#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
MST1L	11223	broad.mit.edu	37	1	17085791	17085791	+	RNA	SNP	G	G	A	rs2297532		TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr1:17085791G>A	ENST00000455405.2	-	0	0							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)										TCTGTACAACGCCGGATCTGG	0.692																																							uc010ock.1		NA																	0					0						c.(1030-1032)CGT>TGT		SubName: Full=Hepatocyte growth factor-like protein homolog;																																						11223							g.chr1:17085791G>A	U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17085791G>A						CROCC_uc009voy.1_Intron|MST1P9_uc001azp.3_5'UTR	p.R344C	NR_002729						8	1030	-								B7WPB1|Q13209	Missense_Mutation	SNP	ENST00000455405.2	37	c.1030C>T		124	0.056776556776556776	29	0.05894308943089431	16	0.04419889502762431	48	0.08391608391608392	31	0.040897097625329816	.	15.12	2.737865	0.49045	.	.	ENSG00000186715	ENST00000389184;ENST00000334998;ENST00000442552	.	.	.	.	.	.	.	0.000000	0.42548	D	0.000696	T	0.09069	0.0224	.	.	.	.	.	.	D	0.89917	1.0	D	0.78314	0.991	T	0.53136	-0.8481	6	0.87932	D	0	.	5.8178	0.18506	0.001:0.0:0.999:0.0	rs2297532;rs3981961;rs3982167;rs9701622;rs57280630	344	Q2TV78-2	.	C	334;344;344	.	ENSP00000439273:R344C	R	-	1	0	MST1P9	16958378	1.000000	0.71417	0.000000	0.03702	0.000000	0.00434	6.473000	0.73572	-0.000000	0.14550	0.000000	0.15137	CGT		0.692	MST1L-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000400328.1	NM_001271733		4	23	0	0	0	0.02938	0	4	23				
EMC1	23065	broad.mit.edu	37	1	19545844	19545844	+	Missense_Mutation	SNP	T	T	A			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr1:19545844T>A	ENST00000477853.1	-	23	2977	c.2935A>T	c.(2935-2937)Act>Tct	p.T979S	EMC1_ENST00000375199.3_Missense_Mutation_p.T978S|EMC1_ENST00000480380.1_5'UTR|RP1-43E13.2_ENST00000437898.1_RNA|EMC1_ENST00000375208.3_Missense_Mutation_p.T957S	NM_001271427.1|NM_001271428.1|NM_015047.2	NP_001258356.1|NP_001258357.1|NP_055862.1	Q8N766	EMC1_HUMAN	ER membrane protein complex subunit 1	979						ER membrane protein complex (GO:0072546)|integral component of membrane (GO:0016021)		p.T979S(1)									AGTCTCTTAGTGATCATGGTG	0.498																																						GBM(4;72 124 25802 30195)	uc001bbo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2935-2937)ACT>TCT		hypothetical protein LOC23065 precursor							83.0	75.0	78.0					1																	19545844		2203	4300	6503	SO:0001583	missense	23065					integral to membrane	protein binding	g.chr1:19545844T>A		CCDS190.1, CCDS59190.1, CCDS59191.1	1p36.13	2012-05-23	2012-05-23	2012-05-23	ENSG00000127463	ENSG00000127463			28957	protein-coding gene	gene with protein product			"""KIAA0090"""	KIAA0090		22119785	Standard	NM_015047		Approved		uc001bbo.4	Q8N766	OTTHUMG00000002497	ENST00000477853.1:c.2935A>T	1.37:g.19545844T>A	ENSP00000420608:p.Thr979Ser					KIAA0090_uc001bbn.2_RNA|KIAA0090_uc001bbp.2_Missense_Mutation_p.T978S|KIAA0090_uc001bbq.2_Missense_Mutation_p.T978S|KIAA0090_uc001bbr.2_Missense_Mutation_p.T957S	p.T979S	NM_015047	NP_055862	Q8N766	K0090_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00492)|BRCA - Breast invasive adenocarcinoma(304;3.84e-05)|Kidney(64;0.000191)|KIRC - Kidney renal clear cell carcinoma(64;0.00274)|GBM - Glioblastoma multiforme(114;0.005)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0656)	23	2978	-		Colorectal(325;0.000147)|Renal(390;0.000469)|Breast(348;0.00366)|all_lung(284;0.00519)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)	979			DUF1620.|Helical; (Potential).		A8K6F3|Q14700|Q5TG62|Q63HL0|Q63HL3|Q8NBH8	Missense_Mutation	SNP	ENST00000477853.1	37	c.2935A>T	CCDS190.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.61|15.61	2.884168|2.884168	0.51908|0.51908	.|.	.|.	ENSG00000127463|ENSG00000127463	ENST00000375197|ENST00000477853;ENST00000375199;ENST00000375208	.|T;T;T	.|0.26067	.|1.76;1.76;1.76	6.06|6.06	6.06|6.06	0.98353|0.98353	.|Domain of unknown function DUF1620 (1);	.|0.040326	.|0.85682	.|D	.|0.000000	T|T	0.14313|0.14313	0.0346|0.0346	N|N	0.03177|0.03177	-0.4|-0.4	0.80722|0.80722	D|D	1|1	.|B;B;B;B	.|0.17465	.|0.015;0.015;0.018;0.022	.|B;B;B;B	.|0.23852	.|0.024;0.024;0.029;0.049	T|T	0.15549|0.15549	-1.0433|-1.0433	5|10	.|0.31617	.|T	.|0.26	.|.	15.4367|15.4367	0.75152|0.75152	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|957;978;978;979	.|Q8N766-4;Q8N766-2;Q8N766-3;Q8N766	.|.;.;.;K0090_HUMAN	L|S	603|979;978;957	.|ENSP00000420608:T979S;ENSP00000364345:T978S;ENSP00000364354:T957S	.|ENSP00000364345:T978S	H|T	-|-	2|1	0|0	KIAA0090|KIAA0090	19418431|19418431	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.624000|7.624000	0.83124|0.83124	2.322000|2.322000	0.78497|0.78497	0.528000|0.528000	0.53228|0.53228	CAC|ACT		0.498	EMC1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000007076.2	NM_015047		9	41	0	0	0	0.010729	0	9	41				
TMEM234	56063	broad.mit.edu	37	1	32682936	32682936	+	Silent	SNP	C	C	A			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr1:32682936C>A	ENST00000344461.3	-	4	267	c.252G>T	c.(250-252)gtG>gtT	p.V84V	TMEM234_ENST00000373593.1_Silent_p.V84V|TMEM234_ENST00000545122.1_Silent_p.V84V|TMEM234_ENST00000309777.6_Silent_p.V84V|TMEM234_ENST00000485689.1_5'UTR			Q8WY98	TM234_HUMAN	transmembrane protein 234	84						integral component of membrane (GO:0016021)		p.V84V(1)		kidney(2)|lung(3)	5						TACAGATGGGCACAGCCAGGG	0.453																																							uc009vub.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(250-252)GTG>GTT		RecName: Full=UPF0546 membrane protein C1orf91;							118.0	108.0	112.0					1																	32682936		2203	4300	6503	SO:0001819	synonymous_variant	56063					integral to membrane		g.chr1:32682936C>A	AY358586	CCDS356.2	1p36.11-p34.2	2011-02-14	2011-02-14	2011-02-14	ENSG00000160055	ENSG00000160055			28837	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 91"""	C1orf91		12477932	Standard	XM_005271045		Approved	RP4-622L5, dJ622L5.7, FLJ90779	uc001buq.4	Q8WY98	OTTHUMG00000005742	ENST00000344461.3:c.252G>T	1.37:g.32682936C>A						C1orf91_uc001buo.3_RNA|C1orf91_uc001bup.3_RNA|C1orf91_uc010oha.1_RNA|C1orf91_uc001buq.3_Silent_p.V84V	p.V84V			Q8WY98	TM234_HUMAN			4	255	-		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)	84			Helical; (Potential).		B2R535|D3DPP7|Q6UWY9|Q8N2H6|Q9BSR2|Q9NU76	Silent	SNP	ENST00000344461.3	37	c.252G>T																																																																																					0.453	TMEM234-009	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000092260.2	NM_019118		7	66	1	0	0.000157383	0.038147	0.000175297	7	66				
ORC1	4998	broad.mit.edu	37	1	52867116	52867116	+	Silent	SNP	G	G	A			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr1:52867116G>A	ENST00000371568.3	-	3	359	c.141C>T	c.(139-141)atC>atT	p.I47I	ORC1_ENST00000371566.1_Silent_p.I47I	NM_001190818.1|NM_001190819.1|NM_004153.3	NP_001177747.1|NP_001177748.1|NP_004144.2	Q13415	ORC1_HUMAN	origin recognition complex, subunit 1	47	BAH. {ECO:0000255|PROSITE- ProRule:PRU00370}.				DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear origin of replication recognition complex (GO:0005664)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.I47I(1)		breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						GTCCAATCTGGATGTGAATCT	0.408																																							uc001ctt.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(139-141)ATC>ATT		origin recognition complex, subunit 1							214.0	189.0	197.0					1																	52867116		2203	4300	6503	SO:0001819	synonymous_variant	4998				cell cycle checkpoint|DNA-dependent DNA replication initiation|M/G1 transition of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle	cytosol|nuclear origin of replication recognition complex|nucleolus|nucleoplasm|plasma membrane	ATP binding|DNA binding|nucleoside-triphosphatase activity|protein binding	g.chr1:52867116G>A		CCDS566.1	1p32	2010-10-12	2010-10-12	2010-10-12	ENSG00000085840	ENSG00000085840		"""ATPases / AAA-type"""	8487	protein-coding gene	gene with protein product	"""origin recognition complex, subunit 1, S. cerevisiae, homolog-like"", ""origin recognition complex 1"", ""replication control protein 1"""	601902	"""origin recognition complex, subunit 1 (yeast homolog)-like"", ""origin recognition complex, subunit 1-like (yeast)"", ""origin recognition complex, subunit 1 homolog (S. cerevisiae)"""	ORC1L		8884289	Standard	NM_004153		Approved	HSORC1, PARC1	uc001ctu.3	Q13415	OTTHUMG00000008104	ENST00000371568.3:c.141C>T	1.37:g.52867116G>A						ORC1L_uc010oni.1_Silent_p.I47I|ORC1L_uc001ctu.2_Silent_p.I47I|ORC1L_uc009vzd.2_Intron	p.I47I	NM_004153	NP_004144	Q13415	ORC1_HUMAN			3	360	-			47			BAH.		D3DQ34|Q13471|Q5T0F5	Silent	SNP	ENST00000371568.3	37	c.141C>T	CCDS566.1																																																																																				0.408	ORC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022202.1	NM_004153		16	92	0	0	0	0.028581	0	16	92				
CD1D	912	broad.mit.edu	37	1	158153922	158153922	+	Silent	SNP	C	C	T			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr1:158153922C>T	ENST00000368171.3	+	7	1489	c.990C>T	c.(988-990)tcC>tcT	p.S330S		NM_001766.3	NP_001757.1	P15813	CD1D_HUMAN	CD1d molecule	330					antigen processing and presentation, endogenous lipid antigen via MHC class Ib (GO:0048006)|detection of bacterium (GO:0016045)|heterotypic cell-cell adhesion (GO:0034113)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of T cell proliferation (GO:0042102)|T cell selection (GO:0045058)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	beta-2-microglobulin binding (GO:0030881)|cell adhesion molecule binding (GO:0050839)|exogenous lipid antigen binding (GO:0030884)|histone binding (GO:0042393)|lipid antigen binding (GO:0030882)|receptor activity (GO:0004872)	p.S330S(1)		endometrium(1)|kidney(2)|large_intestine(2)|lung(19)|ovary(1)|prostate(3)|urinary_tract(2)	30	all_hematologic(112;0.0378)					CTCACAGTTCCTATCAGGGCG	0.517																																							uc001frr.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(988-990)TCC>TCT		CD1D antigen precursor							230.0	213.0	219.0					1																	158153922		2203	4300	6503	SO:0001819	synonymous_variant	912				antigen processing and presentation, endogenous lipid antigen via MHC class Ib|detection of bacterium|innate immune response|interspecies interaction between organisms|positive regulation of innate immune response|T cell selection	endosome membrane|integral to plasma membrane|lysosomal membrane	beta-2-microglobulin binding|exogenous lipid antigen binding|histone binding	g.chr1:158153922C>T	BC027926	CCDS1173.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158473	ENSG00000158473		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1637	protein-coding gene	gene with protein product		188410	"""CD1D antigen, d polypeptide"", ""CD1d antigen"""			2463622	Standard	NM_001766		Approved		uc001frr.3	P15813	OTTHUMG00000022436	ENST00000368171.3:c.990C>T	1.37:g.158153922C>T						CD1D_uc009wss.2_Silent_p.S237S	p.S330S	NM_001766	NP_001757	P15813	CD1D_HUMAN			7	1489	+	all_hematologic(112;0.0378)		330			Cytoplasmic (Potential).		D3DVD5|Q5W0J3|Q9UMM3|Q9Y5M4	Silent	SNP	ENST00000368171.3	37	c.990C>T	CCDS1173.1																																																																																				0.517	CD1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058340.1	NM_001766		3	110	0	0	0	0.009096	0	3	110				
PAPPA2	60676	broad.mit.edu	37	1	176564566	176564566	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr1:176564566G>A	ENST00000367662.3	+	3	2990	c.1826G>A	c.(1825-1827)gGg>gAg	p.G609E	PAPPA2_ENST00000367661.3_Missense_Mutation_p.G609E	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	609	Metalloprotease.				bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.G609E(2)		NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						GGCTATGATGGGGGTGACTGC	0.587																																							uc001gkz.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						c.(1825-1827)GGG>GAG		pappalysin 2 isoform 1							76.0	82.0	80.0					1																	176564566		2096	4221	6317	SO:0001583	missense	60676				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding	g.chr1:176564566G>A	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.1826G>A	1.37:g.176564566G>A	ENSP00000356634:p.Gly609Glu					PAPPA2_uc001gky.1_Missense_Mutation_p.G609E|PAPPA2_uc009www.2_RNA	p.G609E	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN			3	2990	+			609			Metalloprotease.		A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	37	c.1826G>A	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.371751	0.82573	.	.	ENSG00000116183	ENST00000367662;ENST00000367661	D;D	0.97089	-4.24;-4.24	5.42	5.42	0.78866	Notch domain (2);	0.000000	0.85682	D	0.000000	D	0.98112	0.9377	M	0.62723	1.935	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.99267	1.0892	10	0.87932	D	0	-21.8023	18.8444	0.92198	0.0:0.0:1.0:0.0	.	609;609	Q9BXP8;A9Z1Y8	PAPP2_HUMAN;.	E	609	ENSP00000356634:G609E;ENSP00000356633:G609E	ENSP00000356633:G609E	G	+	2	0	PAPPA2	174831189	1.000000	0.71417	0.996000	0.52242	0.712000	0.41017	7.739000	0.84976	2.542000	0.85734	0.650000	0.86243	GGG		0.587	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1			6	66	0	0	0	0.021553	0	6	66				
CTSE	1510	broad.mit.edu	37	1	206325297	206325297	+	Silent	SNP	G	G	A			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr1:206325297G>A	ENST00000358184.2	+	5	640	c.522G>A	c.(520-522)caG>caA	p.Q174Q	CTSE_ENST00000432969.2_Silent_p.Q99Q|CTSE_ENST00000360218.2_Silent_p.Q174Q|CTSE_ENST00000468617.1_3'UTR|CTSE_ENST00000361052.3_Silent_p.Q179Q	NM_001910.3	NP_001901.1	P14091	CATE_HUMAN	cathepsin E	179					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|digestion (GO:0007586)|protein autoprocessing (GO:0016540)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase activity (GO:0004190)	p.Q174Q(2)		endometrium(2)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|skin(3)	16			BRCA - Breast invasive adenocarcinoma(75;0.0754)			AGCCAGGCCAGACCTTTGTGG	0.532																																							uc001hdu.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(520-522)CAG>CAA		cathepsin E isoform a preproprotein							169.0	152.0	158.0					1																	206325297		2203	4300	6503	SO:0001819	synonymous_variant	1510				antigen processing and presentation of exogenous peptide antigen via MHC class II|digestion|proteolysis	endosome	aspartic-type endopeptidase activity	g.chr1:206325297G>A	BC042537	CCDS73012.1, CCDS73013.1	1q32.1	2008-02-05			ENSG00000196188	ENSG00000196188	3.4.23.5	"""Cathepsins"""	2530	protein-coding gene	gene with protein product		116890				2369841, 2674141	Standard	NM_001910		Approved		uc001hdu.3	P14091	OTTHUMG00000036121	ENST00000358184.2:c.522G>A	1.37:g.206325297G>A						CTSE_uc001hdv.2_Silent_p.Q174Q|CTSE_uc010prs.1_Silent_p.Q99Q	p.Q174Q	NM_001910	NP_001901	P14091	CATE_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.0754)		5	640	+			179					Q5TZ01|Q5TZ02|Q9NY58|Q9UCE3|Q9UCE4	Silent	SNP	ENST00000358184.2	37	c.522G>A	CCDS1462.1																																																																																				0.532	CTSE-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000087998.1	NM_001910		3	57	0	0	0	0.004672	0	3	57				
OR2T11	127077	broad.mit.edu	37	1	248790184	248790184	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr1:248790184C>G	ENST00000330803.2	-	1	307	c.246G>C	c.(244-246)atG>atC	p.M82I		NM_001001964.1	NP_001001964.1	Q8NH01	O2T11_HUMAN	olfactory receptor, family 2, subfamily T, member 11 (gene/pseudogene)	82						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M82I(1)		breast(1)|large_intestine(5)|lung(20)|skin(2)	28	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CTTTAGAAACCATGTCTGCCA	0.502																																							uc001ier.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)	1						c.(244-246)ATG>ATC		olfactory receptor, family 2, subfamily T,							68.0	67.0	67.0					1																	248790184		2053	4234	6287	SO:0001583	missense	127077				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248790184C>G	BK004476	CCDS31122.1	1q44	2013-10-10	2013-10-10		ENSG00000183130	ENSG00000183130		"""GPCR / Class A : Olfactory receptors"""	19574	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 11"""				Standard	NM_001001964		Approved	OR2T11Q	uc001ier.1	Q8NH01	OTTHUMG00000040384	ENST00000330803.2:c.246G>C	1.37:g.248790184C>G	ENSP00000328934:p.Met82Ile						p.M82I	NM_001001964	NP_001001964	Q8NH01	O2T11_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	246	-	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		82			Extracellular (Potential).		Q6IEY6	Missense_Mutation	SNP	ENST00000330803.2	37	c.246G>C	CCDS31122.1	.	.	.	.	.	.	.	.	.	.	.	2.461	-0.324020	0.05350	.	.	ENSG00000183130	ENST00000330803	T	0.00307	8.17	4.62	2.64	0.31445	GPCR, rhodopsin-like superfamily (1);	0.000000	0.52532	D	0.000065	T	0.00109	0.0003	N	0.02765	-0.5	0.09310	N	1	B	0.11235	0.004	B	0.10450	0.005	T	0.39187	-0.9626	10	0.66056	D	0.02	.	3.8093	0.08791	0.1579:0.4482:0.3066:0.0873	.	82	Q8NH01	O2T11_HUMAN	I	82	ENSP00000328934:M82I	ENSP00000328934:M82I	M	-	3	0	OR2T11	246856807	0.000000	0.05858	0.154000	0.22540	0.099000	0.18886	-1.107000	0.03316	1.131000	0.42111	0.655000	0.94253	ATG		0.502	OR2T11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097134.1	NM_001001964		14	37	0	0	0	0.020292	0	14	37				
ITIH5	80760	broad.mit.edu	37	10	7618423	7618423	+	Silent	SNP	C	C	T	rs199861557		TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr10:7618423C>T	ENST00000256861.6	-	10	2049	c.1971G>A	c.(1969-1971)acG>acA	p.T657T	ITIH5_ENST00000434980.1_5'UTR|ITIH5_ENST00000446830.2_Silent_p.T439T|ITIH5_ENST00000298441.6_Silent_p.T443T|ITIH5_ENST00000397146.2_Silent_p.T657T|ITIH5_ENST00000397145.2_Silent_p.T657T	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	657					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.T657T(2)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						TACCTGGCTGCGTGCCAGCTC	0.682																																							uc001ijq.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|central_nervous_system(2)	4						c.(1969-1971)ACG>ACA		inter-alpha trypsin inhibitor heavy chain																																				SO:0001819	synonymous_variant	80760				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity	g.chr10:7618423C>T			10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.1971G>A	10.37:g.7618423C>T						ITIH5_uc001ijp.2_Silent_p.T443T|ITIH5_uc001ijr.1_Silent_p.T657T	p.T657T	NM_030569	NP_085046	Q86UX2	ITIH5_HUMAN			10	2050	-			657					Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Silent	SNP	ENST00000256861.6	37	c.1971G>A																																																																																					0.682	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000046688.1	NM_030569		4	18	0	0	0	0.009096	0	4	18				
MSRB2	22921	broad.mit.edu	37	10	23408331	23408331	+	Missense_Mutation	SNP	G	G	T			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr10:23408331G>T	ENST00000376510.3	+	4	498	c.395G>T	c.(394-396)cGt>cTt	p.R132L	MSRB2_ENST00000468633.1_3'UTR	NM_012228.3	NP_036360.3	Q9Y3D2	MSRB2_HUMAN	methionine sulfoxide reductase B2	132					actin filament polymerization (GO:0030041)|protein repair (GO:0030091)|regulation of transcription, DNA-templated (GO:0006355)|response to oxidative stress (GO:0006979)	mitochondrion (GO:0005739)	actin binding (GO:0003779)|peptide-methionine (R)-S-oxide reductase activity (GO:0033743)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.R132L(1)		endometrium(1)|large_intestine(2)|lung(4)|skin(1)|urinary_tract(1)	9					L-Methionine(DB00134)	ATCCTGAGACGTCTGGATACC	0.517																																					Esophageal Squamous(89;1240 1363 4973 30188 42299)	Esophageal Squamous(89;1240 1363 4973 30188 42299)	uc001iro.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(394-396)CGT>CTT		methionine sulfoxide reductase B2 precursor	L-Methionine(DB00134)						103.0	104.0	104.0					10																	23408331		1976	4160	6136	SO:0001583	missense	22921				protein repair	mitochondrion	peptide-methionine-(S)-S-oxide reductase activity|protein-methionine-R-oxide reductase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr10:23408331G>T	AF122004	CCDS41495.1	10p12	2004-12-07	2004-12-06	2004-12-07	ENSG00000148450	ENSG00000148450			17061	protein-coding gene	gene with protein product		613782	"""methionine sulfoxide reductase B"""	MSRB		8749308, 10375640	Standard	NM_012228		Approved	PILB, CGI-131, CBS1, CBS-1	uc001iro.3	Q9Y3D2	OTTHUMG00000017812	ENST00000376510.3:c.395G>T	10.37:g.23408331G>T	ENSP00000365693:p.Arg132Leu						p.R132L	NM_012228	NP_036360	Q9Y3D2	MSRB2_HUMAN			4	506	+			132					Q17R44|Q4G1C7|Q9Y5W6	Missense_Mutation	SNP	ENST00000376510.3	37	c.395G>T	CCDS41495.1	.	.	.	.	.	.	.	.	.	.	G	11.19	1.564957	0.27915	.	.	ENSG00000148450	ENST00000376510	T	0.76709	-1.04	5.05	5.05	0.67936	Mss4-like (1);Methionine sulphoxide reductase B (3);	0.000000	0.85682	D	0.000000	T	0.71970	0.3403	N	0.26092	0.79	0.58432	D	0.999994	B	0.18461	0.028	B	0.31495	0.131	T	0.69960	-0.5003	10	0.62326	D	0.03	-14.777	17.5535	0.87884	0.0:0.0:1.0:0.0	.	132	Q9Y3D2	MSRB2_HUMAN	L	132	ENSP00000365693:R132L	ENSP00000365693:R132L	R	+	2	0	MSRB2	23448337	0.924000	0.31332	0.869000	0.34112	0.134000	0.20937	4.839000	0.62810	2.510000	0.84645	0.655000	0.94253	CGT		0.517	MSRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047205.1	NM_012228		8	73	1	0	0.00448238	0.004482	0.00472374	8	73				
GPR158	57512	broad.mit.edu	37	10	25886922	25886922	+	Missense_Mutation	SNP	G	G	C			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr10:25886922G>C	ENST00000376351.3	+	11	2726	c.2367G>C	c.(2365-2367)agG>agC	p.R789S	GPR158_ENST00000490549.1_3'UTR	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	789					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R789S(1)		breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						CCCTCATCAGGAAGAACCCCC	0.552																																							uc001isj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|large_intestine(2)|pancreas(1)|skin(1)	8						c.(2365-2367)AGG>AGC		G protein-coupled receptor 158 precursor							71.0	81.0	78.0					10																	25886922		2203	4300	6503	SO:0001583	missense	57512					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr10:25886922G>C	AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.2367G>C	10.37:g.25886922G>C	ENSP00000365529:p.Arg789Ser					GPR158_uc001isk.2_Missense_Mutation_p.R164S	p.R789S	NM_020752	NP_065803	Q5T848	GP158_HUMAN			11	2427	+			789			Cytoplasmic (Potential).		Q6QR81|Q9ULT3	Missense_Mutation	SNP	ENST00000376351.3	37	c.2367G>C	CCDS31166.1	.	.	.	.	.	.	.	.	.	.	G	12.55	1.970325	0.34754	.	.	ENSG00000151025	ENST00000376351	T	0.61859	0.07	5.78	4.87	0.63330	.	0.166007	0.40818	N	0.001009	T	0.38374	0.1038	N	0.16602	0.42	0.39246	D	0.963958	P	0.38788	0.647	B	0.40825	0.341	T	0.26087	-1.0113	10	0.13108	T	0.6	.	7.6156	0.28156	0.14:0.0:0.7263:0.1337	.	789	Q5T848	GP158_HUMAN	S	789	ENSP00000365529:R789S	ENSP00000365529:R789S	R	+	3	2	GPR158	25926928	1.000000	0.71417	0.971000	0.41717	0.384000	0.30261	1.486000	0.35530	1.428000	0.47296	0.650000	0.86243	AGG		0.552	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047248.2	XM_166110		13	67	0	0	0	0.016723	0	13	67				
BMS1	9790	broad.mit.edu	37	10	43315759	43315759	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr10:43315759G>A	ENST00000374518.5	+	16	2719	c.2656G>A	c.(2656-2658)Gtc>Atc	p.V886I		NM_014753.3	NP_055568.3	Q14692	BMS1_HUMAN	BMS1 ribosome biogenesis factor	886					ribosome assembly (GO:0042255)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)	p.V886I(1)		NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(23)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						TGGGATGTACGTCCGCATTGA	0.448																																							uc001jaj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)	3						c.(2656-2658)GTC>ATC		BMS1-like, ribosome assembly protein							135.0	130.0	132.0					10																	43315759		2203	4300	6503	SO:0001583	missense	9790				ribosome assembly	nucleolus	ATP binding|GTP binding|GTPase activity	g.chr10:43315759G>A	BC043345	CCDS7199.1	10q11.21	2013-05-01	2013-05-01	2007-03-20	ENSG00000165733	ENSG00000165733			23505	protein-coding gene	gene with protein product		611448	"""BMS1-like, ribosome assembly protein (yeast)"", ""BMS1 homolog, ribosome assembly protein (yeast)"""	BMS1L		11779832	Standard	NM_014753		Approved	KIAA0187	uc001jaj.3	Q14692	OTTHUMG00000018020	ENST00000374518.5:c.2656G>A	10.37:g.43315759G>A	ENSP00000363642:p.Val886Ile						p.V886I	NM_014753	NP_055568	Q14692	BMS1_HUMAN			16	3014	+			886					Q5QPT5|Q86XJ9	Missense_Mutation	SNP	ENST00000374518.5	37	c.2656G>A	CCDS7199.1	.	.	.	.	.	.	.	.	.	.	G	19.41	3.822524	0.71028	.	.	ENSG00000165733	ENST00000374518	T	0.25579	1.79	5.05	5.05	0.67936	Ribosome biogenesis protein BMS1/TSR1, C-terminal (1);	0.068314	0.64402	D	0.000020	T	0.48169	0.1485	M	0.72576	2.205	0.48696	D	0.999693	D	0.89917	1.0	D	0.83275	0.996	T	0.39313	-0.9620	10	0.37606	T	0.19	.	12.8602	0.57910	0.0789:0.0:0.9211:0.0	.	886	Q14692	BMS1_HUMAN	I	886	ENSP00000363642:V886I	ENSP00000363642:V886I	V	+	1	0	BMS1	42635765	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	3.844000	0.55873	2.352000	0.79861	0.454000	0.30748	GTC		0.448	BMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047690.2	NM_014753		15	70	0	0	0	0.020292	0	15	70				
LRRTM3	347731	broad.mit.edu	37	10	68687143	68687143	+	Silent	SNP	C	C	A			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr10:68687143C>A	ENST00000361320.4	+	2	1047	c.469C>A	c.(469-471)Cgg>Agg	p.R157R	CTNNA3_ENST00000433211.2_Intron|CTNNA3_ENST00000373744.4_Intron	NM_178011.3	NP_821079.3	Q86VH5	LRRT3_HUMAN	leucine rich repeat transmembrane neuronal 3	157					positive regulation of beta-amyloid formation (GO:1902004)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)		p.R157R(2)		breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(20)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	41						TCGGGGCTTGCGGAAGCTGCT	0.458																																							uc001jmz.1		NA																	2	Substitution - coding silent(2)		lung(2)	upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						c.(469-471)CGG>AGG		leucine rich repeat transmembrane neuronal 3							97.0	104.0	102.0					10																	68687143		2203	4300	6503	SO:0001819	synonymous_variant	347731					integral to membrane		g.chr10:68687143C>A	BX640611	CCDS7270.1	10q22.1	2007-01-22				ENSG00000198739			19410	protein-coding gene	gene with protein product		610869				12676565	Standard	XR_247527		Approved		uc001jmz.1	Q86VH5		ENST00000361320.4:c.469C>A	10.37:g.68687143C>A						CTNNA3_uc009xpn.1_Intron|CTNNA3_uc001jmw.2_Intron|CTNNA3_uc001jmx.3_Intron|CTNNA3_uc009xpo.1_Intron|LRRTM3_uc001jmy.2_Silent_p.R157R	p.R157R	NM_178011	NP_821079	Q86VH5	LRRT3_HUMAN			2	1019	+			157			Extracellular (Potential).		A8K2A3|Q2NKX7|Q6N0A3	Silent	SNP	ENST00000361320.4	37	c.469C>A	CCDS7270.1																																																																																				0.458	LRRTM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048277.2	NM_178011		16	115	1	0	3.32936e-07	0.038395	4.07252e-07	16	115				
FAM178A	55719	broad.mit.edu	37	10	102678196	102678196	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr10:102678196C>T	ENST00000238961.4	+	4	1513	c.971C>T	c.(970-972)tCa>tTa	p.S324L	FAM178A_ENST00000370271.3_Missense_Mutation_p.S324L|FAM178A_ENST00000370269.3_Missense_Mutation_p.S324L	NM_018121.3	NP_060591.3	Q8IX21	F178A_HUMAN	family with sequence similarity 178, member A	324						chromatin (GO:0000785)|extracellular space (GO:0005615)|nucleus (GO:0005634)		p.S324L(1)									GAACCTACTTCAGGTAGAATC	0.299																																							uc001krt.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(970-972)TCA>TTA		hypothetical protein LOC55719 isoform 1							80.0	88.0	85.0					10																	102678196		2203	4298	6501	SO:0001583	missense	55719							g.chr10:102678196C>T	AF460991	CCDS7500.1, CCDS44470.1, CCDS65918.1	10q24.31	2008-07-18	2008-07-18	2008-07-18	ENSG00000119906	ENSG00000119906			17814	protein-coding gene	gene with protein product		610348	"""chromosome 10 open reading frame 6"""	C10orf6		12459258	Standard	NM_018121		Approved	FLJ10512, FLJ25012	uc001krs.3	Q8IX21	OTTHUMG00000018919	ENST00000238961.4:c.971C>T	10.37:g.102678196C>T	ENSP00000238961:p.Ser324Leu					FAM178A_uc001krr.1_Missense_Mutation_p.S324L|FAM178A_uc001krs.2_Missense_Mutation_p.S324L|FAM178A_uc001kru.1_Missense_Mutation_p.S260L	p.S324L	NM_018121	NP_060591	Q8IX21	F178A_HUMAN			4	1513	+			324					A8K950|B1AL17|Q5W0L8|Q6GMU6|Q9NPE8	Missense_Mutation	SNP	ENST00000238961.4	37	c.971C>T	CCDS7500.1	.	.	.	.	.	.	.	.	.	.	C	14.70	2.614801	0.46631	.	.	ENSG00000119906	ENST00000370271;ENST00000238961;ENST00000370269	T;T;T	0.58060	0.36;0.98;0.96	5.56	4.64	0.57946	.	0.520975	0.16358	N	0.217910	T	0.42337	0.1198	N	0.24115	0.695	0.80722	D	1	B;P;P	0.45957	0.419;0.562;0.869	B;B;B	0.43680	0.183;0.183;0.427	T	0.37842	-0.9688	10	0.59425	D	0.04	-0.731	10.9124	0.47116	0.0:0.9103:0.0:0.0897	.	324;324;324	Q8IX21;B1AL17;B1AL16	F178A_HUMAN;.;.	L	324	ENSP00000359294:S324L;ENSP00000238961:S324L;ENSP00000359292:S324L	ENSP00000238961:S324L	S	+	2	0	FAM178A	102668186	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.428000	0.59894	1.444000	0.47605	0.650000	0.86243	TCA		0.299	FAM178A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049897.3			20	141	0	0	0	0.043863	0	20	141				
VENTX	27287	broad.mit.edu	37	10	135053498	135053498	+	Silent	SNP	G	G	A			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr10:135053498G>A	ENST00000325980.9	+	3	976	c.465G>A	c.(463-465)ctG>ctA	p.L155L		NM_014468.3	NP_055283.1	O95231	VENTX_HUMAN	VENT homeobox	155					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.L155L(1)		NS(1)|endometrium(1)|large_intestine(1)|lung(9)|soft_tissue(1)|upper_aerodigestive_tract(1)	14		all_cancers(35;4.15e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;7.8e-06)|Epithelial(32;9.31e-06)|all cancers(32;1.19e-05)		ACCCCCAGCTGCACAGCCCCT	0.562																																							uc010quy.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(463-465)CTG>CTA		VENT homeobox							50.0	55.0	53.0					10																	135053498		2203	4300	6503	SO:0001819	synonymous_variant	27287				multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr10:135053498G>A	AF068006	CCDS7675.1	10q26.3	2011-06-20	2011-06-01	2005-09-27	ENSG00000151650	ENSG00000151650		"""Homeoboxes / ANTP class : NKL subclass"""	13639	protein-coding gene	gene with protein product		607158	"""VENT-like homeobox 2"", ""VENT homeobox homolog (Xenopus laevis)"""	VENTX2		10790436	Standard	NM_014468		Approved	HPX42B	uc010quy.1	O95231	OTTHUMG00000019307	ENST00000325980.9:c.465G>A	10.37:g.135053498G>A							p.L155L	NM_014468	NP_055283	O95231	VENTX_HUMAN		OV - Ovarian serous cystadenocarcinoma(35;7.8e-06)|Epithelial(32;9.31e-06)|all cancers(32;1.19e-05)	3	476	+		all_cancers(35;4.15e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)	155					Q32MZ3	Silent	SNP	ENST00000325980.9	37	c.465G>A	CCDS7675.1																																																																																				0.562	VENTX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051116.4	NM_014468		13	77	0	0	0	0.020292	0	13	77				
OR52R1	119695	broad.mit.edu	37	11	4824855	4824855	+	Missense_Mutation	SNP	C	C	A			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr11:4824855C>A	ENST00000356069.2	-	1	755	c.756G>T	c.(754-756)ttG>ttT	p.L252F	MMP26_ENST00000477339.1_Intron|OR52R1_ENST00000380382.1_Missense_Mutation_p.L331F|MMP26_ENST00000380390.1_Intron	NM_001005177.3	NP_001005177.3	Q8NGF1	O52R1_HUMAN	olfactory receptor, family 52, subfamily R, member 1	252						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L331F(1)|p.L251F(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|prostate(1)|skin(3)	29		Medulloblastoma(188;0.0025)|Breast(177;0.0184)|all_neural(188;0.0227)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		TATAAAGAGCCAAGATGACAC	0.473																																							uc010qym.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(991-993)TTG>TTT		olfactory receptor, family 52, subfamily R,							99.0	100.0	100.0					11																	4824855		2201	4298	6499	SO:0001583	missense	119695				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4824855C>A	BK004282	CCDS31360.1, CCDS31360.2	11p15.4	2012-08-09			ENSG00000176937	ENSG00000176937		"""GPCR / Class A : Olfactory receptors"""	15235	protein-coding gene	gene with protein product							Standard	NM_001005177		Approved		uc021qcs.1	Q8NGF1	OTTHUMG00000066510	ENST00000356069.2:c.756G>T	11.37:g.4824855C>A	ENSP00000348368:p.Leu252Phe						p.L331F	NM_001005177	NP_001005177	Q8NGF1	O52R1_HUMAN		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	993	-		Medulloblastoma(188;0.0025)|Breast(177;0.0184)|all_neural(188;0.0227)	252			Helical; Name=6; (Potential).		Q6IFI0	Missense_Mutation	SNP	ENST00000356069.2	37	c.993G>T	CCDS31360.2	.	.	.	.	.	.	.	.	.	.	C	14.98	2.698516	0.48307	.	.	ENSG00000176937	ENST00000356069;ENST00000380382	T;T	0.39406	1.08;1.08	5.57	-1.33	0.09172	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38837	N	0.001553	T	0.54382	0.1855	M	0.83692	2.655	0.09310	N	1	D	0.89917	1.0	D	0.80764	0.994	T	0.46610	-0.9179	10	0.72032	D	0.01	.	0.5069	0.00589	0.3621:0.2325:0.118:0.2874	.	252	Q8NGF1	O52R1_HUMAN	F	252;331	ENSP00000348368:L252F;ENSP00000369742:L331F	ENSP00000348368:L252F	L	-	3	2	OR52R1	4781431	0.000000	0.05858	0.240000	0.24138	0.848000	0.48234	-2.628000	0.00873	0.093000	0.17368	0.650000	0.86243	TTG		0.473	OR52R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142183.1	NM_001005177		14	74	1	0	3.27435e-08	0.020292	4.15358e-08	14	74				
OR52N1	79473	broad.mit.edu	37	11	5809322	5809322	+	Missense_Mutation	SNP	G	G	T			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr11:5809322G>T	ENST00000317078.1	-	1	724	c.725C>A	c.(724-726)aCc>aAc	p.T242N	TRIM5_ENST00000380027.1_Intron	NM_001001913.1	NP_001001913.1	Q8NH53	O52N1_HUMAN	olfactory receptor, family 52, subfamily N, member 1	242						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T242N(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(15)|prostate(2)|skin(3)	31		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.05e-11)|LUSC - Lung squamous cell carcinoma(625;0.112)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.195)		GGCAGTGCAGGTGCTGAAGGC	0.473																																							uc010qzo.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(724-726)ACC>AAC		olfactory receptor, family 52, subfamily N,							158.0	144.0	149.0					11																	5809322		2201	4296	6497	SO:0001583	missense	79473				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5809322G>T	AB065538	CCDS31398.1	11p15.4	2012-08-09			ENSG00000181001	ENSG00000181001		"""GPCR / Class A : Olfactory receptors"""	14853	protein-coding gene	gene with protein product							Standard	NM_001001913		Approved		uc010qzo.2	Q8NH53	OTTHUMG00000168800	ENST00000317078.1:c.725C>A	11.37:g.5809322G>T	ENSP00000322823:p.Thr242Asn					TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron	p.T242N	NM_001001913	NP_001001913	Q8NH53	O52N1_HUMAN		Epithelial(150;3.05e-11)|LUSC - Lung squamous cell carcinoma(625;0.112)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.195)	1	725	-		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)	242			Helical; Name=6; (Potential).		Q6IFF6	Missense_Mutation	SNP	ENST00000317078.1	37	c.725C>A	CCDS31398.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.221878	0.79464	.	.	ENSG00000181001	ENST00000317078	T	0.40476	1.03	4.71	4.71	0.59529	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43579	D	0.000544	T	0.74160	0.3680	H	0.94734	3.575	0.44123	D	0.9969	D	0.89917	1.0	D	0.97110	1.0	T	0.82420	-0.0466	10	0.87932	D	0	.	16.7505	0.85484	0.0:0.0:1.0:0.0	.	242	Q8NH53	O52N1_HUMAN	N	242	ENSP00000322823:T242N	ENSP00000322823:T242N	T	-	2	0	OR52N1	5765898	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.404000	0.73268	2.588000	0.87417	0.609000	0.83330	ACC		0.473	OR52N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401142.1	NM_001001913		8	60	1	0	0.000157383	0.038147	0.000175297	8	60				
ST5	6764	broad.mit.edu	37	11	8751902	8751902	+	Missense_Mutation	SNP	C	C	T	rs200023000	byFrequency	TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr11:8751902C>T	ENST00000534127.1	-	6	1320	c.935G>A	c.(934-936)cGg>cAg	p.R312Q	ST5_ENST00000530438.1_Intron|ST5_ENST00000313726.6_Missense_Mutation_p.R312Q|ST5_ENST00000526757.1_Intron|ST5_ENST00000357665.1_Missense_Mutation_p.R312Q	NM_005418.3	NP_005409.3	P78524	ST5_HUMAN	suppression of tumorigenicity 5	312					positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.R312Q(1)		NS(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(13)|liver(1)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	39				Epithelial(150;2.63e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0352)		CCTTTTCCCCCGGTCCACGCT	0.667													C|||	2	0.000399361	0.0	0.0014	5008	,	,		14536	0.0		0.001	False		,,,				2504	0.0						uc001mgt.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)	1						c.(934-936)CGG>CAG		suppression of tumorigenicity 5 isoform 1							33.0	39.0	37.0					11																	8751902		2185	4287	6472	SO:0001583	missense	6764				positive regulation of ERK1 and ERK2 cascade		protein binding	g.chr11:8751902C>T	U15131	CCDS7791.1, CCDS7792.1	11p15	2012-10-04				ENSG00000166444		"""DENN/MADD domain containing"""	11350	protein-coding gene	gene with protein product	"""DENN/MADD domain containing 2B"""	140750				1390339	Standard	NM_005418		Approved	HTS1, DENND2B, p126	uc001mgt.3	P78524		ENST00000534127.1:c.935G>A	11.37:g.8751902C>T	ENSP00000433528:p.Arg312Gln					ST5_uc009yfr.2_Intron|ST5_uc001mgu.2_Intron|ST5_uc001mgv.2_Missense_Mutation_p.R312Q|ST5_uc010rbq.1_Intron|ST5_uc001mgw.1_Missense_Mutation_p.R312Q	p.R312Q	NM_213618	NP_998783	P78524	ST5_HUMAN		Epithelial(150;2.63e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0352)	3	1121	-			312					B2R6X7|B3KXQ6|P78523|Q16492|Q7KYY2|Q7KZ12|Q8NE12|Q9BQQ6	Missense_Mutation	SNP	ENST00000534127.1	37	c.935G>A	CCDS7791.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	10.83	1.462218	0.26248	.	.	ENSG00000166444	ENST00000534127;ENST00000313726;ENST00000357665	T;T;T	0.04862	3.54;3.54;3.54	6.17	3.97	0.46021	.	0.221382	0.38005	N	0.001850	T	0.03608	0.0103	N	0.15975	0.35	0.24871	N	0.992286	B	0.10296	0.003	B	0.04013	0.001	T	0.44205	-0.9343	10	0.21540	T	0.41	0.0	6.9465	0.24522	0.0:0.662:0.1356:0.2023	.	312	P78524	ST5_HUMAN	Q	312	ENSP00000433528:R312Q;ENSP00000319678:R312Q;ENSP00000350294:R312Q	ENSP00000319678:R312Q	R	-	2	0	ST5	8708478	1.000000	0.71417	0.996000	0.52242	0.959000	0.62525	1.669000	0.37492	0.672000	0.31204	0.655000	0.94253	CGG		0.667	ST5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386518.1	NM_005418		17	71	0	0	0	0.010504	0	17	71				
OR4A16	81327	broad.mit.edu	37	11	55110891	55110891	+	Missense_Mutation	SNP	C	C	A	rs371963500		TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr11:55110891C>A	ENST00000314721.2	+	1	265	c.215C>A	c.(214-216)tCc>tAc	p.S72Y		NM_001005274.1	NP_001005274.1	Q8NH70	O4A16_HUMAN	olfactory receptor, family 4, subfamily A, member 16	72						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S72Y(1)		NS(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	51						GCCATATATTCCACTGCCATG	0.443																																							uc010rie.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)|pancreas(1)	3						c.(214-216)TCC>TAC		olfactory receptor, family 4, subfamily A,		C	TYR/SER	0,4402		0,0,2201	197.0	180.0	185.0		215	2.6	0.4	11		185	1,8591	1.2+/-3.3	0,1,4295	no	missense	OR4A16	NM_001005274.1	144	0,1,6496	AA,AC,CC		0.0116,0.0,0.0077	possibly-damaging	72/329	55110891	1,12993	2201	4296	6497	SO:0001583	missense	81327				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55110891C>A	AB065519	CCDS31499.1	11q11	2012-08-09			ENSG00000181961	ENSG00000181961		"""GPCR / Class A : Olfactory receptors"""	15153	protein-coding gene	gene with protein product							Standard	NM_001005274		Approved	OR4A16Q	uc010rie.2	Q8NH70	OTTHUMG00000166710	ENST00000314721.2:c.215C>A	11.37:g.55110891C>A	ENSP00000325128:p.Ser72Tyr						p.S72Y	NM_001005274	NP_001005274	Q8NH70	O4A16_HUMAN			1	215	+			72			Helical; Name=2; (Potential).		Q6IFL3	Missense_Mutation	SNP	ENST00000314721.2	37	c.215C>A	CCDS31499.1	.	.	.	.	.	.	.	.	.	.	c	6.383	0.438708	0.12104	0.0	1.16E-4	ENSG00000181961	ENST00000314721	T	0.00840	5.63	2.57	2.57	0.30868	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.04363	0.0120	H	0.96547	3.84	0.09310	N	1	P	0.46621	0.881	P	0.45474	0.482	T	0.11397	-1.0589	9	0.87932	D	0	.	10.8399	0.46708	0.0:1.0:0.0:0.0	.	72	Q8NH70	O4A16_HUMAN	Y	72	ENSP00000325128:S72Y	ENSP00000325128:S72Y	S	+	2	0	OR4A16	54867467	0.000000	0.05858	0.377000	0.26055	0.018000	0.09664	0.184000	0.16939	1.445000	0.47624	0.423000	0.28283	TCC		0.443	OR4A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391160.1	NM_001005274		43	155	1	0	6.61955e-31	0.01441	8.97899e-31	43	155				
OR1S2	219958	broad.mit.edu	37	11	57971611	57971611	+	Missense_Mutation	SNP	G	G	T			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr11:57971611G>T	ENST00000302592.6	-	1	42	c.43C>A	c.(43-45)Cat>Aat	p.H15N		NM_001004459.1	NP_001004459.1	Q8NGQ3	OR1S2_HUMAN	olfactory receptor, family 1, subfamily S, member 2	15						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H15N(1)		endometrium(11)|kidney(1)|large_intestine(4)|lung(23)|ovary(2)|skin(2)|stomach(2)|urinary_tract(1)	46		Breast(21;0.0589)				TTTTCTTGATGCATATTTCTG	0.413																																							uc010rkb.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(43-45)CAT>AAT		olfactory receptor, family 1, subfamily S,							137.0	134.0	135.0					11																	57971611		2201	4296	6497	SO:0001583	missense	219958				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:57971611G>T	BK004297	CCDS31545.1	11q12.1	2012-08-09			ENSG00000197887	ENSG00000197887		"""GPCR / Class A : Olfactory receptors"""	15141	protein-coding gene	gene with protein product							Standard	NM_001004459		Approved		uc010rkb.2	Q8NGQ3	OTTHUMG00000167541	ENST00000302592.6:c.43C>A	11.37:g.57971611G>T	ENSP00000305469:p.His15Asn						p.H15N	NM_001004459	NP_001004459	Q8NGQ3	OR1S2_HUMAN			1	43	-		Breast(21;0.0589)	15			Extracellular (Potential).		Q6IFG5|Q96R85	Missense_Mutation	SNP	ENST00000302592.6	37	c.43C>A	CCDS31545.1	.	.	.	.	.	.	.	.	.	.	G	0.935	-0.711575	0.03230	.	.	ENSG00000197887	ENST00000302592	T	0.02890	4.12	4.25	-0.933	0.10431	.	1.575840	0.03767	N	0.259078	T	0.01730	0.0055	N	0.04508	-0.205	0.09310	N	0.999999	B	0.13145	0.007	B	0.14023	0.01	T	0.45818	-0.9235	10	0.59425	D	0.04	.	3.568	0.07907	0.0899:0.136:0.2299:0.5442	.	15	Q8NGQ3	OR1S2_HUMAN	N	15	ENSP00000305469:H15N	ENSP00000305469:H15N	H	-	1	0	OR1S2	57728187	0.023000	0.18921	0.799000	0.32177	0.052000	0.14988	-0.041000	0.12084	-0.032000	0.13758	-0.175000	0.13238	CAT		0.413	OR1S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394703.2	NM_001004459		17	95	1	0	1.02788e-11	0.0333	1.32849e-11	17	95				
MS4A4A	51338	broad.mit.edu	37	11	60070111	60070111	+	Missense_Mutation	SNP	C	C	T	rs201354974		TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr11:60070111C>T	ENST00000337908.4	+	5	557	c.467C>T	c.(466-468)gCg>gTg	p.A156V	MS4A4A_ENST00000355131.3_Missense_Mutation_p.A137V|MS4A4A_ENST00000532114.1_Intron|MS4A4A_ENST00000395016.3_Missense_Mutation_p.A137V	NM_148975.2	NP_683876.1	Q96JQ5	M4A4A_HUMAN	membrane-spanning 4-domains, subfamily A, member 4A	156						integral component of membrane (GO:0016021)		p.A156V(1)|p.A137V(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(12)|prostate(1)|skin(4)	23						TTTAGCTTGGCGTTTTATTCA	0.403																																							uc001noz.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(466-468)GCG>GTG		membrane-spanning 4-domains, subfamily A, member		C	VAL/ALA,VAL/ALA	0,4406		0,0,2203	215.0	177.0	190.0		410,467	-6.2	0.0	11		190	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	MS4A4A	NM_024021.3,NM_148975.2	64,64	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	137/221,156/240	60070111	1,13005	2203	4300	6503	SO:0001583	missense	51338					integral to membrane	receptor activity	g.chr11:60070111C>T	AB013102	CCDS7982.1, CCDS58135.1	11q12	2012-02-28	2012-02-28		ENSG00000110079	ENSG00000110079			13371	protein-coding gene	gene with protein product		606547	"""membrane-spanning 4-domains, subfamily A, member 4"""	MS4A4		11245982, 11401424	Standard	NM_148975		Approved	CD20L1, MS4A7	uc001noz.3	Q96JQ5	OTTHUMG00000154949	ENST00000337908.4:c.467C>T	11.37:g.60070111C>T	ENSP00000338648:p.Ala156Val					MS4A4A_uc001npa.2_Missense_Mutation_p.A137V|MS4A4A_uc001npb.2_Missense_Mutation_p.A137V|MS4A4A_uc001npc.2_Intron	p.A156V	NM_148975	NP_683876	Q96JQ5	M4A4A_HUMAN			5	477	+			156			Helical; (Potential).		Q8TEZ6|Q96PG7|Q9BY18|Q9H3V3|Q9P1S3	Missense_Mutation	SNP	ENST00000337908.4	37	c.467C>T	CCDS7982.1	.	.	.	.	.	.	.	.	.	.	C	4.519	0.096311	0.08681	0.0	1.16E-4	ENSG00000110079	ENST00000337908;ENST00000355131;ENST00000395016	T;T;T	0.02606	4.23;4.23;4.23	3.12	-6.23	0.02052	.	12.834800	0.00887	U	0.002192	T	0.01905	0.0060	L	0.29908	0.895	0.09310	N	1	B	0.26002	0.139	B	0.19391	0.025	T	0.44236	-0.9341	10	0.15066	T	0.55	7.0711	0.5741	0.00701	0.3509:0.2798:0.1458:0.2235	.	156	Q96JQ5	M4A4A_HUMAN	V	156;137;137	ENSP00000338648:A156V;ENSP00000347252:A137V;ENSP00000378462:A137V	ENSP00000338648:A156V	A	+	2	0	MS4A4A	59826687	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-5.788000	0.00098	-2.104000	0.00843	-1.407000	0.01130	GCG		0.403	MS4A4A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000337774.2			8	105	0	0	0	0.038147	0	8	105				
DNAJC4	3338	broad.mit.edu	37	11	63999376	63999376	+	Silent	SNP	G	G	A			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr11:63999376G>A	ENST00000321685.3	+	3	585	c.120G>A	c.(118-120)ggG>ggA	p.G40G	VEGFB_ENST00000426086.2_5'Flank|DNAJC4_ENST00000321460.5_Silent_p.G40G|RP11-783K16.14_ENST00000534988.1_RNA|DNAJC4_ENST00000355040.4_Silent_p.G40G|VEGFB_ENST00000309422.2_5'Flank|RP11-783K16.14_ENST00000539963.1_RNA	NM_005528.3	NP_005519.2	Q9NNZ3	DNJC4_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 4	40	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				protein folding (GO:0006457)|response to unfolded protein (GO:0006986)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	unfolded protein binding (GO:0051082)	p.G40G(1)		endometrium(1)|lung(1)|prostate(1)	3						AACTGTTGGGGGTGCATCCTG	0.552																																							uc001nys.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(118-120)GGG>GGA		DnaJ (Hsp40) homolog, subfamily C, member 4							83.0	88.0	86.0					11																	63999376		1946	4137	6083	SO:0001819	synonymous_variant	3338				protein folding|response to unfolded protein	integral to membrane|membrane fraction	heat shock protein binding|unfolded protein binding	g.chr11:63999376G>A	AF012106	CCDS41666.1	11q13	2011-09-02			ENSG00000110011	ENSG00000110011		"""Heat shock proteins / DNAJ (HSP40)"""	5271	protein-coding gene	gene with protein product		604189		HSPF2		9473517, 11147971	Standard	NM_005528		Approved	MCG18	uc001nys.3	Q9NNZ3	OTTHUMG00000167792	ENST00000321685.3:c.120G>A	11.37:g.63999376G>A						uc001nyr.1_5'Flank|DNAJC4_uc001nyt.2_Silent_p.G40G|DNAJC4_uc001nyu.2_Silent_p.G40G|VEGFB_uc001nyw.2_5'Flank|VEGFB_uc001nyx.2_5'Flank	p.G40G	NM_005528	NP_005519	Q9NNZ3	DNJC4_HUMAN			3	582	+			40			J.		O14716	Silent	SNP	ENST00000321685.3	37	c.120G>A	CCDS41666.1	.	.	.	.	.	.	.	.	.	.	G	12.40	1.926941	0.34002	.	.	ENSG00000110011	ENST00000535246	.	.	.	5.32	-0.46	0.12175	.	0.000000	0.85682	D	0.000000	T	0.48892	0.1525	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44937	-0.9295	6	0.87932	D	0	-20.7297	1.3402	0.02153	0.2435:0.214:0.4048:0.1377	.	.	.	.	S	5	.	ENSP00000444879:G5S	G	+	1	0	DNAJC4	63755952	0.556000	0.26538	0.992000	0.48379	0.995000	0.86356	-0.772000	0.04694	-0.280000	0.09154	0.561000	0.74099	GGT		0.552	DNAJC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396305.1			7	55	0	0	0	0.038147	0	7	55				
CAPN5	726	broad.mit.edu	37	11	76829343	76829343	+	Missense_Mutation	SNP	A	A	G			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr11:76829343A>G	ENST00000278559.3	+	8	1301	c.1112A>G	c.(1111-1113)cAg>cGg	p.Q371R	CAPN5_ENST00000456580.2_Missense_Mutation_p.Q411R|CAPN5_ENST00000529629.1_Missense_Mutation_p.Q371R|CAPN5_ENST00000531028.1_Intron	NM_004055.4	NP_004046.2	O15484	CAN5_HUMAN	calpain 5	371	Domain III.				proteolysis (GO:0006508)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)	p.Q371R(1)		NS(1)|breast(2)|endometrium(2)|large_intestine(7)|lung(17)|urinary_tract(1)	30						GACCCGCGACAGAACCGCGGT	0.637																																							uc001oxx.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1111-1113)CAG>CGG		calpain 5							67.0	60.0	63.0					11																	76829343		2200	4292	6492	SO:0001583	missense	726				proteolysis|signal transduction	intracellular	calcium-dependent cysteine-type endopeptidase activity	g.chr11:76829343A>G		CCDS8248.1	11q14	2014-01-29				ENSG00000149260			1482	protein-coding gene	gene with protein product		602537	"""vitreoretinopathy, neovascular inflammatory"""	VRNI		9503024, 9367857, 23055945	Standard	NM_004055		Approved	nCL-3, HTRA3, ADNIV	uc001oxx.3	O15484		ENST00000278559.3:c.1112A>G	11.37:g.76829343A>G	ENSP00000278559:p.Gln371Arg					CAPN5_uc009yup.2_Missense_Mutation_p.Q411R|CAPN5_uc009yuq.2_Missense_Mutation_p.Q407R|CAPN5_uc001oxy.2_Missense_Mutation_p.Q411R|CAPN5_uc001oya.2_5'Flank	p.Q371R	NM_004055	NP_004046	O15484	CAN5_HUMAN			8	1297	+			371			Domain III.		O00263	Missense_Mutation	SNP	ENST00000278559.3	37	c.1112A>G	CCDS8248.1	.	.	.	.	.	.	.	.	.	.	A	2.172	-0.389593	0.04932	.	.	ENSG00000149260	ENST00000278559;ENST00000360841;ENST00000529629;ENST00000456580;ENST00000544318	D;D;D	0.86865	-2.18;-2.18;-2.18	5.21	1.36	0.22044	Peptidase C2, calpain, large subunit, domain III (2);Peptidase C2, calpain, domain III (1);	0.660669	0.15722	N	0.247841	T	0.64571	0.2610	N	0.03948	-0.315	0.09310	N	1	B;B;B;B	0.06786	0.001;0.0;0.0;0.0	B;B;B;B	0.08055	0.003;0.002;0.002;0.001	T	0.51779	-0.8662	10	0.07813	T	0.8	.	5.3751	0.16160	0.6259:0.0:0.0761:0.298	.	409;411;411;371	Q59GM2;E7EV01;Q6ZRM8;O15484	.;.;.;CAN5_HUMAN	R	371;411;371;411;411	ENSP00000278559:Q371R;ENSP00000432332:Q371R;ENSP00000409996:Q411R	ENSP00000278559:Q371R	Q	+	2	0	CAPN5	76506991	0.000000	0.05858	0.027000	0.17364	0.758000	0.43043	0.586000	0.23894	-0.023000	0.13963	0.459000	0.35465	CAG		0.637	CAPN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382564.2	NM_004055		3	18	0	0	0	0.004672	0	3	18				
USP28	57646	broad.mit.edu	37	11	113702712	113702712	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr11:113702712C>T	ENST00000003302.4	-	8	831	c.763G>A	c.(763-765)Gat>Aat	p.D255N	USP28_ENST00000542033.1_Intron|USP28_ENST00000537706.1_Missense_Mutation_p.D255N|USP28_ENST00000545540.1_Missense_Mutation_p.D130N|USP28_ENST00000260188.5_Missense_Mutation_p.D255N|USP28_ENST00000544967.1_5'Flank	NM_020886.2	NP_065937.1	Q96RU2	UBP28_HUMAN	ubiquitin specific peptidase 28	255	USP.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|protein deubiquitination (GO:0016579)|response to ionizing radiation (GO:0010212)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.D255N(1)		breast(4)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|lung(24)|ovary(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	59		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)		TCACTCACATCTTGCTATAAG	0.363																																					Melanoma(4;162 555 7664)|GBM(79;500 2010 17506)|Esophageal Squamous(9;463 924 15765)	Melanoma(4;162 555 7664)|GBM(79;500 2010 17506)|Esophageal Squamous(9;463 924 15765)	uc001poh.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|breast(2)|ovary(1)|large_intestine(1)|kidney(1)	7						c.(763-765)GAT>AAT		ubiquitin specific protease 28							101.0	86.0	91.0					11																	113702712		2201	4296	6497	SO:0001583	missense	57646				cell proliferation|DNA damage checkpoint|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA repair|protein deubiquitination|response to ionizing radiation|ubiquitin-dependent protein catabolic process	nucleolus|nucleoplasm	protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr11:113702712C>T	AB040948	CCDS31680.1, CCDS73394.1	11q23	2008-04-11	2005-08-08		ENSG00000048028	ENSG00000048028		"""Ubiquitin-specific peptidases"""	12625	protein-coding gene	gene with protein product		610748	"""ubiquitin specific protease 28"""			12838346, 11597335	Standard	XM_005271630		Approved	KIAA1515	uc001poh.3	Q96RU2	OTTHUMG00000168205	ENST00000003302.4:c.763G>A	11.37:g.113702712C>T	ENSP00000003302:p.Asp255Asn					USP28_uc001pog.2_5'Flank|USP28_uc010rwy.1_Missense_Mutation_p.D130N|USP28_uc001poi.2_Splice_Site|USP28_uc001poj.3_Missense_Mutation_p.D255N|USP28_uc010rwz.1_Intron	p.D255N	NM_020886	NP_065937	Q96RU2	UBP28_HUMAN		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)	8	796	-		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)	255					B0YJC0|B0YJC1|Q9P213	Missense_Mutation	SNP	ENST00000003302.4	37	c.763G>A	CCDS31680.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.126276	0.77549	.	.	ENSG00000048028	ENST00000003302;ENST00000260188;ENST00000545540;ENST00000538475;ENST00000537706;ENST00000537642	T;T;T;T;D;T	0.94897	-0.04;-0.04;-0.04;-0.04;-3.55;0.87	4.51	4.51	0.55191	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	D	0.98134	0.9384	H	0.95816	3.725	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	D	0.99445	1.0939	10	0.87932	D	0	-28.5085	17.7679	0.88483	0.0:1.0:0.0:0.0	.	130;255;255	B4E3L3;Q6NZX9;Q96RU2	.;.;UBP28_HUMAN	N	255;255;130;19;255;154	ENSP00000003302:D255N;ENSP00000260188:D255N;ENSP00000444991:D130N;ENSP00000442257:D19N;ENSP00000445743:D255N;ENSP00000440799:D154N	ENSP00000003302:D255N	D	-	1	0	USP28	113207922	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.119000	0.64679	2.485000	0.83878	0.563000	0.77884	GAT		0.363	USP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398789.1			4	23	0	0	0	0.009096	0	4	23				
C3AR1	719	broad.mit.edu	37	12	8211605	8211605	+	Missense_Mutation	SNP	A	A	G			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr12:8211605A>G	ENST00000307637.4	-	2	1380	c.1177T>C	c.(1177-1179)Tac>Cac	p.Y393H		NM_004054.2	NP_004045.1	Q16581	C3AR_HUMAN	complement component 3a receptor 1	393					blood circulation (GO:0008015)|chemotaxis (GO:0006935)|complement receptor mediated signaling pathway (GO:0002430)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|metabolic process (GO:0008152)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation vascular endothelial growth factor production (GO:0010575)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C3a anaphylatoxin receptor activity (GO:0004943)|complement component C3a receptor activity (GO:0004876)|G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)	p.Y393H(1)		breast(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(1)	20				Kidney(36;0.0893)		AAAATGTGGTATGGAGTCCAG	0.512																																							uc001qtv.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1177-1179)TAC>CAC		complement component 3a receptor 1							65.0	60.0	61.0					12																	8211605		2203	4300	6503	SO:0001583	missense	719				blood circulation|chemotaxis|elevation of cytosolic calcium ion concentration|inflammatory response	integral to plasma membrane	C3a anaphylatoxin receptor activity|complement component C3a receptor activity|phosphatidylinositol phospholipase C activity	g.chr12:8211605A>G	U28488	CCDS8588.1	12p13.31	2012-08-10				ENSG00000171860		"""Complement system"", ""GPCR / Class A : Complement component receptors"""	1319	protein-coding gene	gene with protein product		605246				8605247	Standard	NM_004054		Approved	C3AR, AZ3B	uc001qtv.1	Q16581		ENST00000307637.4:c.1177T>C	12.37:g.8211605A>G	ENSP00000302079:p.Tyr393His						p.Y393H	NM_004054	NP_004045	Q16581	C3AR_HUMAN		Kidney(36;0.0893)	2	1269	-			393			Helical; Name=6; (Potential).		O43771|Q92868	Missense_Mutation	SNP	ENST00000307637.4	37	c.1177T>C	CCDS8588.1	.	.	.	.	.	.	.	.	.	.	A	17.67	3.445936	0.63178	.	.	ENSG00000171860	ENST00000307637	T	0.74526	-0.85	5.79	5.79	0.91817	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000014	D	0.86347	0.5911	M	0.81614	2.55	0.51012	D	0.999907	D	0.89917	1.0	D	0.97110	1.0	D	0.88128	0.2836	10	0.87932	D	0	.	14.0823	0.64932	1.0:0.0:0.0:0.0	.	393	Q16581	C3AR_HUMAN	H	393	ENSP00000302079:Y393H	ENSP00000302079:Y393H	Y	-	1	0	C3AR1	8102872	1.000000	0.71417	0.942000	0.38095	0.162000	0.22319	9.253000	0.95501	2.218000	0.71995	0.533000	0.62120	TAC		0.512	C3AR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400254.1			5	34	0	0	0	0.021553	0	5	34				
ABCD2	225	broad.mit.edu	37	12	39947886	39947886	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr12:39947886C>T	ENST00000308666.3	-	10	2186	c.2051G>A	c.(2050-2052)cGc>cAc	p.R684H		NM_005164.3	NP_005155.1	Q9UBJ2	ABCD2_HUMAN	ATP-binding cassette, sub-family D (ALD), member 2	684	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				fatty acid beta-oxidation (GO:0006635)|positive regulation of fatty acid beta-oxidation (GO:0032000)|transmembrane transport (GO:0055085)|very long-chain fatty acid catabolic process (GO:0042760)|very long-chain fatty acid metabolic process (GO:0000038)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|protein homodimerization activity (GO:0042803)	p.R684H(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(24)|ovary(2)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	52						TTGTTCAAAGCGCCAACCTCC	0.348																																							uc001rmb.2		NA																	2	Substitution - Missense(2)		lung(1)|breast(1)	ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)|central_nervous_system(1)|skin(1)	6						c.(2050-2052)CGC>CAC		ATP-binding cassette, sub-family D, member 2							101.0	99.0	99.0					12																	39947886		2203	4300	6503	SO:0001583	missense	225				fatty acid metabolic process|transport	ATP-binding cassette (ABC) transporter complex|integral to plasma membrane|peroxisomal membrane	ATP binding|ATPase activity|protein binding	g.chr12:39947886C>T	U28150	CCDS8734.1	12q12	2012-05-16			ENSG00000173208	ENSG00000173208		"""ATP binding cassette transporters / subfamily D"""	66	protein-coding gene	gene with protein product		601081		ALDL1		8577752	Standard	NM_005164		Approved	ALDR, ALDRP	uc001rmb.2	Q9UBJ2	OTTHUMG00000169337	ENST00000308666.3:c.2051G>A	12.37:g.39947886C>T	ENSP00000310688:p.Arg684His						p.R684H	NM_005164	NP_005155	Q9UBJ2	ABCD2_HUMAN			10	2477	-			684			ABC transporter.		B2RAM3|Q13210|Q2M3H9	Missense_Mutation	SNP	ENST00000308666.3	37	c.2051G>A	CCDS8734.1	.	.	.	.	.	.	.	.	.	.	C	11.48	1.651274	0.29336	.	.	ENSG00000173208	ENST00000308666	D	0.94650	-3.48	5.1	5.1	0.69264	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.059794	0.64402	D	0.000002	D	0.91240	0.7239	L	0.46157	1.445	0.47374	D	0.999407	B	0.16166	0.016	B	0.13407	0.009	D	0.87211	0.2247	9	.	.	.	1.7877	14.2213	0.65828	0.0:0.925:0.0:0.075	.	684	Q9UBJ2	ABCD2_HUMAN	H	684	ENSP00000310688:R684H	.	R	-	2	0	ABCD2	38234153	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.855000	0.55957	2.535000	0.85469	0.655000	0.94253	CGC		0.348	ABCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403591.1	NM_005164		6	84	0	0	0	0.021553	0	6	84				
MON2	23041	broad.mit.edu	37	12	62938755	62938755	+	Silent	SNP	A	A	T			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr12:62938755A>T	ENST00000393632.2	+	21	2935	c.2544A>T	c.(2542-2544)acA>acT	p.T848T	MON2_ENST00000552115.1_Silent_p.T848T|MON2_ENST00000393630.3_Silent_p.T849T|MON2_ENST00000552738.1_Silent_p.T825T|MON2_ENST00000393629.2_Silent_p.T848T|MON2_ENST00000546600.1_Silent_p.T848T|RNU6-399P_ENST00000365164.1_RNA|MON2_ENST00000280379.6_Silent_p.T849T	NM_015026.2	NP_055841.2	Q7Z3U7	MON2_HUMAN	MON2 homolog (S. cerevisiae)	848					actin cytoskeleton organization (GO:0030036)|Golgi to endosome transport (GO:0006895)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.T848T(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(15)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	57			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		CAGGATTAACATTTAACCATG	0.333																																							uc001sre.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(2)	2						c.(2542-2544)ACA>ACT		MON2 homolog							66.0	66.0	66.0					12																	62938755		2203	4300	6503	SO:0001819	synonymous_variant	23041				Golgi to endosome transport|protein transport	cytoplasm	ARF guanyl-nucleotide exchange factor activity|binding	g.chr12:62938755A>T		CCDS31849.1, CCDS61175.1, CCDS61177.1, CCDS61178.1	12q14.1	2014-08-12	2006-04-04		ENSG00000061987	ENSG00000061987			29177	protein-coding gene	gene with protein product			"""MON2 homolog (yeast)"""			16301316, 24285343	Standard	NM_015026		Approved	KIAA1040	uc001sre.3	Q7Z3U7	OTTHUMG00000169992	ENST00000393632.2:c.2544A>T	12.37:g.62938755A>T						MON2_uc009zqj.2_Silent_p.T848T|MON2_uc010ssl.1_Silent_p.T776T|MON2_uc010ssm.1_Silent_p.T825T|MON2_uc010ssn.1_Silent_p.T848T|MON2_uc001srf.2_Silent_p.T611T	p.T848T	NM_015026	NP_055841	Q7Z3U7	MON2_HUMAN	BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)	21	2935	+			849					A5D8U7|A7E2Y0|B9EGP5|F8VWA6|F8W1Z6|Q86TA2|Q8N3I5|Q8NAI0|Q8NHE2|Q9UPW1	Silent	SNP	ENST00000393632.2	37	c.2544A>T	CCDS31849.1																																																																																				0.333	MON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406767.3	NM_015026		12	51	0	0	0	0.020292	0	12	51				
TMEM19	55266	broad.mit.edu	37	12	72091178	72091178	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr12:72091178C>A	ENST00000266673.5	+	4	1095	c.501C>A	c.(499-501)taC>taA	p.Y167*	RP11-293I14.2_ENST00000548802.1_3'UTR|TMEM19_ENST00000549735.1_Nonsense_Mutation_p.Y167*	NM_018279.3	NP_060749.2	Q96HH6	TMM19_HUMAN	transmembrane protein 19	167						integral component of membrane (GO:0016021)		p.Y167*(1)		large_intestine(1)|lung(8)	9		Breast(359;0.0889)		GBM - Glioblastoma multiforme(134;0.044)		CCAAGCAGTACTCCGCTTCCT	0.512																																							uc001sws.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(499-501)TAC>TAA		transmembrane protein 19							104.0	104.0	104.0					12																	72091178		2203	4300	6503	SO:0001587	stop_gained	55266					integral to membrane		g.chr12:72091178C>A	BC008596	CCDS9002.1	12q15	2004-03-04				ENSG00000139291			25605	protein-coding gene	gene with protein product						12477932	Standard	NM_018279		Approved	FLJ10936	uc001sws.3	Q96HH6	OTTHUMG00000169558	ENST00000266673.5:c.501C>A	12.37:g.72091178C>A	ENSP00000266673:p.Tyr167*					TMEM19_uc001swr.1_Nonsense_Mutation_p.Y153*|TMEM19_uc009zru.1_RNA	p.Y167*	NM_018279	NP_060749	Q96HH6	TMM19_HUMAN		GBM - Glioblastoma multiforme(134;0.044)	4	1084	+		Breast(359;0.0889)	167					B2RDL2|Q53FY3|Q9NV41	Nonsense_Mutation	SNP	ENST00000266673.5	37	c.501C>A	CCDS9002.1	.	.	.	.	.	.	.	.	.	.	C	36	5.639025	0.96693	.	.	ENSG00000139291	ENST00000266673;ENST00000550524;ENST00000549735;ENST00000546677;ENST00000546795	.	.	.	5.94	3.16	0.36331	.	0.293852	0.39475	N	0.001350	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.6156	9.8275	0.40921	0.0:0.6808:0.0:0.3192	.	.	.	.	X	167;167;167;66;11	.	ENSP00000266673:Y167X	Y	+	3	2	TMEM19	70377445	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	0.982000	0.29539	0.865000	0.35603	0.650000	0.86243	TAC		0.512	TMEM19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404801.1	NM_018279		19	85	1	0	2.32416e-17	0.014323	3.09136e-17	19	85				
NR1H4	9971	broad.mit.edu	37	12	100928726	100928726	+	Silent	SNP	T	T	C			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr12:100928726T>C	ENST00000551379.1	+	4	715	c.687T>C	c.(685-687)caT>caC	p.H229H	NR1H4_ENST00000549996.1_Silent_p.H168H|NR1H4_ENST00000548884.1_Silent_p.H215H|NR1H4_ENST00000188403.7_Silent_p.H225H|NR1H4_ENST00000392986.3_Silent_p.H219H			Q96RI1	NR1H4_HUMAN	nuclear receptor subfamily 1, group H, member 4	229					bile acid metabolic process (GO:0008206)|cellular response to acid chemical (GO:0071229)|cellular response to organonitrogen compound (GO:0071417)|digestive tract development (GO:0048565)|gene expression (GO:0010467)|intracellular bile acid receptor signaling pathway (GO:0038185)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nitrogen catabolite activation of transcription from RNA polymerase II promoter (GO:0001080)|positive regulation of ammonia assimilation cycle (GO:2001250)|positive regulation of glutamate metabolic process (GO:2000213)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of carbohydrate metabolic process (GO:0006109)|regulation of cholesterol metabolic process (GO:0090181)|regulation of urea metabolic process (GO:0034255)|response to glucose (GO:0009749)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)	bile acid binding (GO:0032052)|bile acid receptor activity (GO:0038181)|chenodeoxycholic acid binding (GO:1902122)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|ligand-dependent nuclear receptor binding (GO:0016922)|peptide binding (GO:0042277)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|thyroid hormone receptor activity (GO:0004887)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.H215H(1)|p.H229H(1)		NS(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(23)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	44					Chenodeoxycholic acid(DB06777)	TGAAGCAGCATGCAGATCAGA	0.413																																							uc001tht.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)|lung(1)|skin(1)	3						c.(685-687)CAT>CAC		nuclear receptor subfamily 1, group H, member 4							127.0	104.0	112.0					12																	100928726		2203	4300	6503	SO:0001819	synonymous_variant	9971				bile acid metabolic process|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|thyroid hormone receptor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding	g.chr12:100928726T>C	U68233	CCDS9078.1, CCDS55873.1, CCDS55874.1, CCDS55875.1, CCDS55876.1	12q23.1	2013-01-16				ENSG00000012504		"""Nuclear hormone receptors"""	7967	protein-coding gene	gene with protein product		603826				7774010, 9223286	Standard	NM_001206977		Approved	FXR, RIP14, HRR1, HRR-1	uc001tht.2	Q96RI1	OTTHUMG00000170359	ENST00000551379.1:c.687T>C	12.37:g.100928726T>C						NR1H4_uc001thp.1_Silent_p.H215H|NR1H4_uc001thq.1_Silent_p.H219H|NR1H4_uc010svj.1_RNA|NR1H4_uc001thr.1_Silent_p.H219H|NR1H4_uc010svk.1_Silent_p.H168H|NR1H4_uc001ths.1_Silent_p.H225H	p.H229H	NM_005123	NP_005114	Q96RI1	NR1H4_HUMAN			4	715	+			229					A1L4K5|B7Z412|B7ZM06|F8VYG8|Q8NFP5|Q8NFP6|Q92943	Silent	SNP	ENST00000551379.1	37	c.687T>C	CCDS55876.1																																																																																				0.413	NR1H4-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409140.1	NM_005123		13	60	0	0	0	0.016723	0	13	60				
UBC	7316	broad.mit.edu	37	12	125397791	125397791	+	Missense_Mutation	SNP	T	T	G			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr12:125397791T>G	ENST00000536769.1	-	1	2103	c.527A>C	c.(526-528)gAg>gCg	p.E176A	MIR5188_ENST00000583467.1_RNA|UBC_ENST00000546120.1_Intron|UBC_ENST00000339647.5_Missense_Mutation_p.E176A|UBC_ENST00000538617.1_Intron|UBC_ENST00000536661.1_5'Flank			P0CG48	UBC_HUMAN	ubiquitin C	176	Ubiquitin-like 3. {ECO:0000255|PROSITE- ProRule:PRU00214}.				activation of MAPK activity (GO:0000187)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|carbohydrate metabolic process (GO:0005975)|cellular response to hypoxia (GO:0071456)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular transport of virus (GO:0075733)|ion transmembrane transport (GO:0034220)|JNK cascade (GO:0007254)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of type I interferon production (GO:0032479)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protease binding (GO:0002020)	p.E176A(1)		breast(3)|endometrium(4)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)		CTTGACATTCTCGATGGTGTC	0.527																																							uc001ugs.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(526-528)GAG>GCG		ubiquitin C							115.0	110.0	112.0					12																	125397791		2203	4300	6503	SO:0001583	missense	7316				activation of MAPK activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|anti-apoptosis|apoptosis|cellular membrane organization|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA repair|endosome transport|epidermal growth factor receptor signaling pathway|G1/S transition of mitotic cell cycle|I-kappaB kinase/NF-kappaB cascade|induction of apoptosis by extracellular signals|innate immune response|JNK cascade|M/G1 transition of mitotic cell cycle|mRNA metabolic process|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of type I interferon production|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|S phase of mitotic cell cycle|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|viral reproduction	cytosol|endocytic vesicle membrane|endosome membrane|nucleoplasm|plasma membrane	protein binding	g.chr12:125397791T>G		CCDS9260.1	12q24.3	2008-09-08			ENSG00000150991	ENSG00000150991			12468	protein-coding gene	gene with protein product	"""polyubiquitin-C"""	191340				1315303, 11872750	Standard	NM_021009		Approved		uc001ugs.4	P0CG48		ENST00000536769.1:c.527A>C	12.37:g.125397791T>G	ENSP00000441543:p.Glu176Ala					UBC_uc001ugr.2_5'Flank|UBC_uc001ugu.1_Missense_Mutation_p.E176A|UBC_uc001ugt.2_Missense_Mutation_p.E176A|UBC_uc001ugv.2_Intron|UBC_uc001ugw.2_Missense_Mutation_p.E24A	p.E176A	NM_021009	NP_066289	P0CG48	UBC_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)	2	975	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)		176			Ubiquitin-like 3.		P02248|P02249|P02250|P62988|Q29120|Q6LBL4|Q6LDU5|Q8WYN8|Q91887|Q91888|Q9BWD6|Q9BX98|Q9UEF2|Q9UEG1|Q9UEK8|Q9UPK7	Missense_Mutation	SNP	ENST00000536769.1	37	c.527A>C	CCDS9260.1	.	.	.	.	.	.	.	.	.	.	-	12.37	1.916695	0.33815	.	.	ENSG00000150991	ENST00000536769;ENST00000535460;ENST00000541046;ENST00000339647;ENST00000541272	T;T;T	0.73681	-0.77;-0.77;-0.77	2.79	2.79	0.32731	Ubiquitin supergroup (1);Ubiquitin (2);	0.000000	0.48286	U	0.000181	T	0.73071	0.3540	L	0.42744	1.35	0.80722	D	1	B;B;B	0.31519	0.327;0.198;0.327	P;B;P	0.45538	0.484;0.178;0.484	T	0.75221	-0.3394	10	0.87932	D	0	.	9.4156	0.38519	0.0:0.0:0.0:1.0	.	265;176;176	Q66K58;F5H7K6;P0CG48	.;.;UBC_HUMAN	A	176;176;100;176;100	ENSP00000441543:E176A;ENSP00000344818:E176A;ENSP00000440205:E100A	ENSP00000344818:E176A	E	-	2	0	UBC	123963744	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	6.544000	0.73878	1.543000	0.49345	0.449000	0.29647	GAG		0.527	UBC-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400177.1	NM_021009		10	142	0	0	0	0.020292	0	10	142				
ZNF10	7556	broad.mit.edu	37	12	133727632	133727632	+	Missense_Mutation	SNP	G	G	T			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr12:133727632G>T	ENST00000248211.6	+	3	274	c.52G>T	c.(52-54)Gat>Tat	p.D18Y	ZNF10_ENST00000402932.2_Missense_Mutation_p.D18Y|ZNF268_ENST00000416488.1_Missense_Mutation_p.D18Y|CTD-2140B24.4_ENST00000540096.2_Missense_Mutation_p.D18Y|ZNF10_ENST00000540927.1_Intron|ZNF10_ENST00000426665.2_Missense_Mutation_p.D18Y	NM_015394.4	NP_056209.2	P21506	ZNF10_HUMAN	zinc finger protein 10	18	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D18Y(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(9)|prostate(1)|skin(5)|urinary_tract(1)	26	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;1.28e-06)|all_epithelial(31;0.0051)|Lung NSC(355;0.00948)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		GACCTTCAAGGATGTATTTGT	0.458																																							uc009zzb.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)|central_nervous_system(1)|skin(1)	3						c.(52-54)GAT>TAT		zinc finger protein 10							274.0	241.0	252.0					12																	133727632		2203	4300	6503	SO:0001583	missense	7556				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding	g.chr12:133727632G>T	X52332, BC024182	CCDS9283.1	12q24.33	2013-01-08	2005-05-22		ENSG00000256223	ENSG00000256223		"""Zinc fingers, C2H2-type"", ""-"""	12879	protein-coding gene	gene with protein product		194538	"""zinc finger protein 10 (KOX 1)"""			7865130, 8262519	Standard	NM_015394		Approved	KOX1	uc001ulq.3	P21506	OTTHUMG00000167944	ENST00000248211.6:c.52G>T	12.37:g.133727632G>T	ENSP00000248211:p.Asp18Tyr					ZNF268_uc010tbv.1_5'UTR|ZNF10_uc001ulq.2_Missense_Mutation_p.D18Y	p.D18Y	NM_015394	NP_056209	P21506	ZNF10_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)	3	499	+	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;1.28e-06)|all_epithelial(31;0.0051)|Lung NSC(355;0.00948)	18			KRAB.		B2RBS1|Q8TC91	Missense_Mutation	SNP	ENST00000248211.6	37	c.52G>T	CCDS9283.1	.	.	.	.	.	.	.	.	.	.	G	17.41	3.383059	0.61845	.	.	ENSG00000256223;ENSG00000256223;ENSG00000256223;ENSG00000256223;ENSG00000256223;ENSG00000256223;ENSG00000090612	ENST00000538918;ENST00000540609;ENST00000248211;ENST00000536877;ENST00000426665;ENST00000402932;ENST00000416488	T;T;T;T;T;T;T	0.12039	2.72;2.72;2.72;2.72;2.72;2.72;2.72	3.49	3.49	0.39957	Krueppel-associated box (4);	0.000000	0.33854	N	0.004500	T	0.51652	0.1687	H	0.97682	4.055	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.71464	-0.4585	9	.	.	.	.	14.3011	0.66352	0.0:0.0:1.0:0.0	.	18	P21506	ZNF10_HUMAN	Y	18	ENSP00000445997:D18Y;ENSP00000438232:D18Y;ENSP00000248211:D18Y;ENSP00000441339:D18Y;ENSP00000393814:D18Y;ENSP00000384893:D18Y;ENSP00000409295:D18Y	.	D	+	1	0	ZNF10;ZNF268	132237705	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	6.401000	0.73256	1.951000	0.56629	0.462000	0.41574	GAT		0.458	ZNF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397182.1	NM_015394		13	81	1	0	0.000219431	0.020292	0.000242436	13	81				
OLFM4	10562	broad.mit.edu	37	13	53624329	53624329	+	Missense_Mutation	SNP	G	G	A	rs144683972		TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr13:53624329G>A	ENST00000219022.2	+	5	1034	c.956G>A	c.(955-957)cGa>cAa	p.R319Q		NM_006418.4	NP_006409.3	Q6UX06	OLFM4_HUMAN	olfactomedin 4	319	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				cell adhesion (GO:0007155)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein homooligomerization (GO:0051260)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|specific granule (GO:0042581)	cadherin binding (GO:0045296)|catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)	p.R319Q(1)		breast(2)|endometrium(4)|kidney(4)|large_intestine(5)|lung(20)|skin(3)|urinary_tract(1)	39		Breast(56;0.000776)|Lung NSC(96;0.000814)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.13e-08)		ATAAATGCTCGAGAGTTGCGG	0.433																																							uc001vhl.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(955-957)CGA>CAA		olfactomedin 4 precursor		G	GLN/ARG	0,4406		0,0,2203	131.0	106.0	114.0		956	-4.4	0.0	13	dbSNP_134	114	1,8599	1.2+/-3.3	0,1,4299	yes	missense	OLFM4	NM_006418.4	43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	319/511	53624329	1,13005	2203	4300	6503	SO:0001583	missense	10562				cell adhesion	extracellular space		g.chr13:53624329G>A	AY358567	CCDS9440.1	13q14	2004-06-25			ENSG00000102837	ENSG00000102837			17190	protein-coding gene	gene with protein product		614061					Standard	NM_006418		Approved	OlfD, GW112, GC1	uc001vhl.3	Q6UX06	OTTHUMG00000016981	ENST00000219022.2:c.956G>A	13.37:g.53624329G>A	ENSP00000219022:p.Arg319Gln					OLFM4_uc001vhk.1_Intron	p.R319Q	NM_006418	NP_006409	Q6UX06	OLFM4_HUMAN		GBM - Glioblastoma multiforme(99;3.13e-08)	5	956	+		Breast(56;0.000776)|Lung NSC(96;0.000814)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)	319			Olfactomedin-like.		O95362|Q5VWG0|Q86T22	Missense_Mutation	SNP	ENST00000219022.2	37	c.956G>A	CCDS9440.1	.	.	.	.	.	.	.	.	.	.	G	3.051	-0.195405	0.06259	0.0	1.16E-4	ENSG00000102837	ENST00000219022	D	0.88664	-2.41	5.92	-4.44	0.03557	Olfactomedin-like (3);	1.252940	0.05227	N	0.509545	T	0.74921	0.3780	N	0.11927	0.2	0.09310	N	1	B	0.21071	0.051	B	0.18561	0.022	T	0.61004	-0.7150	10	0.22109	T	0.4	.	5.7045	0.17901	0.5433:0.0858:0.2844:0.0866	.	319	Q6UX06	OLFM4_HUMAN	Q	319	ENSP00000219022:R319Q	ENSP00000219022:R319Q	R	+	2	0	OLFM4	52522330	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-2.853000	0.00731	-1.042000	0.03262	0.650000	0.86243	CGA		0.433	OLFM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045112.2	NM_006418		4	88	0	0	0	0.009096	0	4	88				
COL4A1	1282	broad.mit.edu	37	13	110822018	110822018	+	Silent	SNP	A	A	G			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr13:110822018A>G	ENST00000375820.4	-	43	3955	c.3834T>C	c.(3832-3834)ggT>ggC	p.G1278G		NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1	1278	Triple-helical region.				axon guidance (GO:0007411)|basement membrane organization (GO:0071711)|blood vessel morphogenesis (GO:0048514)|brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)|patterning of blood vessels (GO:0001569)|renal tubule morphogenesis (GO:0061333)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)|platelet-derived growth factor binding (GO:0048407)	p.G1278G(1)|p.G921G(1)		breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			GCCCTGGGACACCGGGTGCTC	0.512																																							uc001vqw.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6						c.(3832-3834)GGT>GGC		alpha 1 type IV collagen preproprotein							63.0	72.0	69.0					13																	110822018		2203	4300	6503	SO:0001819	synonymous_variant	1282				angiogenesis|axon guidance		extracellular matrix structural constituent|platelet-derived growth factor binding	g.chr13:110822018A>G	J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498		"""Collagens"""	2202	protein-coding gene	gene with protein product		120130				3691802	Standard	NM_001845		Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.3834T>C	13.37:g.110822018A>G						COL4A1_uc010agl.2_Intron	p.G1278G	NM_001845	NP_001836	P02462	CO4A1_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)		43	3956	-	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	1278			Triple-helical region.		A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	Silent	SNP	ENST00000375820.4	37	c.3834T>C	CCDS9511.1																																																																																				0.512	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045759.3			15	81	0	0	0	0.043863	0	15	81				
FITM1	161247	broad.mit.edu	37	14	24600930	24600930	+	Missense_Mutation	SNP	G	G	C	rs200414982		TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr14:24600930G>C	ENST00000267426.5	+	1	447	c.158G>C	c.(157-159)cGg>cCg	p.R53P	FITM1_ENST00000559294.1_5'Flank|RP11-468E2.6_ENST00000558325.1_Silent_p.T240T	NM_203402.2	NP_981947.1	A5D6W6	FITM1_HUMAN	fat storage-inducing transmembrane protein 1	53					lipid particle organization (GO:0034389)|positive regulation of sequestering of triglyceride (GO:0010890)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)		p.R53P(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	11						CCCTGCTTACGGCGCCTCTAC	0.627																																							uc001wmf.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(157-159)CGG>CCG		fat-inducing transcript 1							59.0	61.0	60.0					14																	24600930		2203	4300	6503	SO:0001583	missense	161247				lipid particle organization|positive regulation of sequestering of triglyceride	endoplasmic reticulum membrane|integral to membrane		g.chr14:24600930G>C		CCDS9611.1	14q12	2009-07-09			ENSG00000139914	ENSG00000139914			33714	protein-coding gene	gene with protein product	"""fat-inducing transcript 1"""	612028				18160536	Standard	NM_203402		Approved	FIT1	uc001wmf.2	A5D6W6	OTTHUMG00000133476	ENST00000267426.5:c.158G>C	14.37:g.24600930G>C	ENSP00000267426:p.Arg53Pro						p.R53P	NM_203402	NP_981947	A5D6W6	FITM1_HUMAN			1	256	+			53			Extracellular (Potential).		Q8IUQ7	Missense_Mutation	SNP	ENST00000267426.5	37	c.158G>C	CCDS9611.1	.	.	.	.	.	.	.	.	.	.	g	16.30	3.084429	0.55861	.	.	ENSG00000139914	ENST00000267426	.	.	.	4.58	2.71	0.32032	.	0.078086	0.50627	D	0.000109	T	0.33585	0.0868	N	0.19112	0.55	0.80722	D	1	B	0.29232	0.238	B	0.23419	0.046	T	0.27606	-1.0069	9	0.72032	D	0.01	-23.0711	9.0118	0.36146	0.1858:0.0:0.8142:0.0	.	53	A5D6W6	FITM1_HUMAN	P	53	.	ENSP00000267426:R53P	R	+	2	0	FITM1	23670770	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.187000	0.58344	1.149000	0.42402	0.462000	0.41574	CGG		0.627	FITM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257366.1	NM_203402		4	42	0	0	0	0.009096	0	4	42				
RIPK3	11035	broad.mit.edu	37	14	24808294	24808294	+	Missense_Mutation	SNP	T	T	A			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr14:24808294T>A	ENST00000216274.5	-	3	616	c.398A>T	c.(397-399)gAc>gTc	p.D133V	RP11-934B9.3_ENST00000555591.1_5'Flank|RIPK3_ENST00000554338.1_5'Flank	NM_006871.3	NP_006862.2	Q9Y572	RIPK3_HUMAN	receptor-interacting serine-threonine kinase 3	133	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|amyloid fibril formation (GO:1990000)|apoptotic signaling pathway (GO:0097190)|cellular protein modification process (GO:0006464)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|lymph node development (GO:0048535)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic process (GO:0070266)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of ligase activity (GO:0051351)|positive regulation of necroptotic process (GO:0060545)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of phosphatase activity (GO:0010922)|positive regulation of protein deacetylation (GO:0090312)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of type I interferon production (GO:0032481)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of activated T cell proliferation (GO:0046006)|regulation of activation-induced cell death of T cells (GO:0070235)|regulation of adaptive immune response (GO:0002819)|regulation of CD8-positive, alpha-beta cytotoxic T cell extravasation (GO:2000452)|regulation of interferon-gamma production (GO:0032649)|regulation of T cell mediated cytotoxicity (GO:0001914)|signal transduction (GO:0007165)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|ripoptosome (GO:0097342)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|NF-kappaB-inducing kinase activity (GO:0004704)|protein complex binding (GO:0032403)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription coactivator activity (GO:0003713)	p.D133V(1)		NS(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23				GBM - Glioblastoma multiforme(265;0.0181)		CGGGTTCTGGTCGTGCAGGTA	0.637																																					Pancreas(58;918 1191 4668 13304 15331)	Pancreas(58;918 1191 4668 13304 15331)	uc001wpb.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|ovary(1)|lung(1)	4						c.(397-399)GAC>GTC		receptor-interacting serine-threonine kinase 3							49.0	56.0	54.0					14																	24808294		2203	4300	6503	SO:0001583	missense	11035				apoptosis|induction of apoptosis by extracellular signals	cytoplasm	ATP binding|protein binding|transcription coactivator activity	g.chr14:24808294T>A	AF156884	CCDS9628.1	14q12	2006-05-15			ENSG00000129465	ENSG00000129465			10021	protein-coding gene	gene with protein product		605817				10339433, 10358032	Standard	NM_006871		Approved	RIP3	uc001wpb.3	Q9Y572	OTTHUMG00000029349	ENST00000216274.5:c.398A>T	14.37:g.24808294T>A	ENSP00000216274:p.Asp133Val					RIPK3_uc001wpa.2_5'Flank|RIPK3_uc010alq.2_RNA|RIPK3_uc010toi.1_5'UTR|RIPK3_uc010toj.1_Missense_Mutation_p.D133V	p.D133V	NM_006871	NP_006862	Q9Y572	RIPK3_HUMAN		GBM - Glioblastoma multiforme(265;0.0181)	3	608	-			133			Protein kinase.		B4DJL9|C4AM87|Q5J795|Q5J796|Q6P5Y1	Missense_Mutation	SNP	ENST00000216274.5	37	c.398A>T	CCDS9628.1	.	.	.	.	.	.	.	.	.	.	T	7.746	0.702253	0.15172	.	.	ENSG00000129465	ENST00000216274	T	0.63580	-0.05	4.14	1.29	0.21616	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.330971	0.26609	N	0.023439	T	0.47377	0.1442	L	0.38838	1.175	0.33844	D	0.631835	B;B	0.20887	0.02;0.049	B;B	0.23150	0.005;0.044	T	0.49854	-0.8895	10	0.44086	T	0.13	-6.7875	7.7347	0.28806	0.0:0.6974:0.0:0.3026	.	133;133	B4DJZ5;Q9Y572	.;RIPK3_HUMAN	V	133	ENSP00000216274:D133V	ENSP00000216274:D133V	D	-	2	0	RIPK3	23878134	0.984000	0.35163	0.009000	0.14445	0.002000	0.02628	2.167000	0.42415	0.290000	0.22444	-0.366000	0.07423	GAC		0.637	RIPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073203.4	NM_006871		5	50	0	0	0	0.014758	0	5	50				
ARID4A	5926	broad.mit.edu	37	14	58831476	58831476	+	Missense_Mutation	SNP	T	T	C			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr14:58831476T>C	ENST00000355431.3	+	20	3042	c.2669T>C	c.(2668-2670)aTt>aCt	p.I890T	ARID4A_ENST00000348476.3_Missense_Mutation_p.I890T|ARID4A_ENST00000395168.3_Missense_Mutation_p.I890T|ARID4A_ENST00000431317.2_Missense_Mutation_p.I890T	NM_002892.3	NP_002883.3	P29374	ARI4A_HUMAN	AT rich interactive domain 4A (RBP1-like)	890					erythrocyte development (GO:0048821)|histone H3-K4 trimethylation (GO:0080182)|histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of gene expression by genetic imprinting (GO:0006349)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I890T(2)		NS(1)|breast(2)|central_nervous_system(1)|cervix(4)|endometrium(8)|kidney(2)|large_intestine(14)|lung(19)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						AGTGATTGTATTGGATCTGAG	0.353																																							uc001xdp.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|skin(2)|lung(1)	6						c.(2668-2670)ATT>ACT		retinoblastoma-binding protein 1 isoform I							83.0	76.0	79.0					14																	58831476		2202	4300	6502	SO:0001583	missense	5926				negative regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	transcriptional repressor complex	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr14:58831476T>C	S57153	CCDS9732.1, CCDS9733.1, CCDS45114.1	14q22.3	2013-02-07	2004-01-28	2004-01-28	ENSG00000032219	ENSG00000032219		"""-"""	9885	protein-coding gene	gene with protein product		180201	"""retinoblastoma-binding protein 1"""	RBBP1		1857421, 8455946	Standard	NM_023000		Approved	RBP1, RBP-1	uc001xdp.3	P29374	OTTHUMG00000140320	ENST00000355431.3:c.2669T>C	14.37:g.58831476T>C	ENSP00000347602:p.Ile890Thr					ARID4A_uc001xdo.2_Missense_Mutation_p.I890T|ARID4A_uc001xdq.2_Missense_Mutation_p.I890T|ARID4A_uc010apg.1_Missense_Mutation_p.I568T	p.I890T	NM_002892	NP_002883	P29374	ARI4A_HUMAN			20	2923	+			890					Q15991|Q15992|Q15993	Missense_Mutation	SNP	ENST00000355431.3	37	c.2669T>C	CCDS9732.1	.	.	.	.	.	.	.	.	.	.	T	0.847	-0.739954	0.03088	.	.	ENSG00000032219	ENST00000355431;ENST00000348476;ENST00000395168;ENST00000431317;ENST00000417477	T;T;T;T;T	0.13538	2.58;2.58;2.59;2.58;2.58	5.59	2.03	0.26663	.	1.994440	0.01603	N	0.022154	T	0.06416	0.0165	N	0.08118	0	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.31641	-0.9936	10	0.09338	T	0.73	0.2114	1.4046	0.02278	0.1529:0.3489:0.1587:0.3396	.	890;890;890	P29374-3;P29374;P29374-2	.;ARI4A_HUMAN;.	T	890;890;890;890;568	ENSP00000347602:I890T;ENSP00000344556:I890T;ENSP00000378597:I890T;ENSP00000397368:I890T;ENSP00000416053:I568T	ENSP00000344556:I890T	I	+	2	0	ARID4A	57901229	0.000000	0.05858	0.007000	0.13788	0.935000	0.57460	-0.225000	0.09151	0.420000	0.25954	0.528000	0.53228	ATT		0.353	ARID4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276927.2	NM_023001		3	38	0	0	0	0.009096	0	3	38				
SPG11	80208	broad.mit.edu	37	15	44955626	44955627	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr15:44955626_44955627CC>AA	ENST00000261866.7	-	1	235_236	c.219_220GG>TT	c.(217-222)cgGGgc>cgTTgc	p.G74C	SPG11_ENST00000427534.2_Missense_Mutation_p.G74C|SPG11_ENST00000559193.1_Missense_Mutation_p.G74C|SPG11_ENST00000535302.2_Missense_Mutation_p.G74C|SPG11_ENST00000558319.1_Missense_Mutation_p.G74C	NM_025137.3	NP_079413.3	Q96JI7	SPTCS_HUMAN	spastic paraplegia 11 (autosomal recessive)	74					cell death (GO:0008219)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)		p.G74C(1)		autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	72		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		CGACCCCCGCCCCGGCTGCCAG	0.698																																							uc001ztx.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(1)	5						c.(217-222)CGGGGC>CGTTGC		spatacsin isoform 1																																				SO:0001583	missense	80208				cell death	cytosol|integral to membrane|nucleus	protein binding	g.chr15:44955626_44955627CC>AA		CCDS10112.1, CCDS53939.1	15q13-q15	2007-11-13			ENSG00000104133	ENSG00000104133			11226	protein-coding gene	gene with protein product	"""spatacsin"""	610844	"""KIAA1840"""	KIAA1840		10408536, 17322883	Standard	NM_001160227		Approved	FLJ21439	uc001ztx.3	Q96JI7	OTTHUMG00000131199	ENST00000261866.7:c.219_220delinsAA	15.37:g.44955626_44955627delinsAA	ENSP00000261866:p.Gly74Cys					SPG11_uc010ueh.1_Missense_Mutation_p.G74C|SPG11_uc010uei.1_Missense_Mutation_p.G74C|SPG11_uc001zua.1_Missense_Mutation_p.G74C	p.G74C	NM_025137	NP_079413	Q96JI7	SPTCS_HUMAN		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)	1	250_251	-		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)	74			Extracellular (Potential).		A8KAX9|B9EK60|F5H3N6|Q4VC11|Q58G86|Q69YG6|Q6NW01|Q8N270|Q8TBU9|Q9H734	Missense_Mutation	DNP	ENST00000261866.7	37	c.219_220GG>TT	CCDS10112.1																																																																																				0.698	SPG11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253927.1			3	10	0	0	0	0.004672	0	3	10				
FANCI	55215	broad.mit.edu	37	15	89811675	89811676	+	Nonsense_Mutation	DNP	GG	GG	CT			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr15:89811675_89811676GG>CT	ENST00000310775.7	+	10	887_888	c.801_802GG>CT	c.(799-804)gtGGaa>gtCTaa	p.E268*	FANCI_ENST00000300027.8_Nonsense_Mutation_p.E268*	NM_001113378.1	NP_001106849.1	Q9NVI1	FANCI_HUMAN	Fanconi anemia, complementation group I	268					cell cycle (GO:0007049)|DNA repair (GO:0006281)|positive regulation of protein ubiquitination (GO:0031398)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA polymerase binding (GO:0070182)	p.E268*(2)		breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	Lung NSC(78;0.0472)|all_lung(78;0.089)					TTCGTCATGTGGAAGGCACCAT	0.416								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																														uc010bnp.1		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(2)	2						c.(799-804)GTGGAA>GTCTAA	Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi anemia, complementation group I isoform																																				SO:0001587	stop_gained	55215	FanconAnemia	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	cell cycle|DNA repair	nucleoplasm	protein binding	g.chr15:89811675_89811676GG>CT	BC004277	CCDS10349.2, CCDS45346.1	15q26.1	2014-09-17	2007-05-03	2007-05-03	ENSG00000140525	ENSG00000140525		"""Fanconi anemia, complementation groups"""	25568	protein-coding gene	gene with protein product		611360	"""KIAA1794"""	KIAA1794		14630800, 17460694, 17412408	Standard	NM_001113378		Approved	FLJ10719	uc010bnp.1	Q9NVI1	OTTHUMG00000132993	Exception_encountered	15.37:g.89811675_89811676delinsCT	ENSP00000310842:p.Glu268*					FANCI_uc002bnm.1_Nonsense_Mutation_p.E268*|FANCI_uc002bnn.1_RNA|FANCI_uc002bnp.1_Nonsense_Mutation_p.E89*	p.E268*	NM_001113378	NP_001106849	Q9NVI1	FANCI_HUMAN			10	891_892	+	Lung NSC(78;0.0472)|all_lung(78;0.089)		268					A4ZVE4|A5YMH4|A6NJZ0|Q96JN1|Q96ST0|Q9BT96	Nonsense_Mutation	DNP	ENST00000310775.7	37	c.801_802GG>CT	CCDS45346.1																																																																																				0.416	FANCI-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421140.1	NM_018193		18	150	0	0	0	0.004672	0	18	150				
SPATA8	145946	broad.mit.edu	37	15	97327418	97327418	+	Missense_Mutation	SNP	G	G	T			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr15:97327418G>T	ENST00000328504.3	+	2	392	c.125G>T	c.(124-126)tGt>tTt	p.C42F	SPATA8-AS1_ENST00000560888.1_RNA|SPATA8-AS1_ENST00000558722.1_RNA|SPATA8_ENST00000558553.1_Start_Codon_SNP_p.M1I	NM_173499.3	NP_775770.1	Q6RVD6	SPAT8_HUMAN	spermatogenesis associated 8	42								p.C42F(1)		large_intestine(4)|lung(8)|ovary(1)|skin(3)	16	Melanoma(26;0.0142)|Lung NSC(78;0.041)|all_lung(78;0.0468)		OV - Ovarian serous cystadenocarcinoma(32;0.0718)			GCCATGACATGTCCCTGCGGC	0.592																																							uc002bue.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(124-126)TGT>TTT		spermatogenesis associated 8							77.0	74.0	75.0					15																	97327418		2197	4298	6495	SO:0001583	missense	145946							g.chr15:97327418G>T	AY489187	CCDS10376.1	15q26	2008-02-05			ENSG00000185594	ENSG00000185594			28676	protein-coding gene	gene with protein product		613948					Standard	NM_173499		Approved	MGC44294	uc002bue.3	Q6RVD6	OTTHUMG00000149847	ENST00000328504.3:c.125G>T	15.37:g.97327418G>T	ENSP00000328149:p.Cys42Phe					uc010urp.1_5'Flank|uc002bud.1_5'Flank	p.C42F	NM_173499	NP_775770	Q6RVD6	SPAT8_HUMAN	OV - Ovarian serous cystadenocarcinoma(32;0.0718)		2	335	+	Melanoma(26;0.0142)|Lung NSC(78;0.041)|all_lung(78;0.0468)		42					Q2KJ07	Missense_Mutation	SNP	ENST00000328504.3	37	c.125G>T	CCDS10376.1	.	.	.	.	.	.	.	.	.	.	G	15.67	2.901019	0.52227	.	.	ENSG00000185594	ENST00000328504	T	0.29917	1.55	4.04	3.12	0.35913	.	.	.	.	.	T	0.29716	0.0742	N	0.08118	0	0.58432	D	0.999999	D	0.67145	0.996	D	0.68192	0.956	T	0.17899	-1.0354	9	0.87932	D	0	.	7.8265	0.29318	0.1126:0.0:0.8874:0.0	.	42	Q6RVD6	SPAT8_HUMAN	F	42	ENSP00000328149:C42F	ENSP00000328149:C42F	C	+	2	0	SPATA8	95128422	0.666000	0.27475	0.995000	0.50966	0.969000	0.65631	0.774000	0.26675	1.293000	0.44690	0.655000	0.94253	TGT		0.592	SPATA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313533.1	NM_173499		12	67	1	0	9.31168e-06	0.016723	1.09974e-05	12	67				
TPSAB1	7177	broad.mit.edu	37	16	1291189	1291189	+	Missense_Mutation	SNP	G	G	A	rs143010092		TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr16:1291189G>A	ENST00000338844.3	+	3	130	c.97G>A	c.(97-99)Ggg>Agg	p.G33R	TPSAB1_ENST00000461509.2_Missense_Mutation_p.G40R	NM_003294.3	NP_003285.2	Q15661	TRYB1_HUMAN	tryptase alpha/beta 1	33	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				defense response (GO:0006952)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.G33R(1)		NS(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|skin(1)	10		Hepatocellular(780;0.00369)				GGGCATCGTCGGGGGTCAGGA	0.701																																							uc002ckz.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(97-99)GGG>AGG		tryptase alpha/beta 1 precursor		G	ARG/GLY	0,4398		0,0,2199	38.0	39.0	39.0		97	3.4	0.3	16	dbSNP_134	39	1,8599		0,1,4299	no	missense	TPSAB1	NM_003294.3	125	0,1,6498	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	33/276	1291189	1,12997	2199	4300	6499	SO:0001583	missense	7177				defense response|proteolysis	extracellular space	protein binding|serine-type endopeptidase activity	g.chr16:1291189G>A	M33494	CCDS10431.1	16p13.3	2009-11-13	2004-10-14	2004-10-15	ENSG00000172236	ENSG00000172236			12019	protein-coding gene	gene with protein product	"""tryptase alpha II"", ""tryptase beta I"", ""tryptase-I"", ""tryptase-II"", ""tryptase-III"""	191080	"""tryptase beta 1"""	TPSB1, TPS1, TPS2		2203827, 9920877	Standard	NM_003294		Approved		uc002ckz.3	Q15661	OTTHUMG00000090467	ENST00000338844.3:c.97G>A	16.37:g.1291189G>A	ENSP00000343577:p.Gly33Arg					TPSAB1_uc010uux.1_5'UTR	p.G33R	NM_003294	NP_003285	Q15661	TRYB1_HUMAN			3	149	+		Hepatocellular(780;0.00369)	33			Peptidase S1.		D2E6R9|D2E6S1|P15157|Q15663|Q6B052|Q9H2Y4|Q9H2Y5|Q9UQI1	Missense_Mutation	SNP	ENST00000338844.3	37	c.97G>A	CCDS10431.1	.	.	.	.	.	.	.	.	.	.	G	17.63	3.438212	0.62955	0.0	1.16E-4	ENSG00000172236	ENST00000338844;ENST00000461509	D;D	0.86230	-2.09;-2.09	3.38	3.38	0.38709	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.48767	D	0.000170	D	0.93423	0.7902	M	0.87269	2.87	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	D	0.94271	0.7511	10	0.87932	D	0	.	12.6931	0.56988	0.0:0.0:1.0:0.0	.	33	Q15661	TRYB1_HUMAN	R	33;40	ENSP00000343577:G33R;ENSP00000418247:G40R	ENSP00000343577:G33R	G	+	1	0	TPSAB1	1231190	0.970000	0.33590	0.257000	0.24404	0.160000	0.22226	3.309000	0.51903	1.905000	0.55150	0.479000	0.44913	GGG		0.701	TPSAB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000206914.1	NM_003294		4	44	0	0	0	0.02938	0	4	44				
TPSAB1	7177	broad.mit.edu	37	16	1291244	1291244	+	Missense_Mutation	SNP	A	A	G	rs150845192	byFrequency	TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr16:1291244A>G	ENST00000338844.3	+	3	185	c.152A>G	c.(151-153)cAc>cGc	p.H51R	TPSAB1_ENST00000461509.2_Missense_Mutation_p.H58R	NM_003294.3	NP_003285.2	Q15661	TRYB1_HUMAN	tryptase alpha/beta 1	51	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.		H -> R (in allele alpha; dbSNP:rs1060281).		defense response (GO:0006952)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.H51R(1)		NS(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|skin(1)	10		Hepatocellular(780;0.00369)				CTGAGAGTCCACGGCCCATAC	0.711													G|||	6	0.00119808	0.0038	0.0	5008	,	,		17027	0.0		0.0	False		,,,				2504	0.001						uc002ckz.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(151-153)CAC>CGC		tryptase alpha/beta 1 precursor																																				SO:0001583	missense	7177				defense response|proteolysis	extracellular space	protein binding|serine-type endopeptidase activity	g.chr16:1291244A>G	M33494	CCDS10431.1	16p13.3	2009-11-13	2004-10-14	2004-10-15	ENSG00000172236	ENSG00000172236			12019	protein-coding gene	gene with protein product	"""tryptase alpha II"", ""tryptase beta I"", ""tryptase-I"", ""tryptase-II"", ""tryptase-III"""	191080	"""tryptase beta 1"""	TPSB1, TPS1, TPS2		2203827, 9920877	Standard	NM_003294		Approved		uc002ckz.3	Q15661	OTTHUMG00000090467	ENST00000338844.3:c.152A>G	16.37:g.1291244A>G	ENSP00000343577:p.His51Arg					TPSAB1_uc010uux.1_5'UTR	p.H51R	NM_003294	NP_003285	Q15661	TRYB1_HUMAN			3	204	+		Hepatocellular(780;0.00369)	51			Peptidase S1.		D2E6R9|D2E6S1|P15157|Q15663|Q6B052|Q9H2Y4|Q9H2Y5|Q9UQI1	Missense_Mutation	SNP	ENST00000338844.3	37	c.152A>G	CCDS10431.1	.	.	.	.	.	.	.	.	.	.	G	4.011	-0.000521	0.07819	.	.	ENSG00000172236	ENST00000338844;ENST00000461509	D;D	0.87729	-2.29;-2.29	3.9	-2.91	0.05631	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	1.935460	0.02380	N	0.078734	T	0.61887	0.2383	N	0.00413	-1.525	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.60662	-0.7219	10	0.13108	T	0.6	.	9.4252	0.38574	0.4176:0.0:0.5824:0.0	.	51	Q15661	TRYB1_HUMAN	R	51;58	ENSP00000343577:H51R;ENSP00000418247:H58R	ENSP00000343577:H51R	H	+	2	0	TPSAB1	1231245	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.868000	0.04236	-0.567000	0.06046	-1.818000	0.00600	CAC		0.711	TPSAB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000206914.1	NM_003294		5	71	0	0	0	0.008291	0	5	71				
MAPK8IP3	23162	broad.mit.edu	37	16	1798647	1798647	+	Missense_Mutation	SNP	A	A	G			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr16:1798647A>G	ENST00000250894.4	+	8	1296	c.1139A>G	c.(1138-1140)gAc>gGc	p.D380G	MAPK8IP3_ENST00000356010.5_Missense_Mutation_p.D380G|MAPK8IP3_ENST00000568271.1_3'UTR|LA16c-361A3.3_ENST00000569670.1_RNA	NM_015133.3	NP_055948.2	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting protein 3	380					activation of JUN kinase activity (GO:0007257)|axon guidance (GO:0007411)|forebrain development (GO:0030900)|in utero embryonic development (GO:0001701)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|positive regulation of neuron differentiation (GO:0045666)|post-embryonic development (GO:0009791)|protein localization (GO:0008104)|regulation of gene expression (GO:0010468)|regulation of JNK cascade (GO:0046328)|respiratory gaseous exchange (GO:0007585)|vesicle-mediated transport (GO:0016192)	axolemma (GO:0030673)|dendrite (GO:0030425)|Golgi membrane (GO:0000139)|smooth endoplasmic reticulum (GO:0005790)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)	p.D381G(1)		NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	42						ATCAACACCGACTCCCTGTAC	0.627																																							uc002cmk.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)|central_nervous_system(1)	3						c.(1138-1140)GAC>GGC		mitogen-activated protein kinase 8 interacting							68.0	74.0	72.0					16																	1798647		2128	4251	6379	SO:0001583	missense	23162				vesicle-mediated transport	Golgi membrane	kinesin binding|MAP-kinase scaffold activity|protein kinase binding	g.chr16:1798647A>G	AB028989	CCDS10442.2, CCDS45379.1	16p13.3	2009-11-23			ENSG00000138834	ENSG00000138834			6884	protein-coding gene	gene with protein product	"""homolog of Drosophila Sunday driver 2"""	605431				10523642, 10629060	Standard	XM_005255187		Approved	KIAA1066, JSAP1, JIP3, syd	uc002cmk.3	Q9UPT6	OTTHUMG00000128637	ENST00000250894.4:c.1139A>G	16.37:g.1798647A>G	ENSP00000250894:p.Asp380Gly					MAPK8IP3_uc002cml.2_Missense_Mutation_p.D380G|MAPK8IP3_uc010uvl.1_Missense_Mutation_p.D381G	p.D380G	NM_015133	NP_055948	Q9UPT6	JIP3_HUMAN			8	1259	+			380					A2A2B3|A7E2B3|Q96RY4|Q9H4I4|Q9H7P1|Q9NUG0	Missense_Mutation	SNP	ENST00000250894.4	37	c.1139A>G	CCDS10442.2	.	.	.	.	.	.	.	.	.	.	A	29.3	4.998272	0.93227	.	.	ENSG00000138834	ENST00000250894;ENST00000356010	T;T	0.37411	1.28;1.2	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.55832	0.1945	L	0.59436	1.845	0.80722	D	1	P;D;D	0.71674	0.761;0.985;0.998	B;P;D	0.71870	0.428;0.867;0.975	T	0.58222	-0.7674	10	0.62326	D	0.03	-50.8346	15.2043	0.73165	1.0:0.0:0.0:0.0	.	381;380;380	B7ZMF3;E9PFH7;Q9UPT6	.;.;JIP3_HUMAN	G	380	ENSP00000250894:D380G;ENSP00000348290:D380G	ENSP00000250894:D380G	D	+	2	0	MAPK8IP3	1738648	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	9.176000	0.94839	2.123000	0.65237	0.523000	0.50628	GAC		0.627	MAPK8IP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250508.2	NM_001040439		5	36	0	0	0	0.021553	0	5	36				
PRSS22	64063	broad.mit.edu	37	16	2906186	2906186	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr16:2906186C>A	ENST00000161006.3	-	3	243	c.178G>T	c.(178-180)Gag>Tag	p.E60*	PRSS22_ENST00000571228.1_Nonsense_Mutation_p.E60*|PRSS22_ENST00000574768.1_5'UTR|LA16c-325D7.1_ENST00000577140.1_RNA	NM_022119.3	NP_071402.1	Q9GZN4	BSSP4_HUMAN	protease, serine, 22	60	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)	p.E60*(1)		central_nervous_system(1)|large_intestine(2)|lung(3)|prostate(2)|skin(2)	10						CAGGGCCACTCGCTGTCAGTG	0.602																																							uc002cry.1		NA																	1	Substitution - Nonsense(1)		lung(1)	central_nervous_system(1)	1						c.(178-180)GAG>TAG		protease, serine, 22 precursor							80.0	76.0	77.0					16																	2906186		2198	4300	6498	SO:0001587	stop_gained	64063				proteolysis	extracellular region	serine-type endopeptidase activity	g.chr16:2906186C>A	AF321182	CCDS10481.1	16p13.3	2010-05-07			ENSG00000005001	ENSG00000005001		"""Serine peptidases / Serine peptidases"""	14368	protein-coding gene	gene with protein product	"""brain-specific serine protease 4"""	609343				11602603, 15701722	Standard	XM_005255473		Approved	hBSSP-4, BSSP-4, SP001LA	uc002cry.1	Q9GZN4	OTTHUMG00000128961	ENST00000161006.3:c.178G>T	16.37:g.2906186C>A	ENSP00000161006:p.Glu60*					PRSS22_uc002crz.1_Nonsense_Mutation_p.E60*	p.E60*	NM_022119	NP_071402	Q9GZN4	BSSP4_HUMAN			3	244	-			60			Peptidase S1.		O43342|Q6UXE0	Nonsense_Mutation	SNP	ENST00000161006.3	37	c.178G>T	CCDS10481.1	.	.	.	.	.	.	.	.	.	.	c	15.27	2.785043	0.49997	.	.	ENSG00000005001	ENST00000161006	.	.	.	4.86	1.53	0.23141	.	0.241259	0.28778	N	0.014180	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	13.978	0.64285	0.0:0.5479:0.4521:0.0	.	.	.	.	X	60	.	ENSP00000161006:E60X	E	-	1	0	PRSS22	2846187	0.001000	0.12720	0.484000	0.27391	0.180000	0.23129	0.252000	0.18278	0.433000	0.26313	0.456000	0.33151	GAG		0.602	PRSS22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250943.1	NM_022119		10	47	1	0	0.00829132	0.008291	0.00867107	10	47				
CHD3	1107	broad.mit.edu	37	17	7809897	7809897	+	Missense_Mutation	SNP	A	A	G			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr17:7809897A>G	ENST00000330494.7	+	29	4535	c.4385A>G	c.(4384-4386)cAt>cGt	p.H1462R	CHD3_ENST00000358181.4_Missense_Mutation_p.H1462R|CHD3_ENST00000380358.4_Missense_Mutation_p.H1521R|SCARNA21_ENST00000517026.1_RNA	NM_001005273.2	NP_001005273.1	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	1462					centrosome organization (GO:0051297)|chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|spindle organization (GO:0007051)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.H1462R(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(11)|kidney(6)|large_intestine(13)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	65		Prostate(122;0.202)				TTCATGCGCCATCTGTGTGAG	0.612																																							uc002gje.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(4384-4386)CAT>CGT		chromodomain helicase DNA binding protein 3							118.0	114.0	115.0					17																	7809897		2203	4300	6503	SO:0001583	missense	1107				chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|zinc ion binding	g.chr17:7809897A>G	U08379	CCDS32553.2, CCDS32554.1, CCDS32555.1	17p13	2013-01-28			ENSG00000170004	ENSG00000170004		"""Zinc fingers, PHD-type"""	1918	protein-coding gene	gene with protein product		602120				9326634, 7560064	Standard	NM_001005271		Approved	Mi-2a, ZFH, Mi2-ALPHA	uc002gjd.2	Q12873	OTTHUMG00000150427	ENST00000330494.7:c.4385A>G	17.37:g.7809897A>G	ENSP00000332628:p.His1462Arg					CHD3_uc002gjd.2_Missense_Mutation_p.H1521R|CHD3_uc002gjf.2_Missense_Mutation_p.H1462R|CHD3_uc002gjh.2_Missense_Mutation_p.H38R|CHD3_uc002gjj.2_5'Flank	p.H1462R	NM_001005273	NP_001005273	Q12873	CHD3_HUMAN			29	4535	+		Prostate(122;0.202)	1462					D3DTQ9|E9PG89|Q9Y4I0	Missense_Mutation	SNP	ENST00000330494.7	37	c.4385A>G	CCDS32554.1	.	.	.	.	.	.	.	.	.	.	A	16.16	3.044326	0.55110	.	.	ENSG00000170004	ENST00000380358;ENST00000358181;ENST00000330494	D;D;D	0.93763	-3.28;-3.22;-3.18	4.58	4.58	0.56647	Domain of unknown function DUF1086 (1);	0.000000	0.43260	D	0.000593	D	0.96661	0.8910	M	0.85630	2.765	0.80722	D	1	D;D;D;D	0.69078	0.983;0.989;0.991;0.997	D;D;D;D	0.80764	0.992;0.985;0.991;0.994	D	0.97341	0.9957	10	0.87932	D	0	-17.0604	14.1297	0.65245	1.0:0.0:0.0:0.0	.	38;1462;1462;1521	B3KWV4;Q12873-2;Q12873;E9PG89	.;.;CHD3_HUMAN;.	R	1521;1462;1462	ENSP00000369716:H1521R;ENSP00000350907:H1462R;ENSP00000332628:H1462R	ENSP00000332628:H1462R	H	+	2	0	CHD3	7750622	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.985000	0.76193	1.924000	0.55735	0.402000	0.26972	CAT		0.612	CHD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318050.1	NM_001005273		12	82	0	0	0	0.020292	0	12	82				
NATD1	256302	broad.mit.edu	37	17	21146727	21146727	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr17:21146727C>T	ENST00000399011.2	-	4	239	c.238G>A	c.(238-240)Gtg>Atg	p.V80M	C17orf103_ENST00000468196.1_Silent_p.S80S	NM_152914.2	NP_690878.2	Q8N6N6	NATD1_HUMAN		81	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.							p.V80M(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(2)	6						TCCTCCACCACGAAGTCCAGG	0.657																																							uc010vzx.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(241-243)GTG>ATG		transcript expressed during hematopoiesis 2							39.0	44.0	42.0					17																	21146727		1973	4142	6115	SO:0001583	missense	256302							g.chr17:21146727C>T																												ENST00000399011.2:c.238G>A	17.37:g.21146727C>T	ENSP00000454565:p.Val80Met						p.V81M	NM_152914	NP_690878	Q8N6N6	GTL3B_HUMAN			4	243	-			81					A8MWQ7|B3KX70	Missense_Mutation	SNP	ENST00000399011.2	37	c.241G>A																																																																																					0.657	C17orf103-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				4	38	0	0	0	0.009096	0	4	38				
KRT31	3881	broad.mit.edu	37	17	39552755	39552755	+	Missense_Mutation	SNP	G	G	C			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr17:39552755G>C	ENST00000251645.2	-	3	557	c.505C>G	c.(505-507)Ctg>Gtg	p.L169V		NM_002277.2	NP_002268.2	Q15323	K1H1_HUMAN	keratin 31	169	Coil 1B.|Rod.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural constituent of cytoskeleton (GO:0005200)	p.L169V(2)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	31		Breast(137;0.000496)				CACAGGGTCAGCTCATCCAGG	0.597																																							uc002hwn.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(505-507)CTG>GTG		keratin 31							98.0	82.0	87.0					17																	39552755		2203	4300	6503	SO:0001583	missense	3881				epidermis development	intermediate filament	protein binding|structural constituent of cytoskeleton	g.chr17:39552755G>C	X86570	CCDS11391.1	17q21.2	2014-05-20	2006-07-17	2006-07-17	ENSG00000094796	ENSG00000094796		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6448	protein-coding gene	gene with protein product	"""hard keratin type I 1"""	601077	"""keratin, hair, acidic, 1"""	KRTHA1		7578244, 16831889	Standard	NM_002277		Approved	Ha-1	uc002hwn.3	Q15323	OTTHUMG00000133423	ENST00000251645.2:c.505C>G	17.37:g.39552755G>C	ENSP00000251645:p.Leu169Val					KRT31_uc010cxn.2_Missense_Mutation_p.L169V	p.L169V	NM_002277	NP_002268	Q15323	K1H1_HUMAN			3	558	-		Breast(137;0.000496)	169			Rod.|Coil 1B.		Q9UE12	Missense_Mutation	SNP	ENST00000251645.2	37	c.505C>G	CCDS11391.1	.	.	.	.	.	.	.	.	.	.	g	19.42	3.824970	0.71143	.	.	ENSG00000094796	ENST00000251645	D	0.81659	-1.52	5.11	5.11	0.69529	Filament (1);	0.000000	0.49916	D	0.000130	D	0.90222	0.6943	M	0.88181	2.935	0.31926	N	0.612804	D	0.60575	0.988	P	0.60415	0.874	D	0.92194	0.5762	10	0.72032	D	0.01	.	17.895	0.88885	0.0:0.0:1.0:0.0	.	169	Q15323	K1H1_HUMAN	V	169	ENSP00000251645:L169V	ENSP00000251645:L169V	L	-	1	2	KRT31	36806281	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.795000	0.62489	2.523000	0.85059	0.655000	0.94253	CTG		0.597	KRT31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257286.1	NM_002277		6	54	0	0	0	0.038147	0	6	54				
KRT35	3886	broad.mit.edu	37	17	39636983	39636983	+	Missense_Mutation	SNP	C	C	A	rs201336508		TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr17:39636983C>A	ENST00000393989.1	-	1	409	c.367G>T	c.(367-369)Gcc>Tcc	p.A123S	KRT35_ENST00000246639.2_Missense_Mutation_p.A93S	NM_002280.4	NP_002271.3	Q92764	KRT35_HUMAN	keratin 35	123	Coil 1A.|Rod.				anatomical structure morphogenesis (GO:0009653)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)	p.A123S(1)|p.A123T(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	29		Breast(137;0.000286)				TCCAGGCTGGCGTTCTCCTGC	0.612																																							uc002hws.2		NA																	2	Substitution - Missense(2)		lung(1)|endometrium(1)	ovary(1)|skin(1)	2						c.(367-369)GCC>TCC		keratin 35							72.0	78.0	76.0					17																	39636983		2203	4299	6502	SO:0001583	missense	3886				anatomical structure morphogenesis	intermediate filament	protein binding|structural molecule activity	g.chr17:39636983C>A	X90762	CCDS11394.2	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000197079	ENSG00000197079		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6453	protein-coding gene	gene with protein product	"""hard keratin type I 5"""	602764	"""keratin, hair, acidic, 5"""	KRTHA5		8823373, 16831889	Standard	NM_002280		Approved	Ha-5	uc002hws.3	Q92764	OTTHUMG00000133425	ENST00000393989.1:c.367G>T	17.37:g.39636983C>A	ENSP00000377558:p.Ala123Ser						p.A123S	NM_002280	NP_002271	Q92764	KRT35_HUMAN			1	410	-		Breast(137;0.000286)	123			Rod.|Coil 1A.		O76012|Q92651	Missense_Mutation	SNP	ENST00000393989.1	37	c.367G>T	CCDS11394.2	.	.	.	.	.	.	.	.	.	.	C	10.68	1.419574	0.25552	.	.	ENSG00000197079	ENST00000246639;ENST00000393989	D;D	0.88586	-2.4;-2.4	5.24	0.987	0.19790	Filament (1);	0.100666	0.44285	D	0.000477	D	0.86900	0.6044	L	0.55834	1.745	0.09310	N	1	B	0.22003	0.063	B	0.39617	0.305	T	0.79075	-0.1952	10	0.54805	T	0.06	.	6.4637	0.21970	0.1157:0.6156:0.0:0.2687	.	123	Q92764	KRT35_HUMAN	S	93;123	ENSP00000246639:A93S;ENSP00000377558:A123S	ENSP00000246639:A93S	A	-	1	0	KRT35	36890509	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.495000	0.06443	0.083000	0.17047	0.561000	0.74099	GCC		0.612	KRT35-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_002280		7	97	1	0	0.000157383	0.038147	0.000175297	7	97				
BRCA1	672	broad.mit.edu	37	17	41245544	41245544	+	Silent	SNP	G	G	A			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr17:41245544G>A	ENST00000357654.3	-	10	2122	c.2004C>T	c.(2002-2004)ctC>ctT	p.L668L	BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000346315.3_Silent_p.L668L|BRCA1_ENST00000309486.4_Silent_p.L372L|BRCA1_ENST00000468300.1_Intron|BRCA1_ENST00000351666.3_Intron|BRCA1_ENST00000493795.1_Silent_p.L621L|BRCA1_ENST00000354071.3_Silent_p.L668L|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000471181.2_Silent_p.L668L|BRCA1_ENST00000491747.2_Intron|BRCA1_ENST00000352993.3_Intron|BRCA1_ENST00000591534.1_Intron	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	668			L -> F (in BC; unknown pathological significance; functionally neutral in vitro).		androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.L668L(1)		NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TACCTTCCATGAGTTGTAGGT	0.398			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																													uc002icq.2		NA	yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	D|Mis|N|F|S	familial breast/ovarian cancer gene 1			E		breast|ovarian	ovarian		1	Substitution - coding silent(1)		lung(1)	ovary(24)|breast(21)|lung(4)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)	52						c.(2002-2004)CTC>CTT	Homologous_recombination	breast cancer 1, early onset isoform 1							111.0	98.0	102.0					17																	41245544		2202	4300	6502	SO:0001819	synonymous_variant	672	Hereditary_Breast-Ovarian_Cancer_BRCA1_type	Familial Cancer Database		androgen receptor signaling pathway|apoptosis|cellular response to indole-3-methanol|chromosome segregation|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA damage response, signal transduction resulting in induction of apoptosis|double-strand break repair via homologous recombination|fatty acid biosynthetic process|G2/M transition DNA damage checkpoint|negative regulation of centriole replication|negative regulation of fatty acid biosynthetic process|negative regulation of histone H3-K9 methylation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle arrest|positive regulation of DNA repair|positive regulation of histone acetylation|positive regulation of histone H3-K4 methylation|positive regulation of histone H4-K20 methylation|positive regulation of protein ubiquitination|positive regulation of transcription from RNA polymerase II promoter|postreplication repair|protein autoubiquitination|protein K6-linked ubiquitination|regulation of cell motility|regulation of cell proliferation|regulation of transcription from RNA polymerase III promoter|response to estrogen stimulus|response to ionizing radiation|substrate adhesion-dependent cell spreading	BRCA1-A complex|BRCA1-BARD1 complex|gamma-tubulin ring complex|nucleoplasm|plasma membrane|ribonucleoprotein complex|ruffle	androgen receptor binding|identical protein binding|protein binding|RNA binding|transcription coactivator activity|transcription regulatory region DNA binding|tubulin binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr17:41245544G>A	U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.2004C>T	17.37:g.41245544G>A		TCGA Ovarian(2;0.000030)				BRCA1_uc010whp.1_Intron|BRCA1_uc010whl.1_Intron|BRCA1_uc010whm.1_Intron|BRCA1_uc002icp.3_Silent_p.L597L|BRCA1_uc002icu.2_Intron|BRCA1_uc010cyx.2_Silent_p.L621L|BRCA1_uc002ict.2_Silent_p.L668L|BRCA1_uc010whn.1_Intron|BRCA1_uc010who.1_Intron|BRCA1_uc010whq.1_Intron|BRCA1_uc002idc.1_Intron|BRCA1_uc010whr.1_Intron|BRCA1_uc002idd.2_Silent_p.L668L|BRCA1_uc002ide.1_Silent_p.L499L|BRCA1_uc010cyy.1_Silent_p.L668L|BRCA1_uc010whs.1_Silent_p.L668L|BRCA1_uc010cyz.2_Silent_p.L621L|BRCA1_uc010cza.2_Silent_p.L642L|BRCA1_uc010wht.1_Silent_p.L372L	p.L668L	NM_007294	NP_009225	P38398	BRCA1_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.126)	10	2236	-		Breast(137;0.000717)	668					O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Silent	SNP	ENST00000357654.3	37	c.2004C>T	CCDS11453.1																																																																																				0.398	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348798.2	NM_007294		13	93	0	0	0	0.016723	0	13	93				
CACNG4	27092	broad.mit.edu	37	17	65021068	65021068	+	Missense_Mutation	SNP	C	C	A			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr17:65021068C>A	ENST00000262138.3	+	3	399	c.397C>A	c.(397-399)Cgc>Agc	p.R133S		NM_014405.3	NP_055220.1	Q9UBN1	CCG4_HUMAN	calcium channel, voltage-dependent, gamma subunit 4	133					membrane depolarization (GO:0051899)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)	p.R133S(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(3)	19	all_cancers(12;9.86e-11)		BRCA - Breast invasive adenocarcinoma(6;1.35e-07)			GATCTACAGCCGCAAGAACAA	0.672																																							uc002jft.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(397-399)CGC>AGC		voltage-dependent calcium channel gamma-4							100.0	86.0	91.0					17																	65021068		2203	4300	6503	SO:0001583	missense	27092				membrane depolarization|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane	voltage-gated calcium channel activity	g.chr17:65021068C>A	AH008289	CCDS11667.1	17q24	2006-01-23				ENSG00000075461		"""Calcium channel subunits"""	1408	protein-coding gene	gene with protein product		606404				10613843	Standard	NM_014405		Approved	MGC11138, MGC24983	uc002jft.2	Q9UBN1		ENST00000262138.3:c.397C>A	17.37:g.65021068C>A	ENSP00000262138:p.Arg133Ser						p.R133S	NM_014405	NP_055220	Q9UBN1	CCG4_HUMAN	BRCA - Breast invasive adenocarcinoma(6;1.35e-07)		3	412	+	all_cancers(12;9.86e-11)		133			Cytoplasmic (Potential).		B2RCK0	Missense_Mutation	SNP	ENST00000262138.3	37	c.397C>A	CCDS11667.1	.	.	.	.	.	.	.	.	.	.	C	3.893	-0.023597	0.07634	.	.	ENSG00000075461	ENST00000262138	D	0.87966	-2.32	4.81	2.67	0.31697	.	0.294943	0.41097	D	0.000949	T	0.68026	0.2956	N	0.05441	-0.05	0.41943	D	0.990625	B	0.02656	0.0	B	0.06405	0.002	T	0.61227	-0.7105	10	0.02654	T	1	-3.4274	9.5114	0.39078	0.1968:0.7171:0.0:0.0861	.	133	Q9UBN1	CCG4_HUMAN	S	133	ENSP00000262138:R133S	ENSP00000262138:R133S	R	+	1	0	CACNG4	62451530	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.706000	0.47135	1.157000	0.42530	0.561000	0.74099	CGC		0.672	CACNG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447036.1	NM_014405		4	75	1	0	0.000602214	0.014758	0.000644558	4	75				
SLC25A10	1468	broad.mit.edu	37	17	79682037	79682037	+	Missense_Mutation	SNP	C	C	T	rs368648459		TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr17:79682037C>T	ENST00000350690.5	+	2	234	c.148C>T	c.(148-150)Cgg>Tgg	p.R50W	SLC25A10_ENST00000545862.1_Missense_Mutation_p.R7W|SLC25A10_ENST00000541223.1_Missense_Mutation_p.R205W|SLC25A10_ENST00000571730.1_Missense_Mutation_p.R205W|SLC25A10_ENST00000331531.5_Missense_Mutation_p.R50W	NM_001270953.1|NM_012140.4	NP_001257882.1|NP_036272.2	Q9UBX3	DIC_HUMAN	solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10	50					carbohydrate metabolic process (GO:0005975)|cellular nitrogen compound metabolic process (GO:0034641)|dicarboxylic acid transport (GO:0006835)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|ion transport (GO:0006811)|mitochondrial transport (GO:0006839)|small molecule metabolic process (GO:0044281)|sulfide oxidation, using sulfide:quinone oxidoreductase (GO:0070221)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	dicarboxylic acid transmembrane transporter activity (GO:0005310)	p.R50W(1)		endometrium(1)|lung(9)|ovary(1)|prostate(1)|skin(2)	14	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.23)		BRCA - Breast invasive adenocarcinoma(99;0.0117)|OV - Ovarian serous cystadenocarcinoma(97;0.0955)		Succinic acid(DB00139)	CATGGCGCTGCGGGTGGTGCG	0.667																																							uc002kbi.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(148-150)CGG>TGG		solute carrier family 25 (mitochondrial carrier;	Succinic acid(DB00139)	C	TRP/ARG	1,4399	2.1+/-5.4	0,1,2199	51.0	40.0	43.0		148	0.8	0.8	17		43	0,8600		0,0,4300	no	missense	SLC25A10	NM_012140.3	101	0,1,6499	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	50/288	79682037	1,12999	2200	4300	6500	SO:0001583	missense	1468				gluconeogenesis|mitochondrial transport	integral to membrane|mitochondrial inner membrane|nucleus	protein binding	g.chr17:79682037C>T		CCDS11786.1, CCDS59301.1, CCDS74176.1	17q25.3	2013-07-15			ENSG00000183048	ENSG00000183048		"""Solute carriers"""	10980	protein-coding gene	gene with protein product		606794		DIC		9733776, 10072589	Standard	NM_001270953		Approved		uc031rew.1	Q9UBX3	OTTHUMG00000178173	ENST00000350690.5:c.148C>T	17.37:g.79682037C>T	ENSP00000345580:p.Arg50Trp					SLC25A10_uc010wut.1_Missense_Mutation_p.R205W|SLC25A10_uc010dif.2_Missense_Mutation_p.R50W|SLC25A10_uc010wuu.1_Missense_Mutation_p.R4W	p.R50W	NM_012140	NP_036272	Q9UBX3	DIC_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0117)|OV - Ovarian serous cystadenocarcinoma(97;0.0955)		2	234	+	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.23)		50			Solcar 1.		Q542Z3|Q96BA1|Q96IP1	Missense_Mutation	SNP	ENST00000350690.5	37	c.148C>T	CCDS11786.1	.	.	.	.	.	.	.	.	.	.	C	14.40	2.523587	0.44866	2.27E-4	0.0	ENSG00000183048	ENST00000541223;ENST00000331531;ENST00000350690;ENST00000545862	T;T;T;T	0.80033	-1.33;-1.33;-1.33;-1.33	4.29	0.776	0.18532	Mitochondrial carrier domain (2);	0.789007	0.11462	N	0.561656	D	0.83834	0.5340	M	0.74467	2.265	0.09310	N	1	D;D;D	0.67145	0.996;0.987;0.962	P;P;P	0.55303	0.773;0.54;0.67	T	0.72268	-0.4343	10	0.66056	D	0.02	-6.1623	7.5147	0.27593	0.403:0.51:0.0:0.0871	.	205;50;50	B4DLN1;Q9UBX3-2;Q9UBX3	.;.;DIC_HUMAN	W	205;50;50;7	ENSP00000439565:R205W;ENSP00000328403:R50W;ENSP00000345580:R50W;ENSP00000446242:R7W	ENSP00000328403:R50W	R	+	1	2	SLC25A10	77292442	0.545000	0.26449	0.794000	0.32065	0.316000	0.28119	1.623000	0.37008	0.813000	0.34350	-0.219000	0.12488	CGG		0.667	SLC25A10-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000440816.1			8	32	0	0	0	0.004482	0	8	32				
SLC39A6	25800	broad.mit.edu	37	18	33694106	33694106	+	Silent	SNP	C	C	A			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr18:33694106C>A	ENST00000590986.1	-	7	2086	c.1797G>T	c.(1795-1797)gtG>gtT	p.V599V	SLC39A6_ENST00000269187.5_Silent_p.V599V|SLC39A6_ENST00000440549.2_Silent_p.V324V			Q13433	S39A6_HUMAN	solute carrier family 39 (zinc transporter), member 6	599					cellular zinc ion homeostasis (GO:0006882)|transmembrane transport (GO:0055085)|zinc ion transmembrane import (GO:0071578)|zinc ion transmembrane transport (GO:0071577)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|lamellipodium membrane (GO:0031258)|plasma membrane (GO:0005886)	zinc ion transmembrane transporter activity (GO:0005385)	p.V599V(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(4)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	41						CACCCATTATCACCATCCAGG	0.478																																							uc010dmy.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(1795-1797)GTG>GTT		solute carrier family 39 (zinc transporter),							103.0	105.0	105.0					18																	33694106		2172	4278	6450	SO:0001819	synonymous_variant	25800					integral to membrane|lamellipodium membrane	zinc ion transmembrane transporter activity	g.chr18:33694106C>A	U41060	CCDS42428.1, CCDS45854.1	18q12.2	2013-05-22				ENSG00000141424		"""Solute carriers"""	18607	protein-coding gene	gene with protein product		608731	"""solute carrier family 39 (metal ion transporter), member 6"""			12659941, 12839489	Standard	NM_012319		Approved	LIV-1	uc010dmy.3	Q13433		ENST00000590986.1:c.1797G>T	18.37:g.33694106C>A						SLC39A6_uc002kzj.2_Silent_p.V324V	p.V599V	NM_012319	NP_036451	Q13433	S39A6_HUMAN			7	2087	-			599			Cytoplasmic (Potential).		B4DR49|B4E224|Q8IXR3|Q96HP5	Silent	SNP	ENST00000590986.1	37	c.1797G>T	CCDS42428.1																																																																																				0.478	SLC39A6-004	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000444136.1			5	60	1	0	3.59834e-05	0.021553	4.1081e-05	5	60				
XAB2	56949	broad.mit.edu	37	19	7691039	7691039	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr19:7691039C>T	ENST00000358368.4	-	5	677	c.640G>A	c.(640-642)Ggc>Agc	p.G214S	XAB2_ENST00000534844.1_Missense_Mutation_p.G211S	NM_020196.2	NP_064581.2	Q9HCS7	SYF1_HUMAN	XPA binding protein 2	214					blastocyst development (GO:0001824)|DNA repair (GO:0006281)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|transcription, DNA-templated (GO:0006351)|transcription-coupled nucleotide-excision repair (GO:0006283)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.G211S(1)		breast(1)|central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	26						TTGGACTTGCCGGCCTTAGAC	0.642								Direct reversal of damage;Nucleotide excision repair (NER)																															uc002mgx.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|breast(1)|skin(1)	4						c.(640-642)GGC>AGC	Direct_reversal_of_damage|NER	XPA binding protein 2							63.0	69.0	67.0					19																	7691039		2203	4299	6502	SO:0001583	missense	56949				transcription, DNA-dependent|transcription-coupled nucleotide-excision repair	catalytic step 2 spliceosome|nucleoplasm	protein binding	g.chr19:7691039C>T	AB026111	CCDS32892.1	19p13.3	2013-08-21				ENSG00000076924			14089	protein-coding gene	gene with protein product	"""SYF1 homolog, RNA splicing factor (S. cerevisiae)"", ""SYF1 pre-mRNA-splicing factor"""	610850				10944529	Standard	NM_020196		Approved	HCNP, HCRN, SYF1, NTC90	uc002mgx.3	Q9HCS7		ENST00000358368.4:c.640G>A	19.37:g.7691039C>T	ENSP00000351137:p.Gly214Ser						p.G214S	NM_020196	NP_064581	Q9HCS7	SYF1_HUMAN			5	666	-			214			HAT 6.		Q8TET6|Q96HB0|Q96IW0|Q9NRG6|Q9ULP3	Missense_Mutation	SNP	ENST00000358368.4	37	c.640G>A	CCDS32892.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.987675	0.74589	.	.	ENSG00000076924	ENST00000358368;ENST00000534844	T;T	0.62364	0.03;0.03	4.84	3.8	0.43715	.	0.000000	0.85682	D	0.000000	T	0.72211	0.3432	M	0.75447	2.3	0.58432	D	0.999998	D	0.76494	0.999	P	0.58520	0.84	T	0.73372	-0.4003	10	0.52906	T	0.07	-43.9904	10.2415	0.43314	0.0:0.9057:0.0:0.0943	.	214	Q9HCS7	SYF1_HUMAN	S	214;211	ENSP00000351137:G214S;ENSP00000438225:G211S	ENSP00000351137:G214S	G	-	1	0	XAB2	7597039	1.000000	0.71417	0.986000	0.45419	0.502000	0.33828	7.343000	0.79319	1.033000	0.39918	0.455000	0.32223	GGC		0.642	XAB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000461021.1	NM_020196		3	108	0	0	0	0.004672	0	3	108				
S1PR2	9294	broad.mit.edu	37	19	10334757	10334757	+	Silent	SNP	G	G	A	rs201255057	byFrequency	TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr19:10334757G>A	ENST00000590320.1	-	2	935	c.825C>T	c.(823-825)gcC>gcT	p.A275A	CTD-2369P2.2_ENST00000317726.4_lincRNA	NM_004230.3	NP_004221.3	O95136	S1PR2_HUMAN	sphingosine-1-phosphate receptor 2	275					activation of MAPK activity (GO:0000187)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|positive regulation of cell proliferation (GO:0008284)|positive regulation of establishment of endothelial barrier (GO:1903142)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|G-protein coupled receptor binding (GO:0001664)|integrin binding (GO:0005178)|lipid binding (GO:0008289)|sphingosine-1-phosphate receptor activity (GO:0038036)	p.A275A(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15						GGGTGGAGACGGCGAAAAAGT	0.632													G|||	4	0.000798722	0.0	0.0029	5008	,	,		16521	0.001		0.001	False		,,,				2504	0.0				Pancreas(194;229 3020 15179 45747)	Pancreas(194;229 3020 15179 45747)	uc002mnl.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(1)|central_nervous_system(1)	2						c.(823-825)GCC>GCT		endothelial differentiation, sphingolipid							69.0	62.0	65.0					19																	10334757		2203	4300	6503	SO:0001819	synonymous_variant	9294				activation of MAPK activity|positive regulation of cell proliferation	integral to membrane|plasma membrane	lipid binding|lysosphingolipid and lysophosphatidic acid receptor activity	g.chr19:10334757G>A	AF034780	CCDS12229.1	19q13	2013-03-13	2008-04-30	2008-04-30	ENSG00000267534	ENSG00000267534		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	3169	protein-coding gene	gene with protein product		605111	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 5"""	EDG5		8087418, 8878560	Standard	NM_004230		Approved	Gpcr13, H218, AGR16	uc002mnl.2	O95136	OTTHUMG00000180399	ENST00000590320.1:c.825C>T	19.37:g.10334757G>A							p.A275A	NM_004230	NP_004221	O95136	S1PR2_HUMAN			2	936	-			275			Helical; Name=7; (By similarity).		Q86UN8	Silent	SNP	ENST00000590320.1	37	c.825C>T	CCDS12229.1																																																																																				0.632	S1PR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451194.1	NM_004230		5	28	0	0	0	0.021553	0	5	28				
SMARCA4	6597	broad.mit.edu	37	19	11100015	11100015	+	Nonsense_Mutation	SNP	C	C	T			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr19:11100015C>T	ENST00000429416.3	+	8	1422	c.1141C>T	c.(1141-1143)Cga>Tga	p.R381*	SMARCA4_ENST00000358026.2_Nonsense_Mutation_p.R381*|SMARCA4_ENST00000413806.3_Nonsense_Mutation_p.R381*|SMARCA4_ENST00000344626.4_Nonsense_Mutation_p.R381*|SMARCA4_ENST00000541122.2_Nonsense_Mutation_p.R381*|SMARCA4_ENST00000444061.3_Nonsense_Mutation_p.R381*|SMARCA4_ENST00000589677.1_Nonsense_Mutation_p.R381*|SMARCA4_ENST00000590574.1_Nonsense_Mutation_p.R381*|SMARCA4_ENST00000450717.3_Nonsense_Mutation_p.R381*	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	381					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.R381*(2)|p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				CATCGCACACCGAATTCAGGA	0.607			"""F, N, Mis"""		NSCLC																																		uc002mqf.3		NA		Rec	yes		19	19p13.2	6597	F|N|Mis	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""			E			NSCLC		3	Substitution - Nonsense(2)|Unknown(1)	p.?(1)	lung(3)	lung(29)|ovary(8)|pancreas(7)|large_intestine(5)|central_nervous_system(5)|skin(3)|prostate(3)|breast(2)|adrenal_gland(1)|stomach(1)|liver(1)|autonomic_ganglia(1)|kidney(1)	67						c.(1141-1143)CGA>TGA		SWI/SNF-related matrix-associated							88.0	90.0	90.0					19																	11100015		2203	4300	6503	SO:0001587	stop_gained	6597	Rhabdoid_Predisposition_syndrome			chromatin remodeling|negative regulation of androgen receptor signaling pathway|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|nervous system development|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nuclear chromatin|SWI/SNF complex|WINAC complex	androgen receptor binding|ATP binding|DNA binding|DNA-dependent ATPase activity|helicase activity|histone acetyl-lysine binding|identical protein binding|p53 binding|protein N-terminus binding|transcription corepressor activity	g.chr19:11100015C>T	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.1141C>T	19.37:g.11100015C>T	ENSP00000395654:p.Arg381*					SMARCA4_uc010dxp.2_Nonsense_Mutation_p.R381*|SMARCA4_uc010dxo.2_Nonsense_Mutation_p.R381*|SMARCA4_uc002mqg.1_Nonsense_Mutation_p.R381*|SMARCA4_uc010dxq.2_Nonsense_Mutation_p.R381*|SMARCA4_uc010dxr.2_Nonsense_Mutation_p.R381*|SMARCA4_uc002mqj.3_Nonsense_Mutation_p.R381*|SMARCA4_uc010dxs.2_Nonsense_Mutation_p.R381*|SMARCA4_uc002mqe.2_Nonsense_Mutation_p.R381*	p.R381*	NM_003072	NP_003063	P51532	SMCA4_HUMAN			7	1425	+		all_lung(6;0.0512)|Lung NSC(9;0.0568)	381					B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Nonsense_Mutation	SNP	ENST00000429416.3	37	c.1141C>T	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	C	37	6.291385	0.97449	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	.	.	.	4.18	1.93	0.25924	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.8962	11.0102	0.47659	0.6519:0.348:0.0:0.0	.	.	.	.	X	381	.	ENSP00000343896:R381X	R	+	1	2	SMARCA4	10961015	0.956000	0.32656	0.999000	0.59377	0.973000	0.67179	0.554000	0.23407	0.359000	0.24239	0.462000	0.41574	CGA		0.607	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072		19	85	0	0	0	0.008871	0	19	85				
CPAMD8	27151	broad.mit.edu	37	19	17058020	17058020	+	Silent	SNP	C	C	T	rs372485212		TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr19:17058020C>T	ENST00000443236.1	-	21	2698	c.2667G>A	c.(2665-2667)tcG>tcA	p.S889S		NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	842						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.S889S(1)		breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						CCTTGGGAACCGAGAGCTTCA	0.607																																							uc002nfb.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13						c.(2665-2667)TCG>TCA		C3 and PZP-like, alpha-2-macroglobulin domain		T		1,4139		0,1,2069	155.0	155.0	155.0		2667	-6.9	0.1	19		155	0,8444		0,0,4222	no	coding-synonymous	CPAMD8	NM_015692.2		0,1,6291	TT,TC,CC		0.0,0.0242,0.0079		889/1933	17058020	1,12583	2070	4222	6292	SO:0001819	synonymous_variant	27151					extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity	g.chr19:17058020C>T	AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.2667G>A	19.37:g.17058020C>T							p.S889S	NM_015692	NP_056507	Q8IZJ3	CPMD8_HUMAN			21	2699	-			842					Q8NC09|Q9ULD7	Silent	SNP	ENST00000443236.1	37	c.2667G>A	CCDS42519.1	.	.	.	.	.	.	.	.	.	.	c	7.368	0.626204	0.14257	2.42E-4	0.0	ENSG00000160111	ENST00000443236	.	.	.	3.46	-6.92	0.01644	.	.	.	.	.	T	0.34308	0.0893	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.36383	-0.9750	4	.	.	.	.	1.1274	0.01738	0.1694:0.2108:0.2192:0.4006	.	.	.	.	Q	900	.	.	R	-	2	0	CPAMD8	16919020	0.001000	0.12720	0.066000	0.19879	0.978000	0.69477	-2.576000	0.00910	-2.202000	0.00745	-0.320000	0.08662	CGG		0.607	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257531.2	NM_015692		12	132	0	0	0	0.016723	0	12	132				
HOMER3	9454	broad.mit.edu	37	19	19042357	19042357	+	Silent	SNP	C	C	T	rs375438043		TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr19:19042357C>T	ENST00000539827.1	-	7	1420	c.768G>A	c.(766-768)tcG>tcA	p.S256S	HOMER3_ENST00000594794.1_Silent_p.S47S|HOMER3_ENST00000542541.2_Silent_p.S256S|HOMER3_ENST00000594439.1_Silent_p.S220S|AC002985.3_ENST00000596918.1_3'UTR|HOMER3_ENST00000221222.11_Silent_p.S256S|HOMER3_ENST00000392351.3_Silent_p.S256S|HOMER3_ENST00000355887.6_Silent_p.S256S|HOMER3_ENST00000433218.2_Silent_p.S256S			Q9NSC5	HOME3_HUMAN	homer homolog 3 (Drosophila)	256					G-protein coupled glutamate receptor signaling pathway (GO:0007216)|protein targeting (GO:0006605)	basal part of cell (GO:0045178)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)		p.S256S(1)		endometrium(3)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	10			Epithelial(12;0.0107)			GCTGTTCCAGCGACTGGCCCT	0.637																																							uc002nku.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(766-768)TCG>TCA		Homer, neuronal immediate early gene, 3 isoform		C	,,,	1,4405	2.1+/-5.4	0,1,2202	62.0	61.0	61.0		768,768,660,768	-7.4	0.0	19		61	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	HOMER3	NM_001145721.1,NM_001145722.1,NM_001145724.1,NM_004838.3	,,,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,,,	256/359,256/362,220/326,256/362	19042357	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	9454				metabotropic glutamate receptor signaling pathway|protein targeting	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	protein binding	g.chr19:19042357C>T	Y18894	CCDS12391.1, CCDS46022.1, CCDS46023.1	19p13.1	2008-02-05				ENSG00000051128			17514	protein-coding gene	gene with protein product		604800				10653696, 9808459	Standard	NM_004838		Approved	HOMER-3	uc002nkv.2	Q9NSC5		ENST00000539827.1:c.768G>A	19.37:g.19042357C>T						HOMER3_uc002nko.1_RNA|HOMER3_uc002nkp.1_RNA|HOMER3_uc010eby.2_Silent_p.S220S|HOMER3_uc010ebz.2_Silent_p.S256S|HOMER3_uc002nkw.2_Silent_p.S256S|HOMER3_uc002nkv.2_Silent_p.S256S	p.S256S	NM_004838	NP_004829	Q9NSC5	HOME3_HUMAN	Epithelial(12;0.0107)		7	1421	-			256			Potential.		E9PCW9|O14580|O95350|Q9NSB9|Q9NSC0|Q9NSC1	Silent	SNP	ENST00000539827.1	37	c.768G>A	CCDS12391.1																																																																																				0.637	HOMER3-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464607.1			5	100	0	0	0	0.014758	0	5	100				
ZNF486	90649	broad.mit.edu	37	19	20308637	20308637	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr19:20308637C>T	ENST00000335117.8	+	4	1175	c.1118C>T	c.(1117-1119)aCt>aTt	p.T373I	CTC-260E6.6_ENST00000586657.1_RNA|CTC-260E6.6_ENST00000585498.1_RNA|CTC-260E6.6_ENST00000593655.1_RNA	NM_052852.3	NP_443084.2	Q96H40	ZN486_HUMAN	zinc finger protein 486	373					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T373I(1)|p.T367I(1)		endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	11						ATAATTCATACTGGAGAGAAA	0.433																																							uc002nou.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1117-1119)ACT>ATT		zinc finger protein 486							40.0	43.0	42.0					19																	20308637		2173	4287	6460	SO:0001583	missense	90649				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:20308637C>T	BC008936	CCDS46029.1	19p12	2014-02-13	2003-12-16	2003-12-17	ENSG00000256229	ENSG00000256229		"""Zinc fingers, C2H2-type"", ""-"""	20807	protein-coding gene	gene with protein product			"""KRAB domain only 2"""	KRBO2			Standard	NM_052852		Approved	MGC2396	uc002nou.3	Q96H40	OTTHUMG00000179731	ENST00000335117.8:c.1118C>T	19.37:g.20308637C>T	ENSP00000335042:p.Thr373Ile						p.T373I	NM_052852	NP_443084	Q96H40	ZN486_HUMAN			4	1175	+			373					Q0VG00	Missense_Mutation	SNP	ENST00000335117.8	37	c.1118C>T	CCDS46029.1	.	.	.	.	.	.	.	.	.	.	-	14.36	2.513087	0.44660	.	.	ENSG00000256229	ENST00000545779;ENST00000335117	T	0.25749	1.78	0.85	0.85	0.18980	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.31358	0.0794	M	0.74546	2.27	0.29524	N	0.85329	P	0.46142	0.873	P	0.47528	0.549	T	0.31475	-0.9942	9	0.87932	D	0	.	3.2487	0.06806	0.0:0.6536:0.0:0.3464	.	373	Q96H40	ZN486_HUMAN	I	412;373	ENSP00000335042:T373I	ENSP00000335042:T373I	T	+	2	0	ZNF486	20169637	0.028000	0.19301	0.273000	0.24645	0.272000	0.26649	1.439000	0.35013	0.192000	0.20272	0.195000	0.17529	ACT		0.433	ZNF486-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447843.2	NM_052852		8	49	0	0	0	0.004482	0	8	49				
CCNE1	898	broad.mit.edu	37	19	30312666	30312666	+	Missense_Mutation	SNP	T	T	A			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr19:30312666T>A	ENST00000262643.3	+	8	926	c.647T>A	c.(646-648)gTg>gAg	p.V216E	CCNE1_ENST00000444983.2_Missense_Mutation_p.V201E|CCNE1_ENST00000357943.5_Missense_Mutation_p.V173E	NM_001238.2	NP_001229.1	P24864	CCNE1_HUMAN	cyclin E1	216					androgen receptor signaling pathway (GO:0030521)|cell division (GO:0051301)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|Wnt signaling pathway (GO:0016055)	cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)|kinase activity (GO:0016301)|transcription coactivator activity (GO:0003713)	p.V216E(1)		endometrium(1)|kidney(2)|large_intestine(4)|lung(12)|skin(1)	20	all_cancers(1;2.19e-31)|all_epithelial(1;1.49e-30)|all_lung(1;1.37e-11)|Lung NSC(1;2.35e-11)|Ovarian(5;0.000902)|Breast(6;0.0203)|Esophageal squamous(110;0.195)		UCEC - Uterine corpus endometrioid carcinoma (4;2.65e-06)|Epithelial(1;6.85e-98)|all cancers(1;1.38e-94)|OV - Ovarian serous cystadenocarcinoma(1;1.38e-90)|STAD - Stomach adenocarcinoma(5;5.8e-07)|GBM - Glioblastoma multiforme(4;0.0394)|Lung(7;0.092)|LUAD - Lung adenocarcinoma(5;0.115)|BRCA - Breast invasive adenocarcinoma(6;0.183)|COAD - Colon adenocarcinoma(1;0.188)|Colorectal(1;0.202)			TTTGCGTATGTGACAGATGGA	0.388			A		serous ovarian																																		uc002nsn.2		NA		Dom	yes		19	19q12	898		cyclin E1			E					1	Substitution - Missense(1)		lung(1)	lung(2)	2						c.(646-648)GTG>GAG		cyclin E1 isoform 1							101.0	97.0	99.0					19																	30312666		2203	4300	6503	SO:0001583	missense	898				androgen receptor signaling pathway|cell division|positive regulation of transcription, DNA-dependent|regulation of cyclin-dependent protein kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle	cytosol|nucleoplasm	androgen receptor binding|protein kinase binding|transcription coactivator activity	g.chr19:30312666T>A	M73812	CCDS12419.1	19q12	2014-07-03			ENSG00000105173	ENSG00000105173			1589	protein-coding gene	gene with protein product	"""cyclin Es"", ""cyclin Et"""	123837		CCNE		1833066	Standard	NM_001238		Approved		uc002nsn.3	P24864	OTTHUMG00000177626	ENST00000262643.3:c.647T>A	19.37:g.30312666T>A	ENSP00000262643:p.Val216Glu					CCNE1_uc002nso.2_Missense_Mutation_p.V201E|CCNE1_uc002nsp.2_5'UTR	p.V216E	NM_001238	NP_001229	P24864	CCNE1_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (4;2.65e-06)|Epithelial(1;6.85e-98)|all cancers(1;1.38e-94)|OV - Ovarian serous cystadenocarcinoma(1;1.38e-90)|STAD - Stomach adenocarcinoma(5;5.8e-07)|GBM - Glioblastoma multiforme(4;0.0394)|Lung(7;0.092)|LUAD - Lung adenocarcinoma(5;0.115)|BRCA - Breast invasive adenocarcinoma(6;0.183)|COAD - Colon adenocarcinoma(1;0.188)|Colorectal(1;0.202)		8	830	+	all_cancers(1;2.19e-31)|all_epithelial(1;1.49e-30)|all_lung(1;1.37e-11)|Lung NSC(1;2.35e-11)|Ovarian(5;0.000902)|Breast(6;0.0203)|Esophageal squamous(110;0.195)		216					A8K684|Q14091|Q8NFG1|Q92501|Q9UD21	Missense_Mutation	SNP	ENST00000262643.3	37	c.647T>A	CCDS12419.1	.	.	.	.	.	.	.	.	.	.	T	25.1	4.599673	0.87055	.	.	ENSG00000105173	ENST00000262643;ENST00000357943;ENST00000444983	T;T;T	0.12039	2.72;2.72;2.72	6.08	6.08	0.98989	Cyclin, N-terminal (1);Cyclin-like (3);	0.216384	0.48286	D	0.000197	T	0.39436	0.1078	M	0.80746	2.51	0.80722	D	1	D	0.67145	0.996	D	0.65010	0.931	T	0.28427	-1.0044	10	0.87932	D	0	.	15.8323	0.78764	0.0:0.0:0.0:1.0	.	216	P24864	CCNE1_HUMAN	E	216;173;201	ENSP00000262643:V216E;ENSP00000350625:V173E;ENSP00000410179:V201E	ENSP00000262643:V216E	V	+	2	0	CCNE1	35004506	1.000000	0.71417	0.911000	0.35937	0.649000	0.38597	7.990000	0.88215	2.333000	0.79357	0.482000	0.46254	GTG		0.388	CCNE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438138.1	NM_001238		6	55	0	0	0	0.02938	0	6	55				
ZNF536	9745	broad.mit.edu	37	19	31025842	31025842	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr19:31025842C>G	ENST00000355537.3	+	3	2406	c.2259C>G	c.(2257-2259)tgC>tgG	p.C753W		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	753					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)	p.C753W(1)|p.C753*(1)		NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					TGAAGGACTGCCCGTACTGTG	0.602																																							uc002nsu.1		NA																	2	Substitution - Nonsense(1)|Substitution - Missense(1)		lung(2)	ovary(7)|large_intestine(2)|skin(2)	11						c.(2257-2259)TGC>TGG		zinc finger protein 536							110.0	108.0	109.0					19																	31025842		2203	4300	6503	SO:0001583	missense	9745				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr19:31025842C>G		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.2259C>G	19.37:g.31025842C>G	ENSP00000347730:p.Cys753Trp					ZNF536_uc010edd.1_Missense_Mutation_p.C753W	p.C753W	NM_014717	NP_055532	O15090	ZN536_HUMAN			3	2397	+	Esophageal squamous(110;0.0834)		753			C2H2-type 8.		A2RU18	Missense_Mutation	SNP	ENST00000355537.3	37	c.2259C>G	CCDS32984.1	.	.	.	.	.	.	.	.	.	.	C	15.27	2.784461	0.49997	.	.	ENSG00000198597	ENST00000355537	T	0.60040	0.22	5.81	1.13	0.20643	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.093579	0.85682	D	0.000000	T	0.57417	0.2052	N	0.19112	0.55	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.57808	-0.7747	10	0.87932	D	0	-31.002	9.0267	0.36234	0.0:0.6329:0.0:0.3671	.	753;753	A7E228;O15090	.;ZN536_HUMAN	W	753	ENSP00000347730:C753W	ENSP00000347730:C753W	C	+	3	2	ZNF536	35717682	0.998000	0.40836	1.000000	0.80357	0.995000	0.86356	0.596000	0.24044	0.312000	0.23038	-0.218000	0.12543	TGC		0.602	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717		8	124	0	0	0	0.038147	0	8	124				
FCGBP	8857	broad.mit.edu	37	19	40408275	40408275	+	Missense_Mutation	SNP	A	A	T			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr19:40408275A>T	ENST00000221347.6	-	8	4571	c.4564T>A	c.(4564-4566)Tgg>Agg	p.W1522R		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	1522						extracellular vesicular exosome (GO:0070062)		p.W1522R(1)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			TCAGTCCTCCAGGGCTCCACG	0.622																																							uc002omp.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(4)|central_nervous_system(1)	9						c.(4564-4566)TGG>AGG		Fc fragment of IgG binding protein precursor							82.0	63.0	69.0					19																	40408275		2201	4291	6492	SO:0001583	missense	8857					extracellular region	protein binding	g.chr19:40408275A>T	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.4564T>A	19.37:g.40408275A>T	ENSP00000221347:p.Trp1522Arg						p.W1522R	NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)		8	4572	-	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		1522					O95784	Missense_Mutation	SNP	ENST00000221347.6	37	c.4564T>A	CCDS12546.1	.	.	.	.	.	.	.	.	.	.	a	17.22	3.333446	0.60853	.	.	ENSG00000090920	ENST00000221347	D	0.91407	-2.84	4.61	4.61	0.57282	Uncharacterised domain, cysteine-rich (2);	.	.	.	.	D	0.96781	0.8949	H	0.97983	4.12	0.37414	D	0.913369	D	0.89917	1.0	D	0.97110	1.0	D	0.98290	1.0513	9	0.28530	T	0.3	.	13.0342	0.58860	1.0:0.0:0.0:0.0	.	1522	Q9Y6R7	FCGBP_HUMAN	R	1522	ENSP00000221347:W1522R	ENSP00000221347:W1522R	W	-	1	0	FCGBP	45100115	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	7.085000	0.76875	1.721000	0.51461	0.529000	0.55759	TGG		0.622	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890		44	54	0	0	0	0.036044	0	44	54				
ZNF155	7711	broad.mit.edu	37	19	44495759	44495760	+	Missense_Mutation	DNP	GG	GG	AA			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr19:44495759_44495760GG>AA	ENST00000270014.2	+	3	203_204	c.75_76GG>AA	c.(73-78)ctGGac>ctAAac	p.D26N	ZNF155_ENST00000590615.1_Missense_Mutation_p.D26N|ZNF155_ENST00000407951.2_Missense_Mutation_p.D37N	NM_001260487.1|NM_198089.2	NP_001247416|NP_932355	Q12901	ZN155_HUMAN	zinc finger protein 155	26	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D26N(1)		endometrium(3)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	15		Prostate(69;0.0352)				TGGGGCTGCTGGACCCTGCCCA	0.52																																					NSCLC(61;554 1277 20909 42067 42312)	NSCLC(61;554 1277 20909 42067 42312)	uc002oxy.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(73-78)CTGGAC>CTAAAC		zinc finger protein 155																																				SO:0001583	missense	7711					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:44495759_44495760GG>AA	U09852	CCDS12634.1, CCDS58668.1	19q13.2-q13.32	2013-01-08	2006-08-22			ENSG00000204920		"""Zinc fingers, C2H2-type"", ""-"""	12940	protein-coding gene	gene with protein product		604086	"""zinc finger protein 155 (pHZ-96)"""			7557990	Standard	NM_001260486		Approved	pHZ-96	uc010xwt.2	Q12901		Exception_encountered	19.37:g.44495759_44495760delinsAA	ENSP00000270014:p.Asp26Asn					ZNF155_uc002oxz.1_Missense_Mutation_p.D26N|ZNF155_uc010xwt.1_Missense_Mutation_p.D37N	p.D26N	NM_003445	NP_003436	Q12901	ZN155_HUMAN			3	280_281	+		Prostate(69;0.0352)	26			KRAB.		A2BDE6|B2RB63|B4DM95|J3KQ08|Q6AZZ8|Q9UIE1|Q9UK14	Missense_Mutation	DNP	ENST00000270014.2	37	c.75_76GG>AA	CCDS12634.1																																																																																				0.520	ZNF155-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000460074.1	NM_003445		54	180	0	0	0	0.004672	0	54	180				
ZNF223	7766	broad.mit.edu	37	19	44570427	44570427	+	Missense_Mutation	SNP	A	A	G			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr19:44570427A>G	ENST00000434772.3	+	5	701	c.446A>G	c.(445-447)aAt>aGt	p.N149S	ZNF223_ENST00000591793.1_Missense_Mutation_p.N259S	NM_013361.4	NP_037493.3	Q9UK11	ZN223_HUMAN	zinc finger protein 223	149					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.N149S(1)		endometrium(3)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18		Prostate(69;0.0352)				AAACCTTCCAATTGTGGGAAG	0.448																																							uc002oyf.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(445-447)AAT>AGT		zinc finger protein 223							128.0	110.0	116.0					19																	44570427		2203	4300	6503	SO:0001583	missense	7766				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:44570427A>G	AF187989	CCDS12635.1	19q13.2	2013-01-08				ENSG00000178386		"""Zinc fingers, C2H2-type"", ""-"""	13016	protein-coding gene	gene with protein product							Standard	XM_006723365		Approved		uc002oyf.1	Q9UK11		ENST00000434772.3:c.446A>G	19.37:g.44570427A>G	ENSP00000401947:p.Asn149Ser					ZNF284_uc010ejd.2_RNA	p.N149S	NM_013361	NP_037493	Q9UK11	ZN223_HUMAN			5	699	+		Prostate(69;0.0352)	149					Q15736|Q8TBJ3|Q9HCA9	Missense_Mutation	SNP	ENST00000434772.3	37	c.446A>G	CCDS12635.1	.	.	.	.	.	.	.	.	.	.	A	6.609	0.480798	0.12581	.	.	ENSG00000178386	ENST00000434772	T	0.27104	1.69	2.81	1.76	0.24704	.	.	.	.	.	T	0.09905	0.0243	N	0.02708	-0.52	0.09310	N	1	B	0.13594	0.008	B	0.06405	0.002	T	0.24835	-1.0149	9	0.66056	D	0.02	.	4.0383	0.09740	0.4898:0.376:0.1342:0.0	.	149	Q9UK11	ZN223_HUMAN	S	149	ENSP00000401947:N149S	ENSP00000401947:N149S	N	+	2	0	ZNF223	49262267	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.307000	0.08167	0.290000	0.22444	0.260000	0.18958	AAT		0.448	ZNF223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460469.2			4	150	0	0	0	0.009096	0	4	150				
C5AR1	728	broad.mit.edu	37	19	47823129	47823129	+	Missense_Mutation	SNP	C	C	T	rs200400919		TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr19:47823129C>T	ENST00000355085.3	+	2	117	c.95C>T	c.(94-96)aCg>aTg	p.T32M		NM_001736.3	NP_001727.1	P21730	C5AR1_HUMAN	complement component 5a receptor 1	32					activation of MAPK activity (GO:0000187)|activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|cell proliferation in hindbrain (GO:0021534)|cellular defense response (GO:0006968)|chemotaxis (GO:0006935)|complement component C5a signaling pathway (GO:0038178)|defense response to Gram-positive bacterium (GO:0050830)|immune response (GO:0006955)|inflammatory response (GO:0006954)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of neuron apoptotic process (GO:0043524)|neutrophil chemotaxis (GO:0030593)|organ regeneration (GO:0031100)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|response to lipopolysaccharide (GO:0032496)|response to peptidoglycan (GO:0032494)|sensory perception of chemical stimulus (GO:0007606)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C5a anaphylatoxin receptor activity (GO:0004944)|complement component C5a receptor activity (GO:0004878)	p.T32M(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(11)|ovary(2)|prostate(1)|skin(1)	20		all_cancers(25;2e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;0.000267)|OV - Ovarian serous cystadenocarcinoma(262;0.000618)|Epithelial(262;0.0142)|GBM - Glioblastoma multiforme(486;0.0242)		ACTTCTAACACGCTGCGTGTT	0.532													C|||	1	0.000199681	0.0	0.0	5008	,	,		20641	0.0		0.0	False		,,,				2504	0.001						uc002pgj.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)|skin(1)	4						c.(94-96)ACG>ATG		complement component 5 receptor 1							168.0	142.0	150.0					19																	47823129		2203	4300	6503	SO:0001583	missense	728				activation of MAPK activity|activation of phospholipase C activity|cellular defense response|elevation of cytosolic calcium ion concentration|immune response|sensory perception of chemical stimulus	integral to plasma membrane	C5a anaphylatoxin receptor activity	g.chr19:47823129C>T		CCDS33063.1	19q13.3-q13.4	2012-08-10	2006-02-09	2006-02-09		ENSG00000197405		"""CD molecules"", ""Complement system"", ""GPCR / Class A : Complement component receptors"""	1338	protein-coding gene	gene with protein product		113995	"""complement component 5 receptor 1 (C5a ligand)"""	C5R1		1612600	Standard	NM_001736		Approved	C5A, C5AR, CD88	uc002pgj.1	P21730		ENST00000355085.3:c.95C>T	19.37:g.47823129C>T	ENSP00000347197:p.Thr32Met						p.T32M	NM_001736	NP_001727	P21730	C5AR_HUMAN		all cancers(93;0.000267)|OV - Ovarian serous cystadenocarcinoma(262;0.000618)|Epithelial(262;0.0142)|GBM - Glioblastoma multiforme(486;0.0242)	2	144	+		all_cancers(25;2e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)	32			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000355085.3	37	c.95C>T	CCDS33063.1	.	.	.	.	.	.	.	.	.	.	C	9.210	1.030611	0.19512	.	.	ENSG00000197405	ENST00000355085	T	0.37411	1.2	3.85	-7.7	0.01259	.	0.484862	0.17251	U	0.181174	T	0.10423	0.0255	N	0.08118	0	0.09310	N	1	P	0.51653	0.947	B	0.38296	0.27	T	0.32771	-0.9894	10	0.48119	T	0.1	.	2.3954	0.04388	0.2001:0.3146:0.3273:0.158	.	32	P21730	C5AR_HUMAN	M	32	ENSP00000347197:T32M	ENSP00000347197:T32M	T	+	2	0	C5AR1	52514969	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-3.504000	0.00449	-2.504000	0.00508	-0.792000	0.03331	ACG		0.532	C5AR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466925.1	NM_001736		11	48	0	0	0	0.008291	0	11	48				
LRRC4B	94030	broad.mit.edu	37	19	51022162	51022162	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr19:51022162G>A	ENST00000599957.1	-	3	1005	c.808C>T	c.(808-810)Cgc>Tgc	p.R270C	LRRC4B_ENST00000389201.3_Missense_Mutation_p.R270C			Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B	270					positive regulation of synapse assembly (GO:0051965)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.R270C(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(1)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	30		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)		AAGGCGTTGCGCTCGATGGTG	0.657																																							uc002pss.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(808-810)CGC>TGC		leucine rich repeat containing 4B precursor							64.0	74.0	71.0					19																	51022162		2182	4273	6455	SO:0001583	missense	94030					cell junction|integral to membrane|presynaptic membrane		g.chr19:51022162G>A	BC032460	CCDS42595.1	19q13.33	2014-01-30	2004-06-14	2004-06-16	ENSG00000131409	ENSG00000131409		"""Immunoglobulin superfamily / I-set domain containing"", ""Endogenous ligands"""	25042	protein-coding gene	gene with protein product	"""netrin-G3 ligand"""		"""leucine-rich repeats and immunoglobulin-like domains 4"""	LRIG4		11441184	Standard	NM_001080457		Approved	DKFZp761A179, HSM	uc002pss.3	Q9NT99		ENST00000599957.1:c.808C>T	19.37:g.51022162G>A	ENSP00000471502:p.Arg270Cys						p.R270C	NM_001080457	NP_001073926	Q9NT99	LRC4B_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)	3	945	-		all_neural(266;0.131)	270			Extracellular (Potential).|LRR 8.		Q3ZCQ4|Q58F20	Missense_Mutation	SNP	ENST00000599957.1	37	c.808C>T	CCDS42595.1	.	.	.	.	.	.	.	.	.	.	G	18.35	3.604831	0.66445	.	.	ENSG00000131409	ENST00000389201;ENST00000535879	T	0.58060	0.36	4.05	4.05	0.47172	.	0.000000	0.85682	U	0.000000	T	0.66896	0.2836	L	0.54908	1.71	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.70353	-0.4895	10	0.72032	D	0.01	.	14.1137	0.65139	0.0:0.0:1.0:0.0	.	270	Q9NT99	LRC4B_HUMAN	C	270	ENSP00000373853:R270C	ENSP00000373853:R270C	R	-	1	0	LRRC4B	55713974	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.107000	0.50329	2.274000	0.75844	0.561000	0.74099	CGC		0.657	LRRC4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464907.1	NM_001080457		15	56	0	0	0	0.0333	0	15	56				
SIGLEC14	100049587	broad.mit.edu	37	19	52148735	52148735	+	Missense_Mutation	SNP	C	C	A			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr19:52148735C>A	ENST00000360844.6	-	4	790	c.749G>T	c.(748-750)gGc>gTc	p.G250V	SIGLEC5_ENST00000429354.3_Intron|SIGLEC5_ENST00000222107.4_Intron|SIGLEC5_ENST00000599649.1_Intron|SIGLEC5_ENST00000534261.2_5'UTR	NM_001098612.1	NP_001092082.1	Q08ET2	SIG14_HUMAN	sialic acid binding Ig-like lectin 14	250	Ig-like C2-type 2.				cell adhesion (GO:0007155)|innate immune response (GO:0045087)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.G250V(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|upper_aerodigestive_tract(1)	29		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000965)|OV - Ovarian serous cystadenocarcinoma(262;0.0195)		CCTACCTGTGCCTGTGCCATT	0.552																																							uc002pxf.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(748-750)GGC>GTC		sialic acid binding Ig-like lectin 14 precursor							159.0	160.0	160.0					19																	52148735		1845	4063	5908	SO:0001583	missense	100049587				cell adhesion	integral to membrane|plasma membrane	protein binding|sugar binding	g.chr19:52148735C>A	AY854038	CCDS42604.1	19q13.41	2013-01-29			ENSG00000254415	ENSG00000254415		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	32926	protein-coding gene	gene with protein product						17012248	Standard	NM_001098612		Approved		uc002pxf.4	Q08ET2	OTTHUMG00000165511	ENST00000360844.6:c.749G>T	19.37:g.52148735C>A	ENSP00000354090:p.Gly250Val						p.G250V	NM_001098612	NP_001092082	Q08ET2	SIG14_HUMAN		GBM - Glioblastoma multiforme(134;0.000965)|OV - Ovarian serous cystadenocarcinoma(262;0.0195)	4	869	-		all_neural(266;0.0299)	250			Extracellular (Potential).|Ig-like C2-type 2.		Q6UXG0	Missense_Mutation	SNP	ENST00000360844.6	37	c.749G>T	CCDS42604.1	.	.	.	.	.	.	.	.	.	.	C	10.16	1.274284	0.23221	.	.	ENSG00000254415	ENST00000360844	T	0.28454	1.61	2.29	-4.57	0.03421	Immunoglobulin-like (1);	.	.	.	.	T	0.13756	0.0333	N	0.17723	0.515	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.22591	-1.0212	9	0.46703	T	0.11	.	0.5772	0.00706	0.1819:0.2321:0.1803:0.4057	.	250	Q08ET2	SIG14_HUMAN	V	250	ENSP00000354090:G250V	ENSP00000354090:G250V	G	-	2	0	SIGLEC14	56840547	0.621000	0.27077	0.002000	0.10522	0.618000	0.37518	0.744000	0.26245	-1.125000	0.02932	0.462000	0.41574	GGC		0.552	SIGLEC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466899.2	NM_001098612		8	27	1	0	0.00448238	0.004482	0.00472374	8	27				
TTYH1	57348	broad.mit.edu	37	19	54937858	54937858	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr19:54937858C>T	ENST00000376530.3	+	5	750	c.647C>T	c.(646-648)gCc>gTc	p.A216V	TTYH1_ENST00000376531.3_Missense_Mutation_p.A216V|TTYH1_ENST00000489425.1_3'UTR|TTYH1_ENST00000301194.4_Missense_Mutation_p.A216V|TTYH1_ENST00000391739.3_Missense_Mutation_p.A265V	NM_001201461.1|NM_020659.3	NP_001188390.1|NP_065710.1	Q9H313	TTYH1_HUMAN	tweety family member 1	216					cell-substrate adhesion (GO:0031589)|chloride transport (GO:0006821)|filopodium assembly (GO:0046847)|ion transmembrane transport (GO:0034220)|iron ion transmembrane transport (GO:0034755)|iron ion transport (GO:0006826)|mitotic nuclear division (GO:0007067)|regulation of anion transport (GO:0044070)|single organismal cell-cell adhesion (GO:0016337)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|filopodium membrane (GO:0031527)|filopodium tip (GO:0032433)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum membrane (GO:0030868)	calcium ion binding (GO:0005509)|iron ion transmembrane transporter activity (GO:0005381)|volume-sensitive chloride channel activity (GO:0072320)	p.A216V(2)		endometrium(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0767)		AGGTGGCTGGCCTACGTCCTC	0.647																																							uc002qfq.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(646-648)GCC>GTC		tweety 1 isoform 1							100.0	81.0	87.0					19																	54937858		2203	4300	6503	SO:0001583	missense	57348				cell adhesion	chloride channel complex|plasma membrane	chloride channel activity|iron ion transmembrane transporter activity	g.chr19:54937858C>T	AF177909	CCDS12893.1, CCDS33106.1, CCDS56102.1	19q13.4	2013-09-02	2013-09-02		ENSG00000167614	ENSG00000167614			13476	protein-coding gene	gene with protein product		605784	"""tweety (Drosophila) homolog 1"", ""tweety homolog 1 (Drosophila)"""			10950931	Standard	NM_020659		Approved		uc002qfr.3	Q9H313	OTTHUMG00000065544	ENST00000376530.3:c.647C>T	19.37:g.54937858C>T	ENSP00000365713:p.Ala216Val					TTYH1_uc010yey.1_Missense_Mutation_p.A265V|TTYH1_uc002qfr.2_Missense_Mutation_p.A216V|TTYH1_uc002qft.2_Missense_Mutation_p.A216V|TTYH1_uc002qfu.1_Missense_Mutation_p.A128V	p.A216V	NM_020659	NP_065710	Q9H313	TTYH1_HUMAN		GBM - Glioblastoma multiforme(193;0.0767)	5	739	+	Ovarian(34;0.19)		216			Helical; Name=3; (Potential).		B0VJY3|B0VJY4|B0VJY5|B2VAL9|Q5U682|Q68A17|Q6L750|Q6ZTE5|Q8WUU2	Missense_Mutation	SNP	ENST00000376530.3	37	c.647C>T	CCDS12893.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.801725	0.90538	.	.	ENSG00000167614	ENST00000301194;ENST00000376530;ENST00000445095;ENST00000391739;ENST00000376531	T;T;T;T;T	0.13901	2.55;2.55;2.55;2.55;2.55	4.58	4.58	0.56647	.	0.138667	0.48767	D	0.000173	T	0.29556	0.0737	L	0.59436	1.845	0.45216	D	0.998227	D;D;D;D;D	0.76494	0.999;0.991;0.989;0.989;0.98	D;P;P;P;P	0.72075	0.976;0.886;0.892;0.884;0.818	T	0.04635	-1.0937	10	0.11485	T	0.65	-20.4968	15.236	0.73432	0.0:1.0:0.0:0.0	.	265;128;216;216;216	B7Z1H9;Q9H313-5;Q9H313-2;Q9H313-3;Q9H313	.;.;.;.;TTYH1_HUMAN	V	216;216;265;265;216	ENSP00000301194:A216V;ENSP00000365713:A216V;ENSP00000393592:A265V;ENSP00000375619:A265V;ENSP00000365714:A216V	ENSP00000301194:A216V	A	+	2	0	TTYH1	59629670	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.535000	0.60629	2.263000	0.75096	0.561000	0.74099	GCC		0.647	TTYH1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000140498.1			9	88	0	0	0	0.010729	0	9	88				
ZNF814	730051	broad.mit.edu	37	19	58385546	58385546	+	Missense_Mutation	SNP	G	G	T	rs201682072		TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr19:58385546G>T	ENST00000435989.2	-	3	1446	c.1212C>A	c.(1210-1212)gaC>gaA	p.D404E	ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000595295.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	404					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D404E(10)		NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						AATGTTTTTTGTCAGTGTGAA	0.393																																							uc002qqo.2		NA																	10	Substitution - Missense(10)		urinary_tract(3)|kidney(3)|prostate(2)|NS(1)|skin(1)		0						c.(1210-1212)GAC>GAA		zinc finger protein 814							117.0	93.0	100.0					19																	58385546		692	1591	2283	SO:0001583	missense	730051				regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding	g.chr19:58385546G>T		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.1212C>A	19.37:g.58385546G>T	ENSP00000410545:p.Asp404Glu					ZNF814_uc002qqk.2_Intron|ZNF814_uc010yhl.1_Intron	p.D404E	NM_001144989	NP_001138461	B7Z6K7	ZN814_HUMAN			3	1484	-			404					A6NF35	Missense_Mutation	SNP	ENST00000435989.2	37	c.1212C>A	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	11.12	1.545823	0.27652	.	.	ENSG00000204514	ENST00000435989;ENST00000376205	T	0.14640	2.49	2.33	-4.66	0.03329	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04363	0.0120	N	0.03177	-0.4	0.09310	N	1	B	0.13145	0.007	B	0.10450	0.005	T	0.33574	-0.9863	9	0.54805	T	0.06	.	1.2175	0.01917	0.3897:0.3041:0.1331:0.1731	.	404	B7Z6K7	ZN814_HUMAN	E	404;266	ENSP00000410545:D404E	ENSP00000365378:D266E	D	-	3	2	ZNF814	63077358	0.000000	0.05858	0.000000	0.03702	0.038000	0.13279	-1.489000	0.02306	-2.531000	0.00491	-1.292000	0.01352	GAC		0.393	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708		4	20	1	0	2.56e-06	0.009096	3.07649e-06	4	20				
C2orf70	339778	broad.mit.edu	37	2	26802211	26802211	+	Missense_Mutation	SNP	G	G	A	rs147381361	byFrequency	TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr2:26802211G>A	ENST00000329615.3	+	4	542	c.511G>A	c.(511-513)Gag>Aag	p.E171K	CIB4_ENST00000405346.3_5'Flank|C2orf70_ENST00000409392.1_Missense_Mutation_p.R158Q	NM_001105519.1	NP_001098989.1	A6NJV1	CB070_HUMAN	chromosome 2 open reading frame 70	171						nucleus (GO:0005634)		p.E171K(1)|p.E171*(1)		breast(3)|endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(2)	13						ACTAGCCCCCGAGAACCTGAA	0.532													G|||	5	0.000998403	0.0008	0.0014	5008	,	,		20696	0.0		0.003	False		,,,				2504	0.0						uc010eyn.2		NA																	2	Substitution - Missense(1)|Substitution - Nonsense(1)		lung(2)	skin(1)	1						c.(511-513)GAG>AAG		hypothetical protein LOC339778		G	LYS/GLU	1,3921		0,1,1960	84.0	86.0	85.0		511	3.5	0.1	2	dbSNP_134	85	6,8282		0,6,4138	yes	missense	C2orf70	NM_001105519.1	56	0,7,6098	AA,AG,GG		0.0724,0.0255,0.0573	benign	171/202	26802211	7,12203	1961	4144	6105	SO:0001583	missense	339778							g.chr2:26802211G>A		CCDS42661.1	2p23.3	2011-05-09			ENSG00000173557	ENSG00000173557			27938	protein-coding gene	gene with protein product	"""hypothetical protein LOC339778"""						Standard	NM_001105519		Approved	LOC339778	uc010eyn.3	A6NJV1	OTTHUMG00000151994	ENST00000329615.3:c.511G>A	2.37:g.26802211G>A	ENSP00000332875:p.Glu171Lys						p.E171K	NM_001105519	NP_001098989	A6NJV1	CB070_HUMAN			4	511	+			171						Missense_Mutation	SNP	ENST00000329615.3	37	c.511G>A	CCDS42661.1	2|2	9.157509157509158E-4|9.157509157509158E-4	1|1	0.0020325203252032522|0.0020325203252032522	0|0	0.0|0.0	0|0	0.0|0.0	1|1	0.0013192612137203166|0.0013192612137203166	G|G	8.120|8.120	0.780710|0.780710	0.16120|0.16120	2.55E-4|2.55E-4	7.24E-4|7.24E-4	ENSG00000173557|ENSG00000173557	ENST00000329615|ENST00000409392;ENST00000453368	T|.	0.34072|.	1.38|.	5.3|5.3	3.45|3.45	0.39498|0.39498	.|.	0.517808|.	0.17707|.	N|.	0.164704|.	T|T	0.38746|0.38746	0.1052|0.1052	L|L	0.41027|0.41027	1.25|1.25	0.09310|0.09310	N|N	1|1	B|.	0.21688|.	0.059|.	B|.	0.12837|.	0.008|.	T|T	0.33007|0.33007	-0.9885|-0.9885	10|6	0.09084|0.87932	T|D	0.74|0	-13.7067|-13.7067	6.4437|6.4437	0.21865|0.21865	0.0972:0.1863:0.7166:0.0|0.0972:0.1863:0.7166:0.0	.|.	171|.	A6NJV1|.	CB070_HUMAN|.	K|Q	171|158;97	ENSP00000332875:E171K|.	ENSP00000332875:E171K|ENSP00000386615:R158Q	E|R	+|+	1|2	0|0	C2orf70|C2orf70	26655715|26655715	0.963000|0.963000	0.33076|0.33076	0.088000|0.088000	0.20740|0.20740	0.331000|0.331000	0.28603|0.28603	1.611000|1.611000	0.36879|0.36879	1.198000|1.198000	0.43158|0.43158	0.655000|0.655000	0.94253|0.94253	GAG|CGA		0.532	C2orf70-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353258.1	NM_001105519		13	46	0	0	0	0.016723	0	13	46				
DQX1	165545	broad.mit.edu	37	2	74755588	74755588	+	5'Flank	SNP	C	C	T			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr2:74755588C>T	ENST00000404568.3	-	0	0				AUP1_ENST00000377526.3_Missense_Mutation_p.V185I|DQX1_ENST00000393951.2_5'Flank|HTRA2_ENST00000258080.3_5'Flank|HTRA2_ENST00000352222.3_5'Flank	NM_133637.2	NP_598376.2	Q8TE96	DQX1_HUMAN	DEAQ box RNA-dependent ATPase 1							nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)	p.V185I(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	18						AGAGGTTGTACCACATCTTGG	0.502																																							uc010yrx.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(724-726)GTA>ATA		SubName: Full=cDNA FLJ57204, highly similar to Homo sapiens ancient ubiquitous protein 1 (AUP1), transcript variant 2, mRNA;							63.0	65.0	64.0					2																	74755588		1922	4132	6054	SO:0001631	upstream_gene_variant	550					endoplasmic reticulum membrane|integral to membrane|nucleus	protein binding	g.chr2:74755588C>T	AK074337	CCDS1949.2	2p12	2010-04-20	2009-01-15		ENSG00000144045	ENSG00000144045			20410	protein-coding gene	gene with protein product			"""DEAQ box polypeptide 1 (RNA-dependent ATPase)"""				Standard	NM_133637		Approved	FLJ23757	uc010yrw.2	Q8TE96	OTTHUMG00000129965		2.37:g.74755588C>T	Exception_encountered					DQX1_uc010yrw.1_5'Flank|AUP1_uc002sme.2_5'Flank|AUP1_uc002smf.2_Missense_Mutation_p.V185I|AUP1_uc002smg.2_RNA|AUP1_uc002smh.2_Missense_Mutation_p.V94I|HTRA2_uc002smi.1_5'Flank|HTRA2_uc002smj.1_5'Flank|HTRA2_uc002smk.1_5'Flank|HTRA2_uc002sml.1_5'Flank|HTRA2_uc002smm.1_5'Flank|HTRA2_uc002smn.1_5'Flank|HTRA2_uc010ffl.2_5'Flank	p.V242I			Q9Y679	AUP1_HUMAN			4	850	-			251			Cytoplasmic (Potential).		Q6B017|Q8NAM8	Missense_Mutation	SNP	ENST00000404568.3	37	c.724G>A	CCDS1949.2	.	.	.	.	.	.	.	.	.	.	C	8.106	0.777627	0.16120	.	.	ENSG00000115307	ENST00000377526;ENST00000258081;ENST00000412627	D	0.94046	-3.34	4.95	3.14	0.36123	.	0.270254	0.36555	N	0.002539	D	0.84437	0.5472	N	0.16743	0.435	0.38719	D	0.953407	B;B;B	0.21753	0.022;0.06;0.002	B;B;B	0.14023	0.005;0.01;0.01	T	0.76269	-0.3021	10	0.19147	T	0.46	-1.3334	9.2285	0.37421	0.0:0.8219:0.0:0.1781	.	242;251;185	E7EU18;Q9Y679;Q9Y679-2	.;AUP1_HUMAN;.	I	185;249;187	ENSP00000366748:V185I	ENSP00000258081:V249I	V	-	1	0	AUP1	74609096	0.961000	0.32948	0.799000	0.32177	0.680000	0.39746	1.740000	0.38228	0.676000	0.31285	0.462000	0.41574	GTA		0.502	DQX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252230.3	NM_133637		7	32	0	0	0	0.02938	0	7	32				
KCNH7	90134	broad.mit.edu	37	2	163291819	163291819	+	Missense_Mutation	SNP	C	C	A			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr2:163291819C>A	ENST00000332142.5	-	8	1942	c.1843G>T	c.(1843-1845)Gtc>Ttc	p.V615F	KCNH7_ENST00000328032.4_Missense_Mutation_p.V608F	NM_033272.3	NP_150375.2	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 7	615					circadian rhythm (GO:0007623)|potassium ion transmembrane transport (GO:0071805)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)|signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)	p.V615F(1)|p.V608F(1)		NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(22)|lung(53)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	108					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	AGTGCTGTGACGTATTTGTCT	0.398																																					GBM(196;1492 2208 17507 24132 45496)	GBM(196;1492 2208 17507 24132 45496)	uc002uch.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|skin(2)	5						c.(1843-1845)GTC>TTC		potassium voltage-gated channel, subfamily H,	Ibutilide(DB00308)						217.0	196.0	203.0					2																	163291819		2203	4300	6503	SO:0001583	missense	90134				regulation of transcription, DNA-dependent	integral to membrane	protein binding|signal transducer activity	g.chr2:163291819C>A	AF032897	CCDS2219.1, CCDS2220.1	2q24.3	2012-07-05			ENSG00000184611	ENSG00000184611		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18863	protein-coding gene	gene with protein product		608169				16382104	Standard	NM_173162		Approved	Kv11.3, HERG3, erg3	uc002uch.2	Q9NS40	OTTHUMG00000132069	ENST00000332142.5:c.1843G>T	2.37:g.163291819C>A	ENSP00000331727:p.Val615Phe					KCNH7_uc002uci.2_Missense_Mutation_p.V608F	p.V615F	NM_033272	NP_150375	Q9NS40	KCNH7_HUMAN			8	2055	-			615					Q53QU4|Q53TB7|Q53TP9|Q8IV15	Missense_Mutation	SNP	ENST00000332142.5	37	c.1843G>T	CCDS2219.1	.	.	.	.	.	.	.	.	.	.	C	29.7	5.026726	0.93518	.	.	ENSG00000184611	ENST00000332142;ENST00000328032	D;D	0.97256	-4.31;-4.31	5.9	5.9	0.94986	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.97942	0.9323	L	0.51422	1.61	0.80722	D	1	D;P	0.89917	1.0;0.878	D;P	0.81914	0.995;0.726	D	0.98640	1.0675	10	0.87932	D	0	.	20.2789	0.98501	0.0:1.0:0.0:0.0	.	608;615	Q9NS40-2;Q9NS40	.;KCNH7_HUMAN	F	615;608	ENSP00000331727:V615F;ENSP00000333781:V608F	ENSP00000333781:V608F	V	-	1	0	KCNH7	163000065	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.788000	0.95919	0.650000	0.86243	GTC		0.398	KCNH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255093.1	NM_033272		10	80	1	0	2.17888e-05	0.006214	2.55133e-05	10	80				
HECW2	57520	broad.mit.edu	37	2	197298051	197298051	+	Missense_Mutation	SNP	C	C	T	rs151108819	byFrequency	TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr2:197298051C>T	ENST00000260983.3	-	2	279	c.97G>A	c.(97-99)Gcc>Acc	p.A33T		NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	33					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.A33T(2)		biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						GAGCTCTGGGCGGCAAGGCTC	0.597													C|||	3	0.000599042	0.0023	0.0	5008	,	,		16723	0.0		0.0	False		,,,				2504	0.0						uc002utm.1		NA																	2	Substitution - Missense(2)		lung(1)|prostate(1)	skin(5)|ovary(5)|lung(4)|pancreas(2)|central_nervous_system(1)|kidney(1)	18						c.(97-99)GCC>ACC		HECT, C2 and WW domain containing E3 ubiquitin		C	THR/ALA	11,4395	17.9+/-39.9	0,11,2192	84.0	74.0	77.0		97	3.2	0.9	2	dbSNP_134	77	0,8600		0,0,4300	yes	missense	HECW2	NM_020760.1	58	0,11,6492	TT,TC,CC		0.0,0.2497,0.0846	benign	33/1573	197298051	11,12995	2203	4300	6503	SO:0001583	missense	57520				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm	ubiquitin-protein ligase activity	g.chr2:197298051C>T	AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.97G>A	2.37:g.197298051C>T	ENSP00000260983:p.Ala33Thr						p.A33T	NM_020760	NP_065811	Q9P2P5	HECW2_HUMAN			2	280	-			33					B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Missense_Mutation	SNP	ENST00000260983.3	37	c.97G>A	CCDS33354.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	C	11.54	1.670053	0.29693	0.002497	0.0	ENSG00000138411	ENST00000260983;ENST00000452031;ENST00000427457	T;T;T	0.34275	1.37;1.37;1.37	5.12	3.15	0.36227	.	0.626451	0.16704	N	0.202988	T	0.21674	0.0522	L	0.36672	1.1	0.23089	N	0.998314	B	0.24426	0.103	B	0.14023	0.01	T	0.14144	-1.0483	10	0.14656	T	0.56	.	4.8419	0.13494	0.2427:0.5732:0.0:0.1841	.	33	Q9P2P5	HECW2_HUMAN	T	33	ENSP00000260983:A33T;ENSP00000409918:A33T;ENSP00000395770:A33T	ENSP00000260983:A33T	A	-	1	0	HECW2	197006296	0.974000	0.33945	0.868000	0.34077	0.687000	0.40016	2.483000	0.45233	1.349000	0.45751	0.561000	0.74099	GCC		0.597	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335199.3	NM_020760		9	46	0	0	0	0.006214	0	9	46				
STK11IP	114790	broad.mit.edu	37	2	220476447	220476447	+	Silent	SNP	C	C	T			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr2:220476447C>T	ENST00000456909.1	+	18	2316	c.2226C>T	c.(2224-2226)gcC>gcT	p.A742A	STK11IP_ENST00000295641.10_Silent_p.A753A			Q8N1F8	S11IP_HUMAN	serine/threonine kinase 11 interacting protein	753					protein localization (GO:0008104)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)	protein kinase binding (GO:0019901)	p.A753A(1)|p.A742A(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	23		Renal(207;0.0183)		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTCCGTCTGCCAGCCCTGTCT	0.627																																							uc002vml.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(2257-2259)GCC>GCT		LKB1 interacting protein							54.0	64.0	61.0					2																	220476447		2092	4220	6312	SO:0001819	synonymous_variant	114790				protein localization	cytoplasm	protein kinase binding	g.chr2:220476447C>T	AF450267	CCDS46521.1	2q35	2008-06-03			ENSG00000144589	ENSG00000144589			19184	protein-coding gene	gene with protein product	"""LKB1 interacting protein"""	607172				11741830	Standard	NM_052902		Approved	LIP1, KIAA1898, LKB1IP, STK11IP1	uc002vml.3	Q8N1F8	OTTHUMG00000059239	ENST00000456909.1:c.2226C>T	2.37:g.220476447C>T							p.A753A	NM_052902	NP_443134	Q8N1F8	S11IP_HUMAN		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	18	2302	+		Renal(207;0.0183)	753					Q8NAW9|Q8WXE4|Q96CN3|Q96PY9	Silent	SNP	ENST00000456909.1	37	c.2259C>T																																																																																					0.627	STK11IP-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000131432.1	NM_052902		4	49	0	0	0	0.009096	0	4	49				
SIGLEC1	6614	broad.mit.edu	37	20	3686514	3686514	+	Missense_Mutation	SNP	C	C	T	rs111336308	byFrequency	TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr20:3686514C>T	ENST00000344754.4	-	3	582	c.583G>A	c.(583-585)Ggc>Agc	p.G195S	SIGLEC1_ENST00000202578.4_Missense_Mutation_p.G195S	NM_023068.3	NP_075556.1	Q9BZZ2	SN_HUMAN	sialic acid binding Ig-like lectin 1, sialoadhesin	195	Ig-like C2-type 1.				cell-matrix adhesion (GO:0007160)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of T cell apoptotic process (GO:0070234)|single organismal cell-cell adhesion (GO:0016337)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.G195S(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|liver(2)|lung(24)|ovary(3)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)	70						TGGCCGACGCCGGTGGGCTCA	0.642													C|||	4	0.000798722	0.0	0.0	5008	,	,		18210	0.003		0.001	False		,,,				2504	0.0						uc002wja.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(4)|ovary(2)|skin(2)|breast(1)|central_nervous_system(1)	10						c.(583-585)GGC>AGC		sialoadhesin precursor							96.0	89.0	92.0					20																	3686514		2203	4300	6503	SO:0001583	missense	6614				cell-cell adhesion|cell-matrix adhesion|endocytosis|inflammatory response	extracellular region|integral to membrane|plasma membrane	sugar binding	g.chr20:3686514C>T	AF230073	CCDS13060.1	20p13	2013-01-29	2006-01-19	2006-01-19	ENSG00000088827	ENSG00000088827		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11127	protein-coding gene	gene with protein product		600751	"""sialoadhesin"""	SN		8530048	Standard	XM_006723610		Approved	SIGLEC-1, CD169, FLJ00051, FLJ00055, FLJ00073, FLJ32150, dJ1009E24.1, sialoadhesin	uc002wja.3	Q9BZZ2	OTTHUMG00000031757	ENST00000344754.4:c.583G>A	20.37:g.3686514C>T	ENSP00000341141:p.Gly195Ser					SIGLEC1_uc002wiz.3_Missense_Mutation_p.G195S|SIGLEC1_uc002wjc.2_Missense_Mutation_p.G106S	p.G195S	NM_023068	NP_075556	Q9BZZ2	SN_HUMAN			3	583	-			195			Ig-like C2-type 1.|Extracellular (Potential).		Q96DL4|Q9GZS5|Q9H1H6|Q9H1H7|Q9H7L7	Missense_Mutation	SNP	ENST00000344754.4	37	c.583G>A	CCDS13060.1	4	0.0018315018315018315	0	0.0	0	0.0	3	0.005244755244755245	1	0.0013192612137203166	C	7.253	0.603637	0.14002	.	.	ENSG00000088827	ENST00000344754;ENST00000202578	T;T	0.76060	-0.99;-0.99	4.68	3.71	0.42584	CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.40908	D	0.000993	T	0.56659	0.2000	L	0.46157	1.445	0.09310	N	1	P;P;B	0.39665	0.682;0.604;0.347	B;B;B	0.43123	0.197;0.409;0.095	T	0.50074	-0.8870	10	0.13470	T	0.59	.	6.126	0.20180	0.1853:0.717:0.0:0.0976	.	195;195;195	Q9BZZ2-2;Q9BZZ2;Q9BZZ2-3	.;SN_HUMAN;.	S	195	ENSP00000341141:G195S;ENSP00000202578:G195S	ENSP00000202578:G195S	G	-	1	0	SIGLEC1	3634514	0.092000	0.21681	0.118000	0.21660	0.018000	0.09664	1.211000	0.32382	2.435000	0.82474	0.462000	0.41574	GGC		0.642	SIGLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077761.2	NM_023068		14	105	0	0	0	0.024245	0	14	105				
CD93	22918	broad.mit.edu	37	20	23065344	23065344	+	Missense_Mutation	SNP	G	G	T			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr20:23065344G>T	ENST00000246006.4	-	1	1633	c.1486C>A	c.(1486-1488)Cgt>Agt	p.R496S		NM_012072.3	NP_036204.2	Q9NPY3	C1QR1_HUMAN	CD93 molecule	496				R -> Q (in Ref. 1; AA sequence). {ECO:0000305}.	macrophage activation (GO:0042116)|phagocytosis (GO:0006909)|single organismal cell-cell adhesion (GO:0016337)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|complement component C1q binding (GO:0001849)|receptor activity (GO:0004872)	p.R496S(1)		NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Colorectal(13;0.0352)|Lung NSC(19;0.0542)|all_lung(19;0.118)					GTTGCAGCACGGGGCACGGTG	0.622																																							uc002wsv.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)	2						c.(1486-1488)CGT>AGT		CD93 antigen precursor							36.0	41.0	40.0					20																	23065344		2200	4299	6499	SO:0001583	missense	22918				cell-cell adhesion|interspecies interaction between organisms|macrophage activation|phagocytosis	plasma membrane	calcium ion binding|complement component C1q binding|receptor activity|sugar binding	g.chr20:23065344G>T	U94333	CCDS13149.1	20p11.21	2009-01-29	2006-03-28	2006-02-22	ENSG00000125810	ENSG00000125810		"""CD molecules"""	15855	protein-coding gene	gene with protein product		120577	"""matrix-remodelling associated 4"", ""complement component 1, q subcomponent, receptor 1"", ""CD93 antigen"""	MXRA4, C1QR1		9047234, 10648005	Standard	NM_012072		Approved	C1qRP, C1qR(P), dJ737E23.1, CDw93, ECSM3	uc002wsv.3	Q9NPY3	OTTHUMG00000032058	ENST00000246006.4:c.1486C>A	20.37:g.23065344G>T	ENSP00000246006:p.Arg496Ser						p.R496S	NM_012072	NP_036204	Q9NPY3	C1QR1_HUMAN			1	1634	-	Colorectal(13;0.0352)|Lung NSC(19;0.0542)|all_lung(19;0.118)		496	R -> Q (in Ref. 1; AA sequence).		Extracellular (Potential).		O00274	Missense_Mutation	SNP	ENST00000246006.4	37	c.1486C>A	CCDS13149.1	.	.	.	.	.	.	.	.	.	.	G	3.275	-0.148241	0.06627	.	.	ENSG00000125810	ENST00000246006	T	0.79940	-1.32	5.44	0.945	0.19543	.	1.360190	0.04741	N	0.422840	T	0.46678	0.1405	N	0.00237	-1.79	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46261	-0.9204	10	0.08599	T	0.76	-0.0337	8.8195	0.35016	0.6169:0.0:0.3831:0.0	.	496	Q9NPY3	C1QR1_HUMAN	S	496	ENSP00000246006:R496S	ENSP00000246006:R496S	R	-	1	0	CD93	23013344	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	0.071000	0.14594	0.293000	0.22520	-0.140000	0.14226	CGT		0.622	CD93-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078312.2	NM_012072		10	51	1	0	1.08611e-07	0.010729	1.34051e-07	10	51				
TMPRSS15	5651	broad.mit.edu	37	21	19653418	19653418	+	Missense_Mutation	SNP	A	A	T			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr21:19653418A>T	ENST00000284885.3	-	22	2640	c.2607T>A	c.(2605-2607)aaT>aaA	p.N869K		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	869	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)	p.N869K(1)		NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						TTCTTCGCCTATTGTAATGAG	0.378																																							uc002ykw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	8						c.(2605-2607)AAT>AAA		enterokinase precursor							208.0	197.0	201.0					21																	19653418		2203	4300	6503	SO:0001583	missense	5651				proteolysis	brush border|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity	g.chr21:19653418A>T		CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.2607T>A	21.37:g.19653418A>T	ENSP00000284885:p.Asn869Lys						p.N869K	NM_002772	NP_002763	P98073	ENTK_HUMAN			22	2638	-			869			Extracellular (Potential).|Peptidase S1.		Q2NKL7	Missense_Mutation	SNP	ENST00000284885.3	37	c.2607T>A	CCDS13571.1	.	.	.	.	.	.	.	.	.	.	A	11.46	1.644503	0.29246	.	.	ENSG00000154646	ENST00000284885	D	0.93953	-3.32	5.66	2.08	0.27032	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.166320	0.50627	D	0.000103	D	0.88526	0.6460	L	0.53561	1.675	0.34037	D	0.654498	P	0.35656	0.514	B	0.35353	0.201	D	0.85194	0.1011	9	.	.	.	.	5.3291	0.15922	0.554:0.1438:0.3022:0.0	.	869	P98073	ENTK_HUMAN	K	869	ENSP00000284885:N869K	.	N	-	3	2	TMPRSS15	18575289	0.992000	0.36948	0.973000	0.42090	0.266000	0.26442	0.249000	0.18216	0.440000	0.26502	0.397000	0.26171	AAT		0.378	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158231.2	NM_002772		14	163	0	0	0	0.024245	0	14	163				
CDCP1	64866	broad.mit.edu	37	3	45134848	45134848	+	Silent	SNP	G	G	T			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr3:45134848G>T	ENST00000296129.1	-	6	1682	c.1548C>A	c.(1546-1548)acC>acA	p.T516T		NM_022842.3	NP_073753.3	Q9H5V8	CDCP1_HUMAN	CUB domain containing protein 1	516	CUB.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T516T(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|skin(4)|urinary_tract(1)	29				BRCA - Breast invasive adenocarcinoma(193;0.00928)|KIRC - Kidney renal clear cell carcinoma(197;0.0519)|Kidney(197;0.0651)		AGGTGCGAAGGGTCACCGAGA	0.572																																							uc003com.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(1546-1548)ACC>ACA		CUB domain-containing protein 1 isoform 1							90.0	87.0	88.0					3																	45134848		2203	4300	6503	SO:0001819	synonymous_variant	64866					extracellular region|integral to membrane|plasma membrane		g.chr3:45134848G>T	AF468010	CCDS2727.1, CCDS46812.1	3p21.3	2006-03-28			ENSG00000163814	ENSG00000163814		"""CD molecules"""	24357	protein-coding gene	gene with protein product		611735				11466621	Standard	NM_022842		Approved	CD318, SIMA135	uc003com.3	Q9H5V8	OTTHUMG00000133090	ENST00000296129.1:c.1548C>A	3.37:g.45134848G>T							p.T516T	NM_022842	NP_073753	Q9H5V8	CDCP1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.00928)|KIRC - Kidney renal clear cell carcinoma(197;0.0519)|Kidney(197;0.0651)	6	1683	-			516			CUB.|Extracellular (Potential).		Q49UB4|Q6NT71|Q6U9Y2|Q8WU91|Q96QU7|Q9H676|Q9H8C2	Silent	SNP	ENST00000296129.1	37	c.1548C>A	CCDS2727.1																																																																																				0.572	CDCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256748.3	NM_022842		5	84	1	0	3.59834e-05	0.021553	4.1081e-05	5	84				
LRRC31	79782	broad.mit.edu	37	3	169587661	169587661	+	5'Flank	SNP	C	C	T			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr3:169587661C>T	ENST00000316428.5	-	0	0				LRRC31_ENST00000523069.1_5'Flank|LRRC31_ENST00000397805.2_5'UTR|LRRC31_ENST00000264676.5_5'UTR	NM_001277127.1|NM_024727.2	NP_001264056.1|NP_079003.2	Q6UY01	LRC31_HUMAN	leucine rich repeat containing 31											cervix(3)|endometrium(3)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	31	all_cancers(22;2.76e-22)|all_epithelial(15;4.73e-27)|all_lung(20;9.24e-17)|Lung NSC(18;3.85e-16)|Ovarian(172;0.000223)|Breast(254;0.197)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00943)			TCTAGGATTTCTAAGAAGAAA	0.438																																							uc003fgc.1		NA																	0				ovary(2)|skin(1)	3						c.e1-1		leucine rich repeat containing 31																																				SO:0001631	upstream_gene_variant	79782							g.chr3:169587661C>T	AK026912	CCDS43167.1, CCDS63832.1, CCDS63833.1	3q26.2	2005-01-24			ENSG00000114248	ENSG00000114248			26261	protein-coding gene	gene with protein product						12975309	Standard	NM_001277127		Approved	FLJ23259	uc003fgc.2	Q6UY01	OTTHUMG00000164421		3.37:g.169587661C>T	Exception_encountered					LRRC31_uc010hwp.1_Splice_Site		NM_024727	NP_079003	Q6UY01	LRC31_HUMAN	Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00943)		1	13	-	all_cancers(22;2.76e-22)|all_epithelial(15;4.73e-27)|all_lung(20;9.24e-17)|Lung NSC(18;3.85e-16)|Ovarian(172;0.000223)|Breast(254;0.197)							B7ZL44|E5RJA9|Q17RA3|Q8N848|Q9H5N5|V9HW14	Splice_Site	SNP	ENST00000316428.5	37	c.-64_splice	CCDS43167.1																																																																																				0.438	LRRC31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378699.1	NM_024727		8	19	0	0	0	0.038147	0	8	19				
LINC00969	440993	broad.mit.edu	37	3	195400728	195400728	+	lincRNA	SNP	A	A	G	rs12107841	byFrequency	TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr3:195400728A>G	ENST00000445430.1	+	0	1324									long intergenic non-protein coding RNA 969																		GATTGTGCCCAGCCTGTACGC	0.587																																							uc003fuw.2		NA																	0					0						c.(22-24)CCA>CCG		SubName: Full=cDNA FLJ16373 fis, clone THYMU3000269, highly similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial (EC 1.3.5.1);																																						727956							g.chr3:195400728A>G	AK128346		3q29	2013-06-07			ENSG00000242086	ENSG00000242086		"""Long non-coding RNAs"""	48729	non-coding RNA	RNA, long non-coding							Standard	XR_427455		Approved				OTTHUMG00000155834		3.37:g.195400728A>G						SDHAP2_uc011btb.1_Missense_Mutation_p.S156G|SDHAP2_uc011btc.1_RNA|SDHAP2_uc003fuv.2_RNA	p.P8P							9	1218	+									Silent	SNP	ENST00000445430.1	37	c.24A>G																																																																																					0.587	LINC00969-038	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000341951.1			4	37	0	0	0	0.014758	0	4	37				
KLHL8	57563	broad.mit.edu	37	4	88106793	88106793	+	Silent	SNP	G	G	A	rs367639531		TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr4:88106793G>A	ENST00000273963.5	-	3	716	c.375C>T	c.(373-375)gtC>gtT	p.V125V	KLHL8_ENST00000545252.1_Intron|KLHL8_ENST00000512111.1_Silent_p.V125V|KLHL8_ENST00000425278.2_Intron|KLHL8_ENST00000498875.2_Intron	NM_020803.3	NP_065854.3	Q9P2G9	KLHL8_HUMAN	kelch-like family member 8	125	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	Cul3-RING ubiquitin ligase complex (GO:0031463)|nucleus (GO:0005634)		p.V125V(1)		breast(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|stomach(1)|upper_aerodigestive_tract(1)	17		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000603)		GTGAAGAATAGACAAACTTTA	0.418																																							uc011cdb.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(373-375)GTC>GTT		kelch-like 8		G		0,4406		0,0,2203	78.0	78.0	78.0		375	2.9	1.0	4		78	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	KLHL8	NM_020803.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		125/621	88106793	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	57563							g.chr4:88106793G>A	AB037799	CCDS3617.1, CCDS75163.1	4q21.3	2013-01-30	2013-01-30		ENSG00000145332	ENSG00000145332		"""Kelch-like"", ""BTB/POZ domain containing"""	18644	protein-coding gene	gene with protein product		611967	"""kelch-like 8 (Drosophila)"""				Standard	XM_005263153		Approved	KIAA1378	uc003hql.1	Q9P2G9	OTTHUMG00000130593	ENST00000273963.5:c.375C>T	4.37:g.88106793G>A						KLHL8_uc003hql.1_Silent_p.V125V|KLHL8_uc003hqm.1_Intron|KLHL8_uc003hqn.1_Intron|KLHL8_uc010ikj.1_Intron	p.V125V	NM_020803	NP_065854	Q9P2G9	KLHL8_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000603)	3	760	-		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)	125			BTB.		Q53XA3|Q6N018	Silent	SNP	ENST00000273963.5	37	c.375C>T	CCDS3617.1																																																																																				0.418	KLHL8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253040.1			5	48	0	0	0	0.021553	0	5	48				
SEC24D	9871	broad.mit.edu	37	4	119736190	119736190	+	Missense_Mutation	SNP	G	G	C			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr4:119736190G>C	ENST00000280551.6	-	6	1032	c.794C>G	c.(793-795)cCt>cGt	p.P265R	SEC24D_ENST00000379735.5_Missense_Mutation_p.P266R|SEC24D_ENST00000419654.2_5'UTR			O94855	SC24D_HUMAN	SEC24 family member D	265	Pro-rich.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)	p.P265R(1)		breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(13)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37						TACTGGGCTAGGGATAGAGTC	0.502																																							uc003ici.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(793-795)CCT>CGT		Sec24-related protein D							126.0	131.0	129.0					4																	119736190		2203	4300	6503	SO:0001583	missense	9871				COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	zinc ion binding	g.chr4:119736190G>C	AB018298	CCDS3710.1	4q26	2013-10-21	2013-10-21		ENSG00000150961	ENSG00000150961			10706	protein-coding gene	gene with protein product		607186	"""SEC24 (S. cerevisiae) related gene family, member D"", ""SEC24 family, member D (S. cerevisiae)"""			9872452, 10075675	Standard	NM_014822		Approved	KIAA0755	uc003ici.4	O94855	OTTHUMG00000132957	ENST00000280551.6:c.794C>G	4.37:g.119736190G>C	ENSP00000280551:p.Pro265Arg					SEC24D_uc003icj.3_Missense_Mutation_p.P266R|SEC24D_uc003icl.2_RNA|SEC24D_uc010imz.1_RNA|SEC24D_uc011cgg.1_RNA	p.P265R	NM_014822	NP_055637	O94855	SC24D_HUMAN			6	1066	-			265			Pro-rich.		Q8IYI7	Missense_Mutation	SNP	ENST00000280551.6	37	c.794C>G	CCDS3710.1	.	.	.	.	.	.	.	.	.	.	G	19.85	3.903184	0.72754	.	.	ENSG00000150961	ENST00000280551;ENST00000379735	T;T	0.27104	1.69;1.69	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.61689	0.2367	M	0.92317	3.295	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.71276	-0.4641	10	0.87932	D	0	-18.9303	16.4206	0.83757	0.0:0.0:1.0:0.0	.	266;265	O94855-2;O94855	.;SC24D_HUMAN	R	265;266	ENSP00000280551:P265R;ENSP00000369059:P266R	ENSP00000280551:P265R	P	-	2	0	SEC24D	119955638	1.000000	0.71417	0.999000	0.59377	0.666000	0.39218	8.251000	0.89838	2.598000	0.87819	0.557000	0.71058	CCT		0.502	SEC24D-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256514.4			8	87	0	0	0	0.006214	0	8	87				
GRIA2	2891	broad.mit.edu	37	4	158238861	158238861	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr4:158238861C>G	ENST00000264426.9	+	5	997	c.718C>G	c.(718-720)Ctg>Gtg	p.L240V	GRIA2_ENST00000296526.7_Missense_Mutation_p.L240V|GRIA2_ENST00000393815.2_Missense_Mutation_p.L193V|GRIA2_ENST00000449365.1_Missense_Mutation_p.L193V|GRIA2_ENST00000507898.1_Missense_Mutation_p.L193V	NM_001083619.1	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2	240					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.L240V(2)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(2)|lung(32)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	79	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	CATTGCAAATCTGGTAGGTGA	0.249																																							uc003ipm.3		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(3)|ovary(1)	4						c.(718-720)CTG>GTG		glutamate receptor, ionotropic, AMPA 2 isoform 2	L-Glutamic Acid(DB00142)						38.0	39.0	39.0					4																	158238861		2195	4290	6485	SO:0001583	missense	2891				synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|endoplasmic reticulum membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity	g.chr4:158238861C>G		CCDS3797.1, CCDS43274.1, CCDS43275.1	4q32.1	2012-08-29			ENSG00000120251	ENSG00000120251		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4572	protein-coding gene	gene with protein product		138247		GLUR2		1311100	Standard	NM_001083619		Approved	GluA2, GLURB	uc003ipl.4	P42262	OTTHUMG00000133836	ENST00000264426.9:c.718C>G	4.37:g.158238861C>G	ENSP00000264426:p.Leu240Val					GRIA2_uc011cit.1_Missense_Mutation_p.L193V|GRIA2_uc003ipl.3_Missense_Mutation_p.L240V|GRIA2_uc003ipk.3_Missense_Mutation_p.L193V|GRIA2_uc010iqh.1_RNA	p.L240V	NM_001083619	NP_001077088	P42262	GRIA2_HUMAN		COAD - Colon adenocarcinoma(41;0.0294)	5	1177	+	all_hematologic(180;0.24)	Renal(120;0.0458)	240			Extracellular (Potential).		A8MT92|I6L997|Q96FP6	Missense_Mutation	SNP	ENST00000264426.9	37	c.718C>G	CCDS43274.1	.	.	.	.	.	.	.	.	.	.	C	15.76	2.927460	0.52759	.	.	ENSG00000120251	ENST00000507898;ENST00000393815;ENST00000296526;ENST00000264426;ENST00000449365	D;D;D;D;D	0.85411	-1.98;-1.98;-1.98;-1.98;-1.98	5.17	3.44	0.39384	Extracellular ligand-binding receptor (1);	0.000000	0.64402	D	0.000002	D	0.86167	0.5868	M	0.79693	2.465	0.80722	D	1	B;P;B	0.34724	0.267;0.465;0.223	B;B;B	0.40256	0.324;0.238;0.16	D	0.84871	0.0825	10	0.87932	D	0	.	9.9784	0.41797	0.0:0.7791:0.0:0.2209	.	240;240;193	P42262;P42262-2;A8MT92	GRIA2_HUMAN;.;.	V	193;193;240;240;193	ENSP00000426845:L193V;ENSP00000377403:L193V;ENSP00000296526:L240V;ENSP00000264426:L240V;ENSP00000389837:L193V	ENSP00000264426:L240V	L	+	1	2	GRIA2	158458311	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.343000	0.44001	0.662000	0.31006	0.563000	0.77884	CTG		0.249	GRIA2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000258367.2			4	32	0	0	0	0.014758	0	4	32				
TAS2R1	50834	broad.mit.edu	37	5	9629646	9629646	+	Missense_Mutation	SNP	G	G	T			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr5:9629646G>T	ENST00000382492.2	-	1	817	c.499C>A	c.(499-501)Caa>Aaa	p.Q167K	CTD-2001E22.1_ENST00000504182.2_RNA	NM_019599.2	NP_062545.1	Q9NYW7	TA2R1_HUMAN	taste receptor, type 2, member 1	167					chemosensory behavior (GO:0007635)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)	p.Q167K(1)		breast(5)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(19)|ovary(3)|prostate(1)|skin(1)|stomach(1)	39						TCTTCTTTTTGAATTGTGGCA	0.358																																							uc003jem.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(499-501)CAA>AAA		taste receptor T2R1							75.0	84.0	81.0					5																	9629646		2203	4300	6503	SO:0001583	missense	50834				chemosensory behavior|sensory perception of taste	integral to membrane	taste receptor activity	g.chr5:9629646G>T	AF227129	CCDS3876.1	5p15	2012-08-22			ENSG00000169777	ENSG00000169777		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14909	protein-coding gene	gene with protein product		604796				10761934, 10766242	Standard	NM_019599		Approved	T2R1, TRB7	uc003jem.1	Q9NYW7	OTTHUMG00000090500	ENST00000382492.2:c.499C>A	5.37:g.9629646G>T	ENSP00000371932:p.Gln167Lys						p.Q167K	NM_019599	NP_062545	Q9NYW7	TA2R1_HUMAN			1	818	-			167			Extracellular (Potential).		Q646G8	Missense_Mutation	SNP	ENST00000382492.2	37	c.499C>A	CCDS3876.1	.	.	.	.	.	.	.	.	.	.	G	11.58	1.680317	0.29872	.	.	ENSG00000169777	ENST00000382492	T	0.36878	1.23	5.65	-0.739	0.11120	.	3.161590	0.00948	N	0.002921	T	0.23014	0.0556	N	0.14661	0.345	0.09310	N	1	B	0.30634	0.288	B	0.30105	0.111	T	0.17198	-1.0377	9	.	.	.	.	8.2525	0.31735	0.0721:0.575:0.234:0.1189	.	167	Q9NYW7	TA2R1_HUMAN	K	167	ENSP00000371932:Q167K	.	Q	-	1	0	TAS2R1	9682646	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	0.182000	0.16900	0.141000	0.18875	0.655000	0.94253	CAA		0.358	TAS2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206988.2			5	52	1	0	3.59834e-05	0.021553	4.1081e-05	5	52				
ADAMTS12	81792	broad.mit.edu	37	5	33891898	33891898	+	Missense_Mutation	SNP	C	C	A			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr5:33891898C>A	ENST00000504830.1	-	1	399	c.64G>T	c.(64-66)Ggg>Tgg	p.G22W	ADAMTS12_ENST00000352040.3_Missense_Mutation_p.G22W|ADAMTS12_ENST00000515401.1_Missense_Mutation_p.G22W	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	22					cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.G22W(2)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						CAAAGCGCCCCAAAGTTAAGG	0.498										HNSCC(64;0.19)																													uc003jia.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						c.(64-66)GGG>TGG		ADAM metallopeptidase with thrombospondin type 1							102.0	109.0	107.0					5																	33891898		2203	4300	6503	SO:0001583	missense	81792				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:33891898C>A	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.64G>T	5.37:g.33891898C>A	ENSP00000422554:p.Gly22Trp	HNSCC(64;0.19)				ADAMTS12_uc010iuq.1_Missense_Mutation_p.G22W|ADAMTS12_uc003jib.1_Missense_Mutation_p.G22W	p.G22W	NM_030955	NP_112217	P58397	ATS12_HUMAN			1	227	-			22					A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	ENST00000504830.1	37	c.64G>T	CCDS34140.1	.	.	.	.	.	.	.	.	.	.	C	13.97	2.394862	0.42512	.	.	ENSG00000151388	ENST00000504830;ENST00000352040;ENST00000515401	T;T;T	0.59772	0.24;0.24;2.81	5.61	3.76	0.43208	.	0.400243	0.21947	N	0.066781	T	0.41949	0.1181	L	0.27053	0.805	0.28121	N	0.930599	B;B;B	0.15141	0.005;0.012;0.002	B;B;B	0.16722	0.011;0.016;0.005	T	0.36163	-0.9759	10	0.49607	T	0.09	.	8.231	0.31597	0.1313:0.5756:0.293:0.0	.	22;22;22	P58397-3;D6REX0;P58397	.;.;ATS12_HUMAN	W	22	ENSP00000422554:G22W;ENSP00000344847:G22W;ENSP00000421638:G22W	ENSP00000344847:G22W	G	-	1	0	ADAMTS12	33927655	0.634000	0.27190	0.458000	0.27068	0.980000	0.70556	1.169000	0.31871	1.335000	0.45486	0.585000	0.79938	GGG		0.498	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955		14	106	1	0	0.000308642	0.024245	0.000335587	14	106				
PCDHGA3	56112	broad.mit.edu	37	5	140725167	140725167	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr5:140725167G>A	ENST00000253812.6	+	1	1567	c.1567G>A	c.(1567-1569)Gag>Aag	p.E523K	PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	523	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E523K(1)		breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTTCGACTACGAGCAATTTAG	0.562																																							uc003ljm.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(1567-1569)GAG>AAG		protocadherin gamma subfamily A, 3 isoform 1							98.0	109.0	105.0					5																	140725167		2198	4298	6496	SO:0001583	missense	56112				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140725167G>A	AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.1567G>A	5.37:g.140725167G>A	ENSP00000253812:p.Glu523Lys					PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc010jfx.1_Missense_Mutation_p.E283K|PCDHGA3_uc011dap.1_Missense_Mutation_p.E523K	p.E523K	NM_018916	NP_061739	Q9Y5H0	PCDG3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1567	+			523			Extracellular (Potential).|Cadherin 5.		Q9Y5D4	Missense_Mutation	SNP	ENST00000253812.6	37	c.1567G>A	CCDS47290.1	.	.	.	.	.	.	.	.	.	.	.	25.5	4.644081	0.87859	.	.	ENSG00000254245	ENST00000253812	T	0.72394	-0.65	5.36	5.36	0.76844	Cadherin (5);Cadherin-like (1);	0.000000	0.33327	U	0.005025	D	0.89079	0.6613	H	0.94183	3.505	0.44085	D	0.996848	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.91743	0.5406	10	0.87932	D	0	.	19.0569	0.93069	0.0:0.0:1.0:0.0	.	523;523	Q9Y5H0-2;Q9Y5H0	.;PCDG3_HUMAN	K	523	ENSP00000253812:E523K	ENSP00000253812:E523K	E	+	1	0	PCDHGA3	140705351	1.000000	0.71417	0.893000	0.35052	0.785000	0.44390	9.537000	0.98070	2.665000	0.90641	0.563000	0.77884	GAG		0.562	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377017.1	NM_018916		16	109	0	0	0	0.028581	0	16	109				
ARHGAP26	23092	broad.mit.edu	37	5	142264928	142264928	+	Missense_Mutation	SNP	T	T	G			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr5:142264928T>G	ENST00000274498.4	+	5	828	c.450T>G	c.(448-450)aaT>aaG	p.N150K	ARHGAP26_ENST00000378004.3_Missense_Mutation_p.N150K	NM_015071.4	NP_055886.1	Q9UNA1	RHG26_HUMAN	Rho GTPase activating protein 26	150					actin cytoskeleton organization (GO:0030036)|filopodium assembly (GO:0046847)|nervous system development (GO:0007399)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)	p.N150K(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(7)|ovary(1)	25		all_hematologic(541;0.0416)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AACACTTGAATTTGTCTTCCA	0.338																																							uc011dbj.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(448-450)AAT>AAG		GTPase regulator associated with the focal							103.0	113.0	110.0					5																	142264928		2203	4300	6503	SO:0001583	missense	23092				actin cytoskeleton organization|filopodium assembly|nervous system development|small GTPase mediated signal transduction	cytoskeleton|cytosol|focal adhesion	cytoskeletal adaptor activity|Rho GTPase activator activity|SH3 domain binding	g.chr5:142264928T>G	AB014521	CCDS4277.1, CCDS47297.1	5q31	2011-06-29			ENSG00000145819	ENSG00000145819		"""Rho GTPase activating proteins"""	17073	protein-coding gene	gene with protein product	"""GTPase regulator associated with the focal adhesion kinase pp125"""	605370				9858476, 8649427	Standard	NM_001135608		Approved	GRAF, KIAA0621, OPHN1L, OPHN1L1	uc011dbj.2	Q9UNA1	OTTHUMG00000059705	ENST00000274498.4:c.450T>G	5.37:g.142264928T>G	ENSP00000274498:p.Asn150Lys					ARHGAP26_uc003lmt.2_Missense_Mutation_p.N150K|ARHGAP26_uc003lmw.2_Missense_Mutation_p.N150K	p.N150K	NM_015071	NP_055886	Q9UNA1	RHG26_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		5	485	+		all_hematologic(541;0.0416)	150					O75117|Q5D035|Q9BYS6|Q9BYS7|Q9UJ00	Missense_Mutation	SNP	ENST00000274498.4	37	c.450T>G	CCDS4277.1	.	.	.	.	.	.	.	.	.	.	T	16.02	3.002955	0.54254	.	.	ENSG00000145819	ENST00000274498;ENST00000378004;ENST00000378013	T;T;T	0.30714	1.52;1.52;1.52	5.9	3.55	0.40652	IRSp53/MIM homology domain (IMD) (2);	0.042309	0.85682	D	0.000000	T	0.42063	0.1186	M	0.66939	2.045	0.51233	D	0.999919	P;B	0.51933	0.949;0.415	P;B	0.56343	0.796;0.274	T	0.29941	-0.9995	10	0.56958	D	0.05	.	5.9527	0.19255	0.0:0.3005:0.0:0.6995	.	150;150	Q9UNA1;Q9UNA1-2	RHG26_HUMAN;.	K	150;150;122	ENSP00000274498:N150K;ENSP00000367243:N150K;ENSP00000367252:N122K	ENSP00000274498:N150K	N	+	3	2	ARHGAP26	142245112	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.457000	0.35212	1.054000	0.40438	0.460000	0.39030	AAT		0.338	ARHGAP26-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000132744.3	NM_015071		10	43	0	0	0	0.013537	0	10	43				
HAVCR2	84868	broad.mit.edu	37	5	156535979	156535979	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr5:156535979G>A	ENST00000307851.4	-	1	746	c.16C>T	c.(16-18)Ccc>Tcc	p.P6S	HAVCR2_ENST00000517358.1_5'Flank|CTB-120L21.1_ENST00000517708.1_RNA|HAVCR2_ENST00000522593.1_Missense_Mutation_p.P6S	NM_032782.4	NP_116171.3	Q8TDQ0	HAVR2_HUMAN	hepatitis A virus cellular receptor 2	6						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.P6S(1)		cervix(1)|large_intestine(4)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	22	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CAGTCAAAGGGAAGATGTGAA	0.448																																							uc003lwk.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(16-18)CCC>TCC		T cell immunoglobulin mucin 3 precursor							137.0	125.0	129.0					5																	156535979		2203	4300	6503	SO:0001583	missense	84868					integral to membrane		g.chr5:156535979G>A	AK027334	CCDS4333.1	5q34	2014-01-14			ENSG00000135077	ENSG00000135077		"""Immunoglobulin superfamily / V-set domain containing"""	18437	protein-coding gene	gene with protein product	"""T-cell immunoglobulin mucin family member 3"""	606652				11823861	Standard	NM_032782		Approved	Tim-3, TIM3, FLJ14428, TIMD3	uc003lwk.2	Q8TDQ0	OTTHUMG00000130249	ENST00000307851.4:c.16C>T	5.37:g.156535979G>A	ENSP00000312002:p.Pro6Ser					HAVCR2_uc003lwl.2_Missense_Mutation_p.P6S	p.P6S	NM_032782	NP_116171	Q8TDQ0	HAVR2_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		1	160	-	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	6					B2RAY2|Q8WW60|Q96K94	Missense_Mutation	SNP	ENST00000307851.4	37	c.16C>T	CCDS4333.1	.	.	.	.	.	.	.	.	.	.	G	0.191	-1.053339	0.01965	.	.	ENSG00000135077	ENST00000307851;ENST00000522593	T;T	0.15834	2.39;2.65	4.43	-2.74	0.05932	Immunoglobulin-like (1);	3.161940	0.00659	N	0.000588	T	0.07683	0.0193	N	0.11427	0.14	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.18777	-1.0326	10	0.11794	T	0.64	0.6524	3.0428	0.06143	0.4102:0.0:0.2934:0.2964	.	6;6	Q8TDQ0-2;Q8TDQ0	.;HAVR2_HUMAN	S	6	ENSP00000312002:P6S;ENSP00000430873:P6S	ENSP00000312002:P6S	P	-	1	0	HAVCR2	156468557	0.000000	0.05858	0.000000	0.03702	0.499000	0.33736	-0.180000	0.09754	-0.587000	0.05890	-0.312000	0.09012	CCC		0.448	HAVCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252574.2			9	51	0	0	0	0.006214	0	9	51				
RNF144B	255488	broad.mit.edu	37	6	18457500	18457500	+	Missense_Mutation	SNP	A	A	G			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr6:18457500A>G	ENST00000259939.3	+	5	763	c.446A>G	c.(445-447)cAc>cGc	p.H149R	RNF144B_ENST00000429054.2_Missense_Mutation_p.H60R	NM_182757.3	NP_877434.2	Q7Z419	R144B_HUMAN	ring finger protein 144B	149					apoptotic process (GO:0006915)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.H149R(1)		endometrium(2)|kidney(1)|large_intestine(1)|lung(7)	11	Ovarian(93;0.00365)|Breast(50;0.0145)	all_hematologic(90;0.0536)	OV - Ovarian serous cystadenocarcinoma(7;0.00165)|all cancers(50;0.0102)|Epithelial(50;0.0105)			CCTTCTTGCCACCTGAAATTC	0.552																																							uc003ncs.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(445-447)CAC>CGC		IBR domain containing 2							318.0	278.0	291.0					6																	18457500		2203	4300	6503	SO:0001583	missense	255488				apoptosis|positive regulation of anti-apoptosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	integral to membrane|mitochondrial membrane	protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr6:18457500A>G	AK096832	CCDS34345.1	6p22.3	2011-05-23	2009-01-05	2007-08-20	ENSG00000137393	ENSG00000137393		"""RING-type (C3HC4) zinc fingers"""	21578	protein-coding gene	gene with protein product			"""IBR domain containing 2"""	IBRDC2			Standard	NM_182757		Approved	bA528A10.3	uc003ncs.3	Q7Z419	OTTHUMG00000014322	ENST00000259939.3:c.446A>G	6.37:g.18457500A>G	ENSP00000259939:p.His149Arg						p.H149R	NM_182757	NP_877434	Q7Z419	R144B_HUMAN	OV - Ovarian serous cystadenocarcinoma(7;0.00165)|all cancers(50;0.0102)|Epithelial(50;0.0105)		5	750	+	Ovarian(93;0.00365)|Breast(50;0.0145)	all_hematologic(90;0.0536)	149			IBR-type.		B3KUA8|B4DZI2|Q5TB85|Q6P4Q0|Q8N3R7|Q9BX38	Missense_Mutation	SNP	ENST00000259939.3	37	c.446A>G	CCDS34345.1	.	.	.	.	.	.	.	.	.	.	A	6.496	0.459623	0.12342	.	.	ENSG00000137393	ENST00000429054;ENST00000259939	T;T	0.62232	0.04;0.04	5.12	3.96	0.45880	Zinc finger, C6HC-type (2);	0.251403	0.47852	D	0.000202	T	0.20495	0.0493	N	0.17474	0.49	0.30458	N	0.774584	B	0.06786	0.001	B	0.09377	0.004	T	0.05146	-1.0903	9	.	.	.	.	5.9314	0.19140	0.7754:0.0:0.0776:0.1469	.	149	Q7Z419	R144B_HUMAN	R	60;149	ENSP00000411270:H60R;ENSP00000259939:H149R	.	H	+	2	0	RNF144B	18565479	0.003000	0.15002	1.000000	0.80357	0.999000	0.98932	0.796000	0.26986	2.048000	0.60808	0.496000	0.49642	CAC		0.552	RNF144B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039965.2	XM_172581		25	290	0	0	0	0.030593	0	25	290				
TRIM10	10107	broad.mit.edu	37	6	30128630	30128630	+	Silent	SNP	G	G	T			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr6:30128630G>T	ENST00000449742.2	-	1	81	c.6C>A	c.(4-6)gcC>gcA	p.A2A	TRIM15_ENST00000376694.4_5'Flank|TRIM15_ENST00000376688.1_5'Flank|TRIM10_ENST00000376704.3_Silent_p.A2A	NM_006778.3	NP_006769.2	Q9UDY6	TRI10_HUMAN	tripartite motif containing 10	2					erythrocyte differentiation (GO:0030218)|innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)	p.A2A(1)		ovary(1)	1						AGGCAGCAGAGGCCATGCTGG	0.602																																							uc003npo.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(4-6)GCC>GCA		tripartite motif-containing 10 isoform 1							24.0	24.0	24.0					6																	30128630		2203	4300	6503	SO:0001819	synonymous_variant	10107					cytoplasm	zinc ion binding	g.chr6:30128630G>T	Y07829	CCDS4676.1, CCDS34375.1	6p21.3	2013-01-09	2011-01-25	2001-11-23	ENSG00000204613	ENSG00000204613		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10072	protein-coding gene	gene with protein product		605701	"""tripartite motif-containing 10"""	RNF9		9271628, 10207104	Standard	NM_052828		Approved	RFB30, HERF1	uc003npo.3	Q9UDY6	OTTHUMG00000031295	ENST00000449742.2:c.6C>A	6.37:g.30128630G>T						TRIM10_uc003npn.2_Silent_p.A2A|TRIM15_uc010jrx.2_5'Flank	p.A2A	NM_006778	NP_006769	Q9UDY6	TRI10_HUMAN			1	82	-			2					A6NF84|Q5SRJ5|Q5SRK8|Q86Z08|Q96QB6|Q9C023|Q9C024	Silent	SNP	ENST00000449742.2	37	c.6C>A	CCDS34375.1																																																																																				0.602	TRIM10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076634.1			5	21	1	0	1.024e-07	0.014758	1.27535e-07	5	21				
PTCHD4	442213	broad.mit.edu	37	6	47846983	47846983	+	Missense_Mutation	SNP	T	T	G			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr6:47846983T>G	ENST00000339488.4	-	3	1630	c.1597A>C	c.(1597-1599)Agc>Cgc	p.S533R		NM_001013732.3	NP_001013754.3	Q6ZW05	PTHD4_HUMAN	patched domain containing 4	533						integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)	p.S533C(1)|p.S533R(1)									TCCTGGACGCTGCTGTTCCAG	0.488																																							uc011dwm.1		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)	central_nervous_system(1)	1						c.(1546-1548)AGC>CGC		hypothetical protein LOC442213							54.0	48.0	50.0					6																	47846983		2203	4300	6503	SO:0001583	missense	442213					integral to membrane	hedgehog receptor activity	g.chr6:47846983T>G		CCDS34473.2	6p12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000244694	ENSG00000244694			21345	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 138"""	C6orf138			Standard	NM_001013732		Approved	dJ402H5.2, FLJ41841	uc011dwm.2	Q6ZW05	OTTHUMG00000150404	ENST00000339488.4:c.1597A>C	6.37:g.47846983T>G	ENSP00000341914:p.Ser533Arg					C6orf138_uc011dwn.1_Missense_Mutation_p.S280R	p.S516R	NM_001013732	NP_001013754	Q6ZW05	CF138_HUMAN			3	1631	-			533					B0QZ29|B4DRK3|Q5T884	Missense_Mutation	SNP	ENST00000339488.4	37	c.1546A>C	CCDS34473.2	.	.	.	.	.	.	.	.	.	.	T	13.49	2.253917	0.39896	.	.	ENSG00000244694	ENST00000339488	D	0.85702	-2.02	5.48	4.32	0.51571	.	0.097108	0.64402	D	0.000001	T	0.68732	0.3033	L	0.27053	0.805	0.80722	D	1	B	0.19706	0.038	B	0.34346	0.18	T	0.65849	-0.6068	10	0.41790	T	0.15	.	11.1172	0.48266	0.0:0.0724:0.0:0.9276	.	533	Q6ZW05	CF138_HUMAN	R	533	ENSP00000341914:S533R	ENSP00000341914:S533R	S	-	1	0	C6orf138	47954942	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.698000	0.84413	0.933000	0.37291	0.528000	0.53228	AGC		0.488	PTCHD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317987.2	NM_001013732		3	26	0	0	0	0.009096	0	3	26				
TTK	7272	broad.mit.edu	37	6	80746194	80746194	+	Missense_Mutation	SNP	A	A	C			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr6:80746194A>C	ENST00000369798.2	+	17	2038	c.1927A>C	c.(1927-1929)Att>Ctt	p.I643L	TTK_ENST00000230510.3_Missense_Mutation_p.I642L|TTK_ENST00000509894.1_Missense_Mutation_p.I642L	NM_001166691.1|NM_003318.4	NP_001160163.1|NP_003309.2	P33981	TTK_HUMAN	TTK protein kinase	643	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				chromosome separation (GO:0051304)|mitotic spindle assembly checkpoint (GO:0007094)|mitotic spindle organization (GO:0007052)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|spindle organization (GO:0007051)	membrane (GO:0016020)|spindle (GO:0005819)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)	p.I643L(1)|p.I627L(1)		endometrium(4)|kidney(2)|large_intestine(12)|lung(22)|ovary(7)|pancreas(1)|prostate(1)|stomach(3)|urinary_tract(1)	53		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)		BRCA - Breast invasive adenocarcinoma(397;0.0321)		TTTTAAAGGCATTGTTCACAG	0.328																																							uc003pjc.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|stomach(2)|lung(2)|large_intestine(2)|pancreas(1)	11						c.(1927-1929)ATT>CTT		TTK protein kinase							145.0	142.0	143.0					6																	80746194		2202	4299	6501	SO:0001583	missense	7272				mitotic cell cycle spindle assembly checkpoint|mitotic spindle organization|positive regulation of cell proliferation|positive regulation of pathway-restricted SMAD protein phosphorylation	spindle	ATP binding|identical protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr6:80746194A>C		CCDS4993.1, CCDS55040.1	6q14.1	2014-04-07			ENSG00000112742	ENSG00000112742			12401	protein-coding gene	gene with protein product	"""cancer/testis antigen 96"", ""monopolar spindle 1 kinase"""	604092				1639825	Standard	NM_003318		Approved	MPS1, MPS1L1, CT96, MPH1	uc003pjc.3	P33981	OTTHUMG00000015088	ENST00000369798.2:c.1927A>C	6.37:g.80746194A>C	ENSP00000358813:p.Ile643Leu					TTK_uc003pjb.3_Missense_Mutation_p.I642L	p.I643L	NM_003318	NP_003309	P33981	TTK_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.0321)	17	2001	+		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)	643			Protein kinase.		A8K8U5|B2RDW2|E1P543|Q15272|Q5TCS0|Q9BW51|Q9NTM0	Missense_Mutation	SNP	ENST00000369798.2	37	c.1927A>C	CCDS4993.1	.	.	.	.	.	.	.	.	.	.	A	27.6	4.847545	0.91277	.	.	ENSG00000112742	ENST00000509894;ENST00000230510;ENST00000369798	T;T;T	0.72167	-0.63;-0.63;-0.63	6.08	6.08	0.98989	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.043517	0.85682	N	0.000000	T	0.79616	0.4476	M	0.66939	2.045	0.80722	D	1	D;D	0.59357	0.96;0.985	D;D	0.74674	0.981;0.984	T	0.82226	-0.0562	10	0.87932	D	0	-22.4905	15.8323	0.78764	1.0:0.0:0.0:0.0	.	643;642	P33981;A8K8U5	TTK_HUMAN;.	L	642;642;643	ENSP00000422936:I642L;ENSP00000230510:I642L;ENSP00000358813:I643L	ENSP00000230510:I642L	I	+	1	0	TTK	80802913	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.962000	0.93254	2.333000	0.79357	0.482000	0.46254	ATT		0.328	TTK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041316.2			12	79	0	0	0	0.013537	0	12	79				
TMEM244	253582	broad.mit.edu	37	6	130164711	130164711	+	Missense_Mutation	SNP	T	T	G			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr6:130164711T>G	ENST00000368143.1	-	3	239	c.157A>C	c.(157-159)Aaa>Caa	p.K53Q	TMEM244_ENST00000438392.1_Missense_Mutation_p.K53Q	NM_001010876.1	NP_001010876.1	Q5VVB8	TM244_HUMAN	transmembrane protein 244	53						integral component of membrane (GO:0016021)		p.K53Q(1)									GGATTTGTTTTGAAATCAAAT	0.323																																							uc003qbs.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(157-159)AAA>CAA		hypothetical protein LOC253582							94.0	103.0	100.0					6																	130164711		2203	4300	6503	SO:0001583	missense	253582					integral to membrane		g.chr6:130164711T>G		CCDS34536.1	6q22.33	2012-02-21	2012-02-21	2012-02-21	ENSG00000203756	ENSG00000203756			21571	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 191"""	C6orf191			Standard	NM_001010876		Approved	bA174C7.4	uc003qbs.3	Q5VVB8	OTTHUMG00000015553	ENST00000368143.1:c.157A>C	6.37:g.130164711T>G	ENSP00000357125:p.Lys53Gln						p.K53Q	NM_001010876	NP_001010876	Q5VVB8	CF191_HUMAN		GBM - Glioblastoma multiforme(226;0.0387)|all cancers(137;0.115)|OV - Ovarian serous cystadenocarcinoma(155;0.131)	3	240	-			53						Missense_Mutation	SNP	ENST00000368143.1	37	c.157A>C	CCDS34536.1	.	.	.	.	.	.	.	.	.	.	T	15.85	2.955062	0.53293	.	.	ENSG00000203756	ENST00000368143;ENST00000438392	T;T	0.38240	1.15;1.15	5.01	5.01	0.66863	.	0.062526	0.64402	D	0.000007	T	0.25827	0.0629	L	0.55481	1.735	0.27870	N	0.940079	P	0.44429	0.835	P	0.44990	0.466	T	0.07481	-1.0770	10	0.54805	T	0.06	-18.7606	13.6881	0.62529	0.0:0.0:0.0:1.0	.	53	Q5VVB8	CF191_HUMAN	Q	53	ENSP00000357125:K53Q;ENSP00000403755:K53Q	ENSP00000357125:K53Q	K	-	1	0	C6orf191	130206404	1.000000	0.71417	1.000000	0.80357	0.335000	0.28730	3.108000	0.50337	1.898000	0.54952	0.477000	0.44152	AAA		0.323	TMEM244-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042194.1	NM_001010876		4	119	0	0	0	0.014758	0	4	119				
KDELR2	11014	broad.mit.edu	37	7	6505922	6505922	+	Silent	SNP	G	G	A			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr7:6505922G>A	ENST00000258739.4	-	4	568	c.384C>T	c.(382-384)tcC>tcT	p.S128S	KDELR2_ENST00000490996.1_Intron|DAGLB_ENST00000436575.1_Intron|KDELR2_ENST00000463747.1_Intron	NM_006854.3	NP_006845.1	P33947	ERD22_HUMAN	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2	128					intracellular protein transport (GO:0006886)|protein retention in ER lumen (GO:0006621)|vesicle-mediated transport (GO:0016192)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	KDEL sequence binding (GO:0005046)	p.S128S(1)		central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(5)|ovary(1)	10		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)		GGATAGCCACGGACTCCAGGT	0.542																																							uc003sqe.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(382-384)TCC>TCT		KDEL receptor 2 isoform 1							91.0	81.0	85.0					7																	6505922		2203	4300	6503	SO:0001819	synonymous_variant	11014				intracellular protein transport|protein retention in ER lumen|vesicle-mediated transport	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane	KDEL sequence binding|protein binding|receptor activity	g.chr7:6505922G>A	X63745	CCDS5351.1, CCDS43550.1	7p	2008-05-02			ENSG00000136240	ENSG00000136240			6305	protein-coding gene	gene with protein product		609024				1316805, 1325562	Standard	NM_006854		Approved	ELP-1, ERD2.2	uc003sqe.4	P33947	OTTHUMG00000023103	ENST00000258739.4:c.384C>T	7.37:g.6505922G>A						DAGLB_uc003sqd.3_Intron|KDELR2_uc003sqf.3_Intron	p.S128S	NM_006854	NP_006845	P33947	ERD22_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)	4	545	-		Ovarian(82;0.0776)	128			Helical; (Potential).		A4D2P4|Q6IPC5|Q96E30	Silent	SNP	ENST00000258739.4	37	c.384C>T	CCDS5351.1																																																																																				0.542	KDELR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059424.2			9	58	0	0	0	0.008291	0	9	58				
TWISTNB	221830	broad.mit.edu	37	7	19738091	19738091	+	Missense_Mutation	SNP	C	C	A			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr7:19738091C>A	ENST00000222567.5	-	4	935	c.865G>T	c.(865-867)Gac>Tac	p.D289Y		NM_001002926.1	NP_001002926.1	Q3B726	RPA43_HUMAN	TWIST neighbor	289	Lys-rich.				transcription from RNA polymerase I promoter (GO:0006360)	DNA-directed RNA polymerase I complex (GO:0005736)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA-directed RNA polymerase activity (GO:0003899)			kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(2)	20						GGGTCCTGGTCCTGAACTTCC	0.428																																							uc003sup.1		NA																	0				ovary(1)	1						c.(865-867)GAC>TAC		TWIST neighbor							204.0	226.0	218.0					7																	19738091		2203	4299	6502	SO:0001583	missense	221830					microtubule cytoskeleton|nucleolus	DNA-directed RNA polymerase activity	g.chr7:19738091C>A	AK090846	CCDS34606.1	7p21.1	2010-08-05			ENSG00000105849	ENSG00000105849			18027	protein-coding gene	gene with protein product		608312				12438708	Standard	NM_001002926		Approved		uc003sup.1	Q3B726	OTTHUMG00000152497	ENST00000222567.5:c.865G>T	7.37:g.19738091C>A	ENSP00000222567:p.Asp289Tyr						p.D289Y	NM_001002926	NP_001002926	Q3B726	RPA43_HUMAN			4	886	-			289			Lys-rich.		A0PJ45|B7Z724	Missense_Mutation	SNP	ENST00000222567.5	37	c.865G>T	CCDS34606.1	.	.	.	.	.	.	.	.	.	.	C	11.60	1.686738	0.29962	.	.	ENSG00000105849	ENST00000222567	.	.	.	4.83	3.03	0.35002	.	0.490864	0.25205	N	0.032358	T	0.37210	0.0995	L	0.54323	1.7	0.27175	N	0.960812	B	0.32425	0.371	B	0.33750	0.169	T	0.31166	-0.9953	9	0.62326	D	0.03	-7.6506	8.8372	0.35119	0.0:0.8246:0.0:0.1754	.	289	Q3B726	RPA43_HUMAN	Y	289	.	ENSP00000222567:D289Y	D	-	1	0	TWISTNB	19704616	0.150000	0.22732	0.371000	0.25978	0.590000	0.36582	1.107000	0.31110	0.464000	0.27142	-0.439000	0.05793	GAC		0.428	TWISTNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326463.1			30	346	1	0	1.99505e-19	0.012213	2.67963e-19	30	346				
STK31	56164	broad.mit.edu	37	7	23793962	23793962	+	Nonsense_Mutation	SNP	A	A	T			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr7:23793962A>T	ENST00000355870.3	+	10	1281	c.1162A>T	c.(1162-1164)Aaa>Taa	p.K388*	STK31_ENST00000433467.2_Nonsense_Mutation_p.K388*|STK31_ENST00000354639.3_Nonsense_Mutation_p.K365*|STK31_ENST00000405627.3_3'UTR|STK31_ENST00000428484.1_Nonsense_Mutation_p.K365*	NM_031414.4	NP_113602.2	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31	388						acrosomal vesicle (GO:0001669)	ATP binding (GO:0005524)|hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|protein serine/threonine kinase activity (GO:0004674)	p.K388*(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(31)|ovary(2)|prostate(1)|skin(7)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						CCGTTTCGGAAAAGACCTTTC	0.368																																							uc003sws.3		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(3)|lung(2)|ovary(2)|stomach(2)	9						c.(1162-1164)AAA>TAA		serine/threonine kinase 31 isoform a							140.0	134.0	136.0					7																	23793962		2203	4300	6503	SO:0001587	stop_gained	56164						ATP binding|nucleic acid binding|protein serine/threonine kinase activity	g.chr7:23793962A>T	AF285599	CCDS5386.1, CCDS43556.1, CCDS59049.1	7p15.3	2014-04-23			ENSG00000196335	ENSG00000196335		"""Tudor domain containing"""	11407	protein-coding gene	gene with protein product		605790				11279525	Standard	NM_031414		Approved	TDRD8, SgK396	uc003sws.5	Q9BXU1	OTTHUMG00000023053	ENST00000355870.3:c.1162A>T	7.37:g.23793962A>T	ENSP00000348132:p.Lys388*					STK31_uc003swt.3_Nonsense_Mutation_p.K365*|STK31_uc011jze.1_Nonsense_Mutation_p.K388*|STK31_uc010kuq.2_Nonsense_Mutation_p.K365*	p.K388*	NM_031414	NP_113602	Q9BXU1	STK31_HUMAN			10	1229	+			388					B4DZ06|B7WPP5|C9J4F9|Q6PCD3|Q9BXH8	Nonsense_Mutation	SNP	ENST00000355870.3	37	c.1162A>T	CCDS5386.1	.	.	.	.	.	.	.	.	.	.	A	38	7.084930	0.98051	.	.	ENSG00000196335	ENST00000355870;ENST00000433467;ENST00000354639;ENST00000428484	.	.	.	5.96	3.82	0.43975	.	0.376325	0.28748	N	0.014272	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	-7.5137	5.2191	0.15358	0.4277:0.0:0.5723:0.0	.	.	.	.	X	388;388;365;365	.	ENSP00000346660:K365X	K	+	1	0	STK31	23760487	1.000000	0.71417	1.000000	0.80357	0.670000	0.39368	2.061000	0.41403	0.507000	0.28148	0.477000	0.44152	AAA		0.368	STK31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214036.2	NM_031414		8	123	0	0	0	0.038147	0	8	123				
STK31	56164	broad.mit.edu	37	7	23794038	23794038	+	Missense_Mutation	SNP	T	T	G			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr7:23794038T>G	ENST00000355870.3	+	10	1357	c.1238T>G	c.(1237-1239)aTa>aGa	p.I413R	STK31_ENST00000433467.2_Missense_Mutation_p.I413R|STK31_ENST00000354639.3_Missense_Mutation_p.I390R|STK31_ENST00000405627.3_3'UTR|STK31_ENST00000428484.1_Missense_Mutation_p.I390R	NM_031414.4	NP_113602.2	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31	413						acrosomal vesicle (GO:0001669)	ATP binding (GO:0005524)|hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|protein serine/threonine kinase activity (GO:0004674)	p.I413R(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(31)|ovary(2)|prostate(1)|skin(7)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						GGATTAGAGATAATATGGGCA	0.388																																							uc003sws.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|lung(2)|ovary(2)|stomach(2)	9						c.(1237-1239)ATA>AGA		serine/threonine kinase 31 isoform a							167.0	169.0	168.0					7																	23794038		2203	4300	6503	SO:0001583	missense	56164						ATP binding|nucleic acid binding|protein serine/threonine kinase activity	g.chr7:23794038T>G	AF285599	CCDS5386.1, CCDS43556.1, CCDS59049.1	7p15.3	2014-04-23			ENSG00000196335	ENSG00000196335		"""Tudor domain containing"""	11407	protein-coding gene	gene with protein product		605790				11279525	Standard	NM_031414		Approved	TDRD8, SgK396	uc003sws.5	Q9BXU1	OTTHUMG00000023053	ENST00000355870.3:c.1238T>G	7.37:g.23794038T>G	ENSP00000348132:p.Ile413Arg					STK31_uc003swt.3_Missense_Mutation_p.I390R|STK31_uc011jze.1_Missense_Mutation_p.I413R|STK31_uc010kuq.2_Missense_Mutation_p.I390R	p.I413R	NM_031414	NP_113602	Q9BXU1	STK31_HUMAN			10	1305	+			413					B4DZ06|B7WPP5|C9J4F9|Q6PCD3|Q9BXH8	Missense_Mutation	SNP	ENST00000355870.3	37	c.1238T>G	CCDS5386.1	.	.	.	.	.	.	.	.	.	.	T	3.755	-0.050756	0.07407	.	.	ENSG00000196335	ENST00000355870;ENST00000433467;ENST00000354639;ENST00000428484	T;T;T;T	0.14144	2.53;2.53;2.53;2.53	5.76	-4.61	0.03380	.	0.858134	0.10489	N	0.668667	T	0.05090	0.0136	N	0.12182	0.205	0.28143	N	0.929704	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.46911	-0.9157	10	0.07813	T	0.8	0.0201	7.3227	0.26536	0.639:0.0:0.1934:0.1676	.	413;413	B4DZ06;Q9BXU1	.;STK31_HUMAN	R	413;413;390;390	ENSP00000348132:I413R;ENSP00000411852:I413R;ENSP00000346660:I390R;ENSP00000406146:I390R	ENSP00000346660:I390R	I	+	2	0	STK31	23760563	0.992000	0.36948	0.970000	0.41538	0.632000	0.37999	0.121000	0.15667	-0.452000	0.07087	-1.563000	0.00883	ATA		0.388	STK31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214036.2	NM_031414		5	155	0	0	0	0.021553	0	5	155				
CHCHD2	51142	broad.mit.edu	37	7	56172005	56172005	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr7:56172005C>T	ENST00000395422.3	-	2	376	c.214G>A	c.(214-216)Gtg>Atg	p.V72M		NM_016139.2	NP_057223.1	Q9Y6H1	CHCH2_HUMAN	coiled-coil-helix-coiled-coil-helix domain containing 2	72						mitochondrion (GO:0005739)		p.V72M(1)		endometrium(1)|large_intestine(1)|lung(3)	5	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			GTGTGCCCCACAGCAGAGCCC	0.612																																							uc003tsa.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(214-216)GTG>ATG		coiled-coil-helix-coiled-coil-helix domain							40.0	39.0	40.0					7																	56172005		2203	4300	6503	SO:0001583	missense	51142					mitochondrion		g.chr7:56172005C>T	AF078845	CCDS5526.1	7p11.2	2014-07-14	2004-01-19	2004-01-21	ENSG00000106153	ENSG00000106153		"""Coiled-coil-helix-coiled-coil-helix domain containing"""	21645	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 17"""	C7orf17		23303788	Standard	NM_016139		Approved		uc003tsa.3	Q9Y6H1	OTTHUMG00000129429	ENST00000395422.3:c.214G>A	7.37:g.56172005C>T	ENSP00000378812:p.Val72Met					PSPH_uc003trj.2_Intron	p.V72M	NM_016139	NP_057223	Q9Y6H1	CHCH2_HUMAN	Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)		2	295	-	Breast(14;0.214)		72					Q498C3|Q6NZ50	Missense_Mutation	SNP	ENST00000395422.3	37	c.214G>A	CCDS5526.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.834580	0.91036	.	.	ENSG00000106153	ENST00000395422	T	0.58797	0.31	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.77212	0.4097	M	0.86420	2.815	0.80722	D	1	D	0.57571	0.98	P	0.57911	0.829	T	0.81004	-0.1129	10	0.66056	D	0.02	.	18.6097	0.91279	0.0:1.0:0.0:0.0	.	72	Q9Y6H1	CHCH2_HUMAN	M	72	ENSP00000378812:V72M	ENSP00000378812:V72M	V	-	1	0	CHCHD2	56139499	1.000000	0.71417	0.266000	0.24541	0.969000	0.65631	5.934000	0.70138	2.651000	0.90000	0.650000	0.86243	GTG		0.612	CHCHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251589.1	NM_016139		5	39	0	0	0	0.014758	0	5	39				
TRIM50	135892	broad.mit.edu	37	7	72732960	72732960	+	Missense_Mutation	SNP	C	C	A	rs373729184		TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr7:72732960C>A	ENST00000333149.2	-	4	787	c.587G>T	c.(586-588)gGg>gTg	p.G196V	TRIM50_ENST00000453152.1_Missense_Mutation_p.G196V|TRIM50_ENST00000493498.1_5'Flank	NM_178125.2	NP_835226.2	Q86XT4	TRI50_HUMAN	tripartite motif containing 50	196						cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.G196V(2)		endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|ovary(1)|skin(2)	20						ACCCCCTATCCCCTCCAGGCA	0.667																																							uc010lbd.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(586-588)GGG>GTG		tripartite motif protein 50A							65.0	68.0	67.0					7																	72732960		2203	4300	6503	SO:0001583	missense	135892					cytoplasm|intracellular membrane-bounded organelle	ligase activity|zinc ion binding	g.chr7:72732960C>A	AY081948	CCDS34654.1	7q11.23	2013-01-09	2011-01-25	2006-03-31	ENSG00000146755	ENSG00000146755		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19017	protein-coding gene	gene with protein product		612548	"""tripartite motif-containing 50A"", ""tripartite motif-containing 50"""	TRIM50A			Standard	NM_001281450		Approved	FLJ32804	uc003txy.1	Q86XT4	OTTHUMG00000156805	ENST00000333149.2:c.587G>T	7.37:g.72732960C>A	ENSP00000327994:p.Gly196Val					FKBP6_uc003twz.2_Intron|TRIM50_uc003txy.1_Missense_Mutation_p.G196V|TRIM50_uc003txz.1_Missense_Mutation_p.G196V	p.G196V	NM_178125	NP_835226	Q86XT4	TRI50_HUMAN			4	712	-			196					Q86XT3	Missense_Mutation	SNP	ENST00000333149.2	37	c.587G>T	CCDS34654.1	.	.	.	.	.	.	.	.	.	.	C	15.40	2.822970	0.50739	.	.	ENSG00000146755	ENST00000333149;ENST00000453152	T;T	0.63255	-0.03;-0.03	4.36	4.36	0.52297	.	0.576258	0.15819	N	0.243104	T	0.64832	0.2634	N	0.24115	0.695	0.47009	D	0.999281	D;D	0.76494	0.999;0.998	D;P	0.65987	0.94;0.873	T	0.65038	-0.6265	10	0.51188	T	0.08	.	12.0702	0.53611	0.0:0.8263:0.1737:0.0	.	196;196	Q86XT4-2;Q86XT4	.;TRI50_HUMAN	V	196	ENSP00000327994:G196V;ENSP00000413875:G196V	ENSP00000327994:G196V	G	-	2	0	TRIM50	72370896	0.129000	0.22400	0.709000	0.30452	0.830000	0.47004	1.432000	0.34936	2.253000	0.74438	0.461000	0.40582	GGG		0.667	TRIM50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345925.1	NM_178125		8	104	1	0	0.000274275	0.004482	0.000300606	8	104				
ABCB4	5244	broad.mit.edu	37	7	87080995	87080995	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr7:87080995G>A	ENST00000265723.4	-	7	763	c.652C>T	c.(652-654)Ctt>Ttt	p.L218F	ABCB4_ENST00000545634.1_Missense_Mutation_p.L218F|ABCB4_ENST00000358400.3_Missense_Mutation_p.L218F|ABCB4_ENST00000359206.3_Missense_Mutation_p.L218F|ABCB4_ENST00000453593.1_Missense_Mutation_p.L218F	NM_000443.3|NM_018849.2	NP_000434.1|NP_061337.1	P21439	MDR3_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 4	218	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular lipid metabolic process (GO:0044255)|lipid metabolic process (GO:0006629)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|xenobiotic-transporting ATPase activity (GO:0008559)	p.L218F(1)		breast(5)|endometrium(7)|kidney(2)|large_intestine(15)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				Colchicine(DB01394)|Etravirine(DB06414)|Silodosin(DB06207)	ATTATCACAAGGGTGAGCTTC	0.468																																							uc003uiv.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(1)|pancreas(1)	6						c.(652-654)CTT>TTT		ATP-binding cassette, subfamily B, member 4							163.0	137.0	146.0					7																	87080995		2203	4300	6503	SO:0001583	missense	5244				cellular lipid metabolic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|xenobiotic-transporting ATPase activity	g.chr7:87080995G>A	M23234	CCDS5605.1, CCDS5606.1, CCDS5607.1	7q21	2012-03-14			ENSG00000005471	ENSG00000005471		"""ATP binding cassette transporters / subfamily B"""	45	protein-coding gene	gene with protein product		171060		PGY3, MDR3		2892668, 11313316	Standard	NM_018850		Approved	MDR2, PFIC-3, GBD1	uc003uiv.1	P21439	OTTHUMG00000023396	ENST00000265723.4:c.652C>T	7.37:g.87080995G>A	ENSP00000265723:p.Leu218Phe					ABCB4_uc003uiw.1_Missense_Mutation_p.L218F|ABCB4_uc003uix.1_Missense_Mutation_p.L218F	p.L218F	NM_018849	NP_061337	P21439	MDR3_HUMAN			7	728	-	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)		218			Helical; (By similarity).|ABC transmembrane type-1 1.		A0A2V7|A4D1D3|A4D1D4|A4D1D5|D6W5P3|D6W5P4|Q14813	Missense_Mutation	SNP	ENST00000265723.4	37	c.652C>T	CCDS5606.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.832742	0.91036	.	.	ENSG00000005471	ENST00000359206;ENST00000358400;ENST00000265723;ENST00000453593;ENST00000545634	D;D;D;D;D	0.94232	-3.38;-3.38;-3.38;-3.38;-3.38	5.95	5.95	0.96441	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.97876	0.9302	H	0.95004	3.61	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.77004	0.986;0.969;0.989	D	0.98204	1.0469	10	0.87932	D	0	-18.5819	20.3967	0.98985	0.0:0.0:1.0:0.0	.	218;218;218	A4D1D5;P21439-2;P21439	.;.;MDR3_HUMAN	F	218	ENSP00000352135:L218F;ENSP00000351172:L218F;ENSP00000265723:L218F;ENSP00000392983:L218F;ENSP00000437465:L218F	ENSP00000265723:L218F	L	-	1	0	ABCB4	86918931	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.788000	0.62439	2.829000	0.97493	0.655000	0.94253	CTT		0.468	ABCB4-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000336083.1	NM_000443		7	68	0	0	0	0.038147	0	7	68				
MUC17	140453	broad.mit.edu	37	7	100679976	100679976	+	Missense_Mutation	SNP	C	C	A	rs201025282		TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr7:100679976C>A	ENST00000306151.4	+	3	5343	c.5279C>A	c.(5278-5280)cCg>cAg	p.P1760Q		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1760	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.P1760Q(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					AGCACCACGCCGGTACTCAGT	0.507																																							uc003uxp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(5278-5280)CCG>CAG		mucin 17 precursor							287.0	300.0	296.0					7																	100679976		2203	4300	6503	SO:0001583	missense	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100679976C>A	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.5279C>A	7.37:g.100679976C>A	ENSP00000302716:p.Pro1760Gln					MUC17_uc010lho.1_RNA	p.P1760Q	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN			3	5332	+	Lung NSC(181;0.136)|all_lung(186;0.182)		1760			Extracellular (Potential).|59 X approximate tandem repeats.|27.|Ser-rich.		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	c.5279C>A	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	C	0.293	-0.978940	0.02197	.	.	ENSG00000169876	ENST00000306151	T	0.02158	4.42	0.0465	0.0465	0.14256	.	.	.	.	.	T	0.02193	0.0068	N	0.24115	0.695	0.09310	N	1	D	0.60160	0.987	P	0.48840	0.592	T	0.50566	-0.8813	8	0.18276	T	0.48	.	.	.	.	.	1760	Q685J3	MUC17_HUMAN	Q	1760	ENSP00000302716:P1760Q	ENSP00000302716:P1760Q	P	+	2	0	MUC17	100466696	0.016000	0.18221	0.001000	0.08648	0.002000	0.02628	2.151000	0.42263	0.132000	0.18615	0.134000	0.15878	CCG		0.507	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		22	316	1	0	9.04412e-07	0.024334	1.0965e-06	22	316				
MUC17	140453	broad.mit.edu	37	7	100685846	100685846	+	Missense_Mutation	SNP	C	C	T	rs376881918		TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr7:100685846C>T	ENST00000306151.4	+	3	11213	c.11149C>T	c.(11149-11151)Cct>Tct	p.P3717S		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3717	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.P3717S(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CCTTTCAACACCTTCTGTTGT	0.507																																							uc003uxp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(11149-11151)CCT>TCT		mucin 17 precursor		A	SER/PRO	0,4406		0,0,2203	226.0	205.0	212.0		11149	-4.2	0.0	7		212	1,8599		0,1,4299	no	missense	MUC17	NM_001040105.1	74	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	3717/4494	100685846	1,13005	2203	4300	6503	SO:0001583	missense	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100685846C>T	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.11149C>T	7.37:g.100685846C>T	ENSP00000302716:p.Pro3717Ser					MUC17_uc010lho.1_RNA	p.P3717S	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN			3	11202	+	Lung NSC(181;0.136)|all_lung(186;0.182)		3717			Extracellular (Potential).|59.|59 X approximate tandem repeats.|Ser-rich.		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	c.11149C>T	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	c	1.521	-0.546832	0.04024	0.0	1.16E-4	ENSG00000169876	ENST00000306151	T	0.01745	4.66	2.12	-4.24	0.03777	.	.	.	.	.	T	0.01353	0.0044	N	0.14661	0.345	0.09310	N	1	P	0.46220	0.874	P	0.52066	0.689	T	0.16100	-1.0414	9	0.07175	T	0.84	.	0.5855	0.00719	0.3444:0.2714:0.1179:0.2663	.	3717	Q685J3	MUC17_HUMAN	S	3717	ENSP00000302716:P3717S	ENSP00000302716:P3717S	P	+	1	0	MUC17	100472566	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-6.055000	0.00083	-2.677000	0.00410	-1.467000	0.01014	CCT		0.507	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		11	170	0	0	0	0.016723	0	11	170				
GPR22	2845	broad.mit.edu	37	7	107115089	107115089	+	Missense_Mutation	SNP	T	T	A			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr7:107115089T>A	ENST00000304402.4	+	3	1927	c.584T>A	c.(583-585)cTt>cAt	p.L195H	COG5_ENST00000475638.2_Intron|COG5_ENST00000297135.3_Intron|COG5_ENST00000393603.2_Intron|COG5_ENST00000347053.3_Intron	NM_005295.2	NP_005286.2	Q99680	GPR22_HUMAN	G protein-coupled receptor 22	195					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)	p.L195H(1)		large_intestine(3)|lung(6)|ovary(2)|stomach(1)	12						AACAAGACACTTTTATGTGTC	0.313																																							uc003vef.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(583-585)CTT>CAT		G protein-coupled receptor 22							38.0	40.0	39.0					7																	107115089		2203	4296	6499	SO:0001583	missense	2845					integral to plasma membrane	G-protein coupled receptor activity	g.chr7:107115089T>A	U66581	CCDS5744.1	7q22-q31.1	2012-08-21			ENSG00000172209	ENSG00000172209		"""GPCR / Class A : Orphans"""	4477	protein-coding gene	gene with protein product		601910				9073069	Standard	NM_005295		Approved		uc003vef.3	Q99680	OTTHUMG00000154902	ENST00000304402.4:c.584T>A	7.37:g.107115089T>A	ENSP00000302676:p.Leu195His					COG5_uc003vec.2_Intron|COG5_uc003ved.2_Intron|COG5_uc003vee.2_Intron	p.L195H	NM_005295	NP_005286	Q99680	GPR22_HUMAN			3	1930	+			195			Extracellular (Potential).		O14554	Missense_Mutation	SNP	ENST00000304402.4	37	c.584T>A	CCDS5744.1	.	.	.	.	.	.	.	.	.	.	T	9.614	1.132033	0.21041	.	.	ENSG00000172209	ENST00000304402	T	0.71934	-0.61	5.5	5.5	0.81552	GPCR, rhodopsin-like superfamily (1);	0.192191	0.45126	D	0.000393	T	0.64843	0.2635	L	0.34521	1.04	0.47994	D	0.999564	P	0.44309	0.832	P	0.45971	0.499	T	0.60777	-0.7196	10	0.14656	T	0.56	-9.9425	15.9017	0.79384	0.0:0.0:0.0:1.0	.	195	Q99680	GPR22_HUMAN	H	195	ENSP00000302676:L195H	ENSP00000302676:L195H	L	+	2	0	GPR22	106902325	0.882000	0.30256	0.997000	0.53966	0.998000	0.95712	2.471000	0.45127	2.213000	0.71641	0.528000	0.53228	CTT		0.313	GPR22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337598.1			3	52	0	0	0	0.004672	0	3	52				
CPED1	79974	broad.mit.edu	37	7	120704319	120704319	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr7:120704319C>G	ENST00000310396.5	+	5	1035	c.568C>G	c.(568-570)Cca>Gca	p.P190A	CPED1_ENST00000450913.2_Missense_Mutation_p.P190A|CPED1_ENST00000423795.1_5'UTR	NM_024913.4	NP_079189.4	A4D0V7	CPED1_HUMAN	cadherin-like and PC-esterase domain containing 1	190						endoplasmic reticulum (GO:0005783)		p.P190A(1)									AATACAGCAGCCACTTTGCAG	0.393																																							uc003vjq.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|large_intestine(2)|skin(2)|pancreas(1)	9						c.(568-570)CCA>GCA		hypothetical protein LOC79974 isoform 1							105.0	105.0	105.0					7																	120704319		2203	4300	6503	SO:0001583	missense	79974					endoplasmic reticulum		g.chr7:120704319C>G		CCDS34739.1, CCDS47690.1	7q31.31	2012-06-12	2012-06-12	2012-06-12	ENSG00000106034	ENSG00000106034			26159	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 58"""	C7orf58		20056006	Standard	NM_024913		Approved	FLJ21986	uc003vjq.4	A4D0V7	OTTHUMG00000156982	ENST00000310396.5:c.568C>G	7.37:g.120704319C>G	ENSP00000309772:p.Pro190Ala					C7orf58_uc003vjr.1_Missense_Mutation_p.P190A|C7orf58_uc003vjs.3_Missense_Mutation_p.P190A|C7orf58_uc003vjt.3_5'UTR	p.P190A	NM_024913	NP_079189	A4D0V7	CG058_HUMAN			5	1015	+	all_neural(327;0.117)		190					A8K1R3|Q6UXT1|Q86T76|Q86T84|Q8N2T5|Q96NC9	Missense_Mutation	SNP	ENST00000310396.5	37	c.568C>G	CCDS34739.1	.	.	.	.	.	.	.	.	.	.	C	4.167	0.029467	0.08054	.	.	ENSG00000106034	ENST00000310396;ENST00000428526;ENST00000450913	T;T;T	0.42513	0.97;0.97;0.97	5.68	5.68	0.88126	.	1.026730	0.07693	N	0.938984	T	0.28962	0.0719	N	0.08118	0	0.80722	D	1	B;B	0.19200	0.034;0.022	B;B	0.22601	0.04;0.016	T	0.03673	-1.1014	10	0.18710	T	0.47	-13.2645	15.2861	0.73828	0.0:1.0:0.0:0.0	.	190;190	A4D0V7-2;A4D0V7	.;CG058_HUMAN	A	190	ENSP00000309772:P190A;ENSP00000398082:P190A;ENSP00000406122:P190A	ENSP00000309772:P190A	P	+	1	0	C7orf58	120491555	0.964000	0.33143	0.988000	0.46212	0.787000	0.44495	1.798000	0.38814	2.676000	0.91093	0.563000	0.77884	CCA		0.393	CPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346959.1	NM_024913		6	61	0	0	0	0.02938	0	6	61				
STRIP2	57464	broad.mit.edu	37	7	129125534	129125534	+	Missense_Mutation	SNP	T	T	C			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr7:129125534T>C	ENST00000249344.2	+	21	2409	c.2369T>C	c.(2368-2370)gTg>gCg	p.V790A	RNU1-72P_ENST00000362976.1_RNA	NM_020704.2	NP_065755.1	Q9ULQ0	STRP2_HUMAN	striatin interacting protein 2	790					cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)		p.V790A(1)									TTTTCACCTGTGGATAACTGC	0.502																																							uc011koy.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2368-2370)GTG>GCG		hypothetical protein LOC57464 isoform a							105.0	93.0	97.0					7																	129125534		2203	4300	6503	SO:0001583	missense	57464							g.chr7:129125534T>C	AB032996	CCDS34752.1, CCDS47709.1	7q32.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000128578	ENSG00000128578			22209	protein-coding gene	gene with protein product	"""FAR11 factor arrest 11 homolog B (yeast)"""		"""family with sequence similarity 40, member B"""	FAM40B		22782902, 22298706, 18782753	Standard	NM_020704		Approved	KIAA1170, FAR11B	uc011koy.2	Q9ULQ0	OTTHUMG00000157695	ENST00000249344.2:c.2369T>C	7.37:g.129125534T>C	ENSP00000249344:p.Val790Ala					FAM40B_uc011koz.1_Missense_Mutation_p.V282A	p.V790A	NM_020704	NP_065755	Q9ULQ0	FA40B_HUMAN			21	2409	+			790					Q8WUZ4	Missense_Mutation	SNP	ENST00000249344.2	37	c.2369T>C	CCDS34752.1	.	.	.	.	.	.	.	.	.	.	T	27.9	4.876103	0.91664	.	.	ENSG00000128578	ENST00000249344	T	0.51325	0.71	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	T	0.70316	0.3210	M	0.79805	2.47	0.80722	D	1	D	0.63046	0.992	D	0.77004	0.989	T	0.72861	-0.4164	10	0.51188	T	0.08	-26.0658	15.4895	0.75593	0.0:0.0:0.0:1.0	.	790	Q9ULQ0	FA40B_HUMAN	A	790	ENSP00000249344:V790A	ENSP00000249344:V790A	V	+	2	0	FAM40B	128912770	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	7.997000	0.88414	2.250000	0.74265	0.455000	0.32223	GTG		0.502	STRIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349418.1	NM_001134336		14	66	0	0	0	0.020292	0	14	66				
TAS2R60	338398	broad.mit.edu	37	7	143141101	143141101	+	Silent	SNP	C	C	A	rs201185058		TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr7:143141101C>A	ENST00000332690.1	+	1	556	c.556C>A	c.(556-558)Cgg>Agg	p.R186R	EPHA1-AS1_ENST00000429289.1_RNA	NM_177437.1	NP_803186.1	P59551	T2R60_HUMAN	taste receptor, type 2, member 60	186					sensory perception of bitter taste (GO:0050913)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R186R(1)		breast(1)|kidney(1)|large_intestine(2)|lung(17)|prostate(1)|skin(7)|urinary_tract(2)	31	Melanoma(164;0.172)					CGATAGCATACGGAGCTACTG	0.398																																							uc011ktg.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(6)	6						c.(556-558)CGG>AGG		taste receptor, type 2, member 60							166.0	161.0	163.0					7																	143141101		2203	4300	6503	SO:0001819	synonymous_variant	338398				sensory perception of bitter taste	integral to membrane	G-protein coupled receptor activity	g.chr7:143141101C>A	AY114094	CCDS5885.1	7q35	2014-07-10			ENSG00000185899	ENSG00000185899		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	20639	protein-coding gene	gene with protein product		613968				12584440	Standard	NM_177437		Approved	T2R60	uc011ktg.2	P59551	OTTHUMG00000154891	ENST00000332690.1:c.556C>A	7.37:g.143141101C>A						uc003wda.2_Intron	p.R186R	NM_177437	NP_803186	P59551	T2R60_HUMAN			1	556	+	Melanoma(164;0.172)		186			Helical; Name=5; (Potential).		A4D2G8|Q645W8|Q7RTR7	Silent	SNP	ENST00000332690.1	37	c.556C>A	CCDS5885.1																																																																																				0.398	TAS2R60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337541.1			23	145	1	0	3.08376e-08	0.01892	3.94837e-08	23	145				
SYBU	55638	broad.mit.edu	37	8	110631185	110631185	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr8:110631185G>A	ENST00000422135.1	-	4	828	c.313C>T	c.(313-315)Cct>Tct	p.P105S	SYBU_ENST00000446070.2_Missense_Mutation_p.P104S|SYBU_ENST00000533171.1_Missense_Mutation_p.P105S|SYBU_ENST00000433638.1_Missense_Mutation_p.P105S|SYBU_ENST00000528647.1_Missense_Mutation_p.P104S|SYBU_ENST00000533065.1_5'UTR|SYBU_ENST00000276646.9_Missense_Mutation_p.P105S|SYBU_ENST00000408908.2_Missense_Mutation_p.P105S|SYBU_ENST00000532779.1_Missense_Mutation_p.P37S|SYBU_ENST00000424158.2_Missense_Mutation_p.P110S|SYBU_ENST00000440310.1_Missense_Mutation_p.P105S|SYBU_ENST00000533895.1_Missense_Mutation_p.P104S|SYBU_ENST00000408889.3_5'UTR|SYBU_ENST00000419099.1_Missense_Mutation_p.P104S|SYBU_ENST00000399066.3_Missense_Mutation_p.P102S|SYBU_ENST00000528331.1_5'UTR	NM_001099744.1	NP_001093214.1	Q9NX95	SYBU_HUMAN	syntabulin (syntaxin-interacting)	105	Ser-rich.|Sufficient for interaction with KIF5B.				regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)	cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|dense body (GO:0097433)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.P102S(1)		NS(1)|breast(4)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	30						TCACTTCCAGGGCAAAAGCCA	0.483																																							uc003ynj.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(313-315)CCT>TCT		Golgi-localized syntaphilin-related protein							111.0	108.0	109.0					8																	110631185		1895	4135	6030	SO:0001583	missense	55638					cytoplasmic membrane-bounded vesicle|cytoskeleton|Golgi membrane|integral to membrane		g.chr8:110631185G>A	AB040905	CCDS43763.1, CCDS43764.1, CCDS47912.1, CCDS55271.1	8q23.2	2010-08-27				ENSG00000147642			26011	protein-coding gene	gene with protein product	"""syntaphilin-like"""	611568				17611281, 16750881, 16157705, 15656992, 15459722	Standard	NM_001099743		Approved	FLJ20366, GOLSYN, KIAA1472, OCSYN, SNPHL	uc003ynj.4	Q9NX95		ENST00000422135.1:c.313C>T	8.37:g.110631185G>A	ENSP00000407118:p.Pro105Ser					SYBU_uc003yni.3_Missense_Mutation_p.P102S|SYBU_uc003ynk.3_5'UTR|SYBU_uc010mco.2_Missense_Mutation_p.P104S|SYBU_uc003ynl.3_Missense_Mutation_p.P104S|SYBU_uc010mcp.2_Missense_Mutation_p.P105S|SYBU_uc010mcq.2_Missense_Mutation_p.P105S|SYBU_uc003yno.3_5'UTR|SYBU_uc010mcr.2_Missense_Mutation_p.P105S|SYBU_uc003ynm.3_Missense_Mutation_p.P104S|SYBU_uc003ynn.3_Missense_Mutation_p.P104S|SYBU_uc010mcs.2_5'UTR|SYBU_uc010mct.2_Missense_Mutation_p.P105S|SYBU_uc010mcu.2_Missense_Mutation_p.P104S|SYBU_uc003ynp.3_Missense_Mutation_p.P37S|SYBU_uc010mcv.2_Missense_Mutation_p.P105S	p.P105S	NM_001099754	NP_001093224	Q9NX95	SYBU_HUMAN			3	476	-			105			Sufficient for interaction with KIF5B.|Ser-rich.		A8K354|B3KQX3|B3KU61|Q5R1T1|Q5R1T2|Q5R1T3|Q5Y2M6|Q8ND49|Q8TCR6|Q96D80|Q9P256	Missense_Mutation	SNP	ENST00000422135.1	37	c.313C>T	CCDS47912.1	.	.	.	.	.	.	.	.	.	.	G	19.09	3.760813	0.69763	.	.	ENSG00000147642	ENST00000533895;ENST00000424158;ENST00000532779;ENST00000399066;ENST00000446070;ENST00000276646;ENST00000528647;ENST00000422135;ENST00000419099;ENST00000433638;ENST00000408908;ENST00000440310;ENST00000533171;ENST00000529190;ENST00000533821;ENST00000534501;ENST00000524720	.	.	.	5.91	5.01	0.66863	.	0.342028	0.34628	N	0.003817	T	0.51346	0.1669	M	0.65975	2.015	0.80722	D	1	B;B;P;P	0.48294	0.433;0.211;0.908;0.908	B;B;B;B	0.43916	0.172;0.106;0.436;0.436	T	0.51301	-0.8723	9	0.33141	T	0.24	-12.1919	9.4758	0.38871	0.0:0.1274:0.614:0.2586	.	37;104;105;102	Q9NX95-2;Q9NX95-3;Q9NX95;Q9NX95-4	.;.;SYBU_HUMAN;.	S	104;110;37;102;104;105;104;105;104;105;105;105;105;104;104;105;105	.	ENSP00000276646:P105S	P	-	1	0	SYBU	110700361	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.224000	0.51238	1.439000	0.47511	0.655000	0.94253	CCT		0.483	SYBU-204	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000385501.1	NM_017786		5	139	0	0	0	0.014758	0	5	139				
GDA	9615	broad.mit.edu	37	9	74838084	74838084	+	Missense_Mutation	SNP	T	T	A			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr9:74838084T>A	ENST00000358399.3	+	7	748	c.655T>A	c.(655-657)Tct>Act	p.S219T	GDA_ENST00000545168.1_Missense_Mutation_p.S145T|GDA_ENST00000477618.1_3'UTR|GDA_ENST00000376989.3_Intron|GDA_ENST00000238018.4_Missense_Mutation_p.S219T|GDA_ENST00000376986.1_Intron	NM_001242505.2|NM_001242506.2|NM_004293.4	NP_001229434.1|NP_001229435.1|NP_004284.1	Q9Y2T3	GUAD_HUMAN	guanine deaminase	219					guanine catabolic process (GO:0006147)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	guanine deaminase activity (GO:0008892)|zinc ion binding (GO:0008270)	p.S219T(2)		central_nervous_system(4)|endometrium(1)|kidney(1)|large_intestine(1)|lung(20)|ovary(2)|skin(2)|urinary_tract(1)	32		Myeloproliferative disorder(762;0.0122)		Lung(182;0.0583)		CCTCTCCTGCTCTGAGACTTT	0.413																																							uc004aiq.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|central_nervous_system(2)|skin(1)	5						c.(655-657)TCT>ACT		guanine deaminase							193.0	176.0	182.0					9																	74838084		2203	4300	6503	SO:0001583	missense	9615				nervous system development|purine base metabolic process|purine nucleotide catabolic process	cytosol	guanine deaminase activity|zinc ion binding	g.chr9:74838084T>A	AF095286	CCDS6641.1, CCDS56576.1, CCDS56577.1	9q21.13	2008-05-14			ENSG00000119125	ENSG00000119125			4212	protein-coding gene	gene with protein product		139260				10075721, 3966794	Standard	NM_001242507		Approved		uc004air.3	Q9Y2T3	OTTHUMG00000020005	ENST00000358399.3:c.655T>A	9.37:g.74838084T>A	ENSP00000351170:p.Ser219Thr					GDA_uc011lse.1_Missense_Mutation_p.S145T|GDA_uc011lsf.1_Missense_Mutation_p.S145T|GDA_uc004air.2_Missense_Mutation_p.S219T|GDA_uc010mow.1_RNA|GDA_uc004ais.2_Intron|GDA_uc004ait.1_Missense_Mutation_p.S145T	p.S219T	NM_004293	NP_004284	Q9Y2T3	GUAD_HUMAN		Lung(182;0.0583)	7	838	+		Myeloproliferative disorder(762;0.0122)	219					B4DTY5|Q5SZC7|Q9H335|Q9ULG2	Missense_Mutation	SNP	ENST00000358399.3	37	c.655T>A	CCDS6641.1	.	.	.	.	.	.	.	.	.	.	T	6.402	0.442274	0.12164	.	.	ENSG00000119125	ENST00000545168;ENST00000238018;ENST00000358399;ENST00000414671	D;D;D;D	0.90788	-2.73;-2.73;-2.73;-2.73	5.58	-0.031	0.13911	Amidohydrolase 1 (1);	0.326514	0.34245	N	0.004131	T	0.74253	0.3692	N	0.05383	-0.06	0.30637	N	0.756829	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.002	T	0.62826	-0.6772	10	0.02654	T	1	-8.6962	10.6207	0.45478	0.6701:0.0:0.0:0.3299	.	219;219	Q9Y2T3-3;Q9Y2T3	.;GUAD_HUMAN	T	145;219;219;85	ENSP00000437972:S145T;ENSP00000238018:S219T;ENSP00000351170:S219T;ENSP00000403897:S85T	ENSP00000238018:S219T	S	+	1	0	GDA	74027904	1.000000	0.71417	0.998000	0.56505	0.934000	0.57294	0.949000	0.29109	0.034000	0.15491	-0.333000	0.08304	TCT		0.413	GDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052633.1			12	71	0	0	0	0.020292	0	12	71				
TMC1	117531	broad.mit.edu	37	9	75435847	75435847	+	Missense_Mutation	SNP	G	G	T			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr9:75435847G>T	ENST00000297784.5	+	20	2393	c.1853G>T	c.(1852-1854)tGc>tTc	p.C618F	TMC1_ENST00000396237.3_Missense_Mutation_p.C618F|TMC1_ENST00000340019.3_Missense_Mutation_p.C618F|TMC1_ENST00000486417.1_3'UTR	NM_138691.2	NP_619636.2	Q8TDI8	TMC1_HUMAN	transmembrane channel-like 1	618					auditory receptor cell development (GO:0060117)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)	p.C618F(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(21)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	36						GCCGTTATGTGCTGCAATGTT	0.502																																					Pancreas(75;173 1345 14232 34245 43413)	Pancreas(75;173 1345 14232 34245 43413)	uc004aiz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1852-1854)TGC>TTC		transmembrane channel-like 1							192.0	166.0	175.0					9																	75435847		2203	4300	6503	SO:0001583	missense	117531				sensory perception of sound	integral to membrane		g.chr9:75435847G>T	AF417578	CCDS6643.1	9q21	2014-01-28			ENSG00000165091	ENSG00000165091			16513	protein-coding gene	gene with protein product		606706	"""transmembrane, cochlear expressed, 1"""	DFNA36, DFNB7, DFNB11		11850618, 11850623	Standard	NM_138691		Approved		uc004aiz.1	Q8TDI8	OTTHUMG00000020014	ENST00000297784.5:c.1853G>T	9.37:g.75435847G>T	ENSP00000297784:p.Cys618Phe					TMC1_uc010moz.1_Missense_Mutation_p.C576F|TMC1_uc004aja.1_RNA|TMC1_uc004ajb.1_RNA|TMC1_uc004ajc.1_Missense_Mutation_p.C472F|TMC1_uc010mpa.1_Missense_Mutation_p.C472F	p.C618F	NM_138691	NP_619636	Q8TDI8	TMC1_HUMAN			20	2393	+			618			Cytoplasmic (Potential).		A8MVZ2|B1AM91	Missense_Mutation	SNP	ENST00000297784.5	37	c.1853G>T	CCDS6643.1	.	.	.	.	.	.	.	.	.	.	G	18.11	3.550331	0.65311	.	.	ENSG00000165091	ENST00000297784;ENST00000340019;ENST00000396235;ENST00000537917;ENST00000542143;ENST00000396237	T;T;T	0.62788	0.0;0.0;0.0	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.67869	0.2939	L	0.33485	1.01	0.44843	D	0.997851	D;D;D	0.65815	0.995;0.995;0.995	D;D;D	0.70227	0.968;0.968;0.968	T	0.59069	-0.7523	10	0.13470	T	0.59	-19.5889	16.4891	0.84195	0.0:0.0:0.8686:0.1314	.	585;585;618	A5D8Y1;A4FUA6;Q8TDI8	.;.;TMC1_HUMAN	F	618;618;585;585;612;618	ENSP00000297784:C618F;ENSP00000341433:C618F;ENSP00000379538:C618F	ENSP00000297784:C618F	C	+	2	0	TMC1	74625667	1.000000	0.71417	0.973000	0.42090	0.913000	0.54294	3.746000	0.55127	2.857000	0.98124	0.650000	0.86243	TGC		0.502	TMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052655.1			10	133	1	0	0.000442599	0.006214	0.00047745	10	133				
ROR2	4920	broad.mit.edu	37	9	94487168	94487168	+	Silent	SNP	G	G	A			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr9:94487168G>A	ENST00000375708.3	-	9	1806	c.1608C>T	c.(1606-1608)gtC>gtT	p.V536V	ROR2_ENST00000550066.1_5'UTR|ROR2_ENST00000375715.1_Silent_p.V396V	NM_004560.3	NP_004551.2	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2	536	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|embryonic genitalia morphogenesis (GO:0030538)|inner ear morphogenesis (GO:0042472)|JNK cascade (GO:0007254)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|somitogenesis (GO:0001756)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	clathrin-coated endocytic vesicle membrane (GO:0030669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)	p.V536V(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						GCAGGCAGACGACGTTGGGGT	0.627																																							uc004arj.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(8)|central_nervous_system(5)|ovary(3)|large_intestine(2)|stomach(1)|breast(1)	20						c.(1606-1608)GTC>GTT		receptor tyrosine kinase-like orphan receptor 2							72.0	72.0	72.0					9																	94487168		2203	4300	6503	SO:0001819	synonymous_variant	4920				negative regulation of cell proliferation|positive regulation of cell migration|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding	g.chr9:94487168G>A	M97639	CCDS6691.1	9q22	2013-01-11			ENSG00000169071	ENSG00000169071		"""Immunoglobulin superfamily / I-set domain containing"""	10257	protein-coding gene	gene with protein product		602337		NTRKR2, BDB, BDB1		1334494, 10700182	Standard	NM_004560		Approved		uc004arj.2	Q01974	OTTHUMG00000020211	ENST00000375708.3:c.1608C>T	9.37:g.94487168G>A						ROR2_uc004ari.1_Silent_p.V396V	p.V536V	NM_004560	NP_004551	Q01974	ROR2_HUMAN			9	1807	-			536			Cytoplasmic (Potential).|Protein kinase.		Q59GF5|Q5SPI5|Q9HAY7|Q9HB61	Silent	SNP	ENST00000375708.3	37	c.1608C>T	CCDS6691.1																																																																																				0.627	ROR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053040.1			11	63	0	0	0	0.008291	0	11	63				
OR1N1	138883	broad.mit.edu	37	9	125289309	125289309	+	Silent	SNP	G	G	A			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr9:125289309G>A	ENST00000304880.2	-	1	263	c.264C>T	c.(262-264)caC>caT	p.H88H		NM_012363.1	NP_036495.1	Q8NGS0	OR1N1_HUMAN	olfactory receptor, family 1, subfamily N, member 1	88						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H88H(1)		breast(2)|central_nervous_system(1)|large_intestine(2)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15						AGGAGATGGTGTGATGCCGAG	0.473																																							uc004bmn.1		NA																	1	Substitution - coding silent(1)		lung(1)	upper_aerodigestive_tract(1)|breast(1)|skin(1)	3						c.(262-264)CAC>CAT		olfactory receptor, family 1, subfamily N,							106.0	101.0	103.0					9																	125289309		2203	4300	6503	SO:0001819	synonymous_variant	138883				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:125289309G>A	U86216	CCDS6844.1	9q34.11	2012-08-09			ENSG00000171505	ENSG00000171505		"""GPCR / Class A : Olfactory receptors"""	8221	protein-coding gene	gene with protein product				OR1N3		9500546	Standard	NM_012363		Approved	OR1-26	uc004bmn.1	Q8NGS0	OTTHUMG00000020608	ENST00000304880.2:c.264C>T	9.37:g.125289309G>A							p.H88H	NM_012363	NP_036495	Q8NGS0	OR1N1_HUMAN			1	264	-			88			Extracellular (Potential).		A3KFM1|O43870|Q6IF16|Q96R93	Silent	SNP	ENST00000304880.2	37	c.264C>T	CCDS6844.1																																																																																				0.473	OR1N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053938.1			5	45	0	0	0	0.021553	0	5	45				
NR6A1	2649	broad.mit.edu	37	9	127302372	127302372	+	Missense_Mutation	SNP	G	G	C			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr9:127302372G>C	ENST00000487099.2	-	5	693	c.536C>G	c.(535-537)tCc>tGc	p.S179C	NR6A1_ENST00000344523.4_Missense_Mutation_p.S179C|NR6A1_ENST00000416460.2_Missense_Mutation_p.S175C|NR6A1_ENST00000373584.3_Missense_Mutation_p.S175C	NM_001278546.1	NP_001265475.1	Q15406	NR6A1_HUMAN	nuclear receptor subfamily 6, group A, member 1	179	Sufficient for interaction with UIMC1. {ECO:0000250}.				cell proliferation (GO:0008283)|gamete generation (GO:0007276)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.S179C(1)		NS(1)|breast(1)|cervix(1)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(1)	17						GTTCCCAGGGGAACTGTGGTC	0.517																																					Esophageal Squamous(192;272 2884 6208 20560)	Esophageal Squamous(192;272 2884 6208 20560)	uc004bor.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(535-537)TCC>TGC		nuclear receptor subfamily 6, group A, member 1							222.0	185.0	197.0					9																	127302372		2203	4300	6503	SO:0001583	missense	2649				cell proliferation|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|spermatogenesis	transcription factor complex	protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding	g.chr9:127302372G>C	U64876	CCDS35137.1, CCDS55340.1, CCDS65127.1	9q33.3	2014-01-21			ENSG00000148200	ENSG00000148200		"""Nuclear hormone receptors"""	7985	protein-coding gene	gene with protein product		602778		GCNF		9134503, 8982251	Standard	NM_001489		Approved	GCNF1, RTR, CT150	uc004bor.1	Q15406	OTTHUMG00000020661	ENST00000487099.2:c.536C>G	9.37:g.127302372G>C	ENSP00000420267:p.Ser179Cys					NR6A1_uc004boq.1_Missense_Mutation_p.S175C|NR6A1_uc010mwq.1_Missense_Mutation_p.S175C	p.S179C	NM_033334	NP_201591	Q15406	NR6A1_HUMAN			5	714	-			179			Sufficient for interaction with UIMC1 (By similarity).		O00551|O00603|Q5T6F4|Q8NHQ0|Q92898|Q99802	Missense_Mutation	SNP	ENST00000487099.2	37	c.536C>G	CCDS35137.1	.	.	.	.	.	.	.	.	.	.	G	32	5.153683	0.94645	.	.	ENSG00000148200	ENST00000487099;ENST00000373584;ENST00000416460;ENST00000344523;ENST00000475178	D;D;D;D;D	0.94862	-3.2;-3.32;-3.33;-3.21;-3.54	5.98	5.98	0.97165	Nuclear hormone receptor, ligand-binding (2);	0.000000	0.85682	D	0.000000	D	0.96163	0.8749	L	0.47716	1.5	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	P;D;D	0.69479	0.846;0.96;0.964	D	0.95859	0.8881	10	0.56958	D	0.05	.	19.4463	0.94849	0.0:0.0:1.0:0.0	.	175;179;175	F1DAM1;Q15406;Q15406-5	.;NR6A1_HUMAN;.	C	179;175;175;179;137	ENSP00000420267:S179C;ENSP00000362686:S175C;ENSP00000413701:S175C;ENSP00000341135:S179C;ENSP00000420587:S137C	ENSP00000341135:S179C	S	-	2	0	NR6A1	126342193	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.188000	0.94921	2.835000	0.97688	0.650000	0.86243	TCC		0.517	NR6A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054043.4			18	93	0	0	0	0.0333	0	18	93				
WDR38	401551	broad.mit.edu	37	9	127619095	127619095	+	Missense_Mutation	SNP	T	T	A			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr9:127619095T>A	ENST00000373574.1	+	7	759	c.703T>A	c.(703-705)Tgg>Agg	p.W235R		NM_001045476.1|NM_001276374.1	NP_001038941.1|NP_001263303.1	Q5JTN6	WDR38_HUMAN	WD repeat domain 38	235					hematopoietic progenitor cell differentiation (GO:0002244)			p.W235R(1)		breast(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)	8						CCATGTCACCTGGGTGAAGAG	0.617																																							uc004box.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(703-705)TGG>AGG		WD repeat domain 38							76.0	85.0	82.0					9																	127619095		2081	4198	6279	SO:0001583	missense	401551							g.chr9:127619095T>A		CCDS43876.1, CCDS75898.1, CCDS75899.1	9q33.3	2013-01-09			ENSG00000136918	ENSG00000136918		"""WD repeat domain containing"""	23745	protein-coding gene	gene with protein product							Standard	NM_001276375		Approved		uc011lzo.3	Q5JTN6	OTTHUMG00000020664	ENST00000373574.1:c.703T>A	9.37:g.127619095T>A	ENSP00000362677:p.Trp235Arg					WDR38_uc011lzn.1_Missense_Mutation_p.W224R|WDR38_uc011lzo.1_Missense_Mutation_p.W235R|WDR38_uc011lzp.1_Missense_Mutation_p.W186R	p.W235R	NM_001045476	NP_001038941	Q5JTN6	WDR38_HUMAN			7	759	+			235			WD 6.		A0PK24	Missense_Mutation	SNP	ENST00000373574.1	37	c.703T>A	CCDS43876.1	.	.	.	.	.	.	.	.	.	.	T	18.54	3.647090	0.67358	.	.	ENSG00000136918	ENST00000373574	T	0.59906	0.23	4.92	4.92	0.64577	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.64402	D	0.000016	T	0.59636	0.2208	N	0.17631	0.505	0.40033	D	0.975554	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.57608	-0.7782	10	0.23891	T	0.37	.	12.5625	0.56291	0.0:0.0:0.0:1.0	.	235;235;224;235	B9EK65;B7ZW23;B7ZW24;Q5JTN6	.;.;.;WDR38_HUMAN	R	235	ENSP00000362677:W235R	ENSP00000362677:W235R	W	+	1	0	WDR38	126658916	0.996000	0.38824	0.990000	0.47175	0.796000	0.44982	2.936000	0.48971	2.080000	0.62538	0.459000	0.35465	TGG		0.617	WDR38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054048.1	NM_001045476		14	52	0	0	0	0.016723	0	14	52				
SHOX	6473	broad.mit.edu	37	X	591835	591835	+	Missense_Mutation	SNP	T	T	A			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chrX:591835T>A	ENST00000554971.1	+	1	294	c.203T>A	c.(202-204)gTg>gAg	p.V68E	SHOX_ENST00000381578.1_Missense_Mutation_p.V68E|SHOX_ENST00000334060.3_Missense_Mutation_p.V68E|SHOX_ENST00000381575.1_Missense_Mutation_p.V68E			O15266	SHOX_HUMAN	short stature homeobox	68					skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V68E(1)		endometrium(3)|lung(9)|prostate(1)	13		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CACTGCCCGGTGCATTTGTTC	0.602																																					Ovarian(95;18 1419 12424 14056 28266)	Ovarian(95;18 1419 12424 14056 28266)	uc004cph.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(202-204)GTG>GAG		short stature homeobox isoform SHOXa							74.0	90.0	85.0					X																	591835		2203	4296	6499	SO:0001583	missense	6473				skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chrX:591835T>A	U82668	CCDS14106.1, CCDS14107.1	Xp22.33 and Yp11.32	2014-07-16			ENSG00000185960	ENSG00000185960		"""Pseudoautosomal regions / PAR1"", ""Homeoboxes / PRD class"""	10853	protein-coding gene	gene with protein product		312865, 400020				9259282, 9140395	Standard	XR_247282		Approved	PHOG, GCFX, SS, SHOXY	uc004cph.1	O15266	OTTHUMG00000021053	ENST00000554971.1:c.203T>A	X.37:g.591835T>A	ENSP00000452016:p.Val68Glu					SHOX_uc004cpi.2_Missense_Mutation_p.V68E	p.V68E	NM_000451	NP_000442	O15266	SHOX_HUMAN			2	894	+		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)	68					O00412|O00413|O15267	Missense_Mutation	SNP	ENST00000554971.1	37	c.203T>A	CCDS14107.1	.	.	.	.	.	.	.	.	.	.	T	5.476	0.272929	0.10349	.	.	ENSG00000185960	ENST00000334060;ENST00000381578;ENST00000554971;ENST00000381575	D;D;D;D	0.94793	-3.52;-3.37;-3.37;-3.52	2.26	0.808	0.18719	.	1.169160	0.06562	U	0.746841	D	0.86928	0.6051	L	0.34521	1.04	0.09310	N	1	B;B	0.33583	0.418;0.112	B;B	0.27796	0.083;0.036	T	0.76274	-0.3019	10	0.02654	T	1	.	6.7307	0.23381	0.2127:0.0:0.0:0.7873	.	68;68	O15266-2;O15266	.;SHOX_HUMAN	E	68	ENSP00000335505:V68E;ENSP00000370990:V68E;ENSP00000452016:V68E;ENSP00000370987:V68E	ENSP00000335505:V68E	V	+	2	0	SHOX	511835	1.000000	0.71417	0.951000	0.38953	0.397000	0.30659	3.264000	0.51553	0.631000	0.30412	0.227000	0.17789	GTG		0.602	SHOX-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411999.3	NM_000451		9	88	0	0	0	0.006214	0	9	88				
CHDC2	286464	broad.mit.edu	37	X	36103615	36103615	+	Missense_Mutation	SNP	C	C	A			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chrX:36103615C>A	ENST00000313548.4	+	5	787	c.601C>A	c.(601-603)Caa>Aaa	p.Q201K		NM_173695.2	NP_775966.1	Q8N9S7	CHDC2_HUMAN	calponin homology domain containing 2	201						integral component of membrane (GO:0016021)		p.Q201K(1)									AAGGGTAATTCAACTCCATTT	0.378																																							uc004ddk.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(601-603)CAA>AAA		hypothetical protein LOC286464							73.0	68.0	70.0					X																	36103615		2202	4300	6502	SO:0001583	missense	286464					integral to membrane		g.chrX:36103615C>A	AK093920	CCDS14238.1	Xp21.1	2014-08-07	2012-11-28	2012-11-28	ENSG00000176034	ENSG00000176034			26708	protein-coding gene	gene with protein product			"""chromosome X open reading frame 59"""	CXorf59			Standard	NM_173695		Approved	FLJ36601, RP13-11B7.1	uc004ddk.1	Q8N9S7	OTTHUMG00000021351	ENST00000313548.4:c.601C>A	X.37:g.36103615C>A	ENSP00000324767:p.Gln201Lys						p.Q201K	NM_173695	NP_775966	Q8N9S7	CX059_HUMAN			5	787	+			201						Missense_Mutation	SNP	ENST00000313548.4	37	c.601C>A	CCDS14238.1	.	.	.	.	.	.	.	.	.	.	C	9.764	1.170830	0.21621	.	.	ENSG00000176034	ENST00000378660;ENST00000313548	.	.	.	5.9	5.03	0.67393	.	0.099859	0.38778	N	0.001579	T	0.49795	0.1578	M	0.63843	1.955	0.09310	N	1	P	0.52842	0.956	P	0.49999	0.628	T	0.47849	-0.9085	9	0.51188	T	0.08	-7.7972	12.9836	0.58579	0.1626:0.8374:0.0:0.0	.	201	Q8N9S7	CX059_HUMAN	K	201	.	ENSP00000324767:Q201K	Q	+	1	0	CXorf59	36013536	0.996000	0.38824	0.008000	0.14137	0.009000	0.06853	5.021000	0.64072	1.209000	0.43321	0.600000	0.82982	CAA		0.378	CHDC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_173695		12	30	1	0	2.10051e-16	0.013537	2.76701e-16	12	30				
F8	2157	broad.mit.edu	37	X	154128189	154128189	+	Silent	SNP	G	G	A			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chrX:154128189G>A	ENST00000360256.4	-	21	6425	c.6225C>T	c.(6223-6225)tcC>tcT	p.S2075S		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	2075	F5/8 type C 1. {ECO:0000255|PROSITE- ProRule:PRU00081}.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)	p.S2075S(2)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	TGATTGATCCGGAATAATGAA	0.418													G|||	1	0.000264901	0.0	0.0	3775	,	,		12187	0.001		0.0	False		,,,				2504	0.0						uc004fmt.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(5)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	11						c.(6223-6225)TCC>TCT		coagulation factor VIII isoform a precursor	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)						92.0	82.0	85.0					X																	154128189		2203	4300	6503	SO:0001819	synonymous_variant	2157				acute-phase response|blood coagulation, intrinsic pathway|cell adhesion|platelet activation|platelet degranulation	extracellular space|plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity|protein binding	g.chrX:154128189G>A	M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.6225C>T	X.37:g.154128189G>A						F8_uc010nvi.1_Intron	p.S2075S	NM_000132	NP_000123	P00451	FA8_HUMAN			21	6396	-	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)		2075			F5/8 type C 1.		Q14286|Q5HY69	Silent	SNP	ENST00000360256.4	37	c.6225C>T	CCDS35457.1																																																																																				0.418	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058869.4			4	26	0	0	0	0.009096	0	4	26				
GAL3ST3	89792	broad.mit.edu	37	11	65810949	65810949	+	Frame_Shift_Del	DEL	G	G	-			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr11:65810949delG	ENST00000312006.4	-	3	606	c.325delC	c.(325-327)cgcfs	p.R109fs	GAL3ST3_ENST00000527878.1_Frame_Shift_Del_p.R109fs	NM_033036.2	NP_149025.1	Q96A11	G3ST3_HUMAN	galactose-3-O-sulfotransferase 3	109					monosaccharide metabolic process (GO:0005996)|oligosaccharide metabolic process (GO:0009311)|poly-N-acetyllactosamine metabolic process (GO:0030309)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|carbohydrate binding (GO:0030246)|galactose 3-O-sulfotransferase activity (GO:0050694)|galactosylceramide sulfotransferase activity (GO:0001733)|proteoglycan sulfotransferase activity (GO:0050698)			kidney(1)|lung(9)|ovary(2)|skin(2)	14						GAGAAGTTGCGGGGGTAGCAG	0.692																																							uc001ogv.2		NA																	0				ovary(1)	1						c.(325-327)CGCfs		galactose-3-O-sulfotransferase 3							22.0	22.0	22.0					11																	65810949		2201	4291	6492	SO:0001589	frameshift_variant	89792				monosaccharide metabolic process|oligosaccharide metabolic process|poly-N-acetyllactosamine metabolic process|proteoglycan biosynthetic process|sulfur compound metabolic process	Golgi cisterna membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate binding|carbohydrate binding|galactosylceramide sulfotransferase activity|proteoglycan sulfotransferase activity	g.chr11:65810949delG	AY026481	CCDS8128.1	11q13.1	2014-08-12			ENSG00000175229	ENSG00000175229		"""Sulfotransferases, membrane-bound"""	24144	protein-coding gene	gene with protein product		608234				11323440, 11356829	Standard	NM_033036		Approved	GAL3ST2	uc001ogw.3	Q96A11	OTTHUMG00000166667	ENST00000312006.4:c.325delC	11.37:g.65810949delG	ENSP00000308591:p.Arg109fs					GAL3ST3_uc001ogw.2_Frame_Shift_Del_p.R109fs	p.R109fs	NM_033036	NP_149025	Q96A11	G3ST3_HUMAN			2	485	-			109			Lumenal (Potential).		Q14D05	Frame_Shift_Del	DEL	ENST00000312006.4	37	c.325delC	CCDS8128.1																																																																																				0.692	GAL3ST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391052.1	NM_033036		10	34	NA	NA	NA	NA	NA	10	34	---	---	---	---
TPTE	7179	broad.mit.edu	37	21	10944697	10944697	+	Frame_Shift_Del	DEL	A	A	-			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr21:10944697delA	ENST00000361285.4	-	11	866	c.537delT	c.(535-537)tttfs	p.F179fs	TPTE_ENST00000342420.5_Frame_Shift_Del_p.F141fs|TPTE_ENST00000415664.2_5'UTR|TPTE_ENST00000298232.7_Frame_Shift_Del_p.F161fs	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	179					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ACTTAATGTCAAAAAAAATGT	0.299																																							uc002yip.1		NA																	0				ovary(2)|lung(1)|breast(1)|skin(1)	5						c.(535-537)TTTfs		transmembrane phosphatase with tensin homology							157.0	168.0	164.0					21																	10944697		2203	4300	6503	SO:0001589	frameshift_variant	7179				signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr21:10944697delA	AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.537delT	21.37:g.10944697delA	ENSP00000355208:p.Phe179fs					TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Frame_Shift_Del_p.F161fs|TPTE_uc002yir.1_Frame_Shift_Del_p.F141fs|TPTE_uc010gkv.1_Frame_Shift_Del_p.F41fs	p.F179fs	NM_199261	NP_954870	P56180	TPTE_HUMAN	Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)	11	905	-			179			Helical; (Potential).		B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Frame_Shift_Del	DEL	ENST00000361285.4	37	c.537delT	CCDS13560.2																																																																																				0.299	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157413.1			8	299	NA	NA	NA	NA	NA	8	299	---	---	---	---
SOWAHB	345079	broad.mit.edu	37	4	77816907	77816912	+	In_Frame_Del	DEL	ACATTT	ACATTT	-			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	ACATTT	ACATTT	-	-	ACATTT	ACATTT	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr4:77816907_77816912delACATTT	ENST00000334306.2	-	1	2090_2095	c.2091_2096delAAATGT	c.(2089-2097)gtaaatgtc>gtc	p.697_699VNV>V		NM_001029870.1	NP_001025041.1	A6NEL2	SWAHB_HUMAN	sosondowah ankyrin repeat domain family member B	697																	GCTGTCCCTGACATTTACCCGAGAAG	0.539																																							uc003hki.2		NA																	0					0						c.(2089-2097)GTAAATGTC>GTC		ankyrin repeat domain 56																																				SO:0001651	inframe_deletion	345079							g.chr4:77816907_77816912delACATTT		CCDS34017.1	4q21.1	2013-01-10	2012-01-12	2012-01-12	ENSG00000186212	ENSG00000186212		"""Ankyrin repeat domain containing"""	32958	protein-coding gene	gene with protein product			"""ankyrin repeat domain 56"""	ANKRD56		22234889	Standard	NM_001029870		Approved		uc003hki.3	A6NEL2	OTTHUMG00000160876	ENST00000334306.2:c.2091_2096delAAATGT	4.37:g.77816907_77816912delACATTT	ENSP00000334879:p.Val697_Asn698del						p.697_699VNV>V	NM_001029870	NP_001025041	A6NEL2	ANR56_HUMAN			1	2091_2096	-			697_699			ANK 2.		B2RP29	In_Frame_Del	DEL	ENST00000334306.2	37	c.2091_2096delAAATGT	CCDS34017.1																																																																																				0.539	SOWAHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362762.1	NM_001029870		27	334	NA	NA	NA	NA	NA	27	334	---	---	---	---
PXDC1	221749	broad.mit.edu	37	6	3751655	3751657	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	CTC	CTC	-	-	CTC	CTC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr6:3751655_3751657delCTC	ENST00000380283.4	-	1	603_605	c.109_111delGAG	c.(109-111)gagdel	p.E37del	PXDC1_ENST00000477592.2_5'UTR|RP11-420L9.5_ENST00000603791.1_RNA	NM_183373.3	NP_899229.2	Q5TGL8	PXDC1_HUMAN	PX domain containing 1	37	PX.						phosphatidylinositol binding (GO:0035091)										TCTCGAAGAACTCCTCTTCGTCG	0.69																																							uc003mvt.2		NA																	0				breast(1)	1						c.(109-111)GAGdel		hypothetical protein LOC221749																																				SO:0001651	inframe_deletion	221749				cell communication		phosphatidylinositol binding	g.chr6:3751655_3751657delCTC	AJ420534	CCDS4486.1	6p25.1	2011-11-25	2011-11-25	2011-11-25	ENSG00000168994	ENSG00000168994			21361	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 145"""	C6orf145			Standard	NM_183373		Approved		uc003mvt.2	Q5TGL8	OTTHUMG00000014146	ENST00000380283.4:c.109_111delGAG	6.37:g.3751658_3751660delCTC	ENSP00000369636:p.Glu37del						p.E37del	NM_183373	NP_899229	Q5TGL8	CF145_HUMAN			1	590_592	-	Ovarian(93;0.0925)	all_hematologic(90;0.108)	37			PX.		A8K0N3|Q6PGP0|Q86XB7	In_Frame_Del	DEL	ENST00000380283.4	37	c.109_111delGAG	CCDS4486.1																																																																																				0.690	PXDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039688.1	NM_183373		2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
TRERF1	55809	broad.mit.edu	37	6	42196333	42196333	+	Frame_Shift_Del	DEL	T	T	-			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr6:42196333delT	ENST00000372922.4	-	18	3915	c.3353delA	c.(3352-3354)aagfs	p.K1118fs	TRERF1_ENST00000354325.2_Frame_Shift_Del_p.K1035fs|TRERF1_ENST00000372917.4_Frame_Shift_Del_p.K1047fs|TRERF1_ENST00000340840.2_Frame_Shift_Del_p.K1047fs|TRERF1_ENST00000541110.1_Frame_Shift_Del_p.K1138fs	NM_033502.2	NP_277037.1	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1	1118	Interacts with CREBBP.				cholesterol catabolic process (GO:0006707)|homeostatic process (GO:0042592)|multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hormone biosynthetic process (GO:0046885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|steroid biosynthetic process (GO:0006694)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(2)|endometrium(7)|kidney(1)|large_intestine(12)|lung(13)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(2)	45	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			CTTCTGAGCCTTTTGCCTCTG	0.542																																							uc003osd.2		NA																	0				ovary(3)|pancreas(1)|skin(1)	5						c.(3352-3354)AAGfs		transcriptional regulating factor 1							245.0	274.0	264.0					6																	42196333		2203	4300	6503	SO:0001589	frameshift_variant	55809				cholesterol catabolic process|homeostatic process|multicellular organismal development|positive regulation of transcription, DNA-dependent|regulation of hormone biosynthetic process|steroid biosynthetic process	nucleus	DNA bending activity|ligand-dependent nuclear receptor transcription coactivator activity|RNA polymerase II transcription cofactor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding	g.chr6:42196333delT	AF297872	CCDS4867.1, CCDS75455.1	6p21.1-p12.1	2012-09-25			ENSG00000124496	ENSG00000124496			18273	protein-coding gene	gene with protein product		610322	"""breast cancer anti-estrogen resistance 2"""	BCAR2		11349124	Standard	XM_005249223		Approved	TReP-132, HSA277276, RAPA, dJ139D8.5	uc003osd.2	Q96PN7	OTTHUMG00000014698	ENST00000372922.4:c.3353delA	6.37:g.42196333delT	ENSP00000362013:p.Lys1118fs					TRERF1_uc011duq.1_Frame_Shift_Del_p.K1035fs|TRERF1_uc003osb.2_Frame_Shift_Del_p.K886fs|TRERF1_uc003osc.2_Frame_Shift_Del_p.K874fs|TRERF1_uc003ose.2_Frame_Shift_Del_p.K1138fs	p.K1118fs	NM_033502	NP_277037	Q96PN7	TREF1_HUMAN	Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)		18	3916	-	Colorectal(47;0.196)		1118			Interacts with CREBBP.		Q05GC6|Q7Z6T2|Q7Z6T3|Q9NQ72|Q9NQ73|Q9NUN9	Frame_Shift_Del	DEL	ENST00000372922.4	37	c.3353delA	CCDS4867.1																																																																																				0.542	TRERF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040551.2	NM_033502		8	649	NA	NA	NA	NA	NA	8	649	---	---	---	---
CTSV	1515	broad.mit.edu	37	9	99798905	99798905	+	Frame_Shift_Del	DEL	C	C	-			TCGA-05-5420-01A-01D-1625-08	TCGA-05-5420-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8371b6a4-ffea-4fe5-b997-76ece85064a7	933f6f30-7a1a-4148-953e-f637b1e6c241	g.chr9:99798905delC	ENST00000259470.5	-	5	770	c.521delG	c.(520-522)ggcfs	p.G174fs	CTSV_ENST00000538255.1_Frame_Shift_Del_p.G174fs|CTSV_ENST00000479932.1_5'Flank	NM_001333.3	NP_001324.2	O60911	CATL2_HUMAN	cathepsin V	174					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|autophagic cell death (GO:0048102)|catagen (GO:0042637)|cellular response to starvation (GO:0009267)|decidualization (GO:0046697)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hair follicle morphogenesis (GO:0031069)|multicellular organismal aging (GO:0010259)|negative regulation of keratinocyte proliferation (GO:0010839)|nerve development (GO:0021675)|protein autoprocessing (GO:0016540)|regulation of actin cytoskeleton reorganization (GO:2000249)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to gonadotropin (GO:0034698)|Sertoli cell differentiation (GO:0060008)|spermatogenesis (GO:0007283)	cytoplasmic vesicle (GO:0031410)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|microvillus (GO:0005902)|neuron projection (GO:0043005)|nucleolus (GO:0005730)|perikaryon (GO:0043204)	aminopeptidase activity (GO:0004177)|cysteine-type carboxypeptidase activity (GO:0016807)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|peptide binding (GO:0042277)										GCCCTGATTGCCTTGAGGACG	0.522																																							uc004awt.2		NA																	0					0						c.(520-522)GGCfs		cathepsin L2 preproprotein							107.0	94.0	99.0					9																	99798905		2203	4300	6503	SO:0001589	frameshift_variant	1515					lysosome	cysteine-type endopeptidase activity	g.chr9:99798905delC	Y14734	CCDS6723.1	9q22.33	2013-06-27	2013-06-27	2013-06-27	ENSG00000136943	ENSG00000136943		"""Cathepsins"""	2538	protein-coding gene	gene with protein product		603308	"""cathepsin L2"""	CTSL2		9563472, 10029531	Standard	NM_001201575		Approved	CTSU	uc004awt.3	O60911	OTTHUMG00000020314	ENST00000259470.5:c.521delG	9.37:g.99798905delC	ENSP00000259470:p.Gly174fs					CTSL2_uc010msi.2_Frame_Shift_Del_p.G174fs|CTSL2_uc004awu.2_Frame_Shift_Del_p.G119fs|CTSL2_uc010msj.1_Frame_Shift_Del_p.G119fs|CTSL2_uc010msk.2_Frame_Shift_Del_p.G119fs	p.G174fs	NM_001333	NP_001324	O60911	CATL2_HUMAN			5	718	-		Acute lymphoblastic leukemia(62;0.0559)	174					O60233|Q2TB86|Q5T1U0	Frame_Shift_Del	DEL	ENST00000259470.5	37	c.521delG	CCDS6723.1																																																																																				0.522	CTSV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053301.2	NM_001333		9	70	NA	NA	NA	NA	NA	9	70	---	---	---	---
