	CCDS10629.1	.	.	.	.	.	.	.	.	.	.	G	17.30	3.355075	0.61293	.	.	ENSG00000077238	ENST00000380925;ENST00000449195;ENST00000395762;ENST00000543915;ENST00000380922;ENST00000170630	.	.	.	3.4	2.42	0.29668	.	1.872120	0.02164	N	0.059027	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	-20.7207	6.9976	0.24791	0.1276:0.0:0.8724:0.0	.	.	.	.	X	80;80;80;80;65;80	.	ENSP00000170630:G80X	G	+	1	0	IL4R	27263719	0.004000	0.15560	0.001000	0.08648	0.024000	0.10985	1.484000	0.35508	0.987000	0.38709	0.313000	0.20887	GGA		0.627	IL4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214104.4			85	69	1	0	5.34484e-38	0.01441	8.55573e-38	85	69				
LAT	27040	broad.mit.edu	37	16	29000895	29000895	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr16:29000895G>T	ENST00000360872.5	+	8	706	c.628G>T	c.(628-630)Gca>Tca	p.A210S	LAT_ENST00000354453.4_Missense_Mutation_p.A200S|RP11-264B17.5_ENST00000561471.1_RNA|LAT_ENST00000564277.1_Missense_Mutation_p.A180S|LAT_ENST00000454369.2_Missense_Mutation_p.A180S|RP11-264B17.3_ENST00000569969.1_RNA|LAT_ENST00000395456.2_Missense_Mutation_p.A181S|LAT_ENST00000566177.1_Missense_Mutation_p.A209S|LAT_ENST00000395461.3_Missense_Mutation_p.A217S			O43561	LAT_HUMAN	linker for activation of T cells	210					blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|gene expression (GO:0010467)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|lymphocyte homeostasis (GO:0002260)|mast cell degranulation (GO:0043303)|platelet activation (GO:0030168)|positive regulation of signal transduction (GO:0009967)|Ras protein signal transduction (GO:0007265)|regulation of T cell activation (GO:0050863)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|immunological synapse (GO:0001772)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|SH3/SH2 adaptor activity (GO:0005070)	p.A210S(1)		large_intestine(2)|lung(3)|urinary_tract(1)	6		Hepatocellular(780;0.244)				CGGGGAGAGCGCAGAAGCGTC	0.632																																							uc002dsd.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(628-630)GCA>TCA		linker for activation of T cells isoform a							92.0	77.0	82.0					16																	29000895		2197	4300	6497	SO:0001583	missense	27040				calcium-mediated signaling|integrin-mediated signaling pathway|mast cell degranulation|platelet activation|Ras protein signal transduction|regulation of T cell activation|T cell receptor signaling pathway	immunological synapse|integral to membrane|intracellular|membrane raft	SH3/SH2 adaptor activity	g.chr16:29000895G>T	AF036905	CCDS10647.1, CCDS32425.1, CCDS45455.1, CCDS53999.1	16q13	2011-11-01			ENSG00000213658	ENSG00000213658			18874	protein-coding gene	gene with protein product	"""linker for activation of T cells, transmembrane adaptor"""	602354				9489702	Standard	NM_014387		Approved	LAT1	uc010vdj.2	O43561	OTTHUMG00000131761	ENST00000360872.5:c.628G>T	16.37:g.29000895G>T	ENSP00000354119:p.Ala210Ser					uc010vct.1_Intron|LAT_uc010vdj.1_Missense_Mutation_p.A217S|LAT_uc002dsb.2_Missense_Mutation_p.A181S|LAT_uc002dsc.2_Missense_Mutation_p.A180S|LAT_uc010vdk.1_Missense_Mutation_p.A171S|LAT_uc010vdl.1_Missense_Mutation_p.A209S	p.A210S	NM_014387	NP_055202	O43561	LAT_HUMAN			8	980	+		Hepatocellular(780;0.244)	210			Cytoplasmic (Potential).		B7WPI0|C7C5T6|G5E9K3|O43919	Missense_Mutation	SNP	ENST00000360872.5	37	c.628G>T	CCDS10647.1	.	.	.	.	.	.	.	.	.	.	G	16.35	3.099470	0.56183	.	.	ENSG00000213658	ENST00000395461;ENST00000395456;ENST00000454369;ENST00000360872;ENST00000354453	.	.	.	4.38	3.41	0.39046	.	.	.	.	.	T	0.48624	0.1510	L	0.32530	0.975	0.30033	N	0.813332	P;D;D;P;D	0.76494	0.94;0.999;0.999;0.94;0.999	P;D;D;P;D	0.74348	0.606;0.983;0.967;0.606;0.983	T	0.41305	-0.9516	8	0.66056	D	0.02	-9.2819	7.2996	0.26413	0.118:0.0:0.882:0.0	.	209;181;217;210;180	C7C5T6;O43561-2;B7WPI0;O43561;G5E9K3	.;.;.;LAT_HUMAN;.	S	217;181;180;210;200	.	ENSP00000346441:A200S	A	+	1	0	LAT	28908396	0.002000	0.14202	0.672000	0.29872	0.473000	0.32948	0.659000	0.24994	2.377000	0.81083	0.462000	0.41574	GCA		0.632	LAT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254688.2			71	80	1	0	1.14856e-27	0.01441	1.72889e-27	71	80				
SRCAP	10847	broad.mit.edu	37	16	30723216	30723216	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr16:30723216G>T	ENST00000262518.4	+	12	1938	c.1553G>T	c.(1552-1554)aGt>aTt	p.S518I	SRCAP_ENST00000395059.2_Missense_Mutation_p.S518I|SRCAP_ENST00000344771.4_Missense_Mutation_p.S518I|SNORA30_ENST00000384028.1_RNA	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	518	Glu-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)	p.S518I(1)		NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			GAAGAAACAAGTGGAAGTTCA	0.483																																							uc002dze.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(1552-1554)AGT>ATT		Snf2-related CBP activator protein							76.0	73.0	74.0					16																	30723216		2197	4300	6497	SO:0001583	missense	10847				interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity	g.chr16:30723216G>T	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.1553G>T	16.37:g.30723216G>T	ENSP00000262518:p.Ser518Ile					SRCAP_uc002dzf.2_RNA|SRCAP_uc002dzg.1_Missense_Mutation_p.S375I|SRCAP_uc010bzz.1_Missense_Mutation_p.S88I	p.S518I	NM_006662	NP_006653	Q6ZRS2	SRCAP_HUMAN	Colorectal(24;0.198)		12	1938	+			518			Glu-rich.		B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	ENST00000262518.4	37	c.1553G>T	CCDS10689.2	.	.	.	.	.	.	.	.	.	.	G	3.052	-0.195127	0.06259	.	.	ENSG00000080603	ENST00000262518;ENST00000395059;ENST00000344771	D;D;D	0.91631	-2.88;-2.86;-2.87	4.59	2.52	0.30459	.	0.189681	0.37809	N	0.001932	D	0.87030	0.6076	L	0.36672	1.1	0.09310	N	1	B;B;B	0.28324	0.207;0.207;0.132	B;B;B	0.30646	0.118;0.118;0.055	T	0.78250	-0.2277	10	0.48119	T	0.1	-4.2997	11.023	0.47728	0.0:0.3646:0.6354:0.0	.	518;518;518	Q6ZRS2-3;Q6ZRS2-2;Q6ZRS2	.;.;SRCAP_HUMAN	I	518	ENSP00000262518:S518I;ENSP00000378499:S518I;ENSP00000343042:S518I	ENSP00000262518:S518I	S	+	2	0	SRCAP	30630717	0.997000	0.39634	0.118000	0.21660	0.658000	0.38924	2.496000	0.45346	0.596000	0.29794	0.563000	0.77884	AGT		0.483	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662		94	63	1	0	1.80868e-48	0.01441	3.01915e-48	94	63				
SLC38A7	55238	broad.mit.edu	37	16	58712724	58712724	+	Silent	SNP	G	G	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr16:58712724G>A	ENST00000570101.1	-	3	1228	c.345C>T	c.(343-345)taC>taT	p.Y115Y	SLC38A7_ENST00000219320.4_Silent_p.Y115Y|SLC38A7_ENST00000564010.1_Silent_p.Y26Y|SLC38A7_ENST00000564100.1_Silent_p.Y115Y|SLC38A7_ENST00000566953.1_Intron			Q9NVC3	S38A7_HUMAN	solute carrier family 38, member 7	115					sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	L-alanine transmembrane transporter activity (GO:0015180)|L-amino acid transmembrane transporter activity (GO:0015179)|L-asparagine transmembrane transporter activity (GO:0015182)|L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|L-glutamine transmembrane transporter activity (GO:0015186)|L-histidine transmembrane transporter activity (GO:0005290)|L-leucine transmembrane transporter activity (GO:0015190)|L-methionine transmembrane transporter activity (GO:0015191)|L-serine transmembrane transporter activity (GO:0015194)	p.Y115Y(1)		endometrium(1)|large_intestine(2)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	13						CCACCTCCTGGTAGGTCCTCT	0.552																																							uc002eod.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(343-345)TAC>TAT		solute carrier family 38, member 7							177.0	109.0	132.0					16																	58712724		2198	4300	6498	SO:0001819	synonymous_variant	55238				amino acid transport|sodium ion transport	integral to membrane		g.chr16:58712724G>A	BC001961	CCDS10800.1	16q21	2013-05-22			ENSG00000103042	ENSG00000103042		"""Solute carriers"""	25582	protein-coding gene	gene with protein product		614236					Standard	XM_006721229		Approved	FLJ10815	uc002eod.1	Q9NVC3	OTTHUMG00000133491	ENST00000570101.1:c.345C>T	16.37:g.58712724G>A						SLC38A7_uc002eob.1_RNA|SLC38A7_uc002eoc.1_Silent_p.Y115Y|SLC38A7_uc010vil.1_Silent_p.Y26Y|SLC38A7_uc002eoe.1_Silent_p.Y115Y	p.Y115Y	NM_018231	NP_060701	Q9NVC3	S38A7_HUMAN			4	738	-			115					Q53GJ9|Q9H9I5	Silent	SNP	ENST00000570101.1	37	c.345C>T	CCDS10800.1																																																																																				0.552	SLC38A7-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422206.2	NM_018231		30	36	0	0	0	0.019004	0	30	36				
CMTR2	55783	broad.mit.edu	37	16	71319391	71319391	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr16:71319391C>A	ENST00000338099.5	-	3	769	c.433G>T	c.(433-435)Gaa>Taa	p.E145*	CMTR2_ENST00000434935.2_Nonsense_Mutation_p.E145*			Q8IYT2	CMTR2_HUMAN	cap methyltransferase 2	145	Adrift-type SAM-dependent 2'-O-MTase. {ECO:0000255|PROSITE-ProRule:PRU00946}.				7-methylguanosine mRNA capping (GO:0006370)|cap2 mRNA methylation (GO:0097310)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	mRNA (nucleoside-2'-O-)-methyltransferase activity (GO:0004483)	p.E145*(1)									CCTGGAGCTTCACAAAGGTGT	0.413																																							uc010cga.2		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(1)	1						c.(433-435)GAA>TAA		FtsJ methyltransferase domain containing 1							74.0	75.0	75.0					16																	71319391		2198	4299	6497	SO:0001587	stop_gained	55783					integral to membrane	methyltransferase activity|nucleic acid binding	g.chr16:71319391C>A	BC035005	CCDS10898.1	16q22.2	2013-07-23	2013-07-23	2013-07-23	ENSG00000180917	ENSG00000180917			25635	protein-coding gene	gene with protein product	"""adrift homolog (Drosophila)"""		"""FtsJ methyltransferase domain containing 1"""	FTSJD1		21310715	Standard	NM_018348		Approved	FLJ11171, AFT, MTr2	uc010cga.3	Q8IYT2	OTTHUMG00000137587	ENST00000338099.5:c.433G>T	16.37:g.71319391C>A	ENSP00000337512:p.Glu145*					FTSJD1_uc002ezy.3_Nonsense_Mutation_p.E145*|FTSJD1_uc002ezz.3_Nonsense_Mutation_p.E145*	p.E145*	NM_001099642	NP_001093112	Q8IYT2	FTSJ1_HUMAN			3	839	-			145					B2RCD5|D3DWS1|Q8NE77|Q8NFR5|Q9H8Z4|Q9NUS3|Q9NXF5	Nonsense_Mutation	SNP	ENST00000338099.5	37	c.433G>T	CCDS10898.1	.	.	.	.	.	.	.	.	.	.	C	17.63	3.437766	0.62955	.	.	ENSG00000180917	ENST00000338099;ENST00000434935	.	.	.	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-28.4185	18.5291	0.90984	0.0:1.0:0.0:0.0	.	.	.	.	X	145	.	ENSP00000337512:E145X	E	-	1	0	FTSJD1	69876892	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.614000	0.88457	0.561000	0.74099	GAA		0.413	CMTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268984.2	NM_018348		70	42	1	0	2.23399e-28	0.01441	3.37459e-28	70	42				
FANCA	2175	broad.mit.edu	37	16	89818580	89818580	+	Missense_Mutation	SNP	C	C	T	rs200022826		TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr16:89818580C>T	ENST00000389301.3	-	31	3062	c.3032G>A	c.(3031-3033)cGc>cAc	p.R1011H	FANCA_ENST00000568369.1_Missense_Mutation_p.R1011H	NM_000135.2	NP_000126.2	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A	1011					DNA repair (GO:0006281)|female gonad development (GO:0008585)|male gonad development (GO:0008584)|male meiosis (GO:0007140)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.R1011H(1)		breast(5)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|urinary_tract(3)	47		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		ATTTCCTGTGCGGCCACCAAA	0.408			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia				C|||	1	0.000199681	0.0008	0.0	5008	,	,		20584	0.0		0.0	False		,,,				2504	0.0						uc002fou.1		NA	yes	Rec		Fanconi anaemia A	16	16q24.3	2175	D|Mis|N|F|S	"""Fanconi anemia, complementation group A"""			L		AML|leukemia			1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(2)|central_nervous_system(1)|skin(1)	6						c.(3031-3033)CGC>CAC	Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi anemia, complementation group A isoform							185.0	183.0	184.0					16																	89818580		2198	4300	6498	SO:0001583	missense	2175	FanconAnemia	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	DNA repair|protein complex assembly	cytoplasm|nucleoplasm	protein binding	g.chr16:89818580C>T	Z83067	CCDS32515.1, CCDS42221.1, CCDS67099.1	16q24.3	2014-09-17			ENSG00000187741	ENSG00000187741		"""Fanconi anemia, complementation groups"""	3582	protein-coding gene	gene with protein product		607139		FACA, FANCH		7581462, 9382107	Standard	NM_001286167		Approved	FAA, FA-H, FAH	uc002fou.1	O15360		ENST00000389301.3:c.3032G>A	16.37:g.89818580C>T	ENSP00000373952:p.Arg1011His					FANCA_uc010vpn.1_Missense_Mutation_p.R1011H|FANCA_uc010vpo.1_Missense_Mutation_p.R97H	p.R1011H	NM_000135	NP_000126	O15360	FANCA_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.028)	31	3074	-		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)	1011					A5D923|B4DRI7|H3BSR5|O75266|Q6PL10|Q92497|Q96H18|Q9UEA5|Q9UEL8|Q9UEL9|Q9UPK3|Q9Y6M2	Missense_Mutation	SNP	ENST00000389301.3	37	c.3032G>A	CCDS32515.1	.	.	.	.	.	.	.	.	.	.	C	6.533	0.466595	0.12402	.	.	ENSG00000187741	ENST00000389301	D	0.84660	-1.88	5.21	-4.86	0.03132	.	1.107710	0.06942	N	0.812983	T	0.65512	0.2698	N	0.16478	0.41	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.04013	0.001;0.001	T	0.51466	-0.8702	10	0.14252	T	0.57	-3.1746	2.4474	0.04509	0.1326:0.2431:0.1298:0.4946	.	1011;1011	B4DRI7;O15360	.;FANCA_HUMAN	H	1011	ENSP00000373952:R1011H	ENSP00000373952:R1011H	R	-	2	0	FANCA	88346081	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.417000	0.07088	-0.453000	0.07076	-0.809000	0.03173	CGC		0.408	FANCA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000421927.1			5	304	0	0	0	0.001168	0	5	304				
SLC25A11	8402	broad.mit.edu	37	17	4842201	4842201	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr17:4842201A>T	ENST00000225665.7	-	3	658	c.318T>A	c.(316-318)ttT>ttA	p.F106L	RNF167_ENST00000575111.1_5'Flank|RNF167_ENST00000572430.1_5'Flank|RNF167_ENST00000571816.1_5'Flank|RNF167_ENST00000576229.1_5'Flank|RNF167_ENST00000262482.6_5'Flank|SLC25A11_ENST00000544061.2_Missense_Mutation_p.F55L	NM_001165417.1|NM_003562.4	NP_001158889.1|NP_003553.2	Q02978	M2OM_HUMAN	solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11	106					alpha-ketoglutarate transport (GO:0015742)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxoglutarate:malate antiporter activity (GO:0015367)|poly(A) RNA binding (GO:0044822)	p.F106L(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(5)	10						TCAGGCGCTCAAACAGCACGG	0.612																																					Esophageal Squamous(144;1178 2388 18010 48797)	Esophageal Squamous(144;1178 2388 18010 48797)	uc002fzo.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(316-318)TTT>TTA		solute carrier family 25 member 11 isoform 1							53.0	53.0	53.0					17																	4842201		2203	4300	6503	SO:0001583	missense	8402				gluconeogenesis	integral to plasma membrane|mitochondrial inner membrane	oxoglutarate:malate antiporter activity	g.chr17:4842201A>T	X66114	CCDS11059.1, CCDS54069.1	17p13.3	2013-05-22			ENSG00000108528	ENSG00000108528		"""Solute carriers"""	10981	protein-coding gene	gene with protein product		604165		SLC20A4		10072597, 1457818	Standard	NM_003562		Approved	OGC	uc002fzo.2	Q02978	OTTHUMG00000099395	ENST00000225665.7:c.318T>A	17.37:g.4842201A>T	ENSP00000225665:p.Phe106Leu					SLC25A11_uc002fzp.1_Missense_Mutation_p.F102L|RNF167_uc002fzq.2_5'Flank|RNF167_uc002fzr.2_5'Flank|RNF167_uc002fzs.2_5'Flank|RNF167_uc002fzt.2_5'Flank|RNF167_uc002fzu.2_5'Flank|RNF167_uc002fzv.2_5'Flank|RNF167_uc002fzw.1_5'Flank|RNF167_uc002fzx.2_5'Flank	p.F106L	NM_003562	NP_003553	Q02978	M2OM_HUMAN			3	431	-			106			Solcar 1.		F5GY65|O75537|Q969P7	Missense_Mutation	SNP	ENST00000225665.7	37	c.318T>A	CCDS11059.1	.	.	.	.	.	.	.	.	.	.	A	10.36	1.329581	0.24167	.	.	ENSG00000108528	ENST00000225665;ENST00000544061	T;T	0.78126	-1.15;-1.06	5.97	3.79	0.43588	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	T	0.52435	0.1734	N	0.11000	0.08	0.48511	D	0.999665	B;B	0.02656	0.0;0.0	B;B	0.11329	0.006;0.006	T	0.39702	-0.9601	10	0.07644	T	0.81	-9.7142	6.4085	0.21678	0.7477:0.0:0.2523:0.0	.	106;106	Q6IBH0;Q02978	.;M2OM_HUMAN	L	106;55	ENSP00000225665:F106L;ENSP00000440804:F55L	ENSP00000225665:F106L	F	-	3	2	SLC25A11	4782946	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	1.374000	0.34283	1.096000	0.41439	0.533000	0.62120	TTT		0.612	SLC25A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216852.4	NM_003562		27	40	0	0	0	0.007291	0	27	40				
USP6	9098	broad.mit.edu	37	17	5040419	5040419	+	Missense_Mutation	SNP	A	A	C			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr17:5040419A>C	ENST00000574788.1	+	19	2993	c.763A>C	c.(763-765)Aag>Cag	p.K255Q	USP6_ENST00000250066.6_Missense_Mutation_p.K255Q|USP6_ENST00000332776.4_Missense_Mutation_p.K255Q|USP6_ENST00000304328.5_5'UTR			P35125	UBP6_HUMAN	ubiquitin specific peptidase 6	255	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				cellular protein modification process (GO:0006464)|protein deubiquitination (GO:0016579)|regulation of vesicle-mediated transport (GO:0060627)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	calmodulin binding (GO:0005516)|cysteine-type endopeptidase activity (GO:0004197)|nucleic acid binding (GO:0003676)|Rab GTPase activator activity (GO:0005097)|ubiquitin-specific protease activity (GO:0004843)	p.K255Q(2)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						CCATCAGGACAAGGAAGGTCT	0.592			T	"""COL1A1, CDH11, ZNF9, OMD"""	aneurysmal bone cysts																																		uc002gau.1		NA		Dom	yes		17	17p13	9098	T	ubiquitin specific peptidase 6 (Tre-2 oncogene)			M	COL1A1|CDH11|ZNF9|OMD		aneurysmal bone cysts		2	Substitution - Missense(2)		lung(2)	skin(2)|upper_aerodigestive_tract(1)|lung(1)|breast(1)	5						c.(763-765)AAG>CAG		ubiquitin specific protease 6							105.0	95.0	98.0					17																	5040419		2203	4300	6503	SO:0001583	missense	9098				protein deubiquitination|regulation of vesicle-mediated transport|ubiquitin-dependent protein catabolic process	lysosome|plasma membrane|recycling endosome	calmodulin binding|cysteine-type endopeptidase activity|nucleic acid binding|protein binding|Rab GTPase activator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr17:5040419A>C	X63547	CCDS11069.2	17p13	2014-06-12	2014-06-12		ENSG00000129204	ENSG00000129204	3.4.19.12	"""Ubiquitin-specific peptidases"""	12629	protein-coding gene	gene with protein product	"""ubiquitin carboxyl-terminal hydrolase 6"", ""TBC1D3 and USP32 fusion"", ""Tre-2 oncogene"""	604334	"""ubiquitin specific protease 6 (Tre-2 oncogene)"", ""TRE oncogene, Smith Magenis syndrome chromosome region"", ""ubiquitin specific peptidase 6 (Tre-2 oncogene)"""	HRP1, TRESMCR		12838346, 1349106	Standard	NM_004505		Approved	Tre-2, TRE17, Tre2	uc002gav.1	P35125	OTTHUMG00000099449	ENST00000574788.1:c.763A>C	17.37:g.5040419A>C	ENSP00000460380:p.Lys255Gln					USP6_uc002gav.1_Missense_Mutation_p.K255Q|USP6_uc010ckz.1_5'UTR|uc002gbd.2_5'Flank	p.K255Q	NM_004505	NP_004496	P35125	UBP6_HUMAN			19	2993	+			255			Rab-GAP TBC.		Q15634|Q86WP6|Q8IWT4	Missense_Mutation	SNP	ENST00000574788.1	37	c.763A>C	CCDS11069.2	.	.	.	.	.	.	.	.	.	.	A	7.009	0.556423	0.13436	.	.	ENSG00000129204	ENST00000332776;ENST00000250066	T;T	0.41758	0.99;0.99	0.0465	0.0465	0.14256	Rab-GAP/TBC domain (4);	0.000000	0.85682	D	0.000000	T	0.27594	0.0678	L	0.43757	1.38	0.09310	N	0.999995	P	0.52061	0.95	B	0.39119	0.291	T	0.24835	-1.0149	9	0.87932	D	0	.	.	.	.	.	255	P35125	UBP6_HUMAN	Q	255	ENSP00000328010:K255Q;ENSP00000250066:K255Q	ENSP00000250066:K255Q	K	+	1	0	USP6	4981143	0.132000	0.22450	0.085000	0.20634	0.086000	0.17979	0.148000	0.16224	0.115000	0.18071	0.113000	0.15668	AAG		0.592	USP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438990.1	NM_004505		18	60	0	0	0	0.010504	0	18	60				
DVL2	1856	broad.mit.edu	37	17	7134075	7134075	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr17:7134075G>A	ENST00000005340.5	-	2	518	c.236C>T	c.(235-237)cCc>cTc	p.P79L	DVL2_ENST00000575458.1_Missense_Mutation_p.P79L|DVL2_ENST00000574642.1_5'Flank	NM_004422.2	NP_004413.1	O14641	DVL2_HUMAN	dishevelled segment polarity protein 2	79	DIX. {ECO:0000255|PROSITE- ProRule:PRU00069}.				canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration in hindbrain (GO:0021535)|cellular protein localization (GO:0034613)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|convergent extension involved in neural plate elongation (GO:0022007)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|hippo signaling (GO:0035329)|neural tube closure (GO:0001843)|non-canonical Wnt signaling pathway (GO:0035567)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|segment specification (GO:0007379)|transcription from RNA polymerase II promoter (GO:0006366)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|clathrin-coated endocytic vesicle (GO:0045334)|clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|identical protein binding (GO:0042802)	p.P79L(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(11)|lung(7)|skin(1)	25						GTTGAAGCAGGGGAGGCGGGC	0.587																																							uc002gez.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|kidney(1)	2						c.(235-237)CCC>CTC		dishevelled 2							158.0	141.0	147.0					17																	7134075		2203	4300	6503	SO:0001583	missense	1856				canonical Wnt receptor signaling pathway involved in regulation of cell proliferation|intracellular signal transduction|neural tube closure|positive regulation of JUN kinase activity|positive regulation of protein phosphorylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|segment specification|transcription from RNA polymerase II promoter	cytosol|nucleus|plasma membrane	frizzled binding|identical protein binding|signal transducer activity	g.chr17:7134075G>A	BC014844	CCDS11091.1	17p13.1	2013-05-22	2013-05-22		ENSG00000004975	ENSG00000004975		"""Dishevelled homologs"""	3086	protein-coding gene	gene with protein product		602151	"""dishevelled 2 (homologous to Drosophila dsh)"", ""dishevelled, dsh homolog 2 (Drosophila)"""			8662242	Standard	NM_004422		Approved		uc002gez.1	O14641	OTTHUMG00000102155	ENST00000005340.5:c.236C>T	17.37:g.7134075G>A	ENSP00000005340:p.Pro79Leu					DVL2_uc010vtr.1_Missense_Mutation_p.P79L|DVL2_uc010vts.1_5'Flank|DVL2_uc010clz.1_Missense_Mutation_p.P79L	p.P79L	NM_004422	NP_004413	O14641	DVL2_HUMAN			2	518	-			79			DIX.		D3DTN3|Q53XM0	Missense_Mutation	SNP	ENST00000005340.5	37	c.236C>T	CCDS11091.1	.	.	.	.	.	.	.	.	.	.	G	27.2	4.807342	0.90623	.	.	ENSG00000004975	ENST00000005340	T	0.75938	-0.98	4.69	4.69	0.59074	DIX (3);	0.000000	0.85682	D	0.000000	D	0.89491	0.6730	H	0.95574	3.69	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.91961	0.5579	10	0.87932	D	0	-16.5856	12.9786	0.58552	0.0:0.0:1.0:0.0	.	79;79;79	B4DLQ0;B4E2D6;O14641	.;.;DVL2_HUMAN	L	79	ENSP00000005340:P79L	ENSP00000005340:P79L	P	-	2	0	DVL2	7074799	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.229000	0.95273	2.446000	0.82766	0.609000	0.83330	CCC		0.587	DVL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219999.2	NM_004422		38	111	0	0	0	0.01441	0	38	111				
TP53	7157	broad.mit.edu	37	17	7577099	7577099	+	Missense_Mutation	SNP	C	C	A	rs121912660		TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr17:7577099C>A	ENST00000269305.4	-	8	1028	c.839G>T	c.(838-840)aGa>aTa	p.R280I	TP53_ENST00000445888.2_Missense_Mutation_p.R280I|TP53_ENST00000359597.4_Missense_Mutation_p.R280I|TP53_ENST00000455263.2_Missense_Mutation_p.R280I|TP53_ENST00000420246.2_Missense_Mutation_p.R280I|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	280	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> I (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> K (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1694291}.|R -> P (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).|R -> T (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1631151}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R280T(65)|p.R280K(49)|p.R280I(16)|p.0?(8)|p.?(2)|p.R280_D281delRD(2)|p.A276_R283delACPGRDRR(1)|p.C275fs*20(1)|p.A276fs*64(1)|p.L265_K305del41(1)|p.G279_R280delGR(1)|p.F270_D281del12(1)|p.G279fs*59(1)|p.D281fs*24(1)|p.R280fs*62(1)|p.S269fs*21(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCGCCGGTCTCTCCCAGGACA	0.542		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		154	Substitution - Missense(130)|Deletion - In frame(8)|Whole gene deletion(8)|Deletion - Frameshift(6)|Unknown(2)	p.R280T(53)|p.R280K(41)|p.R280G(18)|p.R280S(13)|p.R280I(12)|p.R280*(8)|p.R280fs*65(7)|p.0?(7)|p.R280R(3)|p.?(2)|p.R280_D281delRD(2)|p.A276_R283delACPGRDRR(1)|p.A276fs*64(1)|p.G279_R280delGR(1)|p.R280fs*62(1)|p.S269fs*21(1)|p.G279fs*59(1)|p.F270_D281del12(1)|p.C275_R283delCACPGRDRR(1)|p.L265_K305del41(1)|p.D281fs*24(1)|p.V272_K292del21(1)|p.C275fs*20(1)	urinary_tract(50)|breast(22)|lung(20)|upper_aerodigestive_tract(14)|haematopoietic_and_lymphoid_tissue(8)|large_intestine(5)|central_nervous_system(5)|stomach(4)|biliary_tract(4)|oesophagus(4)|skin(4)|ovary(4)|bone(4)|prostate(3)|small_intestine(1)|endometrium(1)|vagina(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245	GRCh37	CM993218	TP53	M	rs121912660	c.(838-840)AGA>ATA	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							77.0	67.0	70.0					17																	7577099		2203	4300	6503	SO:0001583	missense	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7577099C>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.839G>T	17.37:g.7577099C>A	ENSP00000269305:p.Arg280Ile	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.R280I|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R148I|TP53_uc010cng.1_Missense_Mutation_p.R148I|TP53_uc002gii.1_Missense_Mutation_p.R148I|TP53_uc010cnh.1_Missense_Mutation_p.R280I|TP53_uc010cni.1_Missense_Mutation_p.R280I|TP53_uc002gij.2_Missense_Mutation_p.R280I	p.R280I	NM_001126112	NP_001119584	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	8	1033	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	280		R -> T (in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> K (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in a sporadic cancer; somatic mutation).|R -> I (in sporadic cancers; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).	Interaction with DNA.||Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	c.839G>T	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	34	5.380644	0.95945	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99868	-7.32;-7.32;-7.32;-7.32;-7.32;-7.32	5.13	5.13	0.70059	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99885	0.9945	M	0.92649	3.33	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.995	D;D;D;D	0.91635	0.99;0.999;0.99;0.99	D	0.96400	0.9296	10	0.87932	D	0	-21.0303	16.1198	0.81342	0.0:1.0:0.0:0.0	.	280;280;280;280	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	I	280;280;280;280;280;269;148	ENSP00000352610:R280I;ENSP00000269305:R280I;ENSP00000398846:R280I;ENSP00000391127:R280I;ENSP00000391478:R280I;ENSP00000425104:R148I	ENSP00000269305:R280I	R	-	2	0	TP53	7517824	0.978000	0.34361	1.000000	0.80357	0.980000	0.70556	7.587000	0.82613	2.667000	0.90743	0.462000	0.41574	AGA		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		24	38	1	0	1.10513e-12	0.014323	1.41102e-12	24	38				
NTN1	9423	broad.mit.edu	37	17	9083206	9083206	+	Silent	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr17:9083206G>T	ENST00000173229.2	+	4	1397	c.1290G>T	c.(1288-1290)acG>acT	p.T430T	RP11-85B7.2_ENST00000574307.2_RNA|NTN1_ENST00000538852.1_Silent_p.T430T|NTN1_ENST00000546090.1_Silent_p.T430T	NM_004822.2	NP_004813.2	O95631	NET1_HUMAN	netrin 1	430	Laminin EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00460}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|establishment of nucleus localization (GO:0040023)|inner ear morphogenesis (GO:0042472)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of axon extension (GO:0030517)|neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of cell proliferation (GO:0008284)|regulation of cell migration (GO:0030334)|single organismal cell-cell adhesion (GO:0016337)	basement membrane (GO:0005604)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)		p.T430T(1)	NTN1/ACLY(2)	central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|lung(5)	13						ACGGCGTGACGGGTATCACCT	0.587																																							uc002glw.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1288-1290)ACG>ACT		netrin 1 precursor							73.0	62.0	66.0					17																	9083206		2203	4300	6503	SO:0001819	synonymous_variant	9423				apoptosis|axon guidance		protein binding	g.chr17:9083206G>T	U75586	CCDS11148.1	17p13-p12	2013-03-01			ENSG00000065320	ENSG00000065320		"""Netrins"""	8029	protein-coding gene	gene with protein product	"""Netrin-1"""	601614				9950216	Standard	NM_004822		Approved	NTN1L	uc002glw.4	O95631	OTTHUMG00000130257	ENST00000173229.2:c.1290G>T	17.37:g.9083206G>T							p.T430T	NM_004822	NP_004813	O95631	NET1_HUMAN			4	1397	+			430			Laminin EGF-like 3.		E9KL51	Silent	SNP	ENST00000173229.2	37	c.1290G>T	CCDS11148.1																																																																																				0.587	NTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252583.1			21	29	1	0	1.10513e-12	0.014323	1.41102e-12	21	29				
ALKBH5	54890	broad.mit.edu	37	17	18087755	18087755	+	Silent	SNP	C	C	T	rs370188460		TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr17:18087755C>T	ENST00000399138.4	+	1	203	c.198C>T	c.(196-198)ccC>ccT	p.P66P	ALKBH5_ENST00000541285.1_Intron|RP11-258F1.1_ENST00000577847.1_RNA|RP11-258F1.1_ENST00000583062.1_RNA	NM_017758.3	NP_060228.3	Q6P6C2	ALKB5_HUMAN	AlkB family member 5, RNA demethylase	66					cell differentiation (GO:0030154)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|oxidative single-stranded RNA demethylation (GO:0035553)|response to hypoxia (GO:0001666)|spermatogenesis (GO:0007283)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|oxidative RNA demethylase activity (GO:0035515)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|poly(A) RNA binding (GO:0044822)	p.P66P(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(2)|ovary(1)|skin(1)	10	all_neural(463;0.228)					ACTCGGACCCCGAGCGCAGCG	0.687																																					Ovarian(166;154 1953 40235 46283 46309)	Ovarian(166;154 1953 40235 46283 46309)	uc010cpw.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(196-198)CCC>CCT		alkB, alkylation repair homolog 5		C		0,4154		0,0,2077	11.0	13.0	12.0		198	-5.3	1.0	17		12	1,8409		0,1,4204	no	coding-synonymous	ALKBH5	NM_017758.3		0,1,6281	TT,TC,CC		0.0119,0.0,0.0080		66/395	18087755	1,12563	2077	4205	6282	SO:0001819	synonymous_variant	54890					integral to membrane	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen	g.chr17:18087755C>T	AK000315	CCDS42272.1	17p11.2	2014-07-23	2014-07-23	2006-02-09	ENSG00000091542	ENSG00000091542	1.14.11.-	"""Alkylation repair homologs"""	25996	protein-coding gene	gene with protein product		613303	"""oxoglutarate and iron-dependent oxygenase domain containing"", ""alkB, alkylation repair homolog 5 (E. coli)"""	OFOXD1		11997338, 24778178	Standard	NM_017758		Approved	FLJ20308	uc010cpw.3	Q6P6C2	OTTHUMG00000059397	ENST00000399138.4:c.198C>T	17.37:g.18087755C>T						uc002gsn.2_RNA	p.P66P	NM_017758	NP_060228	Q6P6C2	ALKB5_HUMAN			1	889	+	all_neural(463;0.228)		66					B4DVJ4|D3DXC6|Q9NXD6	Silent	SNP	ENST00000399138.4	37	c.198C>T	CCDS42272.1																																																																																				0.687	ALKBH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132069.3	NM_017758		3	22	0	0	0	0.004672	0	3	22				
LLGL1	3996	broad.mit.edu	37	17	18133340	18133340	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr17:18133340G>T	ENST00000316843.4	+	2	263	c.167G>T	c.(166-168)gGg>gTg	p.G56V		NM_004140.3	NP_004131	Q15334	L2GL1_HUMAN	lethal giant larvae homolog 1 (Drosophila)	56					axonogenesis (GO:0007409)|cortical actin cytoskeleton organization (GO:0030866)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|maintenance of apical/basal cell polarity (GO:0035090)|positive regulation of Rab GTPase activity (GO:0032851)|protein complex assembly (GO:0006461)	cell projection (GO:0042995)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome membrane (GO:0031901)|Golgi cis cisterna (GO:0000137)|myelin sheath abaxonal region (GO:0035748)|trans-Golgi network membrane (GO:0032588)	protein kinase binding (GO:0019901)|Rab GTPase activator activity (GO:0005097)|structural molecule activity (GO:0005198)	p.G56V(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21	all_neural(463;0.228)					ACCAGGTCTGGGGCTGTCAAG	0.602																																							uc002gsp.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)|skin(2)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)	6						c.(166-168)GGG>GTG		lethal giant larvae homolog 1							88.0	75.0	80.0					17																	18133340		2203	4300	6503	SO:0001583	missense	3996				cortical actin cytoskeleton organization|exocytosis|protein complex assembly	cortical actin cytoskeleton	protein kinase binding|structural molecule activity	g.chr17:18133340G>T		CCDS32586.1	17p11.2	2013-01-10	2001-11-28		ENSG00000131899	ENSG00000131899		"""WD repeat domain containing"""	6628	protein-coding gene	gene with protein product		600966	"""lethal giant larvae (Drosophila) homolog 1"""	DLG4, LLGL, HUGL, HUGL-1		7542763, 8565641	Standard	XM_005256643		Approved		uc002gsp.3	Q15334	OTTHUMG00000059396	ENST00000316843.4:c.167G>T	17.37:g.18133340G>T	ENSP00000321537:p.Gly56Val						p.G56V	NM_004140	NP_004131	Q15334	L2GL1_HUMAN			2	228	+	all_neural(463;0.228)		56			WD 1.		A7MBM7|O00188|Q58F11|Q86UK6	Missense_Mutation	SNP	ENST00000316843.4	37	c.167G>T	CCDS32586.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.443911	0.83993	.	.	ENSG00000131899	ENST00000316843	T	0.75477	-0.94	5.26	4.29	0.51040	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.86564	0.5963	M	0.84683	2.71	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.88561	0.3123	10	0.87932	D	0	-35.4314	13.0264	0.58817	0.08:0.0:0.92:0.0	.	56	Q15334	L2GL1_HUMAN	V	56	ENSP00000321537:G56V	ENSP00000321537:G56V	G	+	2	0	LLGL1	18074065	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.549000	0.98106	1.376000	0.46267	0.558000	0.71614	GGG		0.602	LLGL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132067.3			34	50	1	0	7.61001e-30	0.005524	1.16181e-29	34	50				
AOC3	8639	broad.mit.edu	37	17	41004468	41004468	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr17:41004468G>T	ENST00000308423.2	+	1	1268	c.1108G>T	c.(1108-1110)Gcc>Tcc	p.A370S	AOC3_ENST00000591562.1_5'Flank	NM_003734.2	NP_003725.1	Q16853	AOC3_HUMAN	amine oxidase, copper containing 3	370					amine metabolic process (GO:0009308)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cell adhesion (GO:0007155)|inflammatory response (GO:0006954)|response to antibiotic (GO:0046677)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	aliphatic-amine oxidase activity (GO:0052595)|aminoacetone:oxygen oxidoreductase(deaminating) activity (GO:0052594)|calcium ion binding (GO:0005509)|cation channel activity (GO:0005261)|copper ion binding (GO:0005507)|phenethylamine:oxygen oxidoreductase (deaminating) activity (GO:0052596)|primary amine oxidase activity (GO:0008131)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|quinone binding (GO:0048038)|tryptamine:oxygen oxidoreductase (deaminating) activity (GO:0052593)	p.A370S(1)		breast(1)|central_nervous_system(4)|endometrium(4)|kidney(1)|large_intestine(8)|lung(14)|ovary(1)|skin(8)	41		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)	Hydralazine(DB01275)|Phenelzine(DB00780)	AGAGGCCTTGGCCATCTATGG	0.542																																					NSCLC(3;192 220 10664 11501 16477)	NSCLC(3;192 220 10664 11501 16477)	uc002ibv.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|ovary(1)|skin(1)	4						c.(1108-1110)GCC>TCC		amine oxidase, copper containing 3 precursor	Hydralazine(DB01275)|Phenelzine(DB00780)						82.0	75.0	78.0					17																	41004468		2203	4300	6503	SO:0001583	missense	8639				amine metabolic process|cell adhesion|inflammatory response	cell surface|integral to membrane|plasma membrane	aliphatic-amine oxidase activity|aminoacetone:oxygen oxidoreductase(deaminating) activity|copper ion binding|phenethylamine:oxygen oxidoreductase (deaminating) activity|primary amine oxidase activity|protein homodimerization activity|quinone binding|tryptamine:oxygen oxidoreductase (deaminating) activity	g.chr17:41004468G>T	AF067406	CCDS11444.1, CCDS62198.1, CCDS74071.1	17q21	2013-05-08	2013-05-08			ENSG00000131471	1.4.3.21		550	protein-coding gene	gene with protein product	"""vascular adhesion protein 1"""	603735				9653080, 8972912	Standard	NM_003734		Approved	VAP1, HPAO, VAP-1	uc002ibv.4	Q16853		ENST00000308423.2:c.1108G>T	17.37:g.41004468G>T	ENSP00000312326:p.Ala370Ser						p.A370S	NM_003734	NP_003725	Q16853	AOC3_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.156)	1	1268	+		Breast(137;0.000143)	370			Extracellular (Potential).		B2RCI5|K7ESB3|L0L8N9|Q45F94	Missense_Mutation	SNP	ENST00000308423.2	37	c.1108G>T	CCDS11444.1	.	.	.	.	.	.	.	.	.	.	G	0.034	-1.316001	0.01331	.	.	ENSG00000131471	ENST00000308423	T	0.04275	3.66	4.4	0.0707	0.14379	Copper amine oxidase, C-terminal (3);	0.454840	0.24274	N	0.039964	T	0.02970	0.0088	N	0.25485	0.75	0.80722	D	1	B	0.02656	0.0	B	0.20577	0.03	T	0.48581	-0.9023	10	0.22109	T	0.4	.	4.3897	0.11334	0.3692:0.0:0.3898:0.2409	.	370	Q16853	AOC3_HUMAN	S	370	ENSP00000312326:A370S	ENSP00000312326:A370S	A	+	1	0	AOC3	38257994	0.000000	0.05858	0.051000	0.19133	0.201000	0.24016	-1.013000	0.03645	0.195000	0.20347	0.591000	0.81541	GCC		0.542	AOC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452444.1	NM_003734		38	120	1	0	8.20599e-20	0.011902	1.1467e-19	38	120				
DHX8	1659	broad.mit.edu	37	17	41570854	41570854	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr17:41570854G>A	ENST00000262415.3	+	7	977	c.905G>A	c.(904-906)cGg>cAg	p.R302Q	DHX8_ENST00000540306.1_Missense_Mutation_p.R302Q	NM_004941.1	NP_004932.1	Q14562	DHX8_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 8	302	S1 motif. {ECO:0000255|PROSITE- ProRule:PRU00180}.				ATP catabolic process (GO:0006200)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)	p.R302Q(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.08)		GAGCTCCGGCGGGAGGGTCGT	0.547																																					NSCLC(56;1548 1661 49258 49987)	NSCLC(56;1548 1661 49258 49987)	uc002idu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|kidney(1)|pancreas(1)	4						c.(904-906)CGG>CAG		DEAH (Asp-Glu-Ala-His) box polypeptide 8							125.0	116.0	119.0					17																	41570854		2203	4300	6503	SO:0001583	missense	1659					catalytic step 2 spliceosome	ATP binding|ATP-dependent RNA helicase activity|protein binding|RNA binding	g.chr17:41570854G>A	D50487	CCDS11464.1	17q21.31	2005-08-19	2003-06-13	2003-06-20		ENSG00000067596		"""DEAH-boxes"""	2749	protein-coding gene	gene with protein product		600396	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 8 (RNA helicase)"""	DDX8		7935475	Standard	NM_004941		Approved	HRH1, PRP22, PRPF22	uc002idu.1	Q14562		ENST00000262415.3:c.905G>A	17.37:g.41570854G>A	ENSP00000262415:p.Arg302Gln					DHX8_uc010wif.1_Missense_Mutation_p.R211Q|DHX8_uc010wig.1_Missense_Mutation_p.R302Q	p.R302Q	NM_004941	NP_004932	Q14562	DHX8_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.08)	7	978	+		Breast(137;0.00908)	302			S1 motif.			Missense_Mutation	SNP	ENST00000262415.3	37	c.905G>A	CCDS11464.1	.	.	.	.	.	.	.	.	.	.	G	12.22	1.873166	0.33069	.	.	ENSG00000067596	ENST00000540306;ENST00000262415	T;T	0.43688	0.94;0.94	5.18	5.18	0.71444	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);RNA-binding domain, S1 (1);Ribosomal protein S1, RNA-binding domain (2);	0.051263	0.85682	N	0.000000	T	0.26231	0.0640	N	0.13327	0.33	0.54753	D	0.999984	B;B	0.26775	0.159;0.011	B;B	0.14578	0.011;0.003	T	0.07539	-1.0767	10	0.13853	T	0.58	.	17.8663	0.88796	0.0:0.0:1.0:0.0	.	302;302	F5H658;Q14562	.;DHX8_HUMAN	Q	302	ENSP00000437886:R302Q;ENSP00000262415:R302Q	ENSP00000262415:R302Q	R	+	2	0	DHX8	38926380	1.000000	0.71417	0.979000	0.43373	0.995000	0.86356	7.557000	0.82243	2.697000	0.92050	0.655000	0.94253	CGG		0.547	DHX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453485.1			5	100	0	0	0	0.001168	0	5	100				
CDK5RAP3	80279	broad.mit.edu	37	17	46052626	46052626	+	Nonsense_Mutation	SNP	A	A	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr17:46052626A>T	ENST00000338399.4	+	6	542	c.436A>T	c.(436-438)Aag>Tag	p.K146*	CDK5RAP3_ENST00000536708.2_Nonsense_Mutation_p.K171*|RP11-6N17.9_ENST00000582262.1_RNA	NM_176096.1	NP_788276.1	Q96JB5	CK5P3_HUMAN	CDK5 regulatory subunit associated protein 3	146					brain development (GO:0007420)|protein ufmylation (GO:0071569)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of neuron differentiation (GO:0045664)	membrane (GO:0016020)	protein kinase binding (GO:0019901)	p.K146*(1)		NS(1)|central_nervous_system(2)|cervix(3)|endometrium(3)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	18						ATACAGCCGCAAGGAGGAGGA	0.587																																							uc002imr.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(436-438)AAG>TAG		CDK5 regulatory subunit associated protein 3							57.0	62.0	61.0					17																	46052626		2022	4189	6211	SO:0001587	stop_gained	80279				brain development|regulation of cyclin-dependent protein kinase activity|regulation of neuron differentiation		neuronal Cdc2-like kinase binding	g.chr17:46052626A>T	AF110322	CCDS42356.1, CCDS62232.1	17q21.2	2008-07-18				ENSG00000108465			18673	protein-coding gene	gene with protein product	"""ischemic heart CDK5 activator-binding protein C53"", ""LXXLL/leucine-zipper-containing ARFbinding protein"""	608202				10721722	Standard	NM_176096		Approved	MST016, FLJ13660, C53, IC53, HSF-27, OK/SW-cl.114, LZAP	uc010wlc.3	Q96JB5		ENST00000338399.4:c.436A>T	17.37:g.46052626A>T	ENSP00000344683:p.Lys146*					CDK5RAP3_uc010wlc.1_Nonsense_Mutation_p.K166*|CDK5RAP3_uc002imq.1_5'UTR|CDK5RAP3_uc002imu.2_5'UTR|CDK5RAP3_uc002ims.2_Nonsense_Mutation_p.K59*|CDK5RAP3_uc002imv.2_5'UTR|CDK5RAP3_uc002imw.2_5'UTR|CDK5RAP3_uc002imx.2_5'UTR	p.K146*	NM_176096	NP_788276	Q96JB5	CK5P3_HUMAN			6	520	+			146					B7Z6N4|D3DTU1|D3DTU2|F5H3I5|Q53FA2|Q9H3F8|Q9H8G0|Q9HBR9	Nonsense_Mutation	SNP	ENST00000338399.4	37	c.436A>T	CCDS42356.1	.	.	.	.	.	.	.	.	.	.	A	29.2	4.983535	0.93044	.	.	ENSG00000108465	ENST00000536708;ENST00000338399	.	.	.	5.47	5.47	0.80525	.	0.054299	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-21.2872	14.5253	0.67884	1.0:0.0:0.0:0.0	.	.	.	.	X	171;146	.	ENSP00000344683:K146X	K	+	1	0	CDK5RAP3	43407625	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.043000	0.64208	2.091000	0.63221	0.533000	0.62120	AAG		0.587	CDK5RAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442913.1	NM_176096		39	57	0	0	0	0.01441	0	39	57				
HOXB3	3213	broad.mit.edu	37	17	46627838	46627838	+	Missense_Mutation	SNP	T	T	G	rs576238449		TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr17:46627838T>G	ENST00000470495.1	-	2	2601	c.1154A>C	c.(1153-1155)gAc>gCc	p.D385A	HOXB3_ENST00000498678.1_Missense_Mutation_p.D385A|HOXB3_ENST00000472863.1_Missense_Mutation_p.D312A|HOXB-AS1_ENST00000502764.2_RNA|HOXB3_ENST00000490677.1_Missense_Mutation_p.D251A|HOXB3_ENST00000476342.1_Missense_Mutation_p.D385A|HOXB-AS1_ENST00000435312.1_RNA|HOXB3_ENST00000489475.1_Missense_Mutation_p.D312A|HOXB3_ENST00000460160.1_Missense_Mutation_p.D253A|HOXB3_ENST00000485909.2_Missense_Mutation_p.D253A|HOXB-AS3_ENST00000465846.2_RNA|HOXB3_ENST00000311626.4_Missense_Mutation_p.D385A|HOXB-AS1_ENST00000508688.1_RNA			P14651	HXB3_HUMAN	homeobox B3	385					angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|cartilage development (GO:0051216)|definitive hemopoiesis (GO:0060216)|embryonic skeletal system morphogenesis (GO:0048704)|face development (GO:0060324)|glossopharyngeal nerve morphogenesis (GO:0021615)|hematopoietic progenitor cell differentiation (GO:0002244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of neurogenesis (GO:0050767)|rhombomere development (GO:0021546)|thyroid gland development (GO:0030878)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D385A(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(2)|lung(16)|prostate(4)|upper_aerodigestive_tract(1)	30						CCCGTTGTAGTCCAGGTTCCC	0.697											OREG0024516	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002inn.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1153-1155)GAC>GCC		homeobox B3							44.0	56.0	52.0					17																	46627838		2197	4290	6487	SO:0001583	missense	3213				angiogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr17:46627838T>G		CCDS11528.1	17q21.32	2011-06-20	2005-12-22		ENSG00000120093	ENSG00000120093		"""Homeoboxes / ANTP class : HOXL subclass"""	5114	protein-coding gene	gene with protein product		142966	"""homeo box B3"""	HOX2, HOX2G		1973146, 1358459	Standard	XM_006721854		Approved		uc002ino.3	P14651	OTTHUMG00000159922	ENST00000470495.1:c.1154A>C	17.37:g.46627838T>G	ENSP00000417207:p.Asp385Ala		OREG0024516	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	940	HOXB3_uc010wlm.1_Missense_Mutation_p.D312A|HOXB3_uc010dbf.2_Missense_Mutation_p.D385A|HOXB3_uc010dbg.2_Missense_Mutation_p.D385A|HOXB3_uc002ino.2_Missense_Mutation_p.D385A|HOXB3_uc010wlk.1_Missense_Mutation_p.D253A|HOXB3_uc010wll.1_Missense_Mutation_p.D312A	p.D385A	NM_002146	NP_002137	P14651	HXB3_HUMAN			2	1554	-			385					A8K567|B7Z5N8|B7Z5P8|B7ZAD0|D3DTV3|O95615|P17484	Missense_Mutation	SNP	ENST00000470495.1	37	c.1154A>C	CCDS11528.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.007372	0.75046	.	.	ENSG00000120093	ENST00000470495;ENST00000472863;ENST00000311626;ENST00000498678;ENST00000490677;ENST00000460160;ENST00000485909;ENST00000489475;ENST00000476342	D;D;D;D;D;D;D;D;D	0.93133	-2.94;-3.17;-2.94;-2.94;-3.04;-2.98;-2.98;-3.17;-2.94	4.35	4.35	0.52113	.	0.000000	0.85682	D	0.000000	D	0.96315	0.8798	M	0.87900	2.915	0.80722	D	1	D	0.71674	0.998	P	0.61070	0.883	D	0.96994	0.9724	10	0.87932	D	0	.	13.9757	0.64271	0.0:0.0:0.0:1.0	.	385	P14651	HXB3_HUMAN	A	385;312;385;385;251;253;253;312;385	ENSP00000417207:D385A;ENSP00000419676:D312A;ENSP00000308252:D385A;ENSP00000420595:D385A;ENSP00000449977:D251A;ENSP00000418035:D253A;ENSP00000438747:D253A;ENSP00000418729:D312A;ENSP00000418892:D385A	ENSP00000308252:D385A	D	-	2	0	HOXB3	43982837	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.743000	0.85020	1.958000	0.56883	0.379000	0.24179	GAC		0.697	HOXB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358261.1			4	155	0	0	0	0.014758	0	4	155				
ABCA6	23460	broad.mit.edu	37	17	67132263	67132263	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr17:67132263T>C	ENST00000284425.2	-	4	604	c.430A>G	c.(430-432)Aac>Gac	p.N144D	ABCA6_ENST00000590645.1_Missense_Mutation_p.N144D	NM_080284.2	NP_525023.2	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 6	144					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.N144D(1)		breast(6)|endometrium(5)|kidney(17)|large_intestine(18)|lung(20)|ovary(3)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	82	Breast(10;5.65e-12)					AGTGGACTGTTATATCCCTGG	0.323																																							uc002jhw.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(2)|large_intestine(2)|ovary(2)|skin(1)	7						c.(430-432)AAC>GAC		ATP-binding cassette, sub-family A, member 6							39.0	38.0	38.0					17																	67132263		2201	4296	6497	SO:0001583	missense	23460				transport	integral to membrane	ATP binding|ATPase activity	g.chr17:67132263T>C	U66680	CCDS11683.1	17q21	2012-03-14			ENSG00000154262	ENSG00000154262		"""ATP binding cassette transporters / subfamily A"""	36	protein-coding gene	gene with protein product		612504				8894702	Standard	NM_080284		Approved	EST155051	uc002jhw.1	Q8N139		ENST00000284425.2:c.430A>G	17.37:g.67132263T>C	ENSP00000284425:p.Asn144Asp					ABCA6_uc002jhy.2_Missense_Mutation_p.N142D	p.N144D	NM_080284	NP_525023	Q8N139	ABCA6_HUMAN			4	605	-	Breast(10;5.65e-12)		144					Q6NSH9|Q8N856|Q8WWZ6	Missense_Mutation	SNP	ENST00000284425.2	37	c.430A>G	CCDS11683.1	.	.	.	.	.	.	.	.	.	.	T	4.957	0.177837	0.09443	.	.	ENSG00000154262	ENST00000284425	D	0.87571	-2.27	5.16	-10.3	0.00346	.	3.152340	0.00819	N	0.001566	T	0.63570	0.2522	N	0.03608	-0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.57963	-0.7720	10	0.33141	T	0.24	.	0.6366	0.00803	0.374:0.1144:0.2041:0.3074	.	144;144	Q8N139-3;Q8N139	.;ABCA6_HUMAN	D	144	ENSP00000284425:N144D	ENSP00000284425:N144D	N	-	1	0	ABCA6	64643858	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-5.849000	0.00094	-1.879000	0.01126	-0.242000	0.12053	AAC		0.323	ABCA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450463.1	NM_080284		2	7	0	0	0	0.004672	0	2	7				
ABCA5	23461	broad.mit.edu	37	17	67302912	67302912	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr17:67302912T>A	ENST00000392676.3	-	6	806	c.742A>T	c.(742-744)Ata>Tta	p.I248L	ABCA5_ENST00000392677.2_Missense_Mutation_p.I248L|ABCA5_ENST00000588877.1_Missense_Mutation_p.I248L			Q8WWZ7	ABCA5_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 5	248					cholesterol efflux (GO:0033344)|high-density lipoprotein particle remodeling (GO:0034375)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|reverse cholesterol transport (GO:0043691)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.I248L(1)|p.I248fs*1(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(18)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	54	Breast(10;3.72e-11)				Tacrolimus(DB00864)	AATTCTTTTATTTTTTTTTCT	0.244																																							uc002jif.2		NA																	2	Substitution - Missense(1)|Deletion - Frameshift(1)		large_intestine(1)|lung(1)	ovary(2)|central_nervous_system(1)|skin(1)	4						c.(742-744)ATA>TTA		ATP-binding cassette, sub-family A , member 5							15.0	17.0	16.0					17																	67302912		2130	4239	6369	SO:0001583	missense	23461				cholesterol efflux|high-density lipoprotein particle remodeling|negative regulation of macrophage derived foam cell differentiation	Golgi membrane|integral to membrane|late endosome membrane|lysosomal membrane	ATP binding|ATPase activity	g.chr17:67302912T>A	U66672	CCDS11685.1	17q24.3	2012-03-14			ENSG00000154265	ENSG00000154265		"""ATP binding cassette transporters / subfamily A"""	35	protein-coding gene	gene with protein product		612503				8894702	Standard	NM_172232		Approved	EST90625	uc002jig.2	Q8WWZ7		ENST00000392676.3:c.742A>T	17.37:g.67302912T>A	ENSP00000376443:p.Ile248Leu					ABCA5_uc002jig.2_Missense_Mutation_p.I248L|ABCA5_uc002jih.2_Missense_Mutation_p.I248L|ABCA5_uc010dfe.2_Missense_Mutation_p.I248L	p.I248L	NM_018672	NP_061142	Q8WWZ7	ABCA5_HUMAN			5	1960	-	Breast(10;3.72e-11)		248					Q8IVJ2|Q96LJ1|Q96MS4|Q96PZ9|Q9NY14	Missense_Mutation	SNP	ENST00000392676.3	37	c.742A>T	CCDS11685.1	.	.	.	.	.	.	.	.	.	.	T	3.219	-0.160047	0.06502	.	.	ENSG00000154265	ENST00000392677;ENST00000392676	D;D	0.87966	-2.32;-2.32	5.13	-3.83	0.04269	.	0.326617	0.20420	N	0.092694	T	0.54334	0.1852	N	0.01284	-0.91	0.22457	N	0.999087	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.56685	-0.7938	9	.	.	.	.	1.0809	0.01642	0.2894:0.1018:0.2922:0.3165	.	248;248	Q8WWZ7-2;Q8WWZ7	.;ABCA5_HUMAN	L	248	ENSP00000376444:I248L;ENSP00000376443:I248L	.	I	-	1	0	ABCA5	64814507	0.029000	0.19370	0.823000	0.32752	0.980000	0.70556	0.123000	0.15708	-0.774000	0.04590	-1.407000	0.01130	ATA		0.244	ABCA5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450654.1	NM_018672		15	10	0	0	0	0.006122	0	15	10				
UBE2O	63893	broad.mit.edu	37	17	74394977	74394977	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr17:74394977G>A	ENST00000319380.7	-	10	1788	c.1724C>T	c.(1723-1725)cCt>cTt	p.P575L	UBE2O_ENST00000587581.1_5'UTR	NM_022066.3	NP_071349.3	Q9C0C9	UBE2O_HUMAN	ubiquitin-conjugating enzyme E2O	575					positive regulation of BMP signaling pathway (GO:0030513)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.P575H(2)|p.P575L(2)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36						GTGGTGCACAGGGAAGAGGTC	0.612																																							uc002jrm.3		NA																	4	Substitution - Missense(4)		lung(4)	breast(2)|skin(2)|lung(1)	5						c.(1723-1725)CCT>CTT		ubiquitin-conjugating enzyme E2O							195.0	161.0	172.0					17																	74394977		2203	4300	6503	SO:0001583	missense	63893						ATP binding|ubiquitin-protein ligase activity	g.chr17:74394977G>A	AB051521	CCDS32742.1	17q25.1	2013-10-09			ENSG00000175931	ENSG00000175931			29554	protein-coding gene	gene with protein product						11311559, 11214970	Standard	NM_022066		Approved	E2-230K	uc002jrm.4	Q9C0C9	OTTHUMG00000180178	ENST00000319380.7:c.1724C>T	17.37:g.74394977G>A	ENSP00000323687:p.Pro575Leu					UBE2O_uc002jrn.3_Missense_Mutation_p.P575L|UBE2O_uc002jrl.3_Missense_Mutation_p.P178L	p.P575L	NM_022066	NP_071349	Q9C0C9	UBE2O_HUMAN			10	1789	-			575					A6NDU5|Q69YP4|Q6PIZ2|Q86UA4|Q8N425|Q8TBN1|Q9BSW1|Q9H6E6|Q9H7E4|Q9H9B2	Missense_Mutation	SNP	ENST00000319380.7	37	c.1724C>T	CCDS32742.1	.	.	.	.	.	.	.	.	.	.	G	33	5.222843	0.95139	.	.	ENSG00000175931	ENST00000319380	D	0.82619	-1.63	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	D	0.91129	0.7207	M	0.76170	2.325	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.91998	0.5608	10	0.87932	D	0	-11.0442	18.9039	0.92453	0.0:0.0:1.0:0.0	.	575	Q9C0C9	UBE2O_HUMAN	L	575	ENSP00000323687:P575L	ENSP00000323687:P575L	P	-	2	0	UBE2O	71906572	1.000000	0.71417	0.964000	0.40570	0.856000	0.48823	9.813000	0.99286	2.551000	0.86045	0.561000	0.74099	CCT		0.612	UBE2O-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450123.1	NM_022066		72	297	0	0	0	0.01441	0	72	297				
LAMA1	284217	broad.mit.edu	37	18	6971968	6971968	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr18:6971968C>A	ENST00000389658.3	-	48	6880	c.6787G>T	c.(6787-6789)Gtg>Ttg	p.V2263L	RN7SL537P_ENST00000584392.1_RNA	NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	2263	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)	p.V2263L(1)		NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				GTAACCTTCACAGCAGGAGAT	0.423																																							uc002knm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21						c.(6787-6789)GTG>TTG		laminin, alpha 1 precursor	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						76.0	73.0	74.0					18																	6971968		2203	4300	6503	SO:0001583	missense	284217				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding	g.chr18:6971968C>A	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.6787G>T	18.37:g.6971968C>A	ENSP00000374309:p.Val2263Leu					LAMA1_uc010wzj.1_Missense_Mutation_p.V1739L	p.V2263L	NM_005559	NP_005550	P25391	LAMA1_HUMAN			48	6881	-		Colorectal(10;0.172)	2263			Laminin G-like 1.			Missense_Mutation	SNP	ENST00000389658.3	37	c.6787G>T	CCDS32787.1	.	.	.	.	.	.	.	.	.	.	C	16.31	3.087972	0.55968	.	.	ENSG00000101680	ENST00000389658	T	0.76448	-1.02	5.52	3.71	0.42584	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 1 (1);	0.275036	0.30043	N	0.010560	T	0.68979	0.3060	L	0.58925	1.835	0.43403	D	0.995534	B	0.28324	0.207	B	0.29353	0.101	T	0.61579	-0.7034	10	0.06099	T	0.92	.	11.4007	0.49868	0.0:0.8548:0.0:0.1452	.	2263	P25391	LAMA1_HUMAN	L	2263	ENSP00000374309:V2263L	ENSP00000374309:V2263L	V	-	1	0	LAMA1	6961968	0.982000	0.34865	0.997000	0.53966	0.986000	0.74619	2.456000	0.44997	1.468000	0.48064	0.643000	0.83706	GTG		0.423	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559		58	95	1	0	4.09106e-26	0.01441	6.05195e-26	58	95				
APCDD1	147495	broad.mit.edu	37	18	10468528	10468528	+	Missense_Mutation	SNP	A	A	C			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr18:10468528A>C	ENST00000355285.5	+	2	475	c.121A>C	c.(121-123)Aaa>Caa	p.K41Q	APCDD1_ENST00000578882.1_Missense_Mutation_p.K41Q	NM_153000.4	NP_694545.1			adenomatosis polyposis coli down-regulated 1									p.K41Q(1)		NS(1)|breast(1)|endometrium(3)|large_intestine(5)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22				READ - Rectum adenocarcinoma(15;0.08)		GTCCTTAGAGAAAAGTGCCTG	0.488																																							uc002kom.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(121-123)AAA>CAA		adenomatosis polyposis coli down-regulated 1							114.0	116.0	116.0					18																	10468528		2203	4300	6503	SO:0001583	missense	147495				hair follicle development|negative regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to plasma membrane	Wnt-protein binding	g.chr18:10468528A>C	AB056722	CCDS11849.1	18p11.21	2006-07-07			ENSG00000154856	ENSG00000154856			15718	protein-coding gene	gene with protein product		607479				12384519	Standard	NM_153000		Approved	B7323	uc002kom.4	Q8J025	OTTHUMG00000131635	ENST00000355285.5:c.121A>C	18.37:g.10468528A>C	ENSP00000347433:p.Lys41Gln						p.K41Q	NM_153000	NP_694545	Q8J025	APCD1_HUMAN		READ - Rectum adenocarcinoma(15;0.08)	2	475	+			41			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000355285.5	37	c.121A>C	CCDS11849.1	.	.	.	.	.	.	.	.	.	.	A	12.35	1.913022	0.33815	.	.	ENSG00000154856	ENST00000355285;ENST00000423585	T	0.37752	1.18	5.2	5.2	0.72013	.	0.150734	0.56097	D	0.000023	T	0.37517	0.1006	L	0.54323	1.7	0.44175	D	0.996983	P	0.47302	0.893	B	0.44044	0.439	T	0.12400	-1.0549	10	0.20046	T	0.44	-24.5016	15.3406	0.74293	1.0:0.0:0.0:0.0	.	41	Q8J025	APCD1_HUMAN	Q	41;92	ENSP00000347433:K41Q	ENSP00000347433:K41Q	K	+	1	0	APCDD1	10458528	1.000000	0.71417	0.998000	0.56505	0.956000	0.61745	6.687000	0.74552	2.093000	0.63338	0.482000	0.46254	AAA		0.488	APCDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254529.2	NM_153000		14	255	0	0	0	0.003163	0	14	255				
SEH1L	81929	broad.mit.edu	37	18	12955608	12955608	+	Splice_Site	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr18:12955608G>T	ENST00000262124.11	+	3	436	c.309G>T	c.(307-309)tgG>tgT	p.W103C	SEH1L_ENST00000399892.2_Splice_Site_p.W103C	NM_031216.3	NP_112493.2	Q96EE3	SEH1_HUMAN	SEH1-like (S. cerevisiae)	103					attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation (GO:0051315)|carbohydrate metabolic process (GO:0005975)|cytokine production involved in inflammatory response (GO:0002534)|cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-positive bacterium (GO:0050830)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore organization (GO:0006999)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)		p.W103C(1)		central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(5)|pancreas(1)|prostate(1)	11						AGAGCCACTGGGTGAGACATT	0.458																																							uc002krr.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(307-309)TGG>TGT		sec13-like protein isoform 2							82.0	78.0	80.0					18																	12955608		2203	4300	6503	SO:0001630	splice_region_variant	81929				attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation|carbohydrate metabolic process|cell division|glucose transport|mitotic metaphase plate congression|mitotic prometaphase|mRNA transport|nuclear pore organization|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|Nup107-160 complex		g.chr18:12955608G>T	BC012430	CCDS32791.1, CCDS45832.1	18p11.21	2013-01-10				ENSG00000085415		"""WD repeat domain containing"""	30379	protein-coding gene	gene with protein product	"""sec13 like protein"", ""nucleoporin Seh1"""	609263				12196509, 14517296	Standard	XM_005258152		Approved	SEH1A, SEH1B, Seh1, SEC13L	uc002krq.3	Q96EE3		ENST00000262124.11:c.309+1G>T	18.37:g.12955608G>T						SEH1L_uc002krq.2_Missense_Mutation_p.W103C	p.W103C	NM_031216	NP_112493	Q96EE3	SEH1_HUMAN			3	447	+			103					A8K5B1|Q8NFU6|Q96MH3|Q9C069	Missense_Mutation	SNP	ENST00000262124.11	37	c.309G>T	CCDS45832.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.599783	0.87055	.	.	ENSG00000085415	ENST00000399892;ENST00000262124	T;T	0.68025	-0.3;-0.3	5.8	5.8	0.92144	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.89560	0.6750	H	0.97874	4.095	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.92796	0.6252	10	0.87932	D	0	-7.0578	20.0503	0.97624	0.0:0.0:1.0:0.0	.	103;103	Q96EE3;Q96EE3-1	SEH1_HUMAN;.	C	103	ENSP00000382779:W103C;ENSP00000262124:W103C	ENSP00000262124:W103C	W	+	3	0	SEH1L	12945608	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	9.376000	0.97181	2.736000	0.93811	0.591000	0.81541	TGG		0.458	SEH1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458254.1	NM_031216	Missense_Mutation	19	47	1	0	3.99206e-14	0.007413	5.18967e-14	19	47				
CDH2	1000	broad.mit.edu	37	18	25572694	25572694	+	Missense_Mutation	SNP	A	A	C			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr18:25572694A>C	ENST00000269141.3	-	9	1692	c.1269T>G	c.(1267-1269)agT>agG	p.S423R	CDH2_ENST00000399380.3_Missense_Mutation_p.S392R	NM_001792.3	NP_001783.2	P19022	CADH2_HUMAN	cadherin 2, type 1, N-cadherin (neuronal)	423	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|blood vessel morphogenesis (GO:0048514)|calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell adhesion mediated by cadherin (GO:0044331)|cell-cell junction organization (GO:0045216)|glial cell differentiation (GO:0010001)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuronal stem cell maintenance (GO:0097150)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|striated muscle cell differentiation (GO:0051146)	apical plasma membrane (GO:0016324)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|synapse (GO:0045202)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)	p.S423R(1)		NS(1)|breast(5)|cervix(2)|endometrium(7)|kidney(3)|large_intestine(22)|lung(32)|ovary(4)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						GATCTCCGCCACTGATTCTGT	0.517																																							uc002kwg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(1)	4						c.(1267-1269)AGT>AGG		cadherin 2, type 1 preproprotein							218.0	168.0	185.0					18																	25572694		2203	4300	6503	SO:0001583	missense	1000				adherens junction organization|cell junction assembly|positive regulation of muscle cell differentiation	catenin complex|integral to membrane	alpha-catenin binding|beta-catenin binding|calcium ion binding|gamma-catenin binding	g.chr18:25572694A>C	S42303	CCDS11891.1	18q12.1	2010-01-26			ENSG00000170558	ENSG00000170558		"""CD molecules"", ""Cadherins / Major cadherins"""	1759	protein-coding gene	gene with protein product	"""N-cadherin"""	114020		NCAD		2384753, 7731968, 2216790	Standard	NM_001792		Approved	CDHN, CD325	uc002kwg.2	P19022	OTTHUMG00000059940	ENST00000269141.3:c.1269T>G	18.37:g.25572694A>C	ENSP00000269141:p.Ser423Arg					CDH2_uc010xbn.1_Missense_Mutation_p.S392R	p.S423R	NM_001792	NP_001783	P19022	CADH2_HUMAN			9	1728	-			423			Extracellular (Potential).|Cadherin 3.		A8MWK3|B0YIY6|Q14923|Q8N173	Missense_Mutation	SNP	ENST00000269141.3	37	c.1269T>G	CCDS11891.1	.	.	.	.	.	.	.	.	.	.	A	11.74	1.727908	0.30593	.	.	ENSG00000170558	ENST00000269141;ENST00000399380	T;T	0.53857	0.6;0.6	5.39	-6.78	0.01721	Cadherin (4);Cadherin-like (1);	0.137876	0.64402	D	0.000003	T	0.38931	0.1059	L	0.38953	1.18	0.21627	N	0.999619	B;P	0.40144	0.444;0.704	B;B	0.43754	0.307;0.43	T	0.45366	-0.9266	10	0.44086	T	0.13	.	11.1528	0.48469	0.7701:0.0:0.1099:0.12	.	392;423	A8MWK3;P19022	.;CADH2_HUMAN	R	423;392	ENSP00000269141:S423R;ENSP00000382312:S392R	ENSP00000269141:S423R	S	-	3	2	CDH2	23826692	0.003000	0.15002	0.924000	0.36721	0.335000	0.28730	-0.894000	0.04123	-0.974000	0.03550	-0.290000	0.09829	AGT		0.517	CDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133246.3	NM_001792		12	57	0	0	0	0.013537	0	12	57				
PIK3C3	5289	broad.mit.edu	37	18	39537617	39537617	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr18:39537617C>G	ENST00000262039.4	+	2	237	c.151C>G	c.(151-153)Caa>Gaa	p.Q51E	PIK3C3_ENST00000586545.1_Missense_Mutation_p.Q51E|PIK3C3_ENST00000590220.1_Intron|PIK3C3_ENST00000398870.3_Intron	NM_002647.2	NP_002638.2	Q8NEB9	PK3C3_HUMAN	phosphatidylinositol 3-kinase, catalytic subunit type 3	51	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.				autophagic vacuole assembly (GO:0000045)|cytokinesis (GO:0000910)|early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein processing (GO:0016485)|regulation of protein secretion (GO:0050708)|response to leucine (GO:0043201)|small molecule metabolic process (GO:0044281)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	axoneme (GO:0005930)|cytosol (GO:0005829)|late endosome (GO:0005770)|membrane (GO:0016020)|midbody (GO:0030496)|phagocytic vesicle (GO:0045335)|phosphatidylinositol 3-kinase complex (GO:0005942)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|protein kinase activity (GO:0004672)	p.Q51E(1)		breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(10)|liver(1)|lung(25)|ovary(1)|skin(2)|urinary_tract(1)	49						AGGACTATATCAAGAGACATG	0.418										TSP Lung(28;0.18)																											NSCLC(37;552 1060 2683 16430 37914)	NSCLC(37;552 1060 2683 16430 37914)	uc002lap.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(8)|ovary(1)|breast(1)	10						c.(151-153)CAA>GAA		catalytic phosphatidylinositol 3-kinase 3							149.0	148.0	149.0					18																	39537617		2203	4300	6503	SO:0001583	missense	5289				cell cycle|cytokinesis|fibroblast growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway	midbody|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|protein binding	g.chr18:39537617C>G	Z46973	CCDS11920.1	18q12.3	2012-07-13	2012-07-13		ENSG00000078142	ENSG00000078142	2.7.1.137		8974	protein-coding gene	gene with protein product		602609	"""phosphoinositide-3-kinase, class 3"""			7628435	Standard	NM_002647		Approved	Vps34	uc002lap.3	Q8NEB9	OTTHUMG00000132593	ENST00000262039.4:c.151C>G	18.37:g.39537617C>G	ENSP00000262039:p.Gln51Glu	TSP Lung(28;0.18)				PIK3C3_uc010xcl.1_Intron|PIK3C3_uc002lao.2_Missense_Mutation_p.Q51E	p.Q51E	NM_002647	NP_002638	Q8NEB9	PK3C3_HUMAN			2	209	+			51					Q15134	Missense_Mutation	SNP	ENST00000262039.4	37	c.151C>G	CCDS11920.1	.	.	.	.	.	.	.	.	.	.	C	11.21	1.572990	0.28092	.	.	ENSG00000078142	ENST00000262039	T	0.70045	-0.45	4.44	4.44	0.53790	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);Phosphoinositide 3-kinase, C2 (1);	0.000000	0.85682	D	0.000000	T	0.56352	0.1979	L	0.33245	0.995	0.58432	D	0.999999	B	0.09022	0.002	B	0.10450	0.005	T	0.51919	-0.8644	9	.	.	.	.	17.4576	0.87611	0.0:1.0:0.0:0.0	.	51	Q8NEB9	PK3C3_HUMAN	E	51	ENSP00000262039:Q51E	.	Q	+	1	0	PIK3C3	37791615	1.000000	0.71417	0.958000	0.39756	0.702000	0.40608	7.469000	0.80959	2.182000	0.69389	0.585000	0.79938	CAA		0.418	PIK3C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255804.1	NM_002647		49	70	0	0	0	0.01441	0	49	70				
SETBP1	26040	broad.mit.edu	37	18	42618463	42618463	+	Silent	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr18:42618463C>A	ENST00000282030.5	+	5	4310	c.4014C>A	c.(4012-4014)ccC>ccA	p.P1338P		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	1338						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.P1284P(1)|p.P1338P(1)		NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		TGCCAAGTCCCCACTTAAAAG	0.458									Schinzel-Giedion syndrome																														uc010dni.2		NA																	2	Substitution - coding silent(2)		lung(2)	upper_aerodigestive_tract(2)|large_intestine(1)	3						c.(4012-4014)CCC>CCA		SET binding protein 1 isoform a							128.0	113.0	118.0					18																	42618463		2203	4300	6503	SO:0001819	synonymous_variant	26040	Schinzel-Giedion_syndrome	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome		nucleus	DNA binding	g.chr18:42618463C>A	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.4014C>A	18.37:g.42618463C>A							p.P1338P	NM_015559	NP_056374	Q9Y6X0	SETBP_HUMAN		Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)	5	4310	+			1338					A6H8W5|Q6P6C3|Q9UEF3	Silent	SNP	ENST00000282030.5	37	c.4014C>A	CCDS11923.2																																																																																				0.458	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255854.4	NM_001130110		35	59	1	0	1.07637e-12	0.021022	1.38252e-12	35	59				
SLC14A1	6563	broad.mit.edu	37	18	43319551	43319551	+	Silent	SNP	C	C	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr18:43319551C>T	ENST00000321925.4	+	8	1102	c.870C>T	c.(868-870)agC>agT	p.S290S	RP11-116O18.3_ENST00000586213.1_RNA|SLC14A1_ENST00000402943.2_Silent_p.S185S|SLC14A1_ENST00000591541.1_5'UTR|SLC14A1_ENST00000436407.3_Silent_p.S346S|SLC14A1_ENST00000586142.1_Silent_p.S290S|SLC14A1_ENST00000589700.1_Missense_Mutation_p.A241V|SLC14A1_ENST00000502059.2_Silent_p.S182S|SLC14A1_ENST00000415427.3_Silent_p.S346S|SLC14A1_ENST00000535474.1_Silent_p.S158S|RP11-116O18.3_ENST00000589510.1_RNA	NM_001128588.3|NM_001146036.2|NM_015865.6	NP_001122060.3|NP_001139508.2|NP_056949.4	Q13336	UT1_HUMAN	solute carrier family 14 (urea transporter), member 1 (Kidd blood group)	290					transmembrane transport (GO:0055085)|urea transmembrane transport (GO:0071918)|urea transport (GO:0015840)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	urea channel activity (GO:0015265)|urea transmembrane transporter activity (GO:0015204)|water transmembrane transporter activity (GO:0005372)	p.S346S(1)|p.S290S(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(11)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	21						GTTTCAACAGCTCTCTGGCCT	0.562																																							uc010xcn.1		NA																	2	Substitution - coding silent(2)		lung(2)	central_nervous_system(1)|pancreas(1)	2						c.(868-870)AGC>AGT		solute carrier family 14 (urea transporter),							124.0	106.0	112.0					18																	43319551		2203	4300	6503	SO:0001819	synonymous_variant	6563					integral to plasma membrane	urea transmembrane transporter activity	g.chr18:43319551C>T	BC040128	CCDS11925.1, CCDS45860.1	18q11-q12	2014-07-19	2014-01-02		ENSG00000141469	ENSG00000141469		"""Blood group antigens"", ""Solute carriers"""	10918	protein-coding gene	gene with protein product		613868	"""Kidd blood group"", ""solute carrier family 14 (urea transporter), member 1"""	JK		7797558	Standard	NM_001146037		Approved	HsT1341, RACH1, RACH2	uc010dnk.3	Q13336	OTTHUMG00000132617	ENST00000321925.4:c.870C>T	18.37:g.43319551C>T						SLC14A1_uc010dnk.2_Silent_p.S346S|SLC14A1_uc002lbf.3_Silent_p.S290S|SLC14A1_uc002lbg.3_RNA|SLC14A1_uc010xco.1_Silent_p.S185S|SLC14A1_uc002lbh.3_Silent_p.S182S|SLC14A1_uc002lbi.3_Silent_p.S158S|SLC14A1_uc002lbj.3_Silent_p.S346S|SLC14A1_uc002lbk.3_Silent_p.S290S	p.S290S	NM_001146036	NP_001139508	Q13336	UT1_HUMAN			9	1189	+			290			Helical; (Potential).		A8K0P3|B3KR62|B3KVX3|C9EHF2|Q86VM5	Silent	SNP	ENST00000321925.4	37	c.870C>T	CCDS11925.1																																																																																				0.562	SLC14A1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255860.2	NM_015865		39	87	0	0	0	0.00623	0	39	87				
C18orf25	147339	broad.mit.edu	37	18	43796093	43796093	+	Silent	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr18:43796093C>A	ENST00000282059.6	+	2	621	c.247C>A	c.(247-249)Cga>Aga	p.R83R	C18orf25_ENST00000321319.6_Silent_p.R83R	NM_145055.3	NP_659492	Q96B23	CR025_HUMAN	chromosome 18 open reading frame 25	83								p.R83R(1)		central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)	11						TACAACTGGCCGAGTTTATGA	0.468																																							uc002lbw.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(2)	2						c.(247-249)CGA>AGA		ARKadia-like 1 isoform a							116.0	116.0	116.0					18																	43796093		1963	4158	6121	SO:0001819	synonymous_variant	147339							g.chr18:43796093C>A	AL713661	CCDS42430.1, CCDS42431.1	18q21.1	2014-01-03			ENSG00000152242	ENSG00000152242			28172	protein-coding gene	gene with protein product	"""ARKadia-like 1"""					15722956	Standard	NM_001008239		Approved	MGC12909, ARKL1, RNF111L1	uc002lbw.3	Q96B23		ENST00000282059.6:c.247C>A	18.37:g.43796093C>A						C18orf25_uc002lbx.2_Silent_p.R83R	p.R83R	NM_145055	NP_659492	Q96B23	CR025_HUMAN			2	626	+			83					A8K123|A8KAB6|Q5XG78|Q6N058|Q86TB5|Q8TCQ5	Silent	SNP	ENST00000282059.6	37	c.247C>A	CCDS42430.1																																																																																				0.468	C18orf25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445242.1	NM_145055		52	97	1	0	3.00063e-23	0.01441	4.33424e-23	52	97				
RNF152	220441	broad.mit.edu	37	18	59483460	59483460	+	Silent	SNP	G	G	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr18:59483460G>A	ENST00000312828.3	-	2	1336	c.237C>T	c.(235-237)atC>atT	p.I79I		NM_173557.2	NP_775828.1	Q8N8N0	RN152_HUMAN	ring finger protein 152	79					apoptotic process (GO:0006915)|protein K48-linked ubiquitination (GO:0070936)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.I79I(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(10)|skin(1)	17		Colorectal(73;0.186)				GTGGAATGGCGATGACAGCCA	0.637																																							uc002lih.1		NA																	1	Substitution - coding silent(1)		lung(1)	breast(1)	1						c.(235-237)ATC>ATT		ring finger protein 152							84.0	90.0	88.0					18																	59483460		2203	4300	6503	SO:0001819	synonymous_variant	220441				apoptosis|protein K48-linked ubiquitination	integral to membrane|lysosomal membrane	ubiquitin-protein ligase activity|zinc ion binding	g.chr18:59483460G>A	AK096495	CCDS11978.1	18q21.33	2013-01-09			ENSG00000176641	ENSG00000176641		"""RING-type (C3HC4) zinc fingers"""	26811	protein-coding gene	gene with protein product							Standard	XM_005266650		Approved	FLJ39176	uc002lih.1	Q8N8N0	OTTHUMG00000132774	ENST00000312828.3:c.237C>T	18.37:g.59483460G>A							p.I79I	NM_173557	NP_775828	Q8N8N0	RN152_HUMAN			2	649	-		Colorectal(73;0.186)	79					B3KV99|Q52LA4	Silent	SNP	ENST00000312828.3	37	c.237C>T	CCDS11978.1																																																																																				0.637	RNF152-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256180.1	NM_173557		14	62	0	0	0	0.00499	0	14	62				
SERPINB7	8710	broad.mit.edu	37	18	61459667	61459667	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr18:61459667C>A	ENST00000398019.2	+	3	534	c.209C>A	c.(208-210)tCt>tAt	p.S70Y	SERPINB7_ENST00000540675.1_Intron|SERPINB7_ENST00000336429.2_Missense_Mutation_p.S70Y|SERPINB7_ENST00000546027.1_Missense_Mutation_p.S70Y	NM_003784.3	NP_003775.1	O75635	SPB7_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 7	70					negative regulation of endopeptidase activity (GO:0010951)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of glomerular mesangial cell proliferation (GO:0072126)|positive regulation of platelet-derived growth factor production (GO:0090362)|positive regulation of transforming growth factor beta1 production (GO:0032914)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.S70Y(1)		central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(14)|prostate(1)|skin(3)	27		Esophageal squamous(42;0.129)				GGAAACTCTTCTAATAGTCAG	0.428																																							uc002ljl.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|central_nervous_system(1)	3						c.(208-210)TCT>TAT		serine (or cysteine) proteinase inhibitor, clade							125.0	107.0	113.0					18																	61459667		2202	4300	6502	SO:0001583	missense	8710				regulation of proteolysis	cytoplasm	serine-type endopeptidase inhibitor activity	g.chr18:61459667C>A	AF027866	CCDS11988.1, CCDS58633.1	18q21.33	2014-02-18	2005-08-18		ENSG00000166396	ENSG00000166396		"""Serine (or cysteine) peptidase inhibitors"""	13902	protein-coding gene	gene with protein product		603357	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 7"""			24172014	Standard	NM_003784		Approved	MEGSIN	uc002ljl.4	O75635	OTTHUMG00000060591	ENST00000398019.2:c.209C>A	18.37:g.61459667C>A	ENSP00000381101:p.Ser70Tyr					SERPINB7_uc002ljm.2_Missense_Mutation_p.S70Y|SERPINB7_uc010xet.1_Intron|SERPINB7_uc010dqg.2_Missense_Mutation_p.S70Y	p.S70Y	NM_001040147	NP_001035237	O75635	SPB7_HUMAN			3	305	+		Esophageal squamous(42;0.129)	70					B4DUW8|F5GZC0|Q1ED45|Q3KPG4	Missense_Mutation	SNP	ENST00000398019.2	37	c.209C>A	CCDS11988.1	.	.	.	.	.	.	.	.	.	.	C	18.71	3.683154	0.68157	.	.	ENSG00000166396	ENST00000425392;ENST00000336429;ENST00000398019;ENST00000447428;ENST00000546027;ENST00000431370	D;D;D;D;D;D	0.87650	-2.28;-1.79;-1.79;-1.64;-1.79;-2.28	4.94	4.94	0.65067	Serpin domain (3);	3.015050	0.01013	N	0.003870	D	0.94335	0.8179	M	0.79475	2.455	0.27367	N	0.955801	D	0.69078	0.997	D	0.70487	0.969	T	0.80614	-0.1304	10	0.62326	D	0.03	.	13.8599	0.63554	0.0:1.0:0.0:0.0	.	70	O75635	SPB7_HUMAN	Y	70	ENSP00000397301:S70Y;ENSP00000337212:S70Y;ENSP00000381101:S70Y;ENSP00000402362:S70Y;ENSP00000444861:S70Y;ENSP00000393947:S70Y	ENSP00000337212:S70Y	S	+	2	0	SERPINB7	59610647	0.028000	0.19301	0.256000	0.24389	0.308000	0.27856	1.872000	0.39549	2.735000	0.93741	0.655000	0.94253	TCT		0.428	SERPINB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134007.1	NM_003784		18	42	1	0	2.4624e-09	0.008871	2.89416e-09	18	42				
CDH7	1005	broad.mit.edu	37	18	63492010	63492010	+	Silent	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr18:63492010C>A	ENST00000397968.2	+	6	1350	c.924C>A	c.(922-924)ggC>ggA	p.G308G	CDH7_ENST00000536984.2_Silent_p.G308G|CDH7_ENST00000323011.3_Silent_p.G308G	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	308	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G308G(2)		NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				ATGGTTTGGGCATTTTTAAGA	0.368																																							uc002ljz.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|pancreas(1)|skin(1)	4						c.(922-924)GGC>GGA		cadherin 7, type 2 preproprotein							149.0	141.0	144.0					18																	63492010		2203	4300	6503	SO:0001819	synonymous_variant	1005				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr18:63492010C>A	AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.924C>A	18.37:g.63492010C>A						CDH7_uc002lka.2_Silent_p.G308G|CDH7_uc002lkb.2_Silent_p.G308G	p.G308G	NM_033646	NP_387450	Q9ULB5	CADH7_HUMAN			6	1249	+		Esophageal squamous(42;0.129)	308			Extracellular (Potential).|Cadherin 3.		Q9H157	Silent	SNP	ENST00000397968.2	37	c.924C>A	CCDS11993.1																																																																																				0.368	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256217.2	NM_033646		8	53	1	0	4.3838e-07	0.016723	5.00173e-07	8	53				
ZNF236	7776	broad.mit.edu	37	18	74583760	74583760	+	Nonsense_Mutation	SNP	C	C	T	rs376042351		TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr18:74583760C>T	ENST00000253159.8	+	5	838	c.640C>T	c.(640-642)Cga>Tga	p.R214*	ZNF236_ENST00000583095.1_Intron|ZNF236_ENST00000320610.9_Nonsense_Mutation_p.R216*	NM_007345.3	NP_031371.3	Q9UL36	ZN236_HUMAN	zinc finger protein 236	214					cellular response to glucose stimulus (GO:0071333)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R214*(2)		NS(1)|breast(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(43)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	94		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		CCAGTTAACGCGACACATTAG	0.463																																							uc002lmi.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(4)	4						c.(640-642)CGA>TGA		zinc finger protein 236		C	stop/ARG	1,4095		0,1,2047	132.0	120.0	124.0		640	4.5	0.7	18		124	0,8378		0,0,4189	no	stop-gained	ZNF236	NM_007345.3		0,1,6236	TT,TC,CC		0.0,0.0244,0.0080		214/1846	74583760	1,12473	2048	4189	6237	SO:0001587	stop_gained	7776				cellular response to glucose stimulus	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr18:74583760C>T	AF085243	CCDS42447.1	18q22-q23	2013-01-08				ENSG00000130856		"""Zinc fingers, C2H2-type"""	13028	protein-coding gene	gene with protein product		604760				10458916	Standard	NM_007345		Approved		uc002lmi.3	Q9UL36		ENST00000253159.8:c.640C>T	18.37:g.74583760C>T	ENSP00000253159:p.Arg214*					ZNF236_uc002lmj.2_RNA|ZNF236_uc002lmk.1_Nonsense_Mutation_p.R214*	p.R214*	NM_007345	NP_031371	Q9UL36	ZN236_HUMAN		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)	5	838	+		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)	214			C2H2-type 6.		B2RTX9|Q9UL37	Nonsense_Mutation	SNP	ENST00000253159.8	37	c.640C>T	CCDS42447.1	.	.	.	.	.	.	.	.	.	.	C	38	7.073549	0.98044	2.44E-4	0.0	ENSG00000130856	ENST00000253159;ENST00000543926;ENST00000320610	.	.	.	5.41	4.48	0.54585	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.249	0.73529	0.141:0.859:0.0:0.0	.	.	.	.	X	214	.	ENSP00000253159:R214X	R	+	1	2	ZNF236	72712748	0.985000	0.35326	0.661000	0.29709	0.922000	0.55478	2.703000	0.47110	2.697000	0.92050	0.655000	0.94253	CGA		0.463	ZNF236-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000445776.1			50	81	0	0	0	0.01441	0	50	81				
LMNB2	84823	broad.mit.edu	37	19	2438179	2438179	+	Silent	SNP	C	C	T	rs376727524		TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr19:2438179C>T	ENST00000582871.1	-	4	692	c.606G>A	c.(604-606)cgG>cgA	p.R202R	LMNB2_ENST00000325327.3_Silent_p.R222R	NM_032737.3	NP_116126.3	Q03252	LMNB2_HUMAN	lamin B2	202	Coil 1B.|Rod.					lamin filament (GO:0005638)|nuclear inner membrane (GO:0005637)	structural molecule activity (GO:0005198)	p.R202R(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACACACTCTTCCGGAAGTCCA	0.617													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19232	0.0		0.0	False		,,,				2504	0.0						uc002lvy.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(604-606)CGG>CGA		lamin B2		C		1,4405	2.1+/-5.4	0,1,2202	102.0	98.0	99.0		606	-1.8	0.9	19		99	0,8600		0,0,4300	no	coding-synonymous	LMNB2	NM_032737.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		202/601	2438179	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	84823					nuclear inner membrane	structural molecule activity	g.chr19:2438179C>T	M94362	CCDS12090.1, CCDS12090.2	19p13.3	2013-01-16			ENSG00000176619	ENSG00000176619		"""Intermediate filaments type V, lamins"""	6638	protein-coding gene	gene with protein product		150341		LMN2		1630457	Standard	NM_032737		Approved		uc002lvy.4	Q03252	OTTHUMG00000150626	ENST00000582871.1:c.606G>A	19.37:g.2438179C>T						LMNB2_uc002lwa.1_Silent_p.R222R	p.R202R	NM_032737	NP_116126	Q03252	LMNB2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	4	693	-		Hepatocellular(1079;0.137)	202			Rod.|Coil 1B.		O75292|Q14734|Q96DF6	Silent	SNP	ENST00000582871.1	37	c.606G>A																																																																																					0.617	LMNB2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_032737		26	118	0	0	0	0.00632	0	26	118				
THOP1	7064	broad.mit.edu	37	19	2796159	2796159	+	Silent	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr19:2796159G>T	ENST00000307741.6	+	4	662	c.459G>T	c.(457-459)ggG>ggT	p.G153G	THOP1_ENST00000586677.1_Silent_p.G32G	NM_003249.3	NP_003240.1	P52888	THOP1_HUMAN	thimet oligopeptidase 1	153					intracellular signal transduction (GO:0035556)|peptide metabolic process (GO:0006518)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)	p.G153G(1)		NS(1)|central_nervous_system(1)|endometrium(1)|lung(8)|ovary(2)|skin(1)	14				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGAGAAATGGGCTTCACCTCC	0.592																																							uc002lwj.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(457-459)GGG>GGT		thimet oligopeptidase 1							52.0	43.0	46.0					19																	2796159		2202	4299	6501	SO:0001819	synonymous_variant	7064				proteolysis	cytoplasm	metal ion binding|metalloendopeptidase activity|protein binding	g.chr19:2796159G>T		CCDS12095.1	19p13.3	2008-02-05				ENSG00000172009	3.4.24.15		11793	protein-coding gene	gene with protein product		601117				9790774	Standard	NM_003249		Approved		uc002lwj.3	P52888		ENST00000307741.6:c.459G>T	19.37:g.2796159G>T						THOP1_uc010xgz.1_Silent_p.G32G	p.G153G	NM_003249	NP_003240	P52888	THOP1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	4	614	+			153					B3KSE2|Q9UCB3	Silent	SNP	ENST00000307741.6	37	c.459G>T	CCDS12095.1																																																																																				0.592	THOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451587.2			40	17	1	0	1.57019e-19	0.007835	2.18706e-19	40	17				
PIP5K1C	23396	broad.mit.edu	37	19	3641807	3641807	+	Splice_Site	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr19:3641807C>A	ENST00000335312.3	-	15	1771	c.1683G>T	c.(1681-1683)agG>agT	p.R561S	PIP5K1C_ENST00000537021.1_Splice_Site_p.R561S|PIP5K1C_ENST00000589578.1_Splice_Site_p.R561S|PIP5K1C_ENST00000539785.1_Splice_Site_p.R561S	NM_001195733.1|NM_012398.2	NP_001182662.1|NP_036530.1	O60331	PI51C_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type I, gamma	561					actin cytoskeleton organization (GO:0030036)|adherens junction assembly (GO:0034333)|axon guidance (GO:0007411)|clathrin-mediated endocytosis (GO:0072583)|cytoskeletal anchoring at plasma membrane (GO:0007016)|neutrophil chemotaxis (GO:0030593)|phagocytosis (GO:0006909)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet aggregation (GO:0070527)|single organismal cell-cell adhesion (GO:0016337)|small molecule metabolic process (GO:0044281)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle exocytosis (GO:0016079)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|uropod (GO:0001931)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)	p.R561S(1)		large_intestine(3)|ovary(1)|skin(3)|stomach(2)	9		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.95e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0026)|STAD - Stomach adenocarcinoma(1328;0.183)		CCTCCTGCGGCCTGCAGGCAA	0.637																																					Esophageal Squamous(135;99 1744 12852 27186 39851)	Esophageal Squamous(135;99 1744 12852 27186 39851)	uc002lyj.1		NA																	1	Substitution - Missense(1)		lung(1)	stomach(2)|skin(2)	4						c.(1681-1683)AGG>AGT		phosphatidylinositol-4-phosphate 5-kinase, type							71.0	55.0	60.0					19																	3641807		2203	4300	6503	SO:0001630	splice_region_variant	23396				axon guidance	cytosol|plasma membrane	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding	g.chr19:3641807C>A	AB011161	CCDS32872.1, CCDS56074.1, CCDS74257.1	19p13.3	2012-10-02			ENSG00000186111	ENSG00000186111			8996	protein-coding gene	gene with protein product		606102				9535851	Standard	NM_001195733		Approved	PIP5Kgamma, KIAA0589, LCCS3	uc002lyj.2	O60331	OTTHUMG00000180870	ENST00000335312.3:c.1683-1G>T	19.37:g.3641807C>A						PIP5K1C_uc010xhq.1_Missense_Mutation_p.R561S|PIP5K1C_uc010xhr.1_Missense_Mutation_p.R561S	p.R561S	NM_012398	NP_036530	O60331	PI51C_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.95e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0026)|STAD - Stomach adenocarcinoma(1328;0.183)	15	1740	-		Hepatocellular(1079;0.137)	561					B7Z9E7|C6GIJ7|C6GIJ8|Q7LE07	Missense_Mutation	SNP	ENST00000335312.3	37	c.1683G>T	CCDS32872.1	.	.	.	.	.	.	.	.	.	.	C	6.972	0.549255	0.13374	.	.	ENSG00000186111	ENST00000335312;ENST00000539785;ENST00000537021	T;T;T	0.32023	1.54;1.55;1.47	4.63	0.683	0.17998	.	0.124940	0.52532	N	0.000078	T	0.17831	0.0428	L	0.46157	1.445	0.39783	D	0.972326	P;B	0.40083	0.702;0.04	B;B	0.36567	0.228;0.02	T	0.16837	-1.0389	10	0.08179	T	0.78	.	5.3664	0.16115	0.1505:0.5859:0.0:0.2636	.	561;561	O60331-3;O60331	.;PI51C_HUMAN	S	561	ENSP00000335333:R561S;ENSP00000445992:R561S;ENSP00000444779:R561S	ENSP00000335333:R561S	R	-	3	2	PIP5K1C	3592807	1.000000	0.71417	0.996000	0.52242	0.020000	0.10135	2.050000	0.41297	0.388000	0.25054	-0.248000	0.11899	AGG		0.637	PIP5K1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453432.2	NM_012398	Missense_Mutation	39	12	1	0	6.1244e-12	0.007835	7.6377e-12	39	12				
SEMA6B	10501	broad.mit.edu	37	19	4552480	4552480	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr19:4552480C>A	ENST00000586582.1	-	10	1253	c.943G>T	c.(943-945)Ggg>Tgg	p.G315W	SEMA6B_ENST00000301293.3_Missense_Mutation_p.G315W|SEMA6B_ENST00000586965.1_Missense_Mutation_p.G315W	NM_032108.3	NP_115484.2	Q9H3T3	SEM6B_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6B	315	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.G315W(1)		breast(1)|central_nervous_system(2)|large_intestine(4)|lung(11)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCCGGCCCCCGAGGCTGACC	0.627																																							uc010duc.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(943-945)GGG>TGG		semaphorin 6B precursor							16.0	17.0	17.0					19																	4552480		2194	4288	6482	SO:0001583	missense	10501				cell differentiation|nervous system development	integral to membrane	receptor activity	g.chr19:4552480C>A	AB022433	CCDS12131.1	19p13.3	2008-07-22				ENSG00000167680		"""Semaphorins"""	10739	protein-coding gene	gene with protein product	"""Sema VIb"", ""semaphorin Z"", ""semaphorin VIB"""	608873		SEMAN		9361278	Standard	NM_032108		Approved	semaZ, SEMA-VIB, SEM-SEMA-Y	uc010dud.2	Q9H3T3		ENST00000586582.1:c.943G>T	19.37:g.4552480C>A	ENSP00000467290:p.Gly315Trp					SEMA6B_uc010dud.2_Missense_Mutation_p.G315W|SEMA6B_uc010xih.1_Missense_Mutation_p.G315W	p.G315W	NM_032108	NP_115484	Q9H3T3	SEM6B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)	9	981	-		Hepatocellular(1079;0.137)	315			Extracellular (Potential).|Sema.		A5PKU4|F6IB19|Q9NRK9	Missense_Mutation	SNP	ENST00000586582.1	37	c.943G>T	CCDS12131.1	.	.	.	.	.	.	.	.	.	.	.	18.58	3.654852	0.67472	.	.	ENSG00000167680	ENST00000301293;ENST00000301292	T	0.11169	2.8	4.23	4.23	0.50019	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.364606	0.28527	U	0.015034	T	0.29190	0.0726	M	0.71871	2.18	0.33955	D	0.644941	D;D	0.89917	0.998;1.0	D;D	0.83275	0.959;0.996	T	0.40515	-0.9559	10	0.87932	D	0	.	10.0319	0.42105	0.0:0.8994:0.0:0.1006	.	315;315	B4DT36;Q9H3T3	.;SEM6B_HUMAN	W	315	ENSP00000301293:G315W	ENSP00000301292:G315W	G	-	1	0	SEMA6B	4503480	0.342000	0.24809	1.000000	0.80357	0.993000	0.82548	1.113000	0.31184	2.203000	0.70933	0.567000	0.79289	GGG		0.627	SEMA6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458656.2	NM_032108		4	7	1	0	7.48243e-07	0.006214	8.51449e-07	4	7				
OR2Z1	284383	broad.mit.edu	37	19	8841574	8841574	+	Silent	SNP	C	C	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr19:8841574C>T	ENST00000324060.2	+	1	259	c.184C>T	c.(184-186)Ctg>Ttg	p.L62L		NM_001004699.1	NP_001004699.1	Q8NG97	OR2Z1_HUMAN	olfactory receptor, family 2, subfamily Z, member 1	62						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L62L(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CATGTACTTCCTGCTCAGCCA	0.557																																							uc010xkg.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(184-186)CTG>TTG		olfactory receptor, family 2, subfamily Z,							152.0	136.0	141.0					19																	8841574		2203	4300	6503	SO:0001819	synonymous_variant	284383				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr19:8841574C>T	AC008753	CCDS32895.1	19p13.2	2013-09-20	2002-11-13		ENSG00000181733	ENSG00000181733		"""GPCR / Class A : Olfactory receptors"""	15391	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily Z, member 2"""	OR2Z2			Standard	NM_001004699		Approved		uc010xkg.2	Q8NG97	OTTHUMG00000182195	ENST00000324060.2:c.184C>T	19.37:g.8841574C>T							p.L62L	NM_001004699	NP_001004699	Q8NG97	OR2Z1_HUMAN			1	184	+			62			Helical; Name=2; (Potential).		B9EH50|Q6IFK0|Q96R25	Silent	SNP	ENST00000324060.2	37	c.184C>T	CCDS32895.1																																																																																				0.557	OR2Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459954.1			197	48	0	0	0	0.01441	0	197	48				
MUC16	94025	broad.mit.edu	37	19	9067228	9067228	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr19:9067228C>A	ENST00000397910.4	-	3	20421	c.20218G>T	c.(20218-20220)Ggt>Tgt	p.G6740C		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	6742	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.G6740C(2)|p.G2373C(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGAGGAGGACCTGTTCGAGTG	0.502																																							uc002mkp.2		NA																	3	Substitution - Missense(3)		lung(3)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(20218-20220)GGT>TGT		mucin 16							280.0	275.0	277.0					19																	9067228		2193	4281	6474	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9067228C>A	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.20218G>T	19.37:g.9067228C>A	ENSP00000381008:p.Gly6740Cys						p.G6740C	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN			3	20422	-			6742			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.20218G>T	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	3.224	-0.158958	0.06544	.	.	ENSG00000181143	ENST00000397910	T	0.03663	3.85	2.52	0.146	0.14833	.	.	.	.	.	T	0.03871	0.0109	N	0.24115	0.695	.	.	.	D	0.65815	0.995	P	0.50049	0.629	T	0.40232	-0.9574	8	0.87932	D	0	.	3.5826	0.07959	0.0:0.5733:0.2644:0.1624	.	6740	B5ME49	.	C	6740	ENSP00000381008:G6740C	ENSP00000381008:G6740C	G	-	1	0	MUC16	8928228	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.579000	0.05834	0.113000	0.18004	0.386000	0.25728	GGT		0.502	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		335	107	1	0	3.31527e-164	0.01441	5.73488e-164	335	107				
MUC16	94025	broad.mit.edu	37	19	9073450	9073450	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr19:9073450G>T	ENST00000397910.4	-	3	14199	c.13996C>A	c.(13996-13998)Ctt>Att	p.L4666I		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	4668	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.L4666I(2)|p.L299I(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GAGTTTGAAAGTCTACTGCTG	0.453																																							uc002mkp.2		NA																	3	Substitution - Missense(3)		lung(3)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(13996-13998)CTT>ATT		mucin 16							136.0	130.0	132.0					19																	9073450		1907	4123	6030	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9073450G>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.13996C>A	19.37:g.9073450G>T	ENSP00000381008:p.Leu4666Ile						p.L4666I	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN			3	14200	-			4668			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.13996C>A	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	5.298	0.240385	0.10023	.	.	ENSG00000181143	ENST00000397910	T	0.02890	4.12	1.6	-2.22	0.06952	.	.	.	.	.	T	0.02494	0.0076	L	0.43152	1.355	.	.	.	B	0.27656	0.184	B	0.19391	0.025	T	0.41378	-0.9512	8	0.87932	D	0	.	2.6326	0.04949	0.3876:0.2642:0.3482:0.0	.	4666	B5ME49	.	I	4666	ENSP00000381008:L4666I	ENSP00000381008:L4666I	L	-	1	0	MUC16	8934450	0.000000	0.05858	0.000000	0.03702	0.283000	0.27025	-0.278000	0.08490	-0.610000	0.05716	0.313000	0.20887	CTT		0.453	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		18	241	1	0	3.32936e-07	0.006122	3.81897e-07	18	241				
OR1M1	125963	broad.mit.edu	37	19	9204125	9204125	+	Missense_Mutation	SNP	G	G	A	rs202009987		TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr19:9204125G>A	ENST00000429566.3	+	1	271	c.205G>A	c.(205-207)Gtt>Att	p.V69I		NM_001004456.1	NP_001004456.1	Q8NGA1	OR1M1_HUMAN	olfactory receptor, family 1, subfamily M, member 1	69						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V69I(2)		breast(1)|endometrium(4)|large_intestine(3)|lung(17)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32						CCTGTCCCTGGTTGATTTCTG	0.557																																							uc010xkj.1		NA																	2	Substitution - Missense(2)		prostate(1)|lung(1)	skin(3)	3						c.(205-207)GTT>ATT		olfactory receptor, family 1, subfamily M,							108.0	82.0	91.0					19																	9204125		2203	4300	6503	SO:0001583	missense	125963				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr19:9204125G>A		CCDS32896.1	19p13.2	2013-09-20			ENSG00000170929	ENSG00000170929		"""GPCR / Class A : Olfactory receptors"""	8220	protein-coding gene	gene with protein product							Standard	NM_001004456		Approved	OR19-6	uc010xkj.2	Q8NGA1	OTTHUMG00000179930	ENST00000429566.3:c.205G>A	19.37:g.9204125G>A	ENSP00000401966:p.Val69Ile						p.V69I	NM_001004456	NP_001004456	Q8NGA1	OR1M1_HUMAN			1	205	+			69			Helical; Name=2; (Potential).		B9EHA6|Q6IFJ3|Q96R91	Missense_Mutation	SNP	ENST00000429566.3	37	c.205G>A	CCDS32896.1	.	.	.	.	.	.	.	.	.	.	g	11.00	1.509904	0.27036	.	.	ENSG00000170929	ENST00000305465;ENST00000429566	T	0.02916	4.11	3.49	-0.909	0.10514	GPCR, rhodopsin-like superfamily (1);	0.000000	0.50627	D	0.000102	T	0.05960	0.0155	L	0.39397	1.21	0.09310	N	1	D	0.64830	0.994	D	0.70716	0.97	T	0.23154	-1.0196	10	0.54805	T	0.06	.	4.7447	0.13031	0.4655:0.159:0.3755:0.0	.	69	Q8NGA1	OR1M1_HUMAN	I	72;69	ENSP00000401966:V69I	ENSP00000303195:V72I	V	+	1	0	OR1M1	9065125	0.000000	0.05858	0.004000	0.12327	0.429000	0.31625	-5.071000	0.00154	-0.175000	0.10725	-0.508000	0.04489	GTT		0.557	OR1M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448993.1			4	134	0	0	0	0.00308	0	4	134				
COL5A3	50509	broad.mit.edu	37	19	10102485	10102485	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr19:10102485C>A	ENST00000264828.3	-	23	2011	c.1926G>T	c.(1924-1926)caG>caT	p.Q642H		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	642	Triple-helical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)	p.Q642H(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			GGTTTCCCTGCTGTCCCGGAG	0.552																																							uc002mmq.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|lung(1)|central_nervous_system(1)|skin(1)	10						c.(1924-1926)CAG>CAT		collagen, type V, alpha 3 preproprotein							85.0	83.0	84.0					19																	10102485		2203	4300	6503	SO:0001583	missense	50509				collagen fibril organization|skin development	collagen type V	collagen binding|extracellular matrix structural constituent	g.chr19:10102485C>A	AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.1926G>T	19.37:g.10102485C>A	ENSP00000264828:p.Gln642His						p.Q642H	NM_015719	NP_056534	P25940	CO5A3_HUMAN	Epithelial(33;7.11e-05)		23	2012	-			642			Triple-helical region.		Q9NZQ6	Missense_Mutation	SNP	ENST00000264828.3	37	c.1926G>T	CCDS12222.1	.	.	.	.	.	.	.	.	.	.	C	14.12	2.440709	0.43326	.	.	ENSG00000080573	ENST00000264828	D	0.94232	-3.38	4.66	1.29	0.21616	.	0.000000	0.64402	D	0.000002	D	0.93536	0.7937	L	0.45581	1.43	0.46336	D	0.998998	D	0.65815	0.995	D	0.77557	0.99	D	0.90526	0.4492	10	0.44086	T	0.13	.	7.2979	0.26403	0.0:0.6237:0.0:0.3763	.	642	P25940	CO5A3_HUMAN	H	642	ENSP00000264828:Q642H	ENSP00000264828:Q642H	Q	-	3	2	COL5A3	9963485	0.998000	0.40836	1.000000	0.80357	0.460000	0.32559	0.454000	0.21827	0.392000	0.25172	-0.254000	0.11334	CAG		0.552	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315788.1	NM_015719		141	44	1	0	1.99122e-69	0.01441	3.40331e-69	141	44				
CACNA1A	773	broad.mit.edu	37	19	13410132	13410132	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr19:13410132G>T	ENST00000360228.5	-	19	2314	c.2315C>A	c.(2314-2316)tCc>tAc	p.S772Y	CACNA1A_ENST00000573710.2_Missense_Mutation_p.S773Y	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	773					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)	p.S773Y(3)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	CTCCCACACGGACTTGGCTGG	0.562																																							uc010dze.2		NA																	3	Substitution - Missense(3)		lung(3)	large_intestine(2)	2						c.(2317-2319)TCC>TAC		calcium channel, alpha 1A subunit isoform 3	Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)						135.0	137.0	137.0					19																	13410132		2100	4229	6329	SO:0001583	missense	773				cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding	g.chr19:13410132G>T	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.2315C>A	19.37:g.13410132G>T	ENSP00000353362:p.Ser772Tyr					CACNA1A_uc010dzc.2_Missense_Mutation_p.S298Y|CACNA1A_uc002mwy.3_Missense_Mutation_p.S772Y|CACNA1A_uc010xne.1_Missense_Mutation_p.S301Y	p.S773Y	NM_001127221	NP_001120693	O00555	CAC1A_HUMAN	OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		19	2554	-			773			Cytoplasmic (Potential).		J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Missense_Mutation	SNP	ENST00000360228.5	37	c.2318C>A	CCDS45998.1	.	.	.	.	.	.	.	.	.	.	G	16.12	3.031896	0.54790	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084	D	0.96802	-4.13	4.15	4.15	0.48705	.	2.042920	0.02213	N	0.063352	D	0.97645	0.9228	L	0.56199	1.76	0.54753	D	0.999986	P;D;D	0.63880	0.947;0.993;0.976	P;P;P	0.61132	0.453;0.884;0.726	D	0.90985	0.4830	10	0.87932	D	0	.	15.3429	0.74311	0.0:0.0:1.0:0.0	.	773;776;772	O00555;E9PD31;Q9NS88	CAC1A_HUMAN;.;.	Y	772;776;773;773	ENSP00000353362:S772Y	ENSP00000317661:S773Y	S	-	2	0	CACNA1A	13271132	1.000000	0.71417	0.896000	0.35187	0.957000	0.61999	9.364000	0.97136	2.145000	0.66743	0.561000	0.74099	TCC		0.562	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2	NM_000068		110	71	1	0	2.19568e-55	0.01441	3.6939e-55	110	71				
OR7A10	390892	broad.mit.edu	37	19	14952563	14952563	+	Silent	SNP	G	G	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr19:14952563G>A	ENST00000248058.1	-	1	126	c.127C>T	c.(127-129)Ctg>Ttg	p.L43L		NM_001005190.1	NP_001005190.1	O76100	OR7AA_HUMAN	olfactory receptor, family 7, subfamily A, member 10	43						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L43L(1)		NS(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|stomach(1)	19	Ovarian(108;0.203)					ATGATGAGCAGGTTCCCGAGC	0.502																																							uc002mzx.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(127-129)CTG>TTG		olfactory receptor, family 7, subfamily A,							69.0	66.0	67.0					19																	14952563		2203	4297	6500	SO:0001819	synonymous_variant	390892				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr19:14952563G>A		CCDS32936.1	19p13.1	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8356	protein-coding gene	gene with protein product							Standard	NM_001005190		Approved		uc002mzx.1	O76100		ENST00000248058.1:c.127C>T	19.37:g.14952563G>A							p.L43L	NM_001005190	NP_001005190	O76100	OR7AA_HUMAN			1	127	-	Ovarian(108;0.203)		43			Helical; Name=1; (Potential).		Q6IFP0|Q96R97	Silent	SNP	ENST00000248058.1	37	c.127C>T	CCDS32936.1																																																																																				0.502	OR7A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466520.1	NM_001005190		34	22	0	0	0	0.017118	0	34	22				
AD000091.2	0	broad.mit.edu	37	19	15726466	15726466	+	lincRNA	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr19:15726466G>T	ENST00000589196.2	-	0	0				CYP4F8_ENST00000441682.2_RNA														p.P13P(2)									GCCTCAGGCCGGTGGCAGCAT	0.682																																							uc002nbi.2		NA																	2	Substitution - coding silent(2)		large_intestine(1)|lung(1)	large_intestine(1)	1						c.(37-39)CCG>CCT		cytochrome P450, family 4, subfamily F,							25.0	29.0	27.0					19																	15726466		2201	4293	6494			11283				prostaglandin metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	alkane 1-monooxygenase activity|aromatase activity|electron carrier activity|heme binding|oxygen binding|protein binding	g.chr19:15726466G>T																													19.37:g.15726466G>T						CYP4F8_uc010xoi.1_Silent_p.P13P|CYP4F8_uc010xoj.1_5'UTR	p.P13P	NM_007253	NP_009184	P98187	CP4F8_HUMAN			2	103	+			13						Silent	SNP	ENST00000589196.2	37	c.39G>T																																																																																					0.682	AD000091.2-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000460896.2			5	3	1	0	1.50039e-11	0.012319	1.83905e-11	5	3				
ZNF14	7561	broad.mit.edu	37	19	19823805	19823805	+	Silent	SNP	T	T	C			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr19:19823805T>C	ENST00000344099.3	-	4	423	c.285A>G	c.(283-285)gaA>gaG	p.E95E		NM_021030.2	NP_066358.2	P17017	ZNF14_HUMAN	zinc finger protein 14	95					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E95E(1)		breast(1)|cervix(2)|endometrium(1)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	32		Renal(1328;0.0474)				CAGTAAAAGTTTCCTTGTTGA	0.403																																							uc002nnk.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)	3						c.(283-285)GAA>GAG		zinc finger protein 14							142.0	131.0	135.0					19																	19823805		2203	4300	6503	SO:0001819	synonymous_variant	7561				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:19823805T>C	AA286756	CCDS12409.1	19p13.11	2013-01-08	2006-05-10					"""Zinc fingers, C2H2-type"", ""-"""	12924	protein-coding gene	gene with protein product		194556	"""zinc finger protein 14 (KOX 6)"""				Standard	NM_021030		Approved	KOX6, GIOT-4	uc002nnk.1	P17017		ENST00000344099.3:c.285A>G	19.37:g.19823805T>C							p.E95E	NM_021030	NP_066358	P17017	ZNF14_HUMAN			4	439	-		Renal(1328;0.0474)	95					B9EGA4|Q9ULZ5	Silent	SNP	ENST00000344099.3	37	c.285A>G	CCDS12409.1																																																																																				0.403	ZNF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460775.1	NM_021030		4	95	0	0	0	0.014758	0	4	95				
SLC7A10	56301	broad.mit.edu	37	19	33703293	33703293	+	Silent	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr19:33703293C>A	ENST00000253188.4	-	5	839	c.693G>T	c.(691-693)gtG>gtT	p.V231V		NM_019849.2	NP_062823.1	Q9NS82	AAA1_HUMAN	solute carrier family 7 (neutral amino acid transporter light chain, asc system), member 10	231					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|D-alanine transport (GO:0042941)|D-serine transport (GO:0042942)|ion transport (GO:0006811)|L-serine transport (GO:0015825)|leukocyte migration (GO:0050900)|neutral amino acid transport (GO:0015804)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-serine transmembrane transporter activity (GO:0015194)|neutral amino acid transmembrane transporter activity (GO:0015175)	p.V231V(1)		central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(1)|stomach(1)	18	Esophageal squamous(110;0.137)					CCAGGTGTCCCACGGAGGGCG	0.617																																							uc002num.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(691-693)GTG>GTT		solute carrier family 7, member 10							48.0	43.0	45.0					19																	33703293		2203	4300	6503	SO:0001819	synonymous_variant	56301				blood coagulation|cellular nitrogen compound metabolic process|ion transport|leukocyte migration	integral to plasma membrane	L-serine transmembrane transporter activity	g.chr19:33703293C>A	AB037670	CCDS12431.1	19q13.11	2013-05-28	2011-07-12		ENSG00000130876	ENSG00000130876		"""Solute carriers"""	11058	protein-coding gene	gene with protein product		607959				10734121, 10863037	Standard	NM_019849		Approved	asc-1	uc002num.2	Q9NS82	OTTHUMG00000180344	ENST00000253188.4:c.693G>T	19.37:g.33703293C>A						SLC7A10_uc002nul.2_5'Flank|SLC7A10_uc010xrq.1_Silent_p.V204V	p.V231V	NM_019849	NP_062823	Q9NS82	AAA1_HUMAN			5	840	-	Esophageal squamous(110;0.137)		231					B2RE84	Silent	SNP	ENST00000253188.4	37	c.693G>T	CCDS12431.1																																																																																				0.617	SLC7A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450846.2	NM_019849		15	50	1	0	3.52763e-06	0.00499	3.95132e-06	15	50				
PEPD	5184	broad.mit.edu	37	19	33991872	33991872	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr19:33991872G>A	ENST00000244137.7	-	4	398	c.365C>T	c.(364-366)gCc>gTc	p.A122V	PEPD_ENST00000436370.3_Intron|PEPD_ENST00000397032.4_Missense_Mutation_p.A122V	NM_000285.3	NP_000276.2	P12955	PEPD_HUMAN	peptidase D	122					cellular amino acid metabolic process (GO:0006520)|collagen catabolic process (GO:0030574)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)	aminopeptidase activity (GO:0004177)|dipeptidase activity (GO:0016805)|manganese ion binding (GO:0030145)|metallocarboxypeptidase activity (GO:0004181)	p.A122V(1)		endometrium(3)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)	17	Esophageal squamous(110;0.137)					GTCGTCCACGGCATACTTCTC	0.557																																							uc002nur.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(364-366)GCC>GTC		prolidase isoform 1							137.0	144.0	142.0					19																	33991872		2042	4206	6248	SO:0001583	missense	5184				cellular amino acid metabolic process|collagen catabolic process|proteolysis		aminopeptidase activity|dipeptidase activity|manganese ion binding|metallocarboxypeptidase activity	g.chr19:33991872G>A	BC015027	CCDS42544.1, CCDS54244.1, CCDS54245.1	19q13.11	2008-02-05				ENSG00000124299	3.4.13.9		8840	protein-coding gene	gene with protein product	"""prolidase"""	613230				2925654, 1972707	Standard	NM_000285		Approved		uc002nur.4	P12955		ENST00000244137.7:c.365C>T	19.37:g.33991872G>A	ENSP00000244137:p.Ala122Val					PEPD_uc010xrr.1_Missense_Mutation_p.A122V|PEPD_uc010xrs.1_Intron	p.A122V	NM_000285	NP_000276	P12955	PEPD_HUMAN			4	500	-	Esophageal squamous(110;0.137)		122					A8K3Z1|A8K416|A8K696|A8MX47|B4DDB7|B4DGJ1|E9PCE8|Q8TBN9|Q9BT75	Missense_Mutation	SNP	ENST00000244137.7	37	c.365C>T	CCDS42544.1	.	.	.	.	.	.	.	.	.	.	G	12.87	2.068639	0.36470	.	.	ENSG00000124299	ENST00000244137;ENST00000397032	T;T	0.77098	-1.07;-1.07	5.39	5.39	0.77823	Peptidase M24B, X-Pro dipeptidase/aminopeptidase P N-terminal (1);	0.148969	0.64402	D	0.000010	T	0.74427	0.3715	L	0.58925	1.835	0.80722	D	1	B;B	0.17038	0.02;0.017	B;B	0.19666	0.026;0.009	T	0.69450	-0.5142	10	0.32370	T	0.25	-26.8327	14.6656	0.68904	0.0:0.0:1.0:0.0	.	122;122	A8MX47;P12955	.;PEPD_HUMAN	V	122	ENSP00000244137:A122V;ENSP00000380226:A122V	ENSP00000244137:A122V	A	-	2	0	PEPD	38683712	1.000000	0.71417	0.503000	0.27626	0.454000	0.32378	5.746000	0.68681	2.510000	0.84645	0.462000	0.41574	GCC		0.557	PEPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451432.3	NM_000285		5	144	0	0	0	0.014758	0	5	144				
USF2	7392	broad.mit.edu	37	19	35761990	35761990	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr19:35761990A>G	ENST00000222305.3	+	7	710	c.673A>G	c.(673-675)Att>Gtt	p.I225V	USF2_ENST00000594064.1_Missense_Mutation_p.I223V|USF2_ENST00000343550.5_Missense_Mutation_p.I158V|USF2_ENST00000600341.1_3'UTR|USF2_ENST00000595068.1_Missense_Mutation_p.I225V|USF2_ENST00000379134.3_Missense_Mutation_p.I94V	NM_003367.2	NP_003358.1	Q15853	USF2_HUMAN	upstream transcription factor 2, c-fos interacting	225					lactation (GO:0007595)|late viral transcription (GO:0019086)|lipid homeostasis (GO:0055088)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by glucose (GO:0000432)|regulation of transcription from RNA polymerase II promoter by glucose (GO:0000430)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|double-stranded DNA binding (GO:0003690)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I225V(1)		central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(7)|urinary_tract(1)	13	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)		Epithelial(14;7.4e-20)|OV - Ovarian serous cystadenocarcinoma(14;6.47e-19)|all cancers(14;4.17e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)			TTGTAGAAAAATTGATGGAAC	0.483																																					NSCLC(103;173 2832 8890)	NSCLC(103;173 2832 8890)	uc002nyq.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(673-675)ATT>GTT		upstream stimulatory factor 2 isoform 1							80.0	82.0	81.0					19																	35761990		2203	4300	6503	SO:0001583	missense	7392				lipid homeostasis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter by glucose	nucleus	bHLH transcription factor binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity	g.chr19:35761990A>G	AY007087	CCDS12452.1, CCDS12453.1	19q13	2013-05-21				ENSG00000105698		"""Basic helix-loop-helix proteins"""	12594	protein-coding gene	gene with protein product		600390				8954795	Standard	NM_003367		Approved	FIP, bHLHb12	uc002nyq.1	Q15853		ENST00000222305.3:c.673A>G	19.37:g.35761990A>G	ENSP00000222305:p.Ile225Val					USF2_uc010xss.1_Missense_Mutation_p.I225V|USF2_uc002nyr.1_Missense_Mutation_p.I158V|USF2_uc002nys.1_Missense_Mutation_p.I27V|USF2_uc002nyt.1_Missense_Mutation_p.I94V|USF2_uc002nyu.1_Missense_Mutation_p.I27V|USF2_uc002nyv.1_Missense_Mutation_p.I27V	p.I225V	NM_003367	NP_003358	Q15853	USF2_HUMAN	Epithelial(14;7.4e-20)|OV - Ovarian serous cystadenocarcinoma(14;6.47e-19)|all cancers(14;4.17e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)		7	782	+	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)		225					O00671|O00709|Q05750|Q07952|Q15851|Q15852|Q6FI33|Q6YI47	Missense_Mutation	SNP	ENST00000222305.3	37	c.673A>G	CCDS12452.1	.	.	.	.	.	.	.	.	.	.	A	3.304	-0.142295	0.06669	.	.	ENSG00000105698	ENST00000222305;ENST00000343550;ENST00000379134	D;D;D	0.92495	-3.05;-3.04;-3.02	4.02	4.02	0.46733	.	0.166686	0.48767	D	0.000166	T	0.77572	0.4150	N	0.02916	-0.46	0.39105	D	0.96136	B;B;B;B;B	0.11235	0.001;0.003;0.004;0.001;0.001	B;B;B;B;B	0.12837	0.002;0.004;0.008;0.004;0.002	T	0.72609	-0.4241	10	0.07030	T	0.85	.	11.2262	0.48886	1.0:0.0:0.0:0.0	.	223;225;94;158;225	B4DLJ1;Q15853-2;Q6YI47;Q15853-3;Q15853	.;.;.;.;USF2_HUMAN	V	225;158;94	ENSP00000222305:I225V;ENSP00000340633:I158V;ENSP00000368429:I94V	ENSP00000222305:I225V	I	+	1	0	USF2	40453830	1.000000	0.71417	0.998000	0.56505	0.642000	0.38348	2.388000	0.44398	1.816000	0.52996	0.459000	0.35465	ATT		0.483	USF2-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466056.1	NM_003367		35	132	0	0	0	0.021022	0	35	132				
CYP2B6	1555	broad.mit.edu	37	19	41510205	41510205	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr19:41510205T>A	ENST00000324071.4	+	3	345	c.338T>A	c.(337-339)gTg>gAg	p.V113E	CYP2B6_ENST00000598834.1_3'UTR|CYP2B6_ENST00000593831.1_Missense_Mutation_p.V37E|CYP2B6_ENST00000330446.5_Missense_Mutation_p.V73E	NM_000767.4	NP_000758.1	P20813	CP2B6_HUMAN	cytochrome P450, family 2, subfamily B, polypeptide 6	113					cellular ketone metabolic process (GO:0042180)|drug metabolic process (GO:0017144)|exogenous drug catabolic process (GO:0042738)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)	p.V113E(1)		NS(1)|breast(1)|endometrium(5)|kidney(1)|lung(14)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	28			LUSC - Lung squamous cell carcinoma(20;0.00322)		Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Antipyrine(DB01435)|Artemether(DB06697)|Atorvastatin(DB01076)|Azelastine(DB00972)|Benzphetamine(DB00865)|Benzyl alcohol(DB06770)|Bifonazole(DB04794)|Brompheniramine(DB00835)|Bupropion(DB01156)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Cholecalciferol(DB00169)|Cinnarizine(DB00568)|Cisapride(DB00604)|Cisplatin(DB00515)|Citalopram(DB00215)|Clobazam(DB00349)|Clofibrate(DB00636)|Clopidogrel(DB00758)|Clotiazepam(DB01559)|Clotrimazole(DB00257)|Colchicine(DB01394)|Cyclophosphamide(DB00531)|Desipramine(DB01151)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diphenhydramine(DB01075)|Domperidone(DB01184)|Doxorubicin(DB00997)|Efavirenz(DB00625)|Enzalutamide(DB08899)|Epinastine(DB00751)|Erythromycin(DB00199)|Estrone(DB00655)|Ethanol(DB00898)|Ethylmorphine(DB01466)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluoxetine(DB00472)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Fosphenytoin(DB01320)|Halothane(DB01159)|Ifosfamide(DB01181)|Imipramine(DB00458)|Irinotecan(DB00762)|Isoflurane(DB00753)|Itraconazole(DB01167)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Lidocaine(DB00281)|Loperamide(DB00836)|Lopinavir(DB01601)|Lorcaserin(DB04871)|Malathion(DB00772)|Memantine(DB01043)|Methadone(DB00333)|Methimazole(DB00763)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyltestosterone(DB06710)|Mexiletine(DB00379)|Mianserin(DB06148)|Miconazole(DB01110)|Midazolam(DB00683)|Modafinil(DB00745)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicardipine(DB00622)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nitric Oxide(DB00435)|Orphenadrine(DB01173)|Ospemifene(DB04938)|Paroxetine(DB00715)|Perhexiline(DB01074)|Permethrin(DB04930)|Perphenazine(DB00850)|Pethidine(DB00454)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Prasugrel(DB06209)|Primidone(DB00794)|Promethazine(DB01069)|Propofol(DB00818)|Quinidine(DB00908)|Raloxifene(DB00481)|Regorafenib(DB08896)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Ritonavir(DB00503)|Ropivacaine(DB00296)|Roxithromycin(DB00778)|Selegiline(DB01037)|Sertraline(DB01104)|Sevoflurane(DB01236)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sulfaphenazole(DB06729)|Sulfinpyrazone(DB01138)|Tamoxifen(DB00675)|Temazepam(DB00231)|Testosterone(DB00624)|Thiotepa(DB04572)|Ticlopidine(DB00208)|Tramadol(DB00193)|Tretinoin(DB00755)|Valproic Acid(DB00313)|Venlafaxine(DB00285)|Verapamil(DB00661)	ACCCCAGGTGTGATCTTTGCC	0.552																																							uc002opr.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(337-339)GTG>GAG		cytochrome P450, family 2, subfamily B,	Bupropion(DB01156)|Butalbital(DB00241)|Carbamazepine(DB00564)|Clopidogrel(DB00758)|Cyclophosphamide(DB00531)|Efavirenz(DB00625)|Ifosfamide(DB01181)|Memantine(DB01043)|Meperidine(DB00454)|Mephenytoin(DB00532)|Methadone(DB00333)|Methylphenobarbital(DB00849)|Midazolam(DB00683)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicotine(DB00184)|Orphenadrine(DB01173)|Phenytoin(DB00252)|Propofol(DB00818)|Ritonavir(DB00503)|Selegiline(DB01037)|Sertraline(DB01104)|Ticlopidine(DB00208)|Troleandomycin(DB01361)						47.0	44.0	45.0					19																	41510205		2203	4300	6503	SO:0001583	missense	1555				cellular ketone metabolic process|exogenous drug catabolic process|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding	g.chr19:41510205T>A	AF182277	CCDS12570.1	19q13.2	2013-07-25	2003-01-14		ENSG00000197408	ENSG00000197408		"""Cytochrome P450s"""	2615	protein-coding gene	gene with protein product		123930	"""cytochrome P450, subfamily IIB (phenobarbital-inducible), polypeptide 6"", ""cytochrome P450, family 2, subfamily B"", ""cytochrome P450, subfamily IIB (phenobarbital-inducible)"""	CYP2B		7668294, 15128046	Standard	NM_000767		Approved	CPB6, CYPIIB6	uc002opr.1	P20813	OTTHUMG00000182714	ENST00000324071.4:c.338T>A	19.37:g.41510205T>A	ENSP00000324648:p.Val113Glu					CYP2A7_uc002opo.2_Intron|CYP2B6_uc010xvu.1_Missense_Mutation_p.V73E	p.V113E	NM_000767	NP_000758	P20813	CP2B6_HUMAN	LUSC - Lung squamous cell carcinoma(20;0.00322)		3	345	+			113					B4DWP3|Q2V565|Q9UK46	Missense_Mutation	SNP	ENST00000324071.4	37	c.338T>A	CCDS12570.1	.	.	.	.	.	.	.	.	.	.	.	16.83	3.230741	0.58777	.	.	ENSG00000197408	ENST00000324071;ENST00000330446	T;T	0.72051	-0.62;-0.62	3.33	3.33	0.38152	.	0.259259	0.32459	N	0.006066	D	0.84224	0.5425	M	0.89030	3	0.09310	N	1	D;P	0.89917	1.0;0.955	D;D	0.87578	0.998;0.958	T	0.75028	-0.3462	10	0.72032	D	0.01	.	10.1589	0.42840	0.0:0.0:0.0:1.0	.	73;113	B4DWP3;P20813	.;CP2B6_HUMAN	E	113;73	ENSP00000324648:V113E;ENSP00000330650:V73E	ENSP00000324648:V113E	V	+	2	0	CYP2B6	46202045	0.923000	0.31300	0.053000	0.19242	0.141000	0.21300	6.657000	0.74402	1.563000	0.49615	0.240000	0.17902	GTG		0.552	CYP2B6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463260.1	NM_000767		7	19	0	0	0	0.00308	0	7	19				
CYP2A13	1553	broad.mit.edu	37	19	41600880	41600880	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr19:41600880C>T	ENST00000330436.3	+	8	1178	c.1178C>T	c.(1177-1179)cCt>cTt	p.P393L		NM_000766.4	NP_000757.2	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 13	393					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.P393L(1)		breast(3)|endometrium(6)|kidney(4)|large_intestine(8)|lung(13)|ovary(3)|prostate(3)|skin(2)	42					Methoxsalen(DB00553)|Nicotine(DB00184)|Testosterone(DB00624)	GAAGTGTTCCCTATGCTGGGC	0.572																																							uc002opt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(1177-1179)CCT>CTT		cytochrome P450, family 2, subfamily A,	Clomipramine(DB01242)|Nicotine(DB00184)						119.0	105.0	109.0					19																	41600880		2203	4300	6503	SO:0001583	missense	1553				xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|coumarin 7-hydroxylase activity|electron carrier activity|heme binding	g.chr19:41600880C>T	U22028	CCDS12571.1	19q13.2	2013-11-11	2003-01-14		ENSG00000197838	ENSG00000197838		"""Cytochrome P450s"""	2608	protein-coding gene	gene with protein product		608055	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 13"""			7668294, 15128046	Standard	NM_000766		Approved	CPAD, CYP2A	uc002opt.4	Q16696	OTTHUMG00000182762	ENST00000330436.3:c.1178C>T	19.37:g.41600880C>T	ENSP00000332679:p.Pro393Leu						p.P393L	NM_000766	NP_000757	Q16696	CP2AD_HUMAN			8	1187	+			393					Q53YR8|Q6R569|Q6R570|Q9H2X2	Missense_Mutation	SNP	ENST00000330436.3	37	c.1178C>T	CCDS12571.1	.	.	.	.	.	.	.	.	.	.	.	21.1	4.091285	0.76756	.	.	ENSG00000197838	ENST00000330436	T	0.64991	-0.13	4.25	4.25	0.50352	.	0.000000	0.85682	U	0.000000	T	0.75568	0.3867	L	0.58583	1.82	0.54753	D	0.999989	D	0.89917	1.0	D	0.97110	1.0	T	0.78792	-0.2065	10	0.72032	D	0.01	.	15.6095	0.76704	0.0:1.0:0.0:0.0	.	393	Q16696	CP2AD_HUMAN	L	393	ENSP00000332679:P393L	ENSP00000332679:P393L	P	+	2	0	CYP2A13	46292720	0.993000	0.37304	1.000000	0.80357	0.865000	0.49528	5.570000	0.67398	2.213000	0.71641	0.485000	0.47835	CCT		0.572	CYP2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463505.1	NM_000766		38	112	0	0	0	0.006999	0	38	112				
ZNF614	80110	broad.mit.edu	37	19	52519539	52519539	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr19:52519539T>C	ENST00000270649.6	-	5	1856	c.1312A>G	c.(1312-1314)Aca>Gca	p.T438A	ZNF614_ENST00000356322.6_Intron	NM_025040.3	NP_079316.2	Q8N883	ZN614_HUMAN	zinc finger protein 614	438					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T438A(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	24		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00513)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		GTGCGCTTTGTGGTGAAGCCT	0.408																																							uc002pyj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	5						c.(1312-1314)ACA>GCA		zinc finger protein 614							128.0	128.0	128.0					19																	52519539		2203	4300	6503	SO:0001583	missense	80110				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:52519539T>C	BC022246	CCDS12847.1	19q13.41	2013-01-08				ENSG00000142556		"""Zinc fingers, C2H2-type"", ""-"""	24722	protein-coding gene	gene with protein product						12477932	Standard	NM_025040		Approved	FLJ21941	uc002pyj.3	Q8N883		ENST00000270649.6:c.1312A>G	19.37:g.52519539T>C	ENSP00000270649:p.Thr438Ala					ZNF614_uc002pyi.3_Intron|ZNF614_uc010epj.2_Missense_Mutation_p.T141A	p.T438A	NM_025040	NP_079316	Q8N883	ZN614_HUMAN		GBM - Glioblastoma multiforme(134;0.00513)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)	5	1714	-		all_neural(266;0.0505)	438			C2H2-type 8.		Q494T8|Q8TCF4|Q9BSN8	Missense_Mutation	SNP	ENST00000270649.6	37	c.1312A>G	CCDS12847.1	.	.	.	.	.	.	.	.	.	.	T	1.925	-0.447307	0.04572	.	.	ENSG00000142556	ENST00000270649	T	0.22539	1.95	3.5	1.33	0.21861	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.19725	0.0474	L	0.58925	1.835	0.09310	N	1	P	0.44090	0.826	B	0.41946	0.371	T	0.11717	-1.0576	9	0.33940	T	0.23	.	5.4879	0.16759	0.0:0.0992:0.1738:0.727	.	438	Q8N883	ZN614_HUMAN	A	438	ENSP00000270649:T438A	ENSP00000270649:T438A	T	-	1	0	ZNF614	57211351	0.000000	0.05858	0.164000	0.22755	0.901000	0.52897	-1.824000	0.01708	0.010000	0.14839	0.460000	0.39030	ACA		0.408	ZNF614-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462407.1	NM_025040		46	96	0	0	0	0.011902	0	46	96				
ZNF665	79788	broad.mit.edu	37	19	53669109	53669109	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr19:53669109C>A	ENST00000600412.1	-	2	554	c.439G>T	c.(439-441)Ggc>Tgc	p.G147C	ZNF665_ENST00000396424.3_Missense_Mutation_p.G212C|CTD-2245F17.2_ENST00000600257.1_RNA			Q9H7R5	ZN665_HUMAN	zinc finger protein 665	147					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G147C(1)|p.G212C(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	35				GBM - Glioblastoma multiforme(134;0.0196)		AAGGCTTTGCCACACTTATTA	0.393																																							uc010eqm.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(634-636)GGC>TGC		zinc finger protein 665							118.0	129.0	125.0					19																	53669109		2203	4300	6503	SO:0001583	missense	79788				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53669109C>A		CCDS46169.1	19q13.42	2013-01-08				ENSG00000197497		"""Zinc fingers, C2H2-type"", ""-"""	25885	protein-coding gene	gene with protein product							Standard	NM_024733		Approved	FLJ14345	uc010eqm.1	Q9H7R5		ENST00000600412.1:c.439G>T	19.37:g.53669109C>A	ENSP00000469154:p.Gly147Cys						p.G212C	NM_024733	NP_079009	Q9H7R5	ZN665_HUMAN		GBM - Glioblastoma multiforme(134;0.0196)	4	734	-			147			C2H2-type 2.		A8K5T8	Missense_Mutation	SNP	ENST00000600412.1	37	c.634G>T		.	.	.	.	.	.	.	.	.	.	C	13.39	2.224038	0.39300	.	.	ENSG00000197497	ENST00000396424	T	0.37411	1.2	2.44	-1.51	0.08664	.	.	.	.	.	T	0.61640	0.2363	M	0.93898	3.47	0.21984	N	0.999431	D	0.89917	1.0	D	0.87578	0.998	T	0.50849	-0.8779	9	0.87932	D	0	.	4.1041	0.10028	0.1811:0.5891:0.0:0.2298	.	212	Q9H7R5-2	.	C	212	ENSP00000379702:G212C	ENSP00000379702:G212C	G	-	1	0	ZNF665	58360921	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	0.636000	0.24644	-0.401000	0.07644	-0.324000	0.08512	GGC		0.393	ZNF665-002	PUTATIVE	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000464179.1	NM_024733		39	74	1	0	2.75727e-19	0.021022	3.81571e-19	39	74				
KIR3DL2	3812	broad.mit.edu	37	19	55377868	55377868	+	Silent	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr19:55377868G>T	ENST00000326321.3	+	8	1182	c.1149G>T	c.(1147-1149)gtG>gtT	p.V383V	KIR3DL2_ENST00000270442.5_Silent_p.V366V|KIR3DL1_ENST00000402254.2_Silent_p.V383V|RNU6-222P_ENST00000362438.1_RNA	NM_006737.3	NP_006728.2	P43630	KI3L2_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2	383					cellular defense response (GO:0006968)|regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.V383V(2)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	23				GBM - Glioblastoma multiforme(193;0.0192)		ACAGAACAGTGAATAGGCAGG	0.537																																							uc002qhl.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|skin(1)	5						c.(1147-1149)GTG>GTT		SubName: Full=KIR3DS1;							138.0	141.0	140.0					19																	55377868		2203	4300	6503	SO:0001819	synonymous_variant	3811				immune response|regulation of immune response	integral to plasma membrane	HLA-B specific inhibitory MHC class I receptor activity	g.chr19:55377868G>T	L41270	CCDS12906.1, CCDS58677.1	19q13.4	2014-05-22			ENSG00000240403	ENSG00000240403		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6339	protein-coding gene	gene with protein product		604947				7716543, 8662091	Standard	NM_006737		Approved	cl-5, nkat4, nkat4a, nkat4b, CD158K	uc002qho.4	P43630	OTTHUMG00000065935	ENST00000326321.3:c.1149G>T	19.37:g.55377868G>T						KIR3DL2_uc010esh.2_Silent_p.V366V|KIR3DL2_uc002qho.3_Silent_p.V383V	p.V383V			P43629	KI3L1_HUMAN		GBM - Glioblastoma multiforme(193;0.0192)	8	1212	+			383			Cytoplasmic (Potential).		Q13238|Q14947|Q14948|Q92684|Q95366|Q95367|Q95368	Silent	SNP	ENST00000326321.3	37	c.1149G>T	CCDS12906.1																																																																																				0.537	KIR3DL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000141241.1			30	63	1	0	6.00712e-18	0.012213	8.18113e-18	30	63				
TNNI3	7137	broad.mit.edu	37	19	55666160	55666160	+	Silent	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr19:55666160C>A	ENST00000344887.5	-	6	463	c.321G>T	c.(319-321)gtG>gtT	p.V107V	TNNI3_ENST00000590463.1_5'UTR|TNNI3_ENST00000588882.1_Silent_p.V82V|CTD-2587H24.4_ENST00000587871.1_3'UTR	NM_000363.4	NP_000354.4	P19429	TNNI3_HUMAN	troponin I type 3 (cardiac)	107					cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|heart contraction (GO:0060047)|heart development (GO:0007507)|muscle filament sliding (GO:0030049)|negative regulation of ATPase activity (GO:0032780)|regulation of smooth muscle contraction (GO:0006940)|regulation of systemic arterial blood pressure by ischemic conditions (GO:0001980)|vasculogenesis (GO:0001570)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytosol (GO:0005829)|sarcomere (GO:0030017)|troponin complex (GO:0005861)	actin binding (GO:0003779)|calcium channel inhibitor activity (GO:0019855)|calcium-dependent protein binding (GO:0048306)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|troponin C binding (GO:0030172)|troponin T binding (GO:0031014)	p.V107V(1)		endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|pancreas(1)|urinary_tract(1)	12			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		TCTCTTCATCCACCTTGTCCA	0.572																																							uc002qjg.3		NA																	1	Substitution - coding silent(1)		lung(1)	lung(1)|pancreas(1)	2						c.(319-321)GTG>GTT		troponin I, cardiac							139.0	140.0	140.0					19																	55666160		2139	4235	6374	SO:0001819	synonymous_variant	7137				cardiac muscle contraction|cellular calcium ion homeostasis|muscle filament sliding|negative regulation of ATPase activity|regulation of systemic arterial blood pressure by ischemic conditions|vasculogenesis|ventricular cardiac muscle tissue morphogenesis	cytosol|troponin complex	actin binding|calcium channel inhibitor activity|calcium-dependent protein binding|protein domain specific binding|protein kinase binding|troponin C binding|troponin T binding	g.chr19:55666160C>A	M64247	CCDS42628.1	19q13.4	2014-09-17	2005-09-12			ENSG00000129991			11947	protein-coding gene	gene with protein product		191044	"""troponin I, cardiac"", ""cardiomyopathy, dilated 2A (autosomal recessive)"""	CMD2A		9605869, 9241277, 10806205	Standard	NM_000363		Approved	TNNC1, CMH7	uc002qjg.4	P19429		ENST00000344887.5:c.321G>T	19.37:g.55666160C>A						TNNI3_uc010yft.1_Silent_p.V99V	p.V107V	NM_000363	NP_000354	P19429	TNNI3_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)	6	321	-			107						Silent	SNP	ENST00000344887.5	37	c.321G>T	CCDS42628.1																																																																																				0.572	TNNI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452098.1			18	52	1	0	2.21704e-12	0.016522	2.78917e-12	18	52				
ZNF550	162972	broad.mit.edu	37	19	58058519	58058519	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr19:58058519G>A	ENST00000457177.1	-	4	1273	c.1093C>T	c.(1093-1095)Cac>Tac	p.H365Y	ZNF550_ENST00000325134.5_Missense_Mutation_p.H333Y|ZNF549_ENST00000594943.1_Intron|ZNF550_ENST00000601415.1_Intron|ZNF549_ENST00000602149.1_Intron|ZNF550_ENST00000506609.2_Missense_Mutation_p.H324Y			Q7Z398	ZN550_HUMAN	zinc finger protein 550	365					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H324Y(1)		endometrium(1)|large_intestine(1)|lung(4)|prostate(1)	7		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TCCCCAGTGTGAATCCGCTGG	0.522																																							uc002qpe.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(970-972)CAC>TAC		zinc finger protein 550							107.0	87.0	94.0					19																	58058519		2203	4300	6503	SO:0001583	missense	162972				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:58058519G>A	AL833214	CCDS35500.1, CCDS35500.2	19q13.43	2013-05-22			ENSG00000251369	ENSG00000251369		"""Zinc fingers, C2H2-type"""	28643	protein-coding gene	gene with protein product						12477932	Standard	NM_001277090		Approved	MGC41917	uc002qpd.4	Q7Z398	OTTHUMG00000133709	ENST00000457177.1:c.1093C>T	19.37:g.58058519G>A	ENSP00000469679:p.His365Tyr					ZNF547_uc002qpm.3_Intron|ZNF549_uc010eud.1_Intron|ZNF550_uc002qpc.2_RNA|ZNF550_uc010eue.1_RNA|ZNF550_uc002qpd.2_RNA	p.H324Y	NM_001039654	NP_001034743	Q7Z398	ZN550_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)	2	970	-		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)	365			C2H2-type 6.		B3KVF6|O43337|Q7Z6D7|Q8NE45	Missense_Mutation	SNP	ENST00000457177.1	37	c.970C>T		.	.	.	.	.	.	.	.	.	.	G	21.2	4.119765	0.77323	.	.	ENSG00000251369	ENST00000344222;ENST00000325134;ENST00000506609	T;T	0.67523	-0.27;-0.27	3.5	3.5	0.40072	.	.	.	.	.	D	0.86331	0.5907	H	0.95917	3.74	0.35426	D	0.793665	D	0.89917	1.0	D	0.87578	0.998	D	0.92512	0.6017	9	0.87932	D	0	.	12.8976	0.58108	0.0:0.0:1.0:0.0	.	333	Q7Z398-2	.	Y	365;333;324	ENSP00000446224:H333Y;ENSP00000422344:H324Y	ENSP00000446224:H333Y	H	-	1	0	AC003682.1	62750331	1.000000	0.71417	0.845000	0.33349	0.999000	0.98932	8.341000	0.90046	1.952000	0.56665	0.655000	0.94253	CAC		0.522	ZNF550-001	KNOWN	NMD_exception|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000257992.2	NM_153231		15	39	0	0	0	0.00499	0	15	39				
TPO	7173	broad.mit.edu	37	2	1497723	1497723	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr2:1497723G>C	ENST00000345913.4	+	11	2009	c.1918G>C	c.(1918-1920)Gct>Cct	p.A640P	TPO_ENST00000329066.4_Missense_Mutation_p.A640P|TPO_ENST00000382201.3_Missense_Mutation_p.A583P|TPO_ENST00000349624.3_Missense_Mutation_p.A467P|TPO_ENST00000346956.3_Missense_Mutation_p.A640P|TPO_ENST00000497517.2_3'UTR|TPO_ENST00000382198.1_Missense_Mutation_p.A467P|TPO_ENST00000337415.3_Missense_Mutation_p.A640P	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	640					cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)	p.A640P(1)		breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	GGGAGGCTTAGCTGAAAACTT	0.582																																							uc002qww.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|pancreas(6)|skin(5)|lung(1)|kidney(1)	20						c.(1918-1920)GCT>CCT		thyroid peroxidase isoform a	Carbimazole(DB00389)|Methimazole(DB00763)|Propylthiouracil(DB00550)						85.0	83.0	84.0					2																	1497723		2203	4300	6503	SO:0001583	missense	7173				cellular nitrogen compound metabolic process|hormone biosynthetic process|hydrogen peroxide catabolic process	cell surface|cytoplasm|integral to plasma membrane	calcium ion binding|heme binding|iodide peroxidase activity	g.chr2:1497723G>C		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.1918G>C	2.37:g.1497723G>C	ENSP00000318820:p.Ala640Pro					TPO_uc010ewj.2_RNA|TPO_uc002qwu.2_Missense_Mutation_p.A583P|TPO_uc002qwr.2_Missense_Mutation_p.A640P|TPO_uc002qwx.2_Missense_Mutation_p.A583P|TPO_uc010yio.1_Missense_Mutation_p.A467P|TPO_uc010yip.1_Missense_Mutation_p.A640P|TPO_uc002qwy.1_5'UTR|TPO_uc002qwz.2_RNA	p.A640P	NM_000547	NP_000538	P07202	PERT_HUMAN		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	11	2009	+	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)	640			Extracellular (Potential).		P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	c.1918G>C	CCDS1643.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.06|11.06	1.526293|1.526293	0.27299|0.27299	.|.	.|.	ENSG00000115705|ENSG00000115705	ENST00000337415;ENST00000345913;ENST00000346956;ENST00000349624;ENST00000329066;ENST00000382201;ENST00000382198;ENST00000422464;ENST00000469607|ENST00000446278	T;T;T;T;T;T;T;T;T|.	0.72505|.	-0.66;-0.66;-0.66;-0.66;-0.66;-0.66;-0.66;-0.66;-0.66|.	4.84|4.84	3.02|3.02	0.34903|0.34903	.|.	0.379942|.	0.30244|.	N|.	0.010071|.	T|.	0.72684|.	0.3491|.	M|M	0.93283|0.93283	3.4|3.4	0.09310|0.09310	N|N	0.999994|0.999994	D;D;D;D|.	0.76494|.	0.99;0.999;0.99;0.992|.	D;P;P;D|.	0.67382|.	0.918;0.904;0.88;0.951|.	T|.	0.64997|.	-0.6275|.	10|.	0.62326|.	D|.	0.03|.	-11.2645|-11.2645	10.0639|10.0639	0.42292|0.42292	0.2278:0.0:0.7722:0.0|0.2278:0.0:0.7722:0.0	.|.	640;467;583;640|.	P07202-4;P07202-5;P07202-2;P07202|.	.;.;.;PERT_HUMAN|.	P|Y	640;640;640;467;640;583;467;569;114|114	ENSP00000337263:A640P;ENSP00000318820:A640P;ENSP00000263886:A640P;ENSP00000332044:A467P;ENSP00000329869:A640P;ENSP00000371636:A583P;ENSP00000371633:A467P;ENSP00000405788:A569P;ENSP00000419461:A114P|.	ENSP00000329869:A640P|.	A|X	+|+	1|3	0|2	TPO|TPO	1476730|1476730	0.014000|0.014000	0.17966|0.17966	0.001000|0.001000	0.08648|0.08648	0.031000|0.031000	0.12232|0.12232	1.833000|1.833000	0.39161|0.39161	0.561000|0.561000	0.29186|0.29186	0.561000|0.561000	0.74099|0.74099	GCT|TAG		0.582	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547		14	114	0	0	0	0.003163	0	14	114				
PXDN	7837	broad.mit.edu	37	2	1652348	1652348	+	Silent	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr2:1652348C>A	ENST00000252804.4	-	17	3254	c.3204G>T	c.(3202-3204)gcG>gcT	p.A1068A		NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	1068					extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.A1068A(1)		breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		ACCTGAAGGCCGCGGTGGCGA	0.597																																							uc002qxa.2		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(6)|ovary(2)	8						c.(3202-3204)GCG>GCT		peroxidasin precursor							54.0	66.0	62.0					2																	1652348		2189	4279	6468	SO:0001819	synonymous_variant	7837				extracellular matrix organization|hydrogen peroxide catabolic process|immune response	endoplasmic reticulum|extracellular space|proteinaceous extracellular matrix	extracellular matrix structural constituent|heme binding|interleukin-1 receptor antagonist activity|peroxidase activity	g.chr2:1652348C>A	AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.3204G>T	2.37:g.1652348C>A							p.A1068A	NM_012293	NP_036425	Q92626	PXDN_HUMAN		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)	17	3268	-	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)	1068					A8QM65|D6W4Y0|Q4KMG2	Silent	SNP	ENST00000252804.4	37	c.3204G>T	CCDS46221.1																																																																																				0.597	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322505.1	XM_056455		7	79	1	0	0.000274275	0.004482	0.000296383	7	79				
NCOA1	8648	broad.mit.edu	37	2	24920627	24920627	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr2:24920627G>T	ENST00000406961.1	+	11	1561	c.909G>T	c.(907-909)caG>caT	p.Q303H	NCOA1_ENST00000405141.1_Missense_Mutation_p.Q303H|NCOA1_ENST00000348332.3_Missense_Mutation_p.Q303H|NCOA1_ENST00000407230.1_Missense_Mutation_p.Q152H|NCOA1_ENST00000288599.5_Missense_Mutation_p.Q303H|NCOA1_ENST00000395856.3_Missense_Mutation_p.Q303H|NCOA1_ENST00000538539.1_Missense_Mutation_p.Q303H			Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1	303					androgen receptor signaling pathway (GO:0030521)|cellular lipid metabolic process (GO:0044255)|cellular response to hormone stimulus (GO:0032870)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|estrous cycle phase (GO:0060206)|hippocampus development (GO:0021766)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|labyrinthine layer morphogenesis (GO:0060713)|lactation (GO:0007595)|male gonad development (GO:0008584)|male mating behavior (GO:0060179)|ovulation cycle (GO:0042698)|positive regulation of apoptotic process (GO:0043065)|positive regulation of female receptivity (GO:0045925)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by galactose (GO:0000435)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular response to drug (GO:2001038)|response to estradiol (GO:0032355)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription coactivator activity (GO:0001105)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)	p.Q303H(2)	PAX3/NCOA1(8)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(26)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	53	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCCAACCTCAGGGCAGAGAAC	0.378			T	PAX3	alveolar rhadomyosarcoma																																		uc002rfk.2		NA		Dom	yes		2	2p23	8648	T	nuclear receptor coactivator 1			M	PAX3		alveolar rhadomyosarcoma	PAX3/NCOA1(8)	2	Substitution - Missense(2)		lung(2)	soft_tissue(8)|ovary(1)|lung(1)|skin(1)	11						c.(907-909)CAG>CAT		nuclear receptor coactivator 1 isoform 1							126.0	123.0	124.0					2																	24920627		2203	4300	6503	SO:0001583	missense	8648							g.chr2:24920627G>T	U40396	CCDS1712.1, CCDS1713.1, CCDS42660.1	2p23	2011-07-01			ENSG00000084676	ENSG00000084676		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7668	protein-coding gene	gene with protein product		602691				7481822, 9575154	Standard	XM_005264625		Approved	SRC1, F-SRC-1, NCoA-1, KAT13A, RIP160, bHLHe74	uc002rfk.3	Q15788	OTTHUMG00000125523	ENST00000406961.1:c.909G>T	2.37:g.24920627G>T	ENSP00000385216:p.Gln303His					NCOA1_uc010eye.2_Missense_Mutation_p.Q303H|NCOA1_uc002rfi.2_Missense_Mutation_p.Q152H|NCOA1_uc002rfj.2_Missense_Mutation_p.Q303H|NCOA1_uc002rfl.2_Missense_Mutation_p.Q303H	p.Q303H	NM_003743	NP_003734	Q15788	NCOA1_HUMAN			9	1167	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		303					O00150|O43792|O43793|Q13071|Q13420|Q2T9G5|Q53SX3|Q6GVI5|Q7KYV3	Missense_Mutation	SNP	ENST00000406961.1	37	c.909G>T	CCDS1712.1	.	.	.	.	.	.	.	.	.	.	G	12.52	1.962244	0.34659	.	.	ENSG00000084676	ENST00000406961;ENST00000405141;ENST00000407230;ENST00000538539;ENST00000348332;ENST00000288599;ENST00000395856	T;T;T;T;T;T;T	0.17528	2.27;2.27;2.27;2.27;2.27;2.27;2.27	5.74	2.65	0.31530	.	0.173320	0.51477	D	0.000096	T	0.07324	0.0185	N	0.12887	0.27	0.58432	D	0.999997	B;B;B;B	0.28233	0.204;0.029;0.012;0.082	B;B;B;B	0.21708	0.036;0.012;0.02;0.015	T	0.25710	-1.0124	10	0.11794	T	0.64	.	8.3656	0.32385	0.1496:0.0:0.7233:0.1271	.	303;303;303;152	Q15788-3;Q15788;Q15788-2;B5MCN7	.;NCOA1_HUMAN;.;.	H	303;303;152;303;303;303;303	ENSP00000385216:Q303H;ENSP00000385097:Q303H;ENSP00000385195:Q152H;ENSP00000444039:Q303H;ENSP00000320940:Q303H;ENSP00000288599:Q303H;ENSP00000379197:Q303H	ENSP00000288599:Q303H	Q	+	3	2	NCOA1	24774131	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.113000	0.31184	1.457000	0.47850	0.563000	0.77884	CAG		0.378	NCOA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246852.3	NM_147223		40	122	1	0	2.47872e-24	0.010771	3.64169e-24	40	122				
GALNT14	79623	broad.mit.edu	37	2	31360856	31360856	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr2:31360856C>A	ENST00000349752.5	-	1	736	c.97G>T	c.(97-99)Gtg>Ttg	p.V33L	GALNT14_ENST00000420311.2_5'UTR|GALNT14_ENST00000324589.5_Missense_Mutation_p.V33L|GALNT14_ENST00000356174.3_Missense_Mutation_p.V33L	NM_024572.3	NP_078848.2	Q96FL9	GLT14_HUMAN	polypeptide N-acetylgalactosaminyltransferase 14	33					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.V33L(1)		cervix(1)|endometrium(3)|large_intestine(10)|liver(1)|lung(21)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)	43	Acute lymphoblastic leukemia(172;0.155)					CCCGTCGGCACCTCCAACTTC	0.677																																							uc002rnr.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(2)|skin(1)	3						c.(97-99)GTG>TTG		N-acetylgalactosaminyltransferase 14							82.0	73.0	76.0					2																	31360856		2202	4300	6502	SO:0001583	missense	79623					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr2:31360856C>A	AB078144	CCDS1773.2, CCDS58705.1, CCDS58706.1	2p23.2	2014-03-13	2014-03-13		ENSG00000158089	ENSG00000158089	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	22946	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 14"""	608225	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)"""			12507512	Standard	NM_024572		Approved	GalNac-T10, FLJ12691, GalNac-T14	uc002rns.3	Q96FL9	OTTHUMG00000074077	ENST00000349752.5:c.97G>T	2.37:g.31360856C>A	ENSP00000288988:p.Val33Leu					GALNT14_uc002rns.2_Missense_Mutation_p.V33L|GALNT14_uc010ymr.1_5'UTR|GALNT14_uc010ezo.1_Missense_Mutation_p.V33L|GALNT14_uc010ezp.1_Intron	p.V33L	NM_024572	NP_078848	Q96FL9	GLT14_HUMAN			1	716	-	Acute lymphoblastic leukemia(172;0.155)		33			Lumenal (Potential).		B3KV89|Q4ZG75|Q53SU1|Q53TJ0|Q8IVI4|Q9BRH1|Q9H827|Q9H9J8	Missense_Mutation	SNP	ENST00000349752.5	37	c.97G>T	CCDS1773.2	.	.	.	.	.	.	.	.	.	.	C	14.66	2.601532	0.46423	.	.	ENSG00000158089	ENST00000349752;ENST00000324589;ENST00000356174;ENST00000430167	T;T;T;T	0.62639	0.56;0.01;0.42;0.17	4.29	4.29	0.51040	.	.	.	.	.	T	0.51346	0.1669	L	0.36672	1.1	0.80722	D	1	B;B;B	0.25272	0.073;0.122;0.043	B;B;B	0.27608	0.051;0.081;0.023	T	0.45789	-0.9237	9	0.19590	T	0.45	.	13.84	0.63432	0.0:1.0:0.0:0.0	.	33;33;33	Q96FL9-2;Q96FL9-3;Q96FL9	.;.;GLT14_HUMAN	L	33	ENSP00000288988:V33L;ENSP00000314500:V33L;ENSP00000348497:V33L;ENSP00000406399:V33L	ENSP00000314500:V33L	V	-	1	0	GALNT14	31214360	1.000000	0.71417	0.947000	0.38551	0.971000	0.66376	2.408000	0.44574	2.088000	0.63022	0.313000	0.20887	GTG		0.677	GALNT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157264.1	NM_024572		14	66	1	0	6.72482e-11	0.003163	8.10379e-11	14	66				
XDH	7498	broad.mit.edu	37	2	31588955	31588955	+	Silent	SNP	C	C	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr2:31588955C>T	ENST00000379416.3	-	22	2391	c.2343G>A	c.(2341-2343)ttG>ttA	p.L781L		NM_000379.3	NP_000370.2	P47989	XDH_HUMAN	xanthine dehydrogenase	781					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|lactation (GO:0007595)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of gene expression (GO:0010629)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|negative regulation of vasculogenesis (GO:2001213)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)|xanthine catabolic process (GO:0009115)	cytosol (GO:0005829)|extracellular space (GO:0005615)|peroxisome (GO:0005777)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|protein homodimerization activity (GO:0042803)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)|xanthine oxidase activity (GO:0004855)	p.L781L(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(31)|ovary(1)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(1)	74	Acute lymphoblastic leukemia(172;0.155)				Aldesleukin(DB00041)|Allopurinol(DB00437)|Azathioprine(DB00993)|Carboplatin(DB00958)|Carvedilol(DB01136)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Doxorubicin(DB00997)|Flavin adenine dinucleotide(DB03147)|L-Carnitine(DB00583)|Menadione(DB00170)|Mercaptopurine(DB01033)|Nitrofural(DB00336)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Spermine(DB00127)|Trifluoperazine(DB00831)	CTGGAACCCCCAACATTTTTG	0.517																																					Colon(66;682 1445 30109 40147)	Colon(66;682 1445 30109 40147)	uc002rnv.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(4)|breast(2)|ovary(1)|central_nervous_system(1)	8						c.(2341-2343)TTG>TTA		xanthine dehydrogenase	Allopurinol(DB00437)|Carvedilol(DB01136)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Desflurane(DB01189)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|NADH(DB00157)|Nitrofurazone(DB00336)|Papaverine(DB01113)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Rasburicase(DB00049)|Spermine(DB00127)|Trifluoperazine(DB00831)|Vitamin E(DB00163)						129.0	124.0	126.0					2																	31588955		2203	4300	6503	SO:0001819	synonymous_variant	7498				purine nucleotide catabolic process|xanthine catabolic process	cytosol|extracellular region|peroxisome	2 iron, 2 sulfur cluster binding|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|molybdopterin cofactor binding|protein homodimerization activity|xanthine dehydrogenase activity|xanthine oxidase activity	g.chr2:31588955C>T	D11456	CCDS1775.1	2p23.1	2009-07-10	2003-03-20		ENSG00000158125	ENSG00000158125	1.17.1.4		12805	protein-coding gene	gene with protein product		607633	"""xanthene dehydrogenase"""			8224915	Standard	NM_000379		Approved	XOR, XO	uc002rnv.1	P47989	OTTHUMG00000099385	ENST00000379416.3:c.2343G>A	2.37:g.31588955C>T							p.L781L	NM_000379	NP_000370	P47989	XDH_HUMAN			22	2422	-	Acute lymphoblastic leukemia(172;0.155)		781					Q16681|Q16712|Q4PJ16	Silent	SNP	ENST00000379416.3	37	c.2343G>A	CCDS1775.1																																																																																				0.517	XDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216840.1	NM_000379		31	248	0	0	0	0.017118	0	31	248				
DHX57	90957	broad.mit.edu	37	2	39050219	39050219	+	Silent	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr2:39050219G>T	ENST00000295373.6	-	17	3333	c.3207C>A	c.(3205-3207)ggC>ggA	p.G1069G		NM_198963.1	NP_945314.1	Q6P158	DHX57_HUMAN	DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57	1069							ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.G1069G(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(20)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	62		all_hematologic(82;0.248)				ACATTAGTTTGCCAATTCTCA	0.433																																					Melanoma(191;1090 2095 4375 23729 47341)	Melanoma(191;1090 2095 4375 23729 47341)	uc002rrf.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|lung(1)|skin(1)	3						c.(3205-3207)GGC>GGA		DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57							120.0	103.0	109.0					2																	39050219		2203	4300	6503	SO:0001819	synonymous_variant	90957						ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding|zinc ion binding	g.chr2:39050219G>T	AF070590	CCDS1800.1	2p22.3	2008-02-05			ENSG00000163214	ENSG00000163214		"""DEAH-boxes"""	20086	protein-coding gene	gene with protein product							Standard	NM_198963		Approved	DDX57	uc002rrf.3	Q6P158	OTTHUMG00000102103	ENST00000295373.6:c.3207C>A	2.37:g.39050219G>T						DHX57_uc002rrd.3_Silent_p.G453G|DHX57_uc002rre.2_Silent_p.G502G	p.G1069G	NM_198963	NP_945314	Q6P158	DHX57_HUMAN			17	3306	-		all_hematologic(82;0.248)	1069					A2RRC7|Q53SI4|Q6P9G1|Q7Z6H3|Q8NG17|Q96M33	Silent	SNP	ENST00000295373.6	37	c.3207C>A	CCDS1800.1	.	.	.	.	.	.	.	.	.	.	G	6.706	0.498947	0.12762	.	.	ENSG00000163214	ENST00000452978	.	.	.	5.51	3.67	0.42095	.	.	.	.	.	T	0.59878	0.2226	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54938	-0.8218	4	.	.	.	.	10.0627	0.42284	0.0:0.1275:0.4777:0.3948	.	.	.	.	K	393	.	.	Q	-	1	0	DHX57	38903723	0.994000	0.37717	1.000000	0.80357	0.746000	0.42486	0.281000	0.18810	0.662000	0.31006	0.650000	0.86243	CAA		0.433	DHX57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219940.2	NM_145646		22	108	1	0	5.35356e-11	0.016522	6.46951e-11	22	108				
SLC8A1	6546	broad.mit.edu	37	2	40656143	40656143	+	Silent	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr2:40656143G>T	ENST00000403092.1	-	2	1311	c.1278C>A	c.(1276-1278)gcC>gcA	p.A426A	SLC8A1_ENST00000408028.2_Silent_p.A426A|SLC8A1_ENST00000542756.1_Silent_p.A426A|SLC8A1_ENST00000405901.3_Silent_p.A426A|SLC8A1_ENST00000332839.4_Silent_p.A426A|SLC8A1_ENST00000406391.2_Silent_p.A426A|SLC8A1_ENST00000405269.1_Silent_p.A426A|SLC8A1_ENST00000402441.1_Silent_p.A426A|SLC8A1_ENST00000542024.1_Silent_p.A426A|SLC8A1_ENST00000406785.2_Silent_p.A426A			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	426	Calx-beta 1.				blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)	p.A426A(1)		NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	TAATGGTAAGGGCCACAGTAC	0.438																																							uc002rrx.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						c.(1276-1278)GCC>GCA		solute carrier family 8 (sodium/calcium	Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)						105.0	88.0	94.0					2																	40656143		2203	4300	6503	SO:0001819	synonymous_variant	6546				cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding	g.chr2:40656143G>T		CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.1278C>A	2.37:g.40656143G>T						SLC8A1_uc002rry.2_Silent_p.A426A|SLC8A1_uc002rrz.2_Silent_p.A426A|SLC8A1_uc002rsa.2_Silent_p.A426A|SLC8A1_uc002rsd.3_Silent_p.A426A|SLC8A1_uc002rsb.1_Silent_p.A426A|SLC8A1_uc010fan.1_Silent_p.A426A|SLC8A1_uc002rsc.1_Silent_p.A426A	p.A426A	NM_021097	NP_066920	P32418	NAC1_HUMAN			1	1302	-			426			Calx-beta 1.|Cytoplasmic (Potential).		A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Silent	SNP	ENST00000403092.1	37	c.1278C>A	CCDS1806.1																																																																																				0.438	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326065.1	NM_021097		26	103	1	0	3.73988e-18	0.00632	5.12591e-18	26	103				
NRXN1	9378	broad.mit.edu	37	2	50724853	50724853	+	Splice_Site	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr2:50724853C>A	ENST00000406316.2	-	14	3974		c.e14-1		NRXN1_ENST00000401669.2_Splice_Site|NRXN1_ENST00000406859.3_Splice_Site|NRXN1_ENST00000401710.1_5'Flank|NRXN1_ENST00000405472.3_Splice_Site|NRXN1_ENST00000402717.3_Splice_Site|NRXN1_ENST00000404971.1_Splice_Site|NRXN1_ENST00000331040.5_Splice_Site	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1						adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)	p.?(3)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			GCCATTTGACCTAAAAGAGAA	0.373																																							uc010fbq.2		NA																	3	Unknown(3)		lung(3)	ovary(2)	2						c.e14-1		neurexin 1 isoform alpha2 precursor							69.0	63.0	65.0					2																	50724853		1878	4100	5978	SO:0001630	splice_region_variant	9378				angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding	g.chr2:50724853C>A	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.2498-1G>T	2.37:g.50724853C>A						NRXN1_uc002rxb.3_Splice_Site_p.G505_splice|NRXN1_uc002rxe.3_Splice_Site_p.G833_splice|NRXN1_uc002rxc.1_Splice_Site	p.G873_splice	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)		14	4095	-		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)						A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Splice_Site	SNP	ENST00000406316.2	37	c.2618_splice	CCDS54360.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.362100	0.82353	.	.	ENSG00000179915	ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859	.	.	.	5.97	5.97	0.96955	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.434	0.99088	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NRXN1	50578357	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	7.625000	0.83145	2.838000	0.97847	0.561000	0.74099	.		0.373	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2		Intron	4	44	1	0	0.00116845	0.001168	0.00123464	4	44				
NRXN1	9378	broad.mit.edu	37	2	50765556	50765556	+	Missense_Mutation	SNP	C	C	A	rs199939303		TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr2:50765556C>A	ENST00000406316.2	-	10	3454	c.1978G>T	c.(1978-1980)Gct>Tct	p.A660S	NRXN1_ENST00000401669.2_Missense_Mutation_p.A660S|NRXN1_ENST00000406859.3_Missense_Mutation_p.A660S|NRXN1_ENST00000405472.3_Missense_Mutation_p.A652S|NRXN1_ENST00000402717.3_Missense_Mutation_p.A652S|NRXN1_ENST00000404971.1_Missense_Mutation_p.A700S|NRXN1_ENST00000331040.5_5'UTR	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	660	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)	p.A701S(1)|p.A700S(1)|p.A660S(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			TGAACTTCAGCCATTTGCCGG	0.507																																							uc010fbq.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(2)	2						c.(2098-2100)GCT>TCT		neurexin 1 isoform alpha2 precursor							285.0	295.0	292.0					2																	50765556		2188	4294	6482	SO:0001583	missense	9378				angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding	g.chr2:50765556C>A	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.1978G>T	2.37:g.50765556C>A	ENSP00000384311:p.Ala660Ser					NRXN1_uc002rxb.3_Missense_Mutation_p.A332S|NRXN1_uc002rxe.3_Missense_Mutation_p.A660S|NRXN1_uc002rxc.1_RNA	p.A700S	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)		10	3575	-		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Error:Variant_position_missing_in_P58400_after_alignment					A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	ENST00000406316.2	37	c.2098G>T	CCDS54360.1	.	.	.	.	.	.	.	.	.	.	C	31	5.102485	0.94245	.	.	ENSG00000179915	ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859	T;T;T;T;T;T	0.76578	-1.03;-1.03;-1.03;-1.03;-1.03;-1.03	5.0	5.0	0.66597	.	0.110611	0.64402	D	0.000009	D	0.89040	0.6602	M	0.85197	2.74	0.54753	D	0.999988	D;D;D	0.89917	1.0;0.994;0.998	D;D;D	0.91635	0.999;0.965;0.989	D	0.87896	0.2687	10	0.33141	T	0.24	.	18.4909	0.90846	0.0:1.0:0.0:0.0	.	700;660;652	Q9ULB1-3;F8WB18;A7E294	.;.;.	S	700;660;652;660;701;652;660	ENSP00000385142:A700S;ENSP00000384311:A660S;ENSP00000434015:A652S;ENSP00000385017:A660S;ENSP00000385434:A652S;ENSP00000385681:A660S	ENSP00000385017:A660S	A	-	1	0	NRXN1	50619060	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.651000	0.83577	2.596000	0.87737	0.460000	0.39030	GCT		0.507	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2			87	487	1	0	7.63117e-38	0.01441	1.21702e-37	87	487				
MEIS1	4211	broad.mit.edu	37	2	66796217	66796217	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr2:66796217G>A	ENST00000272369.9	+	12	1607	c.1150G>A	c.(1150-1152)Gag>Aag	p.E384K	MEIS1_ENST00000398506.2_Intron|MEIS1_ENST00000444274.2_Intron|MEIS1_ENST00000409517.1_3'UTR|MEIS1_ENST00000495021.2_Missense_Mutation_p.E319K|MEIS1_ENST00000407092.2_Intron|MEIS1_ENST00000488550.1_3'UTR	NM_002398.2	NP_002389.1	O00470	MEIS1_HUMAN	Meis homeobox 1	384	Required for transcriptional activation. {ECO:0000250}.				angiogenesis (GO:0001525)|definitive hemopoiesis (GO:0060216)|lens morphogenesis in camera-type eye (GO:0002089)|megakaryocyte development (GO:0035855)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of neuron differentiation (GO:0045665)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)	p.E384K(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(10)|prostate(2)|skin(1)|urinary_tract(1)	24						TATGGGCATGGAGGGGCAGTG	0.443																																							uc002sdu.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1150-1152)GAG>AAG		Meis homeobox 1							250.0	229.0	236.0					2																	66796217		1892	4111	6003	SO:0001583	missense	4211						sequence-specific DNA binding transcription factor activity	g.chr2:66796217G>A		CCDS46309.1	2p14	2011-06-20	2007-02-15		ENSG00000143995	ENSG00000143995		"""Homeoboxes / TALE class"""	7000	protein-coding gene	gene with protein product		601739	"""Meis1 (mouse) homolog"", ""Meis1, myeloid ecotropic viral integration site 1 homolog (mouse)"""			7565694	Standard	NM_002398		Approved		uc002sdu.3	O00470	OTTHUMG00000150714	ENST00000272369.9:c.1150G>A	2.37:g.66796217G>A	ENSP00000272369:p.Glu384Lys					MEIS1_uc002sdt.2_3'UTR|MEIS1_uc002sdv.2_Intron|MEIS1_uc010yqh.1_Intron|MEIS1_uc010yqi.1_Missense_Mutation_p.E319K|MEIS1_uc002sdw.1_Missense_Mutation_p.E240K	p.E384K	NM_002398	NP_002389	O00470	MEIS1_HUMAN			12	1607	+			384			Required for transcriptional activation (By similarity).		A8MV50	Missense_Mutation	SNP	ENST00000272369.9	37	c.1150G>A	CCDS46309.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.206560	0.79127	.	.	ENSG00000143995	ENST00000272369;ENST00000495021;ENST00000409517	D;D;D	0.93133	-2.11;-2.1;-3.17	6.07	6.07	0.98685	.	0.805822	0.12038	N	0.505294	D	0.91968	0.7456	L	0.48642	1.525	0.80722	D	1	P;P	0.45176	0.852;0.77	B;B	0.39339	0.297;0.101	D	0.90348	0.4364	10	0.41790	T	0.15	.	20.6512	0.99593	0.0:0.0:1.0:0.0	.	319;384	F5GYS8;O00470	.;MEIS1_HUMAN	K	384;319;134	ENSP00000272369:E384K;ENSP00000440571:E319K;ENSP00000386708:E134K	ENSP00000272369:E384K	E	+	1	0	MEIS1	66649721	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.882000	0.98803	0.655000	0.94253	GAG		0.443	MEIS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319725.4	NM_002398		38	266	0	0	0	0.006999	0	38	266				
THNSL2	55258	broad.mit.edu	37	2	88484982	88484982	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr2:88484982G>T	ENST00000324166.5	+	7	2904	c.1213G>T	c.(1213-1215)Gac>Tac	p.D405Y	THNSL2_ENST00000377254.3_Intron|THNSL2_ENST00000343544.4_Intron|THNSL2_ENST00000449349.1_Intron|THNSL2_ENST00000496844.1_Intron|THNSL2_ENST00000402102.1_Intron|THNSL2_ENST00000358591.2_Missense_Mutation_p.D405Y	NM_018271.4	NP_060741.3	Q86YJ6	THNS2_HUMAN	threonine synthase-like 2 (S. cerevisiae)	405					2-oxobutyrate biosynthetic process (GO:0046360)|dephosphorylation (GO:0016311)|serine family amino acid catabolic process (GO:0009071)	extracellular space (GO:0005615)	lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)|serine binding (GO:0070905)	p.D405Y(1)		breast(4)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)	27						CCAGCAGATAGACAGGCAGCA	0.592																																							uc002ssz.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1213-1215)GAC>TAC		threonine synthase-like 2							26.0	28.0	27.0					2																	88484982		2203	4300	6503	SO:0001583	missense	55258				threonine biosynthetic process		threonine synthase activity	g.chr2:88484982G>T		CCDS2002.2, CCDS58718.1, CCDS74539.1	2p11.2	2007-06-20			ENSG00000144115	ENSG00000144115			25602	protein-coding gene	gene with protein product		611261				17034760	Standard	NM_018271		Approved	FLJ10916	uc021vkr.1	Q86YJ6	OTTHUMG00000130314	ENST00000324166.5:c.1213G>T	2.37:g.88484982G>T	ENSP00000327323:p.Asp405Tyr					THNSL2_uc002ssv.2_Intron|THNSL2_uc002ssw.3_Intron|THNSL2_uc002ssx.3_Intron|THNSL2_uc002sta.3_Intron|THNSL2_uc002ssy.3_Missense_Mutation_p.D405Y|THNSL2_uc010fhe.2_Intron	p.D405Y	NM_018271	NP_060741	Q86YJ6	THNS2_HUMAN			8	1366	+			405					B3KTB1|B5MDX8|B7WPF8|D9ZZB8|Q6P2M7|Q6PI27|Q9NV54	Missense_Mutation	SNP	ENST00000324166.5	37	c.1213G>T	CCDS2002.2	.	.	.	.	.	.	.	.	.	.	G	12.45	1.941163	0.34283	.	.	ENSG00000144115	ENST00000358591;ENST00000324166	T;T	0.12672	2.66;2.66	5.8	3.99	0.46301	Threonine synthase (1);Pyridoxal phosphate-dependent enzyme, beta subunit (2);	0.593385	0.18261	N	0.146612	T	0.13114	0.0318	L	0.39147	1.195	0.09310	N	0.999999	B	0.29212	0.237	B	0.30716	0.119	T	0.16012	-1.0417	10	0.62326	D	0.03	.	10.5025	0.44815	0.0691:0.251:0.6799:0.0	.	405	Q86YJ6	THNS2_HUMAN	Y	405	ENSP00000351402:D405Y;ENSP00000327323:D405Y	ENSP00000327323:D405Y	D	+	1	0	THNSL2	88266097	0.099000	0.21834	0.001000	0.08648	0.917000	0.54804	1.166000	0.31834	0.782000	0.33613	0.650000	0.86243	GAC		0.592	THNSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252662.1	NM_018271		5	13	1	0	8.12818e-05	0.001984	8.87275e-05	5	13				
TEKT4	150483	broad.mit.edu	37	2	95539132	95539132	+	Intron	SNP	A	A	G	rs74376788		TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr2:95539132A>G	ENST00000295201.4	+	2	635				AC097374.2_ENST00000568768.1_RNA	NM_144705.2	NP_653306.1	Q8WW24	TEKT4_HUMAN	tektin 4						cell projection organization (GO:0030030)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|motile cilium (GO:0031514)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	28						AGCAGAACTTACACAGTCAGA	0.567																																							uc002stv.1		NA																	0					NA						c.e9+1		Homo sapiens cDNA FLJ44118 fis, clone TESTI4047069.																																				SO:0001627	intron_variant	0							g.chr2:95539132A>G	AK097438	CCDS2005.1	2q11.2	2008-02-05			ENSG00000163060	ENSG00000163060			31012	protein-coding gene	gene with protein product							Standard	XM_005263876		Approved	MGC27019	uc002stw.1	Q8WW24	OTTHUMG00000130396	ENST00000295201.4:c.499-133A>G	2.37:g.95539132A>G						TEKT4_uc002stw.1_Intron|TEKT4_uc010fhr.1_RNA								9		-									Splice_Site	SNP	ENST00000295201.4	37	c.1317_splice	CCDS2005.1																																																																																				0.567	TEKT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252777.1	NM_144705		2	21	0	0	0	0.004672	0	2	21				
DPP10	57628	broad.mit.edu	37	2	116447482	116447482	+	Silent	SNP	C	C	G			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr2:116447482C>G	ENST00000410059.1	+	7	1041	c.561C>G	c.(559-561)gtC>gtG	p.V187V	DPP10_ENST00000409163.1_Silent_p.V137V|DPP10_ENST00000488208.1_3'UTR|DPP10_ENST00000310323.8_Silent_p.V180V|DPP10_ENST00000393147.2_Silent_p.V191V	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	187						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)	p.V180V(1)|p.V187V(1)		breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						CCTGGGGTGTCCAAGGGCAGC	0.443																																							uc002tla.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						c.(559-561)GTC>GTG		dipeptidyl peptidase 10 isoform long							73.0	81.0	78.0					2																	116447482		2203	4300	6503	SO:0001819	synonymous_variant	57628				proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity	g.chr2:116447482C>G	AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.561C>G	2.37:g.116447482C>G						DPP10_uc002tlb.1_Silent_p.V137V|DPP10_uc002tlc.1_Silent_p.V183V|DPP10_uc002tle.2_Silent_p.V191V|DPP10_uc002tlf.1_Silent_p.V180V	p.V187V	NM_020868	NP_065919	Q8N608	DPP10_HUMAN			7	1018	+			187			Extracellular (Potential).		A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Silent	SNP	ENST00000410059.1	37	c.561C>G	CCDS46400.1																																																																																				0.443	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4	NM_020868		3	81	0	0	0	0.009096	0	3	81				
CNTNAP5	129684	broad.mit.edu	37	2	125367481	125367481	+	Silent	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr2:125367481G>T	ENST00000431078.1	+	12	2221	c.1857G>T	c.(1855-1857)gtG>gtT	p.V619V		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	619	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.V619V(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		CTCTCCAGGTGTACTGCAATA	0.527																																							uc002tno.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(10)	10						c.(1855-1857)GTG>GTT		contactin associated protein-like 5 precursor							65.0	64.0	64.0					2																	125367481		1877	4113	5990	SO:0001819	synonymous_variant	129684				cell adhesion|signal transduction	integral to membrane	receptor binding	g.chr2:125367481G>T	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.1857G>T	2.37:g.125367481G>T						CNTNAP5_uc010flu.2_Silent_p.V620V	p.V619V	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.248)	12	2221	+			619			Extracellular (Potential).|Fibrinogen C-terminal.		Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Silent	SNP	ENST00000431078.1	37	c.1857G>T	CCDS46401.1																																																																																				0.527	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3			3	65	1	0	0.004672	0.004672	0.00488851	3	65				
POTEE	445582	broad.mit.edu	37	2	132021859	132021859	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr2:132021859A>T	ENST00000356920.5	+	15	2925	c.2831A>T	c.(2830-2832)gAt>gTt	p.D944V	PLEKHB2_ENST00000303908.3_Intron|PLEKHB2_ENST00000404460.1_Intron|POTEE_ENST00000358087.5_3'UTR	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	944	Actin-like.				retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.D944V(1)									GAGCTGCCCGATGGCCAGGTC	0.602																																							uc002tsn.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2830-2832)GAT>GTT		protein expressed in prostate, ovary, testis,							51.0	60.0	57.0					2																	132021859		2091	4109	6200	SO:0001583	missense	445582						ATP binding	g.chr2:132021859A>T	AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.2831A>T	2.37:g.132021859A>T	ENSP00000439189:p.Asp944Val					PLEKHB2_uc002tsh.2_Intron|POTEE_uc002tsk.2_Missense_Mutation_p.D544V|POTEE_uc002tsl.2_Missense_Mutation_p.D526V|POTEE_uc010fmy.1_Missense_Mutation_p.D408V	p.D944V	NM_001083538	NP_001077007	Q6S8J3	POTEE_HUMAN			15	2883	+			944			Actin-like.		Q6S8J4|Q6S8J5|Q6S8J8	Missense_Mutation	SNP	ENST00000356920.5	37	c.2831A>T	CCDS46414.1	.	.	.	.	.	.	.	.	.	.	.	15.20	2.762812	0.49574	.	.	ENSG00000188219	ENST00000356920	D	0.97941	-4.62	.	.	.	.	.	.	.	.	D	0.99202	0.9723	H	0.99956	5.05	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	D	0.95979	0.8976	8	0.87932	D	0	.	4.5487	0.12098	0.9994:0.0:6.0E-4:0.0	.	944	Q6S8J3	POTEE_HUMAN	V	944	ENSP00000439189:D944V	ENSP00000439189:D944V	D	+	2	0	AC131180.1	131738329	1.000000	0.71417	0.271000	0.24616	0.276000	0.26787	6.177000	0.71961	0.103000	0.17682	0.102000	0.15555	GAT		0.602	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001083538		26	169	0	0	0	0.005524	0	26	169				
NCKAP5	344148	broad.mit.edu	37	2	133721313	133721313	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr2:133721313C>A	ENST00000409261.1	-	8	932	c.559G>T	c.(559-561)Gag>Tag	p.E187*	NCKAP5_ENST00000405974.3_Nonsense_Mutation_p.E187*|NCKAP5_ENST00000409213.1_Nonsense_Mutation_p.E187*|NCKAP5_ENST00000317721.6_Nonsense_Mutation_p.E187*	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	187								p.E187*(1)|p.E26*(1)		NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						TTCAATCTCTCTAATAGCAAT	0.373																																							uc002ttp.2		NA																	2	Substitution - Nonsense(2)		lung(2)		0						c.(559-561)GAG>TAG		Nck-associated protein 5 isoform 1							155.0	151.0	152.0					2																	133721313		1857	4101	5958	SO:0001587	stop_gained	344148						protein binding	g.chr2:133721313C>A	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.559G>T	2.37:g.133721313C>A	ENSP00000387128:p.Glu187*					NCKAP5_uc002ttq.2_Nonsense_Mutation_p.E187*|NCKAP5_uc002tts.1_Nonsense_Mutation_p.E162*	p.E187*	NM_207363	NP_997246	O14513	NCKP5_HUMAN			8	933	-			187			Potential.		B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Nonsense_Mutation	SNP	ENST00000409261.1	37	c.559G>T	CCDS46418.1	.	.	.	.	.	.	.	.	.	.	C	40	7.980206	0.98594	.	.	ENSG00000176771	ENST00000409261;ENST00000409213;ENST00000317721;ENST00000405974;ENST00000537661;ENST00000542834	.	.	.	5.4	3.58	0.41010	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	.	7.2089	0.25923	0.1691:0.7436:0.0:0.0873	.	.	.	.	X	187;187;187;187;187;162	.	ENSP00000380603:E187X	E	-	1	0	NCKAP5	133437783	0.998000	0.40836	0.996000	0.52242	0.968000	0.65278	1.815000	0.38981	0.821000	0.34540	0.650000	0.86243	GAG		0.373	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481		31	53	1	0	2.29764e-31	0.017118	3.55844e-31	31	53				
LY75	4065	broad.mit.edu	37	2	160663639	160663639	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr2:160663639C>A	ENST00000263636.4	-	34	4862	c.4835G>T	c.(4834-4836)aGt>aTt	p.S1612I	LY75_ENST00000553424.1_Intron|LY75-CD302_ENST00000504764.1_Missense_Mutation_p.S1612I|LY75_ENST00000554112.1_Missense_Mutation_p.S1612I|LY75-CD302_ENST00000505052.1_Intron	NM_002349.3	NP_002340.2	O60449	LY75_HUMAN	lymphocyte antigen 75	1612	C-type lectin 10. {ECO:0000255|PROSITE- ProRule:PRU00040}.				endocytosis (GO:0006897)|immune response (GO:0006955)|inflammatory response (GO:0006954)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)	p.S1612I(1)		NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(22)|prostate(7)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	59				COAD - Colon adenocarcinoma(177;0.132)		ATCTAACCAACTCCAAGACTG	0.368																																							uc002ubc.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(4834-4836)AGT>ATT		lymphocyte antigen 75 precursor							113.0	105.0	108.0					2																	160663639		2203	4300	6503	SO:0001583	missense	4065				endocytosis|immune response|inflammatory response	integral to plasma membrane	receptor activity|sugar binding	g.chr2:160663639C>A	AF011333	CCDS2211.1	2q24	2011-08-30			ENSG00000054219	ENSG00000054219		"""CD molecules"", ""C-type lectin domain containing"""	6729	protein-coding gene	gene with protein product		604524				9553150	Standard	NM_002349		Approved	DEC-205, CLEC13B, CD205		O60449	OTTHUMG00000132025	ENST00000263636.4:c.4835G>T	2.37:g.160663639C>A	ENSP00000263636:p.Ser1612Ile					LY75_uc002ubb.3_Missense_Mutation_p.S1612I|LY75_uc010fos.2_Intron	p.S1612I	NM_002349	NP_002340	O60449	LY75_HUMAN		COAD - Colon adenocarcinoma(177;0.132)	34	4904	-			1612			Extracellular (Potential).|C-type lectin 10.		O75913|Q53R46|Q53TF5|Q7Z575|Q7Z577	Missense_Mutation	SNP	ENST00000263636.4	37	c.4835G>T	CCDS2211.1	.	.	.	.	.	.	.	.	.	.	C	15.30	2.792682	0.50102	.	.	ENSG00000054219;ENSG00000054219;ENSG00000248672	ENST00000554112;ENST00000263636;ENST00000504764	T;T;T	0.07688	3.17;3.17;3.17	5.38	0.223	0.15292	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.647462	0.12703	N	0.446183	T	0.12646	0.0307	L	0.58810	1.83	0.80722	D	1	B;P	0.49559	0.381;0.925	B;P	0.48227	0.157;0.571	T	0.14309	-1.0477	10	0.46703	T	0.11	-5.5376	9.1684	0.37065	0.0:0.2345:0.0:0.7655	.	1612;1612	O60449;O60449-2	LY75_HUMAN;.	I	1612	ENSP00000451511:S1612I;ENSP00000263636:S1612I;ENSP00000423463:S1612I	ENSP00000423463:S1612I	S	-	2	0	LY75;LY75-CD302	160371885	0.934000	0.31675	0.998000	0.56505	0.993000	0.82548	-0.222000	0.09190	-0.045000	0.13468	0.563000	0.77884	AGT		0.368	LY75-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255035.1			22	28	1	0	1.55795e-14	0.012319	2.03149e-14	22	28				
GRB14	2888	broad.mit.edu	37	2	165364995	165364995	+	Silent	SNP	C	C	T	rs199902676	byFrequency	TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr2:165364995C>T	ENST00000263915.3	-	8	1531	c.993G>A	c.(991-993)acG>acA	p.T331T	GRB14_ENST00000543549.1_Silent_p.T244T	NM_004490.2	NP_004481.2	Q14449	GRB14_HUMAN	growth factor receptor-bound protein 14	331	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				blood coagulation (GO:0007596)|leukocyte migration (GO:0050900)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)	p.T331T(1)		breast(3)|endometrium(2)|large_intestine(6)|lung(10)|ovary(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	32						TCACCCAGCACGTCCTACTCT	0.458													C|||	3	0.000599042	0.0	0.0	5008	,	,		16583	0.0		0.001	False		,,,				2504	0.002						uc002ucl.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|upper_aerodigestive_tract(1)|lung(1)	7						c.(991-993)ACG>ACA		growth factor receptor-bound protein 14							95.0	92.0	93.0					2																	165364995		2203	4300	6503	SO:0001819	synonymous_variant	2888				blood coagulation|leukocyte migration	cytosol|endosome membrane|Golgi membrane|microsome|plasma membrane	SH3/SH2 adaptor activity	g.chr2:165364995C>T		CCDS2222.1	2q22-q24	2013-02-14			ENSG00000115290	ENSG00000115290		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4565	protein-coding gene	gene with protein product		601524				8812444	Standard	XM_005246477		Approved		uc002ucl.3	Q14449	OTTHUMG00000132135	ENST00000263915.3:c.993G>A	2.37:g.165364995C>T						GRB14_uc010zcv.1_Silent_p.T244T|GRB14_uc002ucm.2_RNA	p.T331T	NM_004490	NP_004481	Q14449	GRB14_HUMAN			8	1534	-			331			PH.		B7Z7F9|Q7Z6I1	Silent	SNP	ENST00000263915.3	37	c.993G>A	CCDS2222.1																																																																																				0.458	GRB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255180.2			8	42	0	0	0	0.00308	0	8	42				
XIRP2	129446	broad.mit.edu	37	2	168107680	168107680	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr2:168107680G>T	ENST00000409195.1	+	9	9867	c.9778G>T	c.(9778-9780)Gag>Tag	p.E3260*	XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000295237.9_Nonsense_Mutation_p.E3260*|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409273.1_Nonsense_Mutation_p.E3038*	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	3085					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)		p.E3260*(1)		NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						GGACGCTCAAGAGGAAATCAG	0.423																																							uc002udx.2		NA																	1	Substitution - Nonsense(1)	p.E3260G(1)	lung(1)	skin(7)|ovary(6)|pancreas(1)	14						c.(9778-9780)GAG>TAG		xin actin-binding repeat containing 2 isoform 1							66.0	62.0	64.0					2																	168107680		1899	4129	6028	SO:0001587	stop_gained	129446				actin cytoskeleton organization	cell junction	actin binding	g.chr2:168107680G>T	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.9778G>T	2.37:g.168107680G>T	ENSP00000386840:p.Glu3260*					XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Nonsense_Mutation_p.E3085*|XIRP2_uc010fpq.2_Nonsense_Mutation_p.E3038*|XIRP2_uc010fpr.2_Intron	p.E3260*	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN			8	9796	+			3085					A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Nonsense_Mutation	SNP	ENST00000409195.1	37	c.9778G>T	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	G	50	16.664426	0.99869	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273;ENST00000413534	.	.	.	5.61	5.61	0.85477	.	0.050567	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-10.5571	18.7693	0.91885	0.0:0.0:1.0:0.0	.	.	.	.	X	3260;3260;3038;674	.	ENSP00000295237:E3260X	E	+	1	0	XIRP2	167815926	1.000000	0.71417	1.000000	0.80357	0.184000	0.23303	7.996000	0.88334	2.805000	0.96524	0.460000	0.39030	GAG		0.423	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381		23	68	1	0	9.95505e-16	0.014323	1.31004e-15	23	68				
LRP2	4036	broad.mit.edu	37	2	170101331	170101331	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr2:170101331C>A	ENST00000263816.3	-	22	3587	c.3302G>T	c.(3301-3303)tGc>tTc	p.C1101F	LRP2_ENST00000443831.1_Missense_Mutation_p.C964F	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	1101	LDL-receptor class A 9. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.C1101F(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	GTGGGTGGGGCAGTTGTGCTC	0.532																																							uc002ues.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29						c.(3301-3303)TGC>TTC		low density lipoprotein-related protein 2	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)						241.0	187.0	205.0					2																	170101331		2203	4300	6503	SO:0001583	missense	4036				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding	g.chr2:170101331C>A		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.3302G>T	2.37:g.170101331C>A	ENSP00000263816:p.Cys1101Phe					LRP2_uc010zdf.1_Missense_Mutation_p.C964F	p.C1101F	NM_004525	NP_004516	P98164	LRP2_HUMAN		STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	22	3515	-			1101			LDL-receptor class A 9.|Extracellular (Potential).		O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	c.3302G>T	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.561081	0.86335	.	.	ENSG00000081479	ENST00000263816;ENST00000443831	D;D	0.99919	-8.0;-8.0	6.06	6.06	0.98353	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99951	0.9979	H	0.97516	4.02	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.96450	0.9333	10	0.87932	D	0	.	20.6397	0.99537	0.0:1.0:0.0:0.0	.	964;1101	E9PC35;P98164	.;LRP2_HUMAN	F	1101;964	ENSP00000263816:C1101F;ENSP00000409813:C964F	ENSP00000263816:C1101F	C	-	2	0	LRP2	169809577	1.000000	0.71417	0.951000	0.38953	0.524000	0.34500	7.760000	0.85248	2.880000	0.98712	0.650000	0.86243	TGC		0.532	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525		51	151	1	0	7.36392e-32	0.01441	1.14877e-31	51	151				
TTN	7273	broad.mit.edu	37	2	179616220	179616220	+	Intron	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr2:179616220C>A	ENST00000591111.1	-	45	10585				TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000360870.5_Missense_Mutation_p.R3636M|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000589042.1_Intron|TTN_ENST00000342992.6_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCCAGTAAACCTCAGGTCAAC	0.368																																							uc002unb.2		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(10906-10908)AGG>ATG		titin isoform novex-3							152.0	147.0	149.0					2																	179616220		2203	4300	6503	SO:0001627	intron_variant	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179616220C>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10360+1630G>T	2.37:g.179616220C>A						TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	p.R3636M	NM_133379	NP_596870	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		46	11131	-			9485					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.10907G>T		.	.	.	.	.	.	.	.	.	.	C	13.92	2.381166	0.42207	.	.	ENSG00000155657	ENST00000360870	T	0.66815	-0.23	5.58	5.58	0.84498	.	.	.	.	.	T	0.70116	0.3187	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	T	0.67317	-0.5701	9	0.33940	T	0.23	.	12.8408	0.57802	0.0:0.9244:0.0:0.0756	.	3636	Q8WZ42-6	.	M	3636	ENSP00000354117:R3636M	ENSP00000354117:R3636M	R	-	2	0	TTN	179324465	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.996000	0.70639	2.780000	0.95670	0.655000	0.94253	AGG		0.368	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		24	97	1	0	1.96895e-08	0.016522	2.28291e-08	24	97				
COL5A2	1290	broad.mit.edu	37	2	189914102	189914102	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr2:189914102T>A	ENST00000374866.3	-	44	3392	c.3118A>T	c.(3118-3120)Aat>Tat	p.N1040Y		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	1040					axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)	p.N1040Y(1)		NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			ACAGGACCATTGGAGCCTGGG	0.453																																							uc002uqk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(3118-3120)AAT>TAT		alpha 2 type V collagen preproprotein							54.0	52.0	53.0					2																	189914102		2202	4300	6502	SO:0001583	missense	1290				axon guidance|collagen fibril organization|eye morphogenesis|skin development	collagen type V	extracellular matrix structural constituent	g.chr2:189914102T>A	Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.3118A>T	2.37:g.189914102T>A	ENSP00000364000:p.Asn1040Tyr					COL5A2_uc010frx.2_Missense_Mutation_p.N616Y	p.N1040Y	NM_000393	NP_000384	P05997	CO5A2_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)		44	3393	-			1040					P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Missense_Mutation	SNP	ENST00000374866.3	37	c.3118A>T	CCDS33350.1	.	.	.	.	.	.	.	.	.	.	T	16.33	3.092275	0.55968	.	.	ENSG00000204262	ENST00000374866;ENST00000452536	D	0.94330	-3.4	5.6	4.44	0.53790	.	0.334454	0.25352	N	0.031292	D	0.92980	0.7766	L	0.54323	1.7	0.42656	D	0.993469	P;P	0.40360	0.679;0.714	B;P	0.48063	0.146;0.565	D	0.91247	0.5026	9	.	.	.	.	13.0396	0.58891	0.0:0.0:0.1344:0.8656	.	680;1040	Q5PR22;P05997	.;CO5A2_HUMAN	Y	1040;680	ENSP00000364000:N1040Y	.	N	-	1	0	COL5A2	189622347	0.998000	0.40836	0.462000	0.27118	0.763000	0.43281	2.945000	0.49043	1.121000	0.41925	0.524000	0.50904	AAT		0.453	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313523.1	NM_000393		11	6	0	0	0	0.016723	0	11	6				
DNAH7	56171	broad.mit.edu	37	2	196834820	196834820	+	Splice_Site	SNP	T	T	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr2:196834820T>A	ENST00000312428.6	-	17	2159		c.e17-2			NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7						cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)	p.?(1)		NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						ACACCGTAACTAATAAAAACA	0.308																																							uc002utj.3		NA																	1	Unknown(1)		lung(1)	skin(10)|ovary(2)	12						c.e17-1		dynein, axonemal, heavy chain 7							72.0	66.0	68.0					2																	196834820		1801	4055	5856	SO:0001630	splice_region_variant	56171				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr2:196834820T>A	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.2059-2A>T	2.37:g.196834820T>A							p.L687_splice	NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN			17	2160	-								B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Splice_Site	SNP	ENST00000312428.6	37	c.2059_splice	CCDS42794.1	.	.	.	.	.	.	.	.	.	.	T	17.07	3.296167	0.60086	.	.	ENSG00000118997	ENST00000312428	.	.	.	5.51	5.51	0.81932	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5761	0.76387	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	DNAH7	196543065	1.000000	0.71417	0.973000	0.42090	0.496000	0.33645	7.155000	0.77445	2.226000	0.72624	0.482000	0.46254	.		0.308	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897	Intron	22	24	0	0	0	0.004656	0	22	24				
SATB2	23314	broad.mit.edu	37	2	200213530	200213530	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr2:200213530G>T	ENST00000417098.1	-	7	1883	c.1067C>A	c.(1066-1068)tCt>tAt	p.S356Y	SATB2_ENST00000428695.1_Missense_Mutation_p.S238Y|SATB2_ENST00000260926.5_Missense_Mutation_p.S356Y|SATB2_ENST00000443023.1_Missense_Mutation_p.S297Y|SATB2_ENST00000457245.1_Missense_Mutation_p.S356Y	NM_001172509.1	NP_001165980.1	Q9UPW6	SATB2_HUMAN	SATB homeobox 2	356					cartilage development (GO:0051216)|cellular response to organic substance (GO:0071310)|chromatin remodeling (GO:0006338)|embryonic pattern specification (GO:0009880)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|osteoblast development (GO:0002076)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)	p.S356Y(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(40)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						TTCCACGGAAGAGTTGGTTGG	0.547																																					Colon(30;262 767 11040 24421 36230)	Colon(30;262 767 11040 24421 36230)	uc002uuy.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1066-1068)TCT>TAT		SATB homeobox 2							185.0	175.0	179.0					2																	200213530		2203	4300	6503	SO:0001583	missense	23314					cytoplasm|nuclear matrix	sequence-specific DNA binding transcription factor activity	g.chr2:200213530G>T	AB028957	CCDS2327.1	2q33.1	2011-06-20	2007-02-15		ENSG00000119042	ENSG00000119042		"""Homeoboxes / CUT class"""	21637	protein-coding gene	gene with protein product		608148	"""SATB family member 2"""				Standard	NM_015265		Approved	KIAA1034, FLJ21474	uc002uva.2	Q9UPW6	OTTHUMG00000132767	ENST00000417098.1:c.1067C>A	2.37:g.200213530G>T	ENSP00000401112:p.Ser356Tyr					SATB2_uc010fsq.1_Missense_Mutation_p.S238Y|SATB2_uc002uuz.1_Missense_Mutation_p.S356Y|SATB2_uc002uva.1_Missense_Mutation_p.S356Y|SATB2_uc002uvb.1_Missense_Mutation_p.S99Y	p.S356Y	NM_015265	NP_056080	Q9UPW6	SATB2_HUMAN			7	1884	-			356			CUT 1.		A8K5Z8|Q3ZB87|Q4V763	Missense_Mutation	SNP	ENST00000417098.1	37	c.1067C>A	CCDS2327.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.823967	0.90873	.	.	ENSG00000119042	ENST00000417098;ENST00000443023;ENST00000260926;ENST00000428695;ENST00000457245	T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78	5.72	5.72	0.89469	Homeodomain protein CUT (2);Lambda repressor-like, DNA-binding (1);	0.210209	0.41500	D	0.000867	T	0.63105	0.2483	L	0.40543	1.245	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.984	D;D;P	0.72338	0.972;0.977;0.823	T	0.64136	-0.6478	10	0.87932	D	0	-9.5047	19.8861	0.96913	0.0:0.0:1.0:0.0	.	238;104;356	Q3ZB87;Q9H726;Q9UPW6	.;.;SATB2_HUMAN	Y	356;297;356;238;356	ENSP00000401112:S356Y;ENSP00000388764:S297Y;ENSP00000260926:S356Y;ENSP00000388581:S238Y;ENSP00000405420:S356Y	ENSP00000260926:S356Y	S	-	2	0	SATB2	199921775	1.000000	0.71417	0.999000	0.59377	0.976000	0.68499	7.958000	0.87877	2.711000	0.92665	0.655000	0.94253	TCT		0.547	SATB2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256140.1	NM_015265		28	105	1	0	3.99451e-17	0.009535	5.38882e-17	28	105				
MAP2	4133	broad.mit.edu	37	2	210561775	210561775	+	Splice_Site	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr2:210561775G>T	ENST00000360351.4	+	9	5028	c.4522G>T	c.(4522-4524)Gca>Tca	p.A1508S	MAP2_ENST00000475600.1_Intron|MAP2_ENST00000447185.1_Splice_Site_p.A1504S|MAP2_ENST00000199940.6_Intron|MAP2_ENST00000361559.4_Intron|MAP2_ENST00000392194.1_Intron	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	1508					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)	p.A1508S(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	GAAAACCACAGGTGACTGTTC	0.373																																					Pancreas(27;423 979 28787 29963)	Pancreas(27;423 979 28787 29963)	uc002vde.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(9)|upper_aerodigestive_tract(2)|large_intestine(2)|pancreas(2)|central_nervous_system(1)|skin(1)	17						c.(4522-4524)GCA>TCA		microtubule-associated protein 2 isoform 1	Estramustine(DB01196)						86.0	91.0	89.0					2																	210561775		2202	4300	6502	SO:0001630	splice_region_variant	4133				central nervous system neuron development|dendrite morphogenesis|negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	beta-dystroglycan binding|calmodulin binding|structural molecule activity	g.chr2:210561775G>T		CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.4522+1G>T	2.37:g.210561775G>T						MAP2_uc002vdd.1_Intron|MAP2_uc002vdf.1_Intron|MAP2_uc002vdg.1_Intron|MAP2_uc002vdh.1_Intron|MAP2_uc002vdi.1_Missense_Mutation_p.A1504S	p.A1508S	NM_002374	NP_002365	P11137	MAP2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	9	4770	+		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)	1508					Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	ENST00000360351.4	37	c.4522G>T	CCDS2384.1	.	.	.	.	.	.	.	.	.	.	G	17.92	3.506642	0.64410	.	.	ENSG00000078018	ENST00000360351;ENST00000447185	T;T	0.07688	3.17;3.17	5.56	5.56	0.83823	.	0.106914	0.41500	D	0.000869	T	0.17238	0.0414	N	0.19112	0.55	0.80722	D	1	D;D	0.69078	0.997;0.995	D;P	0.68483	0.958;0.787	T	0.06625	-1.0816	10	0.37606	T	0.19	-18.5699	19.5375	0.95260	0.0:0.0:1.0:0.0	.	1504;1508	P11137-3;P11137	.;MAP2_HUMAN	S	1508;1504	ENSP00000353508:A1508S;ENSP00000392164:A1504S	ENSP00000353508:A1508S	A	+	1	0	MAP2	210270020	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.229000	0.95273	2.626000	0.88956	0.650000	0.86243	GCA		0.373	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	NM_001039538	Missense_Mutation	55	47	1	0	1.02487e-32	0.01441	1.60463e-32	55	47				
SPAG16	79582	broad.mit.edu	37	2	214215278	214215278	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr2:214215278A>T	ENST00000331683.5	+	7	766	c.671A>T	c.(670-672)gAa>gTa	p.E224V	SPAG16_ENST00000447990.1_Missense_Mutation_p.E224V|SPAG16_ENST00000414961.2_Intron|SPAG16_ENST00000374309.3_Missense_Mutation_p.E130V|SPAG16_ENST00000413312.1_Missense_Mutation_p.E193V|SPAG16_ENST00000272898.7_Missense_Mutation_p.E224V	NM_024532.4	NP_078808.3	Q8N0X2	SPG16_HUMAN	sperm associated antigen 16	224					cilium assembly (GO:0042384)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|microtubule cytoskeleton (GO:0015630)|motile cilium (GO:0031514)|nucleus (GO:0005634)		p.E224V(1)		endometrium(4)|kidney(1)|large_intestine(15)|lung(27)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	56		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)		GCATCTTATGAACCGACTATA	0.348																																							uc002veq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(670-672)GAA>GTA		sperm associated antigen 16 isoform 1							90.0	86.0	88.0					2																	214215278		2203	4300	6503	SO:0001583	missense	79582				cilium assembly	cilium axoneme|flagellar axoneme		g.chr2:214215278A>T	AF310672	CCDS2396.1, CCDS46508.1	2q34	2013-05-21			ENSG00000144451	ENSG00000144451		"""WD repeat domain containing"""	23225	protein-coding gene	gene with protein product		612173				12391165, 11867345	Standard	NM_024532		Approved	PF20, FLJ22724, DKFZp666P1710, WDR29	uc002veq.4	Q8N0X2	OTTHUMG00000133015	ENST00000331683.5:c.671A>T	2.37:g.214215278A>T	ENSP00000332592:p.Glu224Val					SPAG16_uc010fuz.1_Missense_Mutation_p.E75V|SPAG16_uc002ver.2_Missense_Mutation_p.E170V|SPAG16_uc010zjk.1_Missense_Mutation_p.E130V|SPAG16_uc002vep.1_Intron|SPAG16_uc002ves.1_Missense_Mutation_p.E193V	p.E224V	NM_024532	NP_078808	Q8N0X2	SPG16_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)	7	763	+		Renal(323;0.00461)	224			Potential.		Q498B7|Q658W1|Q68DB3|Q6I9Z6|Q8N9C7|Q9H601	Missense_Mutation	SNP	ENST00000331683.5	37	c.671A>T	CCDS2396.1	.	.	.	.	.	.	.	.	.	.	A	19.65	3.867254	0.72065	.	.	ENSG00000144451	ENST00000331683;ENST00000413312;ENST00000272898;ENST00000447990;ENST00000374309	T;T	0.61859	0.11;0.07	5.51	5.51	0.81932	.	0.052819	0.64402	D	0.000001	T	0.75620	0.3874	M	0.81802	2.56	0.40349	D	0.979112	P;D;D;D;D	0.89917	0.877;1.0;0.997;0.983;0.998	B;D;D;P;D	0.80764	0.417;0.97;0.956;0.891;0.994	T	0.80006	-0.1563	10	0.87932	D	0	.	12.0177	0.53324	1.0:0.0:0.0:0.0	.	130;75;193;164;224	B4DYB5;Q8N0X2-2;Q8N0X2-3;Q4G1A2;Q8N0X2	.;.;.;.;SPG16_HUMAN	V	224;193;224;224;130	ENSP00000332592:E224V;ENSP00000363428:E130V	ENSP00000272898:E224V	E	+	2	0	SPAG16	213923523	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	3.526000	0.53509	2.096000	0.63516	0.459000	0.35465	GAA		0.348	SPAG16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256601.2	NM_024532		16	20	0	0	0	0.004007	0	16	20				
SP140L	93349	broad.mit.edu	37	2	231264881	231264881	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr2:231264881G>T	ENST00000415673.2	+	15	1323	c.1237G>T	c.(1237-1239)Ggg>Tgg	p.G413W	SP140L_ENST00000243810.6_Missense_Mutation_p.G413W|SP140L_ENST00000396563.4_Missense_Mutation_p.G378W|SP140L_ENST00000444636.1_Missense_Mutation_p.G413W	NM_138402.4	NP_612411.4	Q9H930	SP14L_HUMAN	SP140 nuclear body protein-like	413						nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.G413W(2)		central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(7)|prostate(1)|skin(1)	20						CCGGGACGGAGGGGAGCTGTT	0.522																																							uc010fxm.1		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(1)	1						c.(1237-1239)GGG>TGG		SP140 nuclear body protein-like							190.0	196.0	194.0					2																	231264881		2082	4238	6320	SO:0001583	missense	93349					nucleus	DNA binding|metal ion binding	g.chr2:231264881G>T	BC004921	CCDS46538.1	2q37.1	2013-01-28			ENSG00000185404	ENSG00000185404		"""Zinc fingers, PHD-type"""	25105	protein-coding gene	gene with protein product						12477932	Standard	NM_138402		Approved		uc010fxm.1	Q9H930	OTTHUMG00000153730	ENST00000415673.2:c.1237G>T	2.37:g.231264881G>T	ENSP00000397911:p.Gly413Trp					SP140L_uc010fxo.1_Missense_Mutation_p.G185W	p.G413W	NM_138402	NP_612411	Q9H930	LY10L_HUMAN			15	1328	+			413			PHD-type; degenerate.		Q2M375|Q4ZG65|Q9BSP3	Missense_Mutation	SNP	ENST00000415673.2	37	c.1237G>T	CCDS46538.1	.	.	.	.	.	.	.	.	.	.	G	14.23	2.474612	0.43942	.	.	ENSG00000185404	ENST00000444636;ENST00000415673;ENST00000243810;ENST00000396563	D;D;D;D	0.89415	-2.51;-2.51;-2.51;-2.51	3.5	2.61	0.31194	.	.	.	.	.	D	0.95220	0.8450	H	0.95780	3.72	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.86612	0.1873	9	0.87932	D	0	.	6.6587	0.23002	0.1347:0.0:0.8653:0.0	.	378;413	Q9H930-2;Q9H930-4	.;.	W	413;413;413;378	ENSP00000395195:G413W;ENSP00000397911:G413W;ENSP00000243810:G413W;ENSP00000379811:G378W	ENSP00000243810:G413W	G	+	1	0	SP140L	230973125	0.965000	0.33210	0.012000	0.15200	0.175000	0.22909	2.883000	0.48554	0.806000	0.34183	0.491000	0.48974	GGG		0.522	SP140L-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374538.1	NM_138402		60	80	1	0	1.99748e-12	0.01441	2.52779e-12	60	80				
ALPP	250	broad.mit.edu	37	2	233244348	233244348	+	Silent	SNP	G	G	A	rs376147815		TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr2:233244348G>A	ENST00000392027.2	+	4	704	c.435G>A	c.(433-435)acG>acA	p.T145T	AC068134.8_ENST00000439072.1_RNA|AC068134.8_ENST00000441266.1_RNA	NM_001632.3	NP_001623.3	P05187	PPB1_HUMAN	alkaline phosphatase, placental	145					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|magnesium ion binding (GO:0000287)|zinc ion binding (GO:0008270)	p.T145T(1)		NS(1)|biliary_tract(1)|endometrium(1)|kidney(4)|large_intestine(2)|liver(1)|lung(10)|ovary(2)	22		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)		AGTGCAACACGACACGCGGCA	0.622																																							uc002vsq.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(433-435)ACG>ACA		placental alkaline phosphatase preproprotein		G		2,4404		0,2,2201	46.0	41.0	43.0		435	-1.2	0.0	2		43	0,8590		0,0,4295	no	coding-synonymous	ALPP	NM_001632.3		0,2,6496	AA,AG,GG		0.0,0.0454,0.0154		145/536	233244348	2,12994	2203	4295	6498	SO:0001819	synonymous_variant	250					anchored to membrane|cell surface|integral to membrane|plasma membrane	alkaline phosphatase activity|metal ion binding	g.chr2:233244348G>A	M14169	CCDS2490.1	2q37.1	2010-06-24	2010-06-24		ENSG00000163283	ENSG00000163283	3.1.3.1		439	protein-coding gene	gene with protein product	"""Regan isozyme"""	171800	"""alkaline phosphatase, placental (Regan isozyme)"""			3001717, 3461452	Standard	XM_005246439		Approved		uc002vsq.3	P05187	OTTHUMG00000133255	ENST00000392027.2:c.435G>A	2.37:g.233244348G>A						ALPP_uc002vsr.2_5'Flank	p.T145T	NM_001632	NP_001623	P05187	PPB1_HUMAN		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)	4	600	+		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)	145					P05188|P06861|Q53S78|Q96DB7	Silent	SNP	ENST00000392027.2	37	c.435G>A	CCDS2490.1																																																																																				0.622	ALPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257032.3	NM_001632		8	34	0	0	0	0.004482	0	8	34				
CHRND	1144	broad.mit.edu	37	2	233392136	233392136	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr2:233392136C>A	ENST00000258385.3	+	3	256	c.224C>A	c.(223-225)aCc>aAc	p.T75N	CHRND_ENST00000457943.2_5'UTR|CHRND_ENST00000543200.1_Intron|CHRND_ENST00000536614.1_Missense_Mutation_p.T75N	NM_000751.2	NP_000742.1	Q07001	ACHD_HUMAN	cholinergic receptor, nicotinic, delta (muscle)	75					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|muscle contraction (GO:0006936)|musculoskeletal movement (GO:0050881)|neuromuscular process (GO:0050905)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)	p.T75N(1)		breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)	34		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;1.89e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00078)|Lung(119;0.00579)|LUSC - Lung squamous cell carcinoma(224;0.00754)	Galantamine(DB00674)	ACCCTCACTACCAATGTGTGG	0.537																																							uc002vsw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)|skin(1)	3						c.(223-225)ACC>AAC		nicotinic acetylcholine receptor delta							144.0	127.0	133.0					2																	233392136		2203	4300	6503	SO:0001583	missense	1144				muscle contraction|musculoskeletal movement|neuromuscular process|skeletal muscle tissue growth|synaptic transmission	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	nicotinic acetylcholine-activated cation-selective channel activity|receptor activity	g.chr2:233392136C>A	X55019	CCDS2494.1, CCDS58754.1	2q37.1	2012-02-11	2012-02-07		ENSG00000135902	ENSG00000135902		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1965	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, delta (muscle)"""	100720	"""cholinergic receptor, nicotinic, delta"""	ACHRD			Standard	NM_000751		Approved		uc002vsw.4	Q07001	OTTHUMG00000133261	ENST00000258385.3:c.224C>A	2.37:g.233392136C>A	ENSP00000258385:p.Thr75Asn					CHRND_uc010zmg.1_Intron|CHRND_uc010fyc.2_5'UTR|CHRND_uc010zmh.1_5'UTR	p.T75N	NM_000751	NP_000742	Q07001	ACHD_HUMAN		Epithelial(121;1.89e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00078)|Lung(119;0.00579)|LUSC - Lung squamous cell carcinoma(224;0.00754)	3	228	+		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)	75			Extracellular (Potential).		A8K661|B4DT92|Q52LH4	Missense_Mutation	SNP	ENST00000258385.3	37	c.224C>A	CCDS2494.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.175378	0.78564	.	.	ENSG00000135902	ENST00000258385;ENST00000536614	T;T	0.81247	-1.47;-1.47	3.97	3.97	0.46021	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.92990	0.7769	H	0.97783	4.075	0.80722	D	1	P	0.48089	0.905	P	0.62089	0.898	D	0.95647	0.8703	10	0.87932	D	0	.	16.2146	0.82198	0.0:1.0:0.0:0.0	.	75	Q07001	ACHD_HUMAN	N	75	ENSP00000258385:T75N;ENSP00000437740:T75N	ENSP00000258385:T75N	T	+	2	0	CHRND	233100380	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.185000	0.77714	2.227000	0.72691	0.561000	0.74099	ACC		0.537	CHRND-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257038.2			4	144	1	0	0.00909568	0.009096	0.00944806	4	144				
OTOS	150677	broad.mit.edu	37	2	241079494	241079494	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr2:241079494C>A	ENST00000391989.2	-	4	300	c.70G>T	c.(70-72)Gtg>Ttg	p.V24L	OTOS_ENST00000319460.1_Missense_Mutation_p.V24L			Q8NHW6	OTOSP_HUMAN	otospiralin	24					sensory perception of sound (GO:0007605)	extracellular region (GO:0005576)		p.V24L(1)		endometrium(2)|large_intestine(1)|lung(3)	6		all_epithelial(40;2.79e-15)|Breast(86;3.04e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0396)|Lung NSC(271;0.128)|Hepatocellular(293;0.148)|all_hematologic(139;0.158)|Melanoma(123;0.16)		Epithelial(32;2.56e-30)|all cancers(36;7.18e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.37e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;8.07e-06)|Lung(119;0.00344)|LUSC - Lung squamous cell carcinoma(224;0.0148)|Colorectal(34;0.019)|COAD - Colon adenocarcinoma(134;0.141)		TCCTCCTGCACAGGCTTGGCC	0.567																																							uc002vyv.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(70-72)GTG>TTG		otospiralin precursor							57.0	56.0	56.0					2																	241079494		2203	4300	6503	SO:0001583	missense	150677					extracellular region		g.chr2:241079494C>A		CCDS2533.1	2q37.3	2008-02-05			ENSG00000178602	ENSG00000178602			22644	protein-coding gene	gene with protein product		607877				12687421	Standard	NM_148961		Approved	OTOSP	uc002vyv.3	Q8NHW6	OTTHUMG00000133351	ENST00000391989.2:c.70G>T	2.37:g.241079494C>A	ENSP00000375849:p.Val24Leu						p.V24L	NM_148961	NP_683764	Q8NHW6	OTOSP_HUMAN		Epithelial(32;2.56e-30)|all cancers(36;7.18e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.37e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;8.07e-06)|Lung(119;0.00344)|LUSC - Lung squamous cell carcinoma(224;0.0148)|Colorectal(34;0.019)|COAD - Colon adenocarcinoma(134;0.141)	3	225	-		all_epithelial(40;2.79e-15)|Breast(86;3.04e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0396)|Lung NSC(271;0.128)|Hepatocellular(293;0.148)|all_hematologic(139;0.158)|Melanoma(123;0.16)	24					Q53SW6	Missense_Mutation	SNP	ENST00000391989.2	37	c.70G>T	CCDS2533.1	.	.	.	.	.	.	.	.	.	.	C	11.84	1.760075	0.31137	.	.	ENSG00000178602	ENST00000391989;ENST00000319460	T;T	0.47869	0.83;0.83	3.39	-0.995	0.10222	.	0.364690	0.27782	N	0.017867	T	0.27384	0.0672	.	.	.	0.23563	N	0.997405	B	0.02656	0.0	B	0.04013	0.001	T	0.08638	-1.0712	9	0.45353	T	0.12	-12.9286	3.7132	0.08428	0.0:0.2991:0.4233:0.2776	.	24	Q8NHW6	OTOSP_HUMAN	L	24	ENSP00000375849:V24L;ENSP00000322486:V24L	ENSP00000322486:V24L	V	-	1	0	OTOS	240728167	0.178000	0.23122	0.682000	0.30024	0.951000	0.60555	-0.015000	0.12634	-0.098000	0.12285	0.563000	0.77884	GTG		0.567	OTOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257181.3	NM_148961		31	48	1	0	5.71845e-15	0.005524	7.50219e-15	31	48				
KIF1A	547	broad.mit.edu	37	2	241700155	241700155	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr2:241700155G>T	ENST00000320389.7	-	24	2502	c.2344C>A	c.(2344-2346)Cgc>Agc	p.R782S	KIF1A_ENST00000498729.2_Missense_Mutation_p.R791S	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A	782					anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)	p.R782S(1)		NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		ACAATGGTGCGGGGGAAGGGC	0.657																																							uc002vzy.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)	1						c.(2344-2346)CGC>AGC		axonal transport of synaptic vesicles							21.0	24.0	23.0					2																	241700155		1904	4100	6004	SO:0001583	missense	547				anterograde axon cargo transport	cytoplasm|microtubule|nucleus	ATP binding|microtubule motor activity	g.chr2:241700155G>T	AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.2344C>A	2.37:g.241700155G>T	ENSP00000322791:p.Arg782Ser					KIF1A_uc010fzk.2_Missense_Mutation_p.R791S|KIF1A_uc002vzz.1_Missense_Mutation_p.R791S	p.R782S	NM_004321	NP_004312	Q12756	KIF1A_HUMAN		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)	24	2490	-		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)	782					B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Missense_Mutation	SNP	ENST00000320389.7	37	c.2344C>A	CCDS46561.1	.	.	.	.	.	.	.	.	.	.	G	14.12	2.440502	0.43326	.	.	ENSG00000130294	ENST00000320389;ENST00000498729;ENST00000373308;ENST00000404283	T;T;T	0.75154	-0.91;-0.91;-0.91	4.94	3.03	0.35002	.	0.000000	0.85682	U	0.000000	T	0.67277	0.2876	L	0.46157	1.445	0.53688	D	0.999973	B;B;B	0.14805	0.011;0.003;0.0	B;B;B	0.17979	0.02;0.005;0.002	T	0.61392	-0.7072	10	0.46703	T	0.11	.	12.7334	0.57210	0.0:0.0:0.4213:0.5787	.	791;791;782	F5H045;Q12756-2;Q12756	.;.;KIF1A_HUMAN	S	782;791;791;791	ENSP00000322791:R782S;ENSP00000438388:R791S;ENSP00000384231:R791S	ENSP00000322791:R782S	R	-	1	0	KIF1A	241348828	0.999000	0.42202	0.981000	0.43875	0.983000	0.72400	2.927000	0.48900	0.427000	0.26145	0.543000	0.68304	CGC		0.657	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324536.3	NM_138483		12	8	1	0	1.61879e-10	0.013537	1.92906e-10	12	8				
NEU4	129807	broad.mit.edu	37	2	242757908	242757908	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr2:242757908C>A	ENST00000391969.2	+	5	1700	c.989C>A	c.(988-990)cCt>cAt	p.P330H	NEU4_ENST00000407683.1_Missense_Mutation_p.P330H|NEU4_ENST00000325935.6_Missense_Mutation_p.P343H|NEU4_ENST00000405370.1_Missense_Mutation_p.P330H|NEU4_ENST00000404257.1_Missense_Mutation_p.P342H	NM_001167602.1	NP_001161074.1	Q8WWR8	NEUR4_HUMAN	sialidase 4	330	Pro-rich.				ganglioside catabolic process (GO:0006689)|glycoprotein catabolic process (GO:0006516)|glycosphingolipid metabolic process (GO:0006687)|oligosaccharide catabolic process (GO:0009313)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|organelle inner membrane (GO:0019866)	exo-alpha-(2->3)-sialidase activity (GO:0052794)|exo-alpha-(2->6)-sialidase activity (GO:0052795)|exo-alpha-(2->8)-sialidase activity (GO:0052796)|exo-alpha-sialidase activity (GO:0004308)	p.P342H(1)		breast(1)|lung(10)|prostate(2)|skin(2)	15		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;3.84e-33)|all cancers(36;8.08e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.41e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0825)		GGCCAGGTGCCTGGTGGGCCC	0.716																																							uc010fzr.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(988-990)CCT>CAT		sialidase 4							11.0	13.0	12.0					2																	242757908		2141	4226	6367	SO:0001583	missense	129807					lysosomal lumen|organelle inner membrane	exo-alpha-sialidase activity|protein binding	g.chr2:242757908C>A	BC012899	CCDS2553.1, CCDS54441.1, CCDS54442.1	2q37.3	2008-02-05			ENSG00000204099	ENSG00000204099			21328	protein-coding gene	gene with protein product		608527					Standard	NM_001167600		Approved		uc010fzr.3	Q8WWR8	OTTHUMG00000133412	ENST00000391969.2:c.989C>A	2.37:g.242757908C>A	ENSP00000375830:p.Pro330His					NEU4_uc002wcl.2_RNA|NEU4_uc002wcm.2_Missense_Mutation_p.P330H|NEU4_uc002wcn.1_Missense_Mutation_p.P342H|NEU4_uc002wco.1_Missense_Mutation_p.P330H|NEU4_uc002wcp.1_Missense_Mutation_p.P342H	p.P330H	NM_080741	NP_542779	Q8WWR8	NEUR4_HUMAN		Epithelial(32;3.84e-33)|all cancers(36;8.08e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.41e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0825)	4	1075	+		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)	330			Pro-rich.		A8K056|J3KNJ5|Q96D64	Missense_Mutation	SNP	ENST00000391969.2	37	c.989C>A	CCDS54442.1	.	.	.	.	.	.	.	.	.	.	C	10.20	1.284096	0.23392	.	.	ENSG00000204099	ENST00000407683;ENST00000405370;ENST00000472793;ENST00000404257;ENST00000391969;ENST00000325935	T;T;T;T;T	0.75477	-0.93;-0.93;-0.94;-0.93;-0.94	3.5	-3.87	0.04218	Neuraminidase (1);	1.686380	0.03184	N	0.172406	T	0.55386	0.1917	N	0.08118	0	0.09310	N	1	P;P;P	0.49447	0.875;0.924;0.875	B;P;B	0.44772	0.271;0.46;0.187	T	0.53549	-0.8423	10	0.56958	D	0.05	-0.4491	5.1233	0.14871	0.354:0.4171:0.0:0.2289	.	342;342;330	A8K211;Q8WWR8-2;Q8WWR8	.;.;NEUR4_HUMAN	H	330;330;340;342;330;343	ENSP00000385402:P330H;ENSP00000384804:P330H;ENSP00000385149:P342H;ENSP00000375830:P330H;ENSP00000320318:P343H	ENSP00000320318:P343H	P	+	2	0	NEU4	242406581	0.000000	0.05858	0.000000	0.03702	0.105000	0.19272	-0.102000	0.10956	-0.322000	0.08615	0.387000	0.25754	CCT		0.716	NEU4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257270.2	NM_080741		6	9	1	0	0.000442599	0.006214	0.000475878	6	9				
LAMP5	24141	broad.mit.edu	37	20	9510440	9510440	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr20:9510440C>A	ENST00000246070.2	+	6	1308	c.816C>A	c.(814-816)gaC>gaA	p.D272E	LAMP5_ENST00000427562.2_Missense_Mutation_p.D228E	NM_012261.3	NP_036393.1	Q9UJQ1	LAMP5_HUMAN	lysosomal-associated membrane protein family, member 5	272						cytoplasmic vesicle membrane (GO:0030659)|dendrite membrane (GO:0032590)|early endosome membrane (GO:0031901)|endoplasmic reticulum-Golgi intermediate compartment membrane (GO:0033116)|endosome membrane (GO:0010008)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)		p.D272E(1)									TCCCTCGGGACAGATCCCAGT	0.527																																							uc002wni.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|lung(1)|breast(1)	3						c.(814-816)GAC>GAA		chromosome 20 open reading frame 103 precursor							107.0	93.0	98.0					20																	9510440		2203	4300	6503	SO:0001583	missense	24141					integral to membrane		g.chr20:9510440C>A	AL121740	CCDS13106.1, CCDS56177.1	20p12	2013-03-14	2011-11-25	2011-11-25	ENSG00000125869	ENSG00000125869			16097	protein-coding gene	gene with protein product	"""brain and dendritic cell associated LAMP"""	614641	"""chromosome 20 open reading frame 103"""	C20orf103		11780052, 21642595	Standard	NM_012261		Approved	dJ1119D9.3, BAD-LAMP, UNC-43	uc002wni.2	Q9UJQ1	OTTHUMG00000031851	ENST00000246070.2:c.816C>A	20.37:g.9510440C>A	ENSP00000246070:p.Asp272Glu					C20orf103_uc010zrc.1_Missense_Mutation_p.D228E	p.D272E	NM_012261	NP_036393	Q9UJQ1	CT103_HUMAN	COAD - Colon adenocarcinoma(9;0.194)		6	1045	+			272			Cytoplasmic (Potential).		B4DHZ7|B7Z9Z9	Missense_Mutation	SNP	ENST00000246070.2	37	c.816C>A	CCDS13106.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.378926	0.82682	.	.	ENSG00000125869	ENST00000246070;ENST00000427562	T;T	0.56776	0.76;0.44	6.06	3.13	0.36017	.	0.045093	0.85682	D	0.000000	T	0.55033	0.1895	N	0.24115	0.695	0.50313	D	0.999868	P;D	0.76494	0.911;0.999	B;D	0.78314	0.438;0.991	T	0.48258	-0.9051	9	.	.	.	-19.0002	11.3345	0.49496	0.0:0.8056:0.0:0.1944	.	228;272	Q9UJQ1-2;Q9UJQ1	.;CT103_HUMAN	E	272;228	ENSP00000246070:D272E;ENSP00000406360:D228E	.	D	+	3	2	C20orf103	9458440	1.000000	0.71417	0.992000	0.48379	0.991000	0.79684	1.312000	0.33574	0.465000	0.27167	0.650000	0.86243	GAC		0.527	LAMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077946.2	NM_012261		30	24	1	0	3.73148e-12	0.007291	4.66707e-12	30	24				
DUSP15	128853	broad.mit.edu	37	20	30436639	30436639	+	Silent	SNP	C	C	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr20:30436639C>T	ENST00000278979.3	-	9	772	c.696G>A	c.(694-696)caG>caA	p.Q232Q				Q9H1R2	DUS15_HUMAN	dual specificity phosphatase 15	232					positive regulation of JNK cascade (GO:0046330)|protein dephosphorylation (GO:0006470)|regulation of cell proliferation (GO:0042127)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.Q232Q(1)		large_intestine(1)|lung(4)|pancreas(1)|stomach(1)	7			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			CCTTGGGGTGCTGTGTGGGGC	0.602																																							uc002wwu.1		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(1)	1						c.(694-696)CAG>CAA		RecName: Full=Dual specificity protein phosphatase 15;          EC=3.1.3.48;          EC=3.1.3.16; AltName: Full=Vaccinia virus VH1-related dual-specific protein phosphatase Y; AltName: Full=VH1-related member Y;							34.0	35.0	34.0					20																	30436639		876	1990	2866	SO:0001819	synonymous_variant	128853					cytoplasm|plasma membrane	protein binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr20:30436639C>T		CCDS13193.1, CCDS42862.1	20q11.21	2011-06-09	2005-03-09		ENSG00000149599	ENSG00000149599		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	16236	protein-coding gene	gene with protein product			"""dual specificity phosphatase-like 15"""			15138252	Standard	NM_080611		Approved	bA243J16.6, VHY	uc002wwx.1	Q9H1R2	OTTHUMG00000032182	ENST00000278979.3:c.696G>A	20.37:g.30436639C>T							p.Q232Q			Q9H1R2	DUS15_HUMAN	Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)		9	773	-			232					A6NH79|A8MVC8|Q5QP62|Q5QP63|Q5QP65|Q6PGN7|Q8N826|Q9BX24	Silent	SNP	ENST00000278979.3	37	c.696G>A		.	.	.	.	.	.	.	.	.	.	C	2.302	-0.360005	0.05103	.	.	ENSG00000149599	ENST00000447647	.	.	.	3.59	1.53	0.23141	.	.	.	.	.	T	0.32194	0.0821	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.22941	-1.0202	4	.	.	.	.	6.8907	0.24228	0.1043:0.35:0.5457:0.0	.	.	.	.	N	30	.	.	S	-	2	0	DUSP15	29900300	0.003000	0.15002	0.040000	0.18447	0.003000	0.03518	-0.041000	0.12084	0.698000	0.31739	-0.502000	0.04539	AGC		0.602	DUSP15-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000078555.3	NM_080611		7	37	0	0	0	0.006214	0	7	37				
EDEM2	55741	broad.mit.edu	37	20	33703271	33703271	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr20:33703271C>A	ENST00000374492.3	-	11	1807	c.1702G>T	c.(1702-1704)Gca>Tca	p.A568S	EDEM2_ENST00000541621.1_Missense_Mutation_p.A347S|SNORD56_ENST00000364281.1_RNA|EDEM2_ENST00000542871.1_Missense_Mutation_p.A292S|EDEM2_ENST00000374491.3_Missense_Mutation_p.A531S	NM_018217.2	NP_060687.2	Q9BV94	EDEM2_HUMAN	ER degradation enhancer, mannosidase alpha-like 2	568					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|response to unfolded protein (GO:0006986)	endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.A568S(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	22			BRCA - Breast invasive adenocarcinoma(18;0.00936)			CCCAGTAATGCCAACTTGGAG	0.433																																					Esophageal Squamous(51;906 1021 24535 36410 39145)	Esophageal Squamous(51;906 1021 24535 36410 39145)	uc002xbo.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1702-1704)GCA>TCA		ER degradation enhancer, mannosidase alpha-like							160.0	160.0	160.0					20																	33703271		2203	4300	6503	SO:0001583	missense	55741				post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|response to unfolded protein	endoplasmic reticulum lumen|endoplasmic reticulum membrane|extracellular region	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity|misfolded protein binding	g.chr20:33703271C>A	AK001645	CCDS13247.1, CCDS46592.1	20q11.22	2006-03-31	2006-03-31	2006-03-31	ENSG00000088298	ENSG00000088298			15877	protein-coding gene	gene with protein product		610302	"""chromosome 20 open reading frame 31"""	C20orf49, C20orf31		15537790, 15579471	Standard	NM_018217		Approved	FLJ10783, bA4204.1	uc002xbo.2	Q9BV94	OTTHUMG00000032322	ENST00000374492.3:c.1702G>T	20.37:g.33703271C>A	ENSP00000363616:p.Ala568Ser					EDEM2_uc010zus.1_Missense_Mutation_p.A347S|EDEM2_uc002xbq.2_Missense_Mutation_p.A531S|EDEM2_uc010zut.1_Missense_Mutation_p.A527S|EDEM2_uc002xbp.2_Missense_Mutation_p.A416S|EDEM2_uc002xbn.2_Missense_Mutation_p.A416S|EDEM2_uc002xbr.2_RNA|EDEM2_uc010zuu.1_Missense_Mutation_p.A292S	p.A568S	NM_018217	NP_060687	Q9BV94	EDEM2_HUMAN	BRCA - Breast invasive adenocarcinoma(18;0.00936)		11	1802	-			568					B4DTG9|Q6GU33|Q6IA89|Q6UWZ4|Q9H4U0|Q9H886|Q9NTL9|Q9NVE6	Missense_Mutation	SNP	ENST00000374492.3	37	c.1702G>T	CCDS13247.1	.	.	.	.	.	.	.	.	.	.	C	11.91	1.780284	0.31502	.	.	ENSG00000088298	ENST00000374491;ENST00000374492;ENST00000541621;ENST00000542871	T;T;T;T	0.56776	0.45;0.44;2.01;2.02	5.24	5.24	0.73138	.	0.319686	0.38111	N	0.001809	T	0.34250	0.0891	N	0.14661	0.345	0.80722	D	1	B;B;B	0.18166	0.018;0.026;0.001	B;B;B	0.20184	0.007;0.028;0.002	T	0.14420	-1.0473	10	0.13108	T	0.6	-11.3323	13.9228	0.63942	0.1519:0.8481:0.0:0.0	.	347;531;568	G3V1Q0;Q9BV94-2;Q9BV94	.;.;EDEM2_HUMAN	S	531;568;347;292	ENSP00000363615:A531S;ENSP00000363616:A568S;ENSP00000443528:A347S;ENSP00000441642:A292S	ENSP00000363615:A531S	A	-	1	0	EDEM2	33166932	1.000000	0.71417	0.996000	0.52242	0.990000	0.78478	1.671000	0.37513	2.737000	0.93849	0.561000	0.74099	GCA		0.433	EDEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078842.2	NM_018217		167	258	1	0	7.08505e-72	0.01441	1.2158e-71	167	258				
EDEM2	55741	broad.mit.edu	37	20	33711807	33711807	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr20:33711807T>A	ENST00000374492.3	-	9	1105	c.1000A>T	c.(1000-1002)Agg>Tgg	p.R334W	EDEM2_ENST00000541621.1_Missense_Mutation_p.R113W|EDEM2_ENST00000540582.1_Missense_Mutation_p.R293W|EDEM2_ENST00000542871.1_Missense_Mutation_p.R58W|EDEM2_ENST00000374491.3_Missense_Mutation_p.R297W	NM_018217.2	NP_060687.2	Q9BV94	EDEM2_HUMAN	ER degradation enhancer, mannosidase alpha-like 2	334					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|response to unfolded protein (GO:0006986)	endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.R334W(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	22			BRCA - Breast invasive adenocarcinoma(18;0.00936)			AGGAAGGTCCTCATGGCATTG	0.502																																					Esophageal Squamous(51;906 1021 24535 36410 39145)	Esophageal Squamous(51;906 1021 24535 36410 39145)	uc002xbo.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1000-1002)AGG>TGG		ER degradation enhancer, mannosidase alpha-like							115.0	99.0	104.0					20																	33711807		2203	4300	6503	SO:0001583	missense	55741				post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|response to unfolded protein	endoplasmic reticulum lumen|endoplasmic reticulum membrane|extracellular region	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity|misfolded protein binding	g.chr20:33711807T>A	AK001645	CCDS13247.1, CCDS46592.1	20q11.22	2006-03-31	2006-03-31	2006-03-31	ENSG00000088298	ENSG00000088298			15877	protein-coding gene	gene with protein product		610302	"""chromosome 20 open reading frame 31"""	C20orf49, C20orf31		15537790, 15579471	Standard	NM_018217		Approved	FLJ10783, bA4204.1	uc002xbo.2	Q9BV94	OTTHUMG00000032322	ENST00000374492.3:c.1000A>T	20.37:g.33711807T>A	ENSP00000363616:p.Arg334Trp					EDEM2_uc010zuv.1_Missense_Mutation_p.R293W|EDEM2_uc010zus.1_Missense_Mutation_p.R113W|EDEM2_uc002xbq.2_Missense_Mutation_p.R297W|EDEM2_uc010zut.1_Missense_Mutation_p.R293W|EDEM2_uc002xbp.2_Missense_Mutation_p.R182W|EDEM2_uc002xbn.2_Missense_Mutation_p.R182W|EDEM2_uc002xbr.2_RNA|EDEM2_uc010zuu.1_Missense_Mutation_p.R58W	p.R334W	NM_018217	NP_060687	Q9BV94	EDEM2_HUMAN	BRCA - Breast invasive adenocarcinoma(18;0.00936)		9	1100	-			334					B4DTG9|Q6GU33|Q6IA89|Q6UWZ4|Q9H4U0|Q9H886|Q9NTL9|Q9NVE6	Missense_Mutation	SNP	ENST00000374492.3	37	c.1000A>T	CCDS13247.1	.	.	.	.	.	.	.	.	.	.	t	24.9	4.583413	0.86748	.	.	ENSG00000088298	ENST00000374491;ENST00000374492;ENST00000541621;ENST00000542871;ENST00000540582	T;T;T;T;T	0.73047	-0.71;-0.71;-0.71;-0.71;-0.71	6.02	3.66	0.41972	.	0.079339	0.85682	D	0.000000	D	0.82848	0.5126	M	0.79258	2.445	0.58432	D	0.999998	D;D;D;D	0.71674	0.997;0.99;0.998;0.998	P;D;D;D	0.79108	0.9;0.99;0.992;0.985	D	0.84908	0.0846	10	0.72032	D	0.01	-17.5805	13.2664	0.60135	0.0:0.0:0.3639:0.6361	.	293;113;297;334	F5GZ44;G3V1Q0;Q9BV94-2;Q9BV94	.;.;.;EDEM2_HUMAN	W	297;334;113;58;293	ENSP00000363615:R297W;ENSP00000363616:R334W;ENSP00000443528:R113W;ENSP00000441642:R58W;ENSP00000441548:R293W	ENSP00000363615:R297W	R	-	1	2	EDEM2	33175468	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.611000	0.54132	1.107000	0.41642	-0.256000	0.11100	AGG		0.502	EDEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078842.2	NM_018217		47	66	0	0	0	0.01441	0	47	66				
MMP9	4318	broad.mit.edu	37	20	44639923	44639923	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr20:44639923C>A	ENST00000372330.3	+	5	810	c.791C>A	c.(790-792)aCc>aAc	p.T264N	RP11-465L10.10_ENST00000535913.1_RNA	NM_004994.2	NP_004985.2	P14780	MMP9_HUMAN	matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)	264	Fibronectin type-II 1. {ECO:0000255|PROSITE-ProRule:PRU00479}.				collagen catabolic process (GO:0030574)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|macrophage differentiation (GO:0030225)|negative regulation of cation channel activity (GO:2001258)|ossification (GO:0001503)|positive regulation of apoptotic process (GO:0043065)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of receptor binding (GO:1900122)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)|identical protein binding (GO:0042802)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.T264N(1)		breast(2)|endometrium(4)|large_intestine(14)|liver(2)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(3)	46		Myeloproliferative disorder(115;0.0122)			Captopril(DB01197)|Glucosamine(DB01296)|Marimastat(DB00786)|Minocycline(DB01017)	AACTACGACACCGACGACCGG	0.652																																							uc002xqz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(790-792)ACC>AAC		matrix metalloproteinase 9 preproprotein	Glucosamine(DB01296)|Marimastat(DB00786)|Minocycline(DB01017)|Simvastatin(DB00641)						58.0	60.0	60.0					20																	44639923		2203	4300	6503	SO:0001583	missense	4318				collagen catabolic process|macrophage differentiation|positive regulation of keratinocyte migration|proteolysis	extracellular space|proteinaceous extracellular matrix	collagen binding|metalloendopeptidase activity|zinc ion binding	g.chr20:44639923C>A		CCDS13390.1	20q12-q13	2008-01-07	2005-08-08		ENSG00000100985	ENSG00000100985	3.4.24.35		7176	protein-coding gene	gene with protein product		120361	"""matrix metalloproteinase 9 (gelatinase B, 92kD gelatinase, 92kD type IV collagenase)"", ""matrix metalloproteinase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)"""	CLG4B		2158484	Standard	NM_004994		Approved		uc002xqz.3	P14780	OTTHUMG00000033044	ENST00000372330.3:c.791C>A	20.37:g.44639923C>A	ENSP00000361405:p.Thr264Asn						p.T264N	NM_004994	NP_004985	P14780	MMP9_HUMAN			5	810	+		Myeloproliferative disorder(115;0.0122)	264			Fibronectin type-II 1.		B2R7V9|Q3LR70|Q8N725|Q9H4Z1|Q9UCJ9|Q9UCL1|Q9UDK2	Missense_Mutation	SNP	ENST00000372330.3	37	c.791C>A	CCDS13390.1	.	.	.	.	.	.	.	.	.	.	C	3.946	-0.013177	0.07727	.	.	ENSG00000100985	ENST00000372330	T	0.50277	0.75	4.56	-5.68	0.02436	Peptidase M10, metallopeptidase (1);Fibronectin, type II, collagen-binding (5);Kringle-like fold (1);Peptidase, metallopeptidase (1);	1.146100	0.06238	N	0.689807	T	0.36608	0.0973	L	0.41632	1.29	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.40346	-0.9568	10	0.42905	T	0.14	.	11.7977	0.52110	0.6071:0.2198:0.1731:0.0	.	264	P14780	MMP9_HUMAN	N	264	ENSP00000361405:T264N	ENSP00000361405:T264N	T	+	2	0	MMP9	44073330	0.000000	0.05858	0.002000	0.10522	0.018000	0.09664	-0.592000	0.05747	-0.700000	0.05070	-0.158000	0.13435	ACC		0.652	MMP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080337.1			72	108	1	0	2.14232e-31	0.01441	3.32992e-31	72	108				
PPP1R3D	5509	broad.mit.edu	37	20	58514323	58514323	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr20:58514323G>A	ENST00000370996.3	-	1	1029	c.664C>T	c.(664-666)Cgg>Tgg	p.R222W	FAM217B_ENST00000358293.3_Intron|FAM217B_ENST00000360816.3_5'Flank	NM_006242.3	NP_006233.1	O95685	PPR3D_HUMAN	protein phosphatase 1, regulatory subunit 3D	222	CBM21. {ECO:0000255|PROSITE- ProRule:PRU00491}.				dephosphorylation (GO:0016311)|glycogen metabolic process (GO:0005977)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of glycogen catabolic process (GO:0005981)	glycogen granule (GO:0042587)|intracellular membrane-bounded organelle (GO:0043231)	protein serine/threonine phosphatase activity (GO:0004722)	p.R222W(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|prostate(1)|urinary_tract(1)	13	all_lung(29;0.00391)		BRCA - Breast invasive adenocarcinoma(7;5.12e-09)			CCGCGCCACCGCGCCACCGCC	0.682																																							uc002ybb.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(664-666)CGG>TGG		protein phosphatase 1, regulatory subunit 3D							29.0	30.0	30.0					20																	58514323		2201	4297	6498	SO:0001583	missense	5509				glycogen metabolic process		protein binding|protein serine/threonine phosphatase activity	g.chr20:58514323G>A	Y18206	CCDS13483.1	20q13.3	2012-04-17	2011-10-04	2001-08-01	ENSG00000132825	ENSG00000132825		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9294	protein-coding gene	gene with protein product		603326	"""protein phosphatase 1, regulatory (inhibitor) subunit 3D"""	PPP1R6		9414128, 9275233	Standard	NM_006242		Approved		uc002ybb.3	O95685	OTTHUMG00000032876	ENST00000370996.3:c.664C>T	20.37:g.58514323G>A	ENSP00000360035:p.Arg222Trp					C20orf177_uc002yba.2_Intron|C20orf177_uc010zzx.1_5'Flank|C20orf177_uc002ybc.2_5'Flank	p.R222W	NM_006242	NP_006233	O95685	PPR3D_HUMAN	BRCA - Breast invasive adenocarcinoma(7;5.12e-09)		1	1030	-	all_lung(29;0.00391)		222			CBM21.		Q6DK02	Missense_Mutation	SNP	ENST00000370996.3	37	c.664C>T	CCDS13483.1	.	.	.	.	.	.	.	.	.	.	G	14.26	2.482843	0.44147	.	.	ENSG00000132825	ENST00000370996	T	0.64618	-0.11	4.98	0.548	0.17208	Putative phosphatase regulatory subunit (2);	0.322500	0.26010	N	0.026895	T	0.71937	0.3399	M	0.65498	2.005	0.09310	N	1	D	0.89917	1.0	D	0.65874	0.939	T	0.65096	-0.6251	10	0.72032	D	0.01	-19.6766	10.7805	0.46376	0.0:0.1168:0.354:0.5292	.	222	O95685	PPR3D_HUMAN	W	222	ENSP00000360035:R222W	ENSP00000360035:R222W	R	-	1	2	PPP1R3D	57947718	0.005000	0.15991	0.151000	0.22473	0.619000	0.37552	1.057000	0.30492	-0.140000	0.11394	-0.475000	0.04921	CGG		0.682	PPP1R3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079940.2	NM_006242		6	59	0	0	0	0.008291	0	6	59				
HELZ2	85441	broad.mit.edu	37	20	62192981	62192981	+	Missense_Mutation	SNP	C	C	T	rs143065747		TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr20:62192981C>T	ENST00000467148.1	-	12	6878	c.6809G>A	c.(6808-6810)cGg>cAg	p.R2270Q	HELZ2_ENST00000427522.2_Missense_Mutation_p.R1701Q	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	2270	Interaction with THRAP3.				cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.R2270Q(1)|p.R2270L(1)									CCTCCCCTCCCGGGGGCTCTT	0.657																																							uc002yfm.2		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(2)	2						c.(6808-6810)CGG>CAG		PPAR-alpha interacting complex protein 285		C	GLN/ARG,GLN/ARG	0,4404		0,0,2202	56.0	67.0	64.0		6809,5102	1.1	0.1	20	dbSNP_134	64	1,8589		0,1,4294	no	missense,missense	PRIC285	NM_001037335.2,NM_033405.3	43,43	0,1,6496	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	2270/2650,1701/2081	62192981	1,12993	2202	4295	6497	SO:0001583	missense	85441				cellular lipid metabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|helicase activity|ribonuclease activity|RNA binding|transcription coactivator activity|zinc ion binding	g.chr20:62192981C>T	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.6809G>A	20.37:g.62192981C>T	ENSP00000417401:p.Arg2270Gln					PRIC285_uc002yfl.1_Missense_Mutation_p.R1701Q	p.R2270Q	NM_001037335	NP_001032412	Q9BYK8	PR285_HUMAN	Epithelial(9;1.27e-08)|all cancers(9;7.32e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)		13	7701	-	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		2270					Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Missense_Mutation	SNP	ENST00000467148.1	37	c.6809G>A	CCDS33508.1	.	.	.	.	.	.	.	.	.	.	C	8.173	0.792011	0.16258	0.0	1.16E-4	ENSG00000130589	ENST00000427522;ENST00000467148	D;D	0.81821	-1.54;-1.54	4.49	1.14	0.20703	ATPase, AAA+ type, core (1);	0.736243	0.12558	N	0.458387	T	0.65502	0.2697	L	0.39326	1.205	0.30876	N	0.731989	B;B	0.30482	0.175;0.281	B;B	0.22601	0.027;0.04	T	0.55554	-0.8123	10	0.21540	T	0.41	-21.436	4.4094	0.11425	0.1642:0.5842:0.0:0.2516	.	2270;1701	Q9BYK8;Q9BYK8-2	PR285_HUMAN;.	Q	1701;2270	ENSP00000393257:R1701Q;ENSP00000417401:R2270Q	ENSP00000393257:R1701Q	R	-	2	0	RP4-697K14.7	61663425	0.410000	0.25376	0.149000	0.22428	0.061000	0.15899	1.029000	0.30140	-0.057000	0.13199	0.491000	0.48974	CGG		0.657	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354127.1	NM_001037335		112	221	0	0	0	0.01441	0	112	221				
DSCAM	1826	broad.mit.edu	37	21	41648050	41648050	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr21:41648050C>T	ENST00000400454.1	-	11	2807	c.2330G>A	c.(2329-2331)aGc>aAc	p.S777N		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	777	Ig-like C2-type 8.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.S777N(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				CATGGACTTGCTGACGTCTGC	0.468																																					Melanoma(134;970 1778 1785 21664 32388)	Melanoma(134;970 1778 1785 21664 32388)	uc002yyq.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11						c.(2329-2331)AGC>AAC		Down syndrome cell adhesion molecule isoform							99.0	103.0	102.0					21																	41648050		2069	4251	6320	SO:0001583	missense	1826				cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding	g.chr21:41648050C>T	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.2330G>A	21.37:g.41648050C>T	ENSP00000383303:p.Ser777Asn					DSCAM_uc002yyr.1_RNA	p.S777N	NM_001389	NP_001380	O60469	DSCAM_HUMAN			11	2782	-		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)	777			Extracellular (Potential).|Ig-like C2-type 8.		O60468	Missense_Mutation	SNP	ENST00000400454.1	37	c.2330G>A	CCDS42929.1	.	.	.	.	.	.	.	.	.	.	C	35	5.517450	0.96416	.	.	ENSG00000171587	ENST00000400454;ENST00000404019	T;T	0.68479	-0.33;-0.33	5.78	5.78	0.91487	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.097775	0.64402	D	0.000001	T	0.72045	0.3412	M	0.80332	2.49	0.80722	D	1	P	0.43231	0.801	B	0.40741	0.339	T	0.73225	-0.4050	10	0.36615	T	0.2	.	20.0204	0.97499	0.0:1.0:0.0:0.0	.	777	O60469	DSCAM_HUMAN	N	777;529	ENSP00000383303:S777N;ENSP00000385342:S529N	ENSP00000383303:S777N	S	-	2	0	DSCAM	40569920	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.726000	0.84824	2.729000	0.93468	0.650000	0.86243	AGC		0.468	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389		15	41	0	0	0	0.004007	0	15	41				
UMODL1	89766	broad.mit.edu	37	21	43505485	43505485	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr21:43505485C>G	ENST00000408910.2	+	4	566	c.566C>G	c.(565-567)cCc>cGc	p.P189R	UMODL1_ENST00000400424.2_Missense_Mutation_p.P117R|UMODL1_ENST00000400427.1_Missense_Mutation_p.P117R|UMODL1_ENST00000408989.2_Missense_Mutation_p.P189R	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1	189					adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)	p.P117R(1)|p.P189R(1)		breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						CAAGTGGACCCCAGGCTCCTG	0.582																																					Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)	Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)	uc002zaf.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|skin(1)	3						c.(565-567)CCC>CGC		uromodulin-like 1 isoform 1 precursor							145.0	149.0	148.0					21																	43505485		1940	4142	6082	SO:0001583	missense	89766					cytoplasm|extracellular region|integral to membrane|plasma membrane	calcium ion binding|peptidase inhibitor activity	g.chr21:43505485C>G		CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.566C>G	21.37:g.43505485C>G	ENSP00000386147:p.Pro189Arg					UMODL1_uc002zad.1_Missense_Mutation_p.P117R|UMODL1_uc002zae.1_Missense_Mutation_p.P117R|UMODL1_uc002zag.1_Missense_Mutation_p.P189R|UMODL1_uc010gow.1_5'UTR|UMODL1_uc002zai.1_5'UTR|UMODL1_uc010gox.1_RNA|UMODL1_uc010goy.1_5'UTR|UMODL1_uc002zaj.1_RNA|UMODL1_uc010goz.1_5'UTR	p.P189R	NM_001004416	NP_001004416	Q5DID0	UROL1_HUMAN			4	566	+			189			Extracellular (Potential).		C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	Missense_Mutation	SNP	ENST00000408910.2	37	c.566C>G	CCDS42936.1	.	.	.	.	.	.	.	.	.	.	C	17.46	3.395035	0.62066	.	.	ENSG00000177398	ENST00000400427;ENST00000400424;ENST00000408989;ENST00000408910;ENST00000380462;ENST00000400417;ENST00000423139	T;T;T;T	0.72615	-0.67;-0.66;-0.67;-0.66	3.9	3.9	0.45041	.	0.165706	0.28301	N	0.015857	T	0.79009	0.4374	M	0.62723	1.935	0.35159	D	0.77051	D;D	0.67145	0.996;0.995	P;P	0.62491	0.903;0.798	D	0.84590	0.0666	10	0.48119	T	0.1	-21.2529	13.6654	0.62391	0.0:1.0:0.0:0.0	.	189;189	Q5DID0-2;Q5DID0	.;UROL1_HUMAN	R	117;117;189;189;35;35;24	ENSP00000383279:P117R;ENSP00000383276:P117R;ENSP00000386126:P189R;ENSP00000386147:P189R	ENSP00000369829:P35R	P	+	2	0	UMODL1	42378554	0.529000	0.26322	0.904000	0.35570	0.924000	0.55760	0.819000	0.27308	2.107000	0.64212	0.563000	0.77884	CCC		0.582	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195292.2			56	212	0	0	0	0.01441	0	56	212				
CCT8L2	150160	broad.mit.edu	37	22	17072655	17072655	+	Silent	SNP	A	A	G			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr22:17072655A>G	ENST00000359963.3	-	1	1045	c.786T>C	c.(784-786)tcT>tcC	p.S262S		NM_014406.4	NP_055221.1	Q96SF2	TCPQM_HUMAN	chaperonin containing TCP1, subunit 8 (theta)-like 2	262					anion transport (GO:0006820)|cellular protein metabolic process (GO:0044267)|potassium ion transmembrane transport (GO:0071805)|transport (GO:0006810)	cytoplasm (GO:0005737)	anion channel activity (GO:0005253)|ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)	p.S262S(1)		breast(3)|endometrium(7)|kidney(1)|large_intestine(8)|liver(2)|lung(37)|ovary(3)|prostate(3)|skin(2)|stomach(1)	67	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				CAGCAGGACTAGAAAGACGGG	0.507																																							uc002zlp.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(784-786)TCT>TCC		T-complex protein 1							109.0	104.0	105.0					22																	17072655		2203	4300	6503	SO:0001819	synonymous_variant	150160				cellular protein metabolic process	cytoplasm	anion channel activity|ATP binding|calcium-activated potassium channel activity	g.chr22:17072655A>G	AP003553	CCDS13738.1	22q11.1	2011-09-01			ENSG00000198445	ENSG00000198445			15553	protein-coding gene	gene with protein product							Standard	NM_014406		Approved	CESK1	uc002zlp.1	Q96SF2	OTTHUMG00000141302	ENST00000359963.3:c.786T>C	22.37:g.17072655A>G							p.S262S	NM_014406	NP_055221	Q96SF2	TCPQM_HUMAN			1	1046	-	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)	262					A4QPH3|Q9UJS3	Silent	SNP	ENST00000359963.3	37	c.786T>C	CCDS13738.1																																																																																				0.507	CCT8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280580.1			9	203	0	0	0	0.008291	0	9	203				
SLC7A4	6545	broad.mit.edu	37	22	21384144	21384144	+	Silent	SNP	G	G	C			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr22:21384144G>C	ENST00000382932.2	-	3	1546	c.1479C>G	c.(1477-1479)ggC>ggG	p.G493G	SLC7A4_ENST00000403586.1_Silent_p.G493G|AC002472.11_ENST00000450652.1_RNA	NM_004173.2	NP_004164.2	O43246	CTR4_HUMAN	solute carrier family 7, member 4	493					basic amino acid transport (GO:0015802)|cellular amino acid metabolic process (GO:0006520)|transport (GO:0006810)	integral component of membrane (GO:0016021)	basic amino acid transmembrane transporter activity (GO:0015174)	p.G493G(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(7)|ovary(1)|prostate(2)	18	all_cancers(11;2.85e-22)|Lung NSC(8;4.21e-14)|all_lung(8;6.08e-13)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0968)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)		L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	CAAGCACGCAGCCTATGGTGA	0.592																																							uc002zud.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|lung(1)	2						c.(1477-1479)GGC>GGG		solute carrier family 7 (cationic amino acid	L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)						64.0	47.0	53.0					22																	21384144		2203	4300	6503	SO:0001819	synonymous_variant	6545				cellular amino acid metabolic process	integral to membrane	basic amino acid transmembrane transporter activity	g.chr22:21384144G>C	AJ000730	CCDS33608.1	22q11.21	2013-07-19	2013-07-19		ENSG00000099960	ENSG00000099960		"""Solute carriers"""	11062	protein-coding gene	gene with protein product		603752	"""solute carrier family 7 (cationic amino acid transporter, y+ system), member 4"", ""solute carrier family 7 (orphan transporter), member 4"""			9598310, 11665818	Standard	NM_004173		Approved	HCAT3, CAT-4, VH	uc002zud.3	O43246	OTTHUMG00000150896	ENST00000382932.2:c.1479C>G	22.37:g.21384144G>C						SLC7A4_uc002zue.2_Silent_p.G493G	p.G493G	NM_004173	NP_004164	O43246	CTR4_HUMAN	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)		3	1547	-	all_cancers(11;2.85e-22)|Lung NSC(8;4.21e-14)|all_lung(8;6.08e-13)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0968)	Lung SC(17;0.0262)	493			Helical; (Potential).		Q0P5U2|Q3KNQ6|Q4VC45|Q6IBY8|Q96H88	Silent	SNP	ENST00000382932.2	37	c.1479C>G	CCDS33608.1																																																																																				0.592	SLC7A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320467.1	NM_004173		26	45	0	0	0	0.021523	0	26	45				
IGLL1	3543	broad.mit.edu	37	22	23917154	23917154	+	Splice_Site	SNP	T	T	C			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr22:23917154T>C	ENST00000330377.2	-	2	439	c.322A>G	c.(322-324)Agt>Ggt	p.S108G	AP000345.2_ENST00000458318.1_RNA|IGLL1_ENST00000249053.3_Intron|AP000345.2_ENST00000454863.1_RNA	NM_020070.3	NP_064455.1	P15814	IGLL1_HUMAN	immunoglobulin lambda-like polypeptide 1	108	J region (By similarity to lambda light- chain).				immune response (GO:0006955)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)		p.S108G(1)		kidney(1)|large_intestine(1)|lung(5)|skin(4)|stomach(1)	12						AGCCACTTACTTAAAACGGTG	0.577																																							uc002zxd.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(322-324)AGT>GGT		immunoglobulin lambda-like polypeptide 1 isoform							64.0	51.0	55.0					22																	23917154		2203	4300	6503	SO:0001630	splice_region_variant	3543				immune response	extracellular region|membrane		g.chr22:23917154T>C	X52204	CCDS13809.1, CCDS13810.1	22q11.23	2014-09-17			ENSG00000128322	ENSG00000128322		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	5870	protein-coding gene	gene with protein product		146770		IGLL		3139558, 2511029	Standard	NM_020070		Approved	IGVPB, IGL5, 14.1, CD179B	uc002zxd.3	P15814	OTTHUMG00000150673	ENST00000330377.2:c.322+1A>G	22.37:g.23917154T>C						IGLL1_uc002zxe.2_Intron	p.S108G	NM_020070	NP_064455	P15814	IGLL1_HUMAN			2	440	-			108			J region (By similarity to lambda light- chain).		Q0P681	Missense_Mutation	SNP	ENST00000330377.2	37	c.322A>G	CCDS13809.1	.	.	.	.	.	.	.	.	.	.	-	0.017	-1.509637	0.00984	.	.	ENSG00000128322	ENST00000330377;ENST00000438703	T;T	0.00940	6.88;5.52	1.74	0.649	0.17806	Immunoglobulin-like fold (1);	0.467603	0.18066	N	0.152775	T	0.00300	0.0009	N	0.00289	-1.7	0.19300	N	0.999977	B	0.02656	0.0	B	0.01281	0.0	T	0.42241	-0.9463	9	.	.	.	.	3.846	0.08934	0.0:0.5293:0.0:0.4707	.	108	P15814	IGLL1_HUMAN	G	108;109	ENSP00000329312:S108G;ENSP00000403391:S109G	.	S	-	1	0	IGLL1	22247154	0.032000	0.19561	0.841000	0.33234	0.015000	0.08874	0.189000	0.17037	0.062000	0.16340	-1.353000	0.01230	AGT		0.577	IGLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319569.1	NM_020070	Missense_Mutation	4	87	0	0	0	0.014758	0	4	87				
CRYBA4	1413	broad.mit.edu	37	22	27021578	27021578	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr22:27021578G>T	ENST00000354760.3	+	4	327	c.292G>T	c.(292-294)Gcc>Tcc	p.A98S	CRYBA4_ENST00000466315.1_3'UTR	NM_001886.2	NP_001877.1	P53673	CRBA4_HUMAN	crystallin, beta A4	98	Beta/gamma crystallin 'Greek key' 2. {ECO:0000255|PROSITE-ProRule:PRU00028}.				camera-type eye development (GO:0043010)|visual perception (GO:0007601)		structural constituent of eye lens (GO:0005212)	p.A98S(1)		large_intestine(6)|liver(1)|lung(6)|skin(3)|urinary_tract(2)	18						CCGGCCTGCGGCCTGTGCTGT	0.597																																							uc003acz.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(292-294)GCC>TCC		crystallin, beta A4							83.0	86.0	85.0					22																	27021578		2203	4300	6503	SO:0001583	missense	1413				camera-type eye development|visual perception	soluble fraction	structural constituent of eye lens	g.chr22:27021578G>T		CCDS13841.1	22q12.1	2008-06-10			ENSG00000196431	ENSG00000196431			2396	protein-coding gene	gene with protein product		123631				8999933, 960806	Standard	NM_001886		Approved		uc003acz.4	P53673	OTTHUMG00000150983	ENST00000354760.3:c.292G>T	22.37:g.27021578G>T	ENSP00000346805:p.Ala98Ser						p.A98S	NM_001886	NP_001877	P53673	CRBA4_HUMAN			4	327	+			98			Beta/gamma crystallin 'Greek key' 2.		Q4VB22|Q6ICE4	Missense_Mutation	SNP	ENST00000354760.3	37	c.292G>T	CCDS13841.1	.	.	.	.	.	.	.	.	.	.	G	8.402	0.842143	0.16963	.	.	ENSG00000196431	ENST00000354760	T	0.74632	-0.86	4.43	1.14	0.20703	Beta/gamma crystallin (2);Gamma-crystallin-related (1);	0.415494	0.25549	N	0.029913	T	0.49983	0.1589	N	0.14661	0.345	0.34647	D	0.721283	B	0.02656	0.0	B	0.04013	0.001	T	0.38178	-0.9673	10	0.19147	T	0.46	.	6.1099	0.20094	0.179:0.155:0.6661:0.0	.	98	P53673	CRBA4_HUMAN	S	98	ENSP00000346805:A98S	ENSP00000346805:A98S	A	+	1	0	CRYBA4	25351578	0.997000	0.39634	0.984000	0.44739	0.620000	0.37586	1.238000	0.32707	0.148000	0.19059	-0.291000	0.09656	GCC		0.597	CRYBA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320793.1	NM_001886		39	206	1	0	2.22609e-26	0.01441	3.30447e-26	39	206				
FAM83F	113828	broad.mit.edu	37	22	40417816	40417816	+	Silent	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr22:40417816C>A	ENST00000333407.6	+	4	1396	c.1302C>A	c.(1300-1302)ccC>ccA	p.P434P	FAM83F_ENST00000473717.1_Silent_p.P266P	NM_138435.2	NP_612444.2	Q8NEG4	FA83F_HUMAN	family with sequence similarity 83, member F	434								p.P434P(1)		breast(1)|endometrium(2)|large_intestine(1)|lung(4)|skin(4)|urinary_tract(2)	14						AGGCCGCCCCCGCCAGGCGCT	0.667																																							uc003ayk.1		NA																	1	Substitution - coding silent(1)		lung(1)	breast(1)	1						c.(1300-1302)CCC>CCA		hypothetical protein LOC113828							17.0	21.0	19.0					22																	40417816		2198	4297	6495	SO:0001819	synonymous_variant	113828							g.chr22:40417816C>A		CCDS14000.2	22q13.1	2006-03-22			ENSG00000133477	ENSG00000133477			25148	protein-coding gene	gene with protein product						12477932	Standard	NM_138435		Approved		uc003ayk.1	Q8NEG4	OTTHUMG00000150688	ENST00000333407.6:c.1302C>A	22.37:g.40417816C>A							p.P434P	NM_138435	NP_612444	Q8NEG4	FA83F_HUMAN			4	1396	+			434					Q96FD6	Silent	SNP	ENST00000333407.6	37	c.1302C>A	CCDS14000.2																																																																																				0.667	FAM83F-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319624.3	NM_138435		15	26	1	0	6.44725e-10	0.014323	7.64053e-10	15	26				
PARVB	29780	broad.mit.edu	37	22	44553945	44553945	+	Silent	SNP	G	G	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr22:44553945G>A	ENST00000338758.7	+	11	990	c.927G>A	c.(925-927)ccG>ccA	p.P309P	PARVB_ENST00000404989.1_Silent_p.P272P|PARVB_ENST00000406477.3_Silent_p.P342P	NM_013327.4	NP_037459.2	Q9HBI1	PARVB_HUMAN	parvin, beta	309	CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin cytoskeleton reorganization (GO:0031532)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell projection assembly (GO:0030031)|establishment or maintenance of cell polarity regulating cell shape (GO:0071963)|lamellipodium assembly (GO:0030032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)		p.P342P(1)		NS(1)|breast(1)|endometrium(3)|large_intestine(7)|lung(8)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	25		Ovarian(80;0.0246)|all_neural(38;0.0423)				ACCTGACTCCGGAAAGCTTCG	0.498																																							uc003ben.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(925-927)CCG>CCA		parvin, beta isoform b							108.0	83.0	92.0					22																	44553945		2203	4300	6503	SO:0001819	synonymous_variant	29780				cell adhesion|cell junction assembly	cytoskeleton|cytosol|focal adhesion	actin binding	g.chr22:44553945G>A	AF151814	CCDS14056.1, CCDS46724.1, CCDS58808.1, CCDS74874.1	22q13.2-q13.33	2013-01-24			ENSG00000188677	ENSG00000188677		"""Parvins"""	14653	protein-coding gene	gene with protein product	"""affixin"""	608121				10810093, 11171322	Standard	NM_001003828		Approved	CGI-56	uc003ben.3	Q9HBI1	OTTHUMG00000150665	ENST00000338758.7:c.927G>A	22.37:g.44553945G>A						PARVB_uc003bem.2_Silent_p.P342P|PARVB_uc010gzn.2_Silent_p.P234P|PARVB_uc003beo.2_Silent_p.P272P	p.P309P	NM_013327	NP_037459	Q9HBI1	PARVB_HUMAN			11	979	+		Ovarian(80;0.0246)|all_neural(38;0.0423)	309			CH 2.		B0QYM8|B0QYN1|B2R9X6|Q5TGJ5|Q86X93|Q96PN1|Q9NSP7|Q9UGT3|Q9Y368|Q9Y3L6|Q9Y3L7	Silent	SNP	ENST00000338758.7	37	c.927G>A	CCDS14056.1																																																																																				0.498	PARVB-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319518.2	NM_001003828		13	39	0	0	0	0.020292	0	13	39				
TTLL3	26140	broad.mit.edu	37	3	9854722	9854722	+	Silent	SNP	A	A	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr3:9854722A>T	ENST00000547186.1	+	3	360	c.144A>T	c.(142-144)tcA>tcT	p.S48S	RP11-266J6.2_ENST00000602768.1_RNA|ARPC4-TTLL3_ENST00000397256.1_Silent_p.S142S|TTLL3_ENST00000426895.4_Silent_p.S191S|TTLL3_ENST00000397241.1_De_novo_Start_OutOfFrame|TTLL3_ENST00000427853.3_5'Flank	NM_001025930.3	NP_001021100.3	Q9Y4R7	TTLL3_HUMAN	tubulin tyrosine ligase-like family, member 3	48					axoneme assembly (GO:0035082)|cilium assembly (GO:0042384)|protein polyglycylation (GO:0018094)	axoneme (GO:0005930)|cilium (GO:0005929)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	protein-glycine ligase activity (GO:0070735)|protein-glycine ligase activity, initiating (GO:0070736)	p.S48S(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(2)|skin(1)	26	Medulloblastoma(99;0.227)					TCCATCGCTCAGGCCCCACCC	0.582																																							uc003btg.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(2)	2						c.(142-144)TCA>TCT		tubulin tyrosine ligase-like family, member 3							65.0	74.0	71.0					3																	9854722		2047	4200	6247	SO:0001819	synonymous_variant	26140				axoneme assembly|cilium assembly|protein polyglycylation	cilium axoneme|cytoplasm|microtubule	protein-glycine ligase activity, initiating|tubulin-tyrosine ligase activity	g.chr3:9854722A>T		CCDS43048.1, CCDS43048.2	3p25.3	2013-02-14			ENSG00000214021	ENSG00000214021		"""Tubulin tyrosine ligase-like family"""	24483	protein-coding gene	gene with protein product						11054573	Standard	NR_037162		Approved	DKFZP434B103, HOTTL	uc003btg.4	Q9Y4R7	OTTHUMG00000128439	ENST00000547186.1:c.144A>T	3.37:g.9854722A>T						ARPC4_uc003btc.1_Intron|TTLL3_uc003btd.3_Silent_p.S48S|TTLL3_uc003btf.3_5'UTR|TTLL3_uc010hco.1_5'Flank|TTLL3_uc003bth.3_5'Flank	p.S48S	NM_001025930	NP_001021100	Q9Y4R7	TTLL3_HUMAN			3	360	+	Medulloblastoma(99;0.227)		48					Q4KMS8|Q6AWA3|Q6ZU95|Q8NDN8|Q96GG8|Q9H876|Q9UI99	Silent	SNP	ENST00000547186.1	37	c.144A>T																																																																																					0.582	TTLL3-203	KNOWN	basic	protein_coding	protein_coding		NM_001025930.2		16	74	0	0	0	0.00499	0	16	74				
GALNT15	117248	broad.mit.edu	37	3	16254188	16254188	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr3:16254188G>A	ENST00000339732.5	+	6	1813	c.1310G>A	c.(1309-1311)aGg>aAg	p.R437K	GALNT15_ENST00000437509.1_Missense_Mutation_p.R437K	NM_054110.4	NP_473451.3	Q8N3T1	GLT15_HUMAN	polypeptide N-acetylgalactosaminyltransferase 15	437					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.R437K(1)									CTGAGGAACAGGGTTCGCATT	0.542																																							uc003car.3		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(1309-1311)AGG>AAG		UDP-N-acetyl-alpha-D-galactosamine:polypeptide							106.0	101.0	103.0					3																	16254188		2203	4300	6503	SO:0001583	missense	117248					Golgi membrane|integral to membrane|transport vesicle	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr3:16254188G>A	AY358443	CCDS33711.1	3p25.1	2014-03-13	2014-03-13	2013-01-25	ENSG00000131386	ENSG00000131386	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	21531	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 15"""	615131	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 2"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15"""	GALNTL2		12975309, 14702039, 15147861	Standard	NM_054110		Approved	GALNT7, pp-GalNAc-T15	uc003car.4	Q8N3T1	OTTHUMG00000156893	ENST00000339732.5:c.1310G>A	3.37:g.16254188G>A	ENSP00000344260:p.Arg437Lys					GALNTL2_uc003caq.3_Missense_Mutation_p.R170K	p.R437K	NM_054110	NP_473451	Q8N3T1	GLTL2_HUMAN			6	1785	+			437			Lumenal (Potential).		A6NMN1|B2R638|F1LIP6|Q86T60|Q96C46|Q96DJ5	Missense_Mutation	SNP	ENST00000339732.5	37	c.1310G>A	CCDS33711.1	.	.	.	.	.	.	.	.	.	.	G	3.509	-0.100280	0.06967	.	.	ENSG00000131386	ENST00000339732;ENST00000437509	T;T	0.60424	0.19;0.19	5.38	4.22	0.49857	.	0.052076	0.64402	N	0.000001	T	0.17916	0.0430	N	0.00268	-1.735	0.22610	N	0.998939	B	0.02656	0.0	B	0.01281	0.0	T	0.30031	-0.9992	10	0.02654	T	1	.	11.0671	0.47982	0.9273:0.0:0.0727:0.0	.	437	Q8N3T1	GLTL2_HUMAN	K	437	ENSP00000344260:R437K;ENSP00000395873:R437K	ENSP00000344260:R437K	R	+	2	0	GALNTL2	16229192	1.000000	0.71417	0.946000	0.38457	0.682000	0.39822	4.486000	0.60286	0.895000	0.36342	-0.340000	0.08031	AGG		0.542	GALNT15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346483.2	NM_054110		72	71	0	0	0	0.01441	0	72	71				
KCNH8	131096	broad.mit.edu	37	3	19575003	19575003	+	Silent	SNP	C	C	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr3:19575003C>T	ENST00000328405.2	+	16	3002	c.2736C>T	c.(2734-2736)agC>agT	p.S912S		NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	912					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)	p.S912S(1)		NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						CTTTGCACAGCACCTCTGTGT	0.522																																					NSCLC(124;1625 1765 8018 24930 42026)	NSCLC(124;1625 1765 8018 24930 42026)	uc003cbk.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(4)|ovary(1)	5						c.(2734-2736)AGC>AGT		potassium voltage-gated channel, subfamily H,							106.0	94.0	98.0					3																	19575003		2203	4300	6503	SO:0001819	synonymous_variant	131096					integral to membrane	two-component sensor activity	g.chr3:19575003C>T	AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.2736C>T	3.37:g.19575003C>T						KCNH8_uc010hex.1_Silent_p.S373S	p.S912S	NM_144633	NP_653234	Q96L42	KCNH8_HUMAN			16	2931	+			912			Cytoplasmic (Potential).		B7Z2I7|Q59GQ6	Silent	SNP	ENST00000328405.2	37	c.2736C>T	CCDS2632.1																																																																																				0.522	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252139.2	NM_144633		46	46	0	0	0	0.01441	0	46	46				
ZNF660	285349	broad.mit.edu	37	3	44636480	44636480	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr3:44636480G>C	ENST00000322734.2	+	3	1128	c.795G>C	c.(793-795)caG>caC	p.Q265H	RP11-944L7.4_ENST00000457331.1_RNA	NM_173658.2	NP_775929.2	Q6AZW8	ZN660_HUMAN	zinc finger protein 660	265					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q265H(1)		large_intestine(2)|lung(4)	6				KIRC - Kidney renal clear cell carcinoma(197;0.0468)|Kidney(197;0.0585)		TTGATCATCAGAGAGTTCACA	0.398																																							uc003cnl.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(793-795)CAG>CAC		zinc finger protein 660							53.0	54.0	54.0					3																	44636480		2203	4300	6503	SO:0001583	missense	285349				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr3:44636480G>C	AK094189	CCDS2716.1	3p21.32	2013-01-08			ENSG00000144792	ENSG00000144792		"""Zinc fingers, C2H2-type"""	26720	protein-coding gene	gene with protein product							Standard	NM_173658		Approved	FLJ36870	uc003cnl.1	Q6AZW8	OTTHUMG00000133097	ENST00000322734.2:c.795G>C	3.37:g.44636480G>C	ENSP00000324605:p.Gln265His						p.Q265H	NM_173658	NP_775929	Q6AZW8	ZN660_HUMAN		KIRC - Kidney renal clear cell carcinoma(197;0.0468)|Kidney(197;0.0585)	3	1128	+			265			C2H2-type 8.		Q7Z331|Q8N9M8	Missense_Mutation	SNP	ENST00000322734.2	37	c.795G>C	CCDS2716.1	.	.	.	.	.	.	.	.	.	.	G	10.96	1.500027	0.26861	.	.	ENSG00000144792	ENST00000322734	T	0.18502	2.21	4.21	3.33	0.38152	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.12561	0.0305	L	0.41492	1.28	0.80722	D	1	B	0.15719	0.014	B	0.17098	0.017	T	0.08848	-1.0702	8	.	.	.	.	6.6793	0.23111	0.095:0.0:0.7291:0.1759	.	265	Q6AZW8	ZN660_HUMAN	H	265	ENSP00000324605:Q265H	.	Q	+	3	2	ZNF660	44611484	0.000000	0.05858	1.000000	0.80357	0.990000	0.78478	0.358000	0.20216	1.113000	0.41760	-0.145000	0.13849	CAG		0.398	ZNF660-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256756.4	NM_173658		14	56	0	0	0	0.003163	0	14	56				
PRSS50	29122	broad.mit.edu	37	3	46757060	46757060	+	Silent	SNP	G	G	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr3:46757060G>A	ENST00000460241.1	-	8	2105	c.435C>T	c.(433-435)tcC>tcT	p.S145S	PRSS50_ENST00000315170.7_Silent_p.S145S			Q9UI38	TSP50_HUMAN	protease, serine, 50	145	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)	serine-type endopeptidase activity (GO:0004252)|threonine-type endopeptidase activity (GO:0004298)	p.S145S(1)		endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	11						GCACCCACTGGGAGGCAATGA	0.647																																					Pancreas(41;915 1239 11561 17469)	Pancreas(41;915 1239 11561 17469)	uc003cqe.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(433-435)TCC>TCT		testes-specific protease 50 precursor							68.0	52.0	57.0					3																	46757060		2202	4300	6502	SO:0001819	synonymous_variant	29122				proteolysis	endoplasmic reticulum	serine-type endopeptidase activity|threonine-type endopeptidase activity	g.chr3:46757060G>A	AF100707	CCDS2745.1	3p21.31	2011-05-24			ENSG00000206549	ENSG00000206549		"""Serine peptidases / Serine peptidases"""	17910	protein-coding gene	gene with protein product	"""cancer/testis antigen 20"", ""testes specific protease 50"""	607950				10397268	Standard	NM_013270		Approved	TSP50, CT20	uc003cqe.1	Q9UI38	OTTHUMG00000164067	ENST00000460241.1:c.435C>T	3.37:g.46757060G>A						PRSS50_uc003cqf.1_Silent_p.S59S	p.S145S	NM_013270	NP_037402	Q9UI38	TSP50_HUMAN			3	494	-			145			Peptidase S1.			Silent	SNP	ENST00000460241.1	37	c.435C>T	CCDS2745.1																																																																																				0.647	PRSS50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354544.1			15	58	0	0	0	0.007413	0	15	58				
KIF9	64147	broad.mit.edu	37	3	47305841	47305841	+	Splice_Site	SNP	C	C	G			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr3:47305841C>G	ENST00000265529.3	-	10	1597		c.e10-1		KIF9_ENST00000335044.2_Splice_Site|KIF9_ENST00000444589.2_Splice_Site|KIF9_ENST00000487440.1_Splice_Site|KIF9_ENST00000452770.2_Splice_Site|KIF9_ENST00000352910.4_Splice_Site			Q9HAQ2	KIF9_HUMAN	kinesin family member 9						ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|extracellular matrix disassembly (GO:0022617)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle disassembly (GO:1903008)|regulation of podosome assembly (GO:0071801)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|podosome (GO:0002102)|vesicle (GO:0031982)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|protein dimerization activity (GO:0046983)	p.?(1)		central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(15)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)	34		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000284)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		CAGTTTCCCCCTGCGGAAAGC	0.428																																					Colon(44;962 1147 15977 24541)	Colon(44;962 1147 15977 24541)	uc010hjp.2		NA																	1	Unknown(1)		lung(1)	skin(1)	1						c.e10-1		kinesin family member 9 isoform 2							163.0	152.0	156.0					3																	47305841		2203	4300	6503	SO:0001630	splice_region_variant	64147				blood coagulation|microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr3:47305841C>G	AF311212	CCDS2751.1, CCDS2752.1	3p21.31	2008-03-03			ENSG00000088727	ENSG00000088727		"""Kinesins"""	16666	protein-coding gene	gene with protein product		607910				11483511	Standard	NM_022342		Approved	MGC104186	uc003cqx.3	Q9HAQ2	OTTHUMG00000133512	ENST00000265529.3:c.917-1G>C	3.37:g.47305841C>G						KIF9_uc003cqx.2_Splice_Site_p.G306_splice|KIF9_uc003cqy.2_Splice_Site_p.G306_splice|KIF9_uc011bat.1_Splice_Site|KIF9_uc011bau.1_Splice_Site	p.G306_splice	NM_001134878	NP_001128350	Q9HAQ2	KIF9_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000284)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)	10	1521	-		Acute lymphoblastic leukemia(5;0.164)						Q86Z28|Q9H8A4	Splice_Site	SNP	ENST00000265529.3	37	c.917_splice	CCDS2752.1	.	.	.	.	.	.	.	.	.	.	c	21.9	4.215217	0.79352	.	.	ENSG00000088727	ENST00000335044;ENST00000265529;ENST00000444589;ENST00000452770;ENST00000352910	.	.	.	5.27	5.27	0.74061	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.4642	0.87628	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KIF9	47280845	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	6.771000	0.74996	2.480000	0.83734	0.556000	0.70494	.		0.428	KIF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257475.2		Intron	34	102	0	0	0	0.019004	0	34	102				
USP19	10869	broad.mit.edu	37	3	49151718	49151718	+	Splice_Site	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr3:49151718C>A	ENST00000398888.2	-	15	2302		c.e15-1		USP19_ENST00000417901.1_Splice_Site|USP19_ENST00000398892.3_Splice_Site|USP19_ENST00000434032.2_Splice_Site|USP19_ENST00000488993.1_5'Flank|USP19_ENST00000453664.1_Splice_Site|USP19_ENST00000398896.1_Splice_Site|USP19_ENST00000398898.2_Splice_Site	NM_006677.2	NP_006668.1	O94966	UBP19_HUMAN	ubiquitin specific peptidase 19						ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of skeletal muscle tissue development (GO:0048642)|positive regulation of cell cycle process (GO:0090068)|protein deubiquitination (GO:0016579)|regulation of cellular response to hypoxia (GO:1900037)|regulation of protein stability (GO:0031647)|response to endoplasmic reticulum stress (GO:0034976)|skeletal muscle atrophy (GO:0014732)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|ubiquitin-specific protease activity (GO:0004843)	p.?(2)		NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(10)|lung(5)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		TGATGGAGACCTGTGGATGTA	0.537																																							uc003cwd.1		NA																	2	Unknown(2)		lung(2)	ovary(4)|breast(2)|lung(1)	7						c.e15-1		ubiquitin thioesterase 19							57.0	61.0	60.0					3																	49151718		1988	4175	6163	SO:0001630	splice_region_variant	10869				ER-associated protein catabolic process|positive regulation of cell cycle process|protein deubiquitination|regulation of protein stability|response to endoplasmic reticulum stress|skeletal muscle atrophy	endoplasmic reticulum membrane|integral to membrane	ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding	g.chr3:49151718C>A	AB020698	CCDS43090.1, CCDS56254.1, CCDS56255.1, CCDS56256.1	3p21.31	2005-10-13	2005-08-08		ENSG00000172046	ENSG00000172046		"""Zinc fingers, MYND-type"", ""Ubiquitin-specific peptidases"""	12617	protein-coding gene	gene with protein product		614471	"""ubiquitin specific protease 19"""			12838346	Standard	NM_001199160		Approved	KIAA0891, ZMYND9	uc011bch.2	O94966	OTTHUMG00000133611	ENST00000398888.2:c.1984-1G>T	3.37:g.49151718C>A						USP19_uc003cwa.2_Splice_Site_p.V470_splice|USP19_uc003cvz.3_Splice_Site_p.V765_splice|USP19_uc011bcg.1_Splice_Site_p.V753_splice|USP19_uc003cwb.2_Intron|USP19_uc003cwc.1_Splice_Site_p.V420_splice|USP19_uc011bch.1_Splice_Site_p.V763_splice	p.V662_splice	NM_006677	NP_006668	O94966	UBP19_HUMAN		BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	15	2145	-								A5PKX8|A6H8U2|B4DGT3|B4DTZ0|E7EN22|E7ETS0|E9PEG8|Q3KQW4|Q641Q9|Q6NZY8|Q86XV9	Splice_Site	SNP	ENST00000398888.2	37	c.1984_splice	CCDS43090.1	.	.	.	.	.	.	.	.	.	.	C	30	5.057566	0.93846	.	.	ENSG00000172046	ENST00000398896;ENST00000398898;ENST00000417901;ENST00000453664;ENST00000398892;ENST00000398888;ENST00000434032	.	.	.	6.17	6.17	0.99709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	USP19	49126722	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.723000	0.84788	2.941000	0.99782	0.655000	0.94253	.		0.537	USP19-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257721.1	NM_006677	Intron	28	85	1	0	7.41945e-09	0.005443	8.62587e-09	28	85				
EPHA6	285220	broad.mit.edu	37	3	97167440	97167440	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr3:97167440C>A	ENST00000389672.5	+	7	1798	c.1760C>A	c.(1759-1761)aCa>aAa	p.T587K	EPHA6_ENST00000502694.1_5'UTR|EPHA6_ENST00000442602.2_5'UTR|EPHA6_ENST00000514100.1_5'UTR	NM_001080448.2	NP_001073917.2	Q9UF33	EPHA6_HUMAN	EPH receptor A6	493						integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)	p.T493K(2)|p.T587K(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						TACTCTTCCACAAGGTCCAAA	0.453																																							uc010how.1		NA																	3	Substitution - Missense(3)		lung(3)	stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16						c.(1759-1761)ACA>AAA		EPH receptor A6 isoform a							114.0	111.0	112.0					3																	97167440		1889	4131	6020	SO:0001583	missense	285220					integral to plasma membrane	ATP binding|ephrin receptor activity	g.chr3:97167440C>A	AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000389672.5:c.1760C>A	3.37:g.97167440C>A	ENSP00000374323:p.Thr587Lys					EPHA6_uc011bgo.1_RNA|EPHA6_uc011bgp.1_5'UTR|EPHA6_uc003drs.3_5'UTR|EPHA6_uc003drr.3_5'UTR|EPHA6_uc003drt.2_5'UTR|EPHA6_uc010hox.1_RNA	p.T587K	NM_001080448	NP_001073917	Q9UF33	EPHA6_HUMAN			7	1803	+			492			Fibronectin type-III 2.|Extracellular (Potential).		D6RAL5	Missense_Mutation	SNP	ENST00000389672.5	37	c.1760C>A	CCDS46876.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.129303	0.77549	.	.	ENSG00000080224	ENST00000389672	T	0.57436	0.4	5.46	5.46	0.80206	.	.	.	.	.	T	0.66934	0.2840	L	0.59436	1.845	0.80722	D	1	.	.	.	.	.	.	T	0.66720	-0.5852	7	0.52906	T	0.07	.	19.2991	0.94136	0.0:1.0:0.0:0.0	.	.	.	.	K	587	ENSP00000374323:T587K	ENSP00000374323:T587K	T	+	2	0	EPHA6	98650130	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.610000	0.61155	2.554000	0.86153	0.655000	0.94253	ACA		0.453	EPHA6-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353845.3	NM_001080448		31	48	1	0	1.07637e-12	0.021022	1.38252e-12	31	48				
CCDC54	84692	broad.mit.edu	37	3	107097226	107097226	+	Missense_Mutation	SNP	T	T	G			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr3:107097226T>G	ENST00000261058.1	+	1	1039	c.792T>G	c.(790-792)agT>agG	p.S264R		NM_032600.2	NP_115989.1	Q8NEL0	CCD54_HUMAN	coiled-coil domain containing 54	264								p.S264R(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	19						TTTTCCTCAGTGCTACCAAGT	0.413																																							uc003dwi.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(790-792)AGT>AGG		coiled-coil domain containing 54							87.0	96.0	93.0					3																	107097226		2203	4300	6503	SO:0001583	missense	84692							g.chr3:107097226T>G	AF367469	CCDS2949.1	3q13.12	2013-10-11			ENSG00000138483	ENSG00000138483			30703	protein-coding gene	gene with protein product	"""sperm protein 17"""					15257753	Standard	NM_032600		Approved	NYD-SP17, FLJ25362, SP17	uc003dwi.1	Q8NEL0	OTTHUMG00000159169	ENST00000261058.1:c.792T>G	3.37:g.107097226T>G	ENSP00000261058:p.Ser264Arg						p.S264R	NM_032600	NP_115989	Q8NEL0	CCD54_HUMAN			1	1039	+			264					Q96A43	Missense_Mutation	SNP	ENST00000261058.1	37	c.792T>G	CCDS2949.1	.	.	.	.	.	.	.	.	.	.	T	12.02	1.811382	0.32053	.	.	ENSG00000138483	ENST00000261058	T	0.56444	0.46	5.09	-1.87	0.07737	.	0.433336	0.21554	N	0.072691	T	0.40040	0.1101	M	0.64997	1.995	0.09310	N	1	B	0.24882	0.113	B	0.26864	0.074	T	0.38950	-0.9637	10	0.72032	D	0.01	0.1186	0.8227	0.01114	0.1621:0.2837:0.1674:0.3867	.	264	Q8NEL0	CCD54_HUMAN	R	264	ENSP00000261058:S264R	ENSP00000261058:S264R	S	+	3	2	CCDC54	108579916	0.034000	0.19679	0.004000	0.12327	0.965000	0.64279	-0.925000	0.03992	-0.326000	0.08564	0.377000	0.23210	AGT		0.413	CCDC54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353651.1	NM_032600		64	91	0	0	0	0.01441	0	64	91				
TRAT1	50852	broad.mit.edu	37	3	108557802	108557802	+	Missense_Mutation	SNP	G	G	T	rs576688406		TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr3:108557802G>T	ENST00000295756.6	+	3	370	c.140G>T	c.(139-141)aGt>aTt	p.S47I	TRAT1_ENST00000426646.1_Missense_Mutation_p.S10I|TRAT1_ENST00000493604.1_3'UTR	NM_016388.2	NP_057472.2	Q6PIZ9	TRAT1_HUMAN	T cell receptor associated transmembrane adaptor 1	47					cellular defense response (GO:0006968)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|negative regulation of receptor recycling (GO:0001920)|negative regulation of transport (GO:0051051)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of T cell receptor signaling pathway (GO:0050862)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.S47I(1)		endometrium(2)|kidney(2)|large_intestine(2)|lung(18)|prostate(1)|skin(3)	28						AGCTACTCCAGTGACCACACC	0.333																																							uc003dxi.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(139-141)AGT>ATT		T-cell receptor interacting molecule							101.0	98.0	99.0					3																	108557802		2203	4300	6503	SO:0001583	missense	50852				cellular defense response|negative regulation of receptor recycling|negative regulation of transport|positive regulation of calcium-mediated signaling|positive regulation of T cell receptor signaling pathway|T cell receptor signaling pathway	integral to plasma membrane|T cell receptor complex	phosphatidylinositol-4,5-bisphosphate 3-kinase activity|transmembrane receptor protein tyrosine kinase adaptor activity	g.chr3:108557802G>T	AJ240084	CCDS33813.1	3q13	2005-05-04	2005-05-04	2005-05-04	ENSG00000163519	ENSG00000163519			30698	protein-coding gene	gene with protein product		604962	"""T cell receptor interacting molecule"""	TCRIM		10663578, 9687533	Standard	NM_016388		Approved	HSPC062, TRIM	uc003dxi.1	Q6PIZ9	OTTHUMG00000159198	ENST00000295756.6:c.140G>T	3.37:g.108557802G>T	ENSP00000295756:p.Ser47Ile					TRAT1_uc010hpx.1_Missense_Mutation_p.S10I	p.S47I	NM_016388	NP_057472	Q6PIZ9	TRAT1_HUMAN			3	284	+			47			Cytoplasmic (Potential).		Q9NZX5	Missense_Mutation	SNP	ENST00000295756.6	37	c.140G>T	CCDS33813.1	.	.	.	.	.	.	.	.	.	.	G	7.642	0.681134	0.14907	.	.	ENSG00000163519	ENST00000295756;ENST00000426646	T;T	0.43294	1.28;0.95	4.16	1.8	0.24995	.	1.074830	0.07179	N	0.853683	T	0.28333	0.0700	N	0.14661	0.345	0.09310	N	1	B;B	0.24963	0.115;0.115	B;B	0.31101	0.068;0.124	T	0.37384	-0.9708	10	0.87932	D	0	-31.5778	5.6592	0.17660	0.7816:0.0:0.2184:0.0	.	10;47	C9JF66;Q6PIZ9	.;TRAT1_HUMAN	I	47;10	ENSP00000295756:S47I;ENSP00000410097:S10I	ENSP00000295756:S47I	S	+	2	0	TRAT1	110040492	0.558000	0.26554	0.342000	0.25602	0.599000	0.36880	0.930000	0.28858	0.416000	0.25844	-1.076000	0.02234	AGT		0.333	TRAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353794.1	NM_016388		34	48	1	0	4.32679e-17	0.006999	5.81879e-17	34	48				
GRAMD1C	54762	broad.mit.edu	37	3	113563429	113563429	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr3:113563429A>G	ENST00000358160.4	+	2	599	c.107A>G	c.(106-108)gAg>gGg	p.E36G	GRAMD1C_ENST00000479212.1_3'UTR|GRAMD1C_ENST00000452134.2_5'UTR	NM_017577.4	NP_060047.3	Q8IYS0	GRM1C_HUMAN	GRAM domain containing 1C	36						integral component of membrane (GO:0016021)		p.E36G(1)		NS(1)|endometrium(1)|large_intestine(6)|lung(13)|ovary(2)|skin(3)	26						ACTGTGGAAGAGAATAATGTG	0.373																																							uc003eaq.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(106-108)GAG>GGG		GRAM domain containing 1C							124.0	129.0	127.0					3																	113563429		2203	4300	6503	SO:0001583	missense	54762					integral to membrane		g.chr3:113563429A>G		CCDS33826.1, CCDS54625.1	3q13.31	2005-11-02			ENSG00000178075	ENSG00000178075			25252	protein-coding gene	gene with protein product						12975309	Standard	NM_017577		Approved	DKFZp434C0328	uc003eaq.4	Q8IYS0	OTTHUMG00000159340	ENST00000358160.4:c.107A>G	3.37:g.113563429A>G	ENSP00000350881:p.Glu36Gly					GRAMD1C_uc011bil.1_RNA|GRAMD1C_uc011bim.1_RNA	p.E36G	NM_017577	NP_060047	Q8IYS0	GRM1C_HUMAN			2	183	+			36					A8K9Y1|A8KA99|Q6AW94|Q6UWN1|Q8N6S0|Q9UF46	Missense_Mutation	SNP	ENST00000358160.4	37	c.107A>G	CCDS33826.1	.	.	.	.	.	.	.	.	.	.	A	14.47	2.546201	0.45383	.	.	ENSG00000178075	ENST00000358160	T	0.33654	1.4	5.58	5.58	0.84498	.	1.102940	0.06830	N	0.793859	T	0.47600	0.1454	N	0.24115	0.695	0.80722	D	1	D	0.71674	0.998	D	0.78314	0.991	T	0.02909	-1.1095	10	0.25751	T	0.34	.	12.1435	0.54010	1.0:0.0:0.0:0.0	.	36	Q8IYS0	GRM1C_HUMAN	G	36	ENSP00000350881:E36G	ENSP00000350881:E36G	E	+	2	0	GRAMD1C	115046119	1.000000	0.71417	0.994000	0.49952	0.727000	0.41649	2.509000	0.45459	2.131000	0.65755	0.533000	0.62120	GAG		0.373	GRAMD1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354733.1	NM_017577		47	158	0	0	0	0.01441	0	47	158				
PLA1A	51365	broad.mit.edu	37	3	119344001	119344001	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr3:119344001A>T	ENST00000273371.4	+	9	1115	c.1043A>T	c.(1042-1044)aAg>aTg	p.K348M	PLA1A_ENST00000488919.1_Missense_Mutation_p.K175M|PLA1A_ENST00000495992.1_Missense_Mutation_p.K332M|PLA1A_ENST00000494440.1_Missense_Mutation_p.K332M	NM_015900.3	NP_056984.1	Q53H76	PLA1A_HUMAN	phospholipase A1 member A	348					lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)|phosphatidylserine metabolic process (GO:0006658)	extracellular vesicular exosome (GO:0070062)	phosphatidylcholine 1-acylhydrolase activity (GO:0008970)	p.K348M(1)		NS(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						TTTCACTTGAAGGAACTGAGA	0.493																																							uc003ecu.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						c.(1042-1044)AAG>ATG		phospholipase A1 member A precursor							185.0	144.0	158.0					3																	119344001		2203	4300	6503	SO:0001583	missense	51365				lipid catabolic process|phosphatidylserine metabolic process	extracellular region	phospholipase A1 activity	g.chr3:119344001A>T	AF035268	CCDS2991.1, CCDS56268.1, CCDS56269.1	3q13.13-q13.2	2002-11-28			ENSG00000144837	ENSG00000144837			17661	protein-coding gene	gene with protein product		607460				10196188	Standard	NM_015900		Approved	ps-PLA1	uc003ecu.3	Q53H76	OTTHUMG00000159425	ENST00000273371.4:c.1043A>T	3.37:g.119344001A>T	ENSP00000273371:p.Lys348Met					PLA1A_uc003ecv.2_Missense_Mutation_p.K332M|PLA1A_uc003ecw.2_RNA|PLA1A_uc011bjc.1_Missense_Mutation_p.K175M	p.K348M	NM_015900	NP_056984	Q53H76	PLA1A_HUMAN			9	1082	+			348					B2R8V2|B4DXA2|O95991|Q86WX6|Q9UPD2	Missense_Mutation	SNP	ENST00000273371.4	37	c.1043A>T	CCDS2991.1	.	.	.	.	.	.	.	.	.	.	A	10.27	1.303665	0.23736	.	.	ENSG00000144837	ENST00000273371;ENST00000488919;ENST00000495992;ENST00000494440	D;D;D;D	0.93712	-2.68;-3.27;-2.67;-2.78	4.56	3.36	0.38483	.	0.453272	0.25759	N	0.028481	D	0.88680	0.6502	N	0.24115	0.695	0.27694	N	0.946021	P;P	0.41569	0.755;0.641	P;B	0.44946	0.465;0.275	T	0.82544	-0.0404	10	0.51188	T	0.08	-0.5756	9.1384	0.36888	0.8373:0.0:0.0:0.1627	.	332;348	Q53H76-3;Q53H76	.;PLA1A_HUMAN	M	348;175;332;332	ENSP00000273371:K348M;ENSP00000420625:K175M;ENSP00000417326:K332M;ENSP00000418793:K332M	ENSP00000273371:K348M	K	+	2	0	PLA1A	120826691	0.993000	0.37304	0.767000	0.31495	0.028000	0.11728	0.922000	0.28734	0.848000	0.35191	0.533000	0.62120	AAG		0.493	PLA1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355252.2			16	84	0	0	0	0.01892	0	16	84				
MCM2	4171	broad.mit.edu	37	3	127337904	127337904	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr3:127337904A>G	ENST00000265056.7	+	13	2292	c.2048A>G	c.(2047-2049)cAc>cGc	p.H683R	MCM2_ENST00000468414.1_3'UTR	NM_004526.2	NP_004517.2	P49736	MCM2_HUMAN	minichromosome maintenance complex component 2	683					cell cycle (GO:0007049)|cellular response to interleukin-4 (GO:0071353)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|MCM complex (GO:0042555)|microtubule cytoskeleton (GO:0015630)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA replication origin binding (GO:0003688)|metal ion binding (GO:0046872)	p.H683R(1)		ovary(3)|skin(2)|stomach(1)	6						GTGGGCAGCCACGTCAGACAC	0.642																																							uc003ejp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(2047-2049)CAC>CGC		minichromosome maintenance complex component 2							29.0	29.0	29.0					3																	127337904		2202	4300	6502	SO:0001583	missense	4171				cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	chromatin|MCM complex	ATP binding|helicase activity|metal ion binding	g.chr3:127337904A>G	X67334	CCDS3043.1	3q21	2007-04-04	2007-04-04		ENSG00000073111	ENSG00000073111			6944	protein-coding gene	gene with protein product	"""mitotin"""	116945	"""minichromosome maintenance deficient (S. cerevisiae) 2 (mitotin)"", ""MCM2 minichromosome maintenance deficient 2, mitotin (S. cerevisiae)"""	CCNL1, CDCL1		1710453, 8258304	Standard	NM_004526		Approved	D3S3194, KIAA0030, BM28, cdc19	uc003ejp.4	P49736	OTTHUMG00000159637	ENST00000265056.7:c.2048A>G	3.37:g.127337904A>G	ENSP00000265056:p.His683Arg					MCM2_uc011bkm.1_Missense_Mutation_p.H553R|MCM2_uc010hsl.2_RNA|MCM2_uc011bkn.1_Missense_Mutation_p.H636R	p.H683R	NM_004526	NP_004517	P49736	MCM2_HUMAN			13	2105	+			683					Q14577|Q15023|Q8N2V1|Q969W7|Q96AE1|Q9BRM7	Missense_Mutation	SNP	ENST00000265056.7	37	c.2048A>G	CCDS3043.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	26.0|26.0	4.698415|4.698415	0.88830|0.88830	.|.	.|.	ENSG00000073111|ENSG00000073111	ENST00000265056;ENST00000539922;ENST00000543142|ENST00000491422	T|.	0.08008|.	3.14|.	5.61|5.61	5.61|5.61	0.85477|0.85477	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.83686|0.83686	0.5308|0.5308	M|M	0.89534|0.89534	3.04|3.04	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	0.997;1.0;1.0|.	D;D;D|.	0.97110|.	0.993;1.0;1.0|.	D|D	0.86901|0.86901	0.2054|0.2054	10|5	0.87932|.	D|.	0|.	-44.3915|-44.3915	15.7928|15.7928	0.78380|0.78380	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	733;553;683|.	F5H1E9;B4DSV5;P49736|.	.;.;MCM2_HUMAN|.	R|A	683;587;733|615	ENSP00000265056:H683R|.	ENSP00000265056:H683R|.	H|T	+|+	2|1	0|0	MCM2|MCM2	128820594|128820594	1.000000|1.000000	0.71417|0.71417	0.989000|0.989000	0.46669|0.46669	0.964000|0.964000	0.63967|0.63967	8.853000|8.853000	0.92222|0.92222	2.132000|2.132000	0.65825|0.65825	0.482000|0.482000	0.46254|0.46254	CAC|ACG		0.642	MCM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356612.1			14	15	0	0	0	0.010504	0	14	15				
EPHB1	2047	broad.mit.edu	37	3	134873028	134873028	+	Missense_Mutation	SNP	T	T	G			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr3:134873028T>G	ENST00000398015.3	+	6	1702	c.1332T>G	c.(1330-1332)agT>agG	p.S444R	EPHB1_ENST00000493838.1_Missense_Mutation_p.S5R	NM_004441.4	NP_004432.1	P54762	EPHB1_HUMAN	EPH receptor B1	444	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|camera-type eye morphogenesis (GO:0048593)|cell chemotaxis (GO:0060326)|cell-substrate adhesion (GO:0031589)|central nervous system projection neuron axonogenesis (GO:0021952)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|neural precursor cell proliferation (GO:0061351)|neurogenesis (GO:0022008)|optic nerve morphogenesis (GO:0021631)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of JNK cascade (GO:0046328)|retinal ganglion cell axon guidance (GO:0031290)	axon (GO:0030424)|early endosome membrane (GO:0031901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|transmembrane-ephrin receptor activity (GO:0005005)	p.S444R(2)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(63)|ovary(8)|pancreas(2)|prostate(8)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	130						ACCAAGTCAGTGCCACTATGA	0.542																																							uc003eqt.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30						c.(1330-1332)AGT>AGG		ephrin receptor EphB1 precursor							191.0	203.0	199.0					3																	134873028		2184	4297	6481	SO:0001583	missense	2047					integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding	g.chr3:134873028T>G	L40636	CCDS46921.1	3q21-q23	2013-02-11	2004-10-28			ENSG00000154928		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3392	protein-coding gene	gene with protein product		600600	"""EphB1"""	EPHT2		8666391	Standard	NM_004441		Approved	Hek6	uc003eqt.3	P54762		ENST00000398015.3:c.1332T>G	3.37:g.134873028T>G	ENSP00000381097:p.Ser444Arg					EPHB1_uc003equ.2_Missense_Mutation_p.S5R	p.S444R	NM_004441	NP_004432	P54762	EPHB1_HUMAN			6	1552	+			444			Fibronectin type-III 2.|Extracellular (Potential).		A8K593|B3KTB2|B5A969|O43569|O95142|O95143|Q0VG87	Missense_Mutation	SNP	ENST00000398015.3	37	c.1332T>G	CCDS46921.1	.	.	.	.	.	.	.	.	.	.	T	14.38	2.518748	0.44763	.	.	ENSG00000154928	ENST00000398015;ENST00000493838	T;T	0.58060	0.36;0.36	5.0	2.61	0.31194	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.091865	0.85682	D	0.000000	T	0.35278	0.0926	L	0.38838	1.175	0.47994	D	0.999568	B	0.33022	0.394	B	0.38842	0.283	T	0.26087	-1.0113	10	0.02654	T	1	.	4.4787	0.11757	0.1434:0.1575:0.0:0.6991	.	444	P54762	EPHB1_HUMAN	R	444;5	ENSP00000381097:S444R;ENSP00000419574:S5R	ENSP00000381097:S444R	S	+	3	2	EPHB1	136355718	0.603000	0.26924	1.000000	0.80357	0.992000	0.81027	-0.214000	0.09292	0.396000	0.25283	-0.256000	0.11100	AGT		0.542	EPHB1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357671.1	NM_004441		5	370	0	0	0	0.001168	0	5	370				
CLDN18	51208	broad.mit.edu	37	3	137717810	137717810	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr3:137717810G>A	ENST00000343735.4	+	1	234	c.100G>A	c.(100-102)Gac>Aac	p.D34N		NM_001002026.2	NP_001002026.1	P56856	CLD18_HUMAN	claudin 18	34					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)	p.D34N(1)		endometrium(1)|large_intestine(2)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	6						GAGCACCCAAGACTTGTACAA	0.582																																							uc003ero.1		NA																	1	Substitution - Missense(1)	p.D34N(1)	ovary(1)	upper_aerodigestive_tract(1)|ovary(1)	2						c.(100-102)GAC>AAC		claudin 18 isoform 2							132.0	114.0	120.0					3																	137717810		2203	4300	6503	SO:0001583	missense	51208				calcium-independent cell-cell adhesion|tight junction assembly	integral to membrane|tight junction	identical protein binding|structural molecule activity	g.chr3:137717810G>A	AF221069, AY102073	CCDS3095.1, CCDS33862.1	3q	2008-08-27			ENSG00000066405	ENSG00000066405		"""Claudins"""	2039	protein-coding gene	gene with protein product		609210	"""surfactant associated protein J"""	SFTPJ			Standard	NM_001002026		Approved		uc003ero.1	P56856	OTTHUMG00000159762	ENST00000343735.4:c.100G>A	3.37:g.137717810G>A	ENSP00000340939:p.Asp34Asn						p.D34N	NM_001002026	NP_001002026	P56856	CLD18_HUMAN			1	153	+			34			Extracellular (Potential).		A5PL21|Q96PH4	Missense_Mutation	SNP	ENST00000343735.4	37	c.100G>A	CCDS33862.1	.	.	.	.	.	.	.	.	.	.	G	18.40	3.615145	0.66672	.	.	ENSG00000066405	ENST00000343735	D	0.88896	-2.44	4.13	4.13	0.48395	.	0.146390	0.45361	D	0.000372	D	0.92890	0.7738	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.90862	0.4739	9	0.21014	T	0.42	.	16.9489	0.86239	0.0:0.0:1.0:0.0	.	34	P56856-2	.	N	34	ENSP00000340939:D34N	ENSP00000340939:D34N	D	+	1	0	CLDN18	139200500	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.143000	0.89621	2.299000	0.77371	0.563000	0.77884	GAC		0.582	CLDN18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000357198.2	NM_001002026		34	178	0	0	0	0.017118	0	34	178				
CLSTN2	64084	broad.mit.edu	37	3	140285094	140285094	+	Nonstop_Mutation	SNP	A	A	G			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr3:140285094A>G	ENST00000458420.3	+	17	3057	c.2867A>G	c.(2866-2868)tAg>tGg	p.*956W		NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	0					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)	p.*956W(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						CTCCCCTACTAGTGCCCAGGG	0.577										HNSCC(16;0.037)																											GBM(45;858 913 3709 36904 37282)	GBM(45;858 913 3709 36904 37282)	uc003etn.2		NA																	1	Nonstop extension(1)		lung(1)	skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						c.(2866-2868)TAG>TGG		calsyntenin 2 precursor							59.0	52.0	54.0					3																	140285094		2194	4279	6473	SO:0001578	stop_lost	64084				homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding	g.chr3:140285094A>G	AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.2867A>G	3.37:g.140285094A>G	ENSP00000402460:p.*956Trpext*14	HNSCC(16;0.037)					p.*956W	NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN			17	3057	+			956					B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Nonstop_Mutation	SNP	ENST00000458420.3	37	c.2867A>G	CCDS3112.1	.	.	.	.	.	.	.	.	.	.	A	15.47	2.843792	0.51164	.	.	ENSG00000158258	ENST00000458420	.	.	.	5.35	5.35	0.76521	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.2845	0.60235	1.0:0.0:0.0:0.0	.	.	.	.	W	956	.	.	X	+	2	0	CLSTN2	141767784	1.000000	0.71417	0.991000	0.47740	0.864000	0.49448	2.635000	0.46537	2.026000	0.59711	0.533000	0.62120	TAG		0.577	CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359393.3	NM_022131		5	3	0	0	0	0.001168	0	5	3				
PCOLCE2	26577	broad.mit.edu	37	3	142567166	142567166	+	Missense_Mutation	SNP	G	G	A	rs547465850		TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr3:142567166G>A	ENST00000295992.3	-	3	647	c.341C>T	c.(340-342)gCc>gTc	p.A114V	PCOLCE2_ENST00000485766.1_Missense_Mutation_p.A114V	NM_013363.3	NP_037495.1	Q9UKZ9	PCOC2_HUMAN	procollagen C-endopeptidase enhancer 2	114	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				positive regulation of peptidase activity (GO:0010952)	extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|peptidase activator activity (GO:0016504)	p.A114V(1)		NS(1)|endometrium(1)|large_intestine(11)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	32						GGACACAAGGGCTCCAGGCCG	0.542													G|||	1	0.000199681	0.0	0.0	5008	,	,		19258	0.001		0.0	False		,,,				2504	0.0						uc003evd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(340-342)GCC>GTC		procollagen C-endopeptidase enhancer 2							92.0	86.0	88.0					3																	142567166		2203	4300	6503	SO:0001583	missense	26577					extracellular region	collagen binding|heparin binding|peptidase activator activity	g.chr3:142567166G>A	AF098269	CCDS3127.1	3q21-q24	2008-07-18			ENSG00000163710	ENSG00000163710			8739	protein-coding gene	gene with protein product		607064				10873381	Standard	NM_013363		Approved	PCPE2	uc003evd.3	Q9UKZ9	OTTHUMG00000159312	ENST00000295992.3:c.341C>T	3.37:g.142567166G>A	ENSP00000295992:p.Ala114Val						p.A114V	NM_013363	NP_037495	Q9UKZ9	PCOC2_HUMAN			3	537	-			114			CUB 1.		B2RCH9|D3DNG4|Q9BRH3	Missense_Mutation	SNP	ENST00000295992.3	37	c.341C>T	CCDS3127.1	.	.	.	.	.	.	.	.	.	.	G	18.33	3.600190	0.66332	.	.	ENSG00000163710	ENST00000295992;ENST00000485766	T;T	0.17528	2.27;2.27	5.25	5.25	0.73442	CUB (5);	0.220678	0.46758	D	0.000270	T	0.15132	0.0365	N	0.21508	0.67	0.51767	D	0.999932	B	0.10296	0.003	B	0.21151	0.033	T	0.06303	-1.0834	10	0.33940	T	0.23	-8.0557	19.0791	0.93175	0.0:0.0:1.0:0.0	.	114	Q9UKZ9	PCOC2_HUMAN	V	114	ENSP00000295992:A114V;ENSP00000419842:A114V	ENSP00000295992:A114V	A	-	2	0	PCOLCE2	144049856	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	9.263000	0.95617	2.742000	0.94016	0.644000	0.83932	GCC		0.542	PCOLCE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354509.1	NM_013363		28	73	0	0	0	0.008361	0	28	73				
ZIC4	84107	broad.mit.edu	37	3	147108911	147108911	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr3:147108911A>T	ENST00000383075.3	-	4	1323	c.811T>A	c.(811-813)Tgc>Agc	p.C271S	ZIC4_ENST00000525172.2_Missense_Mutation_p.C321S|ZIC4_ENST00000491672.1_Missense_Mutation_p.C65S|ZIC4_ENST00000473123.1_Missense_Mutation_p.C271S|ZIC4_ENST00000484399.1_Missense_Mutation_p.C271S|ZIC4_ENST00000425731.3_Missense_Mutation_p.C309S|ZIC4_ENST00000472749.2_5'UTR	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4	271						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C271S(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						CACTTGTCGCAGCCCCGCACC	0.642																																							uc003ewd.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|central_nervous_system(1)	2						c.(811-813)TGC>AGC		zinc finger protein of the cerebellum 4							41.0	47.0	45.0					3																	147108911		2203	4300	6503	SO:0001583	missense	84107					nucleus	DNA binding|zinc ion binding	g.chr3:147108911A>T	AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.811T>A	3.37:g.147108911A>T	ENSP00000372553:p.Cys271Ser					ZIC4_uc003ewc.1_Missense_Mutation_p.C201S|ZIC4_uc011bno.1_Missense_Mutation_p.C321S	p.C271S	NM_032153	NP_115529	Q8N9L1	ZIC4_HUMAN			4	1084	-			271			C2H2-type 5.		A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	Missense_Mutation	SNP	ENST00000383075.3	37	c.811T>A	CCDS43160.1	.	.	.	.	.	.	.	.	.	.	A	29.7	5.028071	0.93518	.	.	ENSG00000174963	ENST00000383075;ENST00000425731;ENST00000525172;ENST00000484399;ENST00000473123;ENST00000491672	D;D;D;D;D;D	0.99974	-10.2;-10.2;-10.2;-10.2;-10.2;-10.2	4.85	4.85	0.62838	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.50627	D	0.000110	D	0.99981	0.9994	H	0.97758	4.07	0.52099	D	0.999948	D;D	0.89917	1.0;1.0	D;D	0.91635	0.994;0.999	D	0.97794	1.0240	9	0.87932	D	0	.	14.4336	0.67266	1.0:0.0:0.0:0.0	.	321;271	B7Z2L2;Q8N9L1	.;ZIC4_HUMAN	S	271;309;321;271;271;65	ENSP00000372553:C271S;ENSP00000397695:C309S;ENSP00000435509:C321S;ENSP00000417855:C271S;ENSP00000420775:C271S;ENSP00000418277:C65S	ENSP00000372553:C271S	C	-	1	0	ZIC4	148591601	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.236000	0.95360	1.809000	0.52856	0.379000	0.24179	TGC		0.642	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355504.1			24	31	0	0	0	0.00632	0	24	31				
GMPS	8833	broad.mit.edu	37	3	155649598	155649598	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr3:155649598A>T	ENST00000496455.2	+	13	1940	c.1605A>T	c.(1603-1605)aaA>aaT	p.K535N	GMPS_ENST00000295920.7_Missense_Mutation_p.K436N	NM_003875.2	NP_003866.1	P49915	GUAA_HUMAN	guanine monphosphate synthase	535					glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|GMP synthase (glutamine-hydrolyzing) activity (GO:0003922)|GMP synthase activity (GO:0003921)|pyrophosphatase activity (GO:0016462)	p.K535N(1)		breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(12)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)		L-Glutamine(DB00130)	TCTCCAGTAAAGATGAACCTG	0.403			T	MLL	AML																																Ovarian(153;896 1876 4149 15499 28134)	Ovarian(153;896 1876 4149 15499 28134)	uc003faq.2		NA		Dom	yes		3	3q24	8833	T	guanine monphosphate synthetase			L	MLL		AML		1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(1)	3						c.(1603-1605)AAA>AAT		guanine monophosphate synthetase	L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)						197.0	180.0	185.0					3																	155649598		1856	4097	5953	SO:0001583	missense	8833				glutamine metabolic process|purine base biosynthetic process	cytosol	ATP binding|GMP synthase (glutamine-hydrolyzing) activity|GMP synthase activity	g.chr3:155649598A>T	U10860	CCDS46941.1	3q25.31	2013-06-18	2013-06-18		ENSG00000163655	ENSG00000163655	6.3.5.2		4378	protein-coding gene	gene with protein product	"""GMP synthase"""	600358	"""guanine monphosphate synthetase"""			8089153, 9195163	Standard	NM_003875		Approved		uc003faq.3	P49915	OTTHUMG00000158551	ENST00000496455.2:c.1605A>T	3.37:g.155649598A>T	ENSP00000419851:p.Lys535Asn					GMPS_uc011bom.1_Missense_Mutation_p.K436N	p.K535N	NM_003875	NP_003866	P49915	GUAA_HUMAN	Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)		13	1940	+			535					A8K639|B4DXV7|F8W720	Missense_Mutation	SNP	ENST00000496455.2	37	c.1605A>T	CCDS46941.1	.	.	.	.	.	.	.	.	.	.	A	13.14	2.149536	0.37923	.	.	ENSG00000163655	ENST00000496455;ENST00000295920;ENST00000537975;ENST00000541628	.	.	.	5.55	3.17	0.36434	GMP synthase, C-terminal (1);	0.102938	0.64402	D	0.000004	T	0.36880	0.0983	N	0.19112	0.55	0.58432	D	0.999991	B;B	0.02656	0.0;0.0	B;B	0.10450	0.001;0.005	T	0.09422	-1.0675	9	0.18276	T	0.48	-16.511	8.397	0.32564	0.7621:0.0:0.2379:0.0	.	436;535	F8W720;P49915	.;GUAA_HUMAN	N	535;436;484;535	.	ENSP00000295920:K436N	K	+	3	2	GMPS	157132292	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.438000	0.52871	0.947000	0.37659	0.533000	0.62120	AAA		0.403	GMPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351260.2			84	148	0	0	0	0.01441	0	84	148				
GOLIM4	27333	broad.mit.edu	37	3	167761282	167761282	+	Silent	SNP	G	G	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr3:167761282G>A	ENST00000470487.1	-	5	1091	c.402C>T	c.(400-402)gaC>gaT	p.D134D	GOLIM4_ENST00000309027.4_Silent_p.D134D	NM_014498.3	NP_055313.1	O00461	GOLI4_HUMAN	golgi integral membrane protein 4	134	Endosome targeting.				transport (GO:0006810)	cis-Golgi network (GO:0005801)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)		p.D134D(1)		breast(5)|endometrium(2)|large_intestine(8)|lung(26)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						CCTCTTCCAAGTCACTGTGCT	0.378																																							uc003ffe.2		NA																	1	Substitution - coding silent(1)		lung(1)	breast(4)|skin(1)	5						c.(400-402)GAC>GAT		golgi integral membrane protein 4							184.0	177.0	179.0					3																	167761282		2203	4300	6503	SO:0001819	synonymous_variant	27333				transport	cis-Golgi network|endocytic vesicle|endosome membrane|Golgi cisterna membrane|Golgi lumen|integral to membrane|nucleus		g.chr3:167761282G>A	U55853	CCDS3204.1	3q26	2007-07-30	2007-07-30	2007-07-30	ENSG00000173905	ENSG00000173905			15448	protein-coding gene	gene with protein product		606805	"""golgi phosphoprotein 4"""	GOLPH4		9201717, 15004235	Standard	NM_014498		Approved	GPP130, GIMPC, P138	uc003ffe.2	O00461	OTTHUMG00000158554	ENST00000470487.1:c.402C>T	3.37:g.167761282G>A						GOLIM4_uc011bpe.1_Silent_p.D134D|GOLIM4_uc011bpf.1_Silent_p.D134D|GOLIM4_uc011bpg.1_Silent_p.D134D	p.D134D	NM_014498	NP_055313	O00461	GOLI4_HUMAN			5	746	-			134			Endosome targeting.|Potential.|Lumenal (Potential).			Silent	SNP	ENST00000470487.1	37	c.402C>T	CCDS3204.1																																																																																				0.378	GOLIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351278.2			34	168	0	0	0	0.005524	0	34	168				
LAMP3	27074	broad.mit.edu	37	3	182870212	182870212	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr3:182870212T>A	ENST00000265598.3	-	3	1094	c.839A>T	c.(838-840)aAc>aTc	p.N280I	LAMP3_ENST00000466939.1_Missense_Mutation_p.N256I	NM_014398.3	NP_055213.2	Q9UQV4	LAMP3_HUMAN	lysosomal-associated membrane protein 3	280					cell proliferation (GO:0008283)|immune system process (GO:0002376)	alveolar lamellar body membrane (GO:0097233)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)		p.N280I(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(9)|ovary(2)|prostate(2)	28	all_cancers(143;9.14e-14)|Ovarian(172;0.0355)		all cancers(12;2.91e-44)|Epithelial(37;5.52e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;4.16e-21)			CAACAGAAGGTTGGATTTTCG	0.468																																							uc003flh.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(838-840)AAC>ATC		lysosomal-associated membrane protein 3							164.0	175.0	172.0					3																	182870212		2203	4300	6503	SO:0001583	missense	27074				cell proliferation	integral to membrane|lysosomal membrane		g.chr3:182870212T>A	AB013924	CCDS3242.1	3q26.3-q27	2011-11-24			ENSG00000078081	ENSG00000078081		"""CD molecules"""	14582	protein-coding gene	gene with protein product		605883				9721848	Standard	NM_014398		Approved	LAMP, TSC403, DC-LAMP, DCLAMP, CD208	uc003flh.4	Q9UQV4	OTTHUMG00000158387	ENST00000265598.3:c.839A>T	3.37:g.182870212T>A	ENSP00000265598:p.Asn280Ile						p.N280I	NM_014398	NP_055213	Q9UQV4	LAMP3_HUMAN	all cancers(12;2.91e-44)|Epithelial(37;5.52e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;4.16e-21)		3	1063	-	all_cancers(143;9.14e-14)|Ovarian(172;0.0355)		280			Lumenal (Potential).		D3DNS4|O94781|Q8NEC8	Missense_Mutation	SNP	ENST00000265598.3	37	c.839A>T	CCDS3242.1	.	.	.	.	.	.	.	.	.	.	T	17.01	3.278528	0.59758	.	.	ENSG00000078081	ENST00000265598;ENST00000466939	T;T	0.33865	1.39;1.39	5.52	3.13	0.36017	.	0.089181	0.48767	D	0.000178	T	0.46483	0.1395	M	0.75447	2.3	0.33325	D	0.567863	D	0.54772	0.968	P	0.52909	0.713	T	0.60449	-0.7261	10	0.62326	D	0.03	-8.071	7.4163	0.27047	0.0:0.1723:0.0:0.8277	.	280	Q9UQV4	LAMP3_HUMAN	I	280;256	ENSP00000265598:N280I;ENSP00000418912:N256I	ENSP00000265598:N280I	N	-	2	0	LAMP3	184352906	1.000000	0.71417	1.000000	0.80357	0.675000	0.39556	1.558000	0.36309	0.470000	0.27294	0.528000	0.53228	AAC		0.468	LAMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350863.1			157	247	0	0	0	0.01441	0	157	247				
ABCC5	10057	broad.mit.edu	37	3	183669353	183669353	+	Silent	SNP	C	C	T	rs139563504		TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr3:183669353C>T	ENST00000334444.6	-	20	3060	c.2820G>A	c.(2818-2820)acG>acA	p.T940T	ABCC5_ENST00000265586.6_Silent_p.T940T	NM_005688.2	NP_005679.2	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 5	940	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)	p.T940T(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cisplatin(DB00515)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Glutathione(DB00143)|Mercaptopurine(DB01033)|Probenecid(DB01032)|Rifampicin(DB01045)|Sildenafil(DB00203)|Sulfinpyrazone(DB01138)|Zidovudine(DB00495)	AAGCTCGCAGCGTGCCCTGAG	0.592																																							uc003fmg.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|large_intestine(1)|central_nervous_system(1)	4						c.(2818-2820)ACG>ACA		ATP-binding cassette, sub-family C, member 5		T		0,4126		0,0,2063	55.0	61.0	59.0		2820	-5.5	0.8	3	dbSNP_134	59	1,8445		0,1,4222	no	coding-synonymous	ABCC5	NM_005688.2		0,1,6285	TT,TC,CC		0.0118,0.0,0.0080		940/1438	183669353	1,12571	2063	4223	6286	SO:0001819	synonymous_variant	10057					integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity	g.chr3:183669353C>T	AF104942	CCDS33898.1, CCDS43176.1	3q27	2012-03-14			ENSG00000114770	ENSG00000114770		"""ATP binding cassette transporters / subfamily C"""	56	protein-coding gene	gene with protein product		605251				8894702, 9827529	Standard	XM_005247058		Approved	MRP5, SMRP, EST277145, MOAT-C	uc003fmg.3	O15440	OTTHUMG00000156871	ENST00000334444.6:c.2820G>A	3.37:g.183669353C>T						ABCC5_uc011bqt.1_Silent_p.T468T|ABCC5_uc010hxl.2_Silent_p.T940T	p.T940T	NM_005688	NP_005679	O15440	MRP5_HUMAN	Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		20	2985	-	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		940			ABC transmembrane type-1 2.		B9EIQ2|O14517|Q29ZA9|Q29ZB1|Q86UX3|Q86W30|Q9UN85|Q9UNP5|Q9UQC3	Silent	SNP	ENST00000334444.6	37	c.2820G>A	CCDS43176.1																																																																																				0.592	ABCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346350.1	NM_005688		21	143	0	0	0	0.005443	0	21	143				
LRCH3	84859	broad.mit.edu	37	3	197598238	197598238	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr3:197598238G>T	ENST00000425562.2	+	19	2035	c.2035G>T	c.(2035-2037)Gga>Tga	p.G679*	LRCH3_ENST00000441090.2_Nonsense_Mutation_p.G525*|LRCH3_ENST00000334859.4_Nonsense_Mutation_p.G679*|LRCH3_ENST00000536618.1_Nonsense_Mutation_p.G274*|LRCH3_ENST00000414675.2_Nonsense_Mutation_p.G627*|LRCH3_ENST00000438796.2_Nonsense_Mutation_p.G679*			Q96II8	LRCH3_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 3	679	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.					cytoplasm (GO:0005737)|extracellular region (GO:0005576)		p.G679*(2)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;4.82e-24)|all cancers(36;3.61e-22)|OV - Ovarian serous cystadenocarcinoma(49;7.08e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.119)		TTGTGATCTCGGAGCAGCTCT	0.423																																							uc011bul.1		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(1)	1						c.(2035-2037)GGA>TGA		leucine-rich repeats and calponin homology (CH)							274.0	254.0	261.0					3																	197598238		2203	4300	6503	SO:0001587	stop_gained	84859					extracellular region		g.chr3:197598238G>T	AL137527	CCDS3330.1	3q29	2006-04-12			ENSG00000186001	ENSG00000186001			28637	protein-coding gene	gene with protein product						12477932	Standard	NM_032773		Approved	MGC4126	uc003fyj.1	Q96II8	OTTHUMG00000155378	ENST00000425562.2:c.2035G>T	3.37:g.197598238G>T	ENSP00000393579:p.Gly679*					LRCH3_uc003fyj.1_Nonsense_Mutation_p.G679*|LRCH3_uc011bum.1_Nonsense_Mutation_p.G627*|LRCH3_uc011bun.1_Nonsense_Mutation_p.G525*|LRCH3_uc003fyk.2_Nonsense_Mutation_p.G274*	p.G679*	NM_032773	NP_116162	Q96II8	LRCH3_HUMAN	Epithelial(36;4.82e-24)|all cancers(36;3.61e-22)|OV - Ovarian serous cystadenocarcinoma(49;7.08e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.119)	19	2040	+	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		679			CH.		B4E0T7|Q96FP9|Q9NT52	Nonsense_Mutation	SNP	ENST00000425562.2	37	c.2035G>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	35|35	5.585863|5.585863	0.96578|0.96578	.|.	.|.	ENSG00000186001|ENSG00000186001	ENST00000438796;ENST00000441090;ENST00000414675;ENST00000334859;ENST00000425562;ENST00000536618;ENST00000452660;ENST00000433298|ENST00000428136	.|.	.|.	.|.	5.79|5.79	4.92|4.92	0.64577|0.64577	.|.	0.067870|.	0.64402|.	D|.	0.000018|.	.|T	.|0.66858	.|0.2832	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.71659	.|-0.4526	.|3	0.87932|.	D|.	0|.	-13.1972|-13.1972	15.1664|15.1664	0.72828|0.72828	0.0675:0.0:0.9325:0.0|0.0675:0.0:0.9325:0.0	.|.	.|.	.|.	.|.	X|L	679;525;627;679;679;274;154;116|56	.|.	ENSP00000334375:G679X|.	G|R	+|+	1|2	0|0	LRCH3|LRCH3	199082635|199082635	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.861000|0.861000	0.49209|0.49209	7.575000|7.575000	0.82447|0.82447	1.482000|1.482000	0.48325|0.48325	-0.125000|-0.125000	0.14975|0.14975	GGA|CGG		0.423	LRCH3-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000339965.1	NM_032773		76	335	1	0	1.91123e-38	0.01441	3.07085e-38	76	335				
RGS12	6002	broad.mit.edu	37	4	3432320	3432320	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr4:3432320G>T	ENST00000344733.5	+	17	4656	c.3752G>T	c.(3751-3753)cGg>cTg	p.R1251L	RGS12_ENST00000382788.3_Missense_Mutation_p.R1251L|RGS12_ENST00000538395.1_3'UTR|RGS12_ENST00000336727.3_Missense_Mutation_p.R1251L|RGS12_ENST00000338806.4_Missense_Mutation_p.R603L	NM_198229.2	NP_937872.1	O14924	RGS12_HUMAN	regulator of G-protein signaling 12	1251					positive regulation of GTPase activity (GO:0043547)|regulation of catalytic activity (GO:0050790)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|GTPase regulator activity (GO:0030695)|receptor signaling protein activity (GO:0005057)	p.R1251L(1)		autonomic_ganglia(1)|breast(4)|endometrium(3)|kidney(2)|large_intestine(9)|lung(16)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		GGCAACGGCCGGGAGAGCGCC	0.667																																							uc003ggw.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(3751-3753)CGG>CTG		regulator of G-protein signalling 12 isoform 1							33.0	26.0	29.0					4																	3432320		2201	4300	6501	SO:0001583	missense	6002					condensed nuclear chromosome|cytoplasm|plasma membrane	GTPase activator activity|receptor signaling protein activity	g.chr4:3432320G>T	AF035152	CCDS3366.1, CCDS3367.1, CCDS3368.1	4p16.3	2008-02-05	2007-08-14		ENSG00000159788	ENSG00000159788		"""Regulators of G-protein signaling"""	9994	protein-coding gene	gene with protein product		602512	"""regulator of G-protein signalling 12"""			9651375	Standard	NM_198229		Approved		uc003ggw.3	O14924	OTTHUMG00000090277	ENST00000344733.5:c.3752G>T	4.37:g.3432320G>T	ENSP00000339381:p.Arg1251Leu					RGS12_uc003ggv.2_Missense_Mutation_p.R1251L|RGS12_uc003ggy.1_3'UTR|RGS12_uc003ggz.2_Missense_Mutation_p.R603L|RGS12_uc011bvs.1_3'UTR|RGS12_uc003gha.2_Missense_Mutation_p.R593L|RGS12_uc010icv.2_Missense_Mutation_p.R450L	p.R1251L	NM_198229	NP_937872	O14924	RGS12_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (64;0.168)	17	4656	+			1251					B1AQ30|B1AQ31|B1AQ32|B7Z764|E7EMN9|O14922|O14923|O43510|O75338|Q147X0|Q8WX95	Missense_Mutation	SNP	ENST00000344733.5	37	c.3752G>T	CCDS3366.1	.	.	.	.	.	.	.	.	.	.	G	12.93	2.086440	0.36855	.	.	ENSG00000159788	ENST00000344733;ENST00000336727;ENST00000382788;ENST00000338806	T;T;T;T	0.34859	1.61;1.62;1.62;1.34	4.49	-0.859	0.10685	.	3.256340	0.01220	N	0.008098	T	0.29458	0.0734	L	0.29908	0.895	0.09310	N	0.999999	P;P;B;P	0.36577	0.558;0.507;0.422;0.558	B;B;B;B	0.35240	0.198;0.149;0.062;0.198	T	0.28933	-1.0028	10	0.30854	T	0.27	-3.2061	11.0523	0.47898	0.4338:0.0:0.5662:0.0	.	593;603;1251;1251	O14924-2;O14924-3;O14924;O14924-4	.;.;RGS12_HUMAN;.	L	1251;1251;1251;603	ENSP00000339381:R1251L;ENSP00000338509:R1251L;ENSP00000372238:R1251L;ENSP00000342133:R603L	ENSP00000338509:R1251L	R	+	2	0	RGS12	3402118	0.013000	0.17824	0.003000	0.11579	0.030000	0.12068	0.028000	0.13644	-0.458000	0.07023	0.655000	0.94253	CGG		0.667	RGS12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206602.1	NM_002926		11	10	1	0	3.45872e-05	0.004007	3.81437e-05	11	10				
CSN1S1	1446	broad.mit.edu	37	4	70804920	70804920	+	Silent	SNP	G	G	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr4:70804920G>A	ENST00000246891.4	+	10	319	c.270G>A	c.(268-270)tcG>tcA	p.S90S	CSN1S1_ENST00000505782.1_Silent_p.S82S|CSN1S1_ENST00000507763.1_Silent_p.S89S|CSN1S1_ENST00000444405.3_Silent_p.S89S|CSN1S1_ENST00000507772.1_Silent_p.S90S	NM_001890.1	NP_001881.1	P47710	CASA1_HUMAN	casein alpha s1	90						extracellular region (GO:0005576)|extracellular space (GO:0005615)	transporter activity (GO:0005215)	p.S90S(1)		lung(5)|prostate(1)|upper_aerodigestive_tract(1)	7						TCAGTTCATCGAGTGAGGTAA	0.323																																							uc003hep.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(268-270)TCG>TCA		casein alpha s1 isoform 1							83.0	83.0	83.0					4																	70804920		1794	4063	5857	SO:0001819	synonymous_variant	1446					extracellular region	protein binding|transporter activity	g.chr4:70804920G>A	X78416	CCDS47067.1, CCDS54769.1	4q21.1	2014-02-19	2003-01-24	2003-01-31	ENSG00000126545	ENSG00000126545			2445	protein-coding gene	gene with protein product		115450	"""casein, alpha"""	CASA, CSN1		9050925, 7619062	Standard	NM_001890		Approved		uc003hep.1	P47710	OTTHUMG00000160843	ENST00000246891.4:c.270G>A	4.37:g.70804920G>A						CSN1S1_uc003heq.1_Silent_p.S89S|CSN1S1_uc003her.1_Silent_p.S90S	p.S90S	NM_001890	NP_001881	P47710	CASA1_HUMAN			10	319	+			90					A1A510|A1A511|E9PB60|Q4PNR5	Silent	SNP	ENST00000246891.4	37	c.270G>A	CCDS47067.1																																																																																				0.323	CSN1S1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362629.1			9	54	0	0	0	0.006214	0	9	54				
GPRIN3	285513	broad.mit.edu	37	4	90169061	90169061	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr4:90169061G>T	ENST00000609438.1	-	2	2719	c.2201C>A	c.(2200-2202)tCc>tAc	p.S734Y	GPRIN3_ENST00000333209.4_Missense_Mutation_p.S734Y	NM_198281.2	NP_938022.2	Q6ZVF9	GRIN3_HUMAN	GPRIN family member 3	734								p.S734Y(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|prostate(2)|skin(1)	36		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)		TGAGGAAATGGATCTCCGGGT	0.478																																							uc003hsm.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(2200-2202)TCC>TAC		G protein-regulated inducer of neurite outgrowth							105.0	106.0	106.0					4																	90169061		2203	4300	6503	SO:0001583	missense	285513							g.chr4:90169061G>T	AK124616	CCDS34030.1	4q22.1	2006-08-24				ENSG00000185477			27733	protein-coding gene	gene with protein product		611241				15488195	Standard	NM_198281		Approved	GRIN3, FLJ42625	uc003hsm.1	Q6ZVF9		ENST00000609438.1:c.2201C>A	4.37:g.90169061G>T	ENSP00000476603:p.Ser734Tyr						p.S734Y	NM_198281	NP_938022	Q6ZVF9	GRIN3_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)	2	2720	-		Hepatocellular(203;0.114)	734					Q8IVE4	Missense_Mutation	SNP	ENST00000609438.1	37	c.2201C>A	CCDS34030.1	.	.	.	.	.	.	.	.	.	.	G	16.47	3.132694	0.56828	.	.	ENSG00000185477	ENST00000333209	T	0.26810	1.71	5.04	5.04	0.67666	.	0.000000	0.32884	N	0.005532	T	0.45756	0.1358	L	0.43923	1.385	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.40021	-0.9585	10	0.72032	D	0.01	-14.7411	18.5856	0.91188	0.0:0.0:1.0:0.0	.	734	Q6ZVF9	GRIN3_HUMAN	Y	734	ENSP00000328672:S734Y	ENSP00000328672:S734Y	S	-	2	0	GPRIN3	90388084	1.000000	0.71417	0.997000	0.53966	0.123000	0.20343	9.222000	0.95196	2.617000	0.88574	0.655000	0.94253	TCC		0.478	GPRIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363540.2	NM_198281		58	228	1	0	3.93605e-18	0.01441	5.3776e-18	58	228				
SLC9B1	150159	broad.mit.edu	37	4	103870474	103870474	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr4:103870474C>A	ENST00000296422.7	-	4	463	c.322G>T	c.(322-324)Ggg>Tgg	p.G108W	SLC9B1_ENST00000394789.3_Missense_Mutation_p.G108W	NM_139173.3	NP_631912	Q4ZJI4	SL9B1_HUMAN	solute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1	108					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)	p.G108W(1)									ATTTTTCCCCCAATAATGGCA	0.353																																							uc003hww.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(322-324)GGG>TGG		Na+/H+ exchanger domain containing 1 isoform 1							52.0	55.0	54.0					4																	103870474		2191	4291	6482	SO:0001583	missense	150159					integral to membrane	solute:hydrogen antiporter activity	g.chr4:103870474C>A	AF447585	CCDS34041.1, CCDS47119.1	4q24	2013-05-22	2012-03-22	2011-07-26	ENSG00000164037	ENSG00000164037		"""Solute carriers"""	24244	protein-coding gene	gene with protein product		611527	"""Na+/H+ exchanger domain containing 1"", ""solute carrier family 9, subfamily B (cation proton antiporter 2), member 1"""	NHEDC1		16850186	Standard	NM_139173		Approved	NHA1	uc003hww.3	Q4ZJI4	OTTHUMG00000161114	ENST00000296422.7:c.322G>T	4.37:g.103870474C>A	ENSP00000296422:p.Gly108Trp					NHEDC1_uc003hwu.2_Missense_Mutation_p.G108W|NHEDC1_uc010ilm.2_5'UTR|NHEDC1_uc003hwv.2_Intron|NHEDC1_uc011cev.1_Intron	p.G108W	NM_139173	NP_631912	Q4ZJI4	NHDC1_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;1.5e-08)	4	444	-		Hepatocellular(203;0.217)	108			Helical; (Potential).		A1KXV1|B9EH04|C9JBP7|Q49A30|Q8NCV2|Q8WVZ0	Missense_Mutation	SNP	ENST00000296422.7	37	c.322G>T	CCDS34041.1	.	.	.	.	.	.	.	.	.	.	C	13.17	2.157914	0.38119	.	.	ENSG00000164037	ENST00000394789;ENST00000296422;ENST00000452285	T;T	0.16743	2.32;2.32	4.18	4.18	0.49190	.	0.000000	0.85682	D	0.000000	T	0.46908	0.1417	M	0.84433	2.695	0.49483	D	0.999794	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.55939	-0.8061	10	0.62326	D	0.03	-6.4764	16.6248	0.84967	0.0:1.0:0.0:0.0	.	108;108	Q4ZJI4;Q4ZJI4-3	SL9B1_HUMAN;.	W	108	ENSP00000378269:G108W;ENSP00000296422:G108W	ENSP00000296422:G108W	G	-	1	0	SLC9B1	104089923	1.000000	0.71417	0.990000	0.47175	0.085000	0.17905	5.222000	0.65277	2.330000	0.79161	0.555000	0.69702	GGG		0.353	SLC9B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363841.1	NM_139173		6	46	1	0	0.00198382	0.001984	0.00208593	6	46				
EEF1A1P9	441032	broad.mit.edu	37	4	106406637	106406637	+	IGR	SNP	T	T	G			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr4:106406637T>G								PPA2 (11399 upstream) : AC004066.3 (54709 downstream)																							GTACTGTTCCTGTTGGCTGAG	0.488																																							uc003hxt.1		NA																	0					0						c.(643-645)CCT>CCG		SubName: Full=Eukaryotic translation elongation factor 1 alpha; Flags: Fragment;																																				SO:0001628	intergenic_variant	441032							g.chr4:106406637T>G																													4.37:g.106406637T>G							p.P215P	NR_003586						1	775	+									Silent	SNP		37	c.645T>G																																																																																				0	0.488									11	32	0	0	0	0.016723	0	11	32				
PCDH18	54510	broad.mit.edu	37	4	138451033	138451033	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr4:138451033C>A	ENST00000344876.4	-	1	2596	c.2210G>T	c.(2209-2211)aGg>aTg	p.R737M	PCDH18_ENST00000507846.1_Missense_Mutation_p.R517M|PCDH18_ENST00000412923.2_Missense_Mutation_p.R737M|PCDH18_ENST00000511115.1_Intron|PCDH18_ENST00000510305.1_Intron	NM_019035.3	NP_061908.1	Q9HCL0	PCD18_HUMAN	protocadherin 18	737					brain development (GO:0007420)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R737M(1)		NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(27)|lung(21)|ovary(2)|pancreas(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86	all_hematologic(180;0.24)					TTCGGCCACCCTGCAGTTATA	0.478																																							uc003ihe.3		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(3)|skin(2)	5						c.(2209-2211)AGG>ATG		protocadherin 18 precursor							185.0	154.0	165.0					4																	138451033		2203	4300	6503	SO:0001583	missense	54510				brain development|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:138451033C>A	AL137471	CCDS34064.1, CCDS75193.1	4q28.3	2010-01-26			ENSG00000189184	ENSG00000189184		"""Cadherins / Protocadherins : Non-clustered"""	14268	protein-coding gene	gene with protein product		608287				10835267, 11549318	Standard	XM_005263070		Approved	KIAA1562, PCDH68L	uc003ihe.4	Q9HCL0	OTTHUMG00000161348	ENST00000344876.4:c.2210G>T	4.37:g.138451033C>A	ENSP00000355082:p.Arg737Met					PCDH18_uc003ihf.3_Missense_Mutation_p.R730M|PCDH18_uc011cgz.1_Intron|PCDH18_uc003ihg.3_Missense_Mutation_p.R517M|PCDH18_uc011cha.1_Intron	p.R737M	NM_019035	NP_061908	Q9HCL0	PCD18_HUMAN			1	2597	-	all_hematologic(180;0.24)		737			Cytoplasmic (Potential).		A8K7K3|B7ZKT1|Q52LS2	Missense_Mutation	SNP	ENST00000344876.4	37	c.2210G>T	CCDS34064.1	.	.	.	.	.	.	.	.	.	.	C	19.25	3.791553	0.70452	.	.	ENSG00000189184	ENST00000344876;ENST00000412923;ENST00000507846	T;T;T	0.59083	0.4;0.38;0.29	5.53	5.53	0.82687	.	0.000000	0.42294	D	0.000728	T	0.78078	0.4227	M	0.78456	2.415	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.996;0.982;0.98	T	0.78280	-0.2265	10	0.56958	D	0.05	.	19.663	0.95879	0.0:1.0:0.0:0.0	.	517;737;737	D6RIG4;Q9HCL0-2;Q9HCL0	.;.;PCD18_HUMAN	M	737;737;517	ENSP00000355082:R737M;ENSP00000390688:R737M;ENSP00000425903:R517M	ENSP00000355082:R737M	R	-	2	0	PCDH18	138670483	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.269000	0.78482	2.871000	0.98454	0.655000	0.94253	AGG		0.478	PCDH18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364614.1	NM_019035		33	53	1	0	1.99505e-19	0.012213	2.76983e-19	33	53				
ARFIP1	27236	broad.mit.edu	37	4	153750861	153750861	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr4:153750861G>T	ENST00000451320.2	+	2	240	c.76G>T	c.(76-78)Gaa>Taa	p.E26*	ARFIP1_ENST00000429148.2_Nonsense_Mutation_p.E26*|ARFIP1_ENST00000353617.2_Nonsense_Mutation_p.E26*|ARFIP1_ENST00000356064.3_Nonsense_Mutation_p.E26*|ARFIP1_ENST00000405727.2_Nonsense_Mutation_p.E26*			P53367	ARFP1_HUMAN	ADP-ribosylation factor interacting protein 1	26					intracellular protein transport (GO:0006886)|regulation of protein secretion (GO:0050708)	cytosol (GO:0005829)|Golgi membrane (GO:0000139)		p.E26*(2)	ARFIP1/FHDC1(2)	cervix(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|urinary_tract(1)	14	all_hematologic(180;0.093)					TGACTCTCGTGAACATAGCTT	0.338																																							uc003imz.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(1)	1						c.(76-78)GAA>TAA		ADP-ribosylation factor interacting protein 1							134.0	140.0	138.0					4																	153750861		2203	4300	6503	SO:0001587	stop_gained	27236				intracellular protein transport|regulation of protein secretion	cytosol|Golgi membrane		g.chr4:153750861G>T	U52521	CCDS3780.1, CCDS34080.1	4q31.3	2008-08-01	2008-08-01			ENSG00000164144			21496	protein-coding gene	gene with protein product	"""arfaptin 1"""	605928				9038142, 10413101	Standard	NM_001025595		Approved	HSU52521	uc003imz.3	P53367		ENST00000451320.2:c.76G>T	4.37:g.153750861G>T	ENSP00000395083:p.Glu26*					ARFIP1_uc003inb.2_Nonsense_Mutation_p.E26*|ARFIP1_uc003ina.2_Nonsense_Mutation_p.E26*|ARFIP1_uc003inc.2_Nonsense_Mutation_p.E26*|ARFIP1_uc011cij.1_Nonsense_Mutation_p.E26*	p.E26*	NM_001025595	NP_001020766	P53367	ARFP1_HUMAN			2	352	+	all_hematologic(180;0.093)		26					Q2M2X4|Q3SYL4|Q9Y2X6	Nonsense_Mutation	SNP	ENST00000451320.2	37	c.76G>T	CCDS34080.1	.	.	.	.	.	.	.	.	.	.	G	36	5.932470	0.97116	.	.	ENSG00000164144	ENST00000451320;ENST00000429148;ENST00000353617;ENST00000405727;ENST00000356064	.	.	.	5.65	5.65	0.86999	.	0.099228	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-11.3261	18.4954	0.90863	0.0:0.0:1.0:0.0	.	.	.	.	X	26	.	ENSP00000296557:E26X	E	+	1	0	ARFIP1	153970311	1.000000	0.71417	0.996000	0.52242	0.770000	0.43624	6.167000	0.71902	2.654000	0.90174	0.557000	0.71058	GAA		0.338	ARFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365032.1	NM_014447		20	57	1	0	8.34094e-07	0.008871	9.4663e-07	20	57				
DCHS2	54798	broad.mit.edu	37	4	155161691	155161691	+	Nonsense_Mutation	SNP	G	G	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr4:155161691G>A	ENST00000357232.4	-	23	5991	c.5992C>T	c.(5992-5994)Cag>Tag	p.Q1998*		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1998	Cadherin 18. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Q1998*(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		CCCTTTACCTGATAGAAATCT	0.403																																							uc003inw.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)|pancreas(1)	4						c.(5992-5994)CAG>TAG		dachsous 2 isoform 1							49.0	47.0	48.0					4																	155161691		2203	4300	6503	SO:0001587	stop_gained	54798				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:155161691G>A	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.5992C>T	4.37:g.155161691G>A	ENSP00000349768:p.Gln1998*						p.Q1998*	NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN		LUSC - Lung squamous cell carcinoma(193;0.107)	23	5992	-	all_hematologic(180;0.208)	Renal(120;0.0854)	1998			Cadherin 18.		B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Nonsense_Mutation	SNP	ENST00000357232.4	37	c.5992C>T	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	G	46	12.123114	0.99638	.	.	ENSG00000197410	ENST00000357232	.	.	.	5.69	5.69	0.88448	.	0.094092	0.45867	D	0.000323	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	.	14.2962	0.66316	0.0:0.0:0.8513:0.1487	.	.	.	.	X	1998	.	ENSP00000349768:Q1998X	Q	-	1	0	DCHS2	155381141	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	6.190000	0.72057	2.677000	0.91161	0.655000	0.94253	CAG		0.403	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552		9	24	0	0	0	0.004482	0	9	24				
DCHS2	54798	broad.mit.edu	37	4	155226292	155226292	+	Silent	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr4:155226292G>T	ENST00000357232.4	-	16	3986	c.3987C>A	c.(3985-3987)acC>acA	p.T1329T		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1329	Cadherin 11. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T1329K(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		CAAGTATGGTGGTTGTCACTA	0.333																																							uc003inw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|pancreas(1)	4						c.(3985-3987)ACC>ACA		dachsous 2 isoform 1							43.0	44.0	43.0					4																	155226292		2203	4300	6503	SO:0001819	synonymous_variant	54798				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:155226292G>T	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.3987C>A	4.37:g.155226292G>T							p.T1329T	NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN		LUSC - Lung squamous cell carcinoma(193;0.107)	16	3987	-	all_hematologic(180;0.208)	Renal(120;0.0854)	1329			Cadherin 11.		B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Silent	SNP	ENST00000357232.4	37	c.3987C>A	CCDS3785.1																																																																																				0.333	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552		4	13	1	0	3.59834e-05	0.001168	3.95817e-05	4	13				
SH3RF1	57630	broad.mit.edu	37	4	170077704	170077704	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr4:170077704C>T	ENST00000284637.9	-	3	861	c.520G>A	c.(520-522)Ggg>Agg	p.G174R	SH3RF1_ENST00000508685.1_5'UTR	NM_020870.3	NP_065921.2	Q7Z6J0	SH3R1_HUMAN	SH3 domain containing ring finger 1	174	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.				negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|protein ubiquitination (GO:0016567)|regulation of JNK cascade (GO:0046328)	cell projection (GO:0042995)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.G174R(1)		NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	31		Prostate(90;0.00267)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)		TTGACTTCCCCATGGTACCAA	0.423																																							uc003isa.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)|lung(1)	3						c.(520-522)GGG>AGG		SH3 domain containing ring finger 1							168.0	171.0	170.0					4																	170077704		2203	4300	6503	SO:0001583	missense	57630					Golgi apparatus|lamellipodium|perinuclear region of cytoplasm	ligase activity|zinc ion binding	g.chr4:170077704C>T	BC033203	CCDS34099.1	4q32.3	2013-01-09	2006-02-13	2006-02-13	ENSG00000154447	ENSG00000154447		"""RING-type (C3HC4) zinc fingers"""	17650	protein-coding gene	gene with protein product	"""plenty of SH3 domains"""		"""SH3 multiple domains 2"""	SH3MD2		9482736	Standard	NM_020870		Approved	POSH, RNF142, KIAA1494	uc003isa.1	Q7Z6J0	OTTHUMG00000161010	ENST00000284637.9:c.520G>A	4.37:g.170077704C>T	ENSP00000284637:p.Gly174Arg					SH3RF1_uc010irc.1_5'UTR	p.G174R	NM_020870	NP_065921	Q7Z6J0	SH3R1_HUMAN		GBM - Glioblastoma multiforme(119;0.0287)	3	855	-		Prostate(90;0.00267)|Renal(120;0.0183)	174			SH3 1.		Q05BT2|Q8IW46|Q9HAM2|Q9P234	Missense_Mutation	SNP	ENST00000284637.9	37	c.520G>A	CCDS34099.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.793047	0.90453	.	.	ENSG00000154447	ENST00000284637	T	0.65732	-0.17	5.76	5.76	0.90799	Src homology-3 domain (4);	0.000000	0.85682	D	0.000000	D	0.85575	0.5728	M	0.93197	3.39	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88182	0.2871	10	0.87932	D	0	-23.2694	20.3242	0.98691	0.0:1.0:0.0:0.0	.	174	Q7Z6J0	SH3R1_HUMAN	R	174	ENSP00000284637:G174R	ENSP00000284637:G174R	G	-	1	0	SH3RF1	170314279	1.000000	0.71417	0.983000	0.44433	0.802000	0.45316	7.445000	0.80570	2.882000	0.98803	0.655000	0.94253	GGG		0.423	SH3RF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363382.3	NM_020870		33	89	0	0	0	0.010818	0	33	89				
SCRG1	11341	broad.mit.edu	37	4	174312327	174312327	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr4:174312327G>T	ENST00000296506.3	-	2	721	c.239C>A	c.(238-240)cCa>cAa	p.P80Q		NM_007281.2	NP_009212.1	O75711	SCRG1_HUMAN	stimulator of chondrogenesis 1	80					nervous system development (GO:0007399)	extracellular space (GO:0005615)		p.P80Q(1)		large_intestine(1)|lung(4)|skin(1)	6		Prostate(90;0.00601)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_neural(102;0.0837)|all_hematologic(60;0.107)		all cancers(43;1.15e-17)|Epithelial(43;4.33e-16)|OV - Ovarian serous cystadenocarcinoma(60;6.62e-09)|STAD - Stomach adenocarcinoma(60;0.00278)|GBM - Glioblastoma multiforme(59;0.00659)|LUSC - Lung squamous cell carcinoma(193;0.0919)		TCCTTACTTTGGGCAGCAGAG	0.408																																							uc003ite.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(238-240)CCA>CAA		stimulator of chondrogenesis 1 precursor							159.0	150.0	153.0					4																	174312327		2203	4300	6503	SO:0001583	missense	11341				nervous system development	extracellular space		g.chr4:174312327G>T	AJ224677	CCDS3818.1	4q34.1	2009-07-09				ENSG00000164106			17036	protein-coding gene	gene with protein product	"""scrapie responsive gene 1"""	603163				9660755, 9516475	Standard	NM_007281		Approved	SCRG-1	uc003ite.3	O75711		ENST00000296506.3:c.239C>A	4.37:g.174312327G>T	ENSP00000296506:p.Pro80Gln					SCRG1_uc003itf.2_RNA	p.P80Q	NM_007281	NP_009212	O75711	SCRG1_HUMAN		all cancers(43;1.15e-17)|Epithelial(43;4.33e-16)|OV - Ovarian serous cystadenocarcinoma(60;6.62e-09)|STAD - Stomach adenocarcinoma(60;0.00278)|GBM - Glioblastoma multiforme(59;0.00659)|LUSC - Lung squamous cell carcinoma(193;0.0919)	2	652	-		Prostate(90;0.00601)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_neural(102;0.0837)|all_hematologic(60;0.107)	80						Missense_Mutation	SNP	ENST00000296506.3	37	c.239C>A	CCDS3818.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.248192	0.80024	.	.	ENSG00000164106	ENST00000296506	T	0.59638	0.25	5.37	5.37	0.77165	.	0.000000	0.64402	D	0.000001	T	0.78723	0.4328	.	.	.	0.51767	D	0.999935	D	0.89917	1.0	D	0.91635	0.999	T	0.81547	-0.0883	9	0.87932	D	0	.	19.1223	0.93367	0.0:0.0:1.0:0.0	.	80	O75711	SCRG1_HUMAN	Q	80	ENSP00000296506:P80Q	ENSP00000296506:P80Q	P	-	2	0	SCRG1	174548902	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	7.320000	0.79064	2.513000	0.84729	0.650000	0.86243	CCA		0.408	SCRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364304.2	NM_007281		33	83	1	0	1.42033e-22	0.019004	2.03787e-22	33	83				
LRRC14B	389257	broad.mit.edu	37	5	194952	194952	+	Silent	SNP	G	G	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr5:194952G>A	ENST00000328278.3	+	2	1057	c.1029G>A	c.(1027-1029)ctG>ctA	p.L343L	CTD-2083E4.7_ENST00000563761.1_RNA	NM_001080478.1	NP_001073947.1	A6NHZ5	LR14B_HUMAN	leucine rich repeat containing 14B	343								p.L355L(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)|upper_aerodigestive_tract(2)	10						GACACAACCTGGTCAGCCTGT	0.622																																							uc003jal.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(1027-1029)CTG>CTA		leucine rich repeat containing 14B							33.0	37.0	35.0					5																	194952		2133	4245	6378	SO:0001819	synonymous_variant	389257							g.chr5:194952G>A		CCDS47184.1	5p15.33	2010-02-17			ENSG00000185028	ENSG00000185028			37268	protein-coding gene	gene with protein product							Standard	NM_001080478		Approved		uc003jal.1	A6NHZ5	OTTHUMG00000161578	ENST00000328278.3:c.1029G>A	5.37:g.194952G>A							p.L343L	NM_001080478	NP_001073947	A6NHZ5	LR14B_HUMAN			2	1057	+			343			LRR 3.			Silent	SNP	ENST00000328278.3	37	c.1029G>A	CCDS47184.1																																																																																				0.622	LRRC14B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000365393.2	NM_001080478		3	8	0	0	0	0.009096	0	3	8				
ADAMTS16	170690	broad.mit.edu	37	5	5235286	5235286	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr5:5235286C>A	ENST00000274181.7	+	13	2148	c.2010C>A	c.(2008-2010)taC>taA	p.Y670*	ADAMTS16_ENST00000513709.1_3'UTR	NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	670	Cys-rich.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.Y670*(2)		breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						GGAAGCCTTACACTCAAGTAG	0.473																																							uc003jdl.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						c.(2008-2010)TAC>TAA		ADAM metallopeptidase with thrombospondin type 1							64.0	67.0	66.0					5																	5235286		1941	4141	6082	SO:0001587	stop_gained	170690				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:5235286C>A	AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.2010C>A	5.37:g.5235286C>A	ENSP00000274181:p.Tyr670*					ADAMTS16_uc003jdk.1_Nonsense_Mutation_p.Y670*|ADAMTS16_uc010itk.1_RNA	p.Y670*	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN			13	2148	+			670			Cys-rich.		C6G490|Q8IVE2	Nonsense_Mutation	SNP	ENST00000274181.7	37	c.2010C>A	CCDS43299.1	.	.	.	.	.	.	.	.	.	.	C	40	8.148029	0.98678	.	.	ENSG00000145536	ENST00000274181;ENST00000536857	.	.	.	4.57	4.57	0.56435	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.4968	0.84247	0.0:1.0:0.0:0.0	.	.	.	.	X	670	.	ENSP00000274181:Y670X	Y	+	3	2	ADAMTS16	5288286	1.000000	0.71417	0.992000	0.48379	0.422000	0.31414	1.911000	0.39937	2.270000	0.75569	0.655000	0.94253	TAC		0.473	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056		28	62	1	0	4.02929e-09	0.010818	4.70998e-09	28	62				
PDZD2	23037	broad.mit.edu	37	5	32048790	32048790	+	Splice_Site	SNP	G	G	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr5:32048790G>A	ENST00000438447.1	+	8	2053	c.1665G>A	c.(1663-1665)caG>caA	p.Q555Q	PDZD2_ENST00000282493.3_Splice_Site_p.Q555Q			O15018	PDZD2_HUMAN	PDZ domain containing 2	555					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)		p.Q555Q(1)		NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						GTGCCTCACAGGTCCGACCAG	0.577																																							uc003jhl.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						c.(1663-1665)CAG>CAA		PDZ domain containing 2							55.0	62.0	59.0					5																	32048790		2203	4300	6503	SO:0001630	splice_region_variant	23037				cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus		g.chr5:32048790G>A	AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.1665+1G>A	5.37:g.32048790G>A						PDZD2_uc003jhm.2_Silent_p.Q555Q|PDZD2_uc011cnx.1_Silent_p.Q381Q	p.Q555Q	NM_178140	NP_835260	O15018	PDZD2_HUMAN			8	2053	+			555					Q9BXD4	Silent	SNP	ENST00000438447.1	37	c.1665G>A	CCDS34137.1																																																																																				0.577	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1		Silent	52	61	0	0	0	0.01441	0	52	61				
SKP2	6502	broad.mit.edu	37	5	36152994	36152994	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr5:36152994G>C	ENST00000274255.6	+	2	326	c.130G>C	c.(130-132)Gag>Cag	p.E44Q	SKP2_ENST00000274254.5_Missense_Mutation_p.E44Q|RNU6-1305P_ENST00000364353.1_RNA|LMBRD2_ENST00000296603.4_5'Flank|SKP2_ENST00000546211.1_5'UTR|SKP2_ENST00000508514.1_Missense_Mutation_p.E44Q	NM_005983.3	NP_005974.2	Q13309	SKP2_HUMAN	S-phase kinase-associated protein 2, E3 ubiquitin protein ligase	44					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|cellular response to cell-matrix adhesion (GO:0071460)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein polyubiquitination (GO:0000209)|regulation of cell cycle (GO:0051726)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)	identical protein binding (GO:0042802)|ubiquitin-protein transferase activity (GO:0004842)	p.E44Q(2)		breast(1)|central_nervous_system(2)|ovary(1)	4	all_lung(31;5.63e-05)		Epithelial(62;0.0396)|Lung(74;0.111)|all cancers(62;0.115)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CCTGGAGAAAGAGGAGCCCGA	0.592																																							uc003jkc.1		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(2)|ovary(1)|breast(1)	4						c.(130-132)GAG>CAG		S-phase kinase-associated protein 2 isoform 1							45.0	46.0	46.0					5																	36152994		2203	4300	6503	SO:0001583	missense	6502				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|G1/S transition of mitotic cell cycle|S phase of mitotic cell cycle	nucleoplasm|SCF ubiquitin ligase complex	protein binding	g.chr5:36152994G>C	U33761	CCDS3915.1, CCDS3916.1, CCDS58944.1	5p13	2012-02-23	2012-02-23		ENSG00000145604	ENSG00000145604		"""F-boxes / Leucine-rich repeats"""	10901	protein-coding gene	gene with protein product		601436	"""S-phase kinase-associated protein 2 (p45)"""			8646875	Standard	NM_005983		Approved	FBXL1, FBL1, p45	uc003jkc.2	Q13309	OTTHUMG00000131106	ENST00000274255.6:c.130G>C	5.37:g.36152994G>C	ENSP00000274255:p.Glu44Gln					SKP2_uc011cou.1_5'UTR|SKP2_uc003jkd.2_Missense_Mutation_p.E44Q|LMBRD2_uc003jkb.1_5'Flank	p.E44Q	NM_005983	NP_005974	Q13309	SKP2_HUMAN	Epithelial(62;0.0396)|Lung(74;0.111)|all cancers(62;0.115)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)		2	312	+	all_lung(31;5.63e-05)		44					A8K5E0|B4DJT4|Q8TDZ0|Q8TDZ1|Q9BV69	Missense_Mutation	SNP	ENST00000274255.6	37	c.130G>C	CCDS3916.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.085975	0.76642	.	.	ENSG00000145604	ENST00000274254;ENST00000274255;ENST00000308927;ENST00000508514;ENST00000513151	T;T;T;T	0.37058	2.82;2.87;1.22;1.34	5.88	5.88	0.94601	.	0.239751	0.41097	D	0.000957	T	0.47303	0.1438	N	0.24115	0.695	0.80722	D	1	D;D	0.71674	0.998;0.981	D;P	0.66351	0.943;0.69	T	0.31110	-0.9955	10	0.36615	T	0.2	-24.9571	20.2284	0.98346	0.0:0.0:1.0:0.0	.	44;44	Q13309-2;Q13309	.;SKP2_HUMAN	Q	44;44;10;44;44	ENSP00000274254:E44Q;ENSP00000274255:E44Q;ENSP00000421941:E44Q;ENSP00000423188:E44Q	ENSP00000274254:E44Q	E	+	1	0	SKP2	36188751	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	6.306000	0.72810	2.785000	0.95823	0.650000	0.86243	GAG		0.592	SKP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253769.2	NM_005983		47	52	0	0	0	0.01441	0	47	52				
CDK7	1022	broad.mit.edu	37	5	68531237	68531237	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr5:68531237A>G	ENST00000256443.3	+	2	186	c.83A>G	c.(82-84)aAg>aGg	p.K28R	CDK7_ENST00000502604.1_5'UTR|CDK7_ENST00000514676.1_Missense_Mutation_p.K28R|CDK7_ENST00000513629.1_3'UTR	NM_001799.3	NP_001790.1	P50613	CDK7_HUMAN	cyclin-dependent kinase 7	28	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				7-methylguanosine mRNA capping (GO:0006370)|androgen receptor signaling pathway (GO:0030521)|ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|cell division (GO:0051301)|cell proliferation (GO:0008283)|DNA repair (GO:0006281)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|DNA-dependent ATPase activity (GO:0008094)|protein C-terminus binding (GO:0008022)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)|transcription coactivator activity (GO:0003713)	p.K28R(1)		endometrium(1)|lung(2)	3		Lung NSC(167;7.26e-05)|Prostate(74;0.00634)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.98e-56)|Epithelial(20;3.54e-52)|all cancers(19;9.11e-48)|Lung(70;0.0185)		ACCGTTTACAAGGCCAGAGAT	0.328								Nucleotide excision repair (NER)																															uc003jvs.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)	1						c.(82-84)AAG>AGG	NER	cyclin-dependent kinase 7							123.0	133.0	130.0					5																	68531237		2203	4300	6503	SO:0001583	missense	1022				androgen receptor signaling pathway|cell division|cell proliferation|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|G2/M transition of mitotic cell cycle|mRNA capping|nucleotide-excision repair, DNA damage removal|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|regulation of cyclin-dependent protein kinase activity|S phase of mitotic cell cycle|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	holo TFIIH complex|mitochondrion	androgen receptor binding|ATP binding|cyclin-dependent protein kinase activity|DNA-dependent ATPase activity|protein C-terminus binding|RNA polymerase II carboxy-terminal domain kinase activity|transcription coactivator activity	g.chr5:68531237A>G		CCDS3999.1	5q12.1	2012-11-05	2007-11-21		ENSG00000134058	ENSG00000134058		"""Cyclin-dependent kinases"", ""General transcription factor IIH complex subunits"""	1778	protein-coding gene	gene with protein product		601955	"""cyclin-dependent kinase 7 (homolog of Xenopus MO15 cdk-activating kinase)"", ""cyclin-dependent kinase 7 (MO15 homolog, Xenopus laevis, cdk-activating kinase)"""			8069918	Standard	NM_001799		Approved	CAK1, CDKN7, MO15, STK1, CAK	uc003jvs.4	P50613	OTTHUMG00000099358	ENST00000256443.3:c.83A>G	5.37:g.68531237A>G	ENSP00000256443:p.Lys28Arg					CDK7_uc010ixd.1_Missense_Mutation_p.K28R|CDK7_uc003jvt.3_5'UTR|CDK7_uc003jvu.3_5'UTR	p.K28R	NM_001799	NP_001790	P50613	CDK7_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;2.98e-56)|Epithelial(20;3.54e-52)|all cancers(19;9.11e-48)|Lung(70;0.0185)	2	264	+		Lung NSC(167;7.26e-05)|Prostate(74;0.00634)|Ovarian(174;0.0448)|Breast(144;0.198)	28			Protein kinase.		Q9BS60|Q9UE19	Missense_Mutation	SNP	ENST00000256443.3	37	c.83A>G	CCDS3999.1	.	.	.	.	.	.	.	.	.	.	A	15.14	2.745978	0.49151	.	.	ENSG00000134058	ENST00000256443;ENST00000514676	T;T	0.68181	-0.31;-0.31	4.85	4.85	0.62838	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.048098	0.85682	N	0.000000	T	0.50446	0.1616	N	0.13198	0.31	0.80722	D	1	B;B	0.14805	0.011;0.005	B;B	0.23150	0.032;0.044	T	0.51188	-0.8737	10	0.59425	D	0.04	.	12.0531	0.53518	1.0:0.0:0.0:0.0	.	28;28	D6RIG9;P50613	.;CDK7_HUMAN	R	28	ENSP00000256443:K28R;ENSP00000422737:K28R	ENSP00000256443:K28R	K	+	2	0	CDK7	68566993	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.783000	0.68982	2.028000	0.59812	0.459000	0.35465	AAG		0.328	CDK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216802.3	NM_001799		12	88	0	0	0	0.013537	0	12	88				
BDP1	55814	broad.mit.edu	37	5	70812006	70812006	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr5:70812006C>G	ENST00000358731.4	+	21	5031	c.4768C>G	c.(4768-4770)Caa>Gaa	p.Q1590E	BDP1_ENST00000380675.2_5'UTR	NM_018429.2	NP_060899.2	A6H8Y1	BDP1_HUMAN	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB	1590					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.Q1590E(1)		NS(2)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(34)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		AGGACAGAGGCAAATAGTAGA	0.398																																							uc003kbp.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(4768-4770)CAA>GAA		transcription factor-like nuclear regulator							71.0	65.0	67.0					5																	70812006		1877	4100	5977	SO:0001583	missense	55814				regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding	g.chr5:70812006C>G	AF298151	CCDS43328.1	5q12-q13	2008-02-05	2001-11-29	2001-11-30	ENSG00000145734	ENSG00000145734			13652	protein-coding gene	gene with protein product		607012	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 1"""	TFNR, TAF3B1		11214970, 11040218	Standard	NM_018429		Approved	TFIIIB150, TFC5, TFIIIB90, KIAA1689, HSA238520, KIAA1241	uc003kbp.1	A6H8Y1	OTTHUMG00000162506	ENST00000358731.4:c.4768C>G	5.37:g.70812006C>G	ENSP00000351575:p.Gln1590Glu					BDP1_uc003kbo.2_Missense_Mutation_p.Q1590E	p.Q1590E	NM_018429	NP_060899	A6H8Y1	BDP1_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)	21	5031	+		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)	1590					Q68DS6|Q68DY5|Q6MZL9|Q6PIM7|Q86W98|Q96LR8|Q9C0H4|Q9H197|Q9H1A1|Q9HAW1|Q9HAW2|Q9HCY0|Q9ULH9	Missense_Mutation	SNP	ENST00000358731.4	37	c.4768C>G	CCDS43328.1	.	.	.	.	.	.	.	.	.	.	C	12.64	1.998286	0.35226	.	.	ENSG00000145734	ENST00000358731;ENST00000451951	T	0.10288	2.89	5.17	4.28	0.50868	.	0.304592	0.26404	N	0.024575	T	0.28234	0.0697	M	0.62723	1.935	0.19775	N	0.999953	P;D	0.61697	0.582;0.99	B;D	0.65233	0.208;0.933	T	0.01988	-1.1234	10	0.59425	D	0.04	.	15.3695	0.74551	0.0:0.8243:0.1757:0.0	.	1590;1590	A6H8Y1;A6H8Y1-2	BDP1_HUMAN;.	E	1590;1170	ENSP00000351575:Q1590E	ENSP00000351575:Q1590E	Q	+	1	0	BDP1	70847762	0.000000	0.05858	0.098000	0.21074	0.162000	0.22319	-0.207000	0.09384	2.394000	0.81467	0.591000	0.81541	CAA		0.398	BDP1-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374681.2	NM_018429		3	13	0	0	0	0.001168	0	3	13				
CMYA5	202333	broad.mit.edu	37	5	79029481	79029481	+	Silent	SNP	G	G	T	rs373921567		TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr5:79029481G>T	ENST00000446378.2	+	2	4924	c.4893G>T	c.(4891-4893)ccG>ccT	p.P1631P		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	1631					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)		p.P1631P(2)		NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		CACACCAACCGTTGGAATTAC	0.423																																							uc003kgc.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(6)|pancreas(2)|lung(1)	9						c.(4891-4893)CCG>CCT		cardiomyopathy associated 5							96.0	97.0	96.0					5																	79029481		1846	4101	5947	SO:0001819	synonymous_variant	202333					perinuclear region of cytoplasm		g.chr5:79029481G>T	AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.4893G>T	5.37:g.79029481G>T							p.P1631P	NM_153610	NP_705838	Q8N3K9	CMYA5_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)	2	4965	+		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)	1631					A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Silent	SNP	ENST00000446378.2	37	c.4893G>T	CCDS47238.1																																																																																				0.423	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610		14	51	1	0	7.87624e-14	0.016522	1.02082e-13	14	51				
SLCO6A1	133482	broad.mit.edu	37	5	101735314	101735314	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr5:101735314A>G	ENST00000506729.1	-	10	1930	c.1759T>C	c.(1759-1761)Tct>Cct	p.S587P	SLCO6A1_ENST00000379810.1_Missense_Mutation_p.S334P|SLCO6A1_ENST00000389019.3_Missense_Mutation_p.S525P|SLCO6A1_ENST00000379807.3_Missense_Mutation_p.S587P|SLCO6A1_ENST00000513675.1_Missense_Mutation_p.S334P			Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family, member 6A1	587						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.S587P(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(17)|lung(22)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	60		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		ATAAGTGTAGAAAAGATAAAA	0.328																																							uc003knn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(3)|central_nervous_system(1)	7						c.(1759-1761)TCT>CCT		solute carrier organic anion transporter family,							95.0	94.0	94.0					5																	101735314		2203	4300	6503	SO:0001583	missense	133482					integral to membrane|plasma membrane	transporter activity	g.chr5:101735314A>G	AF505657	CCDS34206.1, CCDS75282.1	5q21.2	2013-05-22			ENSG00000205359	ENSG00000205359		"""Solute carriers"""	23613	protein-coding gene	gene with protein product	"""cancer/testis antigen 48"""	613365					Standard	XM_005271874		Approved	OATP6A1, OATPY, MGC26949, CT48	uc003knp.3	Q86UG4	OTTHUMG00000162759	ENST00000506729.1:c.1759T>C	5.37:g.101735314A>G	ENSP00000421339:p.Ser587Pro					SLCO6A1_uc003kno.2_Missense_Mutation_p.S334P|SLCO6A1_uc003knp.2_Missense_Mutation_p.S587P|SLCO6A1_uc003knq.2_Missense_Mutation_p.S525P	p.S587P	NM_173488	NP_775759	Q86UG4	SO6A1_HUMAN		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)	10	1931	-		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)	587			Helical; Name=10; (Potential).		A6NHC1|Q6ZMY5|Q86UV2|Q8IYU5	Missense_Mutation	SNP	ENST00000506729.1	37	c.1759T>C	CCDS34206.1	.	.	.	.	.	.	.	.	.	.	A	9.705	1.155417	0.21454	.	.	ENSG00000205359	ENST00000506729;ENST00000379807;ENST00000389019;ENST00000513675;ENST00000379810	T;T;T;T;T	0.80738	-1.41;-1.41;-1.41;0.33;0.33	5.42	2.99	0.34606	Major facilitator superfamily domain, general substrate transporter (1);	0.415061	0.23738	N	0.045052	D	0.87422	0.6173	M	0.77616	2.38	0.18873	N	0.999988	D;D;D	0.89917	1.0;0.995;1.0	D;D;D	0.77557	0.984;0.968;0.99	T	0.77632	-0.2515	10	0.52906	T	0.07	.	9.3287	0.38008	0.6159:0.3841:0.0:0.0	.	525;334;587	Q86UG4-2;C9J020;Q86UG4	.;.;SO6A1_HUMAN	P	587;587;525;334;334	ENSP00000421339:S587P;ENSP00000369135:S587P;ENSP00000373671:S525P;ENSP00000421990:S334P;ENSP00000369138:S334P	ENSP00000369135:S587P	S	-	1	0	SLCO6A1	101763213	0.923000	0.31300	0.066000	0.19879	0.003000	0.03518	0.983000	0.29552	1.044000	0.40200	0.533000	0.62120	TCT		0.328	SLCO6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370335.1	NM_173488		7	31	0	0	0	0.001984	0	7	31				
BRD8	10902	broad.mit.edu	37	5	137500094	137500094	+	Silent	SNP	A	A	G			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr5:137500094A>G	ENST00000254900.5	-	13	2111	c.1740T>C	c.(1738-1740)ccT>ccC	p.P580P	BRD8_ENST00000411594.2_Silent_p.P583P|BRD8_ENST00000402931.1_Silent_p.P580P|BRD8_ENST00000515014.1_5'UTR|BRD8_ENST00000455658.2_Silent_p.P539P|BRD8_ENST00000230901.5_Silent_p.P653P	NM_139199.1	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8	580					cell surface receptor signaling pathway (GO:0007166)|chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|intracellular receptor signaling pathway (GO:0030522)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid hormone receptor activity (GO:0004887)	p.P653P(1)|p.P580P(1)		breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(3)|urinary_tract(1)	35			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			ACATGCTTTCAGGGGATGCCT	0.398																																							uc003lcf.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(1738-1740)CCT>CCC		bromodomain containing 8 isoform 2							122.0	117.0	119.0					5																	137500094		2203	4300	6503	SO:0001819	synonymous_variant	10902				cell surface receptor linked signaling pathway|histone H2A acetylation|histone H4 acetylation|regulation of growth|regulation of transcription from RNA polymerase II promoter	mitochondrion|NuA4 histone acetyltransferase complex	sequence-specific DNA binding transcription factor activity|thyroid hormone receptor activity	g.chr5:137500094A>G	AF016270	CCDS4198.1, CCDS34241.1, CCDS54907.1	5q31	2008-02-05			ENSG00000112983	ENSG00000112983			19874	protein-coding gene	gene with protein product		602848				8611617, 9368056	Standard	NM_001164326		Approved	SMAP, p120	uc003lcf.1	Q9H0E9	OTTHUMG00000129204	ENST00000254900.5:c.1740T>C	5.37:g.137500094A>G						BRD8_uc003lcc.1_RNA|BRD8_uc011cyl.1_Silent_p.P359P|BRD8_uc003lcg.2_Silent_p.P653P|BRD8_uc003lci.2_Silent_p.P583P|BRD8_uc003lch.2_Silent_p.P474P|BRD8_uc011cym.1_Silent_p.P564P|BRD8_uc010jer.1_Silent_p.P549P|BRD8_uc011cyn.1_Silent_p.P539P	p.P580P	NM_139199	NP_631938	Q9H0E9	BRD8_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)		13	1795	-			580					O43178|Q15355|Q58AB0|Q59GN0|Q969M9	Silent	SNP	ENST00000254900.5	37	c.1740T>C	CCDS4198.1	.	.	.	.	.	.	.	.	.	.	A	4.634	0.117903	0.08881	.	.	ENSG00000112983	ENST00000441656	.	.	.	5.2	2.82	0.32997	.	.	.	.	.	T	0.47395	0.1443	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.30679	-0.9970	4	.	.	.	-10.5216	4.3788	0.11284	0.6984:0.0:0.1566:0.145	.	.	.	.	P	574	.	.	L	-	2	0	BRD8	137527993	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	0.989000	0.29629	0.449000	0.26747	0.402000	0.26972	CTG		0.398	BRD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251282.3	NM_006696		3	135	0	0	0	0.004672	0	3	135				
PCDHGB3	56102	broad.mit.edu	37	5	140779851	140779851	+	Intron	SNP	C	C	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr5:140779851C>T	ENST00000576222.1	+	1	2546				PCDHGA9_ENST00000573521.1_5'Flank|PCDHGA5_ENST00000518069.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCCCTGCCGCCTGGAGCTGCT	0.577																																							uc003lkf.1		NA																	0					0						c.(2155-2157)GCC>GCT		protocadherin gamma subfamily B, 5 isoform 1							161.0	173.0	169.0					5																	140779851		2058	4200	6258	SO:0001627	intron_variant	56101				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140779851C>T	AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.2415+27475C>T	5.37:g.140779851C>T						PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc011daw.1_Silent_p.A719A|PCDHGA9_uc011dax.1_5'Flank|PCDHGA9_uc003lkh.1_5'Flank	p.A719A	NM_018925	NP_061748	Q9Y5G0	PCDGH_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2157	+			719			Cytoplasmic (Potential).		A7E229|Q9Y5C7	Silent	SNP	ENST00000576222.1	37	c.2157C>T	CCDS58980.1																																																																																				0.577	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437094.1	NM_018924		149	109	0	0	0	0.01441	0	149	109				
ADAM19	8728	broad.mit.edu	37	5	156920037	156920037	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr5:156920037C>A	ENST00000517905.1	-	16	1896	c.1852G>T	c.(1852-1854)Ggt>Tgt	p.G618C	ADAM19_ENST00000257527.4_Missense_Mutation_p.G618C|ADAM19_ENST00000394020.1_Missense_Mutation_p.G620C|ADAM19_ENST00000430702.2_Missense_Mutation_p.G351C			Q9H013	ADA19_HUMAN	ADAM metallopeptidase domain 19	618	Cys-rich.				heart development (GO:0007507)|membrane protein ectodomain proteolysis (GO:0006509)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.G619C(1)|p.G618C(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AGCATGTCACCCTCCTCCTCA	0.607																																							uc003lwz.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8						c.(1852-1854)GGT>TGT		ADAM metallopeptidase domain 19 preproprotein							99.0	97.0	98.0					5																	156920037		2203	4300	6503	SO:0001583	missense	8728				proteolysis	integral to membrane	metalloendopeptidase activity|SH3 domain binding|zinc ion binding	g.chr5:156920037C>A	AF311317	CCDS4338.1	5q33.3	2010-06-24	2010-06-24		ENSG00000135074	ENSG00000135074		"""ADAM metallopeptidase domain containing"""	197	protein-coding gene	gene with protein product	"""meltrin beta"""	603640	"""a disintegrin and metalloproteinase domain 19 (meltrin beta)"""			9806848	Standard	NM_033274		Approved	MLTNB	uc003lwz.4	Q9H013	OTTHUMG00000130242	ENST00000517905.1:c.1852G>T	5.37:g.156920037C>A	ENSP00000428654:p.Gly618Cys					ADAM19_uc003lww.1_Missense_Mutation_p.G351C|ADAM19_uc003lwy.2_Missense_Mutation_p.G217C|ADAM19_uc011ddr.1_Missense_Mutation_p.G549C	p.G618C	NM_033274	NP_150377	Q9H013	ADA19_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		16	1916	-	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	618			Extracellular (Potential).|Cys-rich.		Q9BZL5|Q9UHP2	Missense_Mutation	SNP	ENST00000517905.1	37	c.1852G>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.98|14.98	2.697778|2.697778	0.48307|0.48307	.|.	.|.	ENSG00000135074|ENSG00000135074	ENST00000430702;ENST00000257527;ENST00000394020;ENST00000517905|ENST00000517374	T;T;T;T|.	0.01887|.	4.58;4.67;4.69;4.68|.	5.01|5.01	1.27|1.27	0.21489|0.21489	ADAM, cysteine-rich (1);|.	0.644862|.	0.15201|.	N|.	0.275035|.	T|T	0.44350|0.44350	0.1289|0.1289	L|L	0.58101|0.58101	1.795|1.795	0.20873|0.20873	N|N	0.999837|0.999837	D;D;D|.	0.76494|.	0.999;0.999;0.999|.	P;D;D|.	0.67382|.	0.885;0.951;0.951|.	T|T	0.33523|0.33523	-0.9865|-0.9865	10|5	0.56958|.	D|.	0.05|.	.|.	9.5588|9.5588	0.39355|0.39355	0.0:0.615:0.0:0.385|0.0:0.615:0.0:0.385	.|.	618;618;351|.	Q9H013-2;Q9H013;E9PD32|.	.;ADA19_HUMAN;.|.	C|S	351;618;620;618|188	ENSP00000414088:G351C;ENSP00000257527:G618C;ENSP00000377588:G620C;ENSP00000428654:G618C|.	ENSP00000257527:G618C|.	G|R	-|-	1|3	0|2	ADAM19|ADAM19	156852615|156852615	0.293000|0.293000	0.24371|0.24371	0.867000|0.867000	0.34043|0.34043	0.741000|0.741000	0.42261|0.42261	1.199000|1.199000	0.32235|0.32235	-0.054000|-0.054000	0.13266|0.13266	-0.244000|-0.244000	0.11960|0.11960	GGT|AGG		0.607	ADAM19-003	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000373918.1	NM_033274		39	67	1	0	2.95478e-19	0.00874	4.07588e-19	39	67				
TENM2	57451	broad.mit.edu	37	5	167545349	167545349	+	Silent	SNP	C	C	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr5:167545349C>T	ENST00000518659.1	+	10	1905	c.1866C>T	c.(1864-1866)tgC>tgT	p.C622C	TENM2_ENST00000545108.1_Silent_p.C622C|CTB-178M22.1_ENST00000517408.1_RNA|TENM2_ENST00000520394.1_Silent_p.C390C|TENM2_ENST00000519204.1_Silent_p.C501C|TENM2_ENST00000403607.2_Silent_p.C455C	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	622	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.C622C(1)|p.C501C(1)|p.C455C(1)									AAGGGACGTGCCAGTGCTACA	0.577																																							uc010jjd.2		NA																	3	Substitution - coding silent(3)		lung(3)	ovary(6)|central_nervous_system(4)	10						c.(1864-1866)TGC>TGT		odz, odd Oz/ten-m homolog 2							159.0	161.0	160.0					5																	167545349		2149	4254	6403	SO:0001819	synonymous_variant	57451							g.chr5:167545349C>T	AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.1866C>T	5.37:g.167545349C>T						ODZ2_uc003lzq.2_Silent_p.C501C|ODZ2_uc003lzr.3_Silent_p.C390C|ODZ2_uc003lzt.3_5'UTR|uc003lzs.1_Intron	p.C622C	NM_001122679	NP_001116151			Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)	10	1866	+	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)						Q9ULU2	Silent	SNP	ENST00000518659.1	37	c.1866C>T																																																																																					0.577	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679		12	178	0	0	0	0.004007	0	12	178				
SLC17A4	10050	broad.mit.edu	37	6	25776840	25776840	+	Silent	SNP	C	C	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr6:25776840C>T	ENST00000377905.4	+	9	1124	c.1005C>T	c.(1003-1005)gcC>gcT	p.A335A	SLC17A4_ENST00000397076.2_Silent_p.A105A|SLC17A4_ENST00000439485.2_Silent_p.A105A	NM_005495.2	NP_005486.1	Q9Y2C5	S17A4_HUMAN	solute carrier family 17, member 4	335					phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	sodium:phosphate symporter activity (GO:0005436)	p.A335A(1)		breast(4)|endometrium(1)|kidney(4)|large_intestine(3)|lung(21)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						TCCTGTCTGCCTTGCCGTTTG	0.507																																							uc003nfe.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(1003-1005)GCC>GCT		solute carrier family 17 (sodium phosphate),							280.0	263.0	269.0					6																	25776840		2203	4300	6503	SO:0001819	synonymous_variant	10050				phosphate metabolic process	integral to plasma membrane|membrane fraction	sodium:phosphate symporter activity	g.chr6:25776840C>T	AB020527	CCDS4564.1, CCDS75411.1	6p22.2	2013-07-18	2013-07-18		ENSG00000146039	ENSG00000146039		"""Solute carriers"""	10932	protein-coding gene	gene with protein product		604216	"""solute carrier family 17 (sodium phosphate), member 4"""			10319585	Standard	NM_005495		Approved	KIAA2138	uc003nfe.3	Q9Y2C5	OTTHUMG00000014410	ENST00000377905.4:c.1005C>T	6.37:g.25776840C>T						SLC17A4_uc011djx.1_Silent_p.A105A|SLC17A4_uc003nff.1_Silent_p.A96A|SLC17A4_uc003nfg.2_Silent_p.A272A|SLC17A4_uc010jqa.2_Intron	p.A335A	NM_005495	NP_005486	Q9Y2C5	S17A4_HUMAN			9	1124	+			335			Helical; (Potential).		B4DDV9|E7EPE8|E7EU17|Q32MB7|Q32MB8	Silent	SNP	ENST00000377905.4	37	c.1005C>T	CCDS4564.1																																																																																				0.507	SLC17A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040068.1			121	177	0	0	0	0.01441	0	121	177				
SLC17A3	10786	broad.mit.edu	37	6	25861926	25861926	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr6:25861926C>T	ENST00000360657.3	-	4	602	c.317G>A	c.(316-318)gGg>gAg	p.G106E	SLC17A3_ENST00000397060.4_Missense_Mutation_p.G184E|SLC17A3_ENST00000361703.6_Missense_Mutation_p.G106E			O00476	NPT4_HUMAN	solute carrier family 17 (organic anion transporter), member 3	106					drug transmembrane transport (GO:0006855)|drug transport (GO:0015893)|glucose-6-phosphate transport (GO:0015760)|ion transmembrane transport (GO:0034220)|organic acid transport (GO:0015849)|organic anion transport (GO:0015711)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|regulation of anion transport (GO:0044070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)|urate transport (GO:0015747)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	drug transmembrane transporter activity (GO:0015238)|efflux transmembrane transporter activity (GO:0015562)|organic anion transmembrane transporter activity (GO:0008514)|sodium:phosphate symporter activity (GO:0005436)|toxin transporter activity (GO:0019534)|urate transmembrane transporter activity (GO:0015143)|voltage-gated anion channel activity (GO:0008308)	p.G106E(1)|p.G184E(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)	20						AAACTGACCCCCAAGTATTGA	0.398																																							uc003nfi.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(316-318)GGG>GAG		solute carrier family 17 (sodium phosphate),							129.0	118.0	122.0					6																	25861926		2203	4300	6503	SO:0001583	missense	10786				glucose-6-phosphate transport|urate metabolic process	apical plasma membrane|brush border membrane|endoplasmic reticulum membrane|integral to plasma membrane|perinuclear region of cytoplasm	drug transmembrane transporter activity|efflux transmembrane transporter activity|organic anion transmembrane transporter activity|sodium:phosphate symporter activity|toxin transporter activity|urate transmembrane transporter activity|voltage-gated anion channel activity	g.chr6:25861926C>T	U90545	CCDS4566.2, CCDS47385.1	6p22.2	2013-07-18	2013-07-18		ENSG00000124564	ENSG00000124564		"""Solute carriers"""	10931	protein-coding gene	gene with protein product		611034	"""solute carrier family 17 (sodium phosphate), member 3"""			9149941	Standard	NM_006632		Approved	NPT4	uc003nfk.4	O00476	OTTHUMG00000014412	ENST00000360657.3:c.317G>A	6.37:g.25861926C>T	ENSP00000353873:p.Gly106Glu					SLC17A3_uc003nfk.3_Missense_Mutation_p.G184E|SLC17A3_uc011djz.1_Missense_Mutation_p.G184E|SLC17A3_uc011dka.1_Missense_Mutation_p.G106E	p.G106E	NM_006632	NP_006623	O00476	NPT4_HUMAN			4	427	-			106					B7WNJ5|B7Z511|Q8WWC7|Q9H533	Missense_Mutation	SNP	ENST00000360657.3	37	c.317G>A	CCDS4566.2	.	.	.	.	.	.	.	.	.	.	C	9.255	1.041657	0.19748	.	.	ENSG00000124564	ENST00000397060;ENST00000360657;ENST00000361703	T;T;T	0.59638	0.38;0.25;0.25	3.72	0.698	0.18087	Major facilitator superfamily domain, general substrate transporter (1);	2.301840	0.02296	N	0.070719	T	0.60090	0.2242	M	0.75447	2.3	0.09310	N	0.999998	D;D;P;D	0.67145	0.996;0.971;0.904;0.97	D;P;P;P	0.65323	0.934;0.786;0.786;0.905	T	0.25152	-1.0140	10	0.59425	D	0.04	.	6.7766	0.23622	0.1902:0.4476:0.3622:0.0	.	106;165;184;106	B7Z531;B7Z3L7;B7Z511;O00476	.;.;.;NPT4_HUMAN	E	184;106;106	ENSP00000380250:G184E;ENSP00000353873:G106E;ENSP00000355307:G106E	ENSP00000353873:G106E	G	-	2	0	SLC17A3	25969905	0.000000	0.05858	0.164000	0.22755	0.257000	0.26127	-0.079000	0.11357	0.114000	0.18032	-0.311000	0.09066	GGG		0.398	SLC17A3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040070.2			48	157	0	0	0	0.01441	0	48	157				
OR2J2	26707	broad.mit.edu	37	6	29142178	29142178	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr6:29142178G>T	ENST00000377167.2	+	1	868	c.766G>T	c.(766-768)Gtc>Ttc	p.V256F		NM_030905.2	NP_112167.2	O76002	OR2J2_HUMAN	olfactory receptor, family 2, subfamily J, member 2	256						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V256F(1)		endometrium(1)|kidney(2)|large_intestine(1)|liver(2)|lung(17)|ovary(1)|upper_aerodigestive_tract(1)	25						TTTCATTCCAGTCATGTGCAT	0.458																																							uc011dlm.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(766-768)GTC>TTC		olfactory receptor, family 2, subfamily J,							120.0	110.0	114.0					6																	29142178		1917	4135	6052	SO:0001583	missense	26707				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr6:29142178G>T		CCDS43434.1	6p22.2-p21.31	2012-08-09			ENSG00000204700	ENSG00000204700		"""GPCR / Class A : Olfactory receptors"""	8260	protein-coding gene	gene with protein product							Standard	NM_030905		Approved	OR6-8, hs6M1-6, dJ80I19.4	uc011dlm.2	O76002	OTTHUMG00000031091	ENST00000377167.2:c.766G>T	6.37:g.29142178G>T	ENSP00000366372:p.Val256Phe						p.V256F	NM_030905	NP_112167	O76002	OR2J2_HUMAN			1	868	+			256			Helical; Name=6; (Potential).		A6NCU9|A6NLD0|B0UY53|Q32N09|Q5ST39|Q5SUJ6|Q6IF24|Q9GZK2|Q9GZL3	Missense_Mutation	SNP	ENST00000377167.2	37	c.766G>T	CCDS43434.1	.	.	.	.	.	.	.	.	.	.	G	7.368	0.626212	0.14257	.	.	ENSG00000204700	ENST00000377167	T	0.00169	8.63	2.0	2.0	0.26442	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00073	0.0002	L	0.49256	1.55	0.09310	N	1	B	0.29432	0.244	B	0.36464	0.225	T	0.05305	-1.0893	9	0.59425	D	0.04	.	10.7841	0.46395	0.0:0.0:1.0:0.0	.	256	O76002	OR2J2_HUMAN	F	256	ENSP00000366372:V256F	ENSP00000366372:V256F	V	+	1	0	OR2J2	29250157	0.000000	0.05858	0.992000	0.48379	0.540000	0.34992	-1.490000	0.02304	1.101000	0.41535	0.205000	0.17691	GTC		0.458	OR2J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076131.2			58	134	1	0	3.37043e-27	0.01441	5.05564e-27	58	134				
C6orf136	221545	broad.mit.edu	37	6	30617664	30617664	+	Silent	SNP	C	C	G			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr6:30617664C>G	ENST00000376473.5	+	2	561	c.402C>G	c.(400-402)tcC>tcG	p.S134S	C6orf136_ENST00000376471.4_Intron|AL662800.2_ENST00000583820.1_RNA|C6orf136_ENST00000528347.2_5'Flank|C6orf136_ENST00000293604.6_Silent_p.S315S|C6orf136_ENST00000493705.1_3'UTR	NM_001109938.2	NP_001103408.1	Q5SQH8	CF136_HUMAN	chromosome 6 open reading frame 136	134						mitochondrion (GO:0005739)		p.S315S(1)		endometrium(1)|large_intestine(2)|lung(6)|ovary(1)	10						CCCACCCTTCCCCTGCCACCC	0.557																																							uc003nqw.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(400-402)TCC>TCG		hypothetical protein LOC221545 isoform 1							90.0	81.0	84.0					6																	30617664		2203	4300	6503	SO:0001819	synonymous_variant	221545							g.chr6:30617664C>G	BC016167	CCDS4684.1, CCDS43443.1, CCDS4684.2, CCDS54979.1	6p21.32	2012-02-06			ENSG00000204564	ENSG00000204564			21301	protein-coding gene	gene with protein product							Standard	NM_001109938		Approved	Em:AB023049.8	uc003nqx.4	Q5SQH8	OTTHUMG00000031221	ENST00000376473.5:c.402C>G	6.37:g.30617664C>G						C6orf136_uc003nqx.3_Silent_p.S315S|C6orf136_uc011dmn.1_Intron	p.S134S	NM_001109938	NP_001103408	Q5SQH8	CF136_HUMAN			2	595	+			134					A9R9P9|F8VX15|Q5SU01|Q6ZSB7|Q8TB84	Silent	SNP	ENST00000376473.5	37	c.402C>G	CCDS43443.1																																																																																				0.557	C6orf136-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076457.4	NM_145029		77	124	0	0	0	0.01441	0	77	124				
C6orf15	29113	broad.mit.edu	37	6	31079232	31079232	+	Missense_Mutation	SNP	G	G	T	rs150278073	byFrequency	TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr6:31079232G>T	ENST00000259870.3	-	2	907	c.904C>A	c.(904-906)Cgc>Agc	p.R302S		NM_014070.2	NP_054789.2	Q6UXA7	CF015_HUMAN	chromosome 6 open reading frame 15	302	Pro-rich.				extracellular matrix organization (GO:0030198)	interstitial matrix (GO:0005614)	heparin binding (GO:0008201)|hyaluronic acid binding (GO:0005540)	p.R302S(1)		endometrium(3)|large_intestine(2)|lung(9)|prostate(1)|skin(1)|stomach(1)	17						CCAGGAGGGCGGAGGACTCCA	0.532																																							uc003nsk.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(904-906)CGC>AGC		STG protein precursor							38.0	37.0	37.0					6																	31079232		1741	3460	5201	SO:0001583	missense	29113							g.chr6:31079232G>T	AB031481	CCDS4693.1	6p21	2011-12-12			ENSG00000204542	ENSG00000204542			13927	protein-coding gene	gene with protein product		611401					Standard	NM_014070		Approved	STG	uc003nsk.1	Q6UXA7	OTTHUMG00000031111	ENST00000259870.3:c.904C>A	6.37:g.31079232G>T	ENSP00000259870:p.Arg302Ser						p.R302S	NM_014070	NP_054789	Q6UXA7	CF015_HUMAN			2	904	-			302			Pro-rich.		B0S7V8|Q0EFA6|Q2L6G7|Q5SQ81|Q86Z05|Q9UIG3	Missense_Mutation	SNP	ENST00000259870.3	37	c.904C>A	CCDS4693.1	.	.	.	.	.	.	.	.	.	.	G	8.640	0.895754	0.17686	.	.	ENSG00000204542	ENST00000259870	T	0.06449	3.3	4.71	2.92	0.33932	.	1.000740	0.08064	N	0.998719	T	0.02533	0.0077	L	0.40543	1.245	0.09310	N	1	P	0.34662	0.462	B	0.38500	0.275	T	0.49011	-0.8983	10	0.54805	T	0.06	-1.0832	5.6617	0.17672	0.0997:0.0:0.7067:0.1936	.	302	Q6UXA7	CF015_HUMAN	S	302	ENSP00000259870:R302S	ENSP00000259870:R302S	R	-	1	0	C6orf15	31187211	0.000000	0.05858	0.000000	0.03702	0.052000	0.14988	0.348000	0.20031	0.588000	0.29660	0.643000	0.83706	CGC		0.532	C6orf15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076184.2	NM_014070		19	108	1	0	8.28177e-16	0.007413	1.09657e-15	19	108				
NOTCH4	4855	broad.mit.edu	37	6	32190540	32190540	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr6:32190540G>T	ENST00000375023.3	-	3	337	c.199C>A	c.(199-201)Ccc>Acc	p.P67T		NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	67	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)	p.P67T(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						TTCTGGCAGGGGTCAGGAAAC	0.622																																							uc003obb.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(8)|ovary(5)|breast(4)|central_nervous_system(3)|upper_aerodigestive_tract(1)|skin(1)	22						c.(199-201)CCC>ACC		notch4 preproprotein							44.0	47.0	46.0					6																	32190540		2202	4300	6502	SO:0001583	missense	4855				cell fate determination|embryo development|hemopoiesis|mammary gland development|negative regulation of endothelial cell differentiation|Notch receptor processing|Notch signaling pathway|patterning of blood vessels|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|protein heterodimerization activity|receptor activity	g.chr6:32190540G>T		CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.199C>A	6.37:g.32190540G>T	ENSP00000364163:p.Pro67Thr					NOTCH4_uc011dpu.1_RNA|NOTCH4_uc011dpv.1_RNA|NOTCH4_uc003obc.2_Missense_Mutation_p.P67T	p.P67T	NM_004557	NP_004548	Q99466	NOTC4_HUMAN			3	338	-			67			Extracellular (Potential).|EGF-like 2.		B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	ENST00000375023.3	37	c.199C>A	CCDS34420.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.953271	0.73902	.	.	ENSG00000204301	ENST00000375023	D	0.83419	-1.72	4.13	4.13	0.48395	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.42964	D	0.000638	D	0.86020	0.5833	L	0.52823	1.66	0.80722	D	1	D;P	0.89917	1.0;0.864	D;P	0.87578	0.998;0.62	D	0.87372	0.2351	10	0.62326	D	0.03	.	13.9161	0.63899	0.0:0.0:1.0:0.0	.	67;67	Q6P3V5;Q99466	.;NOTC4_HUMAN	T	67	ENSP00000364163:P67T	ENSP00000364163:P67T	P	-	1	0	NOTCH4	32298518	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	5.752000	0.68728	2.129000	0.65627	0.555000	0.69702	CCC		0.622	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076045.2			34	65	1	0	3.93418e-24	0.019004	5.74069e-24	34	65				
SCUBE3	222663	broad.mit.edu	37	6	35210036	35210036	+	Silent	SNP	A	A	G			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr6:35210036A>G	ENST00000274938.7	+	13	1473	c.1473A>G	c.(1471-1473)aaA>aaG	p.K491K	SCUBE3_ENST00000394681.1_Silent_p.K507K	NM_152753.2	NP_689966.2			signal peptide, CUB domain, EGF-like 3									p.K491K(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(12)|lung(11)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	37						AGGATGCCAAATGCCGTTTGC	0.542																																							uc003okf.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(1471-1473)AAA>AAG		signal peptide, CUB domain, EGF-like 3							132.0	128.0	129.0					6																	35210036		2203	4300	6503	SO:0001819	synonymous_variant	222663				protein heterooligomerization|protein homooligomerization	cell surface|extracellular region	calcium ion binding|protein binding	g.chr6:35210036A>G	AF452494.1	CCDS4800.1	6p21.3	2008-02-05	2004-05-19	2004-05-21		ENSG00000146197			13655	protein-coding gene	gene with protein product		614708	"""CUB domain and EGF-like repeat containing 3"""	CEGF3		12270931	Standard	NM_152753		Approved	FLJ34743	uc003okf.1	Q8IX30		ENST00000274938.7:c.1473A>G	6.37:g.35210036A>G						SCUBE3_uc003okg.1_Silent_p.K490K|SCUBE3_uc003okh.1_Silent_p.K378K	p.K491K	NM_152753	NP_689966	Q8IX30	SCUB3_HUMAN			13	1479	+			491						Silent	SNP	ENST00000274938.7	37	c.1473A>G	CCDS4800.1																																																																																				0.542	SCUBE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040275.1	NM_152753		56	277	0	0	0	0.01441	0	56	277				
DNAH8	1769	broad.mit.edu	37	6	38976690	38976690	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr6:38976690T>C	ENST00000359357.3	+	87	12918	c.12664T>C	c.(12664-12666)Tat>Cat	p.Y4222H	DNAH8_ENST00000441566.1_Missense_Mutation_p.Y4186H			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	4222					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.Y4222H(2)		NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						GGCTATTGTTTATAGATTATC	0.438																																							uc003ooe.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						c.(12664-12666)TAT>CAT		dynein, axonemal, heavy polypeptide 8							147.0	159.0	155.0					6																	38976690		2203	4300	6503	SO:0001583	missense	1769							g.chr6:38976690T>C	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.12664T>C	6.37:g.38976690T>C	ENSP00000352312:p.Tyr4222His						p.Y4222H	NM_001371	NP_001362					87	13264	+								O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	37	c.12664T>C		.	.	.	.	.	.	.	.	.	.	T	7.137	0.581000	0.13686	.	.	ENSG00000124721	ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.08102	3.13;3.13;3.13	5.5	5.5	0.81552	Dynein heavy chain (1);	0.164893	0.42172	D	0.000750	T	0.03783	0.0107	M	0.62723	1.935	0.18873	N	0.999982	B	0.19200	0.034	B	0.24269	0.052	T	0.35822	-0.9773	10	0.15952	T	0.53	.	11.59	0.50941	0.0:0.0:0.1489:0.8511	.	4222	Q96JB1	DYH8_HUMAN	H	4427;4222;4186	ENSP00000333363:Y4427H;ENSP00000352312:Y4222H;ENSP00000402294:Y4186H	ENSP00000333363:Y4427H	Y	+	1	0	DNAH8	39084668	0.950000	0.32346	0.163000	0.22734	0.884000	0.51177	2.026000	0.41069	2.079000	0.62486	0.528000	0.53228	TAT		0.438	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927		85	200	0	0	0	0.01441	0	85	200				
CD2AP	23607	broad.mit.edu	37	6	47567080	47567080	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr6:47567080G>A	ENST00000359314.5	+	13	1774	c.1318G>A	c.(1318-1320)Gag>Aag	p.E440K		NM_012120.2	NP_036252.1	Q9Y5K6	CD2AP_HUMAN	CD2-associated protein	440					mitotic nuclear division (GO:0007067)|negative regulation of transforming growth factor beta1 production (GO:0032911)|positive regulation of protein localization to nucleus (GO:1900182)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein complex assembly (GO:0006461)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of receptor-mediated endocytosis (GO:0048259)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|substrate-dependent cell migration, cell extension (GO:0006930)|vesicle organization (GO:0016050)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	SH3 domain binding (GO:0017124)|structural constituent of cytoskeleton (GO:0005200)	p.E440K(1)		kidney(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	20			Lung(136;0.105)|LUSC - Lung squamous cell carcinoma(51;0.138)			ATTTGAAACTGAGCCAGTATC	0.348																																							uc003oyw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1318-1320)GAG>AAG		CD2-associated protein							57.0	56.0	57.0					6																	47567080		2203	4300	6503	SO:0001583	missense	23607				cell division|mitosis|protein complex assembly|signal transduction|substrate-dependent cell migration, cell extension	cytoplasm|filamentous actin|nucleolus|plasma membrane|ruffle	SH3 domain binding|structural constituent of cytoskeleton	g.chr6:47567080G>A	AF146277	CCDS34472.1	6p12	2008-02-05			ENSG00000198087	ENSG00000198087			14258	protein-coding gene	gene with protein product		604241				10339567	Standard	NM_012120		Approved	CMS	uc003oyw.3	Q9Y5K6	OTTHUMG00000014799	ENST00000359314.5:c.1318G>A	6.37:g.47567080G>A	ENSP00000352264:p.Glu440Lys						p.E440K	NM_012120	NP_036252	Q9Y5K6	CD2AP_HUMAN	Lung(136;0.105)|LUSC - Lung squamous cell carcinoma(51;0.138)		13	1774	+			440					A6NL34|Q5VYA3|Q9UG97	Missense_Mutation	SNP	ENST00000359314.5	37	c.1318G>A	CCDS34472.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.988130	0.74589	.	.	ENSG00000198087	ENST00000359314	T	0.26957	1.7	5.75	5.75	0.90469	.	2.064250	0.01672	N	0.025651	T	0.36908	0.0984	L	0.46157	1.445	0.47476	D	0.999431	D	0.76494	0.999	D	0.65323	0.934	T	0.41770	-0.9490	10	0.15499	T	0.54	-21.9868	19.5668	0.95397	0.0:0.0:1.0:0.0	.	440	Q9Y5K6	CD2AP_HUMAN	K	440	ENSP00000352264:E440K	ENSP00000352264:E440K	E	+	1	0	CD2AP	47675039	1.000000	0.71417	1.000000	0.80357	0.448000	0.32197	6.378000	0.73150	2.708000	0.92522	0.650000	0.86243	GAG		0.348	CD2AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040817.2			4	37	0	0	0	0.014758	0	4	37				
PTCHD4	442213	broad.mit.edu	37	6	47976507	47976507	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr6:47976507C>G	ENST00000339488.4	-	2	803	c.770G>C	c.(769-771)tGc>tCc	p.C257S	PTCHD4_ENST00000543600.1_Missense_Mutation_p.C240S	NM_001013732.3	NP_001013754.3	Q6ZW05	PTHD4_HUMAN	patched domain containing 4	257	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.					integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)	p.C257S(1)									ACTGCGCAAGCAGTCCTTCAT	0.562																																							uc011dwm.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(718-720)TGC>TCC		hypothetical protein LOC442213							61.0	62.0	62.0					6																	47976507		2033	4206	6239	SO:0001583	missense	442213					integral to membrane	hedgehog receptor activity	g.chr6:47976507C>G		CCDS34473.2	6p12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000244694	ENSG00000244694			21345	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 138"""	C6orf138			Standard	NM_001013732		Approved	dJ402H5.2, FLJ41841	uc011dwm.2	Q6ZW05	OTTHUMG00000150404	ENST00000339488.4:c.770G>C	6.37:g.47976507C>G	ENSP00000341914:p.Cys257Ser					C6orf138_uc011dwn.1_Missense_Mutation_p.C4S|C6orf138_uc003ozf.2_Missense_Mutation_p.C257S	p.C240S	NM_001013732	NP_001013754	Q6ZW05	CF138_HUMAN			2	804	-			257			SSD.		B0QZ29|B4DRK3|Q5T884	Missense_Mutation	SNP	ENST00000339488.4	37	c.719G>C	CCDS34473.2	.	.	.	.	.	.	.	.	.	.	C	20.2	3.948514	0.73787	.	.	ENSG00000244694	ENST00000339488;ENST00000543600	D;D	0.85088	-1.94;-1.94	6.16	5.3	0.74995	Sterol-sensing domain (1);	0.000000	0.85682	D	0.000000	T	0.74543	0.3730	L	0.54323	1.7	0.80722	D	1	B;P	0.40000	0.078;0.698	B;B	0.37550	0.121;0.253	T	0.75051	-0.3454	10	0.20046	T	0.44	.	17.7906	0.88551	0.0:0.8781:0.1219:0.0	.	257;240	Q6ZW05;B0QZ29	CF138_HUMAN;.	S	257;240	ENSP00000341914:C257S;ENSP00000439864:C240S	ENSP00000341914:C257S	C	-	2	0	C6orf138	48084466	1.000000	0.71417	0.963000	0.40424	0.984000	0.73092	7.487000	0.81328	1.620000	0.50308	0.650000	0.86243	TGC		0.562	PTCHD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317987.2	NM_001013732		15	31	0	0	0	0.007413	0	15	31				
MUT	4594	broad.mit.edu	37	6	49412454	49412454	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr6:49412454C>A	ENST00000274813.3	-	9	1701	c.1574G>T	c.(1573-1575)aGg>aTg	p.R525M		NM_000255.3	NP_000246.2	P22033	MUTA_HUMAN	methylmalonyl CoA mutase	525					cellular lipid metabolic process (GO:0044255)|cobalamin metabolic process (GO:0009235)|fatty acid beta-oxidation (GO:0006635)|homocysteine metabolic process (GO:0050667)|post-embryonic development (GO:0009791)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	cobalamin binding (GO:0031419)|metal ion binding (GO:0046872)|methylmalonyl-CoA mutase activity (GO:0004494)|modified amino acid binding (GO:0072341)	p.R525M(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	30	Lung NSC(77;0.0376)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	AGCTTGATCCCTGCTGGATTT	0.443																																							uc003ozg.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1573-1575)AGG>ATG		methylmalonyl Coenzyme A mutase precursor	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)						130.0	122.0	125.0					6																	49412454		2203	4300	6503	SO:0001583	missense	4594				fatty acid beta-oxidation	mitochondrial matrix	cobalamin binding|metal ion binding|methylmalonyl-CoA mutase activity	g.chr6:49412454C>A		CCDS4924.1	6p21	2012-10-02	2010-04-30		ENSG00000146085	ENSG00000146085	5.4.99.2		7526	protein-coding gene	gene with protein product		609058	"""methylmalonyl Coenzyme A mutase"""			2907507, 9503014	Standard	NM_000255		Approved		uc003ozg.4	P22033	OTTHUMG00000014814	ENST00000274813.3:c.1574G>T	6.37:g.49412454C>A	ENSP00000274813:p.Arg525Met						p.R525M	NM_000255	NP_000246	P22033	MUTA_HUMAN			9	1829	-	Lung NSC(77;0.0376)		525					A8K953|Q5SYZ3|Q96B11|Q9UD64	Missense_Mutation	SNP	ENST00000274813.3	37	c.1574G>T	CCDS4924.1	.	.	.	.	.	.	.	.	.	.	C	16.45	3.126494	0.56721	.	.	ENSG00000146085	ENST00000274813	D	0.98747	-5.11	5.31	5.31	0.75309	Cobalamin (vitamin B12)-dependent enzyme, catalytic (1);Cobalamin (vitamin B12)-dependent enzyme, catalytic subdomain (1);Methylmalonyl-CoA mutase, alpha/beta chain, catalytic (1);Methylmalonyl-CoA mutase, alpha chain, catalytic (1);	0.000000	0.85682	D	0.000000	D	0.99579	0.9848	H	0.98446	4.235	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.97868	1.0284	10	0.87932	D	0	-10.2998	18.3267	0.90256	0.0:1.0:0.0:0.0	.	525	P22033	MUTA_HUMAN	M	525	ENSP00000274813:R525M	ENSP00000274813:R525M	R	-	2	0	MUT	49520413	1.000000	0.71417	1.000000	0.80357	0.046000	0.14306	6.773000	0.75006	2.638000	0.89438	0.585000	0.79938	AGG		0.443	MUT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040854.1			27	73	1	0	7.92952e-12	0.021523	9.86019e-12	27	73				
MUT	4594	broad.mit.edu	37	6	49425722	49425722	+	Silent	SNP	G	G	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr6:49425722G>A	ENST00000274813.3	-	3	562	c.435C>T	c.(433-435)ggC>ggT	p.G145G		NM_000255.3	NP_000246.2	P22033	MUTA_HUMAN	methylmalonyl CoA mutase	145			G -> S (in MMAM; mut0). {ECO:0000269|PubMed:16281286}.		cellular lipid metabolic process (GO:0044255)|cobalamin metabolic process (GO:0009235)|fatty acid beta-oxidation (GO:0006635)|homocysteine metabolic process (GO:0050667)|post-embryonic development (GO:0009791)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	cobalamin binding (GO:0031419)|metal ion binding (GO:0046872)|methylmalonyl-CoA mutase activity (GO:0004494)|modified amino acid binding (GO:0072341)	p.G145G(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	30	Lung NSC(77;0.0376)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CTGAATCATAGCCACGATGTG	0.403																																							uc003ozg.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(433-435)GGC>GGT		methylmalonyl Coenzyme A mutase precursor	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)						68.0	69.0	69.0					6																	49425722		2203	4300	6503	SO:0001819	synonymous_variant	4594				fatty acid beta-oxidation	mitochondrial matrix	cobalamin binding|metal ion binding|methylmalonyl-CoA mutase activity	g.chr6:49425722G>A		CCDS4924.1	6p21	2012-10-02	2010-04-30		ENSG00000146085	ENSG00000146085	5.4.99.2		7526	protein-coding gene	gene with protein product		609058	"""methylmalonyl Coenzyme A mutase"""			2907507, 9503014	Standard	NM_000255		Approved		uc003ozg.4	P22033	OTTHUMG00000014814	ENST00000274813.3:c.435C>T	6.37:g.49425722G>A							p.G145G	NM_000255	NP_000246	P22033	MUTA_HUMAN			3	690	-	Lung NSC(77;0.0376)		145		G -> S (in MMAM; mut0).			A8K953|Q5SYZ3|Q96B11|Q9UD64	Silent	SNP	ENST00000274813.3	37	c.435C>T	CCDS4924.1																																																																																				0.403	MUT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040854.1			20	47	0	0	0	0.004656	0	20	47				
EFHC1	114327	broad.mit.edu	37	6	52344532	52344532	+	Silent	SNP	G	G	T	rs377227885		TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr6:52344532G>T	ENST00000371068.5	+	9	1690	c.1587G>T	c.(1585-1587)gcG>gcT	p.A529A	EFHC1_ENST00000433625.2_Silent_p.A438A|EFHC1_ENST00000538167.1_Silent_p.A510A	NM_018100.3	NP_060570.2	Q5JVL4	EFHC1_HUMAN	EF-hand domain (C-terminal) containing 1	529						axoneme (GO:0005930)|neuronal cell body (GO:0043025)	calcium ion binding (GO:0005509)|protein C-terminus binding (GO:0008022)	p.A529A(1)		breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(8)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	27	Lung NSC(77;0.109)					AAGCACTCGCGTCAATTCAGA	0.478																																							uc003pap.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(1)	3						c.(1585-1587)GCG>GCT		EF-hand domain (C-terminal) containing 1							128.0	112.0	118.0					6																	52344532		2203	4300	6503	SO:0001819	synonymous_variant	114327					axoneme|neuronal cell body	calcium ion binding|protein C-terminus binding	g.chr6:52344532G>T	AK001328	CCDS4942.1, CCDS55021.1	6p12.3	2014-02-04			ENSG00000096093	ENSG00000096093		"""EF-hand domain containing"""	16406	protein-coding gene	gene with protein product	"""myoclonin-1"""	608815	"""epilepsy, juvenile myoclonic 1"""	EJM1, EJM		15258581	Standard	NM_018100		Approved	FLJ10466	uc003pap.4	Q5JVL4	OTTHUMG00000014848	ENST00000371068.5:c.1587G>T	6.37:g.52344532G>T						EFHC1_uc011dwv.1_Silent_p.A438A|EFHC1_uc011dww.1_Silent_p.A510A	p.A529A	NM_018100	NP_060570	Q5JVL4	EFHC1_HUMAN			9	1802	+	Lung NSC(77;0.109)		529					B4DMU3|F5GZD8|Q5XKM4|Q6E1U7|Q6E1U8|Q8WUL2|Q9NVW6	Silent	SNP	ENST00000371068.5	37	c.1587G>T	CCDS4942.1																																																																																				0.478	EFHC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040905.2	NM_018100		13	83	1	0	2.61681e-11	0.020292	3.19833e-11	13	83				
DST	667	broad.mit.edu	37	6	56328479	56328479	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr6:56328479G>C	ENST00000361203.3	-	96	21890	c.21883C>G	c.(21883-21885)Cga>Gga	p.R7295G	DST_ENST00000421834.2_Missense_Mutation_p.R5291G|DST_ENST00000446842.2_Missense_Mutation_p.R7080G|DST_ENST00000370754.5_Missense_Mutation_p.R7584G|DST_ENST00000312431.6_3'UTR|DST_ENST00000370769.4_Missense_Mutation_p.R7406G|DST_ENST00000244364.6_Missense_Mutation_p.R4968G|DST_ENST00000370788.2_Missense_Mutation_p.R5209G			Q03001	DYST_HUMAN	dystonin	7404	GAR. {ECO:0000255|PROSITE- ProRule:PRU00792}.				axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)	p.R7379G(1)|p.R4968G(1)		NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CTTCGGCCTCGGGGTCGGAAA	0.582																																							uc003pdf.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14						c.(16414-16416)CGA>GGA		dystonin isoform 2							124.0	133.0	130.0					6																	56328479		2003	4155	6158	SO:0001583	missense	667				cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity	g.chr6:56328479G>C	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.21883C>G	6.37:g.56328479G>C	ENSP00000354508:p.Arg7295Gly					DST_uc003pcz.3_Missense_Mutation_p.R5294G|DST_uc011dxj.1_Missense_Mutation_p.R5323G|DST_uc011dxk.1_Missense_Mutation_p.R5334G|DST_uc003pcy.3_Missense_Mutation_p.R4968G|DST_uc003pcv.3_Missense_Mutation_p.R90G|DST_uc003pcw.3_Missense_Mutation_p.R51G|DST_uc003pcx.3_Missense_Mutation_p.R51G	p.R5472G	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)		94	16442	-	Lung NSC(77;0.103)		7404					B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	37	c.16414C>G		.	.	.	.	.	.	.	.	.	.	G	12.48	1.950385	0.34377	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T	0.69926	0.9;-0.35;-0.38;-0.44;0.57;-0.27;-0.27	5.82	3.83	0.44106	.	0.126543	0.33092	N	0.005289	T	0.74045	0.3665	M	0.77313	2.365	0.34363	D	0.691165	P;D;D;P;B;B;P;B	0.76494	0.753;0.998;0.999;0.753;0.393;0.18;0.941;0.001	B;D;D;B;B;B;P;B	0.67103	0.376;0.949;0.937;0.376;0.246;0.03;0.522;0.004	T	0.79743	-0.1675	9	0.87932	D	0	.	12.4713	0.55790	0.0:0.0:0.3694:0.6306	.	5291;7406;7584;7404;4968;92;55;5209	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8;Q9BSP9;Q86T18;E7ERU0	.;.;.;DYST_HUMAN;.;.;.;.	G	4968;7584;7406;5291;7080;5209;7295	ENSP00000244364:R4968G;ENSP00000359790:R7584G;ENSP00000359805:R7406G;ENSP00000400883:R5291G;ENSP00000393645:R7080G;ENSP00000359824:R5209G;ENSP00000354508:R7295G	ENSP00000244364:R4968G	R	-	1	2	DST	56436438	1.000000	0.71417	0.996000	0.52242	0.976000	0.68499	1.922000	0.40045	1.399000	0.46721	0.655000	0.94253	CGA		0.582	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723		73	148	0	0	0	0.01441	0	73	148				
DST	667	broad.mit.edu	37	6	56507224	56507224	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr6:56507224C>T	ENST00000361203.3	-	12	1230	c.1223G>A	c.(1222-1224)gGa>gAa	p.G408E	DST_ENST00000421834.2_Missense_Mutation_p.G408E|DST_ENST00000446842.2_Missense_Mutation_p.G82E|DST_ENST00000370754.5_Missense_Mutation_p.G586E|DST_ENST00000518935.1_Missense_Mutation_p.G82E|DST_ENST00000312431.6_Missense_Mutation_p.G408E|DST_ENST00000370769.4_Missense_Mutation_p.G408E|DST_ENST00000244364.6_Missense_Mutation_p.G82E|DST_ENST00000370765.6_Missense_Mutation_p.G82E|DST_ENST00000370788.2_Missense_Mutation_p.G408E			Q03001	DYST_HUMAN	dystonin	408					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)	p.G82E(3)|p.G408E(1)|p.G586E(1)		NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			AAGAGCATTTCCAGCAAGAAT	0.383																																							uc003pdf.2		NA																	5	Substitution - Missense(5)		lung(5)	ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14						c.(1756-1758)GGA>GAA		dystonin isoform 2							99.0	95.0	96.0					6																	56507224		2203	4300	6503	SO:0001583	missense	667				cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity	g.chr6:56507224C>T	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.1223G>A	6.37:g.56507224C>T	ENSP00000354508:p.Gly408Glu					DST_uc003pcz.3_Missense_Mutation_p.G408E|DST_uc011dxj.1_Missense_Mutation_p.G437E|DST_uc011dxk.1_Missense_Mutation_p.G448E|DST_uc011dxl.1_Missense_Mutation_p.G437E|DST_uc003pcy.3_Missense_Mutation_p.G82E|DST_uc003pdb.2_Missense_Mutation_p.G82E|DST_uc003pdc.3_Missense_Mutation_p.G82E|DST_uc003pdd.3_Missense_Mutation_p.G82E|DST_uc003pde.2_Missense_Mutation_p.G524E	p.G586E	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)		15	1785	-	Lung NSC(77;0.103)		408					B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	37	c.1757G>A		.	.	.	.	.	.	.	.	.	.	C	12.40	1.925577	0.34002	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000312431;ENST00000370788;ENST00000361203;ENST00000439203;ENST00000520645;ENST00000370765;ENST00000518935;ENST00000449297	D;D;D;D;D;D;D;D;D;D;D;D;D	0.93426	-3.22;-3.22;-3.22;-3.22;-3.22;-3.22;-3.22;-3.22;-3.22;-3.22;-3.22;-3.22;-3.22	5.34	5.34	0.76211	.	0.000000	0.43747	D	0.000535	T	0.68677	0.3027	N	0.02247	-0.625	0.18873	N	0.999984	B;B;P;B;B;B;B;B;B;B	0.35433	0.0;0.0;0.501;0.0;0.006;0.001;0.0;0.004;0.0;0.0	B;B;B;B;B;B;B;B;B;B	0.22386	0.0;0.0;0.039;0.0;0.001;0.0;0.001;0.001;0.0;0.001	T	0.79492	-0.1781	9	0.02654	T	1	.	19.5946	0.95530	0.0:1.0:0.0:0.0	.	437;408;408;586;524;82;82;82;408;82	B4DGY0;Q5TBT1;E7ERU2;E9PEB9;Q03001-13;Q6P0N6;Q03001-3;Q03001-9;Q03001;Q03001-8	.;.;.;.;.;.;.;.;DYST_HUMAN;.	E	82;586;408;408;82;408;408;408;82;448;82;82;586	ENSP00000244364:G82E;ENSP00000359790:G586E;ENSP00000359805:G408E;ENSP00000400883:G408E;ENSP00000393645:G82E;ENSP00000307959:G408E;ENSP00000359824:G408E;ENSP00000354508:G408E;ENSP00000404924:G82E;ENSP00000431030:G448E;ENSP00000359801:G82E;ENSP00000431003:G82E;ENSP00000393082:G586E	ENSP00000244364:G82E	G	-	2	0	DST	56615183	1.000000	0.71417	0.738000	0.30950	0.469000	0.32828	4.401000	0.59716	2.937000	0.99478	0.650000	0.86243	GGA		0.383	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723		33	58	0	0	0	0.015359	0	33	58				
BAI3	577	broad.mit.edu	37	6	69759195	69759195	+	Missense_Mutation	SNP	G	G	T	rs112866971	byFrequency	TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr6:69759195G>T	ENST00000370598.1	+	15	3111	c.2290G>T	c.(2290-2292)Gca>Tca	p.A764S		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	764					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.A764S(1)		NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				TGTTCTTGGCGCAGTCCTATA	0.274																																							uc003pev.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50						c.(2290-2292)GCA>TCA		brain-specific angiogenesis inhibitor 3							73.0	72.0	73.0					6																	69759195		2202	4297	6499	SO:0001583	missense	577				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr6:69759195G>T	AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.2290G>T	6.37:g.69759195G>T	ENSP00000359630:p.Ala764Ser					BAI3_uc010kak.2_Missense_Mutation_p.A764S	p.A764S	NM_001704	NP_001695	O60242	BAI3_HUMAN			15	2738	+		all_lung(197;0.212)	764			Extracellular (Potential).		B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	ENST00000370598.1	37	c.2290G>T	CCDS4968.1	.	.	.	.	.	.	.	.	.	.	G	16.35	3.098915	0.56183	.	.	ENSG00000135298	ENST00000370598	T	0.09538	2.97	5.24	5.24	0.73138	Domain of unknown function DUF3497 (1);	0.058877	0.64402	D	0.000002	T	0.10981	0.0268	L	0.43923	1.385	0.80722	D	1	P	0.45283	0.855	P	0.47402	0.546	T	0.02031	-1.1226	10	0.54805	T	0.06	.	19.2581	0.93955	0.0:0.0:1.0:0.0	.	764	O60242	BAI3_HUMAN	S	764	ENSP00000359630:A764S	ENSP00000359630:A764S	A	+	1	0	BAI3	69815916	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.324000	0.72896	2.606000	0.88127	0.650000	0.86243	GCA		0.274	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1			4	12	1	0	0.00116845	0.001168	0.00123464	4	12				
SH3BGRL2	83699	broad.mit.edu	37	6	80383467	80383467	+	Missense_Mutation	SNP	A	A	C			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr6:80383467A>C	ENST00000369838.4	+	2	361	c.182A>C	c.(181-183)cAg>cCg	p.Q61P		NM_031469.2	NP_113657.1	Q9UJC5	SH3L2_HUMAN	SH3 domain binding glutamate-rich protein like 2	61						extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)		p.Q61P(1)		large_intestine(2)|lung(3)	5		all_cancers(76;0.00188)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.174)		BRCA - Breast invasive adenocarcinoma(397;0.0278)		AAACCCACTCAGGGCAACCCC	0.453																																							uc003piz.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(181-183)CAG>CCG		SH3 domain binding glutamic acid-rich protein							124.0	132.0	129.0					6																	80383467		2203	4300	6503	SO:0001583	missense	83699					nucleus	SH3 domain binding	g.chr6:80383467A>C	AJ297972	CCDS4991.1	6q14.1	2014-02-19	2014-02-19		ENSG00000198478	ENSG00000198478			15567	protein-coding gene	gene with protein product		615678	"""SH3 domain binding glutamic acid-rich protein like 2"""			12095696	Standard	NM_031469		Approved		uc003piz.1	Q9UJC5	OTTHUMG00000015081	ENST00000369838.4:c.182A>C	6.37:g.80383467A>C	ENSP00000358853:p.Gln61Pro						p.Q61P	NM_031469	NP_113657	Q9UJC5	SH3L2_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.0278)	2	361	+		all_cancers(76;0.00188)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.174)	61			SH3-binding (Potential).		A8MQU2|Q2VPC2|Q5VV96|Q6NSK8|Q6P9E8|Q7Z734|Q8IWD3|Q9BPY5	Missense_Mutation	SNP	ENST00000369838.4	37	c.182A>C	CCDS4991.1	.	.	.	.	.	.	.	.	.	.	A	11.45	1.642777	0.29246	.	.	ENSG00000198478	ENST00000369838	T	0.76186	-1.0	5.75	5.75	0.90469	Thioredoxin-like fold (2);	0.100273	0.64402	D	0.000002	T	0.63450	0.2512	N	0.25890	0.77	0.44515	D	0.997469	D	0.58970	0.984	P	0.57679	0.825	T	0.62937	-0.6748	10	0.12766	T	0.61	-25.0623	15.2493	0.73532	1.0:0.0:0.0:0.0	.	61	Q9UJC5	SH3L2_HUMAN	P	61	ENSP00000358853:Q61P	ENSP00000358853:Q61P	Q	+	2	0	SH3BGRL2	80440186	1.000000	0.71417	0.998000	0.56505	0.186000	0.23388	5.741000	0.68638	2.188000	0.69820	0.528000	0.53228	CAG		0.453	SH3BGRL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041309.1			55	112	0	0	0	0.01441	0	55	112				
RRAGD	58528	broad.mit.edu	37	6	90088977	90088977	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr6:90088977G>A	ENST00000369415.4	-	4	1001	c.725C>T	c.(724-726)cCa>cTa	p.P242L	RRAGD_ENST00000359203.3_Missense_Mutation_p.P91L|RRAGD_ENST00000492783.1_5'UTR	NM_021244.4	NP_067067.1			Ras-related GTP binding D									p.P242L(1)		breast(1)|central_nervous_system(1)|large_intestine(4)|lung(7)|ovary(2)	15		all_cancers(76;7.01e-07)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00139)		BRCA - Breast invasive adenocarcinoma(108;0.0144)		CTCCAGAGTTGGGAGTTGTGG	0.323																																							uc003pnd.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(724-726)CCA>CTA		Ras-related GTP binding D							96.0	98.0	97.0					6																	90088977		2203	4300	6503	SO:0001583	missense	58528				cellular protein localization|cellular response to amino acid stimulus|positive regulation of TOR signaling cascade	lysosome|nucleus	GTP binding|protein heterodimerization activity	g.chr6:90088977G>A	AF272036	CCDS5022.1	6q15-q16	2008-02-05			ENSG00000025039	ENSG00000025039			19903	protein-coding gene	gene with protein product		608268				11073942	Standard	NM_021244		Approved	DKFZP761H171, bA11D8.2.1	uc003pnd.4	Q9NQL2	OTTHUMG00000015200	ENST00000369415.4:c.725C>T	6.37:g.90088977G>A	ENSP00000358423:p.Pro242Leu					RRAGD_uc010kcc.2_Missense_Mutation_p.P91L	p.P242L	NM_021244	NP_067067	Q9NQL2	RRAGD_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0144)	4	1008	-		all_cancers(76;7.01e-07)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00139)	242						Missense_Mutation	SNP	ENST00000369415.4	37	c.725C>T	CCDS5022.1	.	.	.	.	.	.	.	.	.	.	G	32	5.154091	0.94645	.	.	ENSG00000025039	ENST00000369415;ENST00000359203	T;T	0.80566	-1.39;-1.39	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	D	0.90147	0.6921	M	0.89478	3.035	0.80722	D	1	D	0.59767	0.986	P	0.62089	0.898	D	0.90678	0.4603	10	0.72032	D	0.01	-11.2263	20.3736	0.98901	0.0:0.0:1.0:0.0	.	242	Q9NQL2	RRAGD_HUMAN	L	242;91	ENSP00000358423:P242L;ENSP00000352131:P91L	ENSP00000352131:P91L	P	-	2	0	RRAGD	90145696	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.820000	0.97059	0.650000	0.86243	CCA		0.323	RRAGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041484.1	NM_021244		9	65	0	0	0	0.008291	0	9	65				
CASP8AP2	9994	broad.mit.edu	37	6	90572786	90572786	+	RNA	SNP	C	C	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr6:90572786C>T	ENST00000551025.1	+	0	2795									caspase 8 associated protein 2									p.A453V(1)		NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		GAAGTTGATGCCATGCATCAG	0.353																																					Colon(187;1656 2025 17045 31481 39901)	Colon(187;1656 2025 17045 31481 39901)	uc003pnr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1357-1359)GCC>GTC		caspase 8 associated protein 2							111.0	107.0	108.0					6																	90572786		1848	4103	5951			9994				cell cycle|cellular response to mechanical stimulus|induction of apoptosis via death domain receptors|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	cytoplasm|nucleus	caspase activator activity|death receptor binding|transcription corepressor activity	g.chr6:90572786C>T	AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212		6.37:g.90572786C>T						CASP8AP2_uc003pns.2_Intron|CASP8AP2_uc003pnt.2_Missense_Mutation_p.A453V|CASP8AP2_uc011dzz.1_Missense_Mutation_p.A453V	p.A453V	NM_001137667	NP_001131139	Q9UKL3	C8AP2_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0953)	7	1554	+		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)	453						Missense_Mutation	SNP	ENST00000551025.1	37	c.1358C>T																																																																																					0.353	CASP8AP2-202	KNOWN	basic	processed_transcript	processed_transcript		NM_001137667		4	145	0	0	0	0.009096	0	4	145				
TMEM200A	114801	broad.mit.edu	37	6	130762171	130762171	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr6:130762171G>T	ENST00000296978.3	+	3	1475	c.604G>T	c.(604-606)Gcc>Tcc	p.A202S	TMEM200A_ENST00000392429.1_Missense_Mutation_p.A202S|TMEM200A_ENST00000545622.1_Missense_Mutation_p.A202S	NM_001258276.1|NM_001258277.1|NM_001258278.1	NP_001245205.1|NP_001245206.1|NP_001245207.1	Q86VY9	T200A_HUMAN	transmembrane protein 200A	202						integral component of membrane (GO:0016021)		p.A202S(2)		NS(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(30)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52				GBM - Glioblastoma multiforme(226;0.0139)|OV - Ovarian serous cystadenocarcinoma(155;0.12)		GAGCTCCTGTGCCTCGAGATT	0.463																																							uc003qca.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(604-606)GCC>TCC		transmembrane protein 200A							85.0	79.0	81.0					6																	130762171		2203	4300	6503	SO:0001583	missense	114801					integral to membrane		g.chr6:130762171G>T	AB067500	CCDS5140.1	6q23.1	2009-09-04	2007-12-18	2007-12-18	ENSG00000164484	ENSG00000164484			21075	protein-coding gene	gene with protein product			"""KIAA1913"""	KIAA1913		15722956	Standard	NM_001258276		Approved	TTMC	uc010kfh.4	Q86VY9	OTTHUMG00000015557	ENST00000296978.3:c.604G>T	6.37:g.130762171G>T	ENSP00000296978:p.Ala202Ser					TMEM200A_uc010kfh.2_Missense_Mutation_p.A202S|TMEM200A_uc010kfi.2_Missense_Mutation_p.A202S|TMEM200A_uc003qcb.2_Missense_Mutation_p.A202S	p.A202S	NM_052913	NP_443145	Q86VY9	T200A_HUMAN		GBM - Glioblastoma multiforme(226;0.0139)|OV - Ovarian serous cystadenocarcinoma(155;0.12)	3	1475	+			202			Cytoplasmic (Potential).		Q96PX5	Missense_Mutation	SNP	ENST00000296978.3	37	c.604G>T	CCDS5140.1	.	.	.	.	.	.	.	.	.	.	G	14.90	2.673694	0.47781	.	.	ENSG00000164484	ENST00000296978;ENST00000545622;ENST00000392429	.	.	.	5.6	4.45	0.53987	.	0.159310	0.56097	D	0.000040	T	0.42131	0.1189	L	0.53249	1.67	0.53005	D	0.999966	B	0.27853	0.191	B	0.28465	0.09	T	0.39482	-0.9612	9	0.39692	T	0.17	-8.4069	12.7728	0.57432	0.1018:0.0:0.8982:0.0	.	202	Q86VY9	T200A_HUMAN	S	202	.	ENSP00000296978:A202S	A	+	1	0	TMEM200A	130803864	1.000000	0.71417	0.984000	0.44739	0.933000	0.57130	3.921000	0.56454	0.971000	0.38288	0.655000	0.94253	GCC		0.463	TMEM200A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042201.1	NM_052913		14	32	1	0	1.02788e-11	0.00499	1.27446e-11	14	32				
WTAP	9589	broad.mit.edu	37	6	160176630	160176630	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr6:160176630G>T	ENST00000358372.4	+	8	2935	c.1178G>T	c.(1177-1179)gGt>gTt	p.G393V	SOD2_ENST00000546087.1_Intron	NM_001270531.1|NM_004906.4	NP_001257460.1|NP_004897.2	Q15007	FL2D_HUMAN	Wilms tumor 1 associated protein	393					cell cycle (GO:0007049)|mRNA methylation (GO:0080009)|mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	MIS complex (GO:0036396)|nuclear membrane (GO:0031965)|nuclear speck (GO:0016607)|nucleus (GO:0005634)		p.G393V(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	18		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.75e-18)|BRCA - Breast invasive adenocarcinoma(81;5.93e-06)		AATGTACAGGGTTCAGTTTTG	0.388																																							uc003qsl.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1177-1179)GGT>GTT		Wilms' tumour 1-associating protein isoform 1							46.0	49.0	48.0					6																	160176630		2203	4300	6503	SO:0001583	missense	9589				cell cycle|mRNA processing|RNA splicing	nuclear membrane|nucleolus		g.chr6:160176630G>T	AJ276706	CCDS5266.1, CCDS5267.1, CCDS75542.1	6q25-q27	2008-02-05			ENSG00000146457	ENSG00000146457			16846	protein-coding gene	gene with protein product		605442				7788527, 11001926	Standard	NM_004906		Approved	KIAA0105, MGC3925	uc003qsl.4	Q15007	OTTHUMG00000015933	ENST00000358372.4:c.1178G>T	6.37:g.160176630G>T	ENSP00000351141:p.Gly393Val					WTAP_uc003qso.2_Missense_Mutation_p.G274V	p.G393V	NM_004906	NP_004897	Q15007	FL2D_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;1.75e-18)|BRCA - Breast invasive adenocarcinoma(81;5.93e-06)	8	1400	+		Breast(66;0.000776)|Ovarian(120;0.0303)	393					Q5TCL8|Q5TCL9|Q96T28|Q9BYJ7|Q9H4E2	Missense_Mutation	SNP	ENST00000358372.4	37	c.1178G>T	CCDS5266.1	.	.	.	.	.	.	.	.	.	.	G	14.55	2.569294	0.45798	.	.	ENSG00000146457	ENST00000358372	T	0.50001	0.76	6.16	6.16	0.99307	.	0.103596	0.64402	D	0.000004	T	0.44095	0.1277	N	0.24115	0.695	0.80722	D	1	D;P	0.63046	0.992;0.893	P;P	0.54544	0.755;0.563	T	0.43621	-0.9380	10	0.72032	D	0.01	-14.2058	20.8598	0.99761	0.0:0.0:1.0:0.0	.	393;393	A8K489;Q15007	.;FL2D_HUMAN	V	393	ENSP00000351141:G393V	ENSP00000351141:G393V	G	+	2	0	WTAP	160096620	1.000000	0.71417	0.969000	0.41365	0.988000	0.76386	5.276000	0.65580	2.937000	0.99478	0.650000	0.86243	GGT		0.388	WTAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042905.1	NM_152857		10	33	1	0	3.86212e-05	0.008291	4.23747e-05	10	33				
SDK1	221935	broad.mit.edu	37	7	4281522	4281522	+	Silent	SNP	C	C	T	rs141297041		TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr7:4281522C>T	ENST00000404826.2	+	43	6367	c.6228C>T	c.(6226-6228)acC>acT	p.T2076T	SDK1_ENST00000389531.3_Silent_p.T2056T|SDK1_ENST00000466611.1_3'UTR	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	2076					cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.T2076T(1)		NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		TCAAGAGCACCTTCTCCAAGA	0.627																																							uc003smx.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(3)|ovary(2)|skin(1)	6						c.(6226-6228)ACC>ACT		sidekick 1 precursor		C		1,4405	2.1+/-5.4	0,1,2202	78.0	67.0	71.0		6228	2.5	1.0	7	dbSNP_134	71	0,8600		0,0,4300	no	coding-synonymous	SDK1	NM_152744.3		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		2076/2214	4281522	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	221935				cell adhesion	integral to membrane		g.chr7:4281522C>T	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.6228C>T	7.37:g.4281522C>T						SDK1_uc010kso.2_Silent_p.T1332T|SDK1_uc003smy.2_Silent_p.T563T|SDK1_uc003smz.2_Silent_p.T136T	p.T2076T	NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)	43	6367	+		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)	2076			Extracellular (Potential).|Cytoplasmic (Potential).		Q8TEN9|Q8TEP5|Q96N44	Silent	SNP	ENST00000404826.2	37	c.6228C>T	CCDS34590.1																																																																																				0.627	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744		19	76	0	0	0	0.014323	0	19	76				
USP42	84132	broad.mit.edu	37	7	6182611	6182611	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr7:6182611C>G	ENST00000306177.5	+	8	1002	c.844C>G	c.(844-846)Cag>Gag	p.Q282E		NM_032172.2	NP_115548.1	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	282	USP.				cell differentiation (GO:0030154)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)	p.Q282E(1)|p.Q410E(1)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(2)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	35		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		GAAGCCGGAACAGCTTGATGG	0.537																																							uc011jwo.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(2)|ovary(1)|pancreas(1)|breast(1)	5						c.(844-846)CAG>GAG		ubiquitin specific peptidase 42							180.0	187.0	185.0					7																	6182611		2121	4245	6366	SO:0001583	missense	84132				cell differentiation|protein deubiquitination|spermatogenesis|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity	g.chr7:6182611C>G	AK022759	CCDS47535.1	7p22.2	2005-08-08	2005-08-08		ENSG00000106346	ENSG00000106346		"""Ubiquitin-specific peptidases"""	20068	protein-coding gene	gene with protein product			"""ubiquitin specific protease 42"""			12838346	Standard	NM_032172		Approved	FLJ12697	uc011jwp.2	Q9H9J4	OTTHUMG00000151888	ENST00000306177.5:c.844C>G	7.37:g.6182611C>G	ENSP00000301962:p.Gln282Glu					USP42_uc011jwn.1_Missense_Mutation_p.Q127E|USP42_uc010kth.1_Missense_Mutation_p.Q215E|USP42_uc011jwp.1_Missense_Mutation_p.Q282E|USP42_uc011jwq.1_Missense_Mutation_p.Q89E|USP42_uc011jwr.1_Missense_Mutation_p.Q127E	p.Q282E	NM_032172	NP_115548	Q9H9J4	UBP42_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)	8	967	+		Ovarian(82;0.0423)	282					A2RUE3|B5MDA5|Q0VIN8|Q3C166|Q6P9B4	Missense_Mutation	SNP	ENST00000306177.5	37	c.844C>G	CCDS47535.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.210586	0.79240	.	.	ENSG00000106346	ENST00000306177;ENST00000465073;ENST00000426246	T;T;T	0.02682	4.2;4.2;4.2	5.56	5.56	0.83823	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.64402	D	0.000012	T	0.07683	0.0193	N	0.25245	0.725	0.38893	D	0.957154	D;D;D;D	0.61697	0.961;0.988;0.99;0.99	P;P;P;P	0.61940	0.841;0.832;0.896;0.896	T	0.50311	-0.8843	10	0.36615	T	0.2	.	19.5344	0.95244	0.0:1.0:0.0:0.0	.	245;282;282;282	A4D2N7;Q9H9J4-2;Q9H9J4;A4D2N6	.;.;UBP42_HUMAN;.	E	282;215;128	ENSP00000301962:Q282E;ENSP00000430568:Q215E;ENSP00000408217:Q128E	ENSP00000301962:Q282E	Q	+	1	0	USP42	6149137	1.000000	0.71417	0.992000	0.48379	0.829000	0.46940	4.546000	0.60705	2.622000	0.88805	0.563000	0.77884	CAG		0.537	USP42-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324262.3	XM_166526		21	60	0	0	0	0.004656	0	21	60				
DNAH11	8701	broad.mit.edu	37	7	21788230	21788230	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr7:21788230A>T	ENST00000409508.3	+	52	8574	c.8543A>T	c.(8542-8544)cAg>cTg	p.Q2848L	DNAH11_ENST00000328843.6_Missense_Mutation_p.Q2855L	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2855	AAA 4. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.Q2855L(1)		NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						CGAACCCCTCAGGGCTGTGCT	0.542									Kartagener syndrome																														uc003svc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						c.(8563-8565)CAG>CTG		dynein, axonemal, heavy chain 11							57.0	59.0	58.0					7																	21788230		1952	4146	6098	SO:0001583	missense	8701	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr7:21788230A>T	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.8543A>T	7.37:g.21788230A>T	ENSP00000475939:p.Gln2848Leu						p.Q2855L	NM_003777	NP_003768	Q96DT5	DYH11_HUMAN			53	8595	+			2855			AAA 4 (By similarity).		Q9UJ82	Missense_Mutation	SNP	ENST00000409508.3	37	c.8564A>T		.	.	.	.	.	.	.	.	.	.	A	9.606	1.129977	0.21041	.	.	ENSG00000105877	ENST00000328843	T	0.41758	0.99	6.06	-2.62	0.06152	Dynein heavy chain, P-loop containing D4 domain (1);ATPase, AAA+ type, core (1);	0.665350	0.16630	N	0.206082	T	0.27027	0.0662	.	.	.	0.09310	N	1	B	0.31351	0.32	B	0.34991	0.193	T	0.16247	-1.0409	9	0.52906	T	0.07	.	3.7666	0.08624	0.4375:0.1055:0.3551:0.1019	.	2855	Q96DT5	DYH11_HUMAN	L	2855	ENSP00000330671:Q2855L	ENSP00000330671:Q2855L	Q	+	2	0	DNAH11	21754755	0.093000	0.21703	0.053000	0.19242	0.033000	0.12548	1.640000	0.37186	-0.679000	0.05217	-0.263000	0.10527	CAG		0.542	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	NM_003777		38	68	0	0	0	0.00623	0	38	68				
DNAH11	8701	broad.mit.edu	37	7	21789974	21789974	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr7:21789974C>A	ENST00000409508.3	+	54	8963	c.8932C>A	c.(8932-8934)Cag>Aag	p.Q2978K	DNAH11_ENST00000328843.6_Missense_Mutation_p.Q2985K	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2985	AAA 4. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.Q2985K(1)		NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						GGTGCGACTACAGCTCAAAGT	0.368									Kartagener syndrome																														uc003svc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						c.(8953-8955)CAG>AAG		dynein, axonemal, heavy chain 11							51.0	50.0	50.0					7																	21789974		1870	4099	5969	SO:0001583	missense	8701	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr7:21789974C>A	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.8932C>A	7.37:g.21789974C>A	ENSP00000475939:p.Gln2978Lys						p.Q2985K	NM_003777	NP_003768	Q96DT5	DYH11_HUMAN			55	8984	+			2985			AAA 4 (By similarity).		Q9UJ82	Missense_Mutation	SNP	ENST00000409508.3	37	c.8953C>A		.	.	.	.	.	.	.	.	.	.	C	21.8	4.209168	0.79240	.	.	ENSG00000105877	ENST00000328843	T	0.38240	1.15	5.91	5.91	0.95273	Dynein heavy chain, P-loop containing D4 domain (1);ATPase, AAA+ type, core (1);	0.107337	0.64402	D	0.000004	T	0.48502	0.1503	.	.	.	0.58432	D	0.999995	D	0.59767	0.986	P	0.52598	0.703	T	0.46062	-0.9218	9	0.59425	D	0.04	.	14.4699	0.67509	0.0:0.9282:0.0:0.0718	.	2985	Q96DT5	DYH11_HUMAN	K	2985	ENSP00000330671:Q2985K	ENSP00000330671:Q2985K	Q	+	1	0	DNAH11	21756499	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.520000	0.60524	2.808000	0.96608	0.655000	0.94253	CAG		0.368	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	NM_003777		7	14	1	0	0.00307968	0.00308	0.00323027	7	14				
GLI3	2737	broad.mit.edu	37	7	42007443	42007443	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr7:42007443G>C	ENST00000395925.3	-	14	2266	c.2182C>G	c.(2182-2184)Ctc>Gtc	p.L728V	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	728					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L728V(1)		NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						GGAAGCTCGAGCCCACTGTTG	0.537									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																														uc011kbh.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(11)|ovary(3)|large_intestine(2)|central_nervous_system(1)|kidney(1)|pancreas(1)	19						c.(2182-2184)CTC>GTC		GLI-Kruppel family member GLI3							159.0	152.0	154.0					7																	42007443		2203	4300	6503	SO:0001583	missense	2737	Greig_Cephalopolysyndactyly|Pallister-Hall_syndrome	Familial Cancer Database	;	negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr7:42007443G>C		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.2182C>G	7.37:g.42007443G>C	ENSP00000379258:p.Leu728Val					GLI3_uc011kbg.1_Missense_Mutation_p.L669V	p.L728V	NM_000168	NP_000159	P10071	GLI3_HUMAN			14	2273	-			728					A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Missense_Mutation	SNP	ENST00000395925.3	37	c.2182C>G	CCDS5465.1	.	.	.	.	.	.	.	.	.	.	G	3.121	-0.180464	0.06380	.	.	ENSG00000106571	ENST00000395925	T	0.08102	3.13	5.82	3.86	0.44501	.	0.156977	0.56097	D	0.000023	T	0.02267	0.0070	N	0.01535	-0.81	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.35968	-0.9767	10	0.02654	T	1	.	6.9807	0.24702	0.0897:0.0:0.5471:0.3632	.	728	P10071	GLI3_HUMAN	V	728	ENSP00000379258:L728V	ENSP00000379258:L728V	L	-	1	0	GLI3	41973968	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.654000	0.46699	1.470000	0.48102	-0.140000	0.14226	CTC		0.537	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	NM_000168		27	267	0	0	0	0.009535	0	27	267				
IKZF1	10320	broad.mit.edu	37	7	50444256	50444256	+	Silent	SNP	G	G	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr7:50444256G>A	ENST00000331340.3	+	4	341	c.186G>A	c.(184-186)caG>caA	p.Q62Q	IKZF1_ENST00000357364.4_Silent_p.Q62Q|IKZF1_ENST00000346667.4_Intron|IKZF1_ENST00000359197.5_Silent_p.Q62Q|IKZF1_ENST00000438033.1_Intron|IKZF1_ENST00000440768.2_Silent_p.Q62Q|IKZF1_ENST00000439701.1_Silent_p.Q62Q|IKZF1_ENST00000349824.4_Silent_p.Q62Q|IKZF1_ENST00000343574.5_Intron	NM_001220769.1|NM_001220772.1|NM_001220773.1|NM_001220775.1|NM_006060.4	NP_001207698.1|NP_001207701.1|NP_001207702.1|NP_001207704.1|NP_006051.1	Q13422	IKZF1_HUMAN	IKAROS family zinc finger 1 (Ikaros)	62					B cell differentiation (GO:0030183)|cell cycle (GO:0007049)|chromatin modification (GO:0016568)|forebrain development (GO:0030900)|lymph node development (GO:0048535)|mesoderm development (GO:0007498)|natural killer cell differentiation (GO:0001779)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Peyer's patch development (GO:0048541)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neutrophil differentiation (GO:0045660)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|T cell differentiation (GO:0030217)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(131)|p.Q62Q(1)		haematopoietic_and_lymphoid_tissue(275)|lung(1)	276	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;7.29e-10)|all_hematologic(4;4.8e-07)				TAGAGACTCAGAGTGATGAAG	0.433			"""D,T"""	BCL6	"""ALL, DLBCL"""																																		uc003tow.3		NA		"""Rec,Dom"""	yes		7	7p12.2	10320	D	IKAROS family zinc finger 1			L			ALL		132	Unknown(131)|Substitution - coding silent(1)	p.?(74)	haematopoietic_and_lymphoid_tissue(131)|lung(1)	haematopoietic_and_lymphoid_tissue(147)|lung(1)	148						c.(184-186)CAG>CAA		zinc finger protein, subfamily 1A, 1 (Ikaros)							142.0	147.0	146.0					7																	50444256		1961	4158	6119	SO:0001819	synonymous_variant	10320				cell cycle|chromatin modification|mesoderm development	cytoplasm|nucleus	zinc ion binding	g.chr7:50444256G>A	U40462	CCDS59055.1, CCDS69299.1, CCDS75596.1, CCDS75597.1	7p12.2	2014-06-12	2006-08-25	2006-08-25	ENSG00000185811	ENSG00000185811		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13176	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 92"""	603023	"""zinc finger protein, subfamily 1A, 1 (Ikaros)"""	ZNFN1A1		1439790, 7935426	Standard	NM_006060		Approved	hIk-1, LyF-1, Hs.54452, IKAROS, PPP1R92	uc003tow.4	Q13422	OTTHUMG00000155907	ENST00000331340.3:c.186G>A	7.37:g.50444256G>A						IKZF1_uc003tox.3_Silent_p.Q62Q|IKZF1_uc003toy.3_Silent_p.Q62Q|IKZF1_uc011kck.1_Intron|IKZF1_uc003toz.3_Silent_p.Q32Q|IKZF1_uc010kyx.2_Intron	p.Q62Q	NM_006060	NP_006051	Q13422	IKZF1_HUMAN			5	354	+	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;7.29e-10)|all_hematologic(4;4.8e-07)	62					A4D260|B4E0Z1|D3DVM5|O00598|Q53XL2|Q69BM4|Q8WVA3	Silent	SNP	ENST00000331340.3	37	c.186G>A																																																																																					0.433	IKZF1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000342242.1	NM_006060		46	226	0	0	0	0.01441	0	46	226				
ZNF716	441234	broad.mit.edu	37	7	57529498	57529498	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr7:57529498C>A	ENST00000420713.1	+	4	1443	c.1331C>A	c.(1330-1332)gCc>gAc	p.A444D		NM_001159279.1	NP_001152751.1	A6NP11	ZN716_HUMAN	zinc finger protein 716	444					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A444D(2)		breast(1)|kidney(1)|lung(20)|ovary(2)	24						TGTGGGAAAGCCTTTACCTTC	0.373																																							uc011kdi.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(1330-1332)GCC>GAC		zinc finger protein 716							52.0	53.0	53.0					7																	57529498		692	1591	2283	SO:0001583	missense	441234							g.chr7:57529498C>A	AK131575	CCDS55112.1	7p11.1	2013-01-08			ENSG00000182111	ENSG00000182111		"""Zinc fingers, C2H2-type"", ""-"""	32458	protein-coding gene	gene with protein product							Standard	NM_001159279		Approved	FLJ46189	uc011kdi.1	A6NP11	OTTHUMG00000156689	ENST00000420713.1:c.1331C>A	7.37:g.57529498C>A	ENSP00000394248:p.Ala444Asp						p.A444D	NM_001159279	NP_001152751					4	1443	+									Missense_Mutation	SNP	ENST00000420713.1	37	c.1331C>A	CCDS55112.1	.	.	.	.	.	.	.	.	.	.	C	9.725	1.160648	0.21454	.	.	ENSG00000182111	ENST00000420713;ENST00000418732	T	0.20069	2.1	0.195	0.195	0.15151	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.31071	0.0785	L	0.58510	1.815	0.09310	N	1	D	0.58268	0.982	P	0.59825	0.864	T	0.12708	-1.0537	9	0.87932	D	0	.	3.8647	0.09012	1.0E-4:0.5249:0.4748:1.0E-4	.	432	A6NP11	ZN716_HUMAN	D	444;432	ENSP00000394248:A444D	ENSP00000387687:A432D	A	+	2	0	ZNF716	57533440	0.000000	0.05858	0.016000	0.15963	0.017000	0.09413	0.004000	0.13106	0.300000	0.22699	0.306000	0.20318	GCC		0.373	ZNF716-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345309.1	NM_001159279		13	15	1	0	1.49906e-05	0.020292	1.67038e-05	13	15				
CD36	948	broad.mit.edu	37	7	80276105	80276105	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr7:80276105G>T	ENST00000435819.1	+	6	733	c.49G>T	c.(49-51)Gct>Tct	p.A17S	CD36_ENST00000433696.2_Missense_Mutation_p.A17S|CD36_ENST00000432207.1_Missense_Mutation_p.A17S|CD36_ENST00000544133.1_Missense_Mutation_p.A17S|CD36_ENST00000394788.3_Missense_Mutation_p.A17S|CD36_ENST00000534394.1_Intron|CD36_ENST00000441109.2_3'UTR|CD36_ENST00000309881.7_Missense_Mutation_p.A17S|CD36_ENST00000447544.2_Missense_Mutation_p.A17S|CD36_ENST00000538969.1_Missense_Mutation_p.A17S			P16671	CD36_HUMAN	CD36 molecule (thrombospondin receptor)	17					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic cell clearance (GO:0043277)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cellular lipid metabolic process (GO:0044255)|cellular response to bacterial lipopeptide (GO:0071221)|cellular response to hydroperoxide (GO:0071447)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cGMP-mediated signaling (GO:0019934)|cholesterol transport (GO:0030301)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response (GO:0045087)|lipid metabolic process (GO:0006629)|lipid storage (GO:0019915)|lipoprotein transport (GO:0042953)|long-chain fatty acid import (GO:0044539)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle mediated signaling (GO:0055096)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of transcription factor import into nucleus (GO:0042992)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nitric oxide mediated signal transduction (GO:0007263)|phagocytosis, recognition (GO:0006910)|plasma lipoprotein particle clearance (GO:0034381)|plasma membrane long-chain fatty acid transport (GO:0015911)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood microparticle formation (GO:2000334)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of removal of superoxide radicals (GO:2000121)|response to stilbenoid (GO:0035634)|small molecule metabolic process (GO:0044281)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cell surface (GO:0009986)|endocytic vesicle membrane (GO:0030666)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)	high-density lipoprotein particle binding (GO:0008035)|lipid binding (GO:0008289)|lipoprotein particle binding (GO:0071813)|lipoteichoic acid receptor activity (GO:0070892)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|thrombospondin receptor activity (GO:0070053)|transforming growth factor beta binding (GO:0050431)	p.A17S(4)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(10)|large_intestine(1)|lung(6)|ovary(1)	21						TGTCATTGGTGCTGTCCTGGC	0.458																																							uc003uhc.2		NA																	4	Substitution - Missense(4)		lung(4)	ovary(1)	1						c.(49-51)GCT>TCT		CD36 antigen							211.0	194.0	200.0					7																	80276105		2203	4300	6503	SO:0001583	missense	948				cell adhesion|cGMP-mediated signaling|cholesterol transport|lipid metabolic process|lipid storage|lipoprotein transport|low-density lipoprotein particle clearance|nitric oxide mediated signal transduction|plasma membrane long-chain fatty acid transport|platelet activation|platelet degranulation|positive regulation of cell-matrix adhesion|positive regulation of macrophage derived foam cell differentiation	integral to plasma membrane|membrane fraction|platelet alpha granule membrane	lipid binding|low-density lipoprotein receptor activity|thrombospondin receptor activity|transforming growth factor beta binding	g.chr7:80276105G>T	Z32770	CCDS34673.1	7q11.2	2010-02-26	2006-03-28		ENSG00000135218	ENSG00000135218		"""CD molecules"""	1663	protein-coding gene	gene with protein product		173510	"""CD36 antigen (collagen type I receptor, thrombospondin receptor)"""			7503937	Standard	NM_001001548		Approved	SCARB3, GPIV, FAT, GP4, GP3B	uc003uhg.4	P16671	OTTHUMG00000155383	ENST00000435819.1:c.49G>T	7.37:g.80276105G>T	ENSP00000399421:p.Ala17Ser					CD36_uc003uhd.3_Missense_Mutation_p.A17S|CD36_uc011kgv.1_Intron|CD36_uc003uhe.3_Missense_Mutation_p.A17S|CD36_uc003uhf.3_Missense_Mutation_p.A17S|CD36_uc003uhg.3_Missense_Mutation_p.A17S|CD36_uc003uhh.3_Missense_Mutation_p.A17S	p.A17S	NM_001127444	NP_001120916	P16671	CD36_HUMAN			6	733	+			17			Helical; (Potential).		D9IX66|D9IX67|D9IX68|D9IX69|Q13966|Q16093|Q8TCV7|Q9BPZ8|Q9BQC2|Q9BZM8|Q9BZN3|Q9BZN4|Q9BZN5	Missense_Mutation	SNP	ENST00000435819.1	37	c.49G>T	CCDS34673.1	.	.	.	.	.	.	.	.	.	.	G	19.42	3.824375	0.71143	.	.	ENSG00000135218	ENST00000435819;ENST00000309881;ENST00000438020;ENST00000436384;ENST00000428497;ENST00000482059;ENST00000394788;ENST00000447544;ENST00000426978;ENST00000432207;ENST00000413265;ENST00000419819;ENST00000538969;ENST00000544133;ENST00000433696	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.72725	-0.68;-0.68;-0.68;-0.68;-0.68;-0.68;-0.68;-0.68;-0.68;-0.68;-0.68;-0.68;-0.68;-0.68;-0.68	5.45	5.45	0.79879	.	0.107611	0.64402	D	0.000006	D	0.82287	0.5004	M	0.85710	2.77	0.43841	D	0.996428	D	0.58970	0.984	P	0.55222	0.771	D	0.84504	0.0618	9	.	.	.	-24.4238	16.194	0.82011	0.0:0.0:1.0:0.0	.	17	P16671	CD36_HUMAN	S	17	ENSP00000399421:A17S;ENSP00000308165:A17S;ENSP00000410371:A17S;ENSP00000398760:A17S;ENSP00000409762:A17S;ENSP00000433659:A17S;ENSP00000378268:A17S;ENSP00000415743:A17S;ENSP00000416388:A17S;ENSP00000411411:A17S;ENSP00000407690:A17S;ENSP00000392298:A17S;ENSP00000439543:A17S;ENSP00000441956:A17S;ENSP00000401863:A17S	.	A	+	1	0	CD36	80114041	1.000000	0.71417	0.863000	0.33907	0.407000	0.30961	6.882000	0.75589	2.552000	0.86080	0.655000	0.94253	GCT		0.458	CD36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339767.6	NM_001001547		39	107	1	0	8.16277e-20	0.006999	1.14439e-19	39	107				
HGF	3082	broad.mit.edu	37	7	81346644	81346644	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr7:81346644C>G	ENST00000222390.5	-	11	1535	c.1309G>C	c.(1309-1311)Gag>Cag	p.E437Q	HGF_ENST00000457544.2_Missense_Mutation_p.E432Q	NM_000601.4	NP_000592.3	P14210	HGF_HUMAN	hepatocyte growth factor (hepapoietin A; scatter factor)	437	Kringle 4. {ECO:0000255|PROSITE- ProRule:PRU00121}.				activation of MAPK activity (GO:0000187)|blood coagulation (GO:0007596)|cell chemotaxis (GO:0060326)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epithelial to mesenchymal transition (GO:0001837)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|hyaluronan metabolic process (GO:0030212)|liver development (GO:0001889)|mitotic nuclear division (GO:0007067)|myoblast proliferation (GO:0051450)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of hydrogen peroxide-mediated programmed cell death (GO:1901299)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|organ regeneration (GO:0031100)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of cell migration (GO:0030335)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	catalytic activity (GO:0003824)|chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|identical protein binding (GO:0042802)	p.E437Q(1)		NS(2)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(41)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	75						CAGTAATTCTCATTCAGCTTA	0.438																																							uc003uhl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(2)	4						c.(1309-1311)GAG>CAG		hepatocyte growth factor isoform 1							232.0	175.0	194.0					7																	81346644		2203	4300	6503	SO:0001583	missense	3082				epithelial to mesenchymal transition|mitosis|platelet activation|platelet degranulation|proteolysis|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling	platelet alpha granule lumen	growth factor activity|serine-type endopeptidase activity	g.chr7:81346644C>G		CCDS5597.1, CCDS47626.1, CCDS47627.1, CCDS47628.1, CCDS47629.1	7q21.1	2009-09-11			ENSG00000019991	ENSG00000019991			4893	protein-coding gene	gene with protein product	"""hepatopoietin A"", ""fibroblast-derived tumor cytotoxic factor"", ""scatter factor"", ""lung fibroblast-derived mitogen"""	142409	"""deafness, autosomal recessive 39"""	DFNB39		1837206, 19576567	Standard	XM_006715956		Approved	SF, F-TCF, HGFB, HPTA	uc003uhl.3	P14210	OTTHUMG00000023804	ENST00000222390.5:c.1309G>C	7.37:g.81346644C>G	ENSP00000222390:p.Glu437Gln					HGF_uc003uhm.2_Missense_Mutation_p.E432Q	p.E437Q	NM_000601	NP_000592	P14210	HGF_HUMAN			11	1474	-			437			Kringle 4.		A1L3U6|Q02935|Q13494|Q14519|Q3KRB2|Q8TCE2|Q9BYL9|Q9BYM0|Q9UDU6	Missense_Mutation	SNP	ENST00000222390.5	37	c.1309G>C	CCDS5597.1	.	.	.	.	.	.	.	.	.	.	C	13.96	2.391959	0.42410	.	.	ENSG00000019991	ENST00000222390;ENST00000457544	T;T	0.64260	-0.09;-0.09	6.02	4.81	0.61882	Kringle (4);Kringle-like fold (1);	0.142496	0.64402	D	0.000005	T	0.47451	0.1446	N	0.25245	0.725	0.80722	D	1	B;B	0.09022	0.001;0.002	B;B	0.15052	0.007;0.012	T	0.36114	-0.9761	10	0.46703	T	0.11	.	10.7536	0.46223	0.0:0.082:0.0:0.918	.	432;437	P14210-3;P14210	.;HGF_HUMAN	Q	437;432	ENSP00000222390:E437Q;ENSP00000391238:E432Q	ENSP00000222390:E437Q	E	-	1	0	HGF	81184580	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	3.614000	0.54160	0.998000	0.38996	-0.355000	0.07637	GAG		0.438	HGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253315.2	NM_000601		25	58	0	0	0	0.00632	0	25	58				
STEAP2	261729	broad.mit.edu	37	7	89856415	89856415	+	Missense_Mutation	SNP	T	T	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr7:89856415T>A	ENST00000287908.3	+	3	1016	c.623T>A	c.(622-624)cTc>cAc	p.L208H	STEAP2_ENST00000394621.2_Missense_Mutation_p.L208H|STEAP2_ENST00000394622.2_Missense_Mutation_p.L208H|STEAP2_ENST00000394626.1_Missense_Mutation_p.L208H|STEAP2_ENST00000402625.2_Missense_Mutation_p.L208H|STEAP2_ENST00000394632.1_Missense_Mutation_p.L208H|STEAP2_ENST00000394629.2_Missense_Mutation_p.L208H	NM_001244944.1|NM_152999.3	NP_001231873.1|NP_694544.2	Q8NFT2	STEA2_HUMAN	STEAP family member 2, metalloreductase	208					copper ion import (GO:0015677)|endocytosis (GO:0006897)|ferric iron import into cell (GO:0097461)|Golgi to plasma membrane transport (GO:0006893)|iron ion homeostasis (GO:0055072)|regulated secretory pathway (GO:0045055)|response to hormone (GO:0009725)	cytosol (GO:0005829)|early endosome (GO:0005769)|integral component of Golgi membrane (GO:0030173)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|trans-Golgi network transport vesicle (GO:0030140)	cupric reductase activity (GO:0008823)|ferric-chelate reductase (NADPH) activity (GO:0052851)|metal ion binding (GO:0046872)|transporter activity (GO:0005215)	p.L208H(2)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(1)	15	all_hematologic(106;0.112)					CCCCTACGACTCTTTACTCTC	0.428																																							uc003ujz.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(622-624)CTC>CAC		six transmembrane epithelial antigen of the							104.0	99.0	101.0					7																	89856415		2203	4300	6503	SO:0001583	missense	261729				electron transport chain|endocytosis|Golgi to plasma membrane transport|ion transport|iron ion homeostasis|regulated secretory pathway|response to hormone stimulus	cytosol|early endosome|endosome membrane|integral to Golgi membrane|plasma membrane|trans-Golgi network transport vesicle|vesicular fraction	electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|oxidoreductase activity|transporter activity	g.chr7:89856415T>A	AF455138	CCDS5615.1, CCDS43612.1, CCDS59064.1	7q21.13	2011-09-30	2011-09-30		ENSG00000157214	ENSG00000157214			17885	protein-coding gene	gene with protein product		605094	"""prostate cancer associated protein 1"", ""six transmembrane epithelial antigen of the prostate 2"""	PCANAP1		10613842, 12095985	Standard	NM_001040665		Approved	IPCA-1, STAMP1, STMP	uc003ujz.3	Q8NFT2	OTTHUMG00000023341	ENST00000287908.3:c.623T>A	7.37:g.89856415T>A	ENSP00000287908:p.Leu208His					STEAP2_uc003ujy.2_Missense_Mutation_p.L250H|STEAP2_uc010len.2_Missense_Mutation_p.L208H|STEAP2_uc003uka.2_Missense_Mutation_p.L208H|STEAP2_uc003ukb.2_Missense_Mutation_p.L208H|STEAP2_uc003ukc.2_Missense_Mutation_p.L208H|STEAP2_uc003ukd.2_Missense_Mutation_p.L208H	p.L208H	NM_152999	NP_694544	Q8NFT2	STEA2_HUMAN			3	1016	+	all_hematologic(106;0.112)		208			Helical; (Potential).		A4D1F1|G5E9C6|Q6UXN6|Q6YPB1|Q8IUE7	Missense_Mutation	SNP	ENST00000287908.3	37	c.623T>A	CCDS5615.1	.	.	.	.	.	.	.	.	.	.	T	24.0	4.479669	0.84747	.	.	ENSG00000157214	ENST00000287908;ENST00000394626;ENST00000394622;ENST00000394632;ENST00000394624;ENST00000394621;ENST00000402625;ENST00000394629	T;T;T;T;T;T;T	0.20069	2.1;2.1;2.1;2.1;2.1;2.1;2.1	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.50871	0.1641	M	0.84219	2.685	0.58432	D	0.999994	D;D;D;D	0.89917	0.999;0.999;1.0;1.0	D;D;D;D	0.72075	0.976;0.947;0.972;0.962	T	0.53634	-0.8411	9	.	.	.	-10.6257	16.6438	0.85155	0.0:0.0:0.0:1.0	.	208;208;208;208	G5E9C6;Q6YPB2;Q8NFT2;B5MC02	.;.;STEA2_HUMAN;.	H	208	ENSP00000287908:L208H;ENSP00000378123:L208H;ENSP00000378120:L208H;ENSP00000378128:L208H;ENSP00000378119:L208H;ENSP00000384191:L208H;ENSP00000378125:L208H	.	L	+	2	0	STEAP2	89694351	1.000000	0.71417	0.937000	0.37676	0.907000	0.53573	8.040000	0.89188	2.333000	0.79357	0.533000	0.62120	CTC		0.428	STEAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059662.4	NM_152999		27	47	0	0	0	0.005443	0	27	47				
NPTX2	4885	broad.mit.edu	37	7	98254413	98254413	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr7:98254413C>A	ENST00000265634.3	+	3	988	c.823C>A	c.(823-825)Cag>Aag	p.Q275K		NM_002523.2	NP_002514.1	P47972	NPTX2_HUMAN	neuronal pentraxin II	275	Pentaxin.				synaptic transmission (GO:0007268)	extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)	p.Q275K(1)		breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(5)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	18	all_cancers(62;2.28e-09)|all_epithelial(64;4.86e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0128)|all_lung(186;0.0142)		STAD - Stomach adenocarcinoma(171;0.215)			GGTGCCAGGGCAGGCCAACGA	0.642																																							uc003upl.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|skin(1)	3						c.(823-825)CAG>AAG		neuronal pentraxin II precursor							106.0	88.0	94.0					7																	98254413		2203	4300	6503	SO:0001583	missense	4885				synaptic transmission	extracellular region	metal ion binding|sugar binding	g.chr7:98254413C>A		CCDS5657.1	7q21.3-q22.1	2008-04-30			ENSG00000106236	ENSG00000106236			7953	protein-coding gene	gene with protein product	"""apexin"""	600750				8530029	Standard	NM_002523		Approved		uc003upl.2	P47972	OTTHUMG00000154369	ENST00000265634.3:c.823C>A	7.37:g.98254413C>A	ENSP00000265634:p.Gln275Lys						p.Q275K	NM_002523	NP_002514	P47972	NPTX2_HUMAN	STAD - Stomach adenocarcinoma(171;0.215)		3	1000	+	all_cancers(62;2.28e-09)|all_epithelial(64;4.86e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0128)|all_lung(186;0.0142)		275			Pentaxin.		A4D267|Q86XV7|Q96G70	Missense_Mutation	SNP	ENST00000265634.3	37	c.823C>A	CCDS5657.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.046970	0.75846	.	.	ENSG00000106236	ENST00000265634	T	0.05513	3.43	5.67	5.67	0.87782	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.27454	0.0674	M	0.77313	2.365	0.80722	D	1	D	0.69078	0.997	D	0.76071	0.987	T	0.00253	-1.1875	10	0.40728	T	0.16	-18.2745	18.7465	0.91795	0.0:1.0:0.0:0.0	.	275	P47972	NPTX2_HUMAN	K	275	ENSP00000265634:Q275K	ENSP00000265634:Q275K	Q	+	1	0	NPTX2	98092349	1.000000	0.71417	1.000000	0.80357	0.184000	0.23303	7.776000	0.85560	2.667000	0.90743	0.561000	0.74099	CAG		0.642	NPTX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334982.1	NM_002523		34	180	1	0	1.04352e-10	0.017118	1.25397e-10	34	180				
NRCAM	4897	broad.mit.edu	37	7	107878195	107878195	+	Splice_Site	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr7:107878195C>A	ENST00000425651.2	-	2	124		c.e2+1		NRCAM_ENST00000379024.4_Splice_Site|NRCAM_ENST00000379028.3_Splice_Site|NRCAM_ENST00000379022.4_Intron|NRCAM_ENST00000351718.4_Intron|NRCAM_ENST00000413765.2_Intron	NM_001037132.2	NP_001032209.1	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule						angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)	p.?(1)		breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						AGGACACTTACAGTCTTCAAG	0.318																																							uc003vfb.2		NA																	1	Unknown(1)		lung(1)	ovary(3)|breast(2)	5						c.e5+1		neuronal cell adhesion molecule isoform A							94.0	86.0	88.0					7																	107878195		1838	4081	5919	SO:0001630	splice_region_variant	4897				angiogenesis|axon guidance|axonal fasciculation|cell-cell adhesion|central nervous system development|clustering of voltage-gated sodium channels|neuron migration|positive regulation of neuron differentiation|regulation of axon extension|synapse assembly	external side of plasma membrane|integral to plasma membrane	ankyrin binding	g.chr7:107878195C>A		CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000425651.2:c.124+1G>T	7.37:g.107878195C>A						NRCAM_uc003vfc.2_Intron|NRCAM_uc011kmk.1_Splice_Site_p.L37_splice|NRCAM_uc003vfd.2_Splice_Site_p.L37_splice|NRCAM_uc003vfe.2_Splice_Site_p.L37_splice	p.L42_splice	NM_001037132	NP_001032209	Q92823	NRCAM_HUMAN			5	595	-								A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	Splice_Site	SNP	ENST00000425651.2	37	c.124_splice	CCDS47686.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.932367	0.73442	.	.	ENSG00000091129	ENST00000379028;ENST00000379024;ENST00000425651;ENST00000442580;ENST00000418239	.	.	.	5.61	5.61	0.85477	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1798	0.89773	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NRCAM	107665431	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.200000	0.72118	2.813000	0.96785	0.655000	0.94253	.		0.318	NRCAM-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337942.2	NM_001037132	Intron	4	14	1	0	0.00116845	0.001168	0.00123464	4	14				
FLNC	2318	broad.mit.edu	37	7	128478674	128478674	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr7:128478674G>T	ENST00000325888.8	+	8	1489	c.1228G>T	c.(1228-1230)Gtt>Ttt	p.V410F	FLNC_ENST00000346177.6_Missense_Mutation_p.V410F	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	410					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)	p.V410F(1)		biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						CACTGGCGATGTTGCTGTGGT	0.657																																							uc003vnz.3		NA																	1	Substitution - Missense(1)		lung(1)	breast(5)|large_intestine(3)|ovary(2)|central_nervous_system(1)|skin(1)	12						c.(1228-1230)GTT>TTT		gamma filamin isoform a							66.0	80.0	75.0					7																	128478674		2163	4249	6412	SO:0001583	missense	2318				cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding	g.chr7:128478674G>T	AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.1228G>T	7.37:g.128478674G>T	ENSP00000327145:p.Val410Phe					FLNC_uc003voa.3_Missense_Mutation_p.V410F	p.V410F	NM_001458	NP_001449	Q14315	FLNC_HUMAN			8	1437	+			410			Filamin 2.		B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	ENST00000325888.8	37	c.1228G>T	CCDS43644.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.003886	0.74932	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	T;T	0.64618	-0.11;-0.11	5.53	5.53	0.82687	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.067671	0.64402	D	0.000019	T	0.78342	0.4268	M	0.71036	2.16	0.54753	D	0.999983	D;D	0.60575	0.975;0.988	P;D	0.67548	0.807;0.952	T	0.80103	-0.1522	10	0.72032	D	0.01	.	18.0334	0.89292	0.0:0.0:1.0:0.0	.	410;410	Q14315-2;Q14315	.;FLNC_HUMAN	F	410	ENSP00000327145:V410F;ENSP00000344002:V410F	ENSP00000327145:V410F	V	+	1	0	FLNC	128265910	1.000000	0.71417	1.000000	0.80357	0.633000	0.38033	4.908000	0.63307	2.590000	0.87494	0.561000	0.74099	GTT		0.657	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3			53	135	1	0	3.54697e-40	0.01441	5.74207e-40	53	135				
DGKI	9162	broad.mit.edu	37	7	137269996	137269996	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr7:137269996G>T	ENST00000288490.5	-	14	1522	c.1522C>A	c.(1522-1524)Ccc>Acc	p.P508T	DGKI_ENST00000446122.1_Missense_Mutation_p.P508T|DGKI_ENST00000453654.2_Missense_Mutation_p.P208T|DGKI_ENST00000424189.2_Missense_Mutation_p.P508T	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	508					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)	p.P508T(2)		breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						GGCAAGTCGGGGTTTCTTTCC	0.483																																							uc003vtt.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|kidney(1)|skin(1)	3						c.(1522-1524)CCC>ACC		diacylglycerol kinase, iota							156.0	144.0	148.0					7																	137269996		2203	4300	6503	SO:0001583	missense	9162				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding	g.chr7:137269996G>T	AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.1522C>A	7.37:g.137269996G>T	ENSP00000288490:p.Pro508Thr					DGKI_uc003vtu.2_Missense_Mutation_p.P208T	p.P508T	NM_004717	NP_004708	O75912	DGKI_HUMAN			14	1523	-			508					A4D1Q9|Q9NZ49	Missense_Mutation	SNP	ENST00000288490.5	37	c.1522C>A	CCDS5845.1	.	.	.	.	.	.	.	.	.	.	G	15.73	2.919108	0.52546	.	.	ENSG00000157680	ENST00000453654;ENST00000540376;ENST00000424189;ENST00000288490;ENST00000446122	T;T;T	0.36340	1.83;1.26;1.46	6.07	6.07	0.98685	.	0.173392	0.52532	D	0.000069	T	0.33323	0.0859	L	0.35542	1.07	0.47659	D	0.999483	B;B	0.20780	0.017;0.048	B;B	0.22753	0.009;0.041	T	0.03139	-1.1068	10	0.35671	T	0.21	.	19.4308	0.94765	0.0:0.0:1.0:0.0	.	208;508	E9PFX6;O75912	.;DGKI_HUMAN	T	208;456;508;508;508	ENSP00000392161:P208T;ENSP00000288490:P508T;ENSP00000399131:P508T	ENSP00000288490:P508T	P	-	1	0	DGKI	136920536	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	3.765000	0.55272	2.885000	0.99019	0.655000	0.94253	CCC		0.483	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341286.3	NM_004717		49	79	1	0	1.38658e-30	0.01441	2.13972e-30	49	79				
UBN2	254048	broad.mit.edu	37	7	138954223	138954223	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr7:138954223A>G	ENST00000473989.3	+	8	1550	c.1550A>G	c.(1549-1551)aAa>aGa	p.K517R	UBN2_ENST00000288561.8_Missense_Mutation_p.K434R	NM_173569.3	NP_775840.3	Q6ZU65	UBN2_HUMAN	ubinuclein 2	517						extracellular space (GO:0005615)|nucleus (GO:0005634)		p.K434R(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	42						CCATGCAATAAAGAAACACTA	0.393																																							uc011kqr.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1549-1551)AAA>AGA		ubinuclein 2							117.0	105.0	109.0					7																	138954223		1865	4125	5990	SO:0001583	missense	254048							g.chr7:138954223A>G	AK098644	CCDS43655.1, CCDS43655.2	7q34	2008-12-08			ENSG00000157741	ENSG00000157741			21931	protein-coding gene	gene with protein product		613841				19029251	Standard	NM_173569		Approved	FLJ25778, KIAA2030	uc011kqr.2	Q6ZU65	OTTHUMG00000157623	ENST00000473989.3:c.1550A>G	7.37:g.138954223A>G	ENSP00000418648:p.Lys517Arg					UBN2_uc003vuv.2_Missense_Mutation_p.K240R	p.K517R	NM_173569	NP_775840	Q6ZU65	UBN2_HUMAN			8	1550	+			517					A4D1S2|Q2YDY4|Q6P1K0|Q86XN9|Q8N7D1	Missense_Mutation	SNP	ENST00000473989.3	37	c.1550A>G	CCDS43655.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	32|32	5.191723|5.191723	0.94923|0.94923	.|.	.|.	ENSG00000157741|ENSG00000157741	ENST00000483726|ENST00000473989;ENST00000288561	T|T;T	0.53857|0.50813	0.6|0.73;0.73	5.73|5.73	5.73|5.73	0.89815|0.89815	.|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.67887|0.67887	0.2941|0.2941	M|M	0.70842|0.70842	2.15|2.15	0.80722|0.80722	D|D	1|1	.|D	.|0.76494	.|0.999	.|D	.|0.81914	.|0.995	T|T	0.68961|0.68961	-0.5271|-0.5271	8|10	0.72032|0.48119	D|T	0.01|0.1	-11.2585|-11.2585	16.0337|16.0337	0.80603|0.80603	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|517	.|Q6ZU65	.|UBN2_HUMAN	E|R	286|517;434	ENSP00000417846:K286E|ENSP00000418648:K517R;ENSP00000288561:K434R	ENSP00000417846:K286E|ENSP00000288561:K434R	K|K	+|+	1|2	0|0	UBN2|UBN2	138604763|138604763	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.497000|7.497000	0.81536|0.81536	2.189000|2.189000	0.69895|0.69895	0.528000|0.528000	0.53228|0.53228	AAG|AAA		0.393	UBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349272.3	NM_173569		22	99	0	0	0	0.014323	0	22	99				
DENND2A	27147	broad.mit.edu	37	7	140273808	140273808	+	Splice_Site	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr7:140273808G>T	ENST00000275884.6	-	5	1663	c.1246C>A	c.(1246-1248)Cag>Aag	p.Q416K	DENND2A_ENST00000496613.1_Splice_Site_p.Q416K|DENND2A_ENST00000537639.1_Splice_Site_p.Q416K|DENND2A_ENST00000492720.1_Splice_Site_p.Q416K			Q9ULE3	DEN2A_HUMAN	DENN/MADD domain containing 2A	416					positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.Q416K(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(22)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49	Melanoma(164;0.00956)					GACAATGACTGCTGTGAAGGA	0.478																																							uc010lnj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(1)	4						c.(1246-1248)CAG>AAG		DENN/MADD domain containing 2A							105.0	106.0	105.0					7																	140273808		1878	4107	5985	SO:0001630	splice_region_variant	27147							g.chr7:140273808G>T	AB033103	CCDS43659.1	7q34	2012-10-03	2005-08-17	2005-08-17	ENSG00000146966	ENSG00000146966		"""DENN/MADD domain containing"""	22212	protein-coding gene	gene with protein product			"""KIAA1277"""	KIAA1277			Standard	NM_015689		Approved	FAM31D	uc010lnj.3	Q9ULE3	OTTHUMG00000157411	ENST00000275884.6:c.1246-1C>A	7.37:g.140273808G>T						DENND2A_uc011kre.1_RNA|DENND2A_uc010lnk.2_Missense_Mutation_p.Q416K|DENND2A_uc003vvw.2_Missense_Mutation_p.Q416K|DENND2A_uc003vvx.2_Missense_Mutation_p.Q416K	p.Q416K	NM_015689	NP_056504	Q9ULE3	DEN2A_HUMAN			4	1391	-	Melanoma(164;0.00956)		416					C9JUI3|Q1RMD5|Q86XY0	Missense_Mutation	SNP	ENST00000275884.6	37	c.1246C>A	CCDS43659.1	.	.	.	.	.	.	.	.	.	.	G	7.245	0.602003	0.13939	.	.	ENSG00000146966	ENST00000275884;ENST00000537639;ENST00000496613;ENST00000492720;ENST00000475837	T;T;T;T	0.09163	3.73;3.73;3.73;3.01	4.65	3.76	0.43208	.	1.582740	0.03591	N	0.231832	T	0.12263	0.0298	L	0.42245	1.32	0.31943	N	0.610691	P;P	0.46142	0.873;0.791	B;B	0.44044	0.439;0.165	T	0.25572	-1.0128	10	0.02654	T	1	-12.373	9.4122	0.38498	0.1635:0.0:0.8365:0.0	.	416;416	Q9ULE3-2;Q9ULE3	.;DEN2A_HUMAN	K	416;416;416;416;39	ENSP00000275884:Q416K;ENSP00000442245:Q416K;ENSP00000419654:Q416K;ENSP00000419464:Q416K	ENSP00000275884:Q416K	Q	-	1	0	DENND2A	139920277	1.000000	0.71417	0.037000	0.18230	0.641000	0.38312	3.473000	0.53122	1.303000	0.44873	0.313000	0.20887	CAG		0.478	DENND2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348742.1	NM_015689	Missense_Mutation	120	153	1	0	1.93806e-58	0.01441	3.28628e-58	120	153				
EPHB6	2051	broad.mit.edu	37	7	142568375	142568375	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr7:142568375A>T	ENST00000392957.2	+	19	3681	c.2894A>T	c.(2893-2895)tAc>tTc	p.Y965F	EPHB6_ENST00000476059.1_3'UTR|EPHB6_ENST00000411471.2_Missense_Mutation_p.Y688F|EPHB6_ENST00000442129.1_Missense_Mutation_p.Y965F	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	965	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)	p.Y950F(1)		NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					CTGGAGTGCTACCAGGACAAC	0.587																																							uc011kst.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(8)|large_intestine(4)|central_nervous_system(3)|stomach(1)|skin(1)|ovary(1)|pancreas(1)	19						c.(2893-2895)TAC>TTC		ephrin receptor EphB6 precursor							92.0	94.0	93.0					7																	142568375		2203	4300	6503	SO:0001583	missense	2051					extracellular region|integral to plasma membrane	ATP binding|ephrin receptor activity	g.chr7:142568375A>T	D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	ENST00000392957.2:c.2894A>T	7.37:g.142568375A>T	ENSP00000376684:p.Tyr965Phe					EPHB6_uc011ksu.1_Missense_Mutation_p.Y965F|EPHB6_uc003wbs.2_Missense_Mutation_p.Y673F|EPHB6_uc003wbt.2_Missense_Mutation_p.Y439F|EPHB6_uc003wbu.2_Missense_Mutation_p.Y673F|EPHB6_uc003wbv.2_Missense_Mutation_p.Y349F	p.Y965F	NM_004445	NP_004436	O15197	EPHB6_HUMAN			19	3681	+	Melanoma(164;0.059)		965			SAM.|Cytoplasmic (Potential).		A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	Missense_Mutation	SNP	ENST00000392957.2	37	c.2894A>T	CCDS5873.2	.	.	.	.	.	.	.	.	.	.	A	26.7	4.759693	0.89932	.	.	ENSG00000106123	ENST00000392957;ENST00000442129;ENST00000411471	T;T;T	0.20069	2.1;2.1;2.1	5.23	5.23	0.72850	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 2 (1);	0.000000	0.41823	D	0.000805	T	0.53916	0.1826	M	0.89658	3.05	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	T	0.64588	-0.6372	10	0.87932	D	0	.	14.3012	0.66355	1.0:0.0:0.0:0.0	.	965;688	O15197;O15197-2	EPHB6_HUMAN;.	F	965;965;688	ENSP00000376684:Y965F;ENSP00000410789:Y965F;ENSP00000409061:Y688F	ENSP00000376684:Y965F	Y	+	2	0	EPHB6	142278497	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.291000	0.78721	1.959000	0.56917	0.533000	0.62120	TAC		0.587	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341329.1			56	209	0	0	0	0.01441	0	56	209				
TRPV5	56302	broad.mit.edu	37	7	142627208	142627208	+	Silent	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr7:142627208C>A	ENST00000265310.1	-	3	642	c.294G>T	c.(292-294)ctG>ctT	p.L98L	TRPV5_ENST00000442623.1_Silent_p.L98L	NM_019841.4	NP_062815.2	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel, subfamily V, member 5	98					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|ion transmembrane transport (GO:0034220)|protein tetramerization (GO:0051262)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.L98L(1)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(14)|lung(32)|ovary(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	67	Melanoma(164;0.059)					CAGCCTCCATCAGCACCAAGG	0.547																																							uc003wby.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|central_nervous_system(2)|skin(1)	6						c.(292-294)CTG>CTT		transient receptor potential cation channel,							79.0	78.0	78.0					7																	142627208		2203	4300	6503	SO:0001819	synonymous_variant	56302				protein tetramerization	apical plasma membrane|integral to plasma membrane	calcium channel activity	g.chr7:142627208C>A	AJ271207	CCDS5875.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000127412	ENSG00000127412		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	3145	protein-coding gene	gene with protein product		606679	"""epithelial calcium channel 1"""	ECAC1		10944439, 10945469, 16382100	Standard	NM_019841		Approved	CaT2	uc003wby.1	Q9NQA5	OTTHUMG00000157157	ENST00000265310.1:c.294G>T	7.37:g.142627208C>A						TRPV5_uc003wbz.2_Silent_p.L98L	p.L98L	NM_019841	NP_062815	Q9NQA5	TRPV5_HUMAN			3	558	-	Melanoma(164;0.059)		98			Cytoplasmic (Potential).|ANK 2.		A4D2H7|E9PBZ6|Q8N4C1|Q8NDW5|Q8NDX7|Q8NDX8|Q96PM6	Silent	SNP	ENST00000265310.1	37	c.294G>T	CCDS5875.1																																																																																				0.547	TRPV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347660.1	NM_019841		48	71	1	0	6.26901e-30	0.01441	9.60502e-30	48	71				
CASP2	835	broad.mit.edu	37	7	142988654	142988654	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr7:142988654G>T	ENST00000310447.5	+	2	337	c.96G>T	c.(94-96)atG>atT	p.M32I	RN7SL535P_ENST00000479087.2_RNA|CASP2_ENST00000392925.2_Missense_Mutation_p.M32I|CASP2_ENST00000493642.1_3'UTR	NM_032982.3|NM_032983.3	NP_116764.2|NP_116765.2	P42575	CASP2_HUMAN	caspase 2, apoptosis-related cysteine peptidase	32	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				aging (GO:0007568)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|brain development (GO:0007420)|cellular response to mechanical stimulus (GO:0071260)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|ectopic germ cell programmed cell death (GO:0035234)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|luteolysis (GO:0001554)|neural retina development (GO:0003407)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of neuron apoptotic process (GO:0043525)|protein processing (GO:0016485)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)	p.M32I(1)		endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)	21	Melanoma(164;0.059)					TGTGTGGCATGCATCCTCATC	0.443																																							uc003wco.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|ovary(1)	3						c.(94-96)ATG>ATT		caspase 2 isoform 1 preproprotein							147.0	147.0	147.0					7																	142988654		2203	4300	6503	SO:0001583	missense	835				apoptosis|cellular response to mechanical stimulus|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|protein maturation by peptide bond cleavage	cytosol	cysteine-type endopeptidase activity|enzyme binding|protein binding|protein domain specific binding	g.chr7:142988654G>T	AK096245, BC002427, BM998653, BX537669, CB988674, U13021	CCDS5879.1, CCDS47733.1	7q34-q35	2014-01-20	2008-08-01		ENSG00000106144	ENSG00000106144		"""Caspases"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1503	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 57"""	600639	"""neural precursor cell expressed, developmentally down-regulated 2"""	NEDD2		7789948, 8780721	Standard	NM_032982		Approved	ICH1, PPP1R57, MGC2181	uc003wco.3	P42575	OTTHUMG00000023641	ENST00000310447.5:c.96G>T	7.37:g.142988654G>T	ENSP00000312664:p.Met32Ile					CASP2_uc003wcp.2_Missense_Mutation_p.M32I|CASP2_uc011kta.1_5'UTR|CASP2_uc003wcq.2_RNA	p.M32I	NM_032982	NP_116764	P42575	CASP2_HUMAN			2	243	+	Melanoma(164;0.059)		32			CARD.		A8K5F9|D3DXD6|E9PDN0|P42576|Q59F21|Q7KZL6|Q86UJ3|Q9BUP7|Q9BZK9|Q9BZL0	Missense_Mutation	SNP	ENST00000310447.5	37	c.96G>T	CCDS5879.1	.	.	.	.	.	.	.	.	.	.	g	27.6	4.847476	0.91277	.	.	ENSG00000106144	ENST00000310447;ENST00000392925;ENST00000392923	T;T	0.57752	0.38;0.38	5.82	5.82	0.92795	DEATH-like (2);Caspase Recruitment (2);	0.000000	0.85682	D	0.000000	T	0.79482	0.4453	M	0.92367	3.3	0.80722	D	1	D;D	0.76494	0.993;0.999	D;D	0.78314	0.968;0.991	D	0.83916	0.0298	10	0.87932	D	0	.	17.0624	0.86550	0.0:0.0:1.0:0.0	.	32;32	E9PDN0;P42575	.;CASP2_HUMAN	I	32;32;1	ENSP00000312664:M32I;ENSP00000376656:M32I	ENSP00000312664:M32I	M	+	3	0	CASP2	142698776	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.016000	0.76393	2.764000	0.94973	0.650000	0.86243	ATG		0.443	CASP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059962.3	NM_032982		76	139	1	0	4.20717e-43	0.01441	6.91523e-43	76	139				
CLCN1	1180	broad.mit.edu	37	7	143039535	143039535	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr7:143039535G>T	ENST00000343257.2	+	16	1954	c.1867G>T	c.(1867-1869)Ggg>Tgg	p.G623W		NM_000083.2	NP_000074	P35523	CLCN1_HUMAN	chloride channel, voltage-sensitive 1	623	CBS 1. {ECO:0000255|PROSITE- ProRule:PRU00703}.				chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|neuronal action potential propagation (GO:0019227)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	adenyl nucleotide binding (GO:0030554)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)	p.G623W(1)		breast(4)|central_nervous_system(1)|endometrium(1)|large_intestine(11)|lung(26)|ovary(3)|prostate(2)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	58	Melanoma(164;0.205)					TTACACATATGGGGAGTTGCG	0.478																																							uc003wcr.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5						c.(1867-1869)GGG>TGG		chloride channel 1, skeletal muscle							169.0	133.0	145.0					7																	143039535		2203	4300	6503	SO:0001583	missense	1180				muscle contraction	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity	g.chr7:143039535G>T	Z25884	CCDS5881.1	7q12	2012-09-26	2012-02-23		ENSG00000188037	ENSG00000188037		"""Ion channels / Chloride channels : Voltage-sensitive"""	2019	protein-coding gene	gene with protein product	"""Thomsen disease, autosomal dominant"""	118425	"""chloride channel 1, skeletal muscle"""			1379744	Standard	NM_000083		Approved	CLC1, ClC-1	uc003wcr.1	P35523	OTTHUMG00000152695	ENST00000343257.2:c.1867G>T	7.37:g.143039535G>T	ENSP00000339867:p.Gly623Trp					CLCN1_uc011ktc.1_Missense_Mutation_p.G235W	p.G623W	NM_000083	NP_000074	P35523	CLCN1_HUMAN			16	1954	+	Melanoma(164;0.205)		623			CBS 1.|Cytoplasmic (By similarity).		A4D2H5|Q2M202	Missense_Mutation	SNP	ENST00000343257.2	37	c.1867G>T	CCDS5881.1	.	.	.	.	.	.	.	.	.	.	G	17.23	3.336999	0.60963	.	.	ENSG00000188037	ENST00000343257	T	0.78707	-1.2	5.82	2.98	0.34508	Cystathionine beta-synthase, core (2);	0.221994	0.46442	D	0.000291	D	0.83589	0.5287	M	0.67700	2.07	0.47341	D	0.999395	D	0.69078	0.997	D	0.69654	0.965	T	0.82957	-0.0199	10	0.72032	D	0.01	.	8.3336	0.32202	0.1696:0.2057:0.6247:0.0	.	623	P35523	CLCN1_HUMAN	W	623	ENSP00000339867:G623W	ENSP00000339867:G623W	G	+	1	0	CLCN1	142749657	0.960000	0.32886	0.340000	0.25575	0.989000	0.77384	1.996000	0.40776	0.813000	0.34350	0.643000	0.83706	GGG		0.478	CLCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327420.1	NM_000083		13	70	1	0	4.3838e-07	0.016723	5.00173e-07	13	70				
CLCN1	1180	broad.mit.edu	37	7	143039586	143039586	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr7:143039586G>T	ENST00000343257.2	+	16	2005	c.1918G>T	c.(1918-1920)Gtt>Ttt	p.V640F		NM_000083.2	NP_000074	P35523	CLCN1_HUMAN	chloride channel, voltage-sensitive 1	640	CBS 1. {ECO:0000255|PROSITE- ProRule:PRU00703}.				chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|neuronal action potential propagation (GO:0019227)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	adenyl nucleotide binding (GO:0030554)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)	p.V640F(1)		breast(4)|central_nervous_system(1)|endometrium(1)|large_intestine(11)|lung(26)|ovary(3)|prostate(2)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	58	Melanoma(164;0.205)					TTTACCACTGGTTGACTCAAA	0.507																																							uc003wcr.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5						c.(1918-1920)GTT>TTT		chloride channel 1, skeletal muscle							104.0	86.0	92.0					7																	143039586		2203	4300	6503	SO:0001583	missense	1180				muscle contraction	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity	g.chr7:143039586G>T	Z25884	CCDS5881.1	7q12	2012-09-26	2012-02-23		ENSG00000188037	ENSG00000188037		"""Ion channels / Chloride channels : Voltage-sensitive"""	2019	protein-coding gene	gene with protein product	"""Thomsen disease, autosomal dominant"""	118425	"""chloride channel 1, skeletal muscle"""			1379744	Standard	NM_000083		Approved	CLC1, ClC-1	uc003wcr.1	P35523	OTTHUMG00000152695	ENST00000343257.2:c.1918G>T	7.37:g.143039586G>T	ENSP00000339867:p.Val640Phe					CLCN1_uc011ktc.1_Missense_Mutation_p.V252F	p.V640F	NM_000083	NP_000074	P35523	CLCN1_HUMAN			16	2005	+	Melanoma(164;0.205)		640			CBS 1.|Cytoplasmic (By similarity).		A4D2H5|Q2M202	Missense_Mutation	SNP	ENST00000343257.2	37	c.1918G>T	CCDS5881.1	.	.	.	.	.	.	.	.	.	.	G	31	5.090506	0.94149	.	.	ENSG00000188037	ENST00000343257	D	0.86865	-2.18	5.82	5.82	0.92795	Cystathionine beta-synthase, core (2);	0.000000	0.85682	D	0.000000	D	0.96043	0.8711	H	0.95884	3.735	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.96738	0.9544	10	0.87932	D	0	.	20.0939	0.97831	0.0:0.0:1.0:0.0	.	640	P35523	CLCN1_HUMAN	F	640	ENSP00000339867:V640F	ENSP00000339867:V640F	V	+	1	0	CLCN1	142749708	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	9.747000	0.98863	2.756000	0.94617	0.643000	0.83706	GTT		0.507	CLCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327420.1	NM_000083		22	40	1	0	3.73148e-12	0.007291	4.66707e-12	22	40				
FAM131B	9715	broad.mit.edu	37	7	143053910	143053910	+	Silent	SNP	G	G	A	rs201753321		TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr7:143053910G>A	ENST00000409408.1	-	6	2440	c.732C>T	c.(730-732)taC>taT	p.Y244Y	FAM131B_ENST00000409346.1_Silent_p.Y244Y|FAM131B_ENST00000409578.1_Silent_p.Y260Y|FAM131B_ENST00000409222.3_Silent_p.Y244Y|FAM131B_ENST00000443739.2_Silent_p.Y272Y			Q86XD5	F131B_HUMAN	family with sequence similarity 131, member B	244								p.Y272Y(1)|p.Y244Y(1)		breast(1)|endometrium(4)|large_intestine(3)|lung(13)|ovary(1)|skin(2)	24	Melanoma(164;0.205)					CCAGAGCAGAGTATCCTGAAG	0.592																																							uc003wct.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(730-732)TAC>TAT		hypothetical protein LOC9715 isoform b							84.0	87.0	86.0					7																	143053910		2203	4300	6503	SO:0001819	synonymous_variant	9715							g.chr7:143053910G>A	BC045611	CCDS5882.1, CCDS47734.1	7q34	2007-03-20			ENSG00000159784	ENSG00000159784			22202	protein-coding gene	gene with protein product							Standard	NM_014690		Approved	KIAA0773	uc010lpa.3	Q86XD5	OTTHUMG00000152697	ENST00000409408.1:c.732C>T	7.37:g.143053910G>A						FAM131B_uc010loz.2_Silent_p.Y212Y|FAM131B_uc003wcu.3_Silent_p.Y244Y|FAM131B_uc010lpa.2_Silent_p.Y272Y	p.Y244Y	NM_014690	NP_055505	Q86XD5	F131B_HUMAN			6	2438	-	Melanoma(164;0.205)		244					A4D2H6|A6NDW3|A8K605|B8ZZN2|D3DXE3|J3KQX2|Q7L0D6|Q86T97	Silent	SNP	ENST00000409408.1	37	c.732C>T	CCDS5882.1																																																																																				0.592	FAM131B-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328057.1	NM_014690		44	214	0	0	0	0.01441	0	44	214				
FAM131B	9715	broad.mit.edu	37	7	143056061	143056061	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr7:143056061G>C	ENST00000409408.1	-	4	1949	c.241C>G	c.(241-243)Cgg>Ggg	p.R81G	FAM131B_ENST00000409346.1_Missense_Mutation_p.R81G|FAM131B_ENST00000409578.1_Missense_Mutation_p.R97G|FAM131B_ENST00000409222.3_Missense_Mutation_p.R81G|FAM131B_ENST00000443739.2_Missense_Mutation_p.R109G			Q86XD5	F131B_HUMAN	family with sequence similarity 131, member B	81								p.R109G(1)|p.R81G(1)		breast(1)|endometrium(4)|large_intestine(3)|lung(13)|ovary(1)|skin(2)	24	Melanoma(164;0.205)					TGGGCCACCCGGCCTTGCCCC	0.577																																							uc003wct.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(241-243)CGG>GGG		hypothetical protein LOC9715 isoform b							81.0	61.0	68.0					7																	143056061		2203	4300	6503	SO:0001583	missense	9715							g.chr7:143056061G>C	BC045611	CCDS5882.1, CCDS47734.1	7q34	2007-03-20			ENSG00000159784	ENSG00000159784			22202	protein-coding gene	gene with protein product							Standard	NM_014690		Approved	KIAA0773	uc010lpa.3	Q86XD5	OTTHUMG00000152697	ENST00000409408.1:c.241C>G	7.37:g.143056061G>C	ENSP00000387017:p.Arg81Gly					FAM131B_uc010loz.2_Missense_Mutation_p.R49G|FAM131B_uc003wcu.3_Missense_Mutation_p.R81G|FAM131B_uc010lpa.2_Missense_Mutation_p.R109G|ZYX_uc011ktd.1_5'Flank	p.R81G	NM_014690	NP_055505	Q86XD5	F131B_HUMAN			4	1947	-	Melanoma(164;0.205)		81					A4D2H6|A6NDW3|A8K605|B8ZZN2|D3DXE3|J3KQX2|Q7L0D6|Q86T97	Missense_Mutation	SNP	ENST00000409408.1	37	c.241C>G	CCDS5882.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.973534	0.92919	.	.	ENSG00000159784	ENST00000443739;ENST00000409578;ENST00000409346;ENST00000452076;ENST00000409408;ENST00000409222	T;T;T;T;T	0.43688	0.94;0.94;0.94;0.94;0.94	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.66858	0.2832	M	0.74647	2.275	0.80722	D	1	D;P	0.89917	1.0;0.946	D;P	0.85130	0.997;0.69	T	0.70854	-0.4759	10	0.87932	D	0	-25.9001	18.8528	0.92240	0.0:0.0:1.0:0.0	.	97;81	Q86XD5-2;Q86XD5	.;F131B_HUMAN	G	109;97;81;85;81;81	ENSP00000410603:R109G;ENSP00000386568:R97G;ENSP00000386984:R81G;ENSP00000387017:R81G;ENSP00000387147:R81G	ENSP00000387147:R81G	R	-	1	2	FAM131B	142766183	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.511000	0.81718	2.442000	0.82660	0.561000	0.74099	CGG		0.577	FAM131B-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328057.1	NM_014690		18	29	0	0	0	0.004656	0	18	29				
FAM115A	9747	broad.mit.edu	37	7	143573331	143573331	+	Missense_Mutation	SNP	A	A	G			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr7:143573331A>G	ENST00000479870.1	-	2	579	c.371T>C	c.(370-372)gTt>gCt	p.V124A	FAM115A_ENST00000392900.3_Intron|FAM115A_ENST00000355951.2_Missense_Mutation_p.V124A	NM_001206938.1|NM_001206941.1|NM_014719.2	NP_001193867.1|NP_001193870.1|NP_055534	Q9Y4C2	F115A_HUMAN	family with sequence similarity 115, member A	124								p.V124A(1)		NS(1)|endometrium(1)|lung(5)	7	Melanoma(164;0.0903)					AATACAGTAAACCCCCAGGGA	0.512																																							uc003wdo.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(370-372)GTT>GCT		hypothetical protein LOC9747							90.0	97.0	95.0					7																	143573331		2203	4300	6503	SO:0001583	missense	9747							g.chr7:143573331A>G	AB018281	CCDS5886.1, CCDS56514.1	7q35	2011-05-03	2006-03-23	2006-03-23	ENSG00000198420	ENSG00000198420			22201	protein-coding gene	gene with protein product						9872452	Standard	NM_014719		Approved	KIAA0738	uc003wdo.2	Q9Y4C2	OTTHUMG00000157773	ENST00000479870.1:c.371T>C	7.37:g.143573331A>G	ENSP00000419235:p.Val124Ala					FAM115A_uc011ktu.1_Intron|FAM115A_uc003wdp.1_Missense_Mutation_p.V124A	p.V124A	NM_014719	NP_055534	Q9Y4C2	F115A_HUMAN			2	504	-	Melanoma(164;0.0903)		124					A8K6E0|Q75KM8|Q75KM9|Q7L665|Q9BW63	Missense_Mutation	SNP	ENST00000479870.1	37	c.371T>C	CCDS5886.1	.	.	.	.	.	.	.	.	.	.	A	17.24	3.339817	0.60963	.	.	ENSG00000198420	ENST00000479870;ENST00000355951;ENST00000460532;ENST00000491908;ENST00000478172	T;T;T;T;T	0.38722	1.12;1.12;1.12;1.12;1.12	4.2	4.2	0.49525	.	0.064560	0.64402	D	0.000010	T	0.54013	0.1832	M	0.90650	3.135	0.38387	D	0.9453	P	0.51351	0.944	P	0.45037	0.467	T	0.69807	-0.5045	10	0.87932	D	0	-15.6344	11.8747	0.52539	1.0:0.0:0.0:0.0	.	124	Q9Y4C2	F115A_HUMAN	A	124	ENSP00000419235:V124A;ENSP00000348220:V124A;ENSP00000420607:V124A;ENSP00000417600:V124A;ENSP00000419622:V124A	ENSP00000348220:V124A	V	-	2	0	FAM115A	143204264	1.000000	0.71417	0.996000	0.52242	0.873000	0.50193	8.416000	0.90244	2.125000	0.65367	0.528000	0.53228	GTT		0.512	FAM115A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349583.1	NM_014719		68	132	0	0	0	0.01441	0	68	132				
POLB	5423	broad.mit.edu	37	8	42213036	42213036	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr8:42213036C>T	ENST00000265421.4	+	7	543	c.373C>T	c.(373-375)Ctc>Ttc	p.L125F	POLB_ENST00000538005.1_5'UTR	NM_002690.2	NP_002681.1	P06746	DPOLB_HUMAN	polymerase (DNA directed), beta	125					base-excision repair (GO:0006284)|base-excision repair, gap-filling (GO:0006287)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|DNA-dependent DNA replication (GO:0006261)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|neuron apoptotic process (GO:0051402)|pyrimidine dimer repair (GO:0006290)|response to ethanol (GO:0045471)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|enzyme binding (GO:0019899)|lyase activity (GO:0016829)|metal ion binding (GO:0046872)|microtubule binding (GO:0008017)	p.L125F(2)		breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(5)|ovary(1)	16	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;2.58e-12)|Lung NSC(13;4.24e-11)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.1)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;3.18e-11)|Lung(22;0.00467)|OV - Ovarian serous cystadenocarcinoma(14;0.00523)|LUSC - Lung squamous cell carcinoma(45;0.024)		Cytarabine(DB00987)	CTATACAGATCTCAGAAAAAA	0.318								DNA polymerases (catalytic subunits)																															uc003xoz.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|breast(1)	2						c.(373-375)CTC>TTC	DNA_polymerases_(catalytic_subunits)	DNA-directed DNA polymerase beta	Cytarabine(DB00987)						66.0	71.0	69.0					8																	42213036		2203	4297	6500	SO:0001583	missense	5423				DNA-dependent DNA replication	cytoplasm|nucleoplasm|spindle microtubule	DNA-(apurinic or apyrimidinic site) lyase activity|DNA-directed DNA polymerase activity|enzyme binding|metal ion binding|microtubule binding	g.chr8:42213036C>T		CCDS6129.1	8p12-p11	2012-10-02			ENSG00000070501	ENSG00000070501	2.7.7.7	"""DNA polymerases"""	9174	protein-coding gene	gene with protein product		174760					Standard	NM_002690		Approved		uc003xoz.2	P06746	OTTHUMG00000164093	ENST00000265421.4:c.373C>T	8.37:g.42213036C>T	ENSP00000265421:p.Leu125Phe					POLB_uc003xpa.1_Missense_Mutation_p.L125F|POLB_uc011lcs.1_5'UTR	p.L125F	NM_002690	NP_002681	P06746	DPOLB_HUMAN	BRCA - Breast invasive adenocarcinoma(8;3.18e-11)|Lung(22;0.00467)|OV - Ovarian serous cystadenocarcinoma(14;0.00523)|LUSC - Lung squamous cell carcinoma(45;0.024)		7	486	+	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;2.58e-12)|Lung NSC(13;4.24e-11)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.1)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	125					B2RC78|Q3KP48|Q6FI34	Missense_Mutation	SNP	ENST00000265421.4	37	c.373C>T	CCDS6129.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.3|20.3	3.963507|3.963507	0.74016|0.74016	.|.	.|.	ENSG00000070501|ENSG00000070501	ENST00000532157;ENST00000265421;ENST00000518925|ENST00000521290	T;T;T|.	0.63744|.	-0.06;-0.06;1.91|.	5.3|5.3	5.3|5.3	0.74995|0.74995	DNA-directed DNA polymerase X (1);DNA polymerase lambda, fingers domain (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.86867|0.86867	0.6036|0.6036	H|H	0.94925|0.94925	3.6|3.6	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	D|D	0.90303|0.90303	0.4331|0.4331	10|5	0.87932|.	D|.	0|.	-2.2952|-2.2952	16.7986|16.7986	0.85609|0.85609	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	125;125|.	Q53EV2;P06746|.	.;DPOLB_HUMAN|.	F|F	11;125;160|55	ENSP00000432084:L11F;ENSP00000265421:L125F;ENSP00000430784:L160F|.	ENSP00000265421:L125F|.	L|S	+|+	1|2	0|0	POLB|POLB	42332193|42332193	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.972000|0.972000	0.66771|0.66771	2.324000|2.324000	0.43831|0.43831	2.620000|2.620000	0.88729|0.88729	0.655000|0.655000	0.94253|0.94253	CTC|TCT		0.318	POLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377242.1	NM_002690		39	52	0	0	0	0.009718	0	39	52				
SPIDR	23514	broad.mit.edu	37	8	48309166	48309166	+	Silent	SNP	A	A	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr8:48309166A>T	ENST00000297423.4	+	6	1140	c.756A>T	c.(754-756)tcA>tcT	p.S252S	SPIDR_ENST00000518074.1_Silent_p.S192S|SPIDR_ENST00000541342.1_Silent_p.S182S|SPIDR_ENST00000521214.1_3'UTR	NM_001080394.2|NM_001282916.1	NP_001073863.1|NP_001269845.1	Q14159	SPIDR_HUMAN	scaffolding protein involved in DNA repair	252	Necessary for interaction with RAD51.				cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of protein complex assembly (GO:0031334)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of establishment of protein localization to chromosome (GO:0070202)	nuclear chromosome (GO:0000228)		p.S252S(1)									CAGAAAATTCAGCAAAGAAGA	0.313																																							uc003xqd.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(754-756)TCA>TCT		hypothetical protein LOC23514							134.0	134.0	134.0					8																	48309166		1799	4069	5868	SO:0001819	synonymous_variant	23514							g.chr8:48309166A>T	AK055680	CCDS43737.1, CCDS64890.1, CCDS64891.1	8q11.21	2013-07-02	2013-07-02	2013-07-02	ENSG00000164808	ENSG00000164808			28971	protein-coding gene	gene with protein product		615384	"""KIAA0146"""	KIAA0146		8590280, 23509288	Standard	XM_005251189		Approved		uc003xqd.3	Q14159	OTTHUMG00000164176	ENST00000297423.4:c.756A>T	8.37:g.48309166A>T						KIAA0146_uc011lcz.1_Intron|KIAA0146_uc011lda.1_Intron|KIAA0146_uc011ldb.1_Silent_p.S252S|KIAA0146_uc010lxs.2_5'UTR|KIAA0146_uc011ldc.1_Silent_p.S182S|KIAA0146_uc011ldd.1_Silent_p.S192S|KIAA0146_uc003xqe.2_Intron|KIAA0146_uc003xqf.2_RNA|KIAA0146_uc011lde.1_Intron	p.S252S	NM_001080394	NP_001073863	Q14159	K0146_HUMAN			6	765	+		Lung NSC(58;0.175)	252					B4DFV2|B4E0Y6|Q96BI5	Silent	SNP	ENST00000297423.4	37	c.756A>T	CCDS43737.1																																																																																				0.313	SPIDR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377611.1	NM_001080394		59	262	0	0	0	0.01441	0	59	262				
CHD7	55636	broad.mit.edu	37	8	61769148	61769149	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr8:61769148_61769149GG>TT	ENST00000423902.2	+	34	7788_7789	c.7309_7310GG>TT	c.(7309-7311)GGa>TTa	p.G2437L	CHD7_ENST00000524602.1_Intron|CHD7_ENST00000529472.1_3'UTR	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	2437					adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.G2437L(2)		NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			CTCAGAAAATGGACAAGAAAAA	0.426																																							uc003xue.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9						c.(7309-7311)GGA>TTA		chromodomain helicase DNA binding protein 7																																				SO:0001583	missense	55636				central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity	g.chr8:61769148_61769149GG>TT	AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		Exception_encountered	8.37:g.61769148_61769149delinsTT	ENSP00000392028:p.Gly2437Leu						p.G2437L	NM_017780	NP_060250	Q9P2D1	CHD7_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.143)		34	7786_7787	+		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	2437					D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Missense_Mutation	DNP	ENST00000423902.2	37	c.7309_7310GG>TT	CCDS47865.1																																																																																				0.426	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383468.2	XM_098762		47	37	0	0	0	0.004672	0	47	37				
NECAB1	64168	broad.mit.edu	37	8	91937876	91937876	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr8:91937876G>A	ENST00000417640.2	+	7	945	c.608G>A	c.(607-609)aGc>aAc	p.S203N		NM_022351.4	NP_071746.1	Q8N987	NECA1_HUMAN	N-terminal EF-hand calcium binding protein 1	203						cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.S203N(1)		breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(7)	12			BRCA - Breast invasive adenocarcinoma(11;0.0499)			TTTAATGTCAGCGGTCCAGGT	0.408																																							uc011lgg.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(607-609)AGC>AAC		N-terminal EF-hand calcium binding protein 1							73.0	77.0	76.0					8																	91937876		1990	4153	6143	SO:0001583	missense	64168				antibiotic biosynthetic process	cytoplasm	calcium ion binding|oxidoreductase activity	g.chr8:91937876G>A	AF414126	CCDS47889.1	8q21.3	2013-01-10	2007-12-06	2007-12-06	ENSG00000123119	ENSG00000123119		"""N-terminal EF-hand calcium binding proteins"", ""EF-hand domain containing"""	20983	protein-coding gene	gene with protein product			"""EF-hand calcium binding protein 1"""	EFCBP1			Standard	NM_022351		Approved		uc011lgg.2	Q8N987	OTTHUMG00000164009	ENST00000417640.2:c.608G>A	8.37:g.91937876G>A	ENSP00000387380:p.Ser203Asn						p.S203N	NM_022351	NP_071746	Q8N987	NECA1_HUMAN	BRCA - Breast invasive adenocarcinoma(11;0.0499)		7	802	+			203					Q6NUS7|Q96AZ7|Q9HBW8	Missense_Mutation	SNP	ENST00000417640.2	37	c.608G>A	CCDS47889.1	.	.	.	.	.	.	.	.	.	.	G	9.413	1.080969	0.20309	.	.	ENSG00000123119	ENST00000417640	T	0.18960	2.18	5.4	3.55	0.40652	.	0.924105	0.09540	N	0.788446	T	0.18299	0.0439	L	0.43923	1.385	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.27606	-1.0069	10	0.33940	T	0.23	-17.6064	7.1021	0.25343	0.2902:0.0:0.7098:0.0	.	203	Q8N987	NECA1_HUMAN	N	203	ENSP00000387380:S203N	ENSP00000387380:S203N	S	+	2	0	NECAB1	92007052	0.012000	0.17670	0.001000	0.08648	0.502000	0.33828	1.922000	0.40045	0.602000	0.29896	0.561000	0.74099	AGC		0.408	NECAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376728.1	NM_022351		14	13	0	0	0	0.00499	0	14	13				
GDF6	392255	broad.mit.edu	37	8	97172982	97172982	+	De_novo_Start_OutOfFrame	SNP	C	C	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr8:97172982C>T	ENST00000287020.5	-	0	38					NM_001001557.2	NP_001001557.1	Q6KF10	GDF6_HUMAN	growth differentiation factor 6						activin receptor signaling pathway (GO:0032924)|apoptotic process (GO:0006915)|BMP signaling pathway (GO:0030509)|growth (GO:0040007)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription, DNA-templated (GO:0045893)|retinal cell apoptotic process (GO:1990009)	extracellular space (GO:0005615)				breast(2)|cervix(1)|endometrium(1)|large_intestine(5)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	27	Breast(36;2.67e-05)					GCGCGGGGCACGGAGCGGCTG	0.761																																							uc003yhp.2		NA																	0				ovary(1)|breast(1)|pancreas(1)	3						c.(-63--59)CCGTG>CCATG		growth differentiation factor 6 precursor																																						392255				activin receptor signaling pathway|BMP signaling pathway|growth|pathway-restricted SMAD protein phosphorylation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription, DNA-dependent	extracellular space	cytokine activity|growth factor activity	g.chr8:97172982C>T		CCDS34926.1	8q22.1	2014-01-29			ENSG00000156466	ENSG00000156466			4221	protein-coding gene	gene with protein product		601147	"""segmentation syndrome 1"""	SGM1		10022976, 18425797	Standard	NM_001001557		Approved	BMP13, KFS, KFS1	uc003yhp.3	Q6KF10	OTTHUMG00000164710	ENST00000287020.5:c.-62G>A	8.37:g.97172982C>T								NM_001001557	NP_001001557	Q6KF10	GDF6_HUMAN			1	39	-	Breast(36;2.67e-05)							Q6PI58	Translation_Start_Site	SNP	ENST00000287020.5	37	c.-61G>A	CCDS34926.1																																																																																				0.761	GDF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379862.2	NM_001001557		10	15	0	0	0	0.010729	0	10	15				
FAM135B	51059	broad.mit.edu	37	8	139263164	139263164	+	Silent	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr8:139263164G>T	ENST00000395297.1	-	6	632	c.462C>A	c.(460-462)gtC>gtA	p.V154V		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	154								p.V154V(2)		NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			AGTCGAACATGACCGGGACCT	0.592										HNSCC(54;0.14)																													uc003yuy.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(7)|skin(2)	9						c.(460-462)GTC>GTA		hypothetical protein LOC51059							132.0	144.0	140.0					8																	139263164		2098	4217	6315	SO:0001819	synonymous_variant	51059							g.chr8:139263164G>T	AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.462C>A	8.37:g.139263164G>T		HNSCC(54;0.14)				FAM135B_uc003yux.2_Silent_p.V55V|FAM135B_uc003yuz.2_RNA	p.V154V	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0805)		6	633	-	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		154					B5MDB3|O95879|Q2WGJ7|Q3KP46	Silent	SNP	ENST00000395297.1	37	c.462C>A	CCDS6375.2																																																																																				0.592	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912		41	290	1	0	1.07121e-22	0.006999	1.54211e-22	41	290				
COL22A1	169044	broad.mit.edu	37	8	139691882	139691882	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr8:139691882G>C	ENST00000303045.6	-	40	3496	c.3050C>G	c.(3049-3051)gCa>gGa	p.A1017G	COL22A1_ENST00000435777.1_Intron|COL22A1_ENST00000341807.4_Intron	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1017	Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.A1017G(1)		breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CCCTCCCAGTGCACAGTTTTC	0.403										HNSCC(7;0.00092)																													uc003yvd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(11)|pancreas(1)|skin(1)	13						c.(3049-3051)GCA>GGA		collagen, type XXII, alpha 1							173.0	153.0	160.0					8																	139691882		2203	4300	6503	SO:0001583	missense	169044				cell adhesion	collagen|cytoplasm	structural molecule activity	g.chr8:139691882G>C	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.3050C>G	8.37:g.139691882G>C	ENSP00000303153:p.Ala1017Gly	HNSCC(7;0.00092)				COL22A1_uc011ljo.1_Intron	p.A1017G	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0517)		40	3497	-	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		1017			Pro-rich.|Gly-rich.		B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	ENST00000303045.6	37	c.3050C>G	CCDS6376.1	.	.	.	.	.	.	.	.	.	.	G	1.932	-0.445742	0.04604	.	.	ENSG00000169436	ENST00000303045	D	0.93426	-3.22	2.67	0.811	0.18739	.	3.954980	0.02370	U	0.077808	D	0.83792	0.5331	N	0.05351	-0.065	0.09310	N	1	B	0.13145	0.007	B	0.04013	0.001	T	0.73630	-0.3922	10	0.21540	T	0.41	.	3.373	0.07228	0.144:0.0:0.6052:0.2508	.	1017	Q8NFW1	COMA1_HUMAN	G	1017	ENSP00000303153:A1017G	ENSP00000303153:A1017G	A	-	2	0	COL22A1	139761064	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.277000	0.08502	0.179000	0.19938	-0.448000	0.05591	GCA		0.403	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257		3	195	0	0	0	0.009096	0	3	195				
MROH6	642475	broad.mit.edu	37	8	144657383	144657383	+	5'Flank	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr8:144657383C>A	ENST00000398882.3	-	0	0				RP11-661A12.9_ENST00000531730.1_RNA|NAPRT1_ENST00000435154.3_Missense_Mutation_p.R475L|NAPRT1_ENST00000460623.1_Intron|NAPRT1_ENST00000276844.7_Missense_Mutation_p.R475L|NAPRT1_ENST00000426292.3_Intron|NAPRT1_ENST00000449291.2_Missense_Mutation_p.R475L	NM_001100878.1	NP_001094348.1	A6NGR9	MROH6_HUMAN	maestro heat-like repeat family member 6									p.R451L(1)|p.R475L(1)									GAGGCAGAGCCGCAGTAGTGG	0.687																																							uc003yym.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1423-1425)CGG>CTG		nicotinate phosphoribosyltransferase domain							20.0	21.0	21.0					8																	144657383		2190	4296	6486	SO:0001631	upstream_gene_variant	93100				nicotinamide metabolic process|nicotinate nucleotide salvage|response to oxidative stress|water-soluble vitamin metabolic process	cytosol|Golgi apparatus|nucleus	nicotinate phosphoribosyltransferase activity|nicotinate-nucleotide diphosphorylase (carboxylating) activity	g.chr8:144657383C>A	AF289596	CCDS47928.1	8q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000204839	ENSG00000204839		"""maestro heat-like repeat containing"""	27814	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 73"""	C8orf73		12477932	Standard	NM_001100878		Approved		uc010mff.3	A6NGR9	OTTHUMG00000165164		8.37:g.144657383C>A	Exception_encountered					C8orf73_uc010mff.2_5'Flank|C8orf73_uc010mfg.1_5'Flank|NAPRT1_uc003yyn.3_Intron|NAPRT1_uc011lkh.1_Missense_Mutation_p.R475L|NAPRT1_uc003yyo.3_Missense_Mutation_p.R475L	p.R475L	NM_145201	NP_660202	Q6XQN6	PNCB_HUMAN	Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.146)		11	1449	-	all_cancers(97;6.49e-11)|all_epithelial(106;4.73e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.014)|Acute lymphoblastic leukemia(118;0.155)		475					A8MWB1	Missense_Mutation	SNP	ENST00000398882.3	37	c.1424G>T	CCDS47928.1	.	.	.	.	.	.	.	.	.	.	C	7.428	0.638166	0.14386	.	.	ENSG00000147813	ENST00000435154;ENST00000449291;ENST00000340490;ENST00000276844	T;T;T;T	0.44881	0.94;0.93;0.91;0.92	4.75	-0.624	0.11552	Quinolinate phosphoribosyl transferase, C-terminal (1);	0.936953	0.09031	N	0.858770	T	0.29389	0.0732	L	0.42245	1.32	0.09310	N	1	P;B;B	0.50066	0.931;0.117;0.319	B;B;B	0.36092	0.217;0.068;0.07	T	0.17592	-1.0364	10	0.51188	T	0.08	0.7434	8.2543	0.31746	0.0:0.5402:0.0:0.4598	.	475;475;475	C9J8U2;G5E977;Q6XQN6	.;.;PNCB_HUMAN	L	475	ENSP00000405670:R475L;ENSP00000401508:R475L;ENSP00000341136:R475L;ENSP00000276844:R475L	ENSP00000276844:R475L	R	-	2	0	NAPRT1	144728526	0.002000	0.14202	0.012000	0.15200	0.009000	0.06853	-0.160000	0.10041	-0.313000	0.08728	-0.793000	0.03317	CGG		0.687	MROH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382330.3	NM_001100878		6	6	1	0	0.000978159	0.010729	0.00104646	6	6				
IFNA16	3449	broad.mit.edu	37	9	21216810	21216810	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr9:21216810C>A	ENST00000380216.1	-	1	500	c.495G>T	c.(493-495)gaG>gaT	p.E165D		NM_002173.2	NP_002164.1	P05015	IFN16_HUMAN	interferon, alpha 16	165					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)	p.E165D(1)		central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)	13				Lung(24;2.12e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.116)		CTCTGACAACCTCCCAGGCAC	0.408																																							uc003zor.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(493-495)GAG>GAT		interferon, alpha 16 precursor							263.0	254.0	257.0					9																	21216810		2203	4300	6503	SO:0001583	missense	3449				blood coagulation|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|interferon-alpha/beta receptor binding	g.chr9:21216810C>A		CCDS34996.1	9p22	2010-12-10			ENSG00000147885	ENSG00000147885		"""Interferons"""	5421	protein-coding gene	gene with protein product		147580				1385305	Standard	NM_002173		Approved	IFN-alphaO	uc003zor.1	P05015	OTTHUMG00000019663	ENST00000380216.1:c.495G>T	9.37:g.21216810C>A	ENSP00000369564:p.Glu165Asp					IFNA14_uc003zoo.1_Intron	p.E165D	NM_002173	NP_002164	P05015	IFN16_HUMAN		Lung(24;2.12e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.116)	1	501	-			165					Q5VV12	Missense_Mutation	SNP	ENST00000380216.1	37	c.495G>T	CCDS34996.1	.	.	.	.	.	.	.	.	.	.	-	15.58	2.874925	0.51695	.	.	ENSG00000147885	ENST00000380216	T	0.09073	3.02	2.62	-1.69	0.08186	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.000000	0.85682	D	0.000000	T	0.33059	0.0850	H	0.96239	3.79	0.09310	N	0.999997	D	0.89917	1.0	D	0.85130	0.997	T	0.08554	-1.0716	10	0.87932	D	0	.	7.2875	0.26348	0.0:0.5126:0.0:0.4874	.	165	P05015	IFN16_HUMAN	D	165	ENSP00000369564:E165D	ENSP00000369564:E165D	E	-	3	2	IFNA16	21206810	0.001000	0.12720	0.120000	0.21714	0.556000	0.35491	-0.699000	0.05087	-0.307000	0.08804	0.184000	0.17185	GAG		0.408	IFNA16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051892.1	NM_002173		113	161	1	0	4.10022e-50	0.01441	6.87107e-50	113	161				
PGM5	5239	broad.mit.edu	37	9	71002378	71002378	+	Splice_Site	SNP	G	G	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr9:71002378G>A	ENST00000396396.1	+	4	800		c.e4-1		PGM5_ENST00000396392.1_Splice_Site|PGM5_ENST00000604870.2_Splice_Site	NM_021965.3	NP_068800.2	Q15124	PGM5_HUMAN	phosphoglucomutase 5						carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)	cell-cell adherens junction (GO:0005913)|costamere (GO:0043034)|cytoplasmic side of plasma membrane (GO:0009898)|dystrophin-associated glycoprotein complex (GO:0016010)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|sarcolemma (GO:0042383)|spot adherens junction (GO:0005914)|stress fiber (GO:0001725)|Z disc (GO:0030018)	intramolecular transferase activity, phosphotransferases (GO:0016868)|magnesium ion binding (GO:0000287)|structural molecule activity (GO:0005198)	p.?(1)		endometrium(5)|kidney(1)|large_intestine(5)|liver(2)|lung(15)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	34						TCTATCTTTAGTGGAGATAGT	0.408																																							uc004agr.2		NA																	1	Unknown(1)		lung(1)	ovary(1)|pancreas(1)	2						c.e4-1		phosphoglucomutase 5							123.0	122.0	122.0					9																	71002378		2203	4297	6500	SO:0001630	splice_region_variant	5239				cell adhesion|cellular calcium ion homeostasis|glucose metabolic process	costamere|dystrophin-associated glycoprotein complex|focal adhesion|intercalated disc|internal side of plasma membrane|sarcolemma|spot adherens junction|stress fiber|Z disc	intramolecular transferase activity, phosphotransferases|magnesium ion binding|structural molecule activity	g.chr9:71002378G>A	L40933	CCDS6622.2	9q13	2008-02-05			ENSG00000154330	ENSG00000154330			8908	protein-coding gene	gene with protein product	"""phosphoglucomutase-related protein"""	600981				8586438, 8631316	Standard	NM_021965		Approved	PGMRP	uc004agr.3	Q15124	OTTHUMG00000019966	ENST00000396396.1:c.572-1G>A	9.37:g.71002378G>A							p.V191_splice	NM_021965	NP_068800	Q15124	PGM5_HUMAN			4	801	+								B1AM46|B4DLQ6|Q5VYV3|Q8N527|Q9UDH4	Splice_Site	SNP	ENST00000396396.1	37	c.572_splice	CCDS6622.2	.	.	.	.	.	.	.	.	.	.	g	23.1	4.372865	0.82573	.	.	ENSG00000154330	ENST00000396396;ENST00000396392;ENST00000377314;ENST00000431583	.	.	.	5.16	5.16	0.70880	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.4863	0.87689	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PGM5	70192198	1.000000	0.71417	0.997000	0.53966	0.979000	0.70002	9.550000	0.98110	2.400000	0.81607	0.567000	0.79289	.		0.408	PGM5-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052548.2	NM_021965	Intron	27	109	0	0	0	0.009535	0	27	109				
TJP2	9414	broad.mit.edu	37	9	71869204	71869204	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr9:71869204G>T	ENST00000377245.4	+	23	3695	c.3487G>T	c.(3487-3489)Gag>Tag	p.E1163*	TJP2_ENST00000535702.1_Nonsense_Mutation_p.E1130*|TJP2_ENST00000453658.2_Nonsense_Mutation_p.E993*|TJP2_ENST00000348208.4_Nonsense_Mutation_p.E1016*|TJP2_ENST00000539225.1_Nonsense_Mutation_p.E1194*	NM_004817.3	NP_004808.2	Q9UDY2	ZO2_HUMAN	tight junction protein 2	1163	Poly-Glu.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|hippo signaling (GO:0035329)|nucleotide phosphorylation (GO:0046939)|response to organic substance (GO:0010033)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	guanylate kinase activity (GO:0004385)	p.E1163*(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(5)|lung(9)|prostate(3)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	35						TGATGCCGAGGAGGAGGAGTA	0.522																																							uc004ahe.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(3487-3489)GAG>TAG		tight junction protein 2 (zona occludens 2)							101.0	98.0	99.0					9																	71869204		2203	4300	6503	SO:0001587	stop_gained	9414				cellular component disassembly involved in apoptosis	adherens junction|cytoplasm|nucleus|tight junction	guanylate kinase activity|protein binding	g.chr9:71869204G>T	L27476	CCDS6627.1, CCDS6628.1, CCDS55314.1, CCDS55315.1, CCDS55316.1, CCDS55317.1	9q13-q21	2012-07-12	2012-07-12		ENSG00000119139	ENSG00000119139			11828	protein-coding gene	gene with protein product	"""Friedreich ataxia region gene X104 (tight junction protein ZO-2)"", ""zona occludens 2"""	607709	"""deafness, autosomal dominant 51"""	DFNA51		7951235, 20602916	Standard	NM_001170630		Approved	ZO-2, X104, ZO2	uc011lrv.2	Q9UDY2	OTTHUMG00000019978	ENST00000377245.4:c.3487G>T	9.37:g.71869204G>T	ENSP00000366453:p.Glu1163*					TJP2_uc011lrs.1_Nonsense_Mutation_p.E993*|TJP2_uc004ahf.2_Nonsense_Mutation_p.E1016*|TJP2_uc011lru.1_Nonsense_Mutation_p.E1130*|TJP2_uc011lrv.1_Nonsense_Mutation_p.E1185*|TJP2_uc010mom.1_3'UTR	p.E1163*	NM_004817	NP_004808	Q9UDY2	ZO2_HUMAN			23	3687	+			1163			Poly-Glu.		A2A3H9|B7Z2R8|B7Z7T6|F5H301|F5H886|Q15883|Q5VXL0|Q5VXL1|Q8N756|Q8NI14|Q99839|Q9UDY0|Q9UDY1	Nonsense_Mutation	SNP	ENST00000377245.4	37	c.3487G>T	CCDS6627.1	.	.	.	.	.	.	.	.	.	.	G	39	7.554462	0.98355	.	.	ENSG00000119139	ENST00000453658;ENST00000377245;ENST00000348208;ENST00000535702;ENST00000539225	.	.	.	5.8	4.89	0.63831	.	0.000000	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.6863	0.85309	0.0:0.1297:0.8703:0.0	.	.	.	.	X	993;1163;1016;1130;1194	.	ENSP00000345893:E1016X	E	+	1	0	TJP2	71059024	1.000000	0.71417	0.990000	0.47175	0.044000	0.14063	8.937000	0.92936	1.410000	0.46936	0.655000	0.94253	GAG		0.522	TJP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052572.2	NM_201629		17	70	1	0	6.94344e-10	0.006122	8.20589e-10	17	70				
S1PR3	1903	broad.mit.edu	37	9	91616344	91616344	+	Missense_Mutation	SNP	T	T	C			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr9:91616344T>C	ENST00000375846.3	+	1	4924	c.229T>C	c.(229-231)Ttc>Ctc	p.F77L	S1PR3_ENST00000358157.2_Missense_Mutation_p.F77L			Q99500	S1PR3_HUMAN	sphingosine-1-phosphate receptor 3	77					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|anatomical structure morphogenesis (GO:0009653)|cytokine production (GO:0001816)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|negative regulation of establishment of endothelial barrier (GO:1903141)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of interleukin-1 beta production (GO:0032651)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|integrin binding (GO:0005178)|lipid binding (GO:0008289)|sphingosine-1-phosphate receptor activity (GO:0038036)	p.F77L(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|skin(1)	34						CATGTACTTTTTCATTGGCAA	0.488											OREG0019291	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc004aqe.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(1)|central_nervous_system(1)|skin(1)	5						c.(229-231)TTC>CTC		sphingosine-1-phosphate receptor 3							83.0	86.0	85.0					9																	91616344		2203	4300	6503	SO:0001583	missense	1903				anatomical structure morphogenesis|elevation of cytosolic calcium ion concentration|inflammatory response|positive regulation of cell proliferation	integral to plasma membrane	lipid binding|lysosphingolipid and lysophosphatidic acid receptor activity	g.chr9:91616344T>C	AF022139	CCDS6680.1	9q22.1-q22.2	2012-08-08	2008-04-30	2008-04-30	ENSG00000213694	ENSG00000213694		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	3167	protein-coding gene	gene with protein product	"""sphingosine-1-phosphate receptor 3"""	601965	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 3"""	EDG3		8878560, 9409733	Standard	NM_005226		Approved	EDG-3	uc004aqe.4	Q99500	OTTHUMG00000020173	ENST00000375846.3:c.229T>C	9.37:g.91616344T>C	ENSP00000365006:p.Phe77Leu		OREG0019291	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1283		p.F77L	NM_005226	NP_005217	Q99500	S1PR3_HUMAN			2	625	+			77			Helical; Name=2; (By similarity).		Q5SQD8|Q7Z5I2	Missense_Mutation	SNP	ENST00000375846.3	37	c.229T>C	CCDS6680.1	.	.	.	.	.	.	.	.	.	.	T	19.73	3.882478	0.72294	.	.	ENSG00000213694	ENST00000358157;ENST00000375846	T;T	0.13778	2.56;2.56	5.14	5.14	0.70334	GPCR, rhodopsin-like superfamily (1);	0.053557	0.85682	D	0.000000	T	0.15262	0.0368	L	0.49640	1.575	0.80722	D	1	B	0.28667	0.219	B	0.31946	0.138	T	0.06092	-1.0846	10	0.15499	T	0.54	.	15.1267	0.72489	0.0:0.0:0.0:1.0	.	77	Q99500	S1PR3_HUMAN	L	77	ENSP00000350878:F77L;ENSP00000365006:F77L	ENSP00000350878:F77L	F	+	1	0	S1PR3	90806164	1.000000	0.71417	0.991000	0.47740	0.992000	0.81027	7.726000	0.84824	2.155000	0.67459	0.459000	0.35465	TTC		0.488	S1PR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052979.2	NM_005226		40	125	0	0	0	0.007835	0	40	125				
SLC35D2	11046	broad.mit.edu	37	9	99114336	99114336	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr9:99114336C>T	ENST00000253270.7	-	5	465	c.403G>A	c.(403-405)Gaa>Aaa	p.E135K	SLC35D2_ENST00000482643.1_5'UTR|SLC35D2_ENST00000375257.1_Missense_Mutation_p.E135K|SLC35D2_ENST00000375259.4_Missense_Mutation_p.E135K	NM_007001.2	NP_008932.2	Q76EJ3	S35D2_HUMAN	solute carrier family 35 (UDP-GlcNAc/UDP-glucose transporter), member D2	135					carbohydrate derivative transport (GO:1901264)|carbohydrate metabolic process (GO:0005975)|carbohydrate transport (GO:0008643)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|nucleotide transmembrane transport (GO:1901679)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	nucleotide-sugar transmembrane transporter activity (GO:0005338)	p.E135K(1)		endometrium(3)|large_intestine(3)|lung(4)|skin(2)	12		Acute lymphoblastic leukemia(62;0.0167)				ATGATGGTTTCCAGAAGTAAG	0.463																																							uc004awc.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(403-405)GAA>AAA		solute carrier family 35, member D2							154.0	134.0	141.0					9																	99114336		2203	4300	6503	SO:0001583	missense	11046					Golgi membrane|integral to membrane	nucleotide-sugar transmembrane transporter activity	g.chr9:99114336C>T	AB122077	CCDS6717.1, CCDS69625.1	9q22.33	2013-07-17	2013-07-17		ENSG00000130958	ENSG00000130958		"""Solute carriers"""	20799	protein-coding gene	gene with protein product		609182	"""solute carrier family 35, member D2"""			15607426	Standard	NM_007001		Approved	UGTrel8, SQV7L	uc004awc.3	Q76EJ3	OTTHUMG00000020293	ENST00000253270.7:c.403G>A	9.37:g.99114336C>T	ENSP00000253270:p.Glu135Lys					SLC35D2_uc010msd.2_RNA|SLC35D2_uc010mse.2_Intron|SLC35D2_uc010msf.2_Missense_Mutation_p.E135K|SLC35D2_uc004awd.2_Intron|SLC35D2_uc004awe.2_Missense_Mutation_p.E135K	p.E135K	NM_007001	NP_008932	Q76EJ3	S35D2_HUMAN			5	479	-		Acute lymphoblastic leukemia(62;0.0167)	135			Cytoplasmic (Potential).		O95454|Q498C1|Q75W21|Q7Z5X5	Missense_Mutation	SNP	ENST00000253270.7	37	c.403G>A	CCDS6717.1	.	.	.	.	.	.	.	.	.	.	C	17.64	3.438670	0.62955	.	.	ENSG00000130958	ENST00000253270;ENST00000375259;ENST00000375257	T;T;T	0.70986	0.2;-0.53;-0.47	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	D	0.83390	0.5244	M	0.71206	2.165	0.53005	D	0.999967	D;D	0.71674	0.998;0.997	D;D	0.78314	0.991;0.96	D	0.84683	0.0718	10	0.66056	D	0.02	.	17.5289	0.87808	0.0:1.0:0.0:0.0	.	135;135	Q76EJ3-2;Q76EJ3	.;S35D2_HUMAN	K	135	ENSP00000253270:E135K;ENSP00000364408:E135K;ENSP00000364406:E135K	ENSP00000253270:E135K	E	-	1	0	SLC35D2	98154157	1.000000	0.71417	0.999000	0.59377	0.021000	0.10359	5.928000	0.70088	2.690000	0.91761	0.655000	0.94253	GAA		0.463	SLC35D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053261.1			14	23	0	0	0	0.003163	0	14	23				
HIATL2	84278	broad.mit.edu	37	9	99711865	99711865	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr9:99711865G>A	ENST00000375223.4	-	4	580	c.367C>T	c.(367-369)Cca>Tca	p.P123S	HIATL2_ENST00000506067.1_5'UTR|HIATL2_ENST00000602917.1_Missense_Mutation_p.P123S			Q5VZR4	HIAL2_HUMAN	hippocampus abundant transcript-like 2	123					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)	p.P123S(1)									AGTGGGATTGGGAAGCAGGTA	0.507																																							uc004aws.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(367-369)CCA>TCA		RecName: Full=Hippocampus abundant transcript-like protein 2;																																				SO:0001583	missense	84278							g.chr9:99711865G>A	BC005058		9q22.33	2008-09-12	2008-09-12		ENSG00000196312	ENSG00000196312			23672	protein-coding gene	gene with protein product						12477932	Standard	NR_002894		Approved	MGC12945	uc004aws.3	Q5VZR4	OTTHUMG00000020317	ENST00000375223.4:c.367C>T	9.37:g.99711865G>A	ENSP00000364371:p.Pro123Ser					HIATL2_uc004awr.1_RNA	p.P123S	NR_002894						4	581	-								Q9BSG7	Missense_Mutation	SNP	ENST00000375223.4	37	c.367C>T		.	.	.	.	.	.	.	.	.	.	.	13.44	2.239083	0.39598	.	.	ENSG00000196312	ENST00000375223	T	0.79247	-1.25	1.44	1.44	0.22558	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.40302	N	0.001129	D	0.85008	0.5599	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.84368	0.0542	9	0.56958	D	0.05	.	8.8518	0.35203	0.0:0.0:1.0:0.0	.	123	Q5VZR4	HIAL2_HUMAN	S	123	ENSP00000364371:P123S	ENSP00000364371:P123S	P	-	1	0	HIATL2	98751686	1.000000	0.71417	0.997000	0.53966	0.379000	0.30106	7.678000	0.84035	1.115000	0.41800	0.184000	0.17185	CCA		0.507	HIATL2-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_032318		22	114	0	0	0	0.00874	0	22	114				
NANS	54187	broad.mit.edu	37	9	100839261	100839261	+	Missense_Mutation	SNP	C	C	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr9:100839261C>T	ENST00000210444.5	+	3	480	c.410C>T	c.(409-411)aCt>aTt	p.T137I	TRIM14_ENST00000375098.3_Intron|NANS_ENST00000461452.1_3'UTR	NM_018946.3	NP_061819.2	Q9NR45	SIAS_HUMAN	N-acetylneuraminic acid synthase	137					lipopolysaccharide biosynthetic process (GO:0009103)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	N-acetylneuraminate synthase activity (GO:0050462)|N-acylneuraminate cytidylyltransferase activity (GO:0008781)|N-acylneuraminate-9-phosphate synthase activity (GO:0047444)	p.T137I(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)	11		Acute lymphoblastic leukemia(62;0.0559)				TCTGGAGACACTAATAATTTT	0.368																																							uc004ayb.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(409-411)ACT>ATT		N-acetylneuraminic acid phosphate synthase							100.0	94.0	96.0					9																	100839261		2203	4300	6503	SO:0001583	missense	54187				lipopolysaccharide biosynthetic process	cytoplasm	N-acetylneuraminate synthase activity|N-acylneuraminate cytidylyltransferase activity|N-acylneuraminate-9-phosphate synthase activity	g.chr9:100839261C>T	AF161387	CCDS6733.1	9p24.1-p23	2008-07-31	2008-07-31		ENSG00000095380	ENSG00000095380			19237	protein-coding gene	gene with protein product	"""sialic acid synthase"""	605202				10749855	Standard	NM_018946		Approved	SAS	uc004ayc.3	Q9NR45	OTTHUMG00000020341	ENST00000210444.5:c.410C>T	9.37:g.100839261C>T	ENSP00000210444:p.Thr137Ile					NANS_uc004ayc.2_Missense_Mutation_p.T137I|TRIM14_uc004ayd.2_Intron|NANS_uc004aye.1_5'Flank	p.T137I	NM_018946	NP_061819	Q9NR45	SIAS_HUMAN			4	1052	+		Acute lymphoblastic leukemia(62;0.0559)	137					B2RE98|Q8WUV9|Q9BWS6|Q9NVD4	Missense_Mutation	SNP	ENST00000210444.5	37	c.410C>T	CCDS6733.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.723334	0.89298	.	.	ENSG00000095380	ENST00000210444	T	0.36699	1.24	5.71	5.71	0.89125	Aldolase-type TIM barrel (1);N-acetylneuraminic acid synthase, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.11836	0.0288	N	0.00382	-1.575	0.80722	D	1	B	0.22604	0.072	B	0.19946	0.027	T	0.34800	-0.9814	10	0.12103	T	0.63	-16.0454	17.79	0.88550	0.0:1.0:0.0:0.0	.	137	Q9NR45	SIAS_HUMAN	I	137	ENSP00000210444:T137I	ENSP00000210444:T137I	T	+	2	0	NANS	99879082	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	7.453000	0.80700	2.885000	0.99019	0.580000	0.79431	ACT		0.368	NANS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053359.1	NM_018946		12	52	0	0	0	0.020292	0	12	52				
SVEP1	79987	broad.mit.edu	37	9	113261349	113261349	+	Missense_Mutation	SNP	A	A	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr9:113261349A>T	ENST00000401783.2	-	7	1989	c.1653T>A	c.(1651-1653)aaT>aaA	p.N551K	SVEP1_ENST00000302728.8_Missense_Mutation_p.N551K|SVEP1_ENST00000467821.1_5'UTR|SVEP1_ENST00000374469.1_Missense_Mutation_p.N528K|SVEP1_ENST00000374461.1_Missense_Mutation_p.N528K	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	551	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)	p.N551K(1)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						GAACTCCGACATTCCATTTTC	0.413																																							uc010mtz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)	7						c.(1651-1653)AAT>AAA		polydom							60.0	56.0	57.0					9																	113261349		1935	4150	6085	SO:0001583	missense	79987				cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding	g.chr9:113261349A>T	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.1653T>A	9.37:g.113261349A>T	ENSP00000384917:p.Asn551Lys					SVEP1_uc010mua.1_Missense_Mutation_p.N551K|SVEP1_uc004beu.2_Missense_Mutation_p.N551K	p.N551K	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN			7	1990	-			551			Sushi 3.		Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	37	c.1653T>A	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	A	13.54	2.267124	0.40095	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000302728;ENST00000374461	T;T;T;T	0.42900	0.96;0.96;0.96;0.96	5.69	0.52	0.17040	Complement control module (2);Sushi/SCR/CCP (2);	0.219324	0.53938	D	0.000060	T	0.25568	0.0622	N	0.19112	0.55	0.20403	N	0.999905	B;B;B	0.24483	0.104;0.02;0.073	B;B;B	0.24394	0.024;0.016;0.053	T	0.19192	-1.0313	10	0.72032	D	0.01	.	9.0857	0.36579	0.6831:0.0:0.3169:0.0	.	551;551;551	E9PBN8;Q4LDE5;Q4LDE5-2	.;SVEP1_HUMAN;.	K	551;528;551;528	ENSP00000384917:N551K;ENSP00000363593:N528K;ENSP00000304118:N551K;ENSP00000363585:N528K	ENSP00000304118:N551K	N	-	3	2	SVEP1	112301170	0.053000	0.20554	0.554000	0.28268	0.725000	0.41563	0.393000	0.20817	-0.137000	0.11455	-0.290000	0.09829	AAT		0.413	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				5	27	0	0	0	0.001984	0	5	27				
ALAD	210	broad.mit.edu	37	9	116152888	116152888	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr9:116152888C>A	ENST00000409155.3	-	6	662	c.466G>T	c.(466-468)Gcg>Tcg	p.A156S	ALAD_ENST00000277315.5_Missense_Mutation_p.A139S|ALAD_ENST00000482001.1_5'Flank	NM_000031.5	NP_000022.3	P13716	HEM2_HUMAN	aminolevulinate dehydratase	156					cellular response to interleukin-4 (GO:0071353)|heme biosynthetic process (GO:0006783)|porphyrin-containing compound metabolic process (GO:0006778)|protein homooligomerization (GO:0051260)|protoporphyrinogen IX biosynthetic process (GO:0006782)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|identical protein binding (GO:0042802)|lead ion binding (GO:0032791)|porphobilinogen synthase activity (GO:0004655)|zinc ion binding (GO:0008270)	p.A185S(1)|p.A156S(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)|stomach(1)	9					Aminolevulinic acid(DB00855)	TTGGCATACGCCAATGCCACC	0.622																																							uc011lxf.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(466-468)GCG>TCG		delta-aminolevulinic acid dehydratase	Aminolevulinic acid(DB00855)						34.0	35.0	35.0					9																	116152888		2203	4300	6503	SO:0001583	missense	210				heme biosynthetic process|protein homooligomerization	cytosol	identical protein binding|lead ion binding|porphobilinogen synthase activity|zinc ion binding	g.chr9:116152888C>A	M13928	CCDS6794.2	9q32	2010-04-29	2010-04-29		ENSG00000148218	ENSG00000148218	4.2.1.24		395	protein-coding gene	gene with protein product	"""porphobilinogen synthase"""	125270	"""aminolevulinate, delta-, dehydratase"""			6839527, 6378062	Standard	NM_000031		Approved	ALADH, PBGS	uc011lxf.2	P13716	OTTHUMG00000020522	ENST00000409155.3:c.466G>T	9.37:g.116152888C>A	ENSP00000386284:p.Ala156Ser					ALAD_uc011lxe.1_Missense_Mutation_p.A139S|ALAD_uc004bhl.3_Missense_Mutation_p.A185S	p.A156S	NM_000031	NP_000022	P13716	HEM2_HUMAN			6	668	-			156					A8K375|B2R6F2|Q16870|Q16871|Q9BVQ9	Missense_Mutation	SNP	ENST00000409155.3	37	c.466G>T	CCDS6794.2	.	.	.	.	.	.	.	.	.	.	C	1.693	-0.503554	0.04261	.	.	ENSG00000148218	ENST00000409155;ENST00000277315	D;D	0.86297	-2.1;-2.1	5.8	4.89	0.63831	Aldolase-type TIM barrel (1);	0.139095	0.64402	N	0.000004	T	0.77465	0.4134	N	0.16266	0.395	0.80722	D	1	B;B;B	0.28400	0.007;0.038;0.21	B;B;B	0.34991	0.057;0.114;0.193	T	0.71318	-0.4629	10	0.02654	T	1	-7.1051	14.8638	0.70399	0.1449:0.8551:0.0:0.0	.	156;139;185	P13716;B7Z3I9;P13716-2	HEM2_HUMAN;.;.	S	156;139	ENSP00000386284:A156S;ENSP00000277315:A139S	ENSP00000277315:A139S	A	-	1	0	ALAD	115192709	1.000000	0.71417	1.000000	0.80357	0.150000	0.21749	3.511000	0.53400	1.414000	0.47017	0.655000	0.94253	GCG		0.622	ALAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053724.3	NM_001003945		6	24	1	0	0.00198382	0.001984	0.00208593	6	24				
RGS3	5998	broad.mit.edu	37	9	116267776	116267776	+	Missense_Mutation	SNP	C	C	G			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr9:116267776C>G	ENST00000374140.2	+	12	1161	c.952C>G	c.(952-954)Cca>Gca	p.P318A	RGS3_ENST00000350696.5_Missense_Mutation_p.P318A|RGS3_ENST00000317613.6_Missense_Mutation_p.P206A|RGS3_ENST00000374136.1_5'UTR|RGS3_ENST00000343817.5_Missense_Mutation_p.P37A|RGS3_ENST00000394646.3_Missense_Mutation_p.P37A	NM_001282923.1|NM_144488.4	NP_001269852.1|NP_652759.3	P49796	RGS3_HUMAN	regulator of G-protein signaling 3	318	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				inactivation of MAPK activity (GO:0000188)|positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)	p.P206A(1)|p.P318A(1)|p.P214A(1)		cervix(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	48						CTGCGACTCTCCAGTTCGAGT	0.572																																							uc004bhq.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(1)|lung(1)|skin(1)	3						c.(952-954)CCA>GCA		regulator of G-protein signalling 3 isoform 6							159.0	113.0	129.0					9																	116267776		2203	4300	6503	SO:0001583	missense	5998				inactivation of MAPK activity|regulation of G-protein coupled receptor protein signaling pathway	cytosol|nucleus|plasma membrane	GTPase activator activity|signal transducer activity	g.chr9:116267776C>G	AF006610	CCDS6797.1, CCDS6798.1, CCDS35113.1, CCDS35114.1, CCDS43869.1, CCDS65111.1	9q32	2008-02-05	2007-08-14		ENSG00000138835	ENSG00000138835		"""Regulators of G-protein signaling"""	9999	protein-coding gene	gene with protein product		602189	"""regulator of G-protein signalling 3"""			8602223, 11034339	Standard	NM_001276260		Approved	C2PA, FLJ20370, PDZ-RGS3	uc004bhq.4	P49796	OTTHUMG00000021048	ENST00000374140.2:c.952C>G	9.37:g.116267776C>G	ENSP00000363255:p.Pro318Ala					RGS3_uc004bhr.2_Missense_Mutation_p.P206A|RGS3_uc004bhs.2_Missense_Mutation_p.P208A|RGS3_uc004bht.2_Missense_Mutation_p.P37A|RGS3_uc010muy.2_Missense_Mutation_p.P37A|RGS3_uc004bhu.2_5'UTR	p.P318A	NM_144488	NP_652759	P49796	RGS3_HUMAN			12	1161	+			318			PDZ.		A6NHA0|A8K0V1|B3KUB2|Q5VXB8|Q5VXC1|Q5VZ05|Q5VZ06|Q6ZRM5|Q8IUQ1|Q8NC47|Q8NFN4|Q8NFN5|Q8NFN6|Q8TD59|Q8TD68|Q8WV02|Q8WXA0	Missense_Mutation	SNP	ENST00000374140.2	37	c.952C>G	CCDS43869.1	.	.	.	.	.	.	.	.	.	.	C	29.1	4.973263	0.92919	.	.	ENSG00000138835	ENST00000374140;ENST00000350696;ENST00000317613;ENST00000343817;ENST00000394646	T;T;T;T;T	0.33654	1.4;1.4;1.4;1.4;1.4	6.01	6.01	0.97437	PDZ/DHR/GLGF (4);	0.050269	0.85682	D	0.000000	T	0.58694	0.2140	L	0.58428	1.81	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.998;1.0;1.0;0.998;0.999	T	0.57189	-0.7854	10	0.72032	D	0.01	.	17.6771	0.88233	0.0:1.0:0.0:0.0	.	37;37;208;206;318	B3KUB2;P49796-4;B3KWG8;P49796-5;P49796	.;.;.;.;RGS3_HUMAN	A	318;318;206;37;37	ENSP00000363255:P318A;ENSP00000259406:P318A;ENSP00000312844:P206A;ENSP00000340284:P37A;ENSP00000378141:P37A	ENSP00000312844:P206A	P	+	1	0	RGS3	115307597	1.000000	0.71417	0.999000	0.59377	0.942000	0.58702	6.912000	0.75753	2.861000	0.98227	0.650000	0.86243	CCA		0.572	RGS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055561.3	NM_017790		13	48	0	0	0	0.003163	0	13	48				
OR1L3	26735	broad.mit.edu	37	9	125437724	125437724	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr9:125437724G>A	ENST00000304820.2	+	1	410	c.316G>A	c.(316-318)Gtt>Att	p.V106I		NM_001005234.1	NP_001005234.1	Q8NH93	OR1L3_HUMAN	olfactory receptor, family 1, subfamily L, member 3	106			V -> A (in dbSNP:rs16912096).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V106I(1)		breast(1)|kidney(1)|large_intestine(2)|lung(6)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	16						TTTCTTCCTGGTTTTTGGAAA	0.428																																							uc011lzb.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(316-318)GTT>ATT		olfactory receptor, family 1, subfamily L,							151.0	155.0	154.0					9																	125437724		2203	4300	6503	SO:0001583	missense	26735				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:125437724G>A		CCDS35128.1	9q33.2	2013-09-20			ENSG00000171481	ENSG00000171481		"""GPCR / Class A : Olfactory receptors"""	8215	protein-coding gene	gene with protein product							Standard	NM_001005234		Approved	OR9-D	uc011lzb.2	Q8NH93	OTTHUMG00000020619	ENST00000304820.2:c.316G>A	9.37:g.125437724G>A	ENSP00000302863:p.Val106Ile						p.V106I	NM_001005234	NP_001005234	Q8NH93	OR1L3_HUMAN			1	316	+			106			Helical; Name=3; (Potential).		B2RNF4|Q6IFN1	Missense_Mutation	SNP	ENST00000304820.2	37	c.316G>A	CCDS35128.1	.	.	.	.	.	.	.	.	.	.	G	8.239	0.806374	0.16467	.	.	ENSG00000171481	ENST00000304820	T	0.00344	8.02	4.54	2.66	0.31614	GPCR, rhodopsin-like superfamily (1);	0.474644	0.15407	N	0.263970	T	0.00178	0.0005	N	0.11201	0.11	0.09310	N	1	B	0.25850	0.136	B	0.32149	0.141	T	0.28650	-1.0037	10	0.40728	T	0.16	-4.8218	8.488	0.33082	0.0836:0.2923:0.6241:0.0	.	106	Q8NH93	OR1L3_HUMAN	I	106	ENSP00000302863:V106I	ENSP00000302863:V106I	V	+	1	0	OR1L3	124477545	0.000000	0.05858	0.284000	0.24805	0.961000	0.63080	-0.758000	0.04766	0.653000	0.30826	0.644000	0.83932	GTT		0.428	OR1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053950.1			45	166	0	0	0	0.011902	0	45	166				
WDR34	89891	broad.mit.edu	37	9	131396070	131396070	+	Missense_Mutation	SNP	G	G	A	rs368864898	byFrequency	TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr9:131396070G>A	ENST00000372715.2	-	9	1624	c.1564C>T	c.(1564-1566)Cgg>Tgg	p.R522W	WDR34_ENST00000483181.1_5'Flank	NM_052844.3	NP_443076.2	Q96EX3	WDR34_HUMAN	WD repeat domain 34	522						axoneme (GO:0005930)|centriole (GO:0005814)|ciliary basal body (GO:0036064)		p.R522W(1)		central_nervous_system(2)|lung(5)|skin(1)|urinary_tract(1)	9						TCAGCTTCCCGGGGCCCTTGT	0.652													G|||	3	0.000599042	0.0015	0.0	5008	,	,		13352	0.0		0.001	False		,,,				2504	0.0						uc004bvq.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|skin(1)	3						c.(1564-1566)CGG>TGG		WD repeat domain 34		G	TRP/ARG	0,4406		0,0,2203	58.0	72.0	67.0		1564	4.5	1.0	9		67	2,8598	1.2+/-3.3	0,2,4298	no	missense	WDR34	NM_052844.3	101	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging	522/537	131396070	2,13004	2203	4300	6503	SO:0001583	missense	89891					cytoplasm		g.chr9:131396070G>A	BC011874	CCDS6906.2	9q34.11	2013-11-15	2013-02-19	2013-02-19	ENSG00000119333	ENSG00000119333		"""WD repeat domain containing"""	28296	protein-coding gene	gene with protein product		613363				19521662, 21953912, 24183451	Standard	NM_052844		Approved	DIC5, MGC20486, bA216B9.3, FAP133	uc004bvq.1	Q96EX3	OTTHUMG00000020750	ENST00000372715.2:c.1564C>T	9.37:g.131396070G>A	ENSP00000361800:p.Arg522Trp					WDR34_uc004bvs.1_Missense_Mutation_p.R513W|WDR34_uc004bvr.1_Missense_Mutation_p.R494W	p.R522W	NM_052844	NP_443076	Q96EX3	WDR34_HUMAN			9	1688	-			522					Q5VXV4|Q9BV46	Missense_Mutation	SNP	ENST00000372715.2	37	c.1564C>T	CCDS6906.2	.	.	.	.	.	.	.	.	.	.	G	19.07	3.756692	0.69648	0.0	2.33E-4	ENSG00000119333	ENST00000372715	T	0.66099	-0.19	5.42	4.53	0.55603	.	0.265044	0.35870	N	0.002928	T	0.72598	0.3480	M	0.80028	2.48	0.44852	D	0.99786	D	0.64830	0.994	P	0.56127	0.792	T	0.75199	-0.3402	10	0.62326	D	0.03	-14.6673	8.9472	0.35767	0.079:0.0:0.7645:0.1566	.	522	Q96EX3	WDR34_HUMAN	W	522	ENSP00000361800:R522W	ENSP00000361800:R522W	R	-	1	2	WDR34	130435891	0.950000	0.32346	0.967000	0.41034	0.686000	0.39977	0.523000	0.22925	1.295000	0.44724	0.561000	0.74099	CGG		0.652	WDR34-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054463.1	NM_052844		6	242	0	0	0	0.001168	0	6	242				
CDKL5	6792	broad.mit.edu	37	X	18668587	18668587	+	Missense_Mutation	SNP	G	G	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chrX:18668587G>A	ENST00000379989.3	+	21	3140	c.2855G>A	c.(2854-2856)cGa>cAa	p.R952Q	CDKL5_ENST00000379996.3_Missense_Mutation_p.R952Q|RS1_ENST00000476595.1_5'UTR|RS1_ENST00000379984.3_Intron	NM_001037343.1	NP_001032420.1	O76039	CDKL5_HUMAN	cyclin-dependent kinase-like 5	952					neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of Rac GTPase activity (GO:0032855)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite development (GO:0050773)	cytoplasm (GO:0005737)|dendrite cytoplasm (GO:0032839)|dendritic growth cone (GO:0044294)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)	p.R952Q(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|skin(5)|stomach(1)	44	Hepatocellular(33;0.183)					GTCCCAAACCGAGCCCTTCAT	0.567																																							uc004cym.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(1)|stomach(1)|central_nervous_system(1)|skin(1)	6						c.(2854-2856)CGA>CAA		cyclin-dependent kinase-like 5							158.0	114.0	129.0					X																	18668587		2203	4300	6503	SO:0001583	missense	6792				neuron migration|positive regulation of axon extension|positive regulation of dendrite morphogenesis|positive regulation of Rac GTPase activity|protein autophosphorylation	dendrite cytoplasm|dendritic growth cone|nucleus	ATP binding|cyclin-dependent protein kinase activity|Rac GTPase binding	g.chrX:18668587G>A	Y15057	CCDS14186.1	Xp22	2011-11-04	2002-11-26	2002-11-29	ENSG00000008086	ENSG00000008086		"""Cyclin-dependent kinases"""	11411	protein-coding gene	gene with protein product		300203	"""serine/threonine kinase 9"""	STK9		9721213, 16935860	Standard	XM_005274584		Approved	EIEE2	uc004cym.3	O76039	OTTHUMG00000021214	ENST00000379989.3:c.2855G>A	X.37:g.18668587G>A	ENSP00000369325:p.Arg952Gln					CDKL5_uc004cyn.2_Missense_Mutation_p.R952Q|RS1_uc004cyo.2_Intron	p.R952Q	NM_003159	NP_003150	O76039	CDKL5_HUMAN			20	3108	+	Hepatocellular(33;0.183)		952					G9B9X4|Q14198|Q5H985|Q8IYC7|Q9UJL6	Missense_Mutation	SNP	ENST00000379989.3	37	c.2855G>A	CCDS14186.1	.	.	.	.	.	.	.	.	.	.	G	11.18	1.563705	0.27915	.	.	ENSG00000008086	ENST00000379996;ENST00000379989	T;T	0.71341	-0.56;-0.56	3.8	0.976	0.19727	.	7.960010	0.00166	N	0.000005	T	0.52322	0.1727	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47484	-0.9114	10	0.87932	D	0	.	5.4055	0.16318	0.4171:0.0:0.5829:0.0	.	952	O76039	CDKL5_HUMAN	Q	952	ENSP00000369332:R952Q;ENSP00000369325:R952Q	ENSP00000369325:R952Q	R	+	2	0	CDKL5	18578508	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.097000	0.15168	0.071000	0.16664	-0.208000	0.12717	CGA		0.567	CDKL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055945.2	NM_003159		12	119	0	0	0	0.013537	0	12	119				
FAM47B	170062	broad.mit.edu	37	X	34961142	34961142	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chrX:34961142C>A	ENST00000329357.5	+	1	230	c.194C>A	c.(193-195)cCt>cAt	p.P65H		NM_152631.2	NP_689844.2	Q8NA70	FA47B_HUMAN	family with sequence similarity 47, member B	65								p.P65H(1)		breast(3)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	71						TGTCAGTCTCCTGAAGATACG	0.547																																							uc004ddi.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(1)	4						c.(193-195)CCT>CAT		hypothetical protein LOC170062							99.0	82.0	88.0					X																	34961142		2202	4300	6502	SO:0001583	missense	170062							g.chrX:34961142C>A	BC035026	CCDS14236.1	Xp21.1	2004-08-09			ENSG00000189132	ENSG00000189132			26659	protein-coding gene	gene with protein product						14702039	Standard	NM_152631		Approved	FLJ35782	uc004ddi.2	Q8NA70	OTTHUMG00000021345	ENST00000329357.5:c.194C>A	X.37:g.34961142C>A	ENSP00000328307:p.Pro65His						p.P65H	NM_152631	NP_689844	Q8NA70	FA47B_HUMAN			1	212	+			65					Q5JQN5|Q6PIG3	Missense_Mutation	SNP	ENST00000329357.5	37	c.194C>A	CCDS14236.1	.	.	.	.	.	.	.	.	.	.	c	9.417	1.082114	0.20309	.	.	ENSG00000189132	ENST00000329357	T	0.23348	1.91	0.655	-1.08	0.09936	.	.	.	.	.	T	0.43033	0.1229	M	0.74881	2.28	0.09310	N	1	D	0.89917	1.0	D	0.80764	0.994	T	0.24119	-1.0169	8	0.41790	T	0.15	.	.	.	.	.	65	Q8NA70	FA47B_HUMAN	H	65	ENSP00000328307:P65H	ENSP00000328307:P65H	P	+	2	0	FAM47B	34871063	0.003000	0.15002	0.001000	0.08648	0.008000	0.06430	0.669000	0.25142	-0.422000	0.07405	0.287000	0.19450	CCT		0.547	FAM47B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056211.1	NM_152631		42	15	1	0	5.82388e-19	0.01441	8.00784e-19	42	15				
KDM5C	8242	broad.mit.edu	37	X	53239923	53239923	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chrX:53239923C>A	ENST00000375401.3	-	11	2050	c.1518G>T	c.(1516-1518)atG>atT	p.M506I	KDM5C_ENST00000465402.1_5'Flank|KDM5C-IT1_ENST00000412242.1_RNA|KDM5C_ENST00000404049.3_Missense_Mutation_p.M505I|KDM5C_ENST00000452825.3_Missense_Mutation_p.M439I|KDM5C_ENST00000375379.3_Missense_Mutation_p.M506I|KDM5C_ENST00000375383.3_Missense_Mutation_p.M465I	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	506	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)	p.M506I(1)|p.M439I(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						CTGAGAAGACCATGCCCACGT	0.517			"""N, F, S"""		clear cell renal carcinoma																																		uc004drz.2		NA		Rec	yes		X	Xp11.22-p11.21	8242	N|F|S	lysine (K)-specific demethylase 5C (JARID1C)			E			clear cell renal carcinoma		2	Substitution - Missense(2)		lung(2)	kidney(9)|ovary(5)|salivary_gland(1)|autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|oesophagus(1)	18						c.(1516-1518)ATG>ATT		jumonji, AT rich interactive domain 1C isoform							170.0	111.0	131.0					X																	53239923		2203	4300	6503	SO:0001583	missense	8242				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding	g.chrX:53239923C>A	Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.1518G>T	X.37:g.53239923C>A	ENSP00000364550:p.Met506Ile					KDM5C_uc011moc.1_RNA|KDM5C_uc011mod.1_Missense_Mutation_p.M439I|KDM5C_uc004dsa.2_Missense_Mutation_p.M505I	p.M506I	NM_004187	NP_004178	P41229	KDM5C_HUMAN			11	2051	-			506			JmjC.		B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Missense_Mutation	SNP	ENST00000375401.3	37	c.1518G>T	CCDS14351.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.240245	0.79912	.	.	ENSG00000126012	ENST00000452825;ENST00000375401;ENST00000404049;ENST00000375379;ENST00000375383	T;T;T;T;T	0.71341	-0.56;-0.56;-0.56;-0.56;-0.56	5.42	5.42	0.78866	Transcription factor jumonji/aspartyl beta-hydroxylase (2);Transcription factor jumonji (1);	0.000000	0.85682	D	0.000000	D	0.88381	0.6421	H	0.94698	3.57	0.58432	D	0.999999	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.91635	0.999;0.999;0.999	D	0.91588	0.5284	10	0.87932	D	0	-25.0837	15.4991	0.75680	0.0:1.0:0.0:0.0	.	439;505;506	F5H3T1;B0QZ44;P41229	.;.;KDM5C_HUMAN	I	439;506;505;506;465	ENSP00000445176:M439I;ENSP00000364550:M506I;ENSP00000385394:M505I;ENSP00000364528:M506I;ENSP00000364532:M465I	ENSP00000364528:M506I	M	-	3	0	KDM5C	53256648	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.784000	0.85713	2.252000	0.74401	0.600000	0.82982	ATG		0.517	KDM5C-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056737.2	NM_004187		23	8	1	0	1.26454e-06	0.005443	1.4276e-06	23	8				
GPR112	139378	broad.mit.edu	37	X	135430553	135430553	+	Missense_Mutation	SNP	C	C	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chrX:135430553C>A	ENST00000394143.1	+	6	4979	c.4688C>A	c.(4687-4689)tCc>tAc	p.S1563Y	GPR112_ENST00000287534.4_Missense_Mutation_p.S1500Y|GPR112_ENST00000394141.1_Missense_Mutation_p.S1358Y|GPR112_ENST00000370652.1_Missense_Mutation_p.S1563Y|GPR112_ENST00000412101.1_Missense_Mutation_p.S1358Y	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	1563					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.S1563Y(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					TCTGAGATGTCCTCAATACCA	0.418																																							uc004ezu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12						c.(4687-4689)TCC>TAC		G-protein coupled receptor 112							136.0	128.0	131.0					X																	135430553		2203	4300	6503	SO:0001583	missense	139378				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chrX:135430553C>A	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.4688C>A	X.37:g.135430553C>A	ENSP00000377699:p.Ser1563Tyr					GPR112_uc010nsb.1_Missense_Mutation_p.S1358Y|GPR112_uc010nsc.1_Missense_Mutation_p.S1330Y	p.S1563Y	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN			6	4979	+	Acute lymphoblastic leukemia(192;0.000127)		1563			Extracellular (Potential).		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	37	c.4688C>A	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	c	13.56	2.274432	0.40194	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.36157	1.31;1.31;1.27;1.4;1.27	2.86	1.95	0.26073	.	.	.	.	.	T	0.25044	0.0608	L	0.29908	0.895	0.09310	N	1	P;P;P	0.49447	0.924;0.924;0.875	B;B;B	0.41646	0.362;0.362;0.198	T	0.10268	-1.0637	9	0.72032	D	0.01	.	6.3065	0.21141	0.0:0.8353:0.0:0.1647	.	1500;1358;1563	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	Y	1563;1563;1358;1500;1358	ENSP00000377699:S1563Y;ENSP00000359686:S1563Y;ENSP00000416526:S1358Y;ENSP00000287534:S1500Y;ENSP00000377697:S1358Y	ENSP00000287534:S1500Y	S	+	2	0	GPR112	135258219	0.001000	0.12720	0.004000	0.12327	0.318000	0.28184	1.367000	0.34204	0.348000	0.23949	0.287000	0.19450	TCC		0.418	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1			83	32	1	0	1.10825e-40	0.01441	1.80091e-40	83	32				
SLITRK2	84631	broad.mit.edu	37	X	144904510	144904510	+	Missense_Mutation	SNP	G	G	C			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chrX:144904510G>C	ENST00000370490.1	+	1	4822	c.567G>C	c.(565-567)agG>agC	p.R189S	SLITRK2_ENST00000428560.2_Missense_Mutation_p.R189S|SLITRK2_ENST00000413937.2_Missense_Mutation_p.R189S|SLITRK2_ENST00000434188.2_Missense_Mutation_p.R189S|SLITRK2_ENST00000447897.2_Missense_Mutation_p.R189S			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	189					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.R189S(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					TAGACCTCAGGGGGAATAGGC	0.468																																							uc004fcd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|central_nervous_system(1)|pancreas(1)	7						c.(565-567)AGG>AGC		SLIT and NTRK-like family, member 2 precursor							146.0	124.0	131.0					X																	144904510		2203	4300	6503	SO:0001583	missense	84631					integral to membrane		g.chrX:144904510G>C	Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.567G>C	X.37:g.144904510G>C	ENSP00000359521:p.Arg189Ser					SLITRK2_uc010nsp.2_Missense_Mutation_p.R189S|SLITRK2_uc010nso.2_Missense_Mutation_p.R189S|SLITRK2_uc011mwq.1_Missense_Mutation_p.R189S|SLITRK2_uc011mwr.1_Missense_Mutation_p.R189S|SLITRK2_uc011mws.1_Missense_Mutation_p.R189S|SLITRK2_uc004fcg.2_Missense_Mutation_p.R189S|SLITRK2_uc011mwt.1_Missense_Mutation_p.R189S	p.R189S	NM_032539	NP_115928	Q9H156	SLIK2_HUMAN			5	1557	+	Acute lymphoblastic leukemia(192;6.56e-05)		189			Extracellular (Potential).|LRR 6.		A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Missense_Mutation	SNP	ENST00000370490.1	37	c.567G>C	CCDS14680.1	.	.	.	.	.	.	.	.	.	.	G	15.35	2.808908	0.50421	.	.	ENSG00000185985	ENST00000335565;ENST00000447897;ENST00000370490;ENST00000434188;ENST00000413937;ENST00000428560	T;T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98;0.98	5.0	1.55	0.23275	.	0.000000	0.85682	D	0.000000	T	0.35364	0.0929	N	0.04090	-0.28	0.50632	D	0.999889	D	0.89917	1.0	D	0.97110	1.0	T	0.24333	-1.0163	10	0.49607	T	0.09	-8.4494	6.8874	0.24209	0.5875:0.0:0.4125:0.0	.	189	Q9H156	SLIK2_HUMAN	S	189	ENSP00000334374:R189S;ENSP00000411681:R189S;ENSP00000359521:R189S;ENSP00000397015:R189S;ENSP00000407347:R189S;ENSP00000412010:R189S	ENSP00000334374:R189S	R	+	3	2	SLITRK2	144712202	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	0.896000	0.28377	0.294000	0.22547	0.600000	0.82982	AGG		0.468	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058633.1	NM_032539		54	94	0	0	0	0.01441	0	54	94				
SLITRK2	84631	broad.mit.edu	37	X	144906366	144906366	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chrX:144906366G>T	ENST00000370490.1	+	1	6678	c.2423G>T	c.(2422-2424)aGg>aTg	p.R808M	SLITRK2_ENST00000428560.2_Missense_Mutation_p.R808M|SLITRK2_ENST00000413937.2_Missense_Mutation_p.R808M|SLITRK2_ENST00000434188.2_Missense_Mutation_p.R808M|TMEM257_ENST00000408967.2_5'Flank|SLITRK2_ENST00000447897.2_Missense_Mutation_p.R808M			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	808					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.R808M(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					GGAACTCCCAGGAAATGCTTT	0.443																																							uc004fcd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|central_nervous_system(1)|pancreas(1)	7						c.(2422-2424)AGG>ATG		SLIT and NTRK-like family, member 2 precursor							94.0	93.0	93.0					X																	144906366		2203	4300	6503	SO:0001583	missense	84631					integral to membrane		g.chrX:144906366G>T	Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.2423G>T	X.37:g.144906366G>T	ENSP00000359521:p.Arg808Met					SLITRK2_uc010nsp.2_Missense_Mutation_p.R808M|SLITRK2_uc010nso.2_Missense_Mutation_p.R808M|SLITRK2_uc011mwq.1_Missense_Mutation_p.R808M|SLITRK2_uc011mwr.1_Missense_Mutation_p.R808M|SLITRK2_uc011mws.1_Missense_Mutation_p.R808M|SLITRK2_uc004fcg.2_Missense_Mutation_p.R808M|SLITRK2_uc011mwt.1_Missense_Mutation_p.R808M|CXorf1_uc004fch.2_5'Flank	p.R808M	NM_032539	NP_115928	Q9H156	SLIK2_HUMAN			5	3413	+	Acute lymphoblastic leukemia(192;6.56e-05)		808			Cytoplasmic (Potential).		A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Missense_Mutation	SNP	ENST00000370490.1	37	c.2423G>T	CCDS14680.1	.	.	.	.	.	.	.	.	.	.	G	19.25	3.790876	0.70452	.	.	ENSG00000185985	ENST00000447897;ENST00000370490;ENST00000434188;ENST00000413937;ENST00000428560	T;T;T;T;T	0.53857	0.6;0.6;0.6;0.6;0.6	5.38	5.38	0.77491	.	0.050048	0.85682	D	0.000000	T	0.55401	0.1918	L	0.54323	1.7	0.58432	D	0.999996	D	0.54397	0.966	P	0.46718	0.525	T	0.60835	-0.7184	10	0.62326	D	0.03	-8.4052	15.4932	0.75629	0.0:0.0:1.0:0.0	.	808	Q9H156	SLIK2_HUMAN	M	808	ENSP00000411681:R808M;ENSP00000359521:R808M;ENSP00000397015:R808M;ENSP00000407347:R808M;ENSP00000412010:R808M	ENSP00000359521:R808M	R	+	2	0	SLITRK2	144714058	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.251000	0.74343	0.600000	0.82982	AGG		0.443	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058633.1	NM_032539		75	31	1	0	2.72187e-29	0.01441	4.14071e-29	75	31				
FMR1NB	158521	broad.mit.edu	37	X	147106432	147106432	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chrX:147106432G>T	ENST00000370467.3	+	5	754	c.680G>T	c.(679-681)gGt>gTt	p.G227V		NM_152578.2	NP_689791.1	Q8N0W7	FMR1N_HUMAN	fragile X mental retardation 1 neighbor	227						integral component of membrane (GO:0016021)|nucleolus (GO:0005730)		p.G227V(1)		breast(2)|cervix(1)|endometrium(3)|large_intestine(7)|lung(10)|ovary(1)|skin(1)	25	Acute lymphoblastic leukemia(192;6.56e-05)					GTTGTAACGGGTTTGAAGAAA	0.408																																							uc004fcm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(679-681)GGT>GTT		fragile X mental retardation 1 neighbor							146.0	126.0	133.0					X																	147106432		2203	4300	6503	SO:0001583	missense	158521					integral to membrane		g.chrX:147106432G>T		CCDS14683.1	Xq28	2009-03-25			ENSG00000176988	ENSG00000176988			26372	protein-coding gene	gene with protein product	"""cancer/testis antigen 37"""					12601173	Standard	NM_152578		Approved	FLJ25736, NY-SAR-35, CT37	uc004fcm.3	Q8N0W7	OTTHUMG00000022608	ENST00000370467.3:c.680G>T	X.37:g.147106432G>T	ENSP00000359498:p.Gly227Val						p.G227V	NM_152578	NP_689791	Q8N0W7	FMR1N_HUMAN			5	754	+	Acute lymphoblastic leukemia(192;6.56e-05)		227			Cytoplasmic (Potential).		D3DWT3	Missense_Mutation	SNP	ENST00000370467.3	37	c.680G>T	CCDS14683.1	.	.	.	.	.	.	.	.	.	.	G	11.88	1.770438	0.31320	.	.	ENSG00000176988	ENST00000370467	T	0.37915	1.17	3.79	-5.27	0.02763	.	1.695500	0.03567	N	0.228009	T	0.13628	0.0330	N	0.02539	-0.55	0.09310	N	1	B	0.24823	0.112	B	0.23574	0.047	T	0.13229	-1.0517	10	0.27082	T	0.32	0.0761	5.4961	0.16804	0.6338:0.0:0.1928:0.1733	.	227	Q8N0W7	FMR1N_HUMAN	V	227	ENSP00000359498:G227V	ENSP00000359498:G227V	G	+	2	0	FMR1NB	146914124	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.487000	0.00977	-1.416000	0.02019	-0.191000	0.12829	GGT		0.408	FMR1NB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058667.1	NM_152578		36	12	1	0	1.30998e-17	0.005524	1.77843e-17	36	12				
MTM1	4534	broad.mit.edu	37	X	149783137	149783137	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chrX:149783137G>T	ENST00000370396.2	+	5	361	c.307G>T	c.(307-309)Gga>Tga	p.G103*	MTM1_ENST00000542741.1_Nonsense_Mutation_p.G8*|MTM1_ENST00000306167.7_Intron|MTM1_ENST00000543350.1_Intron|MTM1_ENST00000413012.2_Intron	NM_000252.2	NP_000243.1	Q13496	MTM1_HUMAN	myotubularin 1	103					endosome to lysosome transport (GO:0008333)|intermediate filament organization (GO:0045109)|mitochondrion distribution (GO:0048311)|mitochondrion morphogenesis (GO:0070584)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|protein transport (GO:0015031)|regulation of vacuole organization (GO:0044088)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	intermediate filament binding (GO:0019215)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)	p.G103*(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|liver(1)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	Acute lymphoblastic leukemia(192;6.56e-05)					GACAAGTAGAGGAGAAAATTC	0.368																																							uc004fef.3		NA																	1	Substitution - Nonsense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3						c.(307-309)GGA>TGA		myotubularin							91.0	82.0	85.0					X																	149783137		2203	4300	6503	SO:0001587	stop_gained	4534				endosome to lysosome transport|intermediate filament organization|mitochondrion distribution|mitochondrion morphogenesis|phosphatidylinositol dephosphorylation|protein transport|regulation of vacuole organization	filopodium|late endosome|plasma membrane|ruffle	intermediate filament binding|phosphatidylinositol binding|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein tyrosine phosphatase activity	g.chrX:149783137G>T	U46024	CCDS14694.1	Xq27.3-q28	2014-09-17			ENSG00000171100	ENSG00000171100		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7448	protein-coding gene	gene with protein product		300415	"""myotubular myopathy 1"""				Standard	NM_000252		Approved		uc004fef.4	Q13496	OTTHUMG00000024158	ENST00000370396.2:c.307G>T	X.37:g.149783137G>T	ENSP00000359423:p.Gly103*					MTM1_uc011mxx.1_RNA|MTM1_uc011mxy.1_Intron|MTM1_uc011mxz.1_Intron|MTM1_uc010nte.2_Intron	p.G103*	NM_000252	NP_000243	Q13496	MTM1_HUMAN			5	383	+	Acute lymphoblastic leukemia(192;6.56e-05)		103					A6NDB1|B7Z491|F2Z330|Q8NEL1	Nonsense_Mutation	SNP	ENST00000370396.2	37	c.307G>T	CCDS14694.1	.	.	.	.	.	.	.	.	.	.	G	38	7.206803	0.98136	.	.	ENSG00000171100	ENST00000370396;ENST00000542741	.	.	.	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	16.9084	0.86134	0.0:0.0:1.0:0.0	.	.	.	.	X	103;8	.	ENSP00000359423:G103X	G	+	1	0	MTM1	149533795	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.372000	0.90127	2.342000	0.79632	0.544000	0.68410	GGA		0.368	MTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060847.3	NM_000252		10	6	1	0	1.61879e-10	0.013537	1.92906e-10	10	6				
CNGA2	1260	broad.mit.edu	37	X	150908126	150908126	+	Missense_Mutation	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chrX:150908126G>T	ENST00000329903.4	+	3	329	c.296G>T	c.(295-297)cGt>cTt	p.R99L		NM_005140.1	NP_005131.1	Q16280	CNGA2_HUMAN	cyclic nucleotide gated channel alpha 2	99					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)	p.R99L(1)		breast(4)|endometrium(4)|large_intestine(5)|lung(34)|prostate(2)	49	Acute lymphoblastic leukemia(192;6.56e-05)					GAGCGTTTTCGTGGGCCTGAA	0.552																																							uc004fey.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(3)	3						c.(295-297)CGT>CTT		cyclic nucleotide gated channel alpha 2							125.0	93.0	104.0					X																	150908126		2203	4300	6503	SO:0001583	missense	1260				response to stimulus|sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity	g.chrX:150908126G>T	S76067	CCDS14701.1	Xq27	2011-07-05			ENSG00000183862	ENSG00000183862		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2149	protein-coding gene	gene with protein product		300338		CNCA1, CNCA		7532814, 16382102	Standard	NM_005140		Approved	CNG2, OCNC1, OCNCa, OCNCALPHA, OCNCalpha, FLJ46312	uc004fey.1	Q16280	OTTHUMG00000024173	ENST00000329903.4:c.296G>T	X.37:g.150908126G>T	ENSP00000328478:p.Arg99Leu						p.R99L	NM_005140	NP_005131	Q16280	CNGA2_HUMAN			4	520	+	Acute lymphoblastic leukemia(192;6.56e-05)		99			Cytoplasmic (Potential).		A0AVD0	Missense_Mutation	SNP	ENST00000329903.4	37	c.296G>T	CCDS14701.1	.	.	.	.	.	.	.	.	.	.	G	18.95	3.731325	0.69189	.	.	ENSG00000183862	ENST00000329903	T	0.55234	0.53	5.58	3.8	0.43715	.	0.128751	0.53938	D	0.000058	T	0.50446	0.1616	M	0.73217	2.22	0.41819	D	0.990015	P	0.36282	0.546	B	0.36504	0.226	T	0.53781	-0.8390	10	0.51188	T	0.08	.	9.7164	0.40276	0.1784:0.0:0.8216:0.0	.	99	Q16280	CNGA2_HUMAN	L	99	ENSP00000328478:R99L	ENSP00000328478:R99L	R	+	2	0	CNGA2	150658782	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	5.171000	0.64996	1.126000	0.42016	0.529000	0.55759	CGT		0.552	CNGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060888.1	NM_005140		83	24	1	0	4.78148e-37	0.01441	7.59725e-37	83	24				
GABRA3	2556	broad.mit.edu	37	X	151424261	151424261	+	Silent	SNP	G	G	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chrX:151424261G>T	ENST00000370314.4	-	5	778	c.540C>A	c.(538-540)ctC>ctA	p.L180L	GABRA3_ENST00000535043.1_Silent_p.L180L	NM_000808.3	NP_000799.1	P34903	GBRA3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 3	180				L -> P (in Ref. 3; AAH28629). {ECO:0000305}.	gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.L180L(1)|p.L70L(1)		breast(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|skin(6)	37	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zolpidem(DB00425)|Zopiclone(DB01198)	TCATTGTATAGAGGAGGGTTC	0.478																																					NSCLC(142;2578 2613 10251 16743)	NSCLC(142;2578 2613 10251 16743)	uc010ntk.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(538-540)CTC>CTA		gamma-aminobutyric acid A receptor, alpha 3	Alprazolam(DB00404)|Diazepam(DB00829)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)						169.0	138.0	148.0					X																	151424261		2203	4300	6503	SO:0001819	synonymous_variant	2556				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding	g.chrX:151424261G>T		CCDS14706.1	Xq28	2012-06-22			ENSG00000011677	ENSG00000011677		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4077	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 3"""	305660					Standard	NM_000808		Approved		uc010ntk.1	P34903	OTTHUMG00000024183	ENST00000370314.4:c.540C>A	X.37:g.151424261G>T							p.L180L	NM_000808	NP_000799	P34903	GBRA3_HUMAN			5	780	-	Acute lymphoblastic leukemia(192;6.56e-05)		180	L -> P (in Ref. 3; AAH28629).		Extracellular (Probable).		Q8TAF9	Silent	SNP	ENST00000370314.4	37	c.540C>A	CCDS14706.1																																																																																				0.478	GABRA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060921.1	NM_000808		64	23	1	0	1.43675e-24	0.01441	2.1181e-24	64	23				
PDZD4	57595	broad.mit.edu	37	X	153069678	153069678	+	Silent	SNP	G	G	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chrX:153069678G>A	ENST00000164640.4	-	8	1631	c.1440C>T	c.(1438-1440)acC>acT	p.T480T	PDZD4_ENST00000393758.2_Silent_p.T405T|PDZD4_ENST00000544474.1_Silent_p.T371T|PDZD4_ENST00000475140.1_5'Flank	NM_032512.2	NP_115901.2	Q76G19	PDZD4_HUMAN	PDZ domain containing 4	480						cytoplasm (GO:0005737)		p.T480T(1)		breast(3)|cervix(1)|endometrium(5)|lung(13)|skin(1)	23	all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CAAGCAGCGGGGTGCTGCGGC	0.687																																							uc004fiz.1		NA																	1	Substitution - coding silent(1)		lung(1)	breast(1)	1						c.(1438-1440)ACC>ACT		PDZ domain containing 4							11.0	13.0	12.0					X																	153069678		2176	4236	6412	SO:0001819	synonymous_variant	57595					cell cortex		g.chrX:153069678G>A	AK091444	CCDS14732.1	Xq28	2008-02-05		2006-01-24	ENSG00000067840	ENSG00000067840			21167	protein-coding gene	gene with protein product		300634		PDZK4		10819331, 15077175	Standard	NM_032512		Approved	KIAA1444, LU1, FLJ34125, PDZRN4L	uc004fiz.1	Q76G19	OTTHUMG00000024209	ENST00000164640.4:c.1440C>T	X.37:g.153069678G>A						PDZD4_uc004fiy.1_Silent_p.T405T|PDZD4_uc004fix.2_Silent_p.T384T|PDZD4_uc004fja.1_Silent_p.T486T|PDZD4_uc011mze.1_Silent_p.T371T	p.T480T	NM_032512	NP_115901	Q76G19	PDZD4_HUMAN			8	1690	-	all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		480					B3KXB1|B7ZKY3|Q8NB75|Q9BUH9|Q9P284	Silent	SNP	ENST00000164640.4	37	c.1440C>T	CCDS14732.1																																																																																				0.687	PDZD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061013.3	NM_032512		5	4	0	0	0	0.021523	0	5	4				
NLGN4Y	22829	broad.mit.edu	37	Y	16941629	16941629	+	3'UTR	SNP	C	C	T			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chrY:16941629C>T	ENST00000476359.1	+	0	1376							Q8NFZ3	NLGNY_HUMAN	neuroligin 4, Y-linked						learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)	p.I277I(1)		large_intestine(3)|lung(7)|prostate(2)|skin(2)	14						AGAAGGCCATCATTCAGAGCG	0.522																																							uc004ftg.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(829-831)ATC>ATT		neuroligin 4, Y-linked isoform 1							46.0	39.0	41.0					Y																	16941629		608	1955	2563	SO:0001624	3_prime_UTR_variant	22829				brainstem development|cell adhesion|cerebellum development|male courtship behavior|positive regulation of organ growth|social behavior|synapse assembly|territorial aggressive behavior|vocalization behavior	cell surface|integral to plasma membrane|synapse	neurexin binding|receptor activity	g.chrY:16941629C>T		CCDS14788.1, CCDS55553.1, CCDS56619.1	Yq11.221	2013-09-20	2004-05-21		ENSG00000165246	ENSG00000165246			15529	protein-coding gene	gene with protein product		400028	"""neuroligin 4, Y linked"""			10231032	Standard	NM_014893		Approved	KIAA0951	uc004ftg.2	Q8NFZ3	OTTHUMG00000036618	ENST00000476359.1:c.*1373C>T	Y.37:g.16941629C>T						NLGN4Y_uc004fte.2_Silent_p.I109I|NLGN4Y_uc011nas.1_Silent_p.I297I|NLGN4Y_uc004ftf.2_5'UTR|NLGN4Y_uc004fth.2_Silent_p.I277I	p.I277I	NM_014893	NP_055708	Q8NFZ3	NLGNY_HUMAN			5	1083	+			277			Extracellular (Potential).		F5H6W0|Q14D08|Q7Z3T5|Q8N5B6|Q9Y2F8	Silent	SNP	ENST00000476359.1	37	c.831C>T																																																																																					0.522	NLGN4Y-004	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000089064.2	NM_014893		21	19	0	0	0	0.005443	0	21	19				
LCK	3932	broad.mit.edu	37	1	32741968	32741969	+	Frame_Shift_Ins	INS	-	-	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr1:32741968_32741969insA	ENST00000336890.5	+	8	800_801	c.662_663insA	c.(661-666)agccgcfs	p.SR221fs	LCK_ENST00000373564.3_Intron|LCK_ENST00000333070.4_Frame_Shift_Ins_p.SR221fs	NM_005356.3	NP_005347.3	P06239	LCK_HUMAN	LCK proto-oncogene, Src family tyrosine kinase	221	Interaction with PTPRH.|SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|aging (GO:0007568)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular zinc ion homeostasis (GO:0006882)|dephosphorylation (GO:0016311)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hemopoiesis (GO:0030097)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of gene expression (GO:0010628)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|positive regulation of uterine smooth muscle contraction (GO:0070474)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of defense response to virus by virus (GO:0050690)|regulation of lymphocyte activation (GO:0051249)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to zinc ion (GO:0010043)|T cell costimulation (GO:0031295)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|pericentriolar material (GO:0000242)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|ATP binding (GO:0005524)|ATPase binding (GO:0051117)|CD4 receptor binding (GO:0042609)|CD8 receptor binding (GO:0042610)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine kinase activity (GO:0004713)|SH2 domain binding (GO:0042169)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|skin(2)|urinary_tract(1)	37		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.212)			Dasatinib(DB01254)|Ponatinib(DB08901)	ACACGGTTGAGCCGCCCCTGCC	0.649			T	TRB@	T-ALL																																		uc001bux.2		NA		Dom	yes		1	1p35-p34.3	3932	T	lymphocyte-specific protein tyrosine kinase			L	TRB@		T-ALL		0				lung(3)|central_nervous_system(2)|ovary(1)	6						c.(661-663)AGCfs		lymphocyte-specific protein tyrosine kinase	Dasatinib(DB01254)																																			SO:0001589	frameshift_variant	3932				activation of caspase activity|cellular zinc ion homeostasis|induction of apoptosis|interspecies interaction between organisms|leukocyte migration|platelet activation|positive regulation of T cell receptor signaling pathway|regulation of defense response to virus by virus|release of sequestered calcium ion into cytosol|response to drug|T cell costimulation|T cell differentiation|T cell receptor signaling pathway|viral reproduction	cytosol|Golgi apparatus|membrane raft|pericentriolar material|plasma membrane	ATP binding|ATPase binding|CD4 receptor binding|CD8 receptor binding|glycoprotein binding|non-membrane spanning protein tyrosine kinase activity|phosphatidylinositol 3-kinase binding|protein C-terminus binding|protein kinase binding|protein serine/threonine phosphatase activity|SH2 domain binding	g.chr1:32741968_32741969insA	M36881	CCDS359.1	1p34.3	2014-09-17	2014-06-25		ENSG00000182866	ENSG00000182866	2.7.10.1	"""SH2 domain containing"""	6524	protein-coding gene	gene with protein product		153390	"""lymphocyte-specific protein tyrosine kinase"""			2787474	Standard	XM_005270862		Approved		uc001buy.3	P06239	OTTHUMG00000007463	Exception_encountered	1.37:g.32741968_32741969insA	ENSP00000337825:p.Ser221fs					LCK_uc001buy.2_Frame_Shift_Ins_p.S221fs|LCK_uc001buz.2_Frame_Shift_Ins_p.S221fs|LCK_uc010ohc.1_Frame_Shift_Ins_p.S265fs|LCK_uc001bva.2_Intron	p.S221fs	NM_005356	NP_005347	P06239	LCK_HUMAN			8	800_801	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.212)	221			SH2.|Interaction with PTPRH.		D3DPP8|P07100|Q12850|Q13152|Q5TDH8|Q5TDH9|Q7RTZ3|Q96DW4|Q9NYT8	Frame_Shift_Ins	INS	ENST00000336890.5	37	c.662_663insA	CCDS359.1																																																																																				0.649	LCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019616.4	NM_005356		7	106	NA	NA	NA	NA	NA	7	106	---	---	---	---
MIER1	57708	broad.mit.edu	37	1	67442326	67442326	+	Frame_Shift_Del	DEL	A	A	-			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr1:67442326delA	ENST00000355356.3	+	11	1140	c.991delA	c.(991-993)aaafs	p.K332fs	MIER1_ENST00000371016.1_Frame_Shift_Del_p.K349fs|MIER1_ENST00000401042.3_Frame_Shift_Del_p.K332fs|MIER1_ENST00000355977.6_Frame_Shift_Del_p.K269fs|MIER1_ENST00000371014.1_Frame_Shift_Del_p.K385fs|MIER1_ENST00000401041.1_Frame_Shift_Del_p.K385fs|MIER1_ENST00000357692.2_Frame_Shift_Del_p.K349fs|MIER1_ENST00000371018.3_Frame_Shift_Del_p.K349fs	NM_001077701.2|NM_001077704.2	NP_001071169.1|NP_001071172.1	Q8N108	MIER1_HUMAN	mesoderm induction early response 1, transcriptional regulator	332	SANT. {ECO:0000255|PROSITE- ProRule:PRU00624}.				positive regulation of chromatin silencing (GO:0031937)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|signal transducer activity (GO:0004871)	p.S333fs*2(1)|p.S386fs*2(1)		breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)|urinary_tract(3)	15						TTACATGTGGAAAAAATCTGA	0.333																																							uc001dde.2		NA																	2	Insertion - Frameshift(2)		large_intestine(2)	ovary(1)	1						c.(1150-1152)AAAfs		mesoderm induction early response 1 isoform b							108.0	105.0	106.0					1																	67442326		1883	4130	6013	SO:0001589	frameshift_variant	57708				positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity	g.chr1:67442326delA		CCDS41347.1, CCDS41348.1, CCDS53325.1, CCDS53326.1, CCDS53327.1, CCDS53328.1, CCDS53329.1, CCDS53330.1, CCDS60163.1	1p31.2	2013-07-23	2013-07-23		ENSG00000198160	ENSG00000198160			29657	protein-coding gene	gene with protein product			"""mesoderm induction early response 1 homolog (Xenopus laevis)"""			12242014, 12482978	Standard	NM_020948		Approved	hMI-ER1, MI-ER1, KIAA1610	uc001dde.2	Q8N108	OTTHUMG00000009194	ENST00000355356.3:c.991delA	1.37:g.67442326delA	ENSP00000347514:p.Lys332fs					MIER1_uc010opf.1_Frame_Shift_Del_p.K348fs|MIER1_uc009way.2_Frame_Shift_Del_p.K348fs|MIER1_uc001ddc.2_Frame_Shift_Del_p.K384fs|MIER1_uc001ddh.2_Frame_Shift_Del_p.K268fs|MIER1_uc001ddf.2_Frame_Shift_Del_p.K348fs|MIER1_uc001ddg.2_Frame_Shift_Del_p.K304fs|MIER1_uc010opg.1_Frame_Shift_Del_p.K348fs|MIER1_uc001ddj.1_Frame_Shift_Del_p.K331fs|MIER1_uc001ddi.2_Frame_Shift_Del_p.K331fs	p.K384fs	NM_001077700	NP_001071168	Q8N108	MIER1_HUMAN			12	1284	+			355			SANT.		C9JFD4|Q08AE0|Q32NC4|Q5T104|Q5TAD1|Q5TAD2|Q5TAD4|Q5TAD5|Q6AHY8|Q86TB4|Q8N156|Q8N161|Q8NC37|Q8NES4|Q8NES5|Q8NES6|Q8WWG2|Q9HCG2	Frame_Shift_Del	DEL	ENST00000355356.3	37	c.1150delA	CCDS41348.1																																																																																				0.333	MIER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025491.2	NM_020948		26	140	NA	NA	NA	NA	NA	26	140	---	---	---	---
FLG	2312	broad.mit.edu	37	1	152275261	152275286	+	Frame_Shift_Del	DEL	TTATTAATATACGTTGCATAATACCT	TTATTAATATACGTTGCATAATACCT	-	rs150330138|rs117440780|rs76330665|rs561151352	byFrequency	TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	TTATTAATATACGTTGCATAATACCT	TTATTAATATACGTTGCATAATACCT	-	-	TTATTAATATACGTTGCATAATACCT	TTATTAATATACGTTGCATAATACCT	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr1:152275261_152275286delTTATTAATATACGTTGCATAATACCT	ENST00000368799.1	-	3	12111_12136	c.12076_12101delAGGTATTATGCAACGTATATTAATAA	c.(12076-12102)aggtattatgcaacgtatattaataagfs	p.RYYATYINK4026fs	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	4026					establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.Y4031Y(1)|p.T4030T(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ACCTGGGTCCTTATTAATATACGTTGCATAATACCTTGGATGATCT	0.363									Ichthyosis																														uc001ezu.1		NA																	2	Substitution - coding silent(2)		large_intestine(1)|stomach(1)	ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16						c.(12076-12102)AGGTATTATGCAACGTATATTAATAAGfs		filaggrin																																				SO:0001589	frameshift_variant	2312	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	g.chr1:152275261_152275286delTTATTAATATACGTTGCATAATACCT	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.12076_12101delAGGTATTATGCAACGTATATTAATAA	1.37:g.152275261_152275286delTTATTAATATACGTTGCATAATACCT	ENSP00000357789:p.Arg4026fs						p.R4026fs	NM_002016	NP_002007	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	12112_12137	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		4026_4034					Q01720|Q5T583|Q9UC71	Frame_Shift_Del	DEL	ENST00000368799.1	37	c.12076_12101delAGGTATTATGCAACGTATATTAATAA	CCDS30860.1																																																																																				0.363	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		16	89	NA	NA	NA	NA	NA	16	89	---	---	---	---
LAMA1	284217	broad.mit.edu	37	18	6966226	6966226	+	Frame_Shift_Del	DEL	C	C	-			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr18:6966226delC	ENST00000389658.3	-	49	7063	c.6970delG	c.(6970-6972)gctfs	p.A2324fs		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	2324	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				GTCACGGTAGCCGGAAGTGAC	0.473																																							uc002knm.2		NA																	0				ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21						c.(6970-6972)GCTfs		laminin, alpha 1 precursor	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						74.0	61.0	66.0					18																	6966226		2203	4300	6503	SO:0001589	frameshift_variant	284217				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding	g.chr18:6966226delC	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.6970delG	18.37:g.6966226delC	ENSP00000374309:p.Ala2324fs					LAMA1_uc002knl.2_5'Flank|LAMA1_uc010wzj.1_Frame_Shift_Del_p.A1800fs	p.A2324fs	NM_005559	NP_005550	P25391	LAMA1_HUMAN			49	7064	-		Colorectal(10;0.172)	2324			Laminin G-like 2.			Frame_Shift_Del	DEL	ENST00000389658.3	37	c.6970delG	CCDS32787.1																																																																																				0.473	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559		10	23	NA	NA	NA	NA	NA	10	23	---	---	---	---
CNN2	1265	broad.mit.edu	37	19	1037646	1037646	+	Frame_Shift_Del	DEL	C	C	-	rs371146424		TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr19:1037646delC	ENST00000263097.4	+	7	1040	c.677delC	c.(676-678)accfs	p.T226fs	CNN2_ENST00000348419.3_Frame_Shift_Del_p.T187fs|AC011558.5_ENST00000585757.1_RNA|CNN2_ENST00000565096.2_Frame_Shift_Del_p.T215fs|CNN2_ENST00000606983.1_3'UTR|CNN2_ENST00000562958.2_Frame_Shift_Del_p.T247fs|ABCA7_ENST00000263094.6_5'Flank	NM_004368.2	NP_004359.1	Q99439	CNN2_HUMAN	calponin 2	226					actomyosin structure organization (GO:0031032)|cellular response to mechanical stimulus (GO:0071260)|cytoskeleton organization (GO:0007010)|hemopoiesis (GO:0030097)|negative regulation of cell migration (GO:0030336)|negative regulation of phagocytosis (GO:0050765)|positive regulation of gene expression (GO:0010628)|regulation of actin filament-based process (GO:0032970)|regulation of cell proliferation (GO:0042127)|wound healing (GO:0042060)	cell-cell junction (GO:0005911)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|stress fiber (GO:0001725)	actin binding (GO:0003779)			endometrium(1)|large_intestine(2)|lung(3)|prostate(1)|skin(3)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCTCCCGGGACCCGGCGGCAC	0.632																																							uc002lqu.2		NA																	0					0						c.(676-678)ACCfs		calponin 2 isoform a			,	229,3873		14,201,1836	77.0	90.0	86.0		,	4.3	1.0	19		87	311,7625		16,279,3673	no	frameshift,frameshift	CNN2	NM_201277.1,NM_004368.2	,	30,480,5509	A1A1,A1R,RR		3.9189,5.5826,4.4858	,	,	1037646	540,11498	2119	4148	6267	SO:0001589	frameshift_variant	1265				actomyosin structure organization|cellular response to mechanical stimulus|regulation of actin filament-based process	cell-cell junction|stress fiber	actin binding|calmodulin binding	g.chr19:1037646delC	D83735	CCDS12053.1, CCDS12054.1	19p13.3	2011-02-18			ENSG00000064666	ENSG00000064666			2156	protein-coding gene	gene with protein product		602373				8889829	Standard	NM_004368		Approved		uc002lqu.3	Q99439		ENST00000263097.4:c.677delC	19.37:g.1037646delC	ENSP00000263097:p.Thr226fs					ABCA7_uc002lqw.3_5'Flank|CNN2_uc002lqv.2_Frame_Shift_Del_p.T187fs|CNN2_uc010xgb.1_Frame_Shift_Del_p.T215fs|CNN2_uc010xgc.1_Frame_Shift_Del_p.T247fs|ABCA7_uc010dsa.2_5'Flank	p.T226fs	NM_004368	NP_004359	Q99439	CNN2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	7	1040	+		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)	226			Calponin-like 2.		A5D8U8|A6NFI4|D6W5X9|Q92578	Frame_Shift_Del	DEL	ENST00000263097.4	37	c.677delC	CCDS12053.1																																																																																				0.632	CNN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420293.3	NM_004368		10	503	NA	NA	NA	NA	NA	10	503	---	---	---	---
LPIN1	23175	broad.mit.edu	37	2	11913804	11913805	+	Frame_Shift_Ins	INS	-	-	TT			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr2:11913804_11913805insTT	ENST00000256720.2	+	5	748_749	c.655_656insTT	c.(655-657)ctgfs	p.L219fs	LPIN1_ENST00000425416.2_Frame_Shift_Ins_p.L225fs|LPIN1_ENST00000396098.1_Frame_Shift_Ins_p.L225fs|LPIN1_ENST00000449576.2_Frame_Shift_Ins_p.L268fs|LPIN1_ENST00000396099.1_Frame_Shift_Ins_p.L225fs	NM_145693.2	NP_663731.1	Q14693	LPIN1_HUMAN	lipin 1	219					cellular lipid metabolic process (GO:0044255)|fatty acid catabolic process (GO:0009062)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)|triglyceride mobilization (GO:0006642)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)	p.A220_V221delAV(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(15)|liver(1)|lung(10)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	45	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.173)		AAACCTCTCCCTGGCTGTGATT	0.446																																							uc010yjn.1		NA																	1	Deletion - In frame(1)		kidney(1)	ovary(2)|large_intestine(1)|skin(1)	4						c.(655-657)CTGfs		lipin 1																																				SO:0001589	frameshift_variant	23175				fatty acid catabolic process|transcription, DNA-dependent|triglyceride biosynthetic process|triglyceride mobilization	cytosol|endoplasmic reticulum membrane	phosphatidate phosphatase activity	g.chr2:11913804_11913805insTT	D80010	CCDS1682.1, CCDS58699.1, CCDS58700.1, CCDS58701.1	2p25.1	2008-05-23			ENSG00000134324	ENSG00000134324			13345	protein-coding gene	gene with protein product		605518				11138012, 8724849, 16950137	Standard	NM_145693		Approved	KIAA0188	uc010yjm.3	Q14693	OTTHUMG00000119082	Exception_encountered	2.37:g.11913804_11913805insTT	ENSP00000256720:p.Leu219fs					LPIN1_uc010yjm.1_Frame_Shift_Ins_p.L268fs|LPIN1_uc002rbt.2_Frame_Shift_Ins_p.L219fs|LPIN1_uc002rbs.2_Frame_Shift_Ins_p.L219fs	p.L219fs	NM_145693	NP_663731	Q14693	LPIN1_HUMAN		Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.173)	6	929_930	+	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)		219					A8MU38|B4DET9|B4DGS4|B4DGZ6|B5MC18|B7Z858|D6W506|E7ESE7|F5GY24|Q53T25	Frame_Shift_Ins	INS	ENST00000256720.2	37	c.655_656insTT	CCDS1682.1																																																																																				0.446	LPIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239296.3	NM_145693		42	232	NA	NA	NA	NA	NA	42	232	---	---	---	---
CEP68	23177	broad.mit.edu	37	2	65299464	65299470	+	Frame_Shift_Del	DEL	GAGCGCA	GAGCGCA	-	rs141435576		TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	GAGCGCA	GAGCGCA	-	-	GAGCGCA	GAGCGCA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr2:65299464_65299470delGAGCGCA	ENST00000377990.2	+	3	1437_1443	c.1234_1240delGAGCGCA	c.(1234-1242)gagcgcagafs	p.ERR412fs	CEP68_ENST00000546106.1_Frame_Shift_Del_p.ERR412fs|CEP68_ENST00000497039.1_3'UTR|CEP68_ENST00000537589.1_Frame_Shift_Del_p.ERR24fs|CEP68_ENST00000260569.4_Frame_Shift_Del_p.ERR412fs|RAB1A_ENST00000494188.1_Intron	NM_015147.2	NP_055962.2	Q76N32	CEP68_HUMAN	centrosomal protein 68kDa	412					centriole-centriole cohesion (GO:0010457)|centrosome organization (GO:0051297)|protein localization to organelle (GO:0033365)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|endometrium(6)|kidney(8)|large_intestine(5)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32						TGCTCGTTGGGAGCGCAGAGAGCCAGC	0.623																																							uc002sdl.3		NA																	0				skin(1)	1						c.(1234-1242)GAGCGCAGAfs		centrosomal protein 68kDa																																				SO:0001589	frameshift_variant	23177				centrosome organization	centrosome		g.chr2:65299464_65299470delGAGCGCA	BC004873	CCDS1880.2	2p14	2014-02-20	2005-12-01	2005-12-01	ENSG00000011523	ENSG00000011523			29076	protein-coding gene	gene with protein product			"""KIAA0582"""	KIAA0582		9628581, 9847074, 14654843	Standard	NM_015147		Approved		uc002sdl.4	Q76N32	OTTHUMG00000129538	ENST00000377990.2:c.1234_1240delGAGCGCA	2.37:g.65299464_65299470delGAGCGCA	ENSP00000367229:p.Glu412fs					CEP68_uc002sdj.2_Frame_Shift_Del_p.E412fs|CEP68_uc010yqb.1_Frame_Shift_Del_p.E412fs|CEP68_uc002sdk.3_Frame_Shift_Del_p.E412fs|CEP68_uc010yqc.1_Frame_Shift_Del_p.E412fs|CEP68_uc010yqd.1_Frame_Shift_Del_p.E412fs	p.E412fs	NM_015147	NP_055962	Q76N32	CEP68_HUMAN			3	1448_1454	+			412_414					B4DRQ1|D6W5F1|D6W5F2|O60326|Q9BQ18|Q9UDM9	Frame_Shift_Del	DEL	ENST00000377990.2	37	c.1234_1240delGAGCGCA	CCDS1880.2																																																																																				0.623	CEP68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251727.2	NM_015147		23	236	NA	NA	NA	NA	NA	23	236	---	---	---	---
CHEK2	11200	broad.mit.edu	37	22	29090083	29090083	+	Frame_Shift_Del	DEL	C	C	-			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr22:29090083delC	ENST00000405598.1	-	14	1589	c.1398delG	c.(1396-1398)ttgfs	p.L467fs	CHEK2_ENST00000382580.2_Frame_Shift_Del_p.L510fs|CHEK2_ENST00000328354.6_Frame_Shift_Del_p.L467fs|CHEK2_ENST00000382578.1_Frame_Shift_Del_p.L376fs|CHEK2_ENST00000382566.1_3'UTR|CHEK2_ENST00000403642.1_Frame_Shift_Del_p.L376fs|CHEK2_ENST00000544772.1_Frame_Shift_Del_p.L246fs|CHEK2_ENST00000382565.1_Intron|CHEK2_ENST00000402731.1_Frame_Shift_Del_p.L438fs|CHEK2_ENST00000348295.3_Frame_Shift_Del_p.L438fs|CHEK2_ENST00000404276.1_Frame_Shift_Del_p.L467fs|CHEK2_ENST00000464581.1_5'Flank			O96017	CHK2_HUMAN	checkpoint kinase 2	467	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular protein catabolic process (GO:0044257)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|double-strand break repair (GO:0006302)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|replicative senescence (GO:0090399)|response to gamma radiation (GO:0010332)|signal transduction in response to DNA damage (GO:0042770)|signal transduction involved in intra-S DNA damage checkpoint (GO:0072428)|spindle assembly involved in mitosis (GO:0090307)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(17)|endometrium(2)|kidney(11)|large_intestine(2)|lung(11)|ovary(1)|prostate(4)|stomach(2)	50						CCACTACCAACAACTTCTTGA	0.433			F			breast		Direct reversal of damage;Other conserved DNA damage response genes																															uc003adu.1		NA	yes	Rec		familial breast cancer	22	22q12.1	11200	F	CHK2 checkpoint homolog (S. pombe)			E		breast 			0				central_nervous_system(17)|stomach(1)|ovary(1)|lung(1)	20						c.(1396-1398)TTGfs	Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes	protein kinase CHK2 isoform a							183.0	208.0	199.0					22																	29090083		1393	2345	3738	SO:0001589	frameshift_variant	11200	Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|CHEK2-associated_cancer			cell cycle|DNA damage checkpoint|DNA damage response, signal transduction resulting in induction of apoptosis|replicative senescence	PML body	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity	g.chr22:29090083delC	AF086904	CCDS13843.1, CCDS13844.1, CCDS33629.1	22q12.1	2014-09-17	2011-11-11	2001-09-27	ENSG00000183765	ENSG00000183765			16627	protein-coding gene	gene with protein product		604373	"""CHK2 (checkpoint, S.pombe) homolog"", ""CHK2 checkpoint homolog (S. pombe)"""	RAD53		9836640, 10097108	Standard	NM_001257387		Approved	CDS1, CHK2, HuCds1, PP1425, bA444G7	uc003adt.1	O96017	OTTHUMG00000151023	ENST00000405598.1:c.1398delG	22.37:g.29090083delC	ENSP00000386087:p.Leu467fs					CHEK2_uc003ads.1_Frame_Shift_Del_p.L245fs|CHEK2_uc010gvh.1_Frame_Shift_Del_p.L375fs|CHEK2_uc010gvi.1_Intron|CHEK2_uc010gvj.1_Intron|CHEK2_uc003adr.1_RNA|CHEK2_uc010gvk.1_RNA|CHEK2_uc003adt.1_Frame_Shift_Del_p.L509fs|CHEK2_uc003adv.1_Frame_Shift_Del_p.L437fs|CHEK2_uc003adw.1_Frame_Shift_Del_p.L466fs|CHEK2_uc003adx.1_Frame_Shift_Del_p.L245fs|CHEK2_uc003ady.1_Frame_Shift_Del_p.L455fs|CHEK2_uc003adz.1_Frame_Shift_Del_p.L270fs	p.L466fs	NM_007194	NP_009125	O96017	CHK2_HUMAN			13	1470	-			466			Protein kinase.		A8K3Y9|B7ZBF3|B7ZBF4|B7ZBF5|Q6QA03|Q6QA04|Q6QA05|Q6QA06|Q6QA07|Q6QA08|Q6QA10|Q6QA11|Q6QA12|Q6QA13|Q9HBS5|Q9HCQ8|Q9UGF0|Q9UGF1	Frame_Shift_Del	DEL	ENST00000405598.1	37	c.1398delG	CCDS13843.1																																																																																				0.433	CHEK2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321150.1	NM_001005735		7	527	NA	NA	NA	NA	NA	7	527	---	---	---	---
CCDC71	64925	broad.mit.edu	37	3	49200414	49200414	+	Frame_Shift_Del	DEL	G	G	-			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr3:49200414delG	ENST00000321895.6	-	2	1334	c.1228delC	c.(1228-1230)cgafs	p.R410fs		NM_022903.3	NP_075054.3	Q8IV32	CCD71_HUMAN	coiled-coil domain containing 71	410								p.R410R(1)		endometrium(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)	10				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00217)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		TTAGGAGATCGGGGCCCAAGC	0.567																																							uc003cwg.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1228-1230)CGAfs		coiled-coil domain containing 71							113.0	112.0	112.0					3																	49200414		2203	4300	6503	SO:0001589	frameshift_variant	64925							g.chr3:49200414delG	AK022862	CCDS2790.1	3p21.31	2014-02-12			ENSG00000177352	ENSG00000177352			25760	protein-coding gene	gene with protein product						12477932	Standard	NM_022903		Approved	FLJ12800	uc003cwg.4	Q8IV32	OTTHUMG00000156815	ENST00000321895.6:c.1228delC	3.37:g.49200414delG	ENSP00000319006:p.Arg410fs						p.R410fs	NM_022903	NP_075054	Q8IV32	CCD71_HUMAN		BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00217)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)	2	1366	-			410					Q6IPE2|Q9H8H4|Q9H9F1	Frame_Shift_Del	DEL	ENST00000321895.6	37	c.1228delC	CCDS2790.1																																																																																				0.567	CCDC71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345980.1	NM_022903		72	101	NA	NA	NA	NA	NA	72	101	---	---	---	---
UBE2D3	7323	broad.mit.edu	37	4	103722680	103722681	+	Frame_Shift_Ins	INS	-	-	A			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr4:103722680_103722681insA	ENST00000453744.2	-	6	747_748	c.234_235insT	c.(232-237)attaacfs	p.N79fs	UBE2D3_ENST00000507845.1_Frame_Shift_Ins_p.N50fs|UBE2D3_ENST00000338145.3_Frame_Shift_Ins_p.N79fs|UBE2D3_ENST00000505207.1_Frame_Shift_Ins_p.N50fs|UBE2D3_ENST00000343106.5_Frame_Shift_Ins_p.N79fs|UBE2D3_ENST00000394804.2_Frame_Shift_Ins_p.N79fs|UBE2D3_ENST00000357194.6_Frame_Shift_Ins_p.N81fs|UBE2D3_ENST00000394801.4_Frame_Shift_Ins_p.N79fs|UBE2D3_ENST00000504211.1_Frame_Shift_Ins_p.N50fs|UBE2D3_ENST00000321805.7_Frame_Shift_Ins_p.N79fs|UBE2D3_ENST00000394803.5_Frame_Shift_Ins_p.N79fs|UBE2D3_ENST00000349311.8_Frame_Shift_Ins_p.N79fs|UBE2D3_ENST00000502404.1_Frame_Shift_Ins_p.N50fs|UBE2D3_ENST00000350435.7_Frame_Shift_Ins_p.N73fs	NM_181891.1	NP_871620.1	P61077	UB2D3_HUMAN	ubiquitin-conjugating enzyme E2D 3	79					apoptotic process (GO:0006915)|BMP signaling pathway (GO:0030509)|cellular protein modification process (GO:0006464)|cellular response to hypoxia (GO:0071456)|DNA repair (GO:0006281)|gene expression (GO:0010467)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of type I interferon production (GO:0032480)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K11-linked ubiquitination (GO:0070979)|protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			kidney(1)|lung(3)|skin(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.13e-08)		CCATTACTGTTAATATTTGGAT	0.277																																							uc003hwk.2		NA																	0					0						c.(232-237)ATTAACfs		ubiquitin-conjugating enzyme E2D 3 isoform 1																																				SO:0001589	frameshift_variant	7323				apoptosis|BMP signaling pathway|DNA repair|negative regulation of type I interferon production|proteasomal ubiquitin-dependent protein catabolic process|protein K11-linked ubiquitination|protein K48-linked ubiquitination|protein monoubiquitination|transforming growth factor beta receptor signaling pathway	endosome membrane|plasma membrane	ATP binding|protein binding|ubiquitin-protein ligase activity	g.chr4:103722680_103722681insA	U39318	CCDS3659.1, CCDS3660.1, CCDS3661.1, CCDS75172.1	4q24	2011-05-19	2011-05-19		ENSG00000109332	ENSG00000109332		"""Ubiquitin-conjugating enzymes E2"""	12476	protein-coding gene	gene with protein product		602963	"""ubiquitin-conjugating enzyme E2D 3 (homologous to yeast UBC4/5)"", ""ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast)"""			8530467	Standard	NM_181886		Approved	UbcH5C	uc003hwl.3	P61077	OTTHUMG00000131119	ENST00000453744.2:c.235dupT	4.37:g.103722682_103722682dupA	ENSP00000396901:p.Asn79fs					UBE2D3_uc003hwi.2_Frame_Shift_Ins_p.I78fs|UBE2D3_uc003hwj.2_RNA|UBE2D3_uc003hwl.2_Frame_Shift_Ins_p.I78fs|UBE2D3_uc011cet.1_Frame_Shift_Ins_p.I78fs|UBE2D3_uc011ceu.1_Frame_Shift_Ins_p.I78fs|UBE2D3_uc003hwo.2_Frame_Shift_Ins_p.I78fs|UBE2D3_uc003hwp.2_Frame_Shift_Ins_p.I78fs|UBE2D3_uc003hwq.2_Frame_Shift_Ins_p.I80fs|UBE2D3_uc003hwr.2_Frame_Shift_Ins_p.I78fs	p.I78fs	NM_181887	NP_871616	P61077	UB2D3_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;2.13e-08)	6	695_696	-		Hepatocellular(203;0.217)	78_79					A6NJ93|A6NJB1|A6NM99|P47986|Q6IB88|Q6NXS4|Q8N924	Frame_Shift_Ins	INS	ENST00000453744.2	37	c.234_235insT	CCDS3660.1																																																																																				0.277	UBE2D3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253791.2	NM_181893		10	28	NA	NA	NA	NA	NA	10	28	---	---	---	---
PXDNL	137902	broad.mit.edu	37	8	52320781	52320781	+	Frame_Shift_Del	DEL	C	C	-			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr8:52320781delC	ENST00000356297.4	-	17	3503	c.3403delG	c.(3403-3405)gtgfs	p.V1135fs	PXDNL_ENST00000543296.1_Frame_Shift_Del_p.V1135fs	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	1135					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				GCCGAATCCACGGCCGCAGAA	0.542																																							uc003xqu.3		NA																	0				ovary(1)|pancreas(1)	2						c.(3403-3405)GTGfs		peroxidasin homolog-like precursor							79.0	85.0	83.0					8																	52320781		1885	4116	6001	SO:0001589	frameshift_variant	137902				hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity	g.chr8:52320781delC		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.3403delG	8.37:g.52320781delC	ENSP00000348645:p.Val1135fs					PXDNL_uc003xqt.3_RNA	p.V1135fs	NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN			17	3504	-		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)	1135					B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Frame_Shift_Del	DEL	ENST00000356297.4	37	c.3403delG	CCDS47855.1																																																																																				0.542	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651		37	216	NA	NA	NA	NA	NA	37	216	---	---	---	---
ZFHX4	79776	broad.mit.edu	37	8	77776623	77776624	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	TG	TG	-	-	TG	TG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr8:77776623_77776624delTG	ENST00000521891.2	+	11	11121_11122	c.10673_10674delTG	c.(10672-10674)ttgfs	p.L3558fs	ZFHX4_ENST00000518282.1_Frame_Shift_Del_p.L3532fs|ZFHX4_ENST00000050961.6_Frame_Shift_Del_p.L3509fs|ZFHX4_ENST00000455469.2_Frame_Shift_Del_p.L3513fs	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	3509					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			ACCTCAAGTTTGTGCAGCACCT	0.49										HNSCC(33;0.089)																													uc003yav.2		NA																	0				ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(10537-10539)TTGfs		zinc finger homeodomain 4																																				SO:0001589	frameshift_variant	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77776623_77776624delTG		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.10673_10674delTG	8.37:g.77776625_77776626delTG	ENSP00000430497:p.Leu3558fs	HNSCC(33;0.089)					p.L3513fs	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		11	10925_10926	+			3509			Ser-rich.		G3V138|Q18PS0|Q6ZN20	Frame_Shift_Del	DEL	ENST00000521891.2	37	c.10538_10539delTG	CCDS47878.2																																																																																				0.490	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		21	142	NA	NA	NA	NA	NA	21	142	---	---	---	---
ZNF658	26149	broad.mit.edu	37	9	40773144	40773144	+	Frame_Shift_Del	DEL	C	C	-	rs143209035	byFrequency	TCGA-05-4420-01A-01D-1265-08	TCGA-05-4420-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0536b000-eaf3-4cb2-b46b-8dd9f23c8199	a325fcb5-f41c-40c5-bbfc-ac56d5af0b3d	g.chr9:40773144delC	ENST00000602553.1	-	5	2425	c.2131delG	c.(2131-2133)gagfs	p.E711fs	ZNF658_ENST00000441795.1_Intron|ZNF658_ENST00000377626.3_Frame_Shift_Del_p.E711fs			Q5TYW1	ZN658_HUMAN	zinc finger protein 658	711					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	46				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		TAGGGTTTCTCCCCCGTGTGA	0.403																																							uc004abs.2		NA																	0				ovary(1)	1						c.(2131-2133)GAGfs		zinc finger protein 658							175.0	191.0	186.0					9																	40773144		2201	4297	6498	SO:0001589	frameshift_variant	26149				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr9:40773144delC	AA482262	CCDS75846.1	9p13.1	2013-01-08			ENSG00000196409	ENSG00000274349		"""Zinc fingers, C2H2-type"", ""-"""	25226	protein-coding gene	gene with protein product							Standard	NM_033160		Approved	MGC35232, DKFZp572C163, FLJ32813	uc004abs.2	Q5TYW1	OTTHUMG00000013392	ENST00000602553.1:c.2131delG	9.37:g.40773144delC	ENSP00000473484:p.Glu711fs					ZNF658_uc010mmm.1_Intron|ZNF658_uc010mmn.1_Frame_Shift_Del_p.E711fs	p.E711fs	NM_033160	NP_149350	Q5TYW1	ZN658_HUMAN		GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)	5	2283	-			711					Q6PIP3|Q96M55|Q9H9S6|Q9UG02	Frame_Shift_Del	DEL	ENST00000602553.1	37	c.2131delG	CCDS35023.1																																																																																				0.403	ZNF658-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467800.1	NM_033160		8	481	NA	NA	NA	NA	NA	8	481	---	---	---	---
