#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
SDF4	51150	broad.mit.edu	37	1	1159282	1159282	+	Silent	SNP	C	C	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr1:1159282C>A	ENST00000360001.6	-	3	655	c.393G>T	c.(391-393)acG>acT	p.T131T	SDF4_ENST00000263741.7_Silent_p.T131T|SDF4_ENST00000545427.1_Silent_p.T131T			Q9BRK5	CAB45_HUMAN	stromal cell derived factor 4	131	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				calcium ion-dependent exocytosis (GO:0017156)|cerebellum development (GO:0021549)|fat cell differentiation (GO:0045444)|response to ethanol (GO:0045471)|UV protection (GO:0009650)|zymogen granule exocytosis (GO:0070625)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|late endosome (GO:0005770)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)	p.T131T(2)		endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	11	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;7.85e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.42e-21)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;4.83e-05)|Kidney(185;0.00252)|BRCA - Breast invasive adenocarcinoma(365;0.00263)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0368)|Lung(427;0.204)		AGTGCTCGGCCGTCTTCTCCA	0.632																																							uc001adh.3		NA																	2	Substitution - coding silent(2)		lung(2)	upper_aerodigestive_tract(1)|large_intestine(1)	2						c.(391-393)ACG>ACT		stromal cell derived factor 4 isoform 2							117.0	91.0	100.0					1																	1159282		2202	4299	6501	SO:0001819	synonymous_variant	51150				cerebellum development|fat cell differentiation|response to ethanol|UV protection|zymogen granule exocytosis	bleb|Golgi lumen|late endosome|soluble fraction	calcium ion binding|calcium ion binding|identical protein binding|protein binding	g.chr1:1159282C>A		CCDS12.1, CCDS30553.1	1p36.33	2013-01-10			ENSG00000078808	ENSG00000078808		"""EF-hand domain containing"""	24188	protein-coding gene	gene with protein product	"""calcium binding protein"""	614282				9254016, 8609160	Standard	NM_016176		Approved	Cab45	uc001adh.4	Q9BRK5	OTTHUMG00000001812	ENST00000360001.6:c.393G>T	1.37:g.1159282C>A						SDF4_uc001adg.2_5'Flank|SDF4_uc001adi.3_Silent_p.T131T|SDF4_uc009vjv.2_Silent_p.T9T|SDF4_uc009vjw.2_RNA|SDF4_uc001adj.1_Silent_p.T9T	p.T131T	NM_016176	NP_057260	Q9BRK5	CAB45_HUMAN		Epithelial(90;7.85e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.42e-21)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;4.83e-05)|Kidney(185;0.00252)|BRCA - Breast invasive adenocarcinoma(365;0.00263)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0368)|Lung(427;0.204)	3	722	-	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)	131			EF-hand 1.		B1AME5|B1AME6|B2RDF1|B4DSM1|Q53G52|Q53HQ9|Q8NBQ3|Q96AA1|Q9NZP7|Q9UN53	Silent	SNP	ENST00000360001.6	37	c.393G>T	CCDS30553.1	.	.	.	.	.	.	.	.	.	.	c	0.822	-0.748436	0.03065	.	.	ENSG00000078808	ENST00000403997	.	.	.	4.24	-5.02	0.02982	.	.	.	.	.	T	0.44871	0.1314	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42103	-0.9471	4	.	.	.	-23.5441	4.4556	0.11642	0.1196:0.134:0.1191:0.6273	.	.	.	.	C	66	.	.	G	-	1	0	SDF4	1149145	0.000000	0.05858	0.106000	0.21319	0.804000	0.45430	-2.583000	0.00904	-0.931000	0.03746	-0.359000	0.07587	GGC		0.632	SDF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000005064.1	NM_016176		11	19	1	0	6.40141e-05	0.010729	7.00937e-05	11	19				
CHD5	26038	broad.mit.edu	37	1	6194240	6194240	+	Missense_Mutation	SNP	T	T	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr1:6194240T>A	ENST00000262450.3	-	20	3191	c.3092A>T	c.(3091-3093)aAg>aTg	p.K1031M	CHD5_ENST00000378021.1_De_novo_Start_InFrame	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.K1031M(1)		breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		CTTCAGCATCTTCTGTAGCAG	0.622																																							uc001amb.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(3)|breast(3)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	12						c.(3091-3093)AAG>ATG		chromodomain helicase DNA binding protein 5							94.0	92.0	92.0					1																	6194240		2203	4300	6503	SO:0001583	missense	26038				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding|zinc ion binding	g.chr1:6194240T>A	AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.3092A>T	1.37:g.6194240T>A	ENSP00000262450:p.Lys1031Met					CHD5_uc001alz.1_5'Flank|CHD5_uc001ama.1_RNA|CHD5_uc001amc.1_RNA|CHD5_uc009vlx.1_RNA	p.K1031M	NM_015557	NP_056372	Q8TDI0	CHD5_HUMAN		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)	20	3192	-	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)	1031			Helicase C-terminal.		A8KAP8|A8MQ44|D3DSH9|O60740	Missense_Mutation	SNP	ENST00000262450.3	37	c.3092A>T	CCDS57.1	.	.	.	.	.	.	.	.	.	.	T	23.7	4.452576	0.84209	.	.	ENSG00000116254	ENST00000262450;ENST00000378006;ENST00000536802;ENST00000538279	T	0.68624	-0.34	4.67	4.67	0.58626	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.78868	0.4351	M	0.63428	1.95	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.81017	-0.1123	10	0.62326	D	0.03	-36.2437	14.3986	0.67027	0.0:0.0:0.0:1.0	.	1031	Q8TDI0	CHD5_HUMAN	M	1031;547;439;439	ENSP00000262450:K1031M	ENSP00000262450:K1031M	K	-	2	0	CHD5	6116827	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.917000	0.87498	1.865000	0.54081	0.459000	0.35465	AAG		0.622	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002823.2	NM_015557		23	47	0	0	0	0.014323	0	23	47				
CROCC	9696	broad.mit.edu	37	1	17280755	17280755	+	Nonsense_Mutation	SNP	C	C	G			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr1:17280755C>G	ENST00000375541.5	+	22	3293	c.3224C>G	c.(3223-3225)tCa>tGa	p.S1075*	CROCC_ENST00000467938.1_3'UTR	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin									p.S1075*(1)		breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		ACGGCGCTGTCAGAGAAGTTG	0.632																																							uc001azt.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|breast(2)|central_nervous_system(1)	5						c.(3223-3225)TCA>TGA		ciliary rootlet coiled-coil							91.0	104.0	99.0					1																	17280755		2201	4300	6501	SO:0001587	stop_gained	9696				cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity	g.chr1:17280755C>G	AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.3224C>G	1.37:g.17280755C>G	ENSP00000364691:p.Ser1075*					CROCC_uc009voz.1_Nonsense_Mutation_p.S674*|CROCC_uc001azu.2_Nonsense_Mutation_p.S378*	p.S1075*	NM_014675	NP_055490	Q5TZA2	CROCC_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)	22	3293	+		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)	1075						Nonsense_Mutation	SNP	ENST00000375541.5	37	c.3224C>G	CCDS30616.1	.	.	.	.	.	.	.	.	.	.	C	38	6.848763	0.97885	.	.	ENSG00000058453	ENST00000375541;ENST00000445545	.	.	.	4.4	4.4	0.53042	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18710	T	0.47	.	11.1915	0.48687	0.0:0.8125:0.1874:0.0	.	.	.	.	X	1075;956	.	ENSP00000364691:S1075X	S	+	2	0	CROCC	17153342	0.118000	0.22208	0.876000	0.34364	0.961000	0.63080	0.923000	0.28757	2.376000	0.81061	0.484000	0.47621	TCA		0.632	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006249.2	NM_014675		13	97	0	0	0	0.00499	0	13	97				
EPS15	2060	broad.mit.edu	37	1	51829698	51829698	+	Silent	SNP	G	G	C			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr1:51829698G>C	ENST00000371733.3	-	23	2295	c.2199C>G	c.(2197-2199)gtC>gtG	p.V733V	EPS15_ENST00000371730.2_Silent_p.V599V|EPS15_ENST00000396122.4_Silent_p.V410V	NM_001981.2	NP_001972.1	P42566	EPS15_HUMAN	epidermal growth factor receptor pathway substrate 15	733	15 X 3 AA repeats of D-P-F.				cell proliferation (GO:0008283)|clathrin coat assembly (GO:0048268)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Golgi to endosome transport (GO:0006895)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|protein transport (GO:0015031)|vesicle organization (GO:0016050)	AP-2 adaptor complex (GO:0030122)|ciliary membrane (GO:0060170)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|polyubiquitin binding (GO:0031593)	p.0?(2)|p.V733V(1)		endometrium(3)|kidney(5)|large_intestine(8)|lung(13)|prostate(2)|skin(1)|stomach(1)|urinary_tract(2)	35						CTTCATTGTTGACCTTTGTTT	0.343			T	MLL	ALL																																		uc001csq.1		NA		Dom	yes		1	1p32	2060	T	epidermal growth factor receptor pathway substrate 15 (AF1p)			L	MLL		ALL		3	Whole gene deletion(2)|Substitution - coding silent(1)		thyroid(1)|lung(1)|central_nervous_system(1)	lung(1)|kidney(1)	2						c.(2197-2199)GTC>GTG		epidermal growth factor receptor pathway							125.0	117.0	119.0					1																	51829698		2203	4300	6503	SO:0001819	synonymous_variant	2060				cell proliferation|clathrin coat assembly|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|protein transport	cytosol|early endosome membrane	calcium ion binding|SH3 domain binding	g.chr1:51829698G>C	BC054006	CCDS557.1	1p32	2013-01-10			ENSG00000085832	ENSG00000085832		"""EF-hand domain containing"""	3419	protein-coding gene	gene with protein product		600051				8183552	Standard	NM_001159969		Approved	AF-1P, MLLT5	uc001csq.1	P42566	OTTHUMG00000008192	ENST00000371733.3:c.2199C>G	1.37:g.51829698G>C						EPS15_uc009vyz.1_Silent_p.V599V|EPS15_uc001csp.3_Silent_p.V419V	p.V733V	NM_001981	NP_001972	P42566	EPS15_HUMAN			23	2291	-			733			15 X 3 AA repeats of D-P-F.		B2R8J7|D3DPJ2|Q5SRH4	Silent	SNP	ENST00000371733.3	37	c.2199C>G	CCDS557.1																																																																																				0.343	EPS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022422.1	NM_001981		3	40	0	0	0	0.004672	0	3	40				
SGIP1	84251	broad.mit.edu	37	1	67147734	67147734	+	Missense_Mutation	SNP	G	G	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr1:67147734G>T	ENST00000371037.4	+	15	1074	c.997G>T	c.(997-999)Gtg>Ttg	p.V333L	SGIP1_ENST00000371036.3_Intron|SGIP1_ENST00000371035.3_Intron|SGIP1_ENST00000237247.6_Missense_Mutation_p.V337L|SGIP1_ENST00000371039.1_Intron	NM_032291.2	NP_115667.2	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting protein 1	333	Pro-rich.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of feeding behavior (GO:2000253)|positive regulation of receptor-mediated endocytosis (GO:0048260)|response to dietary excess (GO:0002021)	AP-2 adaptor complex (GO:0030122)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	microtubule binding (GO:0008017)|phospholipid binding (GO:0005543)|SH3 domain binding (GO:0017124)	p.V333L(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(43)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	71						AAGGGAAAAAGTGGTGTCCCC	0.592																																							uc001dcr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(997-999)GTG>TTG		SH3-domain GRB2-like (endophilin) interacting							98.0	114.0	109.0					1																	67147734		2203	4300	6503	SO:0001583	missense	84251				positive regulation of energy homeostasis|positive regulation of feeding behavior|positive regulation of receptor-mediated endocytosis|response to dietary excess	AP-2 adaptor complex	microtubule binding|phospholipid binding|SH3 domain binding	g.chr1:67147734G>T	AL136561	CCDS30744.1	1p31.3	2008-02-05			ENSG00000118473	ENSG00000118473			25412	protein-coding gene	gene with protein product		611540				11230166	Standard	NM_032291		Approved	DKFZp761D221	uc001dcr.3	Q9BQI5	OTTHUMG00000009161	ENST00000371037.4:c.997G>T	1.37:g.67147734G>T	ENSP00000360076:p.Val333Leu					SGIP1_uc010opd.1_Intron|SGIP1_uc001dcs.2_Intron|SGIP1_uc001dct.2_Intron|SGIP1_uc009wat.2_Missense_Mutation_p.V100L	p.V333L	NM_032291	NP_115667	Q9BQI5	SGIP1_HUMAN			15	1214	+			333			Pro-rich.		A6NL81|A6NLD1|Q4LE32|Q5VYE2|Q5VYE3|Q5VYE4|Q68D76|Q6MZY6|Q8IWC2	Missense_Mutation	SNP	ENST00000371037.4	37	c.997G>T	CCDS30744.1	.	.	.	.	.	.	.	.	.	.	G	17.80	3.477664	0.63849	.	.	ENSG00000118473	ENST00000237247;ENST00000371038;ENST00000407289;ENST00000371037	T;T	0.13420	2.6;2.59	4.66	4.66	0.58398	.	0.357091	0.27134	N	0.020777	T	0.03608	0.0103	N	0.22421	0.69	0.80722	D	1	B;B	0.34372	0.451;0.075	B;B	0.30179	0.112;0.027	T	0.14783	-1.0460	10	0.07030	T	0.85	-3.3721	18.1064	0.89521	0.0:0.0:1.0:0.0	.	336;333	A6NEV3;Q9BQI5	.;SGIP1_HUMAN	L	337;336;336;333	ENSP00000237247:V337L;ENSP00000360076:V333L	ENSP00000237247:V337L	V	+	1	0	SGIP1	66920322	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	2.385000	0.44371	2.570000	0.86706	0.455000	0.32223	GTG		0.592	SGIP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000025395.4	NM_032291		48	108	1	0	7.88023e-25	0.01441	1.24558e-24	48	108				
DPYD	1806	broad.mit.edu	37	1	97839179	97839179	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr1:97839179C>A	ENST00000370192.3	-	16	2096	c.1996G>T	c.(1996-1998)Gag>Tag	p.E666*		NM_000110.3	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase	666					beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase catabolic process (GO:0006145)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymidine catabolic process (GO:0006214)|thymine catabolic process (GO:0006210)|UMP biosynthetic process (GO:0006222)|uracil catabolic process (GO:0006212)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|dihydroorotate dehydrogenase activity (GO:0004152)|dihydropyrimidine dehydrogenase (NADP+) activity (GO:0017113)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)	p.E666*(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(18)|lung(30)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	83		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Flavin adenine dinucleotide(DB03147)|Fluorouracil(DB00544)	AAATTTAACTCCAGGGCATCT	0.428																																							uc001drv.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)|skin(3)|breast(2)	8						c.(1996-1998)GAG>TAG		dihydropyrimidine dehydrogenase isoform 1	Capecitabine(DB01101)|Enfuvirtide(DB00109)						62.0	59.0	60.0					1																	97839179		2203	4300	6503	SO:0001587	stop_gained	1806				'de novo' pyrimidine base biosynthetic process|purine base catabolic process|thymidine catabolic process|thymine catabolic process|UMP biosynthetic process|uracil catabolic process	cytosol	4 iron, 4 sulfur cluster binding|dihydroorotate oxidase activity|dihydropyrimidine dehydrogenase (NADP+) activity|electron carrier activity|flavin adenine dinucleotide binding|metal ion binding|NADP binding|protein homodimerization activity	g.chr1:97839179C>A	U20938	CCDS30777.1, CCDS53346.1	1p22	2014-09-17			ENSG00000188641	ENSG00000188641	1.3.1.2		3012	protein-coding gene	gene with protein product		612779				7713523	Standard	NM_000110		Approved	DPD	uc001drv.3	Q12882	OTTHUMG00000039683	ENST00000370192.3:c.1996G>T	1.37:g.97839179C>A	ENSP00000359211:p.Glu666*						p.E666*	NM_000110	NP_000101	Q12882	DPYD_HUMAN		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	16	2133	-		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)	666			Uracil binding (Potential).		A2RRQ2|A2RRQ3|A8K5A2|A8MWG9|B1AN21|E9PFN1|Q16694|Q16761|Q32NB0|Q96HL6|Q96TH1	Nonsense_Mutation	SNP	ENST00000370192.3	37	c.1996G>T	CCDS30777.1	.	.	.	.	.	.	.	.	.	.	C	41	8.846170	0.98976	.	.	ENSG00000188641	ENST00000370192	.	.	.	5.57	5.57	0.84162	.	0.049931	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-19.6105	19.9003	0.96983	0.0:1.0:0.0:0.0	.	.	.	.	X	666	.	ENSP00000359211:E666X	E	-	1	0	DPYD	97611767	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.094000	0.76944	2.776000	0.95493	0.585000	0.79938	GAG		0.428	DPYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095698.3	NM_000110		10	33	1	0	1.08611e-07	0.010729	1.27471e-07	10	33				
CTTNBP2NL	55917	broad.mit.edu	37	1	112999135	112999135	+	Missense_Mutation	SNP	C	C	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr1:112999135C>A	ENST00000271277.6	+	6	1246	c.1021C>A	c.(1021-1023)Cct>Act	p.P341T		NM_018704.2	NP_061174.1	Q9P2B4	CT2NL_HUMAN	CTTNBP2 N-terminal like	341					negative regulation of transmembrane transport (GO:0034763)|negative regulation of transporter activity (GO:0032410)|protein dephosphorylation (GO:0006470)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	protein phosphatase 2A binding (GO:0051721)	p.P341T(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	29		all_cancers(81;0.00064)|all_epithelial(167;0.000415)|all_lung(203;0.00045)|Lung NSC(69;0.000705)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCCTGCCACTCCTGCTTACTC	0.488																																							uc001ebx.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|ovary(1)	3						c.(1021-1023)CCT>ACT		CTTNBP2 N-terminal like							146.0	148.0	148.0					1																	112999135		2203	4300	6503	SO:0001583	missense	55917					actin cytoskeleton	protein binding	g.chr1:112999135C>A	AB037854	CCDS845.1	1p13.2	2008-02-05			ENSG00000143079	ENSG00000143079			25330	protein-coding gene	gene with protein product		615100				10718198	Standard	NM_018704		Approved	DKFZp547A023	uc001ebx.3	Q9P2B4	OTTHUMG00000011154	ENST00000271277.6:c.1021C>A	1.37:g.112999135C>A	ENSP00000271277:p.Pro341Thr					CTTNBP2NL_uc001ebz.2_5'Flank	p.P341T	NM_018704	NP_061174	Q9P2B4	CT2NL_HUMAN		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)	6	1249	+		all_cancers(81;0.00064)|all_epithelial(167;0.000415)|all_lung(203;0.00045)|Lung NSC(69;0.000705)	341					B3KMS5|Q96B40	Missense_Mutation	SNP	ENST00000271277.6	37	c.1021C>A	CCDS845.1	.	.	.	.	.	.	.	.	.	.	C	6.175	0.400499	0.11696	.	.	ENSG00000143079	ENST00000271277	T	0.28069	1.63	5.69	1.59	0.23543	.	0.587370	0.20135	N	0.098514	T	0.08044	0.0201	L	0.44542	1.39	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.26849	-1.0091	10	0.52906	T	0.07	-4.9974	2.3009	0.04162	0.2257:0.4004:0.2359:0.1379	.	341	Q9P2B4	CT2NL_HUMAN	T	341	ENSP00000271277:P341T	ENSP00000271277:P341T	P	+	1	0	CTTNBP2NL	112800658	0.000000	0.05858	0.103000	0.21229	0.076000	0.17211	0.757000	0.26433	0.313000	0.23062	0.563000	0.77884	CCT		0.488	CTTNBP2NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030686.1	NM_018704		32	89	1	0	6.70999e-13	0.019004	9.32736e-13	32	89				
CSDE1	7812	broad.mit.edu	37	1	115273024	115273024	+	Missense_Mutation	SNP	C	C	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr1:115273024C>A	ENST00000358528.4	-	12	1637	c.1211G>T	c.(1210-1212)aGa>aTa	p.R404I	CSDE1_ENST00000534699.1_Missense_Mutation_p.R404I|CSDE1_ENST00000438362.2_Missense_Mutation_p.R450I|CSDE1_ENST00000530886.1_Missense_Mutation_p.R274I|CSDE1_ENST00000369530.1_Missense_Mutation_p.R419I|CSDE1_ENST00000339438.6_Missense_Mutation_p.R373I|CSDE1_ENST00000261443.5_Missense_Mutation_p.R373I|Y_RNA_ENST00000365030.1_RNA	NM_001007553.2	NP_001007554.1	O75534	CSDE1_HUMAN	cold shock domain containing E1, RNA-binding	404	CSD 5.				male gonad development (GO:0008584)|nuclear-transcribed mRNA catabolic process, no-go decay (GO:0070966)|regulation of transcription, DNA-templated (GO:0006355)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.R404I(2)		NS(1)|breast(4)|endometrium(11)|kidney(2)|large_intestine(12)|lung(17)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	51	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;2.21e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		AGCATGATTTCTTTGAGCAGA	0.363																																							uc001efk.2		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)	ovary(1)	1						c.(1210-1212)AGA>ATA		upstream of NRAS isoform 1							72.0	76.0	75.0					1																	115273024		2203	4300	6503	SO:0001583	missense	7812				male gonad development|regulation of transcription, DNA-dependent	cytoplasm	DNA binding|protein binding|RNA binding	g.chr1:115273024C>A		CCDS30811.1, CCDS30812.1, CCDS44197.1, CCDS55626.1	1p13.2	2011-11-02			ENSG00000009307	ENSG00000009307			29905	protein-coding gene	gene with protein product	"""upstream of NRAS"""	191510				2204029, 10048485	Standard	NM_007158		Approved	D1S155E, UNR	uc001efi.3	O75534	OTTHUMG00000012060	ENST00000358528.4:c.1211G>T	1.37:g.115273024C>A	ENSP00000351329:p.Arg404Ile					CSDE1_uc001efi.2_Missense_Mutation_p.R450I|CSDE1_uc001efj.2_RNA|CSDE1_uc001efl.2_Missense_Mutation_p.R373I|CSDE1_uc001efm.2_Missense_Mutation_p.R419I|CSDE1_uc009wgv.2_Missense_Mutation_p.R404I|CSDE1_uc001efn.2_Missense_Mutation_p.R373I	p.R404I	NM_001007553	NP_001007554	O75534	CSDE1_HUMAN		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	12	1677	-	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;2.21e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)	404			CSD 5.		A8K281|E9PGZ0|G5E9Q2|O94961|Q5TF04|Q5TF05|Q68DF1|Q68DI9|Q9Y2S4	Missense_Mutation	SNP	ENST00000358528.4	37	c.1211G>T	CCDS30812.1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.953956	0.92660	.	.	ENSG00000009307	ENST00000339438;ENST00000438362;ENST00000358528;ENST00000261443;ENST00000530886;ENST00000369530;ENST00000534699	.	.	.	5.85	5.85	0.93711	Cold shock protein (1);Nucleic acid-binding, OB-fold-like (1);Cold-shock protein, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.75332	0.3835	M	0.64170	1.965	0.80722	D	1	D;D;D	0.76494	0.999;0.997;0.994	D;D;D	0.87578	0.998;0.995;0.975	T	0.76127	-0.3073	9	0.87932	D	0	-14.4496	20.1731	0.98165	0.0:1.0:0.0:0.0	.	419;404;450	E9PGZ0;O75534;G5E9Q2	.;CSDE1_HUMAN;.	I	373;450;404;373;274;419;404	.	ENSP00000261443:R373I	R	-	2	0	CSDE1	115074547	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.487000	0.81328	2.768000	0.95171	0.655000	0.94253	AGA		0.363	CSDE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033397.1	NM_007158		12	40	1	0	0.000978159	0.010729	0.00104765	12	40				
TCHHL1	126637	broad.mit.edu	37	1	152059800	152059800	+	Nonsense_Mutation	SNP	G	G	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr1:152059800G>A	ENST00000368806.1	-	3	422	c.358C>T	c.(358-360)Cag>Tag	p.Q120*		NM_001008536.1	NP_001008536.1	Q5QJ38	TCHL1_HUMAN	trichohyalin-like 1	120							calcium ion binding (GO:0005509)	p.Q120*(1)		breast(4)|endometrium(1)|kidney(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(1)|skin(7)|stomach(1)	60	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.246)			ACTGTCCACTGACCATCTCCG	0.453																																							uc001ezo.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|skin(1)	2						c.(358-360)CAG>TAG		trichohyalin-like 1							182.0	154.0	164.0					1																	152059800		2203	4300	6503	SO:0001587	stop_gained	126637						calcium ion binding	g.chr1:152059800G>A		CCDS30857.1	1q21.3	2011-10-11	2004-10-05	2006-01-27	ENSG00000182898	ENSG00000182898		"""S100 calcium binding proteins"""	31796	protein-coding gene	gene with protein product			"""S100 calcium binding protein A17"""	S100A17, THHL1			Standard	NM_001008536		Approved		uc001ezo.1	Q5QJ38	OTTHUMG00000013058	ENST00000368806.1:c.358C>T	1.37:g.152059800G>A	ENSP00000357796:p.Gln120*						p.Q120*	NM_001008536	NP_001008536	Q5QJ38	TCHL1_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.246)		3	423	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		120					B2RPK8|Q5VTJ9	Nonsense_Mutation	SNP	ENST00000368806.1	37	c.358C>T	CCDS30857.1	.	.	.	.	.	.	.	.	.	.	.	16.88	3.246023	0.59103	.	.	ENSG00000182898	ENST00000368806	.	.	.	5.39	3.51	0.40186	.	0.201713	0.24907	N	0.034656	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	4.0E-4	7.5484	0.27781	0.1911:0.0:0.8089:0.0	.	.	.	.	X	120	.	ENSP00000357796:Q120X	Q	-	1	0	TCHHL1	150326424	0.530000	0.26330	0.027000	0.17364	0.009000	0.06853	2.971000	0.49248	1.262000	0.44165	0.563000	0.77884	CAG		0.453	TCHHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036638.2	XM_060104		18	107	0	0	0	0.006122	0	18	107				
SMG5	23381	broad.mit.edu	37	1	156222815	156222815	+	Missense_Mutation	SNP	T	T	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr1:156222815T>A	ENST00000361813.5	-	18	2701	c.2557A>T	c.(2557-2559)Atg>Ttg	p.M853L	SMG5_ENST00000368267.5_Intron	NM_015327.2	NP_056142.2	Q9UPR3	SMG5_HUMAN	SMG5 nonsense mediated mRNA decay factor	853					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)	p.M853L(1)		NS(1)|breast(3)|endometrium(8)|kidney(2)|large_intestine(7)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	48	Hepatocellular(266;0.158)					TAGGGAGACATGGCTGACTGG	0.632																																							uc001foc.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)|pancreas(1)	5						c.(2557-2559)ATG>TTG		SMG5 homolog nonsense mediated mRNA decay							85.0	64.0	71.0					1																	156222815		2203	4300	6503	SO:0001583	missense	23381				mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation	cytoplasm|nucleus	protein phosphatase 2A binding	g.chr1:156222815T>A	AB029012	CCDS1137.1	1q21	2013-07-02	2013-07-02		ENSG00000198952	ENSG00000198952			24644	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog B (S. cerevisiae)"""	610962	"""smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans)"""			12676087, 12699629	Standard	NM_015327		Approved	KIAA1089, LPTS-RP1, LPTSRP1, RP11-54H19.7, SMG-5, EST1B	uc001foc.4	Q9UPR3	OTTHUMG00000017491	ENST00000361813.5:c.2557A>T	1.37:g.156222815T>A	ENSP00000355261:p.Met853Leu					SMG5_uc009wrv.2_Missense_Mutation_p.M338L	p.M853L	NM_015327	NP_056142	Q9UPR3	SMG5_HUMAN			18	2706	-	Hepatocellular(266;0.158)		853					D3DVB7|Q5QJE7|Q659C7|Q8IXC0|Q8IY09|Q96IJ7	Missense_Mutation	SNP	ENST00000361813.5	37	c.2557A>T	CCDS1137.1	.	.	.	.	.	.	.	.	.	.	T	14.15	2.449301	0.43531	.	.	ENSG00000198952	ENST00000361813	T	0.26957	1.7	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.12305	0.0299	N	0.11427	0.14	0.80722	D	1	P;B	0.45283	0.855;0.008	P;B	0.57101	0.813;0.005	T	0.04565	-1.0942	10	0.02654	T	1	-26.234	15.4788	0.75508	0.0:0.0:0.0:1.0	.	122;853	Q96SX4;Q9UPR3	.;SMG5_HUMAN	L	853	ENSP00000355261:M853L	ENSP00000355261:M853L	M	-	1	0	SMG5	154489439	1.000000	0.71417	0.973000	0.42090	0.989000	0.77384	7.233000	0.78125	2.333000	0.79357	0.533000	0.62120	ATG		0.632	SMG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046308.1	NM_015327		6	13	0	0	0	0.00308	0	6	13				
VHLL	391104	broad.mit.edu	37	1	156268936	156268936	+	Silent	SNP	C	C	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr1:156268936C>A	ENST00000339922.3	-	1	492	c.45G>T	c.(43-45)gcG>gcT	p.A15A		NM_001004319.2	NP_001004319.1	Q6RSH7	VHLL_HUMAN	von Hippel-Lindau tumor suppressor-like	15								p.A15A(1)		endometrium(1)|lung(2)|ovary(1)	4	Hepatocellular(266;0.158)					CCTGGGTGCCCGCCTGGGCCT	0.617																																							uc001fok.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(43-45)GCG>GCT		von Hippel-Lindau tumor suppressor-like							44.0	49.0	48.0					1																	156268936		2203	4300	6503	SO:0001819	synonymous_variant	391104				protein ubiquitination	nucleus		g.chr1:156268936C>A			1q22	2013-09-24			ENSG00000189030	ENSG00000189030			30666	protein-coding gene	gene with protein product			"""VHL pseudogene"""	VHLP		14757845	Standard	NM_001004319		Approved	VLP	uc001fok.3	Q6RSH7	OTTHUMG00000024058	ENST00000339922.3:c.45G>T	1.37:g.156268936C>A							p.A15A	NM_001004319	NP_001004319	Q6RSH7	VHLL_HUMAN			1	493	-	Hepatocellular(266;0.158)		15					A1L4M4	Silent	SNP	ENST00000339922.3	37	c.45G>T																																																																																					0.617	VHLL-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000060590.3	NM_001004319		15	102	1	0	4.14922e-12	0.004007	5.68704e-12	15	102				
FCRL5	83416	broad.mit.edu	37	1	157514257	157514257	+	Silent	SNP	G	G	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr1:157514257G>T	ENST00000361835.3	-	5	796	c.639C>A	c.(637-639)acC>acA	p.T213T	FCRL5_ENST00000356953.4_Silent_p.T213T|FCRL5_ENST00000368189.3_Silent_p.T213T|FCRL5_ENST00000368191.3_Silent_p.T128T|FCRL5_ENST00000368190.3_Silent_p.T213T	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	213	Ig-like C2-type 2.				negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)		p.T213T(1)		breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				GAGAGAGCTGGGTCTCACAGG	0.557																																							uc001fqu.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|breast(2)|central_nervous_system(1)	6						c.(637-639)ACC>ACA		Fc receptor-like 5							96.0	98.0	98.0					1																	157514257		2203	4300	6503	SO:0001819	synonymous_variant	83416					integral to membrane|plasma membrane	receptor activity	g.chr1:157514257G>T	AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.639C>A	1.37:g.157514257G>T						FCRL5_uc009wsm.2_Silent_p.T213T|FCRL5_uc010phv.1_Silent_p.T213T|FCRL5_uc010phw.1_Silent_p.T128T|FCRL5_uc001fqv.1_Silent_p.T213T|FCRL5_uc010phx.1_5'UTR	p.T213T	NM_031281	NP_112571	Q96RD9	FCRL5_HUMAN			5	797	-	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)	213			Extracellular (Potential).|Ig-like C2-type 2.		A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Silent	SNP	ENST00000361835.3	37	c.639C>A	CCDS1165.1																																																																																				0.557	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046263.1	NM_031281		30	109	1	0	3.1745e-13	0.008361	4.50871e-13	30	109				
OR10J3	441911	broad.mit.edu	37	1	159284274	159284274	+	Missense_Mutation	SNP	G	G	C			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr1:159284274G>C	ENST00000332217.5	-	1	175	c.176C>G	c.(175-177)cCc>cGc	p.P59R		NM_001004467.1	NP_001004467.1	Q5JRS4	O10J3_HUMAN	olfactory receptor, family 10, subfamily J, member 3	59						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P59R(1)		breast(2)|endometrium(7)|kidney(4)|large_intestine(7)|lung(19)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	47	all_hematologic(112;0.0429)					GAAGTACATGGGGGTGTGAAG	0.468																																							uc010piu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(175-177)CCC>CGC		olfactory receptor, family 10, subfamily J,							200.0	199.0	200.0					1																	159284274		2203	4300	6503	SO:0001583	missense	441911				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:159284274G>C		CCDS30909.1	1q23.2	2012-08-09		2004-03-10	ENSG00000196266	ENSG00000196266		"""GPCR / Class A : Olfactory receptors"""	14992	protein-coding gene	gene with protein product				OR10J3P			Standard	NM_001004467		Approved		uc010piu.2	Q5JRS4	OTTHUMG00000037233	ENST00000332217.5:c.176C>G	1.37:g.159284274G>C	ENSP00000331789:p.Pro59Arg						p.P59R	NM_001004467	NP_001004467	Q5JRS4	O10J3_HUMAN			1	176	-	all_hematologic(112;0.0429)		59			Helical; Name=2; (Potential).			Missense_Mutation	SNP	ENST00000332217.5	37	c.176C>G	CCDS30909.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.051018	0.75960	.	.	ENSG00000196266	ENST00000332217	T	0.02032	4.49	5.4	5.4	0.78164	GPCR, rhodopsin-like superfamily (1);	0.000000	0.30901	U	0.008657	T	0.21921	0.0528	H	0.99454	4.575	0.49051	D	0.999749	D	0.89917	1.0	D	0.87578	0.998	T	0.49082	-0.8976	10	0.87932	D	0	.	16.7112	0.85386	0.0:0.0:1.0:0.0	.	59	Q5JRS4	O10J3_HUMAN	R	59	ENSP00000331789:P59R	ENSP00000331789:P59R	P	-	2	0	OR10J3	157550898	1.000000	0.71417	0.999000	0.59377	0.841000	0.47740	9.500000	0.97977	2.802000	0.96397	0.561000	0.74099	CCC		0.468	OR10J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090629.1			54	57	0	0	0	0.01441	0	54	57				
ADCY10	55811	broad.mit.edu	37	1	167798572	167798572	+	Missense_Mutation	SNP	T	T	C			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr1:167798572T>C	ENST00000367851.4	-	26	3867	c.3683A>G	c.(3682-3684)aAg>aGg	p.K1228R	ADCY10_ENST00000367848.1_Missense_Mutation_p.K1136R|ADCY10_ENST00000545172.1_Missense_Mutation_p.K1075R	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)	1228					cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)	p.K1228R(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						GGCATAATACTTGCAGTGAAA	0.423																																							uc001ger.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|ovary(1)	3						c.(3682-3684)AAG>AGG		adenylate cyclase 10							95.0	95.0	95.0					1																	167798572		2203	4300	6503	SO:0001583	missense	55811				intracellular signal transduction|spermatogenesis	cytoskeleton|cytosol|perinuclear region of cytoplasm|plasma membrane|soluble fraction	adenylate cyclase activity|ATP binding|magnesium ion binding	g.chr1:167798572T>C	AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.3683A>G	1.37:g.167798572T>C	ENSP00000356825:p.Lys1228Arg					ADCY10_uc009wvj.2_RNA|ADCY10_uc009wvk.2_Missense_Mutation_p.K1136R|ADCY10_uc010plj.1_Missense_Mutation_p.K1075R	p.K1228R	NM_018417	NP_060887	Q96PN6	ADCYA_HUMAN			26	3981	-			1228					B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	Missense_Mutation	SNP	ENST00000367851.4	37	c.3683A>G	CCDS1265.1	.	.	.	.	.	.	.	.	.	.	T	11.55	1.672510	0.29693	.	.	ENSG00000143199	ENST00000545172;ENST00000271426;ENST00000367851;ENST00000367848	T;T;T	0.35421	1.31;1.32;1.32	5.52	5.52	0.82312	.	0.179163	0.39759	N	0.001280	T	0.41442	0.1159	L	0.55103	1.725	0.28803	N	0.898683	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.994	T	0.35599	-0.9782	9	0.28530	T	0.3	-23.0715	12.0551	0.53529	0.0:0.0:0.0:1.0	.	1136;1228	Q96PN6-2;Q96PN6	.;ADCYA_HUMAN	R	1075;129;1228;1136	ENSP00000441992:K1075R;ENSP00000356825:K1228R;ENSP00000356822:K1136R	ENSP00000271426:K129R	K	-	2	0	ADCY10	166065196	1.000000	0.71417	0.946000	0.38457	0.011000	0.07611	2.366000	0.44204	2.100000	0.63781	0.523000	0.50628	AAG		0.423	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083663.1	NM_018417		20	67	0	0	0	0.007413	0	20	67				
XCL2	6846	broad.mit.edu	37	1	168510283	168510283	+	Missense_Mutation	SNP	C	C	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr1:168510283C>A	ENST00000367819.2	-	3	284	c.252G>T	c.(250-252)atG>atT	p.M84I		NM_003175.3	NP_003166.1	Q9UBD3	XCL2_HUMAN	chemokine (C motif) ligand 2	84					blood circulation (GO:0008015)|cell chemotaxis (GO:0060326)|immune response (GO:0006955)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)	p.M84I(1)		large_intestine(1)|lung(6)|ovary(1)	8	all_hematologic(923;0.215)					ATTTCCTGTCCATGCTCCTGA	0.488																																							uc001gfn.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(250-252)ATG>ATT		chemokine (C motif) ligand 2 precursor							269.0	210.0	230.0					1																	168510283		2203	4300	6503	SO:0001583	missense	6846				blood circulation|chemotaxis|immune response|signal transduction	extracellular space	chemokine activity	g.chr1:168510283C>A	BC070309	CCDS1273.1	1q24.2	2013-02-28	2002-08-22	2002-08-23	ENSG00000143185	ENSG00000143185		"""Endogenous ligands"""	10646	protein-coding gene	gene with protein product		604828	"""small inducible cytokine subfamily C, member 2"""	SCYC2		7875320	Standard	NM_003175		Approved	SCM-1b	uc001gfn.4	Q9UBD3	OTTHUMG00000034549	ENST00000367819.2:c.252G>T	1.37:g.168510283C>A	ENSP00000356793:p.Met84Ile						p.M84I	NM_003175	NP_003166	Q9UBD3	XCL2_HUMAN			3	285	-	all_hematologic(923;0.215)		84						Missense_Mutation	SNP	ENST00000367819.2	37	c.252G>T	CCDS1273.1	.	.	.	.	.	.	.	.	.	.	C	1.650	-0.514169	0.04200	.	.	ENSG00000143185	ENST00000367819	T	0.03553	3.89	2.35	-3.71	0.04424	Chemokine interleukin-8-like domain (2);	1.402110	0.04179	N	0.326192	T	0.00524	0.0017	N	0.04508	-0.205	0.23243	N	0.998054	B	0.06786	0.001	B	0.06405	0.002	T	0.48019	-0.9071	9	0.34782	T	0.22	0.5528	2.8848	0.05658	0.2013:0.3701:0.0:0.4286	.	84	Q9UBD3	XCL2_HUMAN	I	84	ENSP00000356793:M84I	ENSP00000356793:M84I	M	-	3	0	XCL2	166776907	0.002000	0.14202	0.000000	0.03702	0.178000	0.23041	-0.120000	0.10660	-1.134000	0.02899	0.184000	0.17185	ATG		0.488	XCL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083613.1	NM_003175		25	27	1	0	7.26314e-15	0.007291	1.06237e-14	25	27				
CACNA1E	777	broad.mit.edu	37	1	181706779	181706779	+	Missense_Mutation	SNP	G	G	C			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr1:181706779G>C	ENST00000367573.2	+	23	3541	c.3541G>C	c.(3541-3543)Gag>Cag	p.E1181Q	CACNA1E_ENST00000357570.5_Missense_Mutation_p.E1132Q|CACNA1E_ENST00000360108.3_Missense_Mutation_p.E1162Q|CACNA1E_ENST00000526775.1_Missense_Mutation_p.E1162Q|CACNA1E_ENST00000358338.5_Missense_Mutation_p.E1113Q|CACNA1E_ENST00000367570.1_Missense_Mutation_p.E1181Q|CACNA1E_ENST00000367567.4_Missense_Mutation_p.E788Q	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1181					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)	p.E1181Q(2)		NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						GACCAACTCGGAGCGCAACAA	0.597																																							uc001gow.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|central_nervous_system(2)|pancreas(1)	6						c.(3541-3543)GAG>CAG		calcium channel, voltage-dependent, R type,							93.0	98.0	96.0					1																	181706779		2056	4208	6264	SO:0001583	missense	777				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity	g.chr1:181706779G>C	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.3541G>C	1.37:g.181706779G>C	ENSP00000356545:p.Glu1181Gln					CACNA1E_uc009wxs.2_Missense_Mutation_p.E1069Q|CACNA1E_uc001gox.1_Missense_Mutation_p.E407Q|CACNA1E_uc009wxt.2_Missense_Mutation_p.E407Q	p.E1181Q	NM_000721	NP_000712	Q15878	CAC1E_HUMAN			23	3706	+			1181			Extracellular (Potential).|III.		B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	37	c.3541G>C	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	G	17.39	3.377136	0.61735	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.97575	-4.44;-4.44;-4.44;-4.44;-4.44;-4.44;-4.44	5.58	5.58	0.84498	.	0.282729	0.40640	N	0.001050	D	0.94411	0.8202	N	0.25380	0.74	0.37221	D	0.905256	B;B;B	0.32620	0.02;0.016;0.378	B;B;B	0.33042	0.123;0.011;0.157	D	0.94619	0.7811	10	0.56958	D	0.05	.	19.1775	0.93609	0.0:0.0:1.0:0.0	.	1162;1181;1181	Q15878-2;Q15878;Q15878-3	.;CAC1E_HUMAN;.	Q	1181;1162;1132;1113;788;1162;1181	ENSP00000356542:E1181Q;ENSP00000434814:E1162Q;ENSP00000350183:E1132Q;ENSP00000351101:E1113Q;ENSP00000356539:E788Q;ENSP00000353222:E1162Q;ENSP00000356545:E1181Q	ENSP00000350183:E1132Q	E	+	1	0	CACNA1E	179973402	0.998000	0.40836	0.992000	0.48379	0.931000	0.56810	2.659000	0.46741	2.614000	0.88457	0.555000	0.69702	GAG		0.597	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721		45	65	0	0	0	0.013114	0	45	65				
IARS2	55699	broad.mit.edu	37	1	220307776	220307776	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr1:220307776G>T	ENST00000302637.5	+	15	1974	c.1870G>T	c.(1870-1872)Gga>Tga	p.G624*	IARS2_ENST00000366922.1_Nonsense_Mutation_p.G552*|snoU13_ENST00000459443.1_RNA	NM_018060.3	NP_060530.3	Q9NSE4	SYIM_HUMAN	isoleucyl-tRNA synthetase 2, mitochondrial	624					gene expression (GO:0010467)|isoleucyl-tRNA aminoacylation (GO:0006428)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|isoleucine-tRNA ligase activity (GO:0004822)	p.G624*(1)		NS(1)|breast(1)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(7)|lung(17)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51				GBM - Glioblastoma multiforme(131;0.0554)	L-Isoleucine(DB00167)	GTACTTGGAAGGAAAAGACCA	0.353																																							uc001hmc.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|skin(2)	4						c.(1870-1872)GGA>TGA		mitochondrial isoleucine tRNA synthetase	L-Isoleucine(DB00167)						80.0	78.0	79.0					1																	220307776		2203	4300	6503	SO:0001587	stop_gained	55699				isoleucyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|isoleucine-tRNA ligase activity	g.chr1:220307776G>T	AK022665	CCDS1523.1	1q41	2011-07-01	2007-02-26		ENSG00000067704	ENSG00000067704	6.1.1.5	"""Aminoacyl tRNA synthetases / Class I"""	29685	protein-coding gene	gene with protein product	"""isoleucine tRNA ligase 2, mitochondrial"""	612801					Standard	NM_018060		Approved	FLJ10326	uc001hmc.3	Q9NSE4	OTTHUMG00000037287	ENST00000302637.5:c.1870G>T	1.37:g.220307776G>T	ENSP00000303279:p.Gly624*					IARS2_uc001hmd.2_5'Flank	p.G624*	NM_018060	NP_060530	Q9NSE4	SYIM_HUMAN		GBM - Glioblastoma multiforme(131;0.0554)	15	1974	+			624					B2RPG8|Q1M2P9|Q6PI85|Q7L439|Q86WU9|Q96D91|Q9H9Q8|Q9NW42	Nonsense_Mutation	SNP	ENST00000302637.5	37	c.1870G>T	CCDS1523.1	.	.	.	.	.	.	.	.	.	.	G	41	8.557330	0.98861	.	.	ENSG00000067704	ENST00000366922;ENST00000302637	.	.	.	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-0.6362	18.0397	0.89315	0.0:0.0:1.0:0.0	.	.	.	.	X	552;624	.	ENSP00000303279:G624X	G	+	1	0	IARS2	218374399	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.098000	0.94202	2.421000	0.82119	0.655000	0.94253	GGA		0.353	IARS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_018060		27	29	1	0	7.38237e-10	0.00632	9.15787e-10	27	29				
TP53BP2	7159	broad.mit.edu	37	1	223990466	223990466	+	Silent	SNP	C	C	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr1:223990466C>T	ENST00000343537.7	-	8	1254	c.963G>A	c.(961-963)aaG>aaA	p.K321K	TP53BP2_ENST00000391879.2_5'Flank|TP53BP2_ENST00000498843.1_5'Flank|TP53BP2_ENST00000391878.2_Silent_p.K192K	NM_001031685.2	NP_001026855.2	Q13625	ASPP2_HUMAN	tumor protein p53 binding protein 2	315					cell cycle (GO:0007049)|central nervous system development (GO:0007417)|embryo development ending in birth or egg hatching (GO:0009792)|heart development (GO:0007507)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)|positive regulation of signal transduction (GO:0009967)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|SH3/SH2 adaptor activity (GO:0005070)	p.K192K(1)|p.K321K(1)		NS(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(131;0.0958)		GAGCTGCCTTCTTCTTCCACA	0.468																																							uc010pvb.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|lung(1)	3						c.(961-963)AAG>AAA		tumor protein p53 binding protein, 2 isoform 1							189.0	186.0	187.0					1																	223990466		2203	4300	6503	SO:0001819	synonymous_variant	7159				apoptosis|cell cycle|induction of apoptosis|negative regulation of cell cycle|signal transduction	nucleus|perinuclear region of cytoplasm	NF-kappaB binding|protein binding|SH3 domain binding|SH3/SH2 adaptor activity	g.chr1:223990466C>T	U09582	CCDS1538.1, CCDS44319.1	1q41	2014-06-24	2014-06-24		ENSG00000143514	ENSG00000143514		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	12000	protein-coding gene	gene with protein product		602143	"""tumor protein p53-binding protein, 2"""			8668206, 8016121	Standard	NM_005426		Approved	PPP1R13A, ASPP2, 53BP2	uc010pvb.2	Q13625	OTTHUMG00000037379	ENST00000343537.7:c.963G>A	1.37:g.223990466C>T						TP53BP2_uc001hod.2_Silent_p.K192K|TP53BP2_uc010puz.1_5'Flank|TP53BP2_uc010pva.1_5'Flank	p.K321K	NM_001031685	NP_001026855	Q13625	ASPP2_HUMAN		GBM - Glioblastoma multiforme(131;0.0958)	8	1255	-			315					B4DG66|Q12892|Q86X75|Q96KQ3	Silent	SNP	ENST00000343537.7	37	c.963G>A	CCDS44319.1																																																																																				0.468	TP53BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090985.3	NM_001031685, NM_005426		42	274	0	0	0	0.01441	0	42	274				
URB2	9816	broad.mit.edu	37	1	229781606	229781606	+	Splice_Site	SNP	G	G	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr1:229781606G>T	ENST00000258243.2	+	6	3932	c.3796G>T	c.(3796-3798)Gct>Tct	p.A1266S		NM_014777.2	NP_055592.2	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	1266						aggresome (GO:0016235)|nucleolus (GO:0005730)|nucleus (GO:0005634)		p.A1266S(1)		breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(6)	73						CTTGCCCCAGGCTGTTGTGTC	0.547																																							uc001hts.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|ovary(1)	3						c.(3796-3798)GCT>TCT		URB2 ribosome biogenesis 2 homolog							176.0	162.0	167.0					1																	229781606		2203	4300	6503	SO:0001630	splice_region_variant	9816					nucleolus		g.chr1:229781606G>T	D50923	CCDS31052.1	1q42.13	2009-11-06	2008-10-01	2008-10-01	ENSG00000135763	ENSG00000135763			28967	protein-coding gene	gene with protein product	"""nucleolar preribosomal-associated protein 1"""		"""KIAA0133"""	KIAA0133		8590280	Standard	NM_014777		Approved	NPA2, NET10	uc001hts.1	Q14146	OTTHUMG00000039464	ENST00000258243.2:c.3796-1G>T	1.37:g.229781606G>T						URB2_uc009xfd.1_Missense_Mutation_p.A1266S	p.A1266S	NM_014777	NP_055592	Q14146	URB2_HUMAN			6	3932	+			1266					Q5VYC9	Missense_Mutation	SNP	ENST00000258243.2	37	c.3796G>T	CCDS31052.1	.	.	.	.	.	.	.	.	.	.	G	10.45	1.353890	0.24512	.	.	ENSG00000135763	ENST00000258243	T	0.30981	1.51	5.43	5.43	0.79202	.	0.331114	0.31660	N	0.007276	T	0.24890	0.0604	N	0.24115	0.695	0.42326	D	0.992274	P	0.40970	0.734	B	0.40165	0.321	T	0.02301	-1.1180	9	.	.	.	-5.5633	17.7613	0.88465	0.0:0.0:1.0:0.0	.	1266	Q14146	URB2_HUMAN	S	1266	ENSP00000258243:A1266S	.	A	+	1	0	URB2	227848229	0.999000	0.42202	0.968000	0.41197	0.486000	0.33341	2.878000	0.48515	2.709000	0.92574	0.491000	0.48974	GCT		0.547	URB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095232.1	NM_014777	Missense_Mutation	91	111	1	0	1.55023e-36	0.01441	2.55332e-36	91	111				
SIPA1L2	57568	broad.mit.edu	37	1	232650286	232650286	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr1:232650286G>A	ENST00000366630.1	-	2	1158	c.800C>T	c.(799-801)gCc>gTc	p.A267V	SIPA1L2_ENST00000262861.4_Missense_Mutation_p.A267V			Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like 2	267					regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)	p.A267V(1)		NS(1)|breast(5)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(49)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	103		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				CATCAGGAGGGCACTGTCCAC	0.493																																							uc001hvg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(2)|pancreas(1)|skin(1)	6						c.(799-801)GCC>GTC		signal-induced proliferation-associated 1 like							66.0	66.0	66.0					1																	232650286		1897	4122	6019	SO:0001583	missense	57568				regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity	g.chr1:232650286G>A	AB037810	CCDS41474.1	1q42.2	2008-02-05			ENSG00000116991	ENSG00000116991			23800	protein-coding gene	gene with protein product		611609					Standard	NM_020808		Approved	KIAA1389	uc001hvg.3	Q9P2F8	OTTHUMG00000037820	ENST00000366630.1:c.800C>T	1.37:g.232650286G>A	ENSP00000355589:p.Ala267Val						p.A267V	NM_020808	NP_065859	Q9P2F8	SI1L2_HUMAN			1	958	-		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)	267					Q2TV88|Q5VXR7|Q5VXR8|Q641Q4|Q8NA38|Q96DZ3|Q9H9F6	Missense_Mutation	SNP	ENST00000366630.1	37	c.800C>T	CCDS41474.1	.	.	.	.	.	.	.	.	.	.	G	9.743	1.165282	0.21538	.	.	ENSG00000116991	ENST00000366630;ENST00000262861	T;T	0.78816	-1.21;-1.21	5.54	2.53	0.30540	.	0.189244	0.47852	D	0.000217	T	0.60340	0.2261	N	0.08118	0	0.37606	D	0.920753	B	0.17268	0.021	B	0.19946	0.027	T	0.52411	-0.8579	10	0.26408	T	0.33	-16.6873	16.5444	0.84410	0.0:0.3808:0.6192:0.0	.	267	Q9P2F8	SI1L2_HUMAN	V	267	ENSP00000355589:A267V;ENSP00000262861:A267V	ENSP00000262861:A267V	A	-	2	0	SIPA1L2	230716909	1.000000	0.71417	0.945000	0.38365	0.995000	0.86356	4.620000	0.61226	0.394000	0.25230	0.650000	0.86243	GCC		0.493	SIPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092318.1	XM_045839		33	50	0	0	0	0.019004	0	33	50				
ZP4	57829	broad.mit.edu	37	1	238048740	238048740	+	Missense_Mutation	SNP	G	G	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr1:238048740G>T	ENST00000366570.4	-	8	1269	c.1111C>A	c.(1111-1113)Ccc>Acc	p.P371T	RP11-193H5.1_ENST00000450451.1_RNA	NM_021186.3	NP_067009.1	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4	371	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				acrosomal vesicle exocytosis (GO:0060478)|binding of sperm to zona pellucida (GO:0007339)|intracellular signal transduction (GO:0035556)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of humoral immune response (GO:0002922)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of T cell proliferation (GO:0042102)|protein kinase A signaling (GO:0010737)|protein kinase C signaling (GO:0070528)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	acrosin binding (GO:0032190)|signal transducer activity (GO:0004871)	p.P371T(1)		breast(6)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(42)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	73	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			TCAGTGCTGGGTGTTGCCCAA	0.537																																					NSCLC(166;160 2029 11600 18754 19936)	NSCLC(166;160 2029 11600 18754 19936)	uc001hym.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(1111-1113)CCC>ACC		zona pellucida glycoprotein 4 preproprotein							67.0	69.0	69.0					1																	238048740		2203	4300	6503	SO:0001583	missense	57829				acrosomal vesicle exocytosis|negative regulation of binding of sperm to zona pellucida|positive regulation of acrosome reaction|positive regulation of humoral immune response|positive regulation of protein kinase activity|positive regulation of T cell proliferation|protein kinase A signaling cascade|protein kinase C signaling cascade	integral to membrane|intracellular|plasma membrane|proteinaceous extracellular matrix	acrosin binding|receptor activity	g.chr1:238048740G>T	U05781	CCDS1615.1	1q43	2013-01-17			ENSG00000116996	ENSG00000116996		"""Zona pellucida glycoproteins"""	15770	protein-coding gene	gene with protein product		613514				7841460	Standard	NM_021186		Approved	ZPB	uc001hym.3	Q12836	OTTHUMG00000039586	ENST00000366570.4:c.1111C>A	1.37:g.238048740G>T	ENSP00000355529:p.Pro371Thr					LOC100130331_uc010pyc.1_Intron	p.P371T	NM_021186	NP_067009	Q12836	ZP4_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		8	1111	-	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	371			ZP.|Extracellular (Potential).		B2RAE1	Missense_Mutation	SNP	ENST00000366570.4	37	c.1111C>A	CCDS1615.1	.	.	.	.	.	.	.	.	.	.	G	12.22	1.871488	0.33069	.	.	ENSG00000116996	ENST00000366570	D	0.83163	-1.69	4.98	4.98	0.66077	Endoglin/CD105 antigen conserved site (1);Endoglin/CD105 antigen subgroup (1);Zona pellucida sperm-binding protein (3);	0.137225	0.50627	D	0.000102	D	0.86777	0.6014	L	0.53561	1.675	0.37587	D	0.920053	D	0.54964	0.969	P	0.58013	0.831	D	0.87978	0.2741	10	0.40728	T	0.16	-26.5621	15.7822	0.78269	0.0:0.0:1.0:0.0	.	371	Q12836	ZP4_HUMAN	T	371	ENSP00000355529:P371T	ENSP00000355529:P371T	P	-	1	0	ZP4	236115363	0.995000	0.38212	0.107000	0.21349	0.076000	0.17211	2.501000	0.45389	2.316000	0.78162	0.655000	0.94253	CCC		0.537	ZP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095476.1			42	31	1	0	9.9998e-32	0.011902	1.60652e-31	42	31				
KIF26B	55083	broad.mit.edu	37	1	245861603	245861603	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr1:245861603C>T	ENST00000407071.2	+	13	6460	c.6020C>T	c.(6019-6021)gCc>gTc	p.A2007V	KIF26B_ENST00000366518.4_Missense_Mutation_p.A1626V	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	2007					establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.A2007V(2)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			CGAGGGGGTGCCAGCAAGGTG	0.642																																							uc001ibf.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)	3						c.(6019-6021)GCC>GTC		kinesin family member 26B							20.0	23.0	22.0					1																	245861603		1989	4161	6150	SO:0001583	missense	55083				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr1:245861603C>T	AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.6020C>T	1.37:g.245861603C>T	ENSP00000385545:p.Ala2007Val						p.A2007V	NM_018012	NP_060482	Q2KJY2	KI26B_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.022)		13	6460	+	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		2007					Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Missense_Mutation	SNP	ENST00000407071.2	37	c.6020C>T	CCDS44342.1	.	.	.	.	.	.	.	.	.	.	C	11.29	1.595776	0.28445	.	.	ENSG00000162849	ENST00000407071;ENST00000366518;ENST00000413001	T;T	0.77358	-1.09;-1.09	5.35	-6.36	0.01969	.	.	.	.	.	T	0.52500	0.1738	N	0.08118	0	0.09310	N	1	B	0.20671	0.047	B	0.14023	0.01	T	0.36672	-0.9738	9	0.31617	T	0.26	.	9.6038	0.39622	0.608:0.1168:0.2752:0.0	.	2007	Q2KJY2	KI26B_HUMAN	V	2007;1626;1623	ENSP00000385545:A2007V;ENSP00000355475:A1626V	ENSP00000355475:A1626V	A	+	2	0	KIF26B	243928226	0.001000	0.12720	0.052000	0.19188	0.510000	0.34073	0.017000	0.13399	-1.060000	0.03189	-0.165000	0.13383	GCC		0.642	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381037.1	XM_371354		14	14	0	0	0	0.003163	0	14	14				
OR2T12	127064	broad.mit.edu	37	1	248458842	248458842	+	Silent	SNP	T	T	C			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr1:248458842T>C	ENST00000317996.1	-	1	38	c.39A>G	c.(37-39)ctA>ctG	p.L13L		NM_001004692.1	NP_001004692.1	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T, member 12	13						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L13L(1)		endometrium(4)|kidney(3)|large_intestine(3)|lung(25)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)			TAAAGAGTCCTAGGAGAATAA	0.448																																							uc010pzj.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|ovary(1)	3						c.(37-39)CTA>CTG		olfactory receptor, family 2, subfamily T,							77.0	78.0	78.0					1																	248458842		2203	4298	6501	SO:0001819	synonymous_variant	127064				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248458842T>C	BK004485	CCDS31110.1	1q44	2012-08-09			ENSG00000177201	ENSG00000177201		"""GPCR / Class A : Olfactory receptors"""	19592	protein-coding gene	gene with protein product							Standard	NM_001004692		Approved		uc010pzj.2	Q8NG77	OTTHUMG00000040457	ENST00000317996.1:c.39A>G	1.37:g.248458842T>C							p.L13L	NM_001004692	NP_001004692	Q8NG77	O2T12_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0201)		1	39	-	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		13			Extracellular (Potential).			Silent	SNP	ENST00000317996.1	37	c.39A>G	CCDS31110.1																																																																																				0.448	OR2T12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097353.1	NM_001004692		4	125	0	0	0	0.014758	0	4	125				
OR2T4	127074	broad.mit.edu	37	1	248525370	248525370	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr1:248525370G>A	ENST00000366475.1	+	1	488	c.488G>A	c.(487-489)cGt>cAt	p.R163H		NM_001004696.1	NP_001004696.1	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T, member 4	163						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R163H(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(2)|lung(47)	56	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CATCCTCTCCGTTACCCTGTC	0.527																																							uc001ieh.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(487-489)CGT>CAT		olfactory receptor, family 2, subfamily T,							266.0	232.0	244.0					1																	248525370		2203	4300	6503	SO:0001583	missense	127074				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248525370G>A	BK004464	CCDS31113.1	1q44	2012-08-09			ENSG00000196944	ENSG00000196944		"""GPCR / Class A : Olfactory receptors"""	15016	protein-coding gene	gene with protein product							Standard	NM_001004696		Approved	OR2T4Q	uc001ieh.1	Q8NH00	OTTHUMG00000040453	ENST00000366475.1:c.488G>A	1.37:g.248525370G>A	ENSP00000355431:p.Arg163His						p.R163H	NM_001004696	NP_001004696	Q8NH00	OR2T4_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	488	+	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		163			Cytoplasmic (Potential).		Q6IEZ8	Missense_Mutation	SNP	ENST00000366475.1	37	c.488G>A	CCDS31113.1	.	.	.	.	.	.	.	.	.	.	g	0.639	-0.814195	0.02798	.	.	ENSG00000196944	ENST00000366475	T	0.02258	4.37	3.48	-6.95	0.01628	GPCR, rhodopsin-like superfamily (1);	0.615971	0.14496	N	0.316072	T	0.00724	0.0024	N	0.01431	-0.87	0.09310	N	0.999999	B	0.15719	0.014	B	0.12156	0.007	T	0.40831	-0.9542	10	0.20046	T	0.44	.	5.7593	0.18190	0.4844:0.0:0.2484:0.2672	.	163	Q8NH00	OR2T4_HUMAN	H	163	ENSP00000355431:R163H	ENSP00000355431:R163H	R	+	2	0	OR2T4	246591993	0.000000	0.05858	0.000000	0.03702	0.088000	0.18126	-4.538000	0.00219	-2.452000	0.00542	-1.381000	0.01174	CGT		0.527	OR2T4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097349.2	NM_001004696		116	154	0	0	0	0.01441	0	116	154				
OR2G6	391211	broad.mit.edu	37	1	248684959	248684959	+	Silent	SNP	C	C	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr1:248684959C>A	ENST00000343414.4	+	1	44	c.12C>A	c.(10-12)acC>acA	p.T4T		NM_001013355.1	NP_001013373.1	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G, member 6	4						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T4T(1)		NS(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(40)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TGGAGGAAACCAACAACAGCT	0.398																																							uc001ien.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(1)	3						c.(10-12)ACC>ACA		olfactory receptor, family 2, subfamily G,							126.0	119.0	122.0					1																	248684959		2203	4300	6503	SO:0001819	synonymous_variant	391211				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248684959C>A		CCDS31119.1	1q44	2012-08-09			ENSG00000188558	ENSG00000188558		"""GPCR / Class A : Olfactory receptors"""	27019	protein-coding gene	gene with protein product							Standard	NM_001013355		Approved		uc001ien.1	Q5TZ20	OTTHUMG00000040462	ENST00000343414.4:c.12C>A	1.37:g.248684959C>A							p.T4T	NM_001013355	NP_001013373	Q5TZ20	OR2G6_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	12	+	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	4			Extracellular (Potential).		B2RP33	Silent	SNP	ENST00000343414.4	37	c.12C>A	CCDS31119.1																																																																																				0.398	OR2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097358.1	XM_372842		14	109	1	0	4.36969e-10	0.016723	5.52554e-10	14	109				
SPAG6	9576	broad.mit.edu	37	10	22680767	22680767	+	Missense_Mutation	SNP	G	G	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr10:22680767G>T	ENST00000376624.3	+	8	1257	c.1115G>T	c.(1114-1116)cGg>cTg	p.R372L	SPAG6_ENST00000376603.2_Missense_Mutation_p.R448L|RP11-301N24.3_ENST00000422675.1_RNA|SPAG6_ENST00000490361.1_3'UTR|SPAG6_ENST00000538630.1_Missense_Mutation_p.R347L|SPAG6_ENST00000376601.1_Missense_Mutation_p.R133L|SPAG6_ENST00000313311.6_Missense_Mutation_p.R372L	NM_001253855.1|NM_012443.3	NP_001240784.1|NP_036575.1	O75602	SPAG6_HUMAN	sperm associated antigen 6	372					cell projection organization (GO:0030030)|spermatid development (GO:0007286)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|motile cilium (GO:0031514)|nucleus (GO:0005634)		p.R372L(1)		breast(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|prostate(1)|skin(2)	27						GAACACGCACGGGCTGTTGCA	0.448																																							uc001iri.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(1114-1116)CGG>CTG		sperm associated antigen 6 isoform 1							119.0	111.0	113.0					10																	22680767		2203	4300	6503	SO:0001583	missense	9576				cell projection organization|spermatid development	axoneme|cilium|cytoplasm|flagellum|microtubule	binding	g.chr10:22680767G>T	AF079363	CCDS7139.1, CCDS7140.1, CCDS58071.1, CCDS73072.1	10p12.31	2014-01-21			ENSG00000077327	ENSG00000077327		"""Armadillo repeat containing"""	11215	protein-coding gene	gene with protein product	"""axoneme central apparatus protein"""	605730				10493827	Standard	NM_012443		Approved	Repro-SA-1, pf16, CT141	uc001iri.3	O75602	OTTHUMG00000017808	ENST00000376624.3:c.1115G>T	10.37:g.22680767G>T	ENSP00000365811:p.Arg372Leu					SPAG6_uc001irj.2_Missense_Mutation_p.R372L|SPAG6_uc010qct.1_Missense_Mutation_p.R342L|SPAG6_uc009xkh.2_Missense_Mutation_p.R350L	p.R372L	NM_012443	NP_036575	O75602	SPAG6_HUMAN			8	1257	+			372			ARM 8.		A8K1I8|B4DXZ4|Q5VUX5|Q5VUX6|Q5VUX7|Q6FI74|Q8NHQ6	Missense_Mutation	SNP	ENST00000376624.3	37	c.1115G>T	CCDS7139.1	.	.	.	.	.	.	.	.	.	.	G	13.25	2.181639	0.38511	.	.	ENSG00000077327	ENST00000376624;ENST00000376603;ENST00000376601;ENST00000538630;ENST00000456231;ENST00000313311	T;T;T;T;T;T	0.61859	0.07;0.07;0.73;0.07;0.73;0.07	5.56	3.69	0.42338	Armadillo-like helical (1);Armadillo-type fold (1);	0.114076	0.64402	D	0.000016	T	0.48169	0.1485	L	0.40543	1.245	0.33957	D	0.645162	B;B;B;B	0.14438	0.001;0.009;0.01;0.003	B;B;B;B	0.19391	0.004;0.023;0.025;0.006	T	0.54390	-0.8301	10	0.40728	T	0.16	-10.721	12.0312	0.53399	0.1408:0.0:0.8592:0.0	.	347;448;372;372	B4DXZ4;O75602-3;O75602-2;O75602	.;.;.;SPAG6_HUMAN	L	372;448;133;347;133;372	ENSP00000365811:R372L;ENSP00000365788:R448L;ENSP00000365786:R133L;ENSP00000441325:R347L;ENSP00000411111:R133L;ENSP00000323599:R372L	ENSP00000323599:R372L	R	+	2	0	SPAG6	22720773	0.999000	0.42202	0.224000	0.23877	0.979000	0.70002	4.289000	0.59013	0.690000	0.31570	0.585000	0.79938	CGG		0.448	SPAG6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047187.1			15	18	1	0	6.31663e-08	0.003163	7.50339e-08	15	18				
ARHGAP12	94134	broad.mit.edu	37	10	32098161	32098161	+	Missense_Mutation	SNP	G	G	A	rs573378187		TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr10:32098161G>A	ENST00000344936.2	-	17	2359	c.2125C>T	c.(2125-2127)Cat>Tat	p.H709Y	ARHGAP12_ENST00000375245.4_Missense_Mutation_p.H657Y|ARHGAP12_ENST00000375250.5_Missense_Mutation_p.H679Y|ARHGAP12_ENST00000311380.4_Missense_Mutation_p.H657Y|ARHGAP12_ENST00000396144.4_Missense_Mutation_p.H704Y|ARHGAP12_ENST00000492028.1_5'UTR	NM_001270697.1|NM_018287.6	NP_001257626.1|NP_060757.4	Q8IWW6	RHG12_HUMAN	Rho GTPase activating protein 12	709	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				morphogenesis of an epithelial sheet (GO:0002011)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.H709Y(1)		NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(11)|lung(10)|skin(1)|urinary_tract(2)	31		Prostate(175;0.0199)				ATCTTACCATGATTGACTGCA	0.333																																							uc001ivz.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2125-2127)CAT>TAT		Rho GTPase activating protein 12							124.0	118.0	120.0					10																	32098161		2203	4300	6503	SO:0001583	missense	94134				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity	g.chr10:32098161G>A	AY033594	CCDS7170.1, CCDS59214.1, CCDS59215.1, CCDS59216.1, CCDS73082.1	10p11.22	2013-01-10			ENSG00000165322	ENSG00000165322		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	16348	protein-coding gene	gene with protein product		610577				11854031	Standard	NM_001270695		Approved	FLJ20737, FLJ10971, FLJ21785	uc001ivz.2	Q8IWW6	OTTHUMG00000017911	ENST00000344936.2:c.2125C>T	10.37:g.32098161G>A	ENSP00000345808:p.His709Tyr					ARHGAP12_uc001ivy.1_Missense_Mutation_p.H655Y|ARHGAP12_uc009xls.2_Missense_Mutation_p.H660Y|ARHGAP12_uc001iwb.1_Missense_Mutation_p.H702Y|ARHGAP12_uc001iwc.1_Missense_Mutation_p.H677Y|ARHGAP12_uc009xlq.1_Missense_Mutation_p.H630Y|ARHGAP12_uc001ivw.1_5'Flank|ARHGAP12_uc001ivx.1_5'UTR	p.H709Y	NM_018287	NP_060757	Q8IWW6	RHG12_HUMAN			17	2395	-		Prostate(175;0.0199)	709			Rho-GAP.		B1ANY0|B1ANY1|B1ANY2|Q504X1|Q86UB3|Q8IWW7|Q8N3L1|Q9NT76	Missense_Mutation	SNP	ENST00000344936.2	37	c.2125C>T	CCDS7170.1	.	.	.	.	.	.	.	.	.	.	G	18.36	3.607930	0.66558	.	.	ENSG00000165322	ENST00000311380;ENST00000375250;ENST00000344936;ENST00000396144;ENST00000375245	T;T;T;T;T	0.18502	2.21;2.21;2.21;2.21;2.21	5.96	5.96	0.96718	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.39682	0.1087	L	0.50993	1.605	0.80722	D	1	D;D;D;D;D	0.76494	0.994;0.998;0.999;0.999;0.998	D;D;D;D;D	0.70716	0.943;0.95;0.97;0.97;0.95	T	0.03315	-1.1049	10	0.87932	D	0	.	20.4043	0.99006	0.0:0.0:1.0:0.0	.	662;679;704;709;657	Q1RLN5;Q8IWW6-2;Q504X1;Q8IWW6;Q8IWW6-3	.;.;.;RHG12_HUMAN;.	Y	657;679;709;704;657	ENSP00000310984:H657Y;ENSP00000364399:H679Y;ENSP00000345808:H709Y;ENSP00000379448:H704Y;ENSP00000364394:H657Y	ENSP00000310984:H657Y	H	-	1	0	ARHGAP12	32138167	1.000000	0.71417	1.000000	0.80357	0.391000	0.30476	5.517000	0.67061	2.823000	0.97156	0.650000	0.86243	CAT		0.333	ARHGAP12-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047465.1			12	40	0	0	0	0.010729	0	12	40				
OR13A1	79290	broad.mit.edu	37	10	45799763	45799763	+	Silent	SNP	C	C	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr10:45799763C>A	ENST00000553795.1	-	4	416	c.108G>T	c.(106-108)tcG>tcT	p.S36S	OR13A1_ENST00000374401.2_Silent_p.S36S|OR13A1_ENST00000536058.1_Silent_p.S36S	NM_001004297.2	NP_001004297.2	Q8NGR1	O13A1_HUMAN	olfactory receptor, family 13, subfamily A, member 1	36						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S36S(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|skin(2)|urinary_tract(1)	19						CTGGGTGCTCCGAAAAGCCCT	0.527																																							uc001jcc.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(106-108)TCG>TCT		olfactory receptor, family 13, subfamily A,							68.0	79.0	75.0					10																	45799763		2203	4300	6503	SO:0001819	synonymous_variant	79290				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr10:45799763C>A	AB065728	CCDS31188.1	10q11.21	2012-10-03			ENSG00000256574	ENSG00000256574		"""GPCR / Class A : Olfactory receptors"""	14772	protein-coding gene	gene with protein product							Standard	NM_001004297		Approved		uc001jcc.1	Q8NGR1	OTTHUMG00000018080	ENST00000553795.1:c.108G>T	10.37:g.45799763C>A						OR13A1_uc001jcd.1_Silent_p.S32S	p.S36S	NM_001004297	NP_001004297	Q8NGR1	O13A1_HUMAN			4	417	-			36			Extracellular (Potential).		Q2M3M4|Q5VV57|Q6IFH5|Q6ZMN6	Silent	SNP	ENST00000553795.1	37	c.108G>T	CCDS31188.1																																																																																				0.527	OR13A1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047779.2	NM_001004297		23	15	1	0	3.10358e-05	0.014323	3.43673e-05	23	15				
SYT15	83849	broad.mit.edu	37	10	46968638	46968638	+	Missense_Mutation	SNP	G	G	C			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr10:46968638G>C	ENST00000374321.4	-	3	364	c.298C>G	c.(298-300)Cca>Gca	p.P100A	SYT15_ENST00000503753.1_Missense_Mutation_p.P100A|SYT15_ENST00000374325.3_Missense_Mutation_p.P100A|RP11-38L15.3_ENST00000506914.1_RNA|SYT15_ENST00000374323.4_Missense_Mutation_p.P153A	NM_031912.4	NP_114118.2	Q9BQS2	SYT15_HUMAN	synaptotagmin XV	100						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				cervix(1)|endometrium(5)|kidney(2)|lung(5)	13						GGGTCCCATGGGGCATCGGCC	0.667																																					Ovarian(57;1152 1428 19651 37745)	Ovarian(57;1152 1428 19651 37745)	uc001jea.2		NA																	0					0						c.(298-300)CCA>GCA		synaptotagmin XV isoform a							41.0	50.0	47.0					10																	46968638		2104	4225	6329	SO:0001583	missense	83849					integral to membrane|plasma membrane		g.chr10:46968638G>C	AJ303363	CCDS73103.1, CCDS73104.1	10q11.1	2013-01-21			ENSG00000204176	ENSG00000204176		"""Synaptotagmins"""	17167	protein-coding gene	gene with protein product		608081				11543631	Standard	NM_031912		Approved	CHR10SYT	uc001jea.3	Q9BQS2	OTTHUMG00000018103	ENST00000374321.4:c.298C>G	10.37:g.46968638G>C	ENSP00000363441:p.Pro100Ala					SYT15_uc001jdz.2_Missense_Mutation_p.P100A|SYT15_uc001jeb.2_5'UTR|SYT15_uc010qfp.1_5'Flank	p.P100A	NM_031912	NP_114118	Q9BQS2	SYT15_HUMAN			3	451	-			100			Cytoplasmic (Potential).		A5D6W8|Q5VY53|Q5VY55|Q7Z439|Q7Z440	Missense_Mutation	SNP	ENST00000374321.4	37	c.298C>G	CCDS44376.1	.	.	.	.	.	.	.	.	.	.	.	10.68	1.419262	0.25552	.	.	ENSG00000204176	ENST00000416127;ENST00000374325;ENST00000503753;ENST00000374323;ENST00000374321	T;T;T;T	0.14516	2.5;2.5;2.88;2.73	4.59	2.56	0.30785	.	0.567793	0.18390	N	0.142690	T	0.16811	0.0404	M	0.65975	2.015	0.09310	N	1	B;B	0.18610	0.017;0.029	B;B	0.20577	0.008;0.03	T	0.14448	-1.0472	10	0.48119	T	0.1	.	11.9378	0.52884	0.0:0.4421:0.5579:0.0	.	100;100	Q9BQS2;Q9BQS2-2	SYT15_HUMAN;.	A	100;100;100;153;100	ENSP00000363445:P100A;ENSP00000427607:P100A;ENSP00000363443:P153A;ENSP00000363441:P100A	ENSP00000363441:P100A	P	-	1	0	SYT15	46388644	0.000000	0.05858	0.002000	0.10522	0.025000	0.11179	0.486000	0.22340	1.284000	0.44531	0.555000	0.69702	CCA		0.667	SYT15-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367008.1	NM_031912		12	12	0	0	0	0.013537	0	12	12				
LDB3	11155	broad.mit.edu	37	10	88476273	88476273	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr10:88476273C>A	ENST00000361373.4	+	9	1442	c.1421C>A	c.(1420-1422)tCg>tAg	p.S474*	LDB3_ENST00000352360.5_Nonsense_Mutation_p.S217*|LDB3_ENST00000458213.2_Nonsense_Mutation_p.S364*|LDB3_ENST00000263066.6_Nonsense_Mutation_p.S364*|LDB3_ENST00000429277.2_Nonsense_Mutation_p.S479*	NM_007078.2	NP_009009.1			LIM domain binding 3									p.S479*(1)|p.S474*(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|soft_tissue(1)	25						CCTGCACCCTCGGTGGCCTAC	0.657																																							uc001kdv.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(1)	1						c.(1420-1422)TCG>TAG		LIM domain binding 3 isoform 1							64.0	69.0	68.0					10																	88476273		2203	4300	6503	SO:0001587	stop_gained	11155					cytoskeleton|perinuclear region of cytoplasm|pseudopodium	zinc ion binding	g.chr10:88476273C>A	AB014513	CCDS7377.1, CCDS41544.1, CCDS41545.1, CCDS53549.1, CCDS53550.1	10q22.3-q23.2	2014-09-17			ENSG00000122367	ENSG00000122367			15710	protein-coding gene	gene with protein product	"""cypher"", ""oracle"", ""Z-band alternatively spliced PDZ motif protein"""	605906	"""cardiomyopathy, dilated 1C (autosomal dominant)"""	CMD1C		10427098, 23271734, 23996002, 14662268	Standard	NM_001080114		Approved	PDLIM6, KIAA0613, ZASP	uc001kdv.3	O75112	OTTHUMG00000018655	ENST00000361373.4:c.1421C>A	10.37:g.88476273C>A	ENSP00000355296:p.Ser474*					LDB3_uc010qml.1_Nonsense_Mutation_p.S411*|LDB3_uc010qmm.1_Nonsense_Mutation_p.S479*|LDB3_uc001kdu.2_Nonsense_Mutation_p.S364*|LDB3_uc009xsz.2_Nonsense_Mutation_p.S103*|LDB3_uc009xta.1_5'Flank	p.S474*	NM_007078	NP_009009	O75112	LDB3_HUMAN			9	1444	+			474						Nonsense_Mutation	SNP	ENST00000361373.4	37	c.1421C>A	CCDS7377.1	.	.	.	.	.	.	.	.	.	.	C	14.97	2.693071	0.48202	.	.	ENSG00000122367	ENST00000539402;ENST00000429277;ENST00000458213;ENST00000352360;ENST00000263066;ENST00000361373	.	.	.	4.16	4.16	0.48862	.	.	.	.	.	.	.	.	.	.	.	0.44247	D	0.997091	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.7769	0.23624	0.1781:0.7199:0.0:0.102	.	.	.	.	X	395;479;364;217;364;474	.	ENSP00000263066:S364X	S	+	2	0	LDB3	88466253	0.004000	0.15560	0.019000	0.16419	0.013000	0.08279	1.985000	0.40668	2.033000	0.60031	0.650000	0.86243	TCG		0.657	LDB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000049160.2			46	25	1	0	2.24722e-20	0.01441	3.49568e-20	46	25				
TLL2	7093	broad.mit.edu	37	10	98129870	98129870	+	Silent	SNP	G	G	A	rs186470524		TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr10:98129870G>A	ENST00000357947.3	-	20	3090	c.2865C>T	c.(2863-2865)gaC>gaT	p.D955D		NM_012465.3	NP_036597.1	Q9Y6L7	TLL2_HUMAN	tolloid-like 2	955	CUB 5. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.D955D(1)		NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(15)|lung(22)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	58		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		TGTCGTAGCCGTCGTAGGCTT	0.637																																							uc001kml.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|pancreas(1)|skin(1)	3						c.(2863-2865)GAC>GAT		tolloid-like 2 precursor							58.0	52.0	54.0					10																	98129870		2203	4300	6503	SO:0001819	synonymous_variant	7093				cell differentiation|multicellular organismal development|proteolysis	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding	g.chr10:98129870G>A	AF059516	CCDS7449.1	10q23-q24	2008-07-29			ENSG00000095587	ENSG00000095587			11844	protein-coding gene	gene with protein product		606743				10516436	Standard	NM_012465		Approved		uc001kml.2	Q9Y6L7	OTTHUMG00000018833	ENST00000357947.3:c.2865C>T	10.37:g.98129870G>A							p.D955D	NM_012465	NP_036597	Q9Y6L7	TLL2_HUMAN		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)	20	3091	-		Colorectal(252;0.0846)	955			CUB 5.		A6NDK0|Q2M1H1|Q6PJN5|Q9UQ00	Silent	SNP	ENST00000357947.3	37	c.2865C>T	CCDS7449.1																																																																																				0.637	TLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049608.1			21	16	0	0	0	0.008871	0	21	16				
EDRF1	26098	broad.mit.edu	37	10	127426555	127426555	+	Silent	SNP	A	A	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr10:127426555A>T	ENST00000356792.4	+	14	2059	c.1827A>T	c.(1825-1827)ctA>ctT	p.L609L	C10orf137_ENST00000337623.3_Silent_p.L575L	NM_001202438.1	NP_001189367.1	Q3B7T1	EDRF1_HUMAN		609					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.L575L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(20)|ovary(8)|pancreas(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	61		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)				GCTATGTTCTAGAGGTAAGTT	0.338																																							uc001liq.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|large_intestine(3)|lung(2)	10						c.(1825-1827)CTA>CTT		erythroid differentiation-related factor 1							180.0	171.0	174.0					10																	127426555		2203	4300	6503	SO:0001819	synonymous_variant	26098				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	binding	g.chr10:127426555A>T																												ENST00000356792.4:c.1827A>T	10.37:g.127426555A>T						C10orf137_uc001lin.2_Silent_p.L575L|C10orf137_uc001lio.1_Silent_p.L575L|C10orf137_uc001lip.1_Silent_p.L313L|C10orf137_uc001lir.2_Silent_p.L103L|C10orf137_uc001lis.1_5'Flank	p.L609L	NM_015608	NP_056423	Q3B7T1	EDRF1_HUMAN			14	2120	+		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)	609					B2RC65|Q3KR40|Q4G190|Q5VZQ4|Q8IZ74|Q9Y3W4	Silent	SNP	ENST00000356792.4	37	c.1827A>T	CCDS55733.1																																																																																				0.338	C10orf137-007	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388539.1			37	32	0	0	0	0.006999	0	37	32				
KRTAP5-6	440023	broad.mit.edu	37	11	1718520	1718520	+	Silent	SNP	G	G	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr11:1718520G>T	ENST00000382160.1	+	1	96	c.45G>T	c.(43-45)ggG>ggT	p.G15G		NM_001012416.1	NP_001012416.1	Q6L8G9	KRA56_HUMAN	keratin associated protein 5-6	15						keratin filament (GO:0045095)		p.G15G(1)		endometrium(1)|large_intestine(2)|lung(6)|skin(1)	10		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CCGGCTGTGGGGGCTGTGGCT	0.652																																							uc001lua.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(43-45)GGG>GGT		keratin associated protein 5-6							65.0	83.0	77.0					11																	1718520		2200	4298	6498	SO:0001819	synonymous_variant	440023					keratin filament		g.chr11:1718520G>T	AB126075	CCDS31332.1	11p15.5	2008-02-05			ENSG00000205864	ENSG00000205864		"""Keratin associated proteins"""	23600	protein-coding gene	gene with protein product						15144888	Standard	NM_001012416		Approved	KRTAP5.6	uc001lua.3	Q6L8G9	OTTHUMG00000043932	ENST00000382160.1:c.45G>T	11.37:g.1718520G>T							p.G15G	NM_001012416	NP_001012416	Q6L8G9	KRA56_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)	1	96	+		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	15					A1L452	Silent	SNP	ENST00000382160.1	37	c.45G>T	CCDS31332.1																																																																																				0.652	KRTAP5-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102339.2			33	120	1	0	6.50621e-10	0.013726	8.1224e-10	33	120				
CCDC73	493860	broad.mit.edu	37	11	32674751	32674751	+	Missense_Mutation	SNP	T	T	C			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr11:32674751T>C	ENST00000335185.5	-	12	900	c.857A>G	c.(856-858)cAt>cGt	p.H286R	CCDC73_ENST00000534415.1_Intron	NM_001008391.2	NP_001008392.2	Q6ZRK6	CCD73_HUMAN	coiled-coil domain containing 73	286								p.H286R(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	51	Breast(20;0.112)					CTGCTGCATATGTTGGAAAGA	0.303																																							uc001mtv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(856-858)CAT>CGT		sarcoma antigen NY-SAR-79							141.0	126.0	131.0					11																	32674751		1839	4095	5934	SO:0001583	missense	493860							g.chr11:32674751T>C	AK128159	CCDS41630.1	11p13	2006-02-11			ENSG00000186714	ENSG00000186714			23261	protein-coding gene	gene with protein product		612328					Standard	NM_001008391		Approved	NY-SAR-79	uc001mtv.4	Q6ZRK6	OTTHUMG00000166279	ENST00000335185.5:c.857A>G	11.37:g.32674751T>C	ENSP00000335325:p.His286Arg					CCDC73_uc001mtw.1_Intron	p.H286R	NM_001008391	NP_001008392	Q6ZRK6	CCD73_HUMAN			12	901	-	Breast(20;0.112)		286			Potential.		Q6P5Q7|Q6ZMW0|Q86WE7	Missense_Mutation	SNP	ENST00000335185.5	37	c.857A>G	CCDS41630.1	.	.	.	.	.	.	.	.	.	.	T	11.83	1.756628	0.31137	.	.	ENSG00000186714	ENST00000335185	.	.	.	5.63	2.02	0.26589	.	0.659626	0.15412	N	0.263713	T	0.44477	0.1295	L	0.40543	1.245	0.80722	D	1	B	0.14438	0.01	B	0.16722	0.016	T	0.14615	-1.0466	9	0.25106	T	0.35	.	8.3284	0.32171	0.0:0.3531:0.0:0.6469	.	286	Q6ZRK6	CCD73_HUMAN	R	286	.	ENSP00000335325:H286R	H	-	2	0	CCDC73	32631327	1.000000	0.71417	0.994000	0.49952	0.989000	0.77384	0.810000	0.27183	0.093000	0.17368	0.397000	0.26171	CAT		0.303	CCDC73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388874.2	NM_001008391		29	42	0	0	0	0.007291	0	29	42				
MADD	8567	broad.mit.edu	37	11	47345883	47345883	+	Missense_Mutation	SNP	A	A	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr11:47345883A>T	ENST00000311027.5	+	32	4775	c.4610A>T	c.(4609-4611)aAa>aTa	p.K1537I	MADD_ENST00000405573.2_Missense_Mutation_p.K347I|MADD_ENST00000407859.3_Missense_Mutation_p.K1455I|MADD_ENST00000395336.3_Missense_Mutation_p.K1537I|MADD_ENST00000395344.3_Missense_Mutation_p.K1431I|MADD_ENST00000349238.3_Missense_Mutation_p.K1498I|MADD_ENST00000402799.1_Missense_Mutation_p.K1435I|MADD_ENST00000406482.1_Missense_Mutation_p.K1435I|MADD_ENST00000402192.2_Missense_Mutation_p.K1477I|MADD_ENST00000342922.4_Missense_Mutation_p.K1478I	NM_003682.3	NP_003673.3			MAP-kinase activating death domain									p.K1537I(1)		breast(7)|central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(19)|lung(26)|ovary(6)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	84				Lung(87;0.182)		CAAAGCATCAAACCCGGTGAG	0.582																																							uc001ner.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(4)|central_nervous_system(2)	11						c.(4609-4611)AAA>ATA		MAP-kinase activating death domain-containing							63.0	66.0	65.0					11																	47345883		2201	4298	6499	SO:0001583	missense	8567				activation of MAPK activity|apoptosis|cell surface receptor linked signaling pathway|regulation of apoptosis|regulation of cell cycle	cytoplasm|integral to membrane|plasma membrane	death receptor binding|protein kinase activator activity|Rab guanyl-nucleotide exchange factor activity	g.chr11:47345883A>T	AB002356	CCDS7930.1, CCDS7931.1, CCDS7932.1, CCDS41642.1, CCDS44586.1, CCDS44587.1, CCDS44588.1, CCDS44589.1, CCDS44590.1	11p11.2	2012-10-04			ENSG00000110514	ENSG00000110514		"""DENN/MADD domain containing"""	6766	protein-coding gene	gene with protein product		603584				9115275, 9796103	Standard	NM_130476		Approved	DENN, KIAA0358, RAB3GEP	uc001ner.1	Q8WXG6	OTTHUMG00000150350	ENST00000311027.5:c.4610A>T	11.37:g.47345883A>T	ENSP00000310933:p.Lys1537Ile					MADD_uc001neq.2_Missense_Mutation_p.K1478I|MADD_uc001nev.1_Missense_Mutation_p.K1435I|MADD_uc001nes.1_Missense_Mutation_p.K1455I|MADD_uc001net.1_Missense_Mutation_p.K1498I|MADD_uc009yln.1_Missense_Mutation_p.K1431I|MADD_uc001neu.1_Missense_Mutation_p.K1435I|MADD_uc001nex.2_Missense_Mutation_p.K1537I|MADD_uc001nez.2_Missense_Mutation_p.K1434I|MADD_uc001new.2_Missense_Mutation_p.K1477I|MADD_uc009ylo.2_Missense_Mutation_p.K451I	p.K1537I	NM_003682	NP_003673	Q8WXG6	MADD_HUMAN		Lung(87;0.182)	32	4801	+			1537						Missense_Mutation	SNP	ENST00000311027.5	37	c.4610A>T	CCDS7930.1	.	.	.	.	.	.	.	.	.	.	A	26.2	4.718806	0.89205	.	.	ENSG00000110514	ENST00000342922;ENST00000395342;ENST00000402799;ENST00000406482;ENST00000349238;ENST00000311027;ENST00000407859;ENST00000395344;ENST00000395336;ENST00000402192;ENST00000405573	T;T;T;T;T;T;T;T;T;T	0.48522	3.45;3.33;3.34;3.46;3.42;3.33;3.33;3.41;3.46;0.81	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.56396	0.1982	L	0.36672	1.1	0.80722	D	1	P;D;D;D;D;D;D;D;D;D;D	0.76494	0.954;0.988;0.988;0.991;0.993;0.993;0.993;0.999;0.996;0.992;0.999	P;P;P;D;P;P;P;D;P;P;D	0.69654	0.809;0.694;0.694;0.965;0.839;0.839;0.839;0.954;0.907;0.901;0.954	T	0.49341	-0.8950	10	0.16896	T	0.51	-15.4296	16.0068	0.80367	1.0:0.0:0.0:0.0	.	347;1431;1431;1537;1435;1435;1435;1498;1455;1537;1478	F8W8U2;B5MEE5;A8K8S7;Q8WXG6-7;F8W9P9;Q8WXG6-6;Q8WXG6-5;Q8WXG6-2;Q8WXG6-4;Q8WXG6;Q8WXG6-3	.;.;.;.;.;.;.;.;.;MADD_HUMAN;.	I	1478;1435;1435;1435;1498;1537;1455;1431;1537;1477;347	ENSP00000343902:K1478I;ENSP00000385585:K1435I;ENSP00000384435:K1435I;ENSP00000304505:K1498I;ENSP00000310933:K1537I;ENSP00000384204:K1455I;ENSP00000378753:K1431I;ENSP00000378745:K1537I;ENSP00000384287:K1477I;ENSP00000384483:K347I	ENSP00000310933:K1537I	K	+	2	0	MADD	47302459	1.000000	0.71417	0.995000	0.50966	0.994000	0.84299	8.952000	0.93031	2.186000	0.69663	0.454000	0.30748	AAA		0.582	MADD-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317746.1			4	22	0	0	0	0.009096	0	4	22				
MYBPC3	4607	broad.mit.edu	37	11	47374196	47374196	+	Start_Codon_SNP	SNP	C	C	T	rs397516045		TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr11:47374196C>T	ENST00000545968.1	-	1	57	c.3G>A	c.(1-3)atG>atA	p.M1I	MYBPC3_ENST00000399249.2_Start_Codon_SNP_p.M1I|MYBPC3_ENST00000256993.4_Start_Codon_SNP_p.M1I	NM_000256.3	NP_000247.2	Q14896	MYPC3_HUMAN	myosin binding protein C, cardiac	1					cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|heart morphogenesis (GO:0003007)|muscle filament sliding (GO:0030049)|myosin filament assembly (GO:0031034)|positive regulation of ATPase activity (GO:0032781)|regulation of heart rate (GO:0002027)|regulation of muscle filament sliding (GO:0032971)|regulation of striated muscle contraction (GO:0006942)|sarcomere organization (GO:0045214)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	A band (GO:0031672)|C zone (GO:0014705)|cytosol (GO:0005829)|sarcomere (GO:0030017)|striated muscle myosin thick filament (GO:0005863)	ATPase activator activity (GO:0001671)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|myosin binding (GO:0017022)|myosin heavy chain binding (GO:0032036)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)	p.M1I(1)		breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(4)|lung(16)|ovary(3)|prostate(3)|urinary_tract(2)	42				Lung(87;0.176)		CCGGCTCAGGCATCCTGAGAG	0.602																																							uc001nfa.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(1-3)ATG>ATA		myosin binding protein C, cardiac							108.0	112.0	111.0					11																	47374196		1991	4172	6163	SO:0001582	initiator_codon_variant	4607				cardiac muscle contraction|cell adhesion|muscle filament sliding|regulation of muscle filament sliding|regulation of striated muscle contraction|ventricular cardiac muscle tissue morphogenesis	C zone|cytosol|striated muscle myosin thick filament	actin binding|ATPase activator activity|metal ion binding|myosin heavy chain binding|structural constituent of muscle|titin binding	g.chr11:47374196C>T	X84075	CCDS53621.1	11p11.2	2014-09-17	2001-11-28			ENSG00000134571		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7551	protein-coding gene	gene with protein product		600958	"""myosin-binding protein C, cardiac"""	CMH4		7744002, 8358441	Standard	NM_000256		Approved	MYBP-C, FHC	uc021qis.1	Q14896		ENST00000545968.1:c.3G>A	11.37:g.47374196C>T	ENSP00000442795:p.Met1Ile					SLC39A13_uc001nfd.2_5'Flank	p.M1I	NM_000256	NP_000247	Q14896	MYPC3_HUMAN		Lung(87;0.176)	1	58	-			1					A5PL00|Q16410|Q6R2F7|Q9UE27|Q9UM53	Missense_Mutation	SNP	ENST00000545968.1	37	c.3G>A	CCDS53621.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.581610	0.86748	.	.	ENSG00000134571	ENST00000545968;ENST00000399249;ENST00000256993	T;T;T	0.58358	0.34;0.34;0.39	4.48	4.48	0.54585	.	.	.	.	.	T	0.69869	0.3159	.	.	.	0.80722	D	1	P	0.45126	0.851	P	0.58391	0.838	T	0.74919	-0.3500	8	0.87932	D	0	.	16.2921	0.82757	0.0:1.0:0.0:0.0	.	1	Q14896	MYPC3_HUMAN	I	1	ENSP00000442795:M1I;ENSP00000382193:M1I;ENSP00000256993:M1I	ENSP00000256993:M1I	M	-	3	0	MYBPC3	47330772	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.365000	0.66116	2.179000	0.69175	0.563000	0.77884	ATG		0.602	MYBPC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392271.3		Missense_Mutation	20	34	0	0	0	0.012319	0	20	34				
OR4C13	283092	broad.mit.edu	37	11	49974040	49974040	+	Missense_Mutation	SNP	G	G	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr11:49974040G>T	ENST00000555099.1	+	1	98	c.66G>T	c.(64-66)caG>caT	p.Q22H		NM_001001955.2	NP_001001955.2	Q8NGP0	OR4CD_HUMAN	olfactory receptor, family 4, subfamily C, member 13	22						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Q22H(1)		autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(24)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	43						CAAAAATGCAGAAAATCATAT	0.383																																							uc010rhz.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(1)	4						c.(64-66)CAG>CAT		olfactory receptor, family 4, subfamily C,							134.0	129.0	131.0					11																	49974040		2201	4296	6497	SO:0001583	missense	283092				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:49974040G>T	AB065750	CCDS31495.1	11p11.12	2012-10-03			ENSG00000258817	ENSG00000258817		"""GPCR / Class A : Olfactory receptors"""	15169	protein-coding gene	gene with protein product							Standard	NM_001001955		Approved		uc010rhz.2	Q8NGP0	OTTHUMG00000166686	ENST00000555099.1:c.66G>T	11.37:g.49974040G>T	ENSP00000452277:p.Gln22His						p.Q22H	NM_001001955	NP_001001955	Q8NGP0	OR4CD_HUMAN			1	66	+			22			Extracellular (Potential).		A6NJJ3|B9EH30|Q6IF48|Q96R68	Missense_Mutation	SNP	ENST00000555099.1	37	c.66G>T	CCDS31495.1	.	.	.	.	.	.	.	.	.	.	.	9.807	1.182171	0.21787	.	.	ENSG00000258817	ENST00000555099	T	0.00601	6.29	2.95	-0.108	0.13588	.	0.000000	0.34156	U	0.004201	T	0.01835	0.0058	M	0.82193	2.58	0.25274	N	0.989499	D	0.63880	0.993	D	0.64687	0.928	T	0.34625	-0.9821	9	.	.	.	.	5.577	0.17228	0.5532:0.0:0.4468:0.0	.	22	Q8NGP0	OR4CD_HUMAN	H	22	ENSP00000452277:Q22H	.	Q	+	3	2	OR4C13	49930616	0.004000	0.15560	0.807000	0.32361	0.139000	0.21198	1.026000	0.30103	0.112000	0.17975	0.195000	0.17529	CAG		0.383	OR4C13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391103.1	NM_001001955		22	111	1	0	3.83957e-06	0.016522	4.35003e-06	22	111				
OR4C11	219429	broad.mit.edu	37	11	55371129	55371129	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr11:55371129G>A	ENST00000302231.4	-	1	745	c.721C>T	c.(721-723)Cac>Tac	p.H241Y		NM_001004700.2	NP_001004700.2	Q6IEV9	OR4CB_HUMAN	olfactory receptor, family 4, subfamily C, member 11	241						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H241Y(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(23)|ovary(1)|prostate(1)|skin(1)	33						ACAATTATGTGAGACGTGCAA	0.403																																							uc010rii.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(721-723)CAC>TAC		olfactory receptor, family 4, subfamily C,							72.0	61.0	65.0					11																	55371129		2179	4003	6182	SO:0001583	missense	219429				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55371129G>A	AB065774	CCDS31503.1	11q11	2012-08-09		2004-03-10	ENSG00000172188	ENSG00000172188		"""GPCR / Class A : Olfactory receptors"""	15167	protein-coding gene	gene with protein product				OR4C11P			Standard	NM_001004700		Approved		uc010rii.2	Q6IEV9	OTTHUMG00000165290	ENST00000302231.4:c.721C>T	11.37:g.55371129G>A	ENSP00000306651:p.His241Tyr						p.H241Y	NM_001004700	NP_001004700	Q6IEV9	OR4CB_HUMAN			1	721	-			241			Helical; Name=6; (Potential).		B9EIL4|Q8NGL8	Missense_Mutation	SNP	ENST00000302231.4	37	c.721C>T	CCDS31503.1	.	.	.	.	.	.	.	.	.	.	G	9.562	1.118790	0.20877	.	.	ENSG00000172188	ENST00000302231	T	0.00314	8.14	4.34	3.43	0.39272	GPCR, rhodopsin-like superfamily (1);	0.000000	0.51477	U	0.000095	T	0.00468	0.0015	H	0.95950	3.745	0.36895	D	0.890096	B	0.29188	0.236	B	0.28784	0.094	T	0.38243	-0.9670	10	0.87932	D	0	.	11.6492	0.51279	0.0888:0.0:0.9112:0.0	.	241	Q6IEV9	OR4CB_HUMAN	Y	241	ENSP00000306651:H241Y	ENSP00000306651:H241Y	H	-	1	0	OR4C11	55127705	1.000000	0.71417	0.033000	0.17914	0.003000	0.03518	4.992000	0.63889	1.203000	0.43233	-0.357000	0.07601	CAC		0.403	OR4C11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383268.1	NM_001004700		36	38	0	0	0	0.007835	0	36	38				
OR4S2	219431	broad.mit.edu	37	11	55418437	55418437	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr11:55418437G>T	ENST00000312422.2	+	1	58	c.58G>T	c.(58-60)Gag>Tag	p.E20*		NM_001004059.2	NP_001004059.2	Q8NH73	OR4S2_HUMAN	olfactory receptor, family 4, subfamily S, member 2	20						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E20*(1)		endometrium(1)|kidney(2)|large_intestine(4)|lung(28)|ovary(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_epithelial(135;0.0748)				TCAGAGCCCAGAGATTGAGAA	0.373																																							uc001nhs.1		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(2)|ovary(1)	3						c.(58-60)GAG>TAG		olfactory receptor, family 4, subfamily S,							83.0	74.0	77.0					11																	55418437		2180	4012	6192	SO:0001587	stop_gained	219431				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55418437G>T	BK004390	CCDS31505.1	11q11	2012-08-09	2002-11-13	2002-11-15	ENSG00000174982	ENSG00000174982		"""GPCR / Class A : Olfactory receptors"""	15183	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily S, member 2 pseudogene"""	OR4S2P			Standard	NM_001004059		Approved	OST725	uc001nhs.1	Q8NH73	OTTHUMG00000166799	ENST00000312422.2:c.58G>T	11.37:g.55418437G>T	ENSP00000310337:p.Glu20*						p.E20*	NM_001004059	NP_001004059	Q8NH73	OR4S2_HUMAN			1	58	+		all_epithelial(135;0.0748)	20			Extracellular (Potential).		Q6IF72	Nonsense_Mutation	SNP	ENST00000312422.2	37	c.58G>T	CCDS31505.1	.	.	.	.	.	.	.	.	.	.	G	12.28	1.889501	0.33348	.	.	ENSG00000174982	ENST00000312422	.	.	.	5.36	-0.00212	0.14031	.	0.240385	0.28630	N	0.014670	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.12766	T	0.61	.	1.7873	0.03044	0.2202:0.2546:0.3953:0.1299	.	.	.	.	X	20	.	ENSP00000310337:E20X	E	+	1	0	OR4S2	55175013	0.000000	0.05858	0.001000	0.08648	0.531000	0.34715	-1.043000	0.03535	0.209000	0.20645	0.549000	0.68633	GAG		0.373	OR4S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391503.1	NM_001004059		29	50	1	0	7.01153e-11	0.007291	9.22323e-11	29	50				
OR8J1	219477	broad.mit.edu	37	11	56127726	56127726	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr11:56127726G>A	ENST00000303039.3	+	1	36	c.4G>A	c.(4-6)Gct>Act	p.A2T		NM_001005205.2	NP_001005205.2	Q8NGP2	OR8J1_HUMAN	olfactory receptor, family 8, subfamily J, member 1	2						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A2T(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(30)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	47	Esophageal squamous(21;0.00448)					CTCTGACATGGCTCCTGAAAA	0.428																																							uc010rjh.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(4-6)GCT>ACT		olfactory receptor, family 8, subfamily J,							53.0	58.0	56.0					11																	56127726		2198	4295	6493	SO:0001583	missense	219477				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56127726G>A	AB065748	CCDS31529.1	11q11	2012-08-09			ENSG00000172487	ENSG00000172487		"""GPCR / Class A : Olfactory receptors"""	14855	protein-coding gene	gene with protein product							Standard	NM_001005205		Approved		uc010rjh.2	Q8NGP2	OTTHUMG00000166859	ENST00000303039.3:c.4G>A	11.37:g.56127726G>A	ENSP00000304060:p.Ala2Thr						p.A2T	NM_001005205	NP_001005205	Q8NGP2	OR8J1_HUMAN			1	4	+	Esophageal squamous(21;0.00448)		2			Extracellular (Potential).		B2RNQ6|B9EH63|Q6IFC2|Q96RC3	Missense_Mutation	SNP	ENST00000303039.3	37	c.4G>A	CCDS31529.1	.	.	.	.	.	.	.	.	.	.	G	11.31	1.601352	0.28534	.	.	ENSG00000172487	ENST00000303039	T	0.00590	6.36	4.68	2.64	0.31445	.	0.312069	0.27917	N	0.017327	T	0.00580	0.0019	N	0.17345	0.48	0.19775	N	0.999952	P	0.41947	0.766	P	0.48488	0.579	T	0.60161	-0.7317	10	0.30854	T	0.27	.	6.4445	0.21869	0.0936:0.0:0.608:0.2984	.	2	Q8NGP2	OR8J1_HUMAN	T	2	ENSP00000304060:A2T	ENSP00000304060:A2T	A	+	1	0	OR8J1	55884302	0.824000	0.29247	1.000000	0.80357	0.101000	0.19017	0.679000	0.25291	2.313000	0.78055	0.643000	0.83706	GCT		0.428	OR8J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391606.2	NM_001005205		26	27	0	0	0	0.004656	0	26	27				
MAP3K11	4296	broad.mit.edu	37	11	65375749	65375749	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr11:65375749C>T	ENST00000530153.1	-	2	660	c.139G>A	c.(139-141)Gac>Aac	p.D47N	MAP3K11_ENST00000534432.1_5'Flank|MAP3K11_ENST00000309100.3_Missense_Mutation_p.D304N|MAP3K11_ENST00000532507.1_5'Flank					mitogen-activated protein kinase kinase kinase 11									p.D304N(1)		breast(3)|central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(14)|skin(1)	24						CTCCAGACGTCACTGCCCTTA	0.637																																							uc001oew.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(3)|lung(1)|central_nervous_system(1)|skin(1)	6						c.(910-912)GAC>AAC		mitogen-activated protein kinase kinase kinase							47.0	45.0	46.0					11																	65375749		2201	4297	6498	SO:0001583	missense	4296				activation of JUN kinase activity|cell proliferation|G1 phase of mitotic cell cycle|microtubule-based process|positive regulation of JNK cascade|protein autophosphorylation	centrosome|microtubule	ATP binding|JUN kinase kinase kinase activity|mitogen-activated protein kinase kinase kinase binding|protein homodimerization activity	g.chr11:65375749C>T		CCDS8107.1	11q13.1-q13.3	2011-06-09			ENSG00000173327	ENSG00000173327	2.7.10.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6850	protein-coding gene	gene with protein product		600050		MLK3, PTK1		9267807, 8183572	Standard	NM_002419		Approved	SPRK, MEKK11	uc001oew.3	Q16584	OTTHUMG00000166529	ENST00000530153.1:c.139G>A	11.37:g.65375749C>T	ENSP00000433886:p.Asp47Asn					MAP3K11_uc001oev.2_5'Flank|MAP3K11_uc010rol.1_Missense_Mutation_p.D47N|MAP3K11_uc001oex.1_5'UTR	p.D304N	NM_002419	NP_002410	Q16584	M3K11_HUMAN			2	1403	-			304			Protein kinase.			Missense_Mutation	SNP	ENST00000530153.1	37	c.910G>A		.	.	.	.	.	.	.	.	.	.	C	25.0	4.597226	0.87055	.	.	ENSG00000173327	ENST00000309100;ENST00000530153;ENST00000526293;ENST00000529839	D;D;D;D	0.99394	-5.82;-4.94;-4.94;-4.94	4.6	4.6	0.57074	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.99625	0.9863	H	0.97587	4.035	0.58432	D	0.999997	D	0.76494	0.999	D	0.79784	0.993	D	0.97533	1.0081	10	0.87932	D	0	.	14.9678	0.71208	0.0:1.0:0.0:0.0	.	304	Q16584	M3K11_HUMAN	N	304;47;54;47	ENSP00000309597:D304N;ENSP00000433886:D47N;ENSP00000435970:D54N;ENSP00000435237:D47N	ENSP00000309597:D304N	D	-	1	0	MAP3K11	65132325	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	7.604000	0.82830	2.397000	0.81536	0.561000	0.74099	GAC		0.637	MAP3K11-004	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000390233.2			7	31	0	0	0	0.001984	0	7	31				
XRRA1	143570	broad.mit.edu	37	11	74617397	74617397	+	Missense_Mutation	SNP	C	C	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr11:74617397C>A	ENST00000340360.6	-	10	1197	c.866G>T	c.(865-867)aGt>aTt	p.S289I	XRRA1_ENST00000321448.8_Missense_Mutation_p.S56I|XRRA1_ENST00000527087.1_Missense_Mutation_p.S289I|RP11-147I3.1_ENST00000533875.1_RNA	NM_182969.2	NP_892014.1			X-ray radiation resistance associated 1									p.S289I(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(3)	20						TTTATGGGGACTTCCCCTGCC	0.463																																							uc009yub.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(865-867)AGT>ATT		X-ray radiation resistance associated 1							113.0	110.0	111.0					11																	74617397		1946	4137	6083	SO:0001583	missense	143570				response to X-ray	cytoplasm|nucleus		g.chr11:74617397C>A	AK074152	CCDS44680.1, CCDS58159.1, CCDS58160.1	11q13.4	2010-03-19			ENSG00000166435	ENSG00000166435			18868	protein-coding gene	gene with protein product		609788				12908878, 17295261	Standard	NM_182969		Approved	FLJ00225	uc009yub.3	Q6P2D8		ENST00000340360.6:c.866G>T	11.37:g.74617397C>A	ENSP00000339918:p.Ser289Ile					XRRA1_uc001ovm.2_Intron|XRRA1_uc001ovn.2_5'UTR|XRRA1_uc001ovo.2_5'UTR|XRRA1_uc001ovq.3_Missense_Mutation_p.S289I|XRRA1_uc001ovp.3_Missense_Mutation_p.S56I|XRRA1_uc001ovr.2_5'UTR|XRRA1_uc001ovt.2_Missense_Mutation_p.S56I	p.S289I	NM_182969	NP_892014	Q6P2D8	XRRA1_HUMAN			10	1198	-			289						Missense_Mutation	SNP	ENST00000340360.6	37	c.866G>T	CCDS44680.1	.	.	.	.	.	.	.	.	.	.	C	15.95	2.983738	0.53827	.	.	ENSG00000166435	ENST00000340360;ENST00000321448;ENST00000344880;ENST00000398418;ENST00000527087	T;T;T	0.52983	0.65;1.41;0.64	5.56	0.0363	0.14191	.	0.454996	0.24091	N	0.041627	T	0.26846	0.0657	L	0.29908	0.895	0.09310	N	1	P;B;B;P	0.42203	0.468;0.069;0.16;0.773	B;B;B;B	0.38616	0.109;0.075;0.075;0.277	T	0.20075	-1.0286	10	0.66056	D	0.02	-1.1449	1.0902	0.01662	0.1573:0.4213:0.1532:0.2682	.	289;56;289;289	Q6P2D8;E9PL06;Q6P2D8-2;Q6P2D8-4	XRRA1_HUMAN;.;.;.	I	289;56;289;289;289	ENSP00000339918:S289I;ENSP00000319303:S56I;ENSP00000435838:S289I	ENSP00000319303:S56I	S	-	2	0	XRRA1	74295045	0.017000	0.18338	0.065000	0.19835	0.018000	0.09664	0.159000	0.16442	0.025000	0.15241	-0.137000	0.14449	AGT		0.463	XRRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384715.1	NM_182969		11	45	1	0	0.00829132	0.008291	0.00855315	11	45				
FAT3	120114	broad.mit.edu	37	11	92086077	92086077	+	Missense_Mutation	SNP	C	C	A	rs558379359		TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr11:92086077C>A	ENST00000298047.6	+	1	816	c.799C>A	c.(799-801)Cat>Aat	p.H267N	FAT3_ENST00000525166.1_Missense_Mutation_p.H117N|FAT3_ENST00000409404.2_Missense_Mutation_p.H267N|FAT3_ENST00000541502.1_Missense_Mutation_p.H267N			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	267	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.H267N(2)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CCCAACAATCCATGTAGTCAC	0.443										TCGA Ovarian(4;0.039)																													uc001pdj.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|pancreas(1)	5						c.(799-801)CAT>AAT		FAT tumor suppressor homolog 3							173.0	165.0	168.0					11																	92086077		2024	4187	6211	SO:0001583	missense	120114				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding	g.chr11:92086077C>A	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.799C>A	11.37:g.92086077C>A	ENSP00000298047:p.His267Asn	TCGA Ovarian(4;0.039)					p.H267N	NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN			1	816	+		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)	267			Cadherin 3.|Extracellular (Potential).		B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37	c.799C>A		.	.	.	.	.	.	.	.	.	.	C	1.101	-0.661176	0.03454	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000541502;ENST00000525166	T;T;T;T	0.60299	0.2;0.2;0.2;0.2	5.09	4.12	0.48240	.	.	.	.	.	T	0.28928	0.0718	N	0.02916	-0.46	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.11299	-1.0593	9	0.17369	T	0.5	.	7.4156	0.27042	0.2298:0.6805:0.0:0.0897	.	267	Q8TDW7-3	.	N	267;267;267;117	ENSP00000298047:H267N;ENSP00000387040:H267N;ENSP00000443786:H267N;ENSP00000432586:H117N	ENSP00000298047:H267N	H	+	1	0	FAT3	91725725	0.993000	0.37304	0.053000	0.19242	0.493000	0.33554	3.556000	0.53734	2.509000	0.84616	0.557000	0.71058	CAT		0.443	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781		43	68	1	0	1.76056e-25	0.011902	2.80544e-25	43	68				
MMP3	4314	broad.mit.edu	37	11	102709964	102709964	+	Missense_Mutation	SNP	G	G	A	rs147533686		TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr11:102709964G>A	ENST00000299855.5	-	7	1202	c.946C>T	c.(946-948)Cgc>Tgc	p.R316C	WTAPP1_ENST00000525739.2_RNA	NM_002422.3	NP_002413.1	P08254	MMP3_HUMAN	matrix metallopeptidase 3 (stromelysin 1, progelatinase)	316					cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|positive regulation of oxidative stress-induced cell death (GO:1903209)|proteolysis (GO:0006508)|regulation of cell migration (GO:0030334)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.R316C(3)		endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0142)	Marimastat(DB00786)	AGGGATTTGCGCCAAAAGTGC	0.403													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17541	0.0		0.0	False		,,,				2504	0.0						uc001phj.1		NA																	3	Substitution - Missense(3)	p.R316C(1)	ovary(1)|lung(1)|kidney(1)	lung(1)|kidney(1)	2						c.(946-948)CGC>TGC		matrix metalloproteinase 3 preproprotein	Marimastat(DB00786)|Simvastatin(DB00641)	G	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	76.0	84.0	82.0		946	5.7	1.0	11	dbSNP_134	82	0,8598		0,0,4299	no	missense	MMP3	NM_002422.3	180	0,1,6501	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	316/478	102709964	1,13003	2203	4299	6502	SO:0001583	missense	4314				collagen catabolic process|proteolysis	extracellular space|proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding	g.chr11:102709964G>A	X05232	CCDS8323.1	11q22.3	2012-10-02	2005-08-08		ENSG00000149968	ENSG00000149968	3.4.24.17		7173	protein-coding gene	gene with protein product		185250	"""matrix metalloproteinase 3 (stromelysin 1, progelatinase)"""	STMY1, STMY			Standard	NM_002422		Approved		uc001phj.1	P08254	OTTHUMG00000048254	ENST00000299855.5:c.946C>T	11.37:g.102709964G>A	ENSP00000299855:p.Arg316Cys						p.R316C	NM_002422	NP_002413	P08254	MMP3_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.0142)	7	1011	-		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	316			Hemopexin-like 1.		B2R8B8|Q3B7S0|Q6GRF8	Missense_Mutation	SNP	ENST00000299855.5	37	c.946C>T	CCDS8323.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	22.4	4.285195	0.80803	2.27E-4	0.0	ENSG00000149968	ENST00000299855	T	0.04454	3.62	5.65	5.65	0.86999	Hemopexin/matrixin (2);	0.000000	0.36740	N	0.002424	T	0.37571	0.1008	H	0.97023	3.925	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.54886	-0.8226	10	0.87932	D	0	.	19.9142	0.97043	0.0:0.0:1.0:0.0	.	316	P08254	MMP3_HUMAN	C	316	ENSP00000299855:R316C	ENSP00000299855:R316C	R	-	1	0	MMP3	102215174	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	3.837000	0.55820	2.941000	0.99782	0.655000	0.94253	CGC		0.403	MMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109758.2	NM_002422		28	32	0	0	0	0.009535	0	28	32				
POU2AF1	5450	broad.mit.edu	37	11	111225164	111225164	+	Missense_Mutation	SNP	G	G	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr11:111225164G>T	ENST00000393067.3	-	5	1107	c.593C>A	c.(592-594)cCa>cAa	p.P198Q		NM_006235.2	NP_006226.2	Q16633	OBF1_HUMAN	POU class 2 associating factor 1	198					humoral immune response (GO:0006959)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)	p.P198Q(1)		breast(1)|kidney(2)|lung(2)	5		all_cancers(61;1.36e-12)|all_epithelial(67;1.87e-07)|Melanoma(852;1.46e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|all_neural(223;0.0146)|Medulloblastoma(222;0.0245)|Breast(348;0.0389)		Epithelial(105;1.01e-06)|BRCA - Breast invasive adenocarcinoma(274;3.12e-06)|all cancers(92;1.8e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0364)		AGGTAGGGCTGGGGCCGGAGG	0.642			T	BCL6	NHL																																		uc001plg.3		NA		Dom	yes		11	11q23.1	5450	T	"""POU domain, class 2, associating factor 1 (OBF1)"""			L	BCL6		NHL		1	Substitution - Missense(1)		lung(1)	kidney(1)	1						c.(592-594)CCA>CAA		POU class 2 associating factor 1							43.0	48.0	47.0					11																	111225164		2201	4297	6498	SO:0001583	missense	5450				humoral immune response|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	protein binding|transcription coactivator activity	g.chr11:111225164G>T		CCDS31675.1	11q23.1	2011-06-01	2007-07-13			ENSG00000110777			9211	protein-coding gene	gene with protein product		601206	"""POU domain class 2, associating factor 1"""			8617501	Standard	NM_006235		Approved	OBF1	uc001plg.4	Q16633		ENST00000393067.3:c.593C>A	11.37:g.111225164G>T	ENSP00000376786:p.Pro198Gln						p.P198Q	NM_006235	NP_006226	Q16633	OBF1_HUMAN		Epithelial(105;1.01e-06)|BRCA - Breast invasive adenocarcinoma(274;3.12e-06)|all cancers(92;1.8e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0364)	5	848	-		all_cancers(61;1.36e-12)|all_epithelial(67;1.87e-07)|Melanoma(852;1.46e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|all_neural(223;0.0146)|Medulloblastoma(222;0.0245)|Breast(348;0.0389)	198					B2R8Z9|Q14983	Missense_Mutation	SNP	ENST00000393067.3	37	c.593C>A	CCDS31675.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.312440	0.81358	.	.	ENSG00000110777	ENST00000393067	T	0.28666	1.6	4.76	4.76	0.60689	.	0.128792	0.52532	D	0.000075	T	0.43590	0.1254	L	0.51422	1.61	0.37616	D	0.921134	D	0.55172	0.97	P	0.53450	0.726	T	0.51903	-0.8646	10	0.72032	D	0.01	-12.5409	17.5599	0.87903	0.0:0.0:1.0:0.0	.	198	Q16633	OBF1_HUMAN	Q	198	ENSP00000376786:P198Q	ENSP00000376786:P198Q	P	-	2	0	POU2AF1	110730374	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.924000	0.75823	2.455000	0.83008	0.563000	0.77884	CCA		0.642	POU2AF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391002.1	NM_006235		14	37	1	0	4.3838e-07	0.016723	5.08417e-07	14	37				
NDUFA9	4704	broad.mit.edu	37	12	4768321	4768321	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr12:4768321C>G	ENST00000266544.5	+	5	550	c.530C>G	c.(529-531)tCt>tGt	p.S177C	RP11-500M8.7_ENST00000536588.1_3'UTR	NM_005002.4	NP_004993.1	Q16795	NDUA9_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39kDa	177					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|sodium ion transport (GO:0006814)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)|nucleus (GO:0005634)	coenzyme binding (GO:0050662)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|NADH dehydrogenase activity (GO:0003954)|protein complex binding (GO:0032403)	p.S177C(1)		NS(1)|breast(1)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	21						ATTAAAAGCTCTTCTAGATAT	0.373																																					Colon(75;996 1244 23946 25294 29232)	Colon(75;996 1244 23946 25294 29232)	uc001qnc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(529-531)TCT>TGT		NADH dehydrogenase (ubiquinone) 1 alpha	NADH(DB00157)						50.0	53.0	52.0					12																	4768321		2203	4300	6503	SO:0001583	missense	4704				mitochondrial electron transport, NADH to ubiquinone|sodium ion transport	mitochondrial matrix|mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity|protein binding	g.chr12:4768321C>G	AF050641	CCDS8532.1	12p13.3	2011-09-14	2002-08-29		ENSG00000139180	ENSG00000139180		"""Mitochondrial respiratory chain complex / Complex I"", ""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	7693	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 22E, member 1"", ""complex I 39kDa subunit"""	603834	"""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9 (39kD)"""	NDUFS2L		8486360, 19027726	Standard	NM_005002		Approved	SDR22E1, CI-39k	uc001qnc.3	Q16795		ENST00000266544.5:c.530C>G	12.37:g.4768321C>G	ENSP00000266544:p.Ser177Cys					NDUFA9_uc009zei.1_Missense_Mutation_p.S177C|NDUFA9_uc010ses.1_5'UTR	p.S177C	NM_005002	NP_004993	Q16795	NDUA9_HUMAN			5	540	+			177					Q14076|Q2NKX0	Missense_Mutation	SNP	ENST00000266544.5	37	c.530C>G	CCDS8532.1	.	.	.	.	.	.	.	.	.	.	C	15.65	2.896744	0.52121	.	.	ENSG00000139180	ENST00000266544	D	0.93763	-3.28	5.26	5.26	0.73747	NAD(P)-binding domain (1);NmrA-like (1);	0.382131	0.32301	N	0.006281	D	0.95965	0.8686	M	0.74647	2.275	0.80722	D	1	D;D	0.59767	0.986;0.986	P;P	0.59948	0.866;0.866	D	0.96080	0.9053	10	0.62326	D	0.03	-4.5231	17.9971	0.89187	0.0:1.0:0.0:0.0	.	177;177	A8K4V2;Q16795	.;NDUA9_HUMAN	C	177	ENSP00000266544:S177C	ENSP00000266544:S177C	S	+	2	0	NDUFA9	4638582	0.946000	0.32159	0.868000	0.34077	0.175000	0.22909	5.426000	0.66476	2.596000	0.87737	0.585000	0.79938	TCT		0.373	NDUFA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398900.2	NM_005002		9	35	0	0	0	0.006214	0	9	35				
CCDC91	55297	broad.mit.edu	37	12	28702079	28702079	+	Silent	SNP	A	A	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr12:28702079A>T	ENST00000545336.1	+	16	1718	c.1299A>T	c.(1297-1299)atA>atT	p.I433I	CCDC91_ENST00000381259.1_Silent_p.I433I|CCDC91_ENST00000381256.1_Silent_p.I397I|CCDC91_ENST00000540401.1_3'UTR|CCDC91_ENST00000539107.1_Silent_p.I397I|CCDC91_ENST00000306172.5_Silent_p.I403I			Q7Z6B0	CCD91_HUMAN	coiled-coil domain containing 91	433					protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)		p.I433I(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)|skin(1)	22	Acute lymphoblastic leukemia(23;0.00718)|all_hematologic(23;0.0113)|Lung SC(9;0.184)					GTGCTTTAATAGCTACGGAAC	0.373																																							uc001riq.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(1297-1299)ATA>ATT		GGA binding partner							129.0	125.0	126.0					12																	28702079		2203	4300	6503	SO:0001819	synonymous_variant	55297				protein transport	Golgi apparatus|membrane		g.chr12:28702079A>T	AK093152	CCDS8716.1	12p11.22	2006-03-17				ENSG00000123106			24855	protein-coding gene	gene with protein product	"""GGA binding partner"""					12808037	Standard	XM_005253413		Approved	p56, FLJ11088, DKFZp779L1558	uc001riq.3	Q7Z6B0		ENST00000545336.1:c.1299A>T	12.37:g.28702079A>T						CCDC91_uc001rio.2_Silent_p.I403I|CCDC91_uc009zjk.2_RNA|CCDC91_uc001rir.2_Silent_p.I271I|CCDC91_uc009zjl.2_Silent_p.I235I	p.I433I	NM_018318	NP_060788	Q7Z6B0	CCD91_HUMAN			12	1315	+	Acute lymphoblastic leukemia(23;0.00718)|all_hematologic(23;0.0113)|Lung SC(9;0.184)		433					B3KSA3|C9JR07|Q68D43|Q6IA78|Q8NEN7|Q9NUW9	Silent	SNP	ENST00000545336.1	37	c.1299A>T	CCDS8716.1																																																																																				0.373	CCDC91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402447.1	NM_018318		54	31	0	0	0	0.01441	0	54	31				
CYP27B1	1594	broad.mit.edu	37	12	58158993	58158993	+	Splice_Site	SNP	G	G	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr12:58158993G>T	ENST00000228606.4	-	4	800	c.591C>A	c.(589-591)ggC>ggA	p.G197G	CYP27B1_ENST00000546496.1_5'Flank	NM_000785.3	NP_000776.1	O15528	CP27B_HUMAN	cytochrome P450, family 27, subfamily B, polypeptide 1	197					bone mineralization (GO:0030282)|calcitriol biosynthetic process from calciol (GO:0036378)|calcium ion homeostasis (GO:0055074)|calcium ion transport (GO:0006816)|decidualization (GO:0046697)|G1 to G0 transition (GO:0070314)|negative regulation of calcidiol 1-monooxygenase activity (GO:0010956)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of vitamin D 24-hydroxylase activity (GO:0010980)|positive regulation of vitamin D receptor signaling pathway (GO:0070564)|regulation of bone mineralization (GO:0030500)|response to estrogen (GO:0043627)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)|response to vitamin D (GO:0033280)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D catabolic process (GO:0042369)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	calcidiol 1-monooxygenase activity (GO:0004498)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.G197G(1)		central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|urinary_tract(1)	15	all_cancers(7;8.09e-80)|Lung NSC(6;2.26e-27)|all_lung(6;1.99e-25)|all_epithelial(6;3.62e-18)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;1.97e-113)|all cancers(5;1.54e-78)|BRCA - Breast invasive adenocarcinoma(9;0.0294)		Alfacalcidol(DB01436)|Calcidiol(DB00146)|Corticotropin(DB01285)|Ergocalciferol(DB00153)	CCGCGGCGATGCCTTGTCGGG	0.687											OREG0021953	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001spz.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(3)	3						c.(589-591)GGC>GGA		cytochrome P450, family 27, subfamily B,	Calcidiol(DB00146)|Calcitriol(DB00136)|Ergocalciferol(DB00153)						21.0	21.0	21.0					12																	58158993		2199	4296	6495	SO:0001630	splice_region_variant	1594				bone mineralization|calcium ion homeostasis|calcium ion transport|decidualization|G1 to G0 transition|hormone biosynthetic process|negative regulation of calcidiol 1-monooxygenase activity|negative regulation of cell growth|negative regulation of cell proliferation|positive regulation of keratinocyte differentiation|positive regulation of vitamin D 24-hydroxylase activity|positive regulation of vitamin D receptor signaling pathway|regulation of bone mineralization|response to estrogen stimulus|response to interferon-gamma|response to lipopolysaccharide|response to tumor necrosis factor|response to vitamin D|vitamin D biosynthetic process|xenobiotic metabolic process	mitochondrial outer membrane	calcidiol 1-monooxygenase activity|electron carrier activity|heme binding	g.chr12:58158993G>T	AB006987	CCDS8954.1	12q14.1	2013-11-13	2003-01-14		ENSG00000111012	ENSG00000111012		"""Cytochrome P450s"""	2606	protein-coding gene	gene with protein product	"""VDDR I"", ""1alpha(OH)ase"", ""25-Hydroxyvitamin D3 1alpha-hydroxylase"""	609506	"""cytochrome P450, subfamily XXVIIB (25-hydroxyvitamin D-1-alpha-hydroxylase), polypeptide 1"""	VDD1, PDDR		9295274, 9344864	Standard	NM_000785		Approved	CYP1, P450c1	uc001spz.1	O15528	OTTHUMG00000170457	ENST00000228606.4:c.590-1C>A	12.37:g.58158993G>T			OREG0021953	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1028	CYP27B1_uc001sqa.1_5'UTR|CYP27B1_uc001sqb.1_Missense_Mutation_p.H78N|CYP27B1_uc001sqc.1_Missense_Mutation_p.H78N	p.G197G	NM_000785	NP_000776	O15528	CP27B_HUMAN	GBM - Glioblastoma multiforme(5;1.97e-113)|all cancers(5;1.54e-78)|BRCA - Breast invasive adenocarcinoma(9;0.0294)		4	743	-	all_cancers(7;8.09e-80)|Lung NSC(6;2.26e-27)|all_lung(6;1.99e-25)|all_epithelial(6;3.62e-18)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		197					B2RC61|Q548T3	Silent	SNP	ENST00000228606.4	37	c.591C>A	CCDS8954.1																																																																																				0.687	CYP27B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409248.1	NM_000785	Silent	6	22	1	0	5.9392e-07	0.001168	6.8075e-07	6	22				
E2F7	144455	broad.mit.edu	37	12	77438543	77438543	+	Nonsense_Mutation	SNP	T	T	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr12:77438543T>A	ENST00000322886.7	-	6	1097	c.862A>T	c.(862-864)Aga>Tga	p.R288*	E2F7_ENST00000416496.2_Nonsense_Mutation_p.R288*	NM_203394.2	NP_976328.2	Q96AV8	E2F7_HUMAN	E2F transcription factor 7	288					chorionic trophoblast cell differentiation (GO:0060718)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|hepatocyte differentiation (GO:0070365)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytokinesis (GO:0032466)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|placenta development (GO:0001890)|positive regulation of DNA endoreduplication (GO:0032877)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sprouting angiogenesis (GO:0002040)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|identical protein binding (GO:0042802)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.R288*(2)|p.R288G(2)		central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(15)|lung(14)|ovary(3)|upper_aerodigestive_tract(2)	42						CTCATAATTCTCAGAGACTTG	0.388																																							uc001sym.3		NA																	4	Substitution - Nonsense(2)|Substitution - Missense(2)		lung(2)|kidney(2)	upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3						c.(862-864)AGA>TGA		E2F transcription factor 7							139.0	125.0	129.0					12																	77438543		2203	4300	6503	SO:0001587	stop_gained	144455				cell cycle	transcription factor complex	DNA binding|identical protein binding	g.chr12:77438543T>A	BC016658	CCDS9016.1	12q21.1	2008-02-05				ENSG00000165891			23820	protein-coding gene	gene with protein product		612046				12893818	Standard	NM_203394		Approved		uc001sym.4	Q96AV8	OTTHUMG00000169969	ENST00000322886.7:c.862A>T	12.37:g.77438543T>A	ENSP00000323246:p.Arg288*						p.R288*	NM_203394	NP_976328	Q96AV8	E2F7_HUMAN			6	1098	-			288			Potential.		A6NC74|B2RMR7|B3KTZ5|B3KUP8|B5MED9	Nonsense_Mutation	SNP	ENST00000322886.7	37	c.862A>T	CCDS9016.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	26.5|26.5	4.743290|4.743290	0.89663|0.89663	.|.	.|.	ENSG00000165891|ENSG00000165891	ENST00000322886;ENST00000416496;ENST00000550669|ENST00000551058	.|.	.|.	.|.	6.17|6.17	2.51|2.51	0.30379|0.30379	.|.	0.043924|.	0.85682|.	D|.	0.000000|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.02654|.	T|.	1|.	-17.9279|-17.9279	14.1942|14.1942	0.65659|0.65659	0.0:0.0:0.6388:0.3612|0.0:0.0:0.6388:0.3612	.|.	.|.	.|.	.|.	X|C	288|165	.|.	ENSP00000323246:R288X|.	R|X	-|-	1|3	2|0	E2F7|E2F7	75962674|75962674	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.998000|0.998000	0.95712|0.95712	2.237000|2.237000	0.43061|0.43061	0.516000|0.516000	0.28340|0.28340	0.533000|0.533000	0.62120|0.62120	AGA|TGA		0.388	E2F7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406716.1	XM_084871		37	21	0	0	0	0.007835	0	37	21				
OTOGL	283310	broad.mit.edu	37	12	80762088	80762088	+	Splice_Site	SNP	C	C	T	rs574033095		TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr12:80762088C>T	ENST00000547103.1	+	54	6557	c.6551C>T	c.(6550-6552)gCg>gTg	p.A2184V	OTOGL_ENST00000458043.2_Splice_Site_p.A2196V|OTOGL_ENST00000546620.1_Splice_Site_p.A215V			Q3ZCN5	OTOGL_HUMAN	otogelin-like	2184					L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)	p.A2196V(2)|p.A561V(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						GTTGTATACGCGGTATGTTTC	0.428																																							uc009zsg.1		NA																	3	Substitution - Missense(3)		lung(2)|prostate(1)		NA						c.(226-228)GCG>GTG		RecName: Full=Uncharacterized protein C12orf64;							119.0	104.0	109.0					12																	80762088		2203	4300	6503	SO:0001630	splice_region_variant	0							g.chr12:80762088C>T	AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.6552+1C>T	12.37:g.80762088C>T						uc001szd.2_Missense_Mutation_p.A215V	p.A76V							9	828	+								F8W0C3|Q495U8|Q8N8G5|Q8NC28	Missense_Mutation	SNP	ENST00000547103.1	37	c.227C>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.068|8.068	0.769665|0.769665	0.15983|0.15983	.|.	.|.	ENSG00000165899|ENSG00000165899	ENST00000547103;ENST00000458043;ENST00000546620;ENST00000550182|ENST00000298820	T;T;T;T|.	0.44482|.	2.3;2.3;2.21;0.92|.	5.47|5.47	0.318|0.318	0.15867|0.15867	.|.	0.311579|.	0.28448|.	N|.	0.015308|.	T|T	0.23451|0.23451	0.0567|0.0567	L|L	0.34521|0.34521	1.04|1.04	0.21762|0.21762	N|N	0.999556|0.999556	B|.	0.06786|.	0.001|.	B|.	0.06405|.	0.002|.	T|T	0.24012|0.24012	-1.0172|-1.0172	10|5	0.29301|.	T|.	0.29|.	.|.	1.9303|1.9303	0.03325|0.03325	0.4712:0.2719:0.1355:0.1214|0.4712:0.2719:0.1355:0.1214	.|.	561|.	Q3ZCN5|.	OTOGL_HUMAN|.	V|W	2184;2196;215;213|604	ENSP00000447211:A2184V;ENSP00000400895:A2196V;ENSP00000449094:A215V;ENSP00000449641:A213V|.	ENSP00000400895:A2196V|.	A|R	+|+	2|1	0|2	OTOGL|OTOGL	79286219|79286219	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.196000|0.196000	0.23810|0.23810	1.060000|1.060000	0.30530|0.30530	-0.189000|-0.189000	0.10482|0.10482	-1.622000|-1.622000	0.00790|0.00790	GCG|CGG		0.428	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000407438.1	NM_173591	Missense_Mutation	4	5	0	0	0	0.009096	0	4	5				
UTP20	27340	broad.mit.edu	37	12	101757487	101757487	+	Missense_Mutation	SNP	A	A	G			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr12:101757487A>G	ENST00000261637.4	+	45	6098	c.5924A>G	c.(5923-5925)gAt>gGt	p.D1975G		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	1975					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)	p.D1975G(1)		NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						GTAGGAAAAGATCAGGTTACA	0.398																																							uc001tia.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(2)	4						c.(5923-5925)GAT>GGT		down-regulated in metastasis							100.0	89.0	93.0					12																	101757487		2203	4300	6503	SO:0001583	missense	27340				endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|negative regulation of cell proliferation	90S preribosome|cytoplasm|nucleolus|nucleoplasm|preribosome, small subunit precursor|small-subunit processome	protein binding	g.chr12:101757487A>G	AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.5924A>G	12.37:g.101757487A>G	ENSP00000261637:p.Asp1975Gly						p.D1975G	NM_014503	NP_055318	O75691	UTP20_HUMAN			45	6080	+			1975					Q9H3H4	Missense_Mutation	SNP	ENST00000261637.4	37	c.5924A>G	CCDS9081.1	.	.	.	.	.	.	.	.	.	.	A	13.34	2.208020	0.39003	.	.	ENSG00000120800	ENST00000261637	T	0.57107	0.42	5.92	5.92	0.95590	Armadillo-type fold (1);	0.457645	0.28098	N	0.016613	T	0.33118	0.0852	N	0.14661	0.345	0.30811	N	0.738833	B	0.02656	0.0	B	0.04013	0.001	T	0.28396	-1.0045	10	0.16896	T	0.51	-4.5097	10.9627	0.47395	0.9221:0.0:0.0779:0.0	.	1975	O75691	UTP20_HUMAN	G	1975	ENSP00000261637:D1975G	ENSP00000261637:D1975G	D	+	2	0	UTP20	100281618	1.000000	0.71417	0.996000	0.52242	0.827000	0.46813	6.244000	0.72391	2.274000	0.75844	0.533000	0.62120	GAT		0.398	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408242.1	NM_014503		20	21	0	0	0	0.014323	0	20	21				
PRKAB1	5564	broad.mit.edu	37	12	120106160	120106160	+	Silent	SNP	G	G	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr12:120106160G>A	ENST00000229328.5	+	1	603	c.111G>A	c.(109-111)ctG>ctA	p.L37L	PRKAB1_ENST00000541640.1_Silent_p.L37L|PRKAB1_ENST00000540121.1_5'Flank	NM_006253.4	NP_006244.2	Q9Y478	AAKB1_HUMAN	protein kinase, AMP-activated, beta 1 non-catalytic subunit	37					cell cycle arrest (GO:0007050)|fatty acid biosynthetic process (GO:0006633)|insulin receptor signaling pathway (GO:0008286)|membrane organization (GO:0061024)|positive regulation of gene expression (GO:0010628)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|nucleus (GO:0005634)	protein kinase activity (GO:0004672)	p.L37L(1)		endometrium(2)|large_intestine(3)|lung(5)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.166)	Acetylsalicylic acid(DB00945)|Adenosine monophosphate(DB00131)|Metformin(DB00331)	CCAAGATCCTGATGGACAGCC	0.647																																							uc009zwu.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(109-111)CTG>CTA		AMP-activated protein kinase beta 1	Adenosine monophosphate(DB00131)|Metformin(DB00331)						45.0	39.0	41.0					12																	120106160		2203	4300	6503	SO:0001819	synonymous_variant	5564				cell cycle arrest|fatty acid biosynthetic process|insulin receptor signaling pathway|regulation of fatty acid oxidation	cytosol		g.chr12:120106160G>A	BC001823	CCDS9191.1	12q24.1-q24.3	2008-05-14			ENSG00000111725	ENSG00000111725			9378	protein-coding gene	gene with protein product	"""AMPK beta 1"""	602740				8557660	Standard	NM_006253		Approved		uc001txg.3	Q9Y478	OTTHUMG00000168954	ENST00000229328.5:c.111G>A	12.37:g.120106160G>A						PRKAB1_uc001txg.2_Silent_p.L37L	p.L37L	NM_006253	NP_006244	Q9Y478	AAKB1_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.166)	2	214	+	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)		37					Q9UBV0|Q9UE20|Q9UEX2|Q9Y6V8	Silent	SNP	ENST00000229328.5	37	c.111G>A	CCDS9191.1																																																																																				0.647	PRKAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401731.2	NM_006253		3	13	0	0	0	0.004672	0	3	13				
FLT3	2322	broad.mit.edu	37	13	28602427	28602427	+	Splice_Site	SNP	T	T	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr13:28602427T>A	ENST00000241453.7	-	16	2024		c.e16-2		FLT3_ENST00000380982.4_Splice_Site|FLT3_ENST00000537084.1_Splice_Site	NM_004119.2	NP_004110.2	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3						B cell differentiation (GO:0030183)|cellular response to cytokine stimulus (GO:0071345)|common myeloid progenitor cell proliferation (GO:0035726)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell differentiation (GO:0097028)|hemopoiesis (GO:0030097)|leukocyte homeostasis (GO:0001776)|lymphocyte proliferation (GO:0046651)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|pro-B cell differentiation (GO:0002328)|pro-T cell differentiation (GO:0002572)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor signaling pathway (GO:0038084)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|cytokine receptor activity (GO:0004896)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.?(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(12329)|kidney(2)|large_intestine(8)|lung(30)|ovary(4)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12390	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Ponatinib(DB08901)|Sorafenib(DB00398)|Sunitinib(DB01268)	CTGCTTTTTCTGTCAAAGAAA	0.383			"""Mis, O"""		"""AML, ALL"""																																		uc001urw.2		NA		Dom	yes		13	13q12	2322	Mis|O	fms-related tyrosine kinase 3			L			AML|ALL		1	Unknown(1)		lung(1)	haematopoietic_and_lymphoid_tissue(8536)|lung(7)|ovary(3)|stomach(1)|central_nervous_system(1)|skin(1)	8549						c.e16-1		fms-related tyrosine kinase 3 precursor	Sorafenib(DB00398)|Sunitinib(DB01268)						59.0	51.0	54.0					13																	28602427		2203	4300	6503	SO:0001630	splice_region_variant	2322				positive regulation of cell proliferation	integral to plasma membrane	ATP binding|vascular endothelial growth factor receptor activity	g.chr13:28602427T>A	U02687	CCDS31953.1	13q12	2014-09-17			ENSG00000122025	ENSG00000122025	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3765	protein-coding gene	gene with protein product		136351				8394751	Standard	NM_004119		Approved	STK1, FLK2, CD135	uc001urw.3	P36888	OTTHUMG00000016646	ENST00000241453.7:c.1943-2A>T	13.37:g.28602427T>A						FLT3_uc010aao.2_Splice_Site|FLT3_uc010tdn.1_Splice_Site_p.E648_splice	p.E648_splice	NM_004119	NP_004110	P36888	FLT3_HUMAN	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	16	2025	-	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)						A0AVG9|B7ZLT7|B7ZLT8|F5H0A0|Q13414	Splice_Site	SNP	ENST00000241453.7	37	c.1943_splice	CCDS31953.1	.	.	.	.	.	.	.	.	.	.	T	20.1	3.936179	0.73442	.	.	ENSG00000122025	ENST00000241453;ENST00000380982;ENST00000537084	.	.	.	5.53	5.53	0.82687	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6684	0.77252	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	FLT3	27500427	1.000000	0.71417	0.993000	0.49108	0.755000	0.42902	7.759000	0.85235	2.086000	0.62901	0.454000	0.30748	.		0.383	FLT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044319.2		Intron	6	13	0	0	0	0.001168	0	6	13				
MLNR	2862	broad.mit.edu	37	13	49794774	49794774	+	Missense_Mutation	SNP	T	T	C			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr13:49794774T>C	ENST00000218721.1	+	1	301	c.301T>C	c.(301-303)Tcg>Ccg	p.S101P	MLNR_ENST00000398307.1_Missense_Mutation_p.S101P	NM_001507.1	NP_001498.1	O43193	MTLR_HUMAN	motilin receptor	101					digestion (GO:0007586)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|growth hormone-releasing hormone receptor activity (GO:0016520)	p.S101P(1)		endometrium(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)	14		all_lung(13;8.31e-06)|Lung NSC(96;0.000251)|Breast(56;0.0008)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;6.1e-09)		CCTCTGGCGCTCGCGGCCCTG	0.682																																							uc010tgj.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(301-303)TCG>CCG		motilin receptor							27.0	23.0	25.0					13																	49794774		2197	4284	6481	SO:0001583	missense	2862				digestion	integral to plasma membrane	growth hormone-releasing hormone receptor activity	g.chr13:49794774T>C	AF034632	CCDS9414.1	13q14-q21	2012-08-08	2004-05-27	2004-05-28	ENSG00000102539	ENSG00000102539		"""GPCR / Class A : Motilin receptors"""	4495	protein-coding gene	gene with protein product		602885	"""G protein-coupled receptor 38"""	GPR38		9441746	Standard	NM_001507		Approved		uc010tgj.2	O43193	OTTHUMG00000016909	ENST00000218721.1:c.301T>C	13.37:g.49794774T>C	ENSP00000218721:p.Ser101Pro						p.S101P	NM_001507	NP_001498	O43193	MTLR_HUMAN	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;6.1e-09)	1	301	+		all_lung(13;8.31e-06)|Lung NSC(96;0.000251)|Breast(56;0.0008)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	101			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000218721.1	37	c.301T>C	CCDS9414.1	.	.	.	.	.	.	.	.	.	.	t	15.45	2.836357	0.50951	.	.	ENSG00000102539	ENST00000218721;ENST00000398307	T;T	0.20598	2.06;2.06	4.27	3.03	0.35002	GPCR, rhodopsin-like superfamily (1);	0.068268	0.64402	U	0.000010	T	0.25232	0.0613	N	0.17872	0.535	0.27714	N	0.945349	D	0.76494	0.999	D	0.71184	0.972	T	0.08700	-1.0709	10	0.25106	T	0.35	-17.3979	9.5895	0.39537	0.0:0.0:0.1773:0.8227	.	101	O43193	MTLR_HUMAN	P	101	ENSP00000218721:S101P;ENSP00000381352:S101P	ENSP00000218721:S101P	S	+	1	0	MLNR	48692775	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.579000	0.60936	0.466000	0.27193	0.456000	0.33151	TCG		0.682	MLNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044897.1	NM_001507		7	2	0	0	0	0.001984	0	7	2				
LMO7	4008	broad.mit.edu	37	13	76397902	76397902	+	Nonsense_Mutation	SNP	C	C	T	rs376108448		TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr13:76397902C>T	ENST00000321797.8	+	13	2864	c.2143C>T	c.(2143-2145)Cag>Tag	p.Q715*	LMO7_ENST00000465261.2_Nonsense_Mutation_p.Q715*|LMO7_ENST00000526202.1_Nonsense_Mutation_p.Q565*|LMO7_ENST00000341547.4_Nonsense_Mutation_p.Q666*|LMO7_ENST00000377534.3_Nonsense_Mutation_p.Q1000*|LMO7_ENST00000357063.3_Nonsense_Mutation_p.Q1000*			Q8WWI1	LMO7_HUMAN	LIM domain 7	1000					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.Q666*(1)|p.Q715*(1)|p.Q1000*(1)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(20)|lung(15)|ovary(2)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		TTCCCAAGACCAGGCTGCCAC	0.478																																							uc001vjv.2		NA																	3	Substitution - Nonsense(3)		lung(3)	large_intestine(2)|ovary(1)|prostate(1)|skin(1)	5						c.(2143-2145)CAG>TAG		LIM domain only 7 isoform 2							100.0	82.0	88.0					13																	76397902		2203	4300	6503	SO:0001587	stop_gained	4008					cytoplasm|nucleus|ubiquitin ligase complex	ubiquitin-protein ligase activity|zinc ion binding	g.chr13:76397902C>T	AF092557	CCDS9454.1, CCDS53876.1	13q22.2	2008-02-05	2004-06-15		ENSG00000136153	ENSG00000136153			6646	protein-coding gene	gene with protein product	"""F-box only protein 20"""	604362	"""LIM domain only 7"""	FBXO20		9826547, 10531035	Standard	NM_005358		Approved	FBX20, KIAA0858	uc021rkq.1	Q8WWI1	OTTHUMG00000017093	ENST00000321797.8:c.2143C>T	13.37:g.76397902C>T	ENSP00000317802:p.Gln715*					LMO7_uc010thv.1_Nonsense_Mutation_p.Q666*|LMO7_uc001vjt.1_Nonsense_Mutation_p.Q614*|LMO7_uc010thw.1_Nonsense_Mutation_p.Q565*|LMO7_uc001vjw.1_Nonsense_Mutation_p.Q621*	p.Q715*	NM_015842	NP_056667	Q8WWI1	LMO7_HUMAN		GBM - Glioblastoma multiforme(99;0.0109)	12	2903	+		Breast(118;0.0992)	1000					E9PLH4|O15462|O95346|Q5TBK6|Q9UKC1|Q9UQM5|Q9Y6A7	Nonsense_Mutation	SNP	ENST00000321797.8	37	c.2143C>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	51|51	17.910878|17.910878	0.99895|0.99895	.|.	.|.	ENSG00000136153|ENSG00000136153	ENST00000447038|ENST00000341547;ENST00000357063;ENST00000377534;ENST00000377499;ENST00000321797;ENST00000526202;ENST00000465261	.|.	.|.	.|.	5.98|5.98	4.23|4.23	0.50019|0.50019	.|.	.|1.479750	.|0.03467	.|N	.|0.213086	T|.	0.21307|.	0.0513|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.28618|.	-1.0038|.	3|.	.|0.02654	.|T	.|1	0.3001|0.3001	9.6352|9.6352	0.39804|0.39804	0.0:0.6624:0.2669:0.0708|0.0:0.6624:0.2669:0.0708	.|.	.|.	.|.	.|.	L|X	623|666;1000;1000;614;715;565;715	.|.	.|ENSP00000317802:Q715X	P|Q	+|+	2|1	0|0	LMO7|LMO7	75295903|75295903	0.118000|0.118000	0.22208|0.22208	0.515000|0.515000	0.27774|0.27774	0.882000|0.882000	0.50991|0.50991	1.305000|1.305000	0.33493|0.33493	0.836000|0.836000	0.34901|0.34901	0.655000|0.655000	0.94253|0.94253	CCA|CAG		0.478	LMO7-005	PUTATIVE	alternative_5_UTR|not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000045301.3	NM_005358		8	24	0	0	0	0.004482	0	8	24				
SOS2	6655	broad.mit.edu	37	14	50667801	50667801	+	Splice_Site	SNP	T	T	C			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr14:50667801T>C	ENST00000216373.5	-	3	489	c.215A>G	c.(214-216)gAg>gGg	p.E72G	SOS2_ENST00000543680.1_Splice_Site_p.E72G	NM_006939.2	NP_008870.2	Q07890	SOS2_HUMAN	son of sevenless homolog 2 (Drosophila)	72					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	DNA binding (GO:0003677)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.E72G(2)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(16)|ovary(2)|skin(1)	39	all_epithelial(31;0.000822)|Breast(41;0.0065)					CTGAACTCGCTCCTGCTCAAT	0.358																																							uc001wxs.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(214-216)GAG>GGG		son of sevenless homolog 2							119.0	109.0	112.0					14																	50667801		2203	4300	6503	SO:0001630	splice_region_variant	6655				apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	DNA binding|protein binding|Rho guanyl-nucleotide exchange factor activity	g.chr14:50667801T>C	L13858	CCDS9697.1	14q21	2013-01-10	2001-12-04		ENSG00000100485	ENSG00000100485		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11188	protein-coding gene	gene with protein product		601247	"""son of sevenless (Drosophilia) homolog 2"""			8276400	Standard	NM_006939		Approved		uc001wxs.4	Q07890	OTTHUMG00000140292	ENST00000216373.5:c.214-1A>G	14.37:g.50667801T>C						SOS2_uc010tql.1_Missense_Mutation_p.E72G	p.E72G	NM_006939	NP_008870	Q07890	SOS2_HUMAN			3	313	-	all_epithelial(31;0.000822)|Breast(41;0.0065)		72					B7ZKT6|D3DSB4|Q15503|Q17RN1	Missense_Mutation	SNP	ENST00000216373.5	37	c.215A>G	CCDS9697.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.154209	0.78114	.	.	ENSG00000100485	ENST00000216373;ENST00000543680	D;D	0.84298	-1.83;-1.83	5.34	5.34	0.76211	Histone-fold (1);	0.046084	0.85682	D	0.000000	D	0.86184	0.5872	M	0.77313	2.365	0.80722	D	1	P;P	0.40660	0.726;0.726	B;B	0.39805	0.31;0.31	D	0.88264	0.2925	10	0.72032	D	0.01	.	15.6074	0.76685	0.0:0.0:0.0:1.0	.	72;72	B7ZKT6;Q07890	.;SOS2_HUMAN	G	72	ENSP00000216373:E72G;ENSP00000445328:E72G	ENSP00000216373:E72G	E	-	2	0	SOS2	49737551	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	7.984000	0.88150	2.147000	0.66899	0.460000	0.39030	GAG		0.358	SOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276878.2		Missense_Mutation	16	42	0	0	0	0.003163	0	16	42				
SLC10A1	6554	broad.mit.edu	37	14	70245197	70245197	+	Missense_Mutation	SNP	A	A	C			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr14:70245197A>C	ENST00000216540.4	-	4	929	c.796T>G	c.(796-798)Tgt>Ggt	p.C266G		NM_003049.3	NP_003040.1	Q14973	NTCP_HUMAN	solute carrier family 10 (sodium/bile acid cotransporter), member 1	266					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bile acid:sodium symporter activity (GO:0008508)	p.C266G(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)	14				all cancers(60;0.00228)|BRCA - Breast invasive adenocarcinoma(234;0.0137)|OV - Ovarian serous cystadenocarcinoma(108;0.0226)	Bumetanide(DB00887)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Ethinyl Estradiol(DB00977)|Indomethacin(DB00328)|Liothyronine(DB00279)|Liotrix(DB01583)|Pitavastatin(DB08860)|Probenecid(DB01032)|Progesterone(DB00396)|Testosterone(DB00624)|Ursodeoxycholic acid(DB01586)	ATGGTGGAACAGAGTTGGACA	0.512																																							uc001xlr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(796-798)TGT>GGT		solute carrier family 10, member 1							163.0	135.0	144.0					14																	70245197		2203	4300	6503	SO:0001583	missense	6554				bile acid metabolic process|organic anion transport	integral to plasma membrane	bile acid:sodium symporter activity	g.chr14:70245197A>C	L21893	CCDS9797.1	14q24.2	2013-07-18	2013-07-18		ENSG00000100652	ENSG00000100652		"""Solute carriers"""	10905	protein-coding gene	gene with protein product		182396				8132774	Standard	NM_003049		Approved	NTCP	uc001xlr.2	Q14973	OTTHUMG00000171236	ENST00000216540.4:c.796T>G	14.37:g.70245197A>C	ENSP00000216540:p.Cys266Gly						p.C266G	NM_003049	NP_003040	Q14973	NTCP_HUMAN		all cancers(60;0.00228)|BRCA - Breast invasive adenocarcinoma(234;0.0137)|OV - Ovarian serous cystadenocarcinoma(108;0.0226)	4	930	-			266					B9EGB6|Q2TU29	Missense_Mutation	SNP	ENST00000216540.4	37	c.796T>G	CCDS9797.1	.	.	.	.	.	.	.	.	.	.	A	17.43	3.386799	0.61956	.	.	ENSG00000100652	ENST00000216540	T	0.80994	-1.44	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	D	0.82332	0.5014	L	0.28649	0.875	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.78331	-0.2245	10	0.16420	T	0.52	-15.7756	14.5117	0.67791	1.0:0.0:0.0:0.0	.	266	Q14973	NTCP_HUMAN	G	266	ENSP00000216540:C266G	ENSP00000216540:C266G	C	-	1	0	SLC10A1	69314950	1.000000	0.71417	0.951000	0.38953	0.398000	0.30690	5.976000	0.70484	2.020000	0.59435	0.459000	0.35465	TGT		0.512	SLC10A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412464.1			13	43	0	0	0	0.013537	0	13	43				
RPS6KA5	9252	broad.mit.edu	37	14	91356980	91356980	+	Missense_Mutation	SNP	T	T	C			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr14:91356980T>C	ENST00000261991.3	-	14	1860	c.1687A>G	c.(1687-1689)Ata>Gta	p.I563V	RPS6KA5_ENST00000536315.2_Missense_Mutation_p.I484V	NM_004755.2	NP_004746.2	O75582	KS6A5_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 5	563	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|epidermal growth factor receptor signaling pathway (GO:0007173)|histone H2A-S1 phosphorylation (GO:0043990)|histone H3-S10 phosphorylation (GO:0043987)|histone H3-S28 phosphorylation (GO:0043988)|histone phosphorylation (GO:0016572)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|intracellular signal transduction (GO:0035556)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cytokine production (GO:0001818)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone phosphorylation (GO:0033129)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.I563V(2)		endometrium(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	24		all_cancers(154;0.0148)|Melanoma(154;0.099)|all_epithelial(191;0.146)		Epithelial(152;0.182)|BRCA - Breast invasive adenocarcinoma(234;0.201)		AAATCAATTATTTTAATTTCC	0.408																																							uc001xys.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1687-1689)ATA>GTA		ribosomal protein S6 kinase, polypeptide 5							64.0	63.0	64.0					14																	91356980		2203	4300	6503	SO:0001583	missense	9252				axon guidance|epidermal growth factor receptor signaling pathway|histone phosphorylation|innate immune response|interleukin-1-mediated signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of histone acetylation|positive regulation of histone phosphorylation|positive regulation of transcription from RNA polymerase II promoter|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytoplasm|nucleoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity	g.chr14:91356980T>C	AF074393	CCDS9893.1, CCDS45149.1	14q31-q32.1	2011-04-05	2002-08-29			ENSG00000100784			10434	protein-coding gene	gene with protein product		603607	"""ribosomal protein S6 kinase, 90kD, polypeptide 5"""			9687510, 10702687	Standard	NM_004755		Approved	MSK1, RLPK	uc001xys.2	O75582		ENST00000261991.3:c.1687A>G	14.37:g.91356980T>C	ENSP00000261991:p.Ile563Val					RPS6KA5_uc010twi.1_Missense_Mutation_p.I484V	p.I563V	NM_004755	NP_004746	O75582	KS6A5_HUMAN		Epithelial(152;0.182)|BRCA - Breast invasive adenocarcinoma(234;0.201)	14	1902	-		all_cancers(154;0.0148)|Melanoma(154;0.099)|all_epithelial(191;0.146)	563			Protein kinase 2.		O95316|Q96AF7	Missense_Mutation	SNP	ENST00000261991.3	37	c.1687A>G	CCDS9893.1	.	.	.	.	.	.	.	.	.	.	T	7.235	0.600033	0.13939	.	.	ENSG00000100784	ENST00000261991;ENST00000536315	T;T	0.55234	0.53;0.53	5.45	1.45	0.22620	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.174874	0.48767	N	0.000170	T	0.35856	0.0946	N	0.25992	0.78	0.80722	D	1	B	0.29253	0.239	B	0.32762	0.152	T	0.06110	-1.0845	10	0.32370	T	0.25	.	7.8095	0.29221	0.0:0.4466:0.0:0.5534	.	563	O75582	KS6A5_HUMAN	V	563;484	ENSP00000261991:I563V;ENSP00000442803:I484V	ENSP00000261991:I563V	I	-	1	0	RPS6KA5	90426733	1.000000	0.71417	0.836000	0.33094	0.278000	0.26855	1.581000	0.36558	0.173000	0.19788	-0.274000	0.10170	ATA		0.408	RPS6KA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411442.2	NM_004755		20	23	0	0	0	0.012319	0	20	23				
TECPR2	9895	broad.mit.edu	37	14	102906821	102906821	+	Missense_Mutation	SNP	G	G	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr14:102906821G>T	ENST00000359520.7	+	11	2853	c.2627G>T	c.(2626-2628)tGt>tTt	p.C876F	TECPR2_ENST00000558678.1_Missense_Mutation_p.C876F	NM_014844.3	NP_055659.2	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2	876					autophagy (GO:0006914)|cell death (GO:0008219)			p.C876F(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(21)|ovary(2)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	50						GCTTTTGCTTGTGGGAAAGTC	0.478																																							uc001ylw.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|central_nervous_system(1)|skin(1)	3						c.(2626-2628)TGT>TTT		tectonin beta-propeller repeat containing 2							75.0	84.0	81.0					14																	102906821		2203	4300	6503	SO:0001583	missense	9895						protein binding	g.chr14:102906821G>T	AB019441	CCDS32162.1, CCDS58337.1	14q32.33	2009-02-27	2009-02-27	2009-02-27		ENSG00000196663			19957	protein-coding gene	gene with protein product		615000	"""KIAA0329"""	KIAA0329		9205841	Standard	NM_014844		Approved		uc001ylw.2	O15040		ENST00000359520.7:c.2627G>T	14.37:g.102906821G>T	ENSP00000352510:p.Cys876Phe					TECPR2_uc010awl.2_Missense_Mutation_p.C876F|TECPR2_uc010txx.1_Missense_Mutation_p.C39F	p.C876F	NM_014844	NP_055659	O15040	TCPR2_HUMAN			11	2775	+			876					A5PKY3|A6NFY9|A7E2X3|H0YMM9|Q9UEG6	Missense_Mutation	SNP	ENST00000359520.7	37	c.2627G>T	CCDS32162.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.523999	0.85600	.	.	ENSG00000196663	ENST00000359520	T	0.79554	-1.28	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	D	0.86239	0.5885	L	0.34521	1.04	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.87578	0.996;0.995;0.998	D	0.86613	0.1874	10	0.87932	D	0	.	20.5632	0.99335	0.0:0.0:1.0:0.0	.	59;876;876	B4DSD3;A5PKY3;O15040	.;.;TCPR2_HUMAN	F	876	ENSP00000352510:C876F	ENSP00000352510:C876F	C	+	2	0	TECPR2	101976574	1.000000	0.71417	0.982000	0.44146	0.995000	0.86356	7.823000	0.86660	2.937000	0.99478	0.650000	0.86243	TGT		0.478	TECPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415056.2	NM_014844		19	69	1	0	1.15919e-05	0.008871	1.29829e-05	19	69				
AHNAK2	113146	broad.mit.edu	37	14	105408258	105408258	+	Missense_Mutation	SNP	G	G	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr14:105408258G>T	ENST00000333244.5	-	7	13649	c.13530C>A	c.(13528-13530)gaC>gaA	p.D4510E	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4510						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.D4510E(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GAATGCGGAGGTCAGTGGTCT	0.622																																							uc010axc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(13528-13530)GAC>GAA		AHNAK nucleoprotein 2							123.0	131.0	128.0					14																	105408258		2014	4174	6188	SO:0001583	missense	113146					nucleus		g.chr14:105408258G>T	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.13530C>A	14.37:g.105408258G>T	ENSP00000353114:p.Asp4510Glu					AHNAK2_uc001ypx.2_Missense_Mutation_p.D4410E	p.D4510E	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)		7	13650	-		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	4510					Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	c.13530C>A	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	G	10.50	1.366414	0.24771	.	.	ENSG00000185567	ENST00000333244	T	0.01228	5.14	3.6	-7.2	0.01495	.	0.502698	0.14438	N	0.319591	T	0.01353	0.0044	L	0.55990	1.75	0.09310	N	1	B	0.26672	0.156	B	0.39562	0.303	T	0.51124	-0.8745	10	0.05833	T	0.94	-17.8202	2.0173	0.03500	0.2446:0.3738:0.2545:0.1271	.	4510	Q8IVF2	AHNK2_HUMAN	E	4510	ENSP00000353114:D4510E	ENSP00000353114:D4510E	D	-	3	2	AHNAK2	104479303	0.000000	0.05858	0.000000	0.03702	0.136000	0.21042	-2.252000	0.01185	-2.284000	0.00671	0.306000	0.20318	GAC		0.622	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		35	84	1	0	4.11147e-13	0.017118	5.79747e-13	35	84				
PLCB2	5330	broad.mit.edu	37	15	40581051	40581051	+	Silent	SNP	C	C	T	rs375249031		TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr15:40581051C>T	ENST00000260402.3	-	32	3672	c.3423G>A	c.(3421-3423)tcG>tcA	p.S1141S	PLCB2_ENST00000456256.2_Silent_p.S1126S|PLCB2_ENST00000557821.1_Silent_p.S1137S	NM_001284297.1|NM_004573.2	NP_001271226.1|NP_004564.2	Q00722	PLCB2_HUMAN	phospholipase C, beta 2	1141					activation of phospholipase C activity (GO:0007202)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|sensory perception of bitter taste (GO:0050913)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)	p.S1137S(1)|p.S1141S(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(3)	39		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)		AGGCCCTCACCGACTCCTTCA	0.642																																							uc001zld.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|breast(3)|kidney(1)|pancreas(1)	8						c.(3421-3423)TCG>TCA		phospholipase C, beta 2		C		1,4061		0,1,2030	60.0	67.0	65.0		3423	-7.5	0.0	15		65	0,8358		0,0,4179	no	coding-synonymous	PLCB2	NM_004573.2		0,1,6209	TT,TC,CC		0.0,0.0246,0.0081		1141/1186	40581051	1,12419	2031	4179	6210	SO:0001819	synonymous_variant	5330				activation of phospholipase C activity|intracellular signal transduction|lipid catabolic process|phospholipid metabolic process|synaptic transmission	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity	g.chr15:40581051C>T		CCDS42020.1, CCDS61591.1, CCDS61592.1, CCDS73704.1	15q15.1	2012-01-23			ENSG00000137841	ENSG00000137841	3.1.4.11		9055	protein-coding gene	gene with protein product		604114				1644792, 9925923	Standard	XM_005254448		Approved	FLJ38135	uc001zld.3	Q00722	OTTHUMG00000172412	ENST00000260402.3:c.3423G>A	15.37:g.40581051C>T						PLCB2_uc001zlc.2_Silent_p.S125S|PLCB2_uc010bbo.2_Silent_p.S1137S|PLCB2_uc010ucm.1_Silent_p.S1126S	p.S1141S	NM_004573	NP_004564	Q00722	PLCB2_HUMAN		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)	32	3724	-		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)	1141			Potential.		A8K6J2|B9EGH5	Silent	SNP	ENST00000260402.3	37	c.3423G>A	CCDS42020.1																																																																																				0.642	PLCB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418430.1			7	38	0	0	0	0.00308	0	7	38				
CTDSPL2	51496	broad.mit.edu	37	15	44789291	44789291	+	Silent	SNP	G	G	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr15:44789291G>T	ENST00000260327.4	+	7	1400	c.837G>T	c.(835-837)ccG>ccT	p.P279P	CTDSPL2_ENST00000558373.1_Silent_p.P207P|CTDSPL2_ENST00000561189.1_3'UTR|CTDSPL2_ENST00000396780.1_Silent_p.P207P|CTDSPL2_ENST00000558966.1_Silent_p.P279P	NM_016396.2	NP_057480.2	Q05D32	CTSL2_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2	279							phosphoprotein phosphatase activity (GO:0004721)	p.P279P(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(2)	13		all_cancers(109;4.36e-14)|all_epithelial(112;9.8e-12)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.0122)		all cancers(107;1.02e-20)|GBM - Glioblastoma multiforme(94;1.49e-06)|COAD - Colon adenocarcinoma(120;0.0857)|Colorectal(105;0.0905)		CTGCTCTTCCGTTGAAAACAA	0.343																																							uc001ztr.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(835-837)CCG>CCT		CTD (carboxy-terminal domain, RNA polymerase II,							70.0	71.0	71.0					15																	44789291		2198	4298	6496	SO:0001819	synonymous_variant	51496						phosphoprotein phosphatase activity	g.chr15:44789291G>T	AF161478	CCDS10110.1	15q15.3-q21.1	2010-06-21			ENSG00000137770	ENSG00000137770		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	26936	protein-coding gene	gene with protein product							Standard	NM_016396		Approved	HSPC129, FLJ10523	uc001ztr.3	Q05D32	OTTHUMG00000131159	ENST00000260327.4:c.837G>T	15.37:g.44789291G>T						CTDSPL2_uc001zts.2_Silent_p.P279P|CTDSPL2_uc001ztt.2_Silent_p.P279P|CTDSPL2_uc010bdv.2_Silent_p.P207P	p.P279P	NM_016396	NP_057480	Q05D32	CTSL2_HUMAN		all cancers(107;1.02e-20)|GBM - Glioblastoma multiforme(94;1.49e-06)|COAD - Colon adenocarcinoma(120;0.0857)|Colorectal(105;0.0905)	7	1253	+		all_cancers(109;4.36e-14)|all_epithelial(112;9.8e-12)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.0122)	279					Q3ZTU1|Q6AI06|Q8IYI9|Q9NVT2|Q9NZX8|Q9P030	Silent	SNP	ENST00000260327.4	37	c.837G>T	CCDS10110.1																																																																																				0.343	CTDSPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253851.1	NM_016396		21	20	1	0	1.96895e-08	0.016522	2.38218e-08	21	20				
IGF1R	3480	broad.mit.edu	37	15	99465655	99465655	+	Missense_Mutation	SNP	C	C	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr15:99465655C>A	ENST00000268035.6	+	11	3091	c.2480C>A	c.(2479-2481)cCc>cAc	p.P827H	IGF1R_ENST00000558762.1_Missense_Mutation_p.P827H	NM_000875.3	NP_000866.1	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor	827	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|epidermis development (GO:0008544)|establishment of cell polarity (GO:0030010)|exocrine pancreas development (GO:0031017)|immune response (GO:0006955)|inactivation of MAPKK activity (GO:0051389)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|male sex determination (GO:0030238)|mammary gland development (GO:0030879)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|peptidyl-tyrosine autophosphorylation (GO:0038083)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of DNA replication (GO:0045740)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|prostate gland epithelium morphogenesis (GO:0060740)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein tetramerization (GO:0051262)|regulation of JNK cascade (GO:0046328)|response to vitamin E (GO:0033197)|signal transduction (GO:0007165)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor binding (GO:0005520)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor-activated receptor activity (GO:0005010)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)	p.P827H(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(13)|lung(20)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		"""""""Insulin(DB00071)|Insulin Glargine(DB00047)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	AGGACTATGCCCGCAGGTATG	0.552																																							uc002bul.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|kidney(3)|ovary(1)|central_nervous_system(1)	8						c.(2479-2481)CCC>CAC		insulin-like growth factor 1 receptor precursor	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Mecasermin(DB01277)						100.0	95.0	97.0					15																	99465655		2197	4297	6494	SO:0001583	missense	3480				anti-apoptosis|immune response|insulin receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of DNA replication|protein autophosphorylation|protein tetramerization	microsome	ATP binding|identical protein binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor receptor activity|metal ion binding|phosphatidylinositol 3-kinase binding	g.chr15:99465655C>A	M69229	CCDS10378.1, CCDS73785.1	15q26.3	2013-02-11			ENSG00000140443	ENSG00000140443		"""CD molecules"", ""Fibronectin type III domain containing"""	5465	protein-coding gene	gene with protein product		147370				1316909	Standard	XM_006720486		Approved	JTK13, CD221, IGFIR, MGC18216, IGFR	uc002bul.3	P08069	OTTHUMG00000149851	ENST00000268035.6:c.2480C>A	15.37:g.99465655C>A	ENSP00000268035:p.Pro827His					IGF1R_uc010urq.1_Missense_Mutation_p.P827H|IGF1R_uc010bon.2_Missense_Mutation_p.P827H|IGF1R_uc010boo.1_5'Flank	p.P827H	NM_000875	NP_000866	P08069	IGF1R_HUMAN	Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		11	2530	+	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		827			Extracellular (Potential).		B1B5Y2|Q14CV2|Q9UCC0	Missense_Mutation	SNP	ENST00000268035.6	37	c.2480C>A	CCDS10378.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.557857	0.86231	.	.	ENSG00000140443	ENST00000268035	T	0.72282	-0.64	5.4	5.4	0.78164	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.000000	0.56097	D	0.000021	D	0.85952	0.5817	M	0.85630	2.765	0.80722	D	1	D;D	0.89917	1.0;0.991	D;D	0.69654	0.965;0.923	D	0.88058	0.2792	10	0.87932	D	0	.	19.1662	0.93559	0.0:1.0:0.0:0.0	.	827;827	C9J5X1;P08069	.;IGF1R_HUMAN	H	827	ENSP00000268035:P827H	ENSP00000268035:P827H	P	+	2	0	IGF1R	97283178	1.000000	0.71417	0.984000	0.44739	0.686000	0.39977	7.802000	0.85969	2.509000	0.84616	0.655000	0.94253	CCC		0.552	IGF1R-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313537.2	NM_000875		26	22	1	0	4.22769e-11	0.00632	5.59884e-11	26	22				
CACNA1H	8912	broad.mit.edu	37	16	1261168	1261168	+	Splice_Site	SNP	G	G	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr16:1261168G>T	ENST00000348261.5	+	22	4472	c.4224G>T	c.(4222-4224)agG>agT	p.R1408S	CACNA1H_ENST00000358590.4_Splice_Site_p.R1408S|CACNA1H_ENST00000565831.1_Splice_Site_p.R1408S	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	1408					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)	p.R1408S(2)		breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	TCCCCTCCAGGGTCATCAGCC	0.627																																							uc002cks.2		NA																	2	Substitution - Missense(2)		lung(2)	breast(2)	2						c.(4222-4224)AGG>AGT		calcium channel, voltage-dependent, T type,	Flunarizine(DB04841)|Mibefradil(DB01388)						48.0	55.0	53.0					16																	1261168		2061	4195	6256	SO:0001630	splice_region_variant	8912				aldosterone biosynthetic process|axon guidance|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|muscle contraction|myoblast fusion|positive regulation of acrosome reaction|regulation of heart contraction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity	g.chr16:1261168G>T	AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.4224-1G>T	16.37:g.1261168G>T						CACNA1H_uc002ckt.2_Missense_Mutation_p.R1408S|CACNA1H_uc002cku.2_Missense_Mutation_p.R114S|CACNA1H_uc010brj.2_Missense_Mutation_p.R114S|CACNA1H_uc002ckv.2_Missense_Mutation_p.R114S	p.R1408S	NM_021098	NP_066921	O95180	CAC1H_HUMAN			22	4472	+		Hepatocellular(780;0.00369)	1408			III.|Helical; Name=S4 of repeat III; (Potential).		B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Missense_Mutation	SNP	ENST00000348261.5	37	c.4224G>T	CCDS45375.1	.	.	.	.	.	.	.	.	.	.	G	15.94	2.981514	0.53827	.	.	ENSG00000196557	ENST00000348261;ENST00000358590	D;D	0.98455	-4.94;-4.94	4.35	4.35	0.52113	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99254	0.9740	H	0.97896	4.1	0.80722	D	1	D;D;D;P;P	0.89917	1.0;0.994;0.994;0.566;0.605	D;D;P;B;B	0.87578	0.998;0.945;0.831;0.274;0.377	D	0.98607	1.0661	9	.	.	.	.	9.8806	0.41231	0.107:0.0:0.893:0.0	.	149;149;149;1408;1408	A2SX38;A2SX35;A2SX37;O95180-2;O95180	.;.;.;.;CAC1H_HUMAN	S	1408	ENSP00000334198:R1408S;ENSP00000351401:R1408S	.	R	+	3	2	CACNA1H	1201169	1.000000	0.71417	1.000000	0.80357	0.829000	0.46940	4.487000	0.60293	2.414000	0.81942	0.491000	0.48974	AGG		0.627	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000421601.1	NM_001005407	Missense_Mutation	16	38	1	0	0.00152264	0.010504	0.00161318	16	38				
OR1F1	4992	broad.mit.edu	37	16	3255025	3255025	+	Missense_Mutation	SNP	T	T	G			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr16:3255025T>G	ENST00000304646.2	+	1	779	c.779T>G	c.(778-780)tTt>tGt	p.F260C	AJ003147.9_ENST00000576468.1_RNA	NM_012360.1	NP_036492.1	O43749	OR1F1_HUMAN	olfactory receptor, family 1, subfamily F, member 1	260					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F260C(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(7)	11						GCTGTGTATTTTAACCCTCTG	0.493																																							uc010uwu.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(778-780)TTT>TGT		olfactory receptor, family 1, subfamily F,							196.0	186.0	189.0					16																	3255025		2197	4300	6497	SO:0001583	missense	4992				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr16:3255025T>G	Y14442	CCDS10496.1	16p13.3	2012-08-09			ENSG00000168124	ENSG00000168124		"""GPCR / Class A : Olfactory receptors"""	8194	protein-coding gene	gene with protein product		603232		OR1F4, OR1F6, OR1F7, OR1F8, OR1F9, OR1F5, OR1F10, OR1F13P		9288094, 9500546	Standard	NM_012360		Approved	Olfmf, OR16-36, OR16-37, OR16-88, OR16-89, OR16-90, OLFMF, OR3-145	uc010uwu.2	O43749	OTTHUMG00000133153	ENST00000304646.2:c.779T>G	16.37:g.3255025T>G	ENSP00000305424:p.Phe260Cys						p.F260C	NM_012360	NP_036492	O43749	OR1F1_HUMAN			1	779	+			260			Extracellular (Potential).		O15246|Q6IFL5	Missense_Mutation	SNP	ENST00000304646.2	37	c.779T>G	CCDS10496.1	.	.	.	.	.	.	.	.	.	.	T	11.35	1.613419	0.28712	.	.	ENSG00000168124	ENST00000304646	T	0.43688	0.94	5.06	5.06	0.68205	GPCR, rhodopsin-like superfamily (1);	0.107337	0.41823	D	0.000801	T	0.61324	0.2338	M	0.66378	2.025	0.30398	N	0.78035	D	0.89917	1.0	D	0.80764	0.994	T	0.65380	-0.6182	10	0.87932	D	0	.	12.738	0.57236	0.0:0.0:0.0:1.0	.	260	O43749	OR1F1_HUMAN	C	260	ENSP00000305424:F260C	ENSP00000305424:F260C	F	+	2	0	OR1F1	3195026	0.478000	0.25917	0.997000	0.53966	0.246000	0.25737	4.260000	0.58835	1.891000	0.54761	0.323000	0.21402	TTT		0.493	OR1F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206985.1			65	111	0	0	0	0.01441	0	65	111				
GRIN2A	2903	broad.mit.edu	37	16	9916122	9916122	+	Splice_Site	SNP	C	C	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr16:9916122C>A	ENST00000396573.2	-	11	2476	c.2167G>T	c.(2167-2169)Ggg>Tgg	p.G723W	GRIN2A_ENST00000404927.2_Splice_Site_p.G723W|GRIN2A_ENST00000330684.3_Splice_Site_p.G723W|GRIN2A_ENST00000396575.2_Splice_Site_p.G723W|GRIN2A_ENST00000562109.1_Splice_Site_p.G723W|GRIN2A_ENST00000535259.1_Splice_Site_p.G566W	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	723					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.G723W(1)		NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CATCCTTACCCCGTTTTCAGG	0.463																																							uc002czo.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45						c.(2167-2169)GGG>TGG		N-methyl-D-aspartate receptor subunit 2A isoform	Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)						155.0	138.0	144.0					16																	9916122		2197	4300	6497	SO:0001630	splice_region_variant	2903				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding	g.chr16:9916122C>A		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.2168+1G>T	16.37:g.9916122C>A						GRIN2A_uc010uym.1_Missense_Mutation_p.G723W|GRIN2A_uc010uyn.1_Missense_Mutation_p.G566W|GRIN2A_uc002czr.3_Missense_Mutation_p.G723W	p.G723W	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN			10	2715	-			723			Extracellular (Potential).		O00669|Q17RZ6	Missense_Mutation	SNP	ENST00000396573.2	37	c.2167G>T	CCDS10539.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.834530	0.91036	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000535259;ENST00000330684;ENST00000396575	T;T;T;T;T	0.68025	-0.3;-0.3;-0.3;-0.3;-0.3	5.65	5.65	0.86999	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	D	0.86615	0.5975	M	0.92604	3.325	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.89223	0.3572	9	.	.	.	.	18.7287	0.91726	0.0:1.0:0.0:0.0	.	566;723;723	F5GZ52;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	W	723;723;566;723;723	ENSP00000379818:G723W;ENSP00000385872:G723W;ENSP00000441572:G566W;ENSP00000332549:G723W;ENSP00000379820:G723W	.	G	-	1	0	GRIN2A	9823623	1.000000	0.71417	0.963000	0.40424	0.894000	0.52154	7.684000	0.84104	2.655000	0.90218	0.655000	0.94253	GGG		0.463	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3		Missense_Mutation	49	61	1	0	1.95508e-11	0.01441	2.62462e-11	49	61				
EEF2K	29904	broad.mit.edu	37	16	22237269	22237269	+	Silent	SNP	G	G	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr16:22237269G>T	ENST00000263026.5	+	2	693	c.219G>T	c.(217-219)ggG>ggT	p.G73G		NM_013302.3	NP_037434	O00418	EF2K_HUMAN	eukaryotic elongation factor-2 kinase	73					insulin receptor signaling pathway (GO:0008286)|protein autophosphorylation (GO:0046777)|regulation of protein autophosphorylation (GO:0031952)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|elongation factor-2 kinase activity (GO:0004686)|protein kinase activity (GO:0004672)|translation factor activity, nucleic acid binding (GO:0008135)	p.G73G(2)		breast(1)|central_nervous_system(1)|endometrium(8)|large_intestine(2)|lung(13)|ovary(1)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(48;0.0223)		GCTCCAGCGGGTCCCCGGCAA	0.532																																					NSCLC(195;1411 2157 20319 27471 51856)	NSCLC(195;1411 2157 20319 27471 51856)	uc002dki.2		NA																	2	Substitution - coding silent(2)		lung(2)	large_intestine(1)	1						c.(217-219)GGG>GGT		elongation factor-2 kinase							69.0	65.0	66.0					16																	22237269		2197	4300	6497	SO:0001819	synonymous_variant	29904				insulin receptor signaling pathway|translational elongation	cytosol	ATP binding|calcium ion binding|calmodulin binding|elongation factor-2 kinase activity|translation factor activity, nucleic acid binding	g.chr16:22237269G>T	U93850	CCDS10604.1	16p12	2008-02-05			ENSG00000103319	ENSG00000103319			24615	protein-coding gene	gene with protein product		606968				9144159, 12051769	Standard	NM_013302		Approved	eEF-2K	uc002dki.3	O00418	OTTHUMG00000094771	ENST00000263026.5:c.219G>T	16.37:g.22237269G>T						EEF2K_uc002dkh.2_RNA	p.G73G	NM_013302	NP_037434	O00418	EF2K_HUMAN		GBM - Glioblastoma multiforme(48;0.0223)	2	704	+			73					Q8N588	Silent	SNP	ENST00000263026.5	37	c.219G>T	CCDS10604.1																																																																																				0.532	EEF2K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211580.2	NM_013302		20	36	1	0	1.64113e-05	0.010504	1.82763e-05	20	36				
ZKSCAN2	342357	broad.mit.edu	37	16	25258612	25258612	+	Missense_Mutation	SNP	C	C	A	rs138595438	byFrequency	TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr16:25258612C>A	ENST00000328086.7	-	5	1708	c.905G>T	c.(904-906)cGa>cTa	p.R302L		NM_001012981.4	NP_001012999.3	Q63HK3	ZKSC2_HUMAN	zinc finger with KRAB and SCAN domains 2	302					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.R302L(1)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(15)|ovary(3)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	36				GBM - Glioblastoma multiforme(48;0.0378)		GTAGTTGCTTCGTAGGATACT	0.468																																							uc002dod.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(1)	4						c.(904-906)CGA>CTA		zinc finger with KRAB and SCAN domains 2							133.0	119.0	124.0					16																	25258612		2197	4300	6497	SO:0001583	missense	342357				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr16:25258612C>A	AK026852	CCDS32410.1	16p12.1	2013-01-09	2007-02-20	2007-02-20		ENSG00000155592		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	25677	protein-coding gene	gene with protein product			"""zinc finger protein 694"""	ZNF694			Standard	NM_001012981		Approved	FLJ23199, ZSCAN34	uc002dod.4	Q63HK3		ENST00000328086.7:c.905G>T	16.37:g.25258612C>A	ENSP00000331626:p.Arg302Leu					ZKSCAN2_uc010vcl.1_Missense_Mutation_p.R98L|ZKSCAN2_uc002doe.2_Missense_Mutation_p.R302L	p.R302L	NM_001012981	NP_001012999	Q63HK3	ZKSC2_HUMAN		GBM - Glioblastoma multiforme(48;0.0378)	5	1312	-			302					A1L3B4|Q6ZN77	Missense_Mutation	SNP	ENST00000328086.7	37	c.905G>T	CCDS32410.1	.	.	.	.	.	.	.	.	.	.	C	8.157	0.788589	0.16258	.	.	ENSG00000155592	ENST00000328086;ENST00000536768	T	0.14391	2.51	5.97	1.07	0.20283	.	0.393509	0.21426	N	0.074724	T	0.15565	0.0375	L	0.45352	1.415	0.23946	N	0.996386	P;P;P	0.47253	0.543;0.892;0.543	B;P;B	0.49922	0.149;0.626;0.149	T	0.09185	-1.0686	10	0.39692	T	0.17	-0.3128	7.4724	0.27357	0.0:0.5031:0.0:0.4969	.	98;302;302	B4DYF0;Q63HK3-2;Q63HK3	.;.;ZKSC2_HUMAN	L	302	ENSP00000331626:R302L	ENSP00000331626:R302L	R	-	2	0	ZKSCAN2	25166113	0.001000	0.12720	0.083000	0.20561	0.072000	0.16883	-0.359000	0.07632	-0.044000	0.13491	-0.229000	0.12294	CGA		0.468	ZKSCAN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435739.1	NM_001012981		48	56	1	0	4.21674e-32	0.01441	6.83042e-32	48	56				
SHCBP1	79801	broad.mit.edu	37	16	46633812	46633812	+	Missense_Mutation	SNP	A	A	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr16:46633812A>T	ENST00000303383.3	-	9	1542	c.1276T>A	c.(1276-1278)Tgc>Agc	p.C426S		NM_024745.4	NP_079021	Q8NEM2	SHCBP_HUMAN	SHC SH2-domain binding protein 1	426					fibroblast growth factor receptor signaling pathway (GO:0008543)|regulation of neural precursor cell proliferation (GO:2000177)			p.C426S(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		all_cancers(37;0.00404)|all_epithelial(9;0.00527)|all_lung(18;0.0413)|Lung NSC(13;0.213)				GCACCAGTGCAGTCCACAAAA	0.408																																							uc002eec.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(1276-1278)TGC>AGC		SHC SH2-domain binding protein 1							102.0	97.0	99.0					16																	46633812		2203	4300	6503	SO:0001583	missense	79801							g.chr16:46633812A>T	AK055931	CCDS10720.1	16q11	2008-02-05			ENSG00000171241	ENSG00000171241			29547	protein-coding gene	gene with protein product		611027				10086341	Standard	NM_024745		Approved	FLJ22009	uc002eec.4	Q8NEM2	OTTHUMG00000132540	ENST00000303383.3:c.1276T>A	16.37:g.46633812A>T	ENSP00000306473:p.Cys426Ser						p.C426S	NM_024745	NP_079021	Q8NEM2	SHCBP_HUMAN			9	1316	-		all_cancers(37;0.00404)|all_epithelial(9;0.00527)|all_lung(18;0.0413)|Lung NSC(13;0.213)	426					Q96N60|Q9BVS0|Q9H6P6	Missense_Mutation	SNP	ENST00000303383.3	37	c.1276T>A	CCDS10720.1	.	.	.	.	.	.	.	.	.	.	A	4.583	0.108332	0.08780	.	.	ENSG00000171241	ENST00000303383	T	0.37411	1.2	3.79	3.79	0.43588	Pectin lyase fold/virulence factor (1);Pectin lyase fold (1);	0.104624	0.64402	D	0.000002	T	0.25082	0.0609	L	0.29908	0.895	0.48185	D	0.9996	B	0.34329	0.449	B	0.34873	0.191	T	0.03795	-1.1003	10	0.13470	T	0.59	-10.5492	12.6986	0.57018	1.0:0.0:0.0:0.0	.	426	Q8NEM2	SHCBP_HUMAN	S	426	ENSP00000306473:C426S	ENSP00000306473:C426S	C	-	1	0	SHCBP1	45191313	1.000000	0.71417	0.879000	0.34478	0.205000	0.24178	5.031000	0.64134	1.590000	0.49995	0.460000	0.39030	TGC		0.408	SHCBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255740.1	NM_024745		14	30	0	0	0	0.020292	0	14	30				
MYLK3	91807	broad.mit.edu	37	16	46781866	46781866	+	Silent	SNP	C	C	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr16:46781866C>A	ENST00000394809.4	-	1	355	c.240G>T	c.(238-240)ggG>ggT	p.G80G	MYLK3_ENST00000536476.1_Intron	NM_182493.2	NP_872299.2	Q32MK0	MYLK3_HUMAN	myosin light chain kinase 3	80					cardiac myofibril assembly (GO:0055003)|cellular response to interleukin-1 (GO:0071347)|positive regulation of sarcomere organization (GO:0060298)|protein phosphorylation (GO:0006468)|regulation of vascular permeability involved in acute inflammatory response (GO:0002528)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|myosin light chain kinase activity (GO:0004687)	p.G80G(2)		central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(3)|prostate(3)|skin(5)|stomach(3)	37		all_cancers(37;0.00023)|all_epithelial(9;0.000543)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				TGTGGGGAACCCCATCAGCCC	0.711																																							uc002eei.3		NA																	2	Substitution - coding silent(2)		lung(2)	stomach(2)|skin(2)|large_intestine(1)|ovary(1)|central_nervous_system(1)	7						c.(238-240)GGG>GGT		myosin light chain kinase 3							22.0	25.0	24.0					16																	46781866		2201	4297	6498	SO:0001819	synonymous_variant	91807				cardiac myofibril assembly|cellular response to interleukin-1|positive regulation of sarcomere organization|regulation of vascular permeability involved in acute inflammatory response|sarcomere organization|sarcomerogenesis	cytosol	ATP binding|calmodulin-dependent protein kinase activity|myosin light chain kinase activity	g.chr16:46781866C>A	AJ247087	CCDS10723.2	16q11.2	2008-10-23			ENSG00000140795	ENSG00000140795			29826	protein-coding gene	gene with protein product	"""MLC kinase"""	612147				17885681	Standard	NM_182493		Approved	caMLCK, MLCK	uc002eei.4	Q32MK0	OTTHUMG00000132543	ENST00000394809.4:c.240G>T	16.37:g.46781866C>A						MYLK3_uc010vge.1_Intron	p.G80G	NM_182493	NP_872299	Q32MK0	MYLK3_HUMAN			1	356	-		all_cancers(37;0.00023)|all_epithelial(9;0.000543)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)	80					B5BUL9|B7Z5U8|Q32MK1|Q96DV1	Silent	SNP	ENST00000394809.4	37	c.240G>T	CCDS10723.2																																																																																				0.711	MYLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255743.2	NM_182493		7	23	1	0	0.00198382	0.001984	0.0020793	7	23				
SALL1	6299	broad.mit.edu	37	16	51173150	51173150	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr16:51173150G>A	ENST00000251020.4	-	2	3016	c.2983C>T	c.(2983-2985)Cgg>Tgg	p.R995W	SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_Missense_Mutation_p.R898W|SALL1_ENST00000541611.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	995					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R995W(2)		NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			AATTTACCCCGGTCTCTAAAA	0.433																																					GBM(103;1352 1446 1855 4775 8890)	GBM(103;1352 1446 1855 4775 8890)	uc010vgs.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(5)|ovary(3)	8						c.(2983-2985)CGG>TGG		sal-like 1 isoform a							50.0	52.0	51.0					16																	51173150		2198	4300	6498	SO:0001583	missense	6299				adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr16:51173150G>A	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.2983C>T	16.37:g.51173150G>A	ENSP00000251020:p.Arg995Trp					SALL1_uc010vgr.1_Missense_Mutation_p.R898W|SALL1_uc010cbv.2_Intron	p.R995W	NM_002968	NP_002959	Q9NSC2	SALL1_HUMAN	COAD - Colon adenocarcinoma(2;0.24)		2	3014	-		all_cancers(37;0.0322)	995					Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	37	c.2983C>T	CCDS10747.1	.	.	.	.	.	.	.	.	.	.	G	16.69	3.193867	0.58017	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.09350	3.0;2.99	5.6	4.63	0.57726	.	0.000000	0.85682	D	0.000000	T	0.27241	0.0668	L	0.52011	1.625	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.01102	-1.1451	10	0.72032	D	0.01	.	13.8215	0.63322	0.0:0.0:0.6655:0.3345	.	995	Q9NSC2	SALL1_HUMAN	W	995;898;959	ENSP00000251020:R995W;ENSP00000407914:R898W	ENSP00000251020:R995W	R	-	1	2	SALL1	49730651	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.411000	0.66386	1.333000	0.45449	0.557000	0.71058	CGG		0.433	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968		9	47	0	0	0	0.004482	0	9	47				
SALL1	6299	broad.mit.edu	37	16	51174200	51174200	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr16:51174200G>A	ENST00000251020.4	-	2	1966	c.1933C>T	c.(1933-1935)Cca>Tca	p.P645S	SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_Missense_Mutation_p.P548S|SALL1_ENST00000562674.1_5'Flank|SALL1_ENST00000541611.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	645					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P645S(1)		NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			TCTGCCGCTGGGGAGCTCAGG	0.627																																					GBM(103;1352 1446 1855 4775 8890)	GBM(103;1352 1446 1855 4775 8890)	uc010vgs.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(5)|ovary(3)	8						c.(1933-1935)CCA>TCA		sal-like 1 isoform a							38.0	40.0	39.0					16																	51174200		2198	4300	6498	SO:0001583	missense	6299				adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr16:51174200G>A	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.1933C>T	16.37:g.51174200G>A	ENSP00000251020:p.Pro645Ser					SALL1_uc010vgr.1_Missense_Mutation_p.P548S|SALL1_uc010cbv.2_Intron	p.P645S	NM_002968	NP_002959	Q9NSC2	SALL1_HUMAN	COAD - Colon adenocarcinoma(2;0.24)		2	1964	-		all_cancers(37;0.0322)	645					Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	37	c.1933C>T	CCDS10747.1	.	.	.	.	.	.	.	.	.	.	G	2.576	-0.298512	0.05532	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.06608	3.29;3.28	4.89	4.89	0.63831	.	0.318283	0.37219	N	0.002196	T	0.07279	0.0184	L	0.33189	0.99	0.40787	D	0.983221	B	0.12630	0.006	B	0.14023	0.01	T	0.34428	-0.9829	10	0.27785	T	0.31	.	18.2552	0.90017	0.0:0.0:1.0:0.0	.	645	Q9NSC2	SALL1_HUMAN	S	645;548;609	ENSP00000251020:P645S;ENSP00000407914:P548S	ENSP00000251020:P645S	P	-	1	0	SALL1	49731701	0.997000	0.39634	0.990000	0.47175	0.039000	0.13416	2.242000	0.43106	2.534000	0.85438	0.557000	0.71058	CCA		0.627	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968		10	44	0	0	0	0.008291	0	10	44				
SALL1	6299	broad.mit.edu	37	16	51175394	51175394	+	Missense_Mutation	SNP	T	T	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr16:51175394T>A	ENST00000251020.4	-	2	772	c.739A>T	c.(739-741)Atc>Ttc	p.I247F	SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_Missense_Mutation_p.I150F|SALL1_ENST00000562674.1_5'Flank|SALL1_ENST00000541611.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	247					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I247F(1)		NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			ATCTGTTCGATCAATTGCAGC	0.537																																					GBM(103;1352 1446 1855 4775 8890)	GBM(103;1352 1446 1855 4775 8890)	uc010vgs.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(5)|ovary(3)	8						c.(739-741)ATC>TTC		sal-like 1 isoform a							83.0	86.0	85.0					16																	51175394		2198	4300	6498	SO:0001583	missense	6299				adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr16:51175394T>A	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.739A>T	16.37:g.51175394T>A	ENSP00000251020:p.Ile247Phe					SALL1_uc010vgr.1_Missense_Mutation_p.I150F|SALL1_uc010cbv.2_Intron	p.I247F	NM_002968	NP_002959	Q9NSC2	SALL1_HUMAN	COAD - Colon adenocarcinoma(2;0.24)		2	770	-		all_cancers(37;0.0322)	247					Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	37	c.739A>T	CCDS10747.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.079878	0.76528	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.10099	2.91;2.91	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.34890	0.0913	M	0.78049	2.395	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.14643	-1.0465	10	0.87932	D	0	.	15.3742	0.74590	0.0:0.0:0.0:1.0	.	247	Q9NSC2	SALL1_HUMAN	F	247;150;211	ENSP00000251020:I247F;ENSP00000407914:I150F	ENSP00000251020:I247F	I	-	1	0	SALL1	49732895	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.025000	0.88777	2.018000	0.59344	0.459000	0.35465	ATC		0.537	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968		11	71	0	0	0	0.020292	0	11	71				
CHD9	80205	broad.mit.edu	37	16	53272307	53272307	+	Missense_Mutation	SNP	A	A	G			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr16:53272307A>G	ENST00000398510.3	+	11	2773	c.2686A>G	c.(2686-2688)Att>Gtt	p.I896V	CHD9_ENST00000564845.1_Missense_Mutation_p.I896V|CHD9_ENST00000566029.1_Missense_Mutation_p.I896V|CHD9_ENST00000447540.1_Missense_Mutation_p.I896V			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	896	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.I896V(2)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				TATTCAATCAATTACATTCCT	0.358																																							uc002ehb.2		NA																	2	Substitution - Missense(2)		urinary_tract(1)|lung(1)	lung(2)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|kidney(1)	7						c.(2686-2688)ATT>GTT		chromodomain helicase DNA binding protein 9							102.0	95.0	97.0					16																	53272307		1828	4086	5914	SO:0001583	missense	80205				cellular lipid metabolic process|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleoplasm	ATP binding|DNA binding|helicase activity|protein binding	g.chr16:53272307A>G	AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.2686A>G	16.37:g.53272307A>G	ENSP00000381522:p.Ile896Val					CHD9_uc002egy.2_Missense_Mutation_p.I896V|CHD9_uc002eha.1_Missense_Mutation_p.I896V|CHD9_uc002ehc.2_Missense_Mutation_p.I896V|CHD9_uc002ehf.2_Missense_Mutation_p.I10V|CHD9_uc002ehd.2_Missense_Mutation_p.I422V|CHD9_uc002ehe.1_Missense_Mutation_p.I10V	p.I896V	NM_025134	NP_079410	Q3L8U1	CHD9_HUMAN			11	2850	+		all_cancers(37;0.0212)	896			Helicase ATP-binding.		B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Missense_Mutation	SNP	ENST00000398510.3	37	c.2686A>G		.	.	.	.	.	.	.	.	.	.	A	16.19	3.052972	0.55218	.	.	ENSG00000177200	ENST00000447540;ENST00000398510;ENST00000219084	D;D	0.94092	-3.35;-3.35	5.02	5.02	0.67125	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.64402	D	0.000020	D	0.93877	0.8041	L	0.31371	0.925	0.80722	D	1	B;P;P;P	0.47604	0.422;0.511;0.898;0.876	P;P;D;D	0.68192	0.644;0.526;0.956;0.927	D	0.93224	0.6611	10	0.34782	T	0.22	-15.4207	14.7523	0.69536	1.0:0.0:0.0:0.0	.	422;896;896;896	B4DR07;Q3L8U1-3;Q3L8U1;Q3L8U1-2	.;.;CHD9_HUMAN;.	V	896;896;422	ENSP00000396345:I896V;ENSP00000381522:I896V	ENSP00000219084:I422V	I	+	1	0	CHD9	51829808	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	9.281000	0.95811	1.892000	0.54788	0.377000	0.23210	ATT		0.358	CHD9-020	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000422345.1	NM_025134		17	58	0	0	0	0.00499	0	17	58				
RLTPR	146206	broad.mit.edu	37	16	67686373	67686373	+	Splice_Site	SNP	A	A	G			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr16:67686373A>G	ENST00000334583.6	+	28	3145		c.e28-1		RLTPR_ENST00000545661.1_Splice_Site	NM_001013838.1	NP_001013860.1	Q6F5E8	LR16C_HUMAN	RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing						cell migration (GO:0016477)|establishment of protein localization (GO:0045184)|homeostasis of number of cells (GO:0048872)|maintenance of cell polarity (GO:0030011)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interferon-gamma secretion (GO:1902715)|positive regulation of interleukin-2 secretion (GO:1900042)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|F-actin capping protein complex (GO:0008290)|immunological synapse (GO:0001772)|membrane (GO:0016020)		p.?(2)		breast(1)|cervix(1)|endometrium(4)|kidney(1)|lung(9)|urinary_tract(2)	18		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)		CCTCCCCACCAGGATGACAGT	0.572																																							uc002etn.2		NA																	2	Unknown(2)		lung(2)	breast(1)	1						c.e28-2		RGD motif, leucine rich repeats, tropomodulin							70.0	73.0	72.0					16																	67686373		2033	4181	6214	SO:0001630	splice_region_variant	146206							g.chr16:67686373A>G	AB113647	CCDS45513.1	16q22.1	2010-09-10				ENSG00000159753			27089	protein-coding gene	gene with protein product	"""RGD, leucine-rich repeat, tropomodulin and proline-rich containing protein"", ""leucine rich repeat containing 16C"""	610859				15588584, 19846667	Standard	XM_005255807		Approved	LRRC16C, CARMIL2	uc002etn.3	Q6F5E8		ENST00000334583.6:c.2818-1A>G	16.37:g.67686373A>G						RLTPR_uc010cel.1_Splice_Site_p.D933_splice|RLTPR_uc010vjr.1_Splice_Site_p.D904_splice|RLTPR_uc010vjs.1_5'Flank	p.D940_splice	NM_001013838	NP_001013860	Q6F5E8	LR16C_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)	28	2938	+		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)						B8X2Z3	Splice_Site	SNP	ENST00000334583.6	37	c.2818_splice	CCDS45513.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.565607	0.86439	.	.	ENSG00000159753	ENST00000334583;ENST00000398282;ENST00000545661	.	.	.	4.29	4.29	0.51040	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.9936	0.41885	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RLTPR	66243874	1.000000	0.71417	0.484000	0.27391	0.970000	0.65996	3.290000	0.51755	1.912000	0.55364	0.454000	0.30748	.		0.572	RLTPR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467858.1	NM_001013838	Intron	8	4	0	0	0	0.00308	0	8	4				
CYB5B	80777	broad.mit.edu	37	16	69458735	69458735	+	Missense_Mutation	SNP	A	A	G	rs535299107		TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr16:69458735A>G	ENST00000512062.1	+	1	308	c.137A>G	c.(136-138)tAc>tGc	p.Y46C	CYB5B_ENST00000307892.8_Missense_Mutation_p.Y50C|CYB5B_ENST00000515314.1_Missense_Mutation_p.Y46C|CYB5B_ENST00000561792.1_Missense_Mutation_p.Y46C			O43169	CYB5B_HUMAN	cytochrome b5 type B (outer mitochondrial membrane)	46	Cytochrome b5 heme-binding. {ECO:0000255|PROSITE-ProRule:PRU00279}.				oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)	heme binding (GO:0020037)|metal ion binding (GO:0046872)	p.Y50C(1)		endometrium(3)|kidney(3)|lung(2)	8		Ovarian(137;0.101)				GGGCGAGTCTACGATGTCACC	0.597																																							uc002exg.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(148-150)TAC>TGC		cytochrome b5 outer mitochondrial membrane							57.0	59.0	59.0					16																	69458735		2085	4210	6295	SO:0001583	missense	80777				electron transport chain|transport	integral to membrane|mitochondrial outer membrane	heme binding	g.chr16:69458735A>G		CCDS10880.2	16q22.1	2006-02-02			ENSG00000103018	ENSG00000103018			24374	protein-coding gene	gene with protein product		611964				11867265, 14733950	Standard	NM_030579		Approved	CYB5-M	uc002exg.1	O43169	OTTHUMG00000133020	ENST00000512062.1:c.137A>G	16.37:g.69458735A>G	ENSP00000423679:p.Tyr46Cys					CYB5B_uc002exf.2_Missense_Mutation_p.Y50C|CYB5B_uc010cfl.1_Missense_Mutation_p.Y50C	p.Y50C	NM_030579	NP_085056	O43169	CYB5B_HUMAN			1	238	+		Ovarian(137;0.101)	46			Cytochrome b5 heme-binding.		A8K6B1|Q96CC3|Q9BT35	Missense_Mutation	SNP	ENST00000512062.1	37	c.149A>G		.	.	.	.	.	.	.	.	.	.	A	24.8	4.573050	0.86542	.	.	ENSG00000103018	ENST00000512062;ENST00000307892;ENST00000515314	D;D;D	0.87571	-2.27;-2.27;-2.27	6.03	6.03	0.97812	Cytochrome b5 (5);	0.165972	0.56097	D	0.000032	D	0.96510	0.8861	H	0.99325	4.515	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.98072	1.0399	10	0.87932	D	0	7.0097	14.7953	0.69873	1.0:0.0:0.0:0.0	.	46;46;46	D6RFH4;O43169;Q5HYD9	.;CYB5B_HUMAN;.	C	46;50;46	ENSP00000423679:Y46C;ENSP00000308430:Y50C;ENSP00000421492:Y46C	ENSP00000308430:Y50C	Y	+	2	0	CYB5B	68016236	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.919000	0.63383	2.302000	0.77476	0.533000	0.62120	TAC		0.597	CYB5B-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000256606.2	NM_030579		12	15	0	0	0	0.020292	0	12	15				
CDH13	1012	broad.mit.edu	37	16	83520147	83520147	+	Missense_Mutation	SNP	C	C	T	rs562310269		TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr16:83520147C>T	ENST00000566620.1	+	7	1137	c.847C>T	c.(847-849)Cgg>Tgg	p.R283W	CDH13_ENST00000268613.10_Missense_Mutation_p.R330W|CDH13_ENST00000569454.1_3'UTR|CDH13_ENST00000428848.3_Missense_Mutation_p.R244W	NM_001220488.1|NM_001220489.1|NM_001220490.1|NM_001257.4	NP_001207417.1|NP_001207418.1|NP_001207419.1|NP_001248.1	P55290	CAD13_HUMAN	cadherin 13	283	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|endothelial cell migration (GO:0043542)|homophilic cell adhesion (GO:0007156)|keratinocyte proliferation (GO:0043616)|lamellipodium assembly (GO:0030032)|localization within membrane (GO:0051668)|low-density lipoprotein particle mediated signaling (GO:0055096)|mitotic cell cycle (GO:0000278)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell proliferation (GO:0008285)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Rac protein signal transduction (GO:0016601)|regulation of cell growth (GO:0001558)|regulation of endocytosis (GO:0030100)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|Rho protein signal transduction (GO:0007266)|sprouting angiogenesis (GO:0002040)	anchored component of membrane (GO:0031225)|caveola (GO:0005901)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	adiponectin binding (GO:0055100)|cadherin binding (GO:0045296)|calcium ion binding (GO:0005509)|lipoprotein particle binding (GO:0071813)|low-density lipoprotein particle binding (GO:0030169)	p.R283W(1)		large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		TGCCCTCCTGCGGTATAATAT	0.527																																							uc002fgx.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(847-849)CGG>TGG		cadherin 13 preproprotein							80.0	82.0	81.0					16																	83520147		2086	4213	6299	SO:0001583	missense	1012				adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding	g.chr16:83520147C>T	U59288	CCDS56009.1, CCDS56010.1, CCDS58485.1, CCDS58486.1, CCDS58487.1	16q23.3	2013-08-27	2013-08-27			ENSG00000140945		"""Cadherins / Major cadherins"""	1753	protein-coding gene	gene with protein product	"""T-cadherin"", ""H-cadherin (heart)"""	601364				8673923, 9468307	Standard	NM_001257		Approved	CDHH	uc010vns.2	P55290		ENST00000566620.1:c.847C>T	16.37:g.83520147C>T	ENSP00000454435:p.Arg283Trp					CDH13_uc010vns.1_Missense_Mutation_p.R330W|CDH13_uc010vnt.1_Missense_Mutation_p.R29W|CDH13_uc010vnu.1_Missense_Mutation_p.R244W	p.R283W	NM_001257	NP_001248	P55290	CAD13_HUMAN		COAD - Colon adenocarcinoma(5;0.0268)	7	967	+		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)	283			Cadherin 2.		A8W476|A8W477|B7Z590|C9JRI6|J3KN62|Q6GTW4|Q8TBX3	Missense_Mutation	SNP	ENST00000566620.1	37	c.847C>T	CCDS58486.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.502648	0.85176	.	.	ENSG00000140945	ENST00000268613;ENST00000428848;ENST00000536143	T	0.54866	0.55	5.64	2.5	0.30297	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.78717	0.4327	H	0.94385	3.53	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.995;0.999	T	0.83275	-0.0041	9	0.66056	D	0.02	.	14.1848	0.65598	0.3856:0.6144:0.0:0.0	.	244;330;283	B7Z590;B7Z9B1;P55290	.;.;CAD13_HUMAN	W	330;283;244	ENSP00000268613:R330W	ENSP00000268613:R330W	R	+	1	2	CDH13	82077648	1.000000	0.71417	0.974000	0.42286	0.981000	0.71138	1.749000	0.38319	0.266000	0.21894	0.655000	0.94253	CGG		0.527	CDH13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432917.1	NM_001257		13	51	0	0	0	0.003163	0	13	51				
Unknown	0	broad.mit.edu	37	16	88620260	88620260	+	IGR	SNP	T	T	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr16:88620260T>A								ZFPM1 (16836 upstream) : ZC3H18 (16528 downstream)														p.T124S(1)									TCCACTGCTGTTTTGTGGGAT	0.552																																							uc010vox.1		NA																	1	Substitution - Missense(1)		lung(1)		NA						c.(370-372)ACA>TCA		RecName: Full=Putative uncharacterized protein C16orf85;							76.0	73.0	74.0					16																	88620260		2198	4300	6498	SO:0001628	intergenic_variant	0							g.chr16:88620260T>A																													16.37:g.88620260T>A							p.T124S							2	370	-									Missense_Mutation	SNP		37	c.370A>T		.	.	.	.	.	.	.	.	.	.	T	4.090	0.014760	0.07959	.	.	ENSG00000205036	ENST00000378416	.	.	.	0.82	-1.64	0.08318	.	.	.	.	.	T	0.25531	0.0621	.	.	.	.	.	.	B	0.19331	0.035	B	0.13407	0.009	T	0.20605	-1.0270	6	0.87932	D	0	.	1.4947	0.02464	0.3259:0.0:0.3246:0.3495	.	124	Q6ZSH3	CP085_HUMAN	S	124	.	ENSP00000367672:T124S	T	-	1	0	C16orf85	87147761	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	-0.485000	0.06520	-1.087000	0.03081	0.172000	0.16884	ACA	0	0.552									9	34	0	0	0	0.008291	0	9	34				
TP53	7157	broad.mit.edu	37	17	7577535	7577535	+	Missense_Mutation	SNP	C	C	A	rs587782329		TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr17:7577535C>A	ENST00000269305.4	-	7	935	c.746G>T	c.(745-747)aGg>aTg	p.R249M	TP53_ENST00000413465.2_Missense_Mutation_p.R249M|TP53_ENST00000455263.2_Missense_Mutation_p.R249M|TP53_ENST00000420246.2_Missense_Mutation_p.R249M|TP53_ENST00000445888.2_Missense_Mutation_p.R249M|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.R249M	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	249	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> I (in a sporadic cancer; somatic mutation).|R -> K (in sporadic cancers; somatic mutation).|R -> M (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> S (in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; dbSNP:rs28934571). {ECO:0000269|PubMed:1694291, ECO:0000269|PubMed:16959974}.|R -> T (in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).|RP -> SA (in a sporadic cancer; somatic mutation).|RP -> SS (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R249M(38)|p.R249K(20)|p.R249T(16)|p.0?(8)|p.?(5)|p.R249fs*96(4)|p.M246_P250delMNRRP(2)|p.R248_P250delRRP(1)|p.R249_P250delRP(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*14(1)|p.R249_T256delRPILTIIT(1)|p.R249_I251delRPI(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GAGGATGGGCCTCCGGTTCAT	0.567		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		100	Substitution - Missense(74)|Whole gene deletion(8)|Deletion - In frame(8)|Deletion - Frameshift(5)|Unknown(5)	p.R249S(303)|p.R249M(25)|p.R249G(24)|p.R249W(23)|p.R249T(16)|p.R249K(14)|p.0?(7)|p.R249R(6)|p.R249fs*96(6)|p.M246_P250delMNRRP(2)|p.R249fs*14(2)|p.R248_P250delRRP(1)|p.R249_P250delRP(1)|p.R249_P250insR(1)|p.R249_P250>SS(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*19(1)|p.R249_T256delRPILTIIT(1)|p.R249fs*15(1)|p.R249_I251delRPI(1)	lung(22)|upper_aerodigestive_tract(12)|breast(8)|large_intestine(7)|liver(7)|stomach(6)|haematopoietic_and_lymphoid_tissue(5)|biliary_tract(5)|oesophagus(5)|skin(4)|bone(4)|central_nervous_system(3)|ovary(3)|adrenal_gland(2)|urinary_tract(2)|pancreas(2)|peritoneum(1)|soft_tissue(1)|prostate(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245						c.(745-747)AGG>ATG	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							154.0	113.0	127.0					17																	7577535		2203	4300	6503	SO:0001583	missense	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7577535C>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.746G>T	17.37:g.7577535C>A	ENSP00000269305:p.Arg249Met	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_uc002gig.1_Missense_Mutation_p.R249M|TP53_uc002gih.2_Missense_Mutation_p.R249M|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R117M|TP53_uc010cng.1_Missense_Mutation_p.R117M|TP53_uc002gii.1_Missense_Mutation_p.R117M|TP53_uc010cnh.1_Missense_Mutation_p.R249M|TP53_uc010cni.1_Missense_Mutation_p.R249M|TP53_uc002gij.2_Missense_Mutation_p.R249M|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.R156M|TP53_uc002gio.2_Missense_Mutation_p.R117M	p.R249M	NM_001126112	NP_001119584	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	7	940	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	249		R -> W (in sporadic cancers; somatic mutation).|RP -> SA (in a sporadic cancer; somatic mutation).|RP -> SS (in sporadic cancers; somatic mutation).|R -> T (in sporadic cancers; somatic mutation).|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> I (in a sporadic cancer; somatic mutation).|R -> M (in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> K (in sporadic cancers; somatic mutation).	|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	c.746G>T	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.284101	0.80803	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D;D	0.99869	-7.33;-7.33;-7.33;-7.33;-7.33;-7.33;-7.33	4.62	3.64	0.41730	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99871	0.9939	M	0.92367	3.3	0.52501	D	0.999959	P;D;P;P;D	0.89917	0.932;1.0;0.945;0.86;1.0	P;D;P;P;D	0.87578	0.622;0.998;0.795;0.453;0.991	D	0.96551	0.9408	10	0.87932	D	0	-3.0658	12.8645	0.57932	0.0:0.8349:0.1651:0.0	.	249;249;249;249;249	P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;P53_HUMAN;.;.	M	249;249;249;249;249;249;238;117	ENSP00000410739:R249M;ENSP00000352610:R249M;ENSP00000269305:R249M;ENSP00000398846:R249M;ENSP00000391127:R249M;ENSP00000391478:R249M;ENSP00000425104:R117M	ENSP00000269305:R249M	R	-	2	0	TP53	7518260	0.835000	0.29415	0.998000	0.56505	0.801000	0.45260	7.609000	0.82925	1.295000	0.44724	0.462000	0.41574	AGG		0.567	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		11	9	1	0	6.40141e-05	0.010729	7.00937e-05	11	9				
TP53	7157	broad.mit.edu	37	17	7578264	7578264	+	Missense_Mutation	SNP	G	G	C			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr17:7578264G>C	ENST00000269305.4	-	6	774	c.585C>G	c.(583-585)atC>atG	p.I195M	TP53_ENST00000413465.2_Missense_Mutation_p.I195M|TP53_ENST00000455263.2_Missense_Mutation_p.I195M|TP53_ENST00000420246.2_Missense_Mutation_p.I195M|TP53_ENST00000445888.2_Missense_Mutation_p.I195M|TP53_ENST00000574684.1_Intron|TP53_ENST00000359597.4_Missense_Mutation_p.I195M	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	195	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		I -> F (in sporadic cancers; somatic mutation).|I -> L (in a sporadic cancer; somatic mutation).|I -> N (in sporadic cancers; somatic mutation).|I -> S (in sporadic cancers; somatic mutation).|I -> T (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:9450901}.|I -> V (in a sporadic cancer; somatic mutation).|I -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.R196*(7)|p.?(5)|p.A189_V197delAPPQHLIRV(4)|p.I195M(3)|p.P191_E198>Q(3)|p.I195fs*14(2)|p.I195fs*50(1)|p.H193_I195>AP(1)|p.I63M(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.I102M(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.I195fs*12(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTTCCACTCGGATAAGATGCT	0.547		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		42	Whole gene deletion(8)|Substitution - Nonsense(7)|Deletion - In frame(6)|Complex - deletion inframe(6)|Unknown(5)|Substitution - Missense(5)|Insertion - Frameshift(2)|Deletion - Frameshift(2)|Complex - frameshift(1)	p.I195T(61)|p.I195F(16)|p.I195N(12)|p.0?(7)|p.R196*(7)|p.I195S(4)|p.A189_V197delAPPQHLIRV(4)|p.I195fs*14(3)|p.I195fs*52(3)|p.K164_P219del(1)|p.I195L(1)|p.I195fs*50(1)|p.H193_I195>AP(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.H193_I195delHLI(1)|p.I195fs*12(1)	skin(11)|biliary_tract(5)|lung(5)|breast(5)|bone(4)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(2)|pancreas(2)|stomach(1)|large_intestine(1)|urinary_tract(1)|eye(1)|ovary(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245						c.(583-585)ATC>ATG	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							100.0	90.0	93.0					17																	7578264		2203	4300	6503	SO:0001583	missense	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7578264G>C	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.585C>G	17.37:g.7578264G>C	ENSP00000269305:p.Ile195Met	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_uc002gig.1_Missense_Mutation_p.I195M|TP53_uc002gih.2_Missense_Mutation_p.I195M|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.I63M|TP53_uc010cng.1_Missense_Mutation_p.I63M|TP53_uc002gii.1_Missense_Mutation_p.I63M|TP53_uc010cnh.1_Missense_Mutation_p.I195M|TP53_uc010cni.1_Missense_Mutation_p.I195M|TP53_uc002gij.2_Missense_Mutation_p.I195M|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Missense_Mutation_p.I102M|TP53_uc002gio.2_Missense_Mutation_p.I63M|TP53_uc010vug.1_Missense_Mutation_p.I156M	p.I195M	NM_001126112	NP_001119584	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	6	779	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	195		I -> F (in sporadic cancers; somatic mutation).|I -> L (in a sporadic cancer; somatic mutation).|I -> S (in sporadic cancers; somatic mutation).|I -> T (in sporadic cancers; somatic mutation).|I -> V (in a sporadic cancer; somatic mutation).|I -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|I -> N (in sporadic cancers; somatic mutation).	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	c.585C>G	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	11.42	1.632086	0.29068	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99816	-6.91;-6.91;-6.91;-6.91;-6.91;-6.91;-6.91;-6.91	5.41	4.44	0.53790	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.103171	0.64402	D	0.000004	D	0.99667	0.9876	M	0.71920	2.185	0.42493	D	0.992909	D;P;D;P;P;P;D	0.89917	1.0;0.901;0.994;0.877;0.85;0.805;0.979	D;P;D;P;P;P;D	0.91635	0.999;0.896;0.969;0.835;0.825;0.902;0.931	D	0.98141	1.0436	10	0.56958	D	0.05	-18.4587	8.2219	0.31547	0.0843:0.1568:0.7589:0.0	.	156;195;195;102;195;195;195	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	M	195;195;195;195;195;195;184;102;63;102;63	ENSP00000410739:I195M;ENSP00000352610:I195M;ENSP00000269305:I195M;ENSP00000398846:I195M;ENSP00000391127:I195M;ENSP00000391478:I195M;ENSP00000425104:I63M;ENSP00000423862:I102M	ENSP00000269305:I195M	I	-	3	3	TP53	7518989	1.000000	0.71417	0.991000	0.47740	0.026000	0.11368	4.749000	0.62155	1.422000	0.47177	0.655000	0.94253	ATC		0.547	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		14	12	0	0	0	0.020292	0	14	12				
DNAH2	146754	broad.mit.edu	37	17	7708677	7708677	+	Silent	SNP	C	C	T	rs200872109		TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr17:7708677C>T	ENST00000572933.1	+	61	10868	c.9408C>T	c.(9406-9408)aaC>aaT	p.N3136N	DNAH2_ENST00000389173.2_Silent_p.N3136N			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	3136	Stalk. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.N3136N(1)		NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TTCGAGGCAACGAGCCCACAT	0.498													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19185	0.0		0.0	False		,,,				2504	0.0						uc002giu.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(6)|skin(6)|central_nervous_system(1)	13						c.(9406-9408)AAC>AAT		dynein heavy chain domain 3							95.0	90.0	92.0					17																	7708677		2203	4300	6503	SO:0001819	synonymous_variant	146754				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr17:7708677C>T	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.9408C>T	17.37:g.7708677C>T						DNAH2_uc010cnm.1_Silent_p.N74N	p.N3136N	NM_020877	NP_065928	Q9P225	DYH2_HUMAN			60	9422	+		all_cancers(10;4.66e-07)|Prostate(122;0.081)	3136			Stalk (By similarity).		A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Silent	SNP	ENST00000572933.1	37	c.9408C>T	CCDS32551.1																																																																																				0.498	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877		10	34	0	0	0	0.008291	0	10	34				
RAB11FIP4	84440	broad.mit.edu	37	17	29855757	29855757	+	Silent	SNP	C	C	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr17:29855757C>A	ENST00000325874.8	+	13	1843	c.1614C>A	c.(1612-1614)cgC>cgA	p.R538R	RAB11FIP4_ENST00000394744.2_Silent_p.R436R	NM_032932.3	NP_116321.2	Q86YS3	RFIP4_HUMAN	RAB11 family interacting protein 4 (class II)	538	Necessary for interaction with RAB11A, subcellular location, homo- or heterooligomerization.				cytokinesis (GO:0000910)|transport (GO:0006810)|viral process (GO:0016032)	cleavage furrow (GO:0032154)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|midbody (GO:0030496)|recycling endosome membrane (GO:0055038)	ADP-ribosylation factor binding (GO:0030306)|calcium ion binding (GO:0005509)|protein homodimerization activity (GO:0042803)|Rab GTPase binding (GO:0017137)	p.R538R(1)		endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_cancers(10;3.62e-13)|all_epithelial(10;0.000387)|all_lung(9;0.0132)|Breast(31;0.014)|all_hematologic(16;0.015)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0259)|Ovarian(249;0.0423)|Lung NSC(157;0.066)				CCAGGGCCCGCGAGGTGGAGC	0.667																																							uc002hgn.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(1612-1614)CGC>CGA		RAB11 family interacting protein 4 (class II)							29.0	28.0	28.0					17																	29855757		2203	4300	6503	SO:0001819	synonymous_variant	84440				cytokinesis|interspecies interaction between organisms|protein transport	cleavage furrow|endocytic vesicle|midbody|recycling endosome membrane	ADP-ribosylation factor binding|calcium ion binding|protein homodimerization activity|Rab GTPase binding	g.chr17:29855757C>A	AB058724	CCDS11267.1	17q11.2	2013-01-10			ENSG00000131242	ENSG00000131242		"""EF-hand domain containing"""	30267	protein-coding gene	gene with protein product		611999				11347906, 11468690	Standard	NM_032932		Approved	RAB11-FIP4, KIAA1821, MGC11316, FLJ00131	uc002hgn.1	Q86YS3	OTTHUMG00000132787	ENST00000325874.8:c.1614C>A	17.37:g.29855757C>A						RAB11FIP4_uc002hgo.2_Silent_p.R436R	p.R538R	NM_032932	NP_116321	Q86YS3	RFIP4_HUMAN			13	1843	+		all_cancers(10;3.62e-13)|all_epithelial(10;0.000387)|all_lung(9;0.0132)|Breast(31;0.014)|all_hematologic(16;0.015)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0259)|Ovarian(249;0.0423)|Lung NSC(157;0.066)	538			Potential.|Necessary for interaction with RAB11A, subcellular location, homo- or heterooligomerization.		Q52LI1|Q8N829|Q8NDT7|Q969D8	Silent	SNP	ENST00000325874.8	37	c.1614C>A	CCDS11267.1																																																																																				0.667	RAB11FIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256195.2	NM_032932		8	7	1	0	0.000157383	0.00308	0.000171373	8	7				
STAT5A	6776	broad.mit.edu	37	17	40453374	40453374	+	Silent	SNP	C	C	T	rs377400234		TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr17:40453374C>T	ENST00000345506.4	+	10	1713	c.1071C>T	c.(1069-1071)ggC>ggT	p.G357G	STAT5A_ENST00000590949.1_Silent_p.G357G|STAT5A_ENST00000452307.2_Silent_p.G357G|STAT5A_ENST00000546010.2_Silent_p.G327G|STAT5A_ENST00000588868.1_Silent_p.G357G	NM_003152.3	NP_003143.2	P42229	STA5A_HUMAN	signal transducer and activator of transcription 5A	357					2-oxoglutarate metabolic process (GO:0006103)|allantoin metabolic process (GO:0000255)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|development of secondary female sexual characteristics (GO:0046543)|development of secondary male sexual characteristics (GO:0046544)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|fatty acid metabolic process (GO:0006631)|female pregnancy (GO:0007565)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|lipid storage (GO:0019915)|luteinization (GO:0001553)|mammary gland epithelium development (GO:0061180)|natural killer cell differentiation (GO:0001779)|negative regulation of erythrocyte differentiation (GO:0045647)|negative regulation of mast cell apoptotic process (GO:0033026)|oxaloacetate metabolic process (GO:0006107)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch development (GO:0048541)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of mast cell differentiation (GO:0060376)|positive regulation of mast cell proliferation (GO:0070668)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prolactin signaling pathway (GO:0038161)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of cell adhesion (GO:0030155)|regulation of epithelial cell differentiation (GO:0030856)|regulation of multicellular organism growth (GO:0040014)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|succinate metabolic process (GO:0006105)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|taurine metabolic process (GO:0019530)|transcription, DNA-templated (GO:0006351)|valine metabolic process (GO:0006573)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	calcium ion binding (GO:0005509)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.G357G(1)		central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	14		all_cancers(22;1.56e-06)|all_epithelial(22;3.17e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.128)		TGCTGGTGGGCGGGAAGCTGA	0.562																																							uc002hzj.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(1)	1						c.(1069-1071)GGC>GGT		signal transducer and activator of transcription		C		0,4406		0,0,2203	148.0	127.0	134.0		1071	-4.7	1.0	17		134	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	STAT5A	NM_003152.3		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		357/795	40453374	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	6776				2-oxoglutarate metabolic process|allantoin metabolic process|citrate metabolic process|creatine metabolic process|creatinine metabolic process|fatty acid metabolic process|isoleucine metabolic process|oxaloacetate metabolic process|succinate metabolic process|taurine metabolic process|valine metabolic process	cytosol|nucleoplasm	calcium ion binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr17:40453374C>T	U43185	CCDS11424.1, CCDS74066.1, CCDS74067.1	17q11.2	2013-02-14			ENSG00000126561	ENSG00000126561		"""SH2 domain containing"""	11366	protein-coding gene	gene with protein product		601511		STAT5		7719937, 8631883	Standard	NM_003152		Approved	MGF	uc002hzj.2	P42229	OTTHUMG00000150725	ENST00000345506.4:c.1071C>T	17.37:g.40453374C>T						STAT5A_uc010cya.1_Silent_p.G357G|STAT5A_uc010cyb.1_Silent_p.G357G|STAT5A_uc010cyc.1_Silent_p.G327G	p.G357G	NM_003152	NP_003143	P42229	STA5A_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.128)	10	1713	+		all_cancers(22;1.56e-06)|all_epithelial(22;3.17e-05)|Breast(137;0.000143)	357					Q1KLZ6	Silent	SNP	ENST00000345506.4	37	c.1071C>T	CCDS11424.1																																																																																				0.562	STAT5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319804.1	NM_003152		33	23	0	0	0	0.009535	0	33	23				
TEX14	56155	broad.mit.edu	37	17	56679786	56679786	+	Missense_Mutation	SNP	C	C	T	rs368880555		TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr17:56679786C>T	ENST00000240361.8	-	12	1605	c.1520G>A	c.(1519-1521)cGg>cAg	p.R507Q	TEX14_ENST00000349033.5_Missense_Mutation_p.R501Q|TEX14_ENST00000389934.3_Missense_Mutation_p.R501Q			Q8IWB6	TEX14_HUMAN	testis expressed 14	507	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				attachment of spindle microtubules to kinetochore (GO:0008608)|intercellular bridge organization (GO:0043063)|male meiosis (GO:0007140)|mitotic sister chromatid separation (GO:0051306)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of cytokinesis (GO:0032466)|negative regulation of protein binding (GO:0032091)	cell (GO:0005623)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|midbody (GO:0030496)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)	p.R507Q(1)|p.R501Q(1)		breast(6)|endometrium(5)|kidney(3)|large_intestine(22)|liver(1)|lung(24)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	81	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CAGAATATACCGGATATCTTG	0.408													C|||	1	0.000199681	0.0	0.0	5008	,	,		19833	0.0		0.0	False		,,,				2504	0.001						uc010dcz.1		NA																	2	Substitution - Missense(2)		lung(2)	stomach(4)|lung(3)|breast(3)|ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)|pancreas(1)	17						c.(1519-1521)CGG>CAG		testis expressed sequence 14 isoform a		C	GLN/ARG,GLN/ARG,GLN/ARG	0,4406		0,0,2203	118.0	103.0	108.0		1520,1502,1502	-6.0	0.4	17		108	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	TEX14	NM_001201457.1,NM_031272.4,NM_198393.3	43,43,43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign	507/1498,501/1452,501/1492	56679786	1,13005	2203	4300	6503	SO:0001583	missense	56155					cytoplasm	ATP binding|protein kinase activity	g.chr17:56679786C>T	AF285601	CCDS32692.1, CCDS32693.1, CCDS56042.1	17q22	2013-09-20	2007-03-13		ENSG00000121101	ENSG00000121101			11737	protein-coding gene	gene with protein product	"""cancer/testis antigen 113"""	605792	"""testis expressed sequence 14"""			11279525, 12711554	Standard	NM_031272		Approved	CT113	uc010dcz.2	Q8IWB6	OTTHUMG00000179245	ENST00000240361.8:c.1520G>A	17.37:g.56679786C>T	ENSP00000240361:p.Arg507Gln					TEX14_uc002iwr.1_Missense_Mutation_p.R501Q|TEX14_uc002iws.1_Missense_Mutation_p.R501Q|TEX14_uc010dda.1_Missense_Mutation_p.R281Q	p.R507Q	NM_198393	NP_938207	Q8IWB6	TEX14_HUMAN			12	1638	-	Medulloblastoma(34;0.127)|all_neural(34;0.237)		507			Protein kinase.		A6NH19|Q7RTP3|Q8ND97|Q9BXT9	Missense_Mutation	SNP	ENST00000240361.8	37	c.1520G>A	CCDS56042.1	.	.	.	.	.	.	.	.	.	.	C	7.186	0.590653	0.13812	0.0	1.16E-4	ENSG00000121101	ENST00000240361;ENST00000389934;ENST00000349033	T;T;T	0.42900	0.96;0.96;0.96	6.04	-6.0	0.02206	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.619757	0.15908	N	0.238734	T	0.21427	0.0516	L	0.27053	0.805	0.19300	N	0.999975	B;B;B	0.19583	0.025;0.037;0.02	B;B;B	0.17722	0.019;0.011;0.011	T	0.20240	-1.0281	10	0.17369	T	0.5	-1.1395	9.1987	0.37244	0.101:0.3169:0.0:0.5821	.	507;501;501	Q8IWB6;Q8IWB6-3;Q8IWB6-2	TEX14_HUMAN;.;.	Q	507;501;501	ENSP00000240361:R507Q;ENSP00000374584:R501Q;ENSP00000268910:R501Q	ENSP00000240361:R507Q	R	-	2	0	TEX14	54034785	0.000000	0.05858	0.376000	0.26042	0.982000	0.71751	-0.558000	0.05978	-1.491000	0.01840	-0.244000	0.11960	CGG		0.408	TEX14-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445446.1			9	64	0	0	0	0.006214	0	9	64				
ABCA9	10350	broad.mit.edu	37	17	67003946	67003946	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr17:67003946C>T	ENST00000340001.4	-	25	3600	c.3389G>A	c.(3388-3390)cGc>cAc	p.R1130H	ABCA9_ENST00000453985.2_Intron|ABCA9_ENST00000370732.2_Missense_Mutation_p.R1130H|ABCA9-AS1_ENST00000458677.1_RNA	NM_080283.3	NP_525022.2	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 9	1130					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.R1130H(1)		NS(2)|breast(4)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(21)|lung(35)|ovary(4)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	91	Breast(10;1.47e-12)					TCTCCCATTGCGAAAAATGAA	0.313																																							uc002jhu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6						c.(3388-3390)CGC>CAC		ATP-binding cassette, sub-family A, member 9							90.0	91.0	91.0					17																	67003946		2203	4297	6500	SO:0001583	missense	10350				transport	integral to membrane	ATP binding|ATPase activity	g.chr17:67003946C>T	AF423307	CCDS11681.1	17q24	2012-03-14			ENSG00000154258	ENSG00000154258		"""ATP binding cassette transporters / subfamily A"""	39	protein-coding gene	gene with protein product		612507					Standard	XM_005256934		Approved	EST640918	uc002jhu.3	Q8IUA7	OTTHUMG00000140371	ENST00000340001.4:c.3389G>A	17.37:g.67003946C>T	ENSP00000342216:p.Arg1130His					ABCA9_uc010dez.2_Intron	p.R1130H	NM_080283	NP_525022	Q8IUA7	ABCA9_HUMAN			25	3532	-	Breast(10;1.47e-12)		1130					Q6P655|Q8N2S4|Q8WWZ5|Q96MD8	Missense_Mutation	SNP	ENST00000340001.4	37	c.3389G>A	CCDS11681.1	.	.	.	.	.	.	.	.	.	.	C	9.696	1.153264	0.21371	.	.	ENSG00000154258	ENST00000340001;ENST00000370732	D;D	0.85773	-2.03;-2.03	4.74	0.456	0.16655	.	0.270493	0.26227	N	0.025583	T	0.81098	0.4752	M	0.71036	2.16	0.09310	N	1	B	0.28820	0.224	B	0.33690	0.168	T	0.72187	-0.4366	10	0.56958	D	0.05	.	4.2432	0.10658	0.1553:0.4787:0.0:0.366	.	1130	Q8IUA7	ABCA9_HUMAN	H	1130	ENSP00000342216:R1130H;ENSP00000359767:R1130H	ENSP00000342216:R1130H	R	-	2	0	ABCA9	64515541	0.000000	0.05858	0.030000	0.17652	0.540000	0.34992	0.009000	0.13219	0.185000	0.20105	-0.324000	0.08512	CGC		0.313	ABCA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277072.2	NM_172386		12	36	0	0	0	0.016723	0	12	36				
KIAA0195	9772	broad.mit.edu	37	17	73484840	73484840	+	Splice_Site	SNP	G	G	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr17:73484840G>A	ENST00000314256.7	+	7	1007	c.613G>A	c.(613-615)Gat>Aat	p.D205N	KIAA0195_ENST00000583795.1_3'UTR|KIAA0195_ENST00000375248.5_Splice_Site_p.D215N|KIAA0195_ENST00000579208.1_Intron	NM_014738.4	NP_055553.3	Q12767	K0195_HUMAN	KIAA0195	205						integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.D205N(1)		breast(2)|endometrium(5)|kidney(2)|large_intestine(7)|lung(17)|ovary(5)|skin(2)|stomach(1)|urinary_tract(1)	42	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			CTGCCGGCAGGATGACGAGCA	0.612																																							uc002jnz.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(613-615)GAT>AAT		hypothetical protein LOC9772							78.0	83.0	81.0					17																	73484840		2203	4300	6503	SO:0001630	splice_region_variant	9772				ATP biosynthetic process|cation transport	integral to membrane	ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism	g.chr17:73484840G>A		CCDS32732.1	17q25.1	2012-03-01			ENSG00000177728	ENSG00000177728			28983	protein-coding gene	gene with protein product						8724849	Standard	NM_014738		Approved	TMEM94	uc002jnz.4	Q12767		ENST00000314256.7:c.613-1G>A	17.37:g.73484840G>A						KIAA0195_uc010wsa.1_Missense_Mutation_p.D215N|KIAA0195_uc010wsb.1_5'Flank	p.D205N	NM_014738	NP_055553	Q12767	K0195_HUMAN	all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)		7	888	+	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		205					O75536|Q86XF1	Missense_Mutation	SNP	ENST00000314256.7	37	c.613G>A	CCDS32732.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.432635	0.83776	.	.	ENSG00000177728	ENST00000314256;ENST00000375248	T;T	0.47177	0.86;0.85	5.5	5.5	0.81552	.	0.050780	0.85682	D	0.000000	T	0.50326	0.1609	L	0.58101	1.795	0.80722	D	1	P;P	0.47302	0.893;0.808	B;B	0.43301	0.415;0.309	T	0.49437	-0.8940	9	.	.	.	-12.262	18.9936	0.92803	0.0:0.0:1.0:0.0	.	215;205	C9JL75;Q12767	.;K0195_HUMAN	N	205;215	ENSP00000313885:D205N;ENSP00000364397:D215N	.	D	+	1	0	KIAA0195	70996435	1.000000	0.71417	1.000000	0.80357	0.516000	0.34256	9.345000	0.97053	2.590000	0.87494	0.549000	0.68633	GAT		0.612	KIAA0195-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447303.1	NM_014738	Missense_Mutation	19	75	0	0	0	0.012319	0	19	75				
SETBP1	26040	broad.mit.edu	37	18	42643114	42643114	+	Missense_Mutation	SNP	G	G	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr18:42643114G>T	ENST00000282030.5	+	6	4538	c.4242G>T	c.(4240-4242)atG>atT	p.M1414I		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	1414						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.M1360I(1)|p.M1414I(1)		NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		TGCGGAAGATGTGCAACTACA	0.532									Schinzel-Giedion syndrome																														uc010dni.2		NA																	2	Substitution - Missense(2)		lung(2)	upper_aerodigestive_tract(2)|large_intestine(1)	3						c.(4240-4242)ATG>ATT		SET binding protein 1 isoform a							60.0	56.0	58.0					18																	42643114		2203	4300	6503	SO:0001583	missense	26040	Schinzel-Giedion_syndrome	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome		nucleus	DNA binding	g.chr18:42643114G>T	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.4242G>T	18.37:g.42643114G>T	ENSP00000282030:p.Met1414Ile						p.M1414I	NM_015559	NP_056374	Q9Y6X0	SETBP_HUMAN		Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)	6	4538	+			1414					A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	ENST00000282030.5	37	c.4242G>T	CCDS11923.2	.	.	.	.	.	.	.	.	.	.	G	26.1	4.702531	0.88924	.	.	ENSG00000152217	ENST00000282030	T	0.72051	-0.62	5.27	5.27	0.74061	.	0.050882	0.85682	D	0.000000	T	0.72277	0.3440	L	0.29908	0.895	0.42107	D	0.991368	D	0.56968	0.978	P	0.53861	0.736	T	0.74904	-0.3505	10	0.54805	T	0.06	.	18.8667	0.92294	0.0:0.0:1.0:0.0	.	1414	Q9Y6X0	SETBP_HUMAN	I	1414	ENSP00000282030:M1414I	ENSP00000282030:M1414I	M	+	3	0	SETBP1	40897112	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.044000	0.93805	2.615000	0.88500	0.563000	0.77884	ATG		0.532	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255854.4	NM_001130110		17	20	1	0	4.7546e-09	0.004007	5.82439e-09	17	20				
EPG5	57724	broad.mit.edu	37	18	43462448	43462448	+	Missense_Mutation	SNP	T	T	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr18:43462448T>A	ENST00000282041.5	-	31	5343	c.5309A>T	c.(5308-5310)gAt>gTt	p.D1770V	EPG5_ENST00000585906.1_5'UTR	NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	1770					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)			p.D1770V(1)		NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						TTGTTTAAGATCGAACTAAAA	0.393																																							uc002lbm.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(5308-5310)GAT>GTT		hypothetical protein LOC57724							44.0	43.0	43.0					18																	43462448		1833	4080	5913	SO:0001583	missense	57724				autophagy			g.chr18:43462448T>A	AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.5309A>T	18.37:g.43462448T>A	ENSP00000282041:p.Asp1770Val					KIAA1632_uc010xcq.1_Missense_Mutation_p.D324V|KIAA1632_uc010xcr.1_RNA|KIAA1632_uc010xcs.1_Intron|KIAA1632_uc002lbn.2_Missense_Mutation_p.D645V	p.D1770V	NM_020964	NP_066015	Q9HCE0	EPG5_HUMAN			31	5409	-			1770					A2BDF3|Q9H8C8	Missense_Mutation	SNP	ENST00000282041.5	37	c.5309A>T	CCDS11926.2	.	.	.	.	.	.	.	.	.	.	T	17.07	3.295320	0.60086	.	.	ENSG00000152223	ENST00000282041;ENST00000308403	T	0.21932	1.98	5.45	5.45	0.79879	.	.	.	.	.	T	0.27832	0.0685	M	0.66939	2.045	0.80722	D	1	B	0.18013	0.025	B	0.20184	0.028	T	0.05115	-1.0905	9	0.87932	D	0	-14.4063	15.5079	0.75757	0.0:0.0:0.0:1.0	.	1770	Q9HCE0	EPG5_HUMAN	V	1770;645	ENSP00000282041:D1770V	ENSP00000282041:D1770V	D	-	2	0	EPG5	41716446	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.841000	0.86834	2.059000	0.61396	0.533000	0.62120	GAT		0.393	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445081.1	NM_020964		6	22	0	0	0	0.00308	0	6	22				
SERPINB5	5268	broad.mit.edu	37	18	61160254	61160254	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr18:61160254G>A	ENST00000382771.4	+	5	785	c.493G>A	c.(493-495)Gcc>Acc	p.A165T	SERPINB5_ENST00000489441.1_Missense_Mutation_p.A165T|SERPINB5_ENST00000464346.1_3'UTR	NM_002639.4	NP_002630.2	P36952	SPB5_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 5	165					cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelium (GO:0002009)|negative regulation of endopeptidase activity (GO:0010951)|prostate gland morphogenesis (GO:0060512)|regulation of epithelial cell proliferation (GO:0050678)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.A165T(1)		kidney(3)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)	12						GGTTAATGCTGCCTACTTTGT	0.408																																							uc002liz.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(493-495)GCC>ACC		serine (or cysteine) proteinase inhibitor, clade							153.0	146.0	148.0					18																	61160254		2203	4300	6503	SO:0001583	missense	5268				cellular component movement|regulation of proteolysis	cytoplasm|extracellular space	protein binding|serine-type endopeptidase inhibitor activity	g.chr18:61160254G>A	U04313	CCDS32839.1	18q21.33	2014-02-18	2005-08-18		ENSG00000206075	ENSG00000206075		"""Serine (or cysteine) peptidase inhibitors"""	8949	protein-coding gene	gene with protein product	"""protease inhibitor 5 (maspin)"""	154790	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 5"""	PI5		8290962, 7724531, 16720730, 24172014	Standard	NM_002639		Approved	maspin	uc002liz.4	P36952	OTTHUMG00000141307	ENST00000382771.4:c.493G>A	18.37:g.61160254G>A	ENSP00000372221:p.Ala165Thr					SERPINB5_uc002liy.2_Missense_Mutation_p.A165T	p.A165T	NM_002639	NP_002630	P36952	SPB5_HUMAN			5	635	+			165					B2R6Y4|Q6N0B4|Q8WW89	Missense_Mutation	SNP	ENST00000382771.4	37	c.493G>A	CCDS32839.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.602812	0.87157	.	.	ENSG00000206075	ENST00000382771	D	0.84370	-1.84	6.05	6.05	0.98169	Serpin domain (3);	0.000000	0.85682	D	0.000000	D	0.91260	0.7245	L	0.54323	1.7	0.54753	D	0.999983	D;P	0.89917	1.0;0.71	D;B	0.80764	0.994;0.201	D	0.90808	0.4699	10	0.66056	D	0.02	.	20.2037	0.98272	0.0:0.0:1.0:0.0	.	165;165	P36952;P36952-2	SPB5_HUMAN;.	T	165	ENSP00000372221:A165T	ENSP00000372221:A165T	A	+	1	0	SERPINB5	59311234	1.000000	0.71417	1.000000	0.80357	0.764000	0.43329	4.367000	0.59498	2.880000	0.98712	0.655000	0.94253	GCC		0.408	SERPINB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280629.1	NM_002639		32	53	0	0	0	0.012213	0	32	53				
KCNG2	26251	broad.mit.edu	37	18	77659344	77659344	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr18:77659344C>T	ENST00000316249.3	+	2	929	c.929C>T	c.(928-930)tCg>tTg	p.S310L	KCNG2_ENST00000590307.1_3'UTR	NM_012283.1	NP_036415.1	Q9UJ96	KCNG2_HUMAN	potassium voltage-gated channel, subfamily G, member 2	310					energy reserve metabolic process (GO:0006112)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of heart contraction (GO:0008016)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)	p.S310L(1)		breast(2)|endometrium(4)|lung(7)|skin(1)|upper_aerodigestive_tract(4)	18		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;6.92e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0244)		GGGCTGCGTTCGCTGGGCCTG	0.726																																							uc010xfl.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(928-930)TCG>TTG		potassium voltage-gated channel, subfamily G,							6.0	8.0	7.0					18																	77659344		2059	3982	6041	SO:0001583	missense	26251				energy reserve metabolic process|regulation of heart contraction|regulation of insulin secretion	voltage-gated potassium channel complex	delayed rectifier potassium channel activity	g.chr18:77659344C>T	AJ011021	CCDS12019.1	18q23	2011-07-05			ENSG00000178342	ENSG00000178342		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6249	protein-coding gene	gene with protein product		605696				10551266, 16382104	Standard	NM_012283		Approved	Kv6.2, KCNF2	uc010xfl.2	Q9UJ96	OTTHUMG00000044541	ENST00000316249.3:c.929C>T	18.37:g.77659344C>T	ENSP00000315654:p.Ser310Leu						p.S310L	NM_012283	NP_036415	Q9UJ96	KCNG2_HUMAN		OV - Ovarian serous cystadenocarcinoma(15;6.92e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0244)	2	929	+		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)	310			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000316249.3	37	c.929C>T	CCDS12019.1	.	.	.	.	.	.	.	.	.	.	C	15.75	2.924528	0.52653	.	.	ENSG00000178342	ENST00000316249	T	0.42513	0.97	3.35	2.47	0.30058	Ion transport (1);	0.353105	0.23380	N	0.048815	T	0.22781	0.0550	N	0.05510	-0.035	0.29919	N	0.822901	P	0.42039	0.769	B	0.40199	0.322	T	0.10613	-1.0622	10	0.48119	T	0.1	.	10.0578	0.42255	0.0:0.8989:0.0:0.1011	.	310	Q9UJ96	KCNG2_HUMAN	L	310	ENSP00000315654:S310L	ENSP00000315654:S310L	S	+	2	0	KCNG2	75760332	1.000000	0.71417	0.992000	0.48379	0.937000	0.57800	4.947000	0.63583	0.610000	0.30035	0.411000	0.27672	TCG		0.726	KCNG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103906.1	NM_012283		2	2	0	0	0	0.004672	0	2	2				
AP3D1	8943	broad.mit.edu	37	19	2138643	2138643	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr19:2138643G>A	ENST00000345016.5	-	2	398	c.167C>T	c.(166-168)gCg>gTg	p.A56V	AP3D1_ENST00000356926.4_Missense_Mutation_p.A56V|AP3D1_ENST00000350812.6_Missense_Mutation_p.A56V|AP3D1_ENST00000355272.6_Missense_Mutation_p.A56V	NM_003938.6	NP_003929.4	O14617	AP3D1_HUMAN	adaptor-related protein complex 3, delta 1 subunit	56					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|endosome to melanosome transport (GO:0035646)|eye pigment biosynthetic process (GO:0006726)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein localization to membrane (GO:0072657)|protein localization to organelle (GO:0033365)|regulation of sequestering of zinc ion (GO:0061088)|synaptic vesicle membrane organization (GO:0048499)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane coat (GO:0030117)|terminal bouton (GO:0043195)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)	p.A56V(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(23)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GACCGCGTTCGCCTTCACCGC	0.517																																							uc002luz.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(166-168)GCG>GTG		adaptor-related protein complex 3, delta 1							140.0	144.0	142.0					19																	2138643		2176	4264	6440	SO:0001583	missense	8943				eye pigment biosynthetic process|intracellular protein transport|regulation of sequestering of zinc ion|vesicle-mediated transport	endosome membrane|Golgi membrane|membrane coat	binding|protein transporter activity	g.chr19:2138643G>A	U91930	CCDS42459.1, CCDS58638.1	19p13.3	2014-09-04			ENSG00000065000	ENSG00000065000			568	protein-coding gene	gene with protein product		607246				9151686, 9303295	Standard	NM_003938		Approved	ADTD	uc002lva.4	O14617	OTTHUMG00000180354	ENST00000345016.5:c.167C>T	19.37:g.2138643G>A	ENSP00000344055:p.Ala56Val					AP3D1_uc002luy.2_Missense_Mutation_p.A56V|AP3D1_uc002lva.2_Missense_Mutation_p.A56V	p.A56V	NM_003938	NP_003929	O14617	AP3D1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	2	390	-		Hepatocellular(1079;0.137)	56			HEAT 1.		O00202|O75262|Q59HF5|Q96G11|Q9H3C6	Missense_Mutation	SNP	ENST00000345016.5	37	c.167C>T	CCDS42459.1	.	.	.	.	.	.	.	.	.	.	G	17.66	3.443679	0.63067	.	.	ENSG00000065000	ENST00000356926;ENST00000345016;ENST00000355272;ENST00000343722;ENST00000350812	T;T;T;T	0.12879	2.64;2.64;2.64;2.64	5.3	4.25	0.50352	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.42131	0.1189	M	0.84683	2.71	0.28993	N	0.887916	D;D;D	0.89917	1.0;0.998;0.999	D;D;P	0.85130	0.997;0.937;0.895	T	0.48980	-0.8986	10	0.87932	D	0	-23.63	15.2165	0.73270	0.0:0.1415:0.8585:0.0	.	56;56;56	O14617-5;O14617;G5E988	.;AP3D1_HUMAN;.	V	56	ENSP00000349398:A56V;ENSP00000344055:A56V;ENSP00000347416:A56V;ENSP00000342321:A56V	ENSP00000341579:A56V	A	-	2	0	AP3D1	2089643	1.000000	0.71417	0.924000	0.36721	0.741000	0.42261	7.334000	0.79224	1.329000	0.45376	0.563000	0.77884	GCG		0.517	AP3D1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450912.1			23	47	0	0	0	0.016522	0	23	47				
PTPRS	5802	broad.mit.edu	37	19	5245847	5245847	+	Missense_Mutation	SNP	T	T	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr19:5245847T>A	ENST00000587303.1	-	9	1027	c.928A>T	c.(928-930)Acc>Tcc	p.T310S	PTPRS_ENST00000348075.2_Missense_Mutation_p.T297S|PTPRS_ENST00000353284.2_Missense_Mutation_p.T297S|PTPRS_ENST00000262963.6_Missense_Mutation_p.T306S|PTPRS_ENST00000357368.4_Missense_Mutation_p.T310S|PTPRS_ENST00000588552.1_5'UTR|PTPRS_ENST00000372412.4_Missense_Mutation_p.T311S|PTPRS_ENST00000588012.1_Missense_Mutation_p.T297S|PTPRS_ENST00000592099.1_Missense_Mutation_p.T297S			Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type, S	310	Ig-like C2-type 3.				cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|corpus callosum development (GO:0022038)|extracellular matrix organization (GO:0030198)|hippocampus development (GO:0021766)|peptidyl-tyrosine dephosphorylation (GO:0035335)|spinal cord development (GO:0021510)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.T310S(1)		NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(9)|ovary(4)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)	61				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)	Alendronate(DB00630)|Etidronic acid(DB01077)	GCCACGCAGGTGTAGTTGGCC	0.632																																							uc002mbv.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)|ovary(1)|central_nervous_system(1)	4						c.(928-930)ACC>TCC		protein tyrosine phosphatase, receptor type,							82.0	67.0	72.0					19																	5245847		2203	4300	6503	SO:0001583	missense	5802				cell adhesion	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr19:5245847T>A	U35234	CCDS12139.1, CCDS12140.1, CCDS45930.1, CCDS74265.1	19p13.3	2013-02-11				ENSG00000105426		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9681	protein-coding gene	gene with protein product		601576				8954782, 8524829	Standard	NM_002850		Approved		uc002mbv.3	Q13332		ENST00000587303.1:c.928A>T	19.37:g.5245847T>A	ENSP00000467537:p.Thr310Ser					PTPRS_uc002mbu.1_Missense_Mutation_p.T297S|PTPRS_uc010xin.1_Missense_Mutation_p.T297S|PTPRS_uc002mbw.2_Missense_Mutation_p.T297S|PTPRS_uc002mbx.2_Missense_Mutation_p.T301S|PTPRS_uc002mby.2_Missense_Mutation_p.T297S	p.T310S	NM_002850	NP_002841	Q13332	PTPRS_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)	10	1162	-			310			Ig-like C2-type 3.|Extracellular (Potential).		O75255|O75870|Q15718|Q16341|Q2M3R7	Missense_Mutation	SNP	ENST00000587303.1	37	c.928A>T	CCDS45930.1	.	.	.	.	.	.	.	.	.	.	T	27.1	4.804542	0.90623	.	.	ENSG00000105426	ENST00000536396;ENST00000372412;ENST00000357368;ENST00000355005;ENST00000356037;ENST00000262963;ENST00000348075;ENST00000355322;ENST00000544524;ENST00000353284	T;T;T;T;T	0.43294	0.95;0.95;0.95;0.95;0.95	4.22	4.22	0.49857	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	U	0.000002	T	0.60495	0.2273	M	0.67700	2.07	0.58432	D	0.999997	P;B;B;D;D;P	0.76494	0.61;0.002;0.013;0.997;0.999;0.534	B;B;B;P;D;B	0.73708	0.169;0.003;0.011;0.904;0.981;0.156	T	0.63184	-0.6694	10	0.51188	T	0.08	.	13.4738	0.61297	0.0:0.0:0.0:1.0	.	310;297;301;297;310;323	F8W800;Q13332-7;F5H2T4;Q13332-6;Q13332;Q59FX6	.;.;.;.;PTPRS_HUMAN;.	S	323;311;310;310;310;306;297;310;301;297	ENSP00000361489:T311S;ENSP00000349932:T310S;ENSP00000262963:T306S;ENSP00000269907:T297S;ENSP00000327313:T297S	ENSP00000262963:T306S	T	-	1	0	PTPRS	5196847	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.759000	0.85235	1.778000	0.52293	0.402000	0.26972	ACC		0.632	PTPRS-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450762.2			15	7	0	0	0	0.004007	0	15	7				
ZNF559	84527	broad.mit.edu	37	19	9452452	9452452	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr19:9452452C>T	ENST00000393883.2	+	6	973	c.325C>T	c.(325-327)Cac>Tac	p.H109Y	ZNF559_ENST00000317221.7_3'UTR|ZNF559_ENST00000586255.1_Intron|ZNF559_ENST00000592504.1_3'UTR|ZNF177_ENST00000602856.1_Intron|ZNF559_ENST00000585352.1_3'UTR|ZNF177_ENST00000446085.4_Intron|ZNF559_ENST00000587557.1_Missense_Mutation_p.H173Y|ZNF177_ENST00000605471.1_Intron|ZNF177_ENST00000602738.1_Intron|ZNF559_ENST00000603380.1_Missense_Mutation_p.H109Y|ZNF177_ENST00000541595.2_Intron|ZNF559_ENST00000538743.1_Missense_Mutation_p.H29Y|ZNF559_ENST00000592896.1_3'UTR	NM_001202412.1	NP_001189341.1	Q9BR84	ZN559_HUMAN	zinc finger protein 559	109					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H109Y(1)		endometrium(2)|large_intestine(7)|lung(15)|ovary(1)|urinary_tract(1)	26						CCTTAAGACTCACAGGAGAAC	0.358																																							uc002mlg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(325-327)CAC>TAC		zinc finger protein 559							55.0	59.0	58.0					19																	9452452		2202	4300	6502	SO:0001583	missense	84527				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:9452452C>T	AL389937	CCDS12211.1, CCDS59349.1, CCDS62531.1, CCDS62532.1	19p13.2	2013-09-20			ENSG00000188321	ENSG00000188321		"""Zinc fingers, C2H2-type"", ""-"""	28197	protein-coding gene	gene with protein product						12477932	Standard	NM_001202406		Approved	MGC13105	uc002mle.4	Q9BR84	OTTHUMG00000179942	ENST00000393883.2:c.325C>T	19.37:g.9452452C>T	ENSP00000377461:p.His109Tyr					ZNF559_uc002mlf.2_5'UTR|ZNF559_uc010dwl.1_5'UTR|ZNF559_uc010xkn.1_Missense_Mutation_p.H101Y|ZNF559_uc010dwm.1_3'UTR|ZNF559_uc002mle.3_Missense_Mutation_p.H173Y|ZNF559_uc010dwk.1_5'UTR|ZNF559_uc002mld.2_3'UTR|ZNF559_uc010dwo.1_Intron|ZNF177_uc002mli.2_Intron|ZNF177_uc002mlj.2_Intron	p.H109Y	NM_032497	NP_115886	Q9BR84	ZN559_HUMAN			7	972	+			109			C2H2-type 1; degenerate.		K7EMG6	Missense_Mutation	SNP	ENST00000393883.2	37	c.325C>T	CCDS12211.1	.	.	.	.	.	.	.	.	.	.	C	12.89	2.074602	0.36566	.	.	ENSG00000188321	ENST00000317221;ENST00000538743;ENST00000393883	T;T	0.35048	1.33;1.33	2.01	-0.19	0.13256	.	.	.	.	.	T	0.64918	0.2642	H	0.98594	4.275	0.09310	N	1	D;B;B	0.65815	0.995;0.209;0.331	P;B;B	0.57911	0.829;0.134;0.112	T	0.55354	-0.8154	9	0.62326	D	0.03	.	5.8958	0.18939	0.0:0.6912:0.0:0.3088	.	109;109;29	B3KPL8;Q9BR84;B4DP29	.;ZN559_HUMAN;.	Y	109;29;109	ENSP00000442832:H29Y;ENSP00000377461:H109Y	ENSP00000325393:H109Y	H	+	1	0	ZNF559	9313452	0.021000	0.18746	0.001000	0.08648	0.528000	0.34623	1.074000	0.30703	0.004000	0.14682	0.462000	0.41574	CAC		0.358	ZNF559-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000449021.1	NM_032497		29	20	0	0	0	0.007291	0	29	20				
PLVAP	83483	broad.mit.edu	37	19	17487843	17487843	+	Silent	SNP	G	G	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr19:17487843G>A	ENST00000252590.4	-	1	316	c.255C>T	c.(253-255)acC>acT	p.T85T		NM_031310.1	NP_112600.1	Q9BX97	PLVAP_HUMAN	plasmalemma vesicle associated protein	85					MAPK cascade (GO:0000165)|positive regulation of cellular extravasation (GO:0002693)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	caveola (GO:0005901)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)		p.T85T(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						TGAGCTCCTTGGTCAAGTTGG	0.622																																							uc002ngk.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(253-255)ACC>ACT		plasmalemma vesicle associated protein							119.0	103.0	108.0					19																	17487843		2203	4300	6503	SO:0001819	synonymous_variant	83483					caveola|integral to membrane|perinuclear region of cytoplasm		g.chr19:17487843G>A	AF326591	CCDS32952.1	19p13.2	2008-07-17				ENSG00000130300			13635	protein-coding gene	gene with protein product	"""fenestrated-endothelial linked structure protein; PV-1 protein"""	607647				11401446	Standard	NM_031310		Approved	gp68, PV-1, PV1, FELS	uc002ngk.1	Q9BX97		ENST00000252590.4:c.255C>T	19.37:g.17487843G>A							p.T85T	NM_031310	NP_112600	Q9BX97	PLVAP_HUMAN			1	305	-			85			Extracellular (Potential).		Q86VP0|Q8N8Y0|Q8ND68|Q8TER8|Q9BZD5	Silent	SNP	ENST00000252590.4	37	c.255C>T	CCDS32952.1																																																																																				0.622	PLVAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463655.1	NM_031310		19	11	0	0	0	0.010504	0	19	11				
SUGP1	57794	broad.mit.edu	37	19	19408000	19408000	+	Missense_Mutation	SNP	T	T	G	rs191697530		TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr19:19408000T>G	ENST00000247001.5	-	8	1388	c.1041A>C	c.(1039-1041)ttA>ttC	p.L347F	SUGP1_ENST00000585763.1_5'UTR	NM_172231.3	NP_757386.2	Q8IWZ8	SUGP1_HUMAN	SURP and G patch domain containing 1	347	Pro-rich.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(7)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	22						TGGCTGGGGGTAAGGACCCTG	0.672																																							uc002nmh.2		NA																	0					0						c.(1039-1041)TTA>TTC		splicing factor 4							45.0	53.0	50.0					19																	19408000		2203	4300	6503	SO:0001583	missense	57794				nuclear mRNA splicing, via spliceosome	nucleoplasm|spliceosomal complex	RNA binding	g.chr19:19408000T>G	AF521128	CCDS12399.1	19p13	2013-01-28	2010-08-10	2010-08-10		ENSG00000105705		"""G patch domain containing"""	18643	protein-coding gene	gene with protein product		607992	"""splicing factor 4"""	SF4		12594045	Standard	NM_172231		Approved	F23858, DKFZp434E2216, RBP	uc002nmh.3	Q8IWZ8		ENST00000247001.5:c.1041A>C	19.37:g.19408000T>G	ENSP00000247001:p.Leu347Phe					SF4_uc002nmf.2_5'UTR|SF4_uc002nmg.2_5'UTR|SF4_uc002nmi.2_Missense_Mutation_p.L137F|SF4_uc002nmj.2_Missense_Mutation_p.L137F|SF4_uc010xqr.1_RNA	p.L347F	NM_172231	NP_757386	Q8IWZ8	SUGP1_HUMAN			8	1043	-			347			Pro-rich.		O60378|Q6P3X9|Q8TCQ4|Q8WWT4|Q8WWT5|Q9NTG3	Missense_Mutation	SNP	ENST00000247001.5	37	c.1041A>C	CCDS12399.1	.	.	.	.	.	.	.	.	.	.	T	5.171	0.217062	0.09810	.	.	ENSG00000105705	ENST00000247001	T	0.24151	1.87	3.51	-5.67	0.02444	.	2.685070	0.01049	N	0.004421	T	0.12561	0.0305	N	0.08118	0	0.09310	N	1	B	0.25169	0.119	B	0.21917	0.037	T	0.30268	-0.9984	10	0.54805	T	0.06	.	6.5436	0.22394	0.0:0.3713:0.1585:0.4702	.	347	Q8IWZ8	SUGP1_HUMAN	F	347	ENSP00000247001:L347F	ENSP00000247001:L347F	L	-	3	2	SUGP1	19269000	0.000000	0.05858	0.000000	0.03702	0.092000	0.18411	-0.012000	0.12699	-0.597000	0.05813	-0.608000	0.04076	TTA		0.672	SUGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460128.4	NM_021164		6	39	0	0	0	0.006214	0	6	39				
PROSER3	148137	broad.mit.edu	37	19	36253234	36253234	+	Missense_Mutation	SNP	G	G	C			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr19:36253234G>C	ENST00000544099.1	+	5	583	c.520G>C	c.(520-522)Gct>Cct	p.A174P	C19orf55_ENST00000536950.1_Missense_Mutation_p.A173P|C19orf55_ENST00000537459.1_Missense_Mutation_p.A174P|C19orf55_ENST00000396908.4_Missense_Mutation_p.A174P|C19orf55_ENST00000421853.2_Missense_Mutation_p.A74P			Q2NL68	PRSR3_HUMAN		174								p.A174P(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|prostate(1)	15	all_lung(56;2.87e-07)|Lung NSC(56;4.32e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CCATGCTGTGGCTCCCCTTCA	0.547																																							uc002obq.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(520-522)GCT>CCT		hypothetical protein LOC148137							64.0	68.0	66.0					19																	36253234		2039	4193	6232	SO:0001583	missense	148137							g.chr19:36253234G>C																												ENST00000544099.1:c.520G>C	19.37:g.36253234G>C	ENSP00000467267:p.Ala174Pro					C19orf55_uc002obp.2_Missense_Mutation_p.A173P|C19orf55_uc002obo.1_Missense_Mutation_p.A174P	p.A174P	NM_001039887	NP_001034976	Q2NL68	CS055_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.0515)		5	593	+	all_lung(56;2.87e-07)|Lung NSC(56;4.32e-07)|Esophageal squamous(110;0.162)		174					Q8NDI3|Q8WWC8|Q96NL4	Missense_Mutation	SNP	ENST00000544099.1	37	c.520G>C		.	.	.	.	.	.	.	.	.	.	G	14.70	2.614472	0.46631	.	.	ENSG00000167595	ENST00000396908;ENST00000301165;ENST00000537459;ENST00000545674	T;T;T	0.42900	0.96;0.96;0.96	3.93	3.93	0.45458	.	0.836097	0.09998	N	0.728832	T	0.59280	0.2182	M	0.62723	1.935	0.09310	N	1	D;D;D	0.71674	0.987;0.998;0.998	P;D;D	0.66351	0.696;0.943;0.943	T	0.45673	-0.9245	10	0.46703	T	0.11	-0.3321	11.7565	0.51878	0.0:0.0:1.0:0.0	.	174;173;174	E5RFB9;Q2NL68-3;Q2NL68-4	.;.;.	P	174;173;89;88	ENSP00000380116:A174P;ENSP00000301165:A173P;ENSP00000440357:A88P	ENSP00000301165:A173P	A	+	1	0	C19orf55	40945074	0.159000	0.22864	0.010000	0.14722	0.009000	0.06853	2.333000	0.43912	2.469000	0.83416	0.650000	0.86243	GCT		0.547	C19orf55-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000398160.2			4	1	0	0	0	0.014758	0	4	1				
DPF1	8193	broad.mit.edu	37	19	38709662	38709662	+	Missense_Mutation	SNP	G	G	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr19:38709662G>T	ENST00000420980.2	-	4	442	c.416C>A	c.(415-417)cCg>cAg	p.P139Q	DPF1_ENST00000414789.1_Missense_Mutation_p.P57Q|DPF1_ENST00000456296.1_Missense_Mutation_p.P113Q|DPF1_ENST00000412732.1_Missense_Mutation_p.P57Q|DPF1_ENST00000355526.4_Missense_Mutation_p.P139Q|DPF1_ENST00000416611.1_Missense_Mutation_p.P113Q	NM_004647.2	NP_004638.2	Q92782	DPF1_HUMAN	D4, zinc and double PHD fingers family 1	139					apoptotic process (GO:0006915)|nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nBAF complex (GO:0071565)	zinc ion binding (GO:0008270)	p.P112Q(1)|p.P139Q(1)		large_intestine(1)|lung(4)|ovary(1)|skin(1)	7	all_cancers(60;1.24e-06)		Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			CGGCCCTTCCGGGAGGCCACC	0.607																																							uc002ohl.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(415-417)CCG>CAG		D4, zinc and double PHD fingers family 1 isoform							96.0	103.0	101.0					19																	38709662		2203	4300	6503	SO:0001583	missense	8193				induction of apoptosis|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nBAF complex	zinc ion binding	g.chr19:38709662G>T	U43843	CCDS33008.2, CCDS46064.1, CCDS46065.1	19q13.12	2013-01-28			ENSG00000011332	ENSG00000011332		"""Zinc fingers, PHD-type"""	20225	protein-coding gene	gene with protein product		601670				8812431	Standard	XM_005259288		Approved	neuro-d4, NEUD4, BAF45b	uc002ohm.3	Q92782	OTTHUMG00000157164	ENST00000420980.2:c.416C>A	19.37:g.38709662G>T	ENSP00000397354:p.Pro139Gln					DPF1_uc002ohm.2_Missense_Mutation_p.P139Q|DPF1_uc002ohn.2_Missense_Mutation_p.P57Q|DPF1_uc010xtu.1_Missense_Mutation_p.P113Q|DPF1_uc010xtv.1_Missense_Mutation_p.P113Q|DPF1_uc010xtw.1_Missense_Mutation_p.P113Q	p.P139Q	NM_004647	NP_004638	Q92782	DPF1_HUMAN	Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)		4	443	-	all_cancers(60;1.24e-06)		139					B3KSY8|Q08AJ0	Missense_Mutation	SNP	ENST00000420980.2	37	c.416C>A	CCDS33008.2	.	.	.	.	.	.	.	.	.	.	G	20.9	4.072419	0.76415	.	.	ENSG00000011332	ENST00000420980;ENST00000437720;ENST00000412732;ENST00000416611;ENST00000414789;ENST00000456296;ENST00000438060;ENST00000434076;ENST00000438365	D;D;D;D;D;T	0.89050	-2.03;-2.46;-2.0;-2.46;-2.46;2.58	3.95	3.95	0.45737	.	0.000000	0.64402	D	0.000009	D	0.90051	0.6893	L	0.31664	0.95	0.52501	D	0.99995	D;D;P;P;P;B	0.89917	1.0;0.98;0.922;0.771;0.953;0.136	D;P;P;P;P;B	0.85130	0.997;0.808;0.463;0.463;0.664;0.032	D	0.88147	0.2848	10	0.26408	T	0.33	-8.0558	15.3013	0.73955	0.0:0.0:1.0:0.0	.	113;113;112;139;139;139	B4DMQ8;E9PDV3;C8C3P2;Q6PJ73;Q92782-2;Q92782	.;.;.;.;.;DPF1_HUMAN	Q	139;139;57;113;57;113;57;113;57	ENSP00000397354:P139Q;ENSP00000412098:P57Q;ENSP00000390223:P113Q;ENSP00000391884:P57Q;ENSP00000411569:P113Q;ENSP00000416347:P57Q	ENSP00000412098:P57Q	P	-	2	0	DPF1	43401502	1.000000	0.71417	0.946000	0.38457	0.847000	0.48162	6.328000	0.72915	2.184000	0.69523	0.467000	0.42956	CCG		0.607	DPF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347721.1			54	57	1	0	2.82306e-37	0.01441	4.68916e-37	54	57				
EGLN2	112398	broad.mit.edu	37	19	41306994	41306994	+	Missense_Mutation	SNP	G	G	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr19:41306994G>T	ENST00000593726.1	+	1	1545	c.517G>T	c.(517-519)Gcg>Tcg	p.A173S	EGLN2_ENST00000594140.1_5'Flank|RAB4B-EGLN2_ENST00000594136.1_3'UTR|EGLN2_ENST00000303961.4_Missense_Mutation_p.A173S|EGLN2_ENST00000406058.2_Missense_Mutation_p.A173S|CTC-490E21.12_ENST00000601627.1_5'Flank			Q96KS0	EGLN2_HUMAN	egl-9 family hypoxia-inducible factor 2	173					cell redox homeostasis (GO:0045454)|cellular response to hypoxia (GO:0071456)|intracellular estrogen receptor signaling pathway (GO:0030520)|peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)|positive regulation of protein catabolic process (GO:0045732)|regulation of cell growth (GO:0001558)|regulation of neuron apoptotic process (GO:0043523)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|response to hypoxia (GO:0001666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ferrous iron binding (GO:0008198)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|oxygen sensor activity (GO:0019826)|peptidyl-proline 4-dioxygenase activity (GO:0031545)	p.A173S(1)		breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	10			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Vitamin C(DB00126)	GCTGCCCTCTGCGCCCGAGCG	0.667																																							uc010ehd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(517-519)GCG>TCG		EGL nine (C.elegans) homolog 2	Vitamin C(DB00126)						49.0	53.0	51.0					19																	41306994		2203	4298	6501	SO:0001583	missense	112398				cell redox homeostasis|estrogen receptor signaling pathway|positive regulation of protein catabolic process|regulation of cell growth|response to hypoxia	cytoplasm|nucleus	ferrous iron binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|oxygen sensor activity	g.chr19:41306994G>T	AJ310544	CCDS12567.1	19q13.2	2013-08-21	2013-08-21		ENSG00000269858	ENSG00000269858			14660	protein-coding gene	gene with protein product	"""HIF prolyl hydroxylase 1"""	606424	"""EGL nine (C.elegans) homolog 2"", ""egl nine homolog 2 (C. elegans)"""				Standard	NM_080732		Approved	PHD1, HIFPH1	uc002oph.3	Q96KS0		ENST00000593726.1:c.517G>T	19.37:g.41306994G>T	ENSP00000469686:p.Ala173Ser					EGLN2_uc002opg.3_Missense_Mutation_p.A173S|EGLN2_uc002oph.2_Missense_Mutation_p.A173S|EGLN2_uc002opi.2_Missense_Mutation_p.A173S	p.A173S	NM_080732	NP_542770	Q96KS0	EGLN2_HUMAN	LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		8	1518	+			173					A8K5S0|Q8WWY4|Q9BV14	Missense_Mutation	SNP	ENST00000593726.1	37	c.517G>T	CCDS12567.1	.	.	.	.	.	.	.	.	.	.	G	0.031	-1.333547	0.01298	.	.	ENSG00000171570	ENST00000303961;ENST00000406058	T;T	0.24723	1.84;1.84	4.16	0.7	0.18099	.	0.434461	0.23048	N	0.052522	T	0.05227	0.0139	N	0.00823	-1.155	0.09310	N	1	B	0.12013	0.005	B	0.06405	0.002	T	0.35301	-0.9794	10	0.08599	T	0.76	-1.0422	3.2273	0.06736	0.0951:0.3271:0.4099:0.1679	.	173	Q96KS0	EGLN2_HUMAN	S	173	ENSP00000307080:A173S;ENSP00000385253:A173S	ENSP00000307080:A173S	A	+	1	0	EGLN2	45998834	0.053000	0.20554	0.001000	0.08648	0.015000	0.08874	1.148000	0.31614	0.140000	0.18849	-0.274000	0.10170	GCG		0.667	EGLN2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463218.1			41	31	1	0	2.40579e-17	0.00623	3.62719e-17	41	31				
ATP5SL	55101	broad.mit.edu	37	19	41944255	41944255	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr19:41944255G>A	ENST00000221943.9	-	2	88	c.83C>T	c.(82-84)gCa>gTa	p.A28V	ATP5SL_ENST00000597457.1_Missense_Mutation_p.A28V|ATP5SL_ENST00000438807.3_Missense_Mutation_p.A28V|ATP5SL_ENST00000595425.1_Missense_Mutation_p.A28V|ATP5SL_ENST00000589970.1_Missense_Mutation_p.A28V|ATP5SL_ENST00000301183.11_Missense_Mutation_p.A34V|ATP5SL_ENST00000417807.3_Missense_Mutation_p.A34V|ATP5SL_ENST00000590641.2_Missense_Mutation_p.A34V|ATP5SL_ENST00000592922.2_Missense_Mutation_p.A28V	NM_018035.2	NP_060505.2	Q9NW81	AT5SL_HUMAN	ATP5S-like	28						mitochondrion (GO:0005739)		p.A28V(1)		breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(2)|stomach(1)	11						TGGGGCCACTGCCGCACCCAG	0.582																																							uc002oqw.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|breast(1)	2						c.(82-84)GCA>GTA		ATP5S-like							97.0	88.0	91.0					19																	41944255		2203	4300	6503	SO:0001583	missense	55101							g.chr19:41944255G>A	AK001103	CCDS33032.1, CCDS54269.1, CCDS54270.1, CCDS54271.1, CCDS59389.1, CCDS59390.1	19q13.2	2007-12-13				ENSG00000105341			25496	protein-coding gene	gene with protein product						12477932	Standard	NM_001167867		Approved	FLJ10241	uc002oqv.3	Q9NW81		ENST00000221943.9:c.83C>T	19.37:g.41944255G>A	ENSP00000221943:p.Ala28Val					CYP2F1_uc010xvw.1_Intron|ATP5SL_uc002oqu.1_RNA|ATP5SL_uc002oqv.2_Missense_Mutation_p.A34V|ATP5SL_uc010xwa.1_Missense_Mutation_p.A34V|ATP5SL_uc002oqx.1_Missense_Mutation_p.A28V|ATP5SL_uc002oqy.1_Missense_Mutation_p.A28V|ATP5SL_uc002oqz.1_Missense_Mutation_p.A28V|ATP5SL_uc002ora.1_Missense_Mutation_p.A15V|ATP5SL_uc010xwb.1_Missense_Mutation_p.A34V	p.A28V	NM_018035	NP_060505	Q9NW81	AT5SL_HUMAN			2	89	-			28					B4DDC0|B4DMZ4|B4DP55|B4DXE8|F5H4W7|K7EMF6|Q96D43	Missense_Mutation	SNP	ENST00000221943.9	37	c.83C>T	CCDS33032.1	.	.	.	.	.	.	.	.	.	.	G	14.77	2.635283	0.47049	.	.	ENSG00000105341	ENST00000221943;ENST00000438807;ENST00000417807;ENST00000301183;ENST00000507129	T;T;T;T	0.24151	3.13;1.9;3.09;1.87	3.49	-1.41	0.08941	.	1.308630	0.05562	N	0.569445	T	0.25121	0.0610	L	0.60455	1.87	0.09310	N	1	B;B;B;B;B;B;B	0.20550	0.003;0.046;0.017;0.017;0.008;0.019;0.008	B;B;B;B;B;B;B	0.15484	0.007;0.013;0.007;0.007;0.007;0.011;0.007	T	0.38714	-0.9648	10	0.59425	D	0.04	-9.8453	6.8684	0.24106	0.6837:0.0:0.3163:0.0	.	34;34;28;28;28;28;34	B4DFT4;B4DDC0;Q9NW81-2;B4DMZ4;E9PDC6;Q9NW81;F5H4W7	.;.;.;.;.;AT5SL_HUMAN;.	V	28;28;34;34;104	ENSP00000221943:A28V;ENSP00000397413:A28V;ENSP00000403910:A34V;ENSP00000301183:A34V	ENSP00000221943:A28V	A	-	2	0	ATP5SL	46636095	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-0.239000	0.08965	-0.188000	0.10499	0.655000	0.94253	GCA		0.582	ATP5SL-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460602.1	NM_018035		15	33	0	0	0	0.003163	0	15	33				
PSG8	440533	broad.mit.edu	37	19	43258594	43258594	+	Missense_Mutation	SNP	C	C	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr19:43258594C>A	ENST00000306511.4	-	5	1231	c.1134G>T	c.(1132-1134)aaG>aaT	p.K378N	PSG8_ENST00000401467.2_Missense_Mutation_p.K285N|PSG8_ENST00000600709.1_5'UTR|PSG8_ENST00000404209.4_Missense_Mutation_p.K378N|PSG8_ENST00000406636.3_Missense_Mutation_p.K256N	NM_182707.2	NP_874366.1	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8	378	Ig-like C2-type 3.					extracellular region (GO:0005576)		p.K378N(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(19)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	40		Prostate(69;0.00899)				GGATAAAGAGCTTTTGTCCTG	0.463																																							uc002ouo.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1132-1134)AAG>AAT		pregnancy specific beta-1-glycoprotein 8 isoform							202.0	220.0	214.0					19																	43258594		2203	4299	6502	SO:0001583	missense	440533					extracellular region		g.chr19:43258594C>A	M74106	CCDS33037.1, CCDS46090.1, CCDS46091.1	19q13.2	2013-01-29			ENSG00000124467	ENSG00000124467		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9525	protein-coding gene	gene with protein product		176397				1672663, 1572651	Standard	NM_182707		Approved		uc002ouo.2	Q9UQ74	OTTHUMG00000151118	ENST00000306511.4:c.1134G>T	19.37:g.43258594C>A	ENSP00000305005:p.Lys378Asn					PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Intron|PSG8_uc010eim.2_RNA|PSG8_uc002oui.2_Missense_Mutation_p.K217N|PSG8_uc002ouh.2_Missense_Mutation_p.K378N|PSG8_uc010ein.2_Missense_Mutation_p.K256N|PSG8_uc002ouj.3_Missense_Mutation_p.K160N|PSG8_uc002ouk.3_Missense_Mutation_p.K217N|PSG8_uc002oul.3_Missense_Mutation_p.K378N|PSG8_uc002oum.3_Missense_Mutation_p.K285N|PSG1_uc002oun.2_Intron|PSG8_uc002oup.3_Missense_Mutation_p.K285N	p.K378N	NM_182707	NP_874366	Q9UQ74	PSG8_HUMAN			5	1232	-		Prostate(69;0.00899)	378			Ig-like C2-type 3.		A5PKV3|B2RPL4|B4DTI6|O60410|Q68CR6	Missense_Mutation	SNP	ENST00000306511.4	37	c.1134G>T	CCDS33037.1	.	.	.	.	.	.	.	.	.	.	N	3.684	-0.064979	0.07273	.	.	ENSG00000124467	ENST00000404209;ENST00000292109;ENST00000406636;ENST00000401467;ENST00000426252;ENST00000407488;ENST00000306511	T;T;T;T	0.09817	2.94;2.94;2.94;2.94	1.38	-0.108	0.13588	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.05960	0.0155	N	0.17248	0.465	0.09310	N	1	B;B;B;B;B;B	0.14012	0.001;0.001;0.001;0.009;0.0;0.001	B;B;B;B;B;B	0.20384	0.012;0.008;0.012;0.029;0.005;0.008	T	0.38757	-0.9646	9	0.41790	T	0.15	.	4.0129	0.09631	0.4104:0.5896:0.0:0.0	.	256;285;378;285;378;378	Q9UQ74-2;B5MCQ0;Q9UQ74;E7ENH0;Q9UQ74-3;A5PKV3	.;.;PSG8_HUMAN;.;.;.	N	378;160;256;285;190;285;378	ENSP00000385869:K378N;ENSP00000385081:K256N;ENSP00000386090:K285N;ENSP00000305005:K378N	ENSP00000292109:K160N	K	-	3	2	PSG8	47950434	0.001000	0.12720	0.002000	0.10522	0.002000	0.02628	0.508000	0.22692	0.731000	0.32448	0.298000	0.19748	AAG		0.463	PSG8-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464526.1			46	171	1	0	4.18559e-23	0.01441	6.563e-23	46	171				
ZNF416	55659	broad.mit.edu	37	19	58083957	58083957	+	Nonsense_Mutation	SNP	C	C	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr19:58083957C>A	ENST00000196489.3	-	4	1537	c.1315G>T	c.(1315-1317)Gag>Tag	p.E439*		NM_017879.1	NP_060349.1	Q9BWM5	ZN416_HUMAN	zinc finger protein 416	439					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E439*(1)		breast(1)|endometrium(3)|large_intestine(5)|lung(12)|prostate(1)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0259)		TCATCACACTCAAAGGGCCTA	0.468																																							uc002qpf.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(1315-1317)GAG>TAG		zinc finger protein 416							103.0	95.0	97.0					19																	58083957		2203	4300	6503	SO:0001587	stop_gained	55659				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:58083957C>A	BC000130	CCDS12954.1	19q13.4	2013-01-08				ENSG00000083817		"""Zinc fingers, C2H2-type"", ""-"""	20645	protein-coding gene	gene with protein product							Standard	NM_017879		Approved	FLJ20557	uc002qpf.3	Q9BWM5		ENST00000196489.3:c.1315G>T	19.37:g.58083957C>A	ENSP00000196489:p.Glu439*					ZNF547_uc002qpm.3_Intron	p.E439*	NM_017879	NP_060349	Q9BWM5	ZN416_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0259)	4	1486	-		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)	439			C2H2-type 8.		Q9NWW8	Nonsense_Mutation	SNP	ENST00000196489.3	37	c.1315G>T	CCDS12954.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.812976	0.90707	.	.	ENSG00000083817	ENST00000196489;ENST00000428052	.	.	.	3.42	3.42	0.39159	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	.	6.3939	0.21601	0.2052:0.5949:0.1998:0.0	.	.	.	.	X	439;337	.	ENSP00000196489:E439X	E	-	1	0	ZNF416	62775769	0.000000	0.05858	0.045000	0.18777	0.247000	0.25773	-1.533000	0.02215	1.913000	0.55393	0.655000	0.94253	GAG		0.468	ZNF416-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466787.1	NM_017879		34	30	1	0	8.4185e-14	0.012213	1.2044e-13	34	30				
C2orf16	84226	broad.mit.edu	37	2	27805334	27805334	+	Silent	SNP	C	C	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr2:27805334C>A	ENST00000408964.2	+	1	5946	c.5895C>A	c.(5893-5895)ctC>ctA	p.L1965L	ZNF512_ENST00000355467.4_5'Flank|ZNF512_ENST00000556601.1_5'Flank|ZNF512_ENST00000416005.2_5'Flank|RP11-158I13.2_ENST00000505973.1_RNA|ZNF512_ENST00000413371.2_5'Flank|ZNF512_ENST00000379717.1_5'Flank|AC074091.1_ENST00000408604.1_RNA	NM_032266.3	NP_115642.3	Q68DN1	CB016_HUMAN	chromosome 2 open reading frame 16	1965						extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)		p.L1965L(2)		breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(33)|urinary_tract(1)	47	Acute lymphoblastic leukemia(172;0.155)					CAACTCTCCTCGGGACCACAC	0.507																																							uc002rkz.3		NA																	2	Substitution - coding silent(2)		lung(2)	large_intestine(1)	1						c.(5893-5895)CTC>CTA		hypothetical protein LOC84226							97.0	97.0	97.0					2																	27805334		1884	4112	5996	SO:0001819	synonymous_variant	84226							g.chr2:27805334C>A	AL136898	CCDS42666.1	2p23.3	2013-09-20			ENSG00000221843	ENSG00000221843			25275	protein-coding gene	gene with protein product	"""P-S-E-R-S-H-H-S repeats containing"""						Standard	NM_032266		Approved	DKFZp434G118	uc002rkz.4	Q68DN1	OTTHUMG00000159099	ENST00000408964.2:c.5895C>A	2.37:g.27805334C>A						ZNF512_uc010ylv.1_5'Flank|ZNF512_uc010ylw.1_5'Flank|ZNF512_uc002rlb.2_5'Flank|ZNF512_uc010ylx.1_5'Flank|ZNF512_uc002rlc.2_5'Flank|ZNF512_uc002rla.2_5'Flank|ZNF512_uc010yly.1_5'Flank|ZNF512_uc010ylz.1_5'Flank	p.L1965L	NM_032266	NP_115642	Q68DN1	CB016_HUMAN			1	5946	+	Acute lymphoblastic leukemia(172;0.155)		1965					B9EIQ4|Q53S01|Q8ND64|Q9H088	Silent	SNP	ENST00000408964.2	37	c.5895C>A	CCDS42666.1																																																																																				0.507	C2orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353292.1	NM_032266		41	32	1	0	1.34996e-11	0.009718	1.82478e-11	41	32				
NEURL3	93082	broad.mit.edu	37	2	97166170	97166170	+	RNA	SNP	C	C	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr2:97166170C>A	ENST00000310865.3	-	0	752							A8MQ27	NEU1B_HUMAN	neuralized E3 ubiquitin protein ligase 3						Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)										CCCATGGTCGCCTCACCCAGC	0.662																																							uc010yuo.1		NA																	0					0						c.(520-522)GCG>TCG		SubName: Full=cDNA FLJ54814;							14.0	16.0	15.0					2																	97166170		2025	4176	6201			93082							g.chr2:97166170C>A		CCDS74541.1, CCDS74542.1	2q11.2	2013-10-24	2013-10-24		ENSG00000163121	ENSG00000163121			25162	protein-coding gene	gene with protein product			"""neuralized homolog 3 (Drosophila) pseudogene"""			15936721	Standard	NM_001285486		Approved	Lincr, LOC93082	uc010yuo.2	Q96EH8	OTTHUMG00000128645		2.37:g.97166170C>A						NEURL3_uc010fhx.2_Intron|NEURL3_uc002swc.2_Intron	p.A174S							2	591	-								C9DQJ5|C9DQJ6|C9DQJ7	Missense_Mutation	SNP	ENST00000310865.3	37	c.520G>T																																																																																					0.662	NEURL3-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000250521.1	NM_138397		13	2	1	0	3.27435e-08	0.020292	3.93726e-08	13	2				
ST6GAL2	84620	broad.mit.edu	37	2	107423368	107423368	+	Missense_Mutation	SNP	G	G	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr2:107423368G>T	ENST00000409382.3	-	6	1966	c.1356C>A	c.(1354-1356)caC>caA	p.H452Q	ST6GAL2_ENST00000361686.4_Missense_Mutation_p.H452Q	NM_001142351.1	NP_001135823.1	Q96JF0	SIAT2_HUMAN	ST6 beta-galactosamide alpha-2,6-sialyltranferase 2	452					growth (GO:0040007)|multicellular organismal development (GO:0007275)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-galactoside alpha-2,6-sialyltransferase activity (GO:0003835)	p.H452Q(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(30)|ovary(5)|pancreas(6)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	65						ATTCATACACGTGCACCTCTC	0.498																																							uc002tdq.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(6)|ovary(4)|skin(1)	11						c.(1354-1356)CAC>CAA		ST6 beta-galactosamide							56.0	51.0	53.0					2																	107423368		2203	4300	6503	SO:0001583	missense	84620				growth|multicellular organismal development|oligosaccharide metabolic process|protein glycosylation	Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,6-sialyltransferase activity	g.chr2:107423368G>T	AB059555	CCDS2073.1, CCDS46380.1	2q11-q12	2008-02-05	2005-02-07	2005-02-07	ENSG00000144057	ENSG00000144057	2.4.99.2		10861	protein-coding gene	gene with protein product		608472	"""sialyltransferase 2 (monosialoganglioside sialyltransferase)"""	SIAT2			Standard	NM_032528		Approved	KIAA1877, St6gal2, St6GalII	uc002tdr.3	Q96JF0	OTTHUMG00000130923	ENST00000409382.3:c.1356C>A	2.37:g.107423368G>T	ENSP00000386942:p.His452Gln					ST6GAL2_uc002tdr.2_Missense_Mutation_p.H452Q	p.H452Q	NM_001142351	NP_001135823	Q96JF0	SIAT2_HUMAN			6	1475	-			452			Lumenal (Potential).		D3DVK3|Q53QP4|Q86Y44|Q8IUG7|Q96HE4	Missense_Mutation	SNP	ENST00000409382.3	37	c.1356C>A	CCDS2073.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.06|16.06	3.016088|3.016088	0.54468|0.54468	.|.	.|.	ENSG00000144057|ENSG00000144057	ENST00000361686;ENST00000409382|ENST00000361803	T;T|.	0.31769|.	1.48;1.48|.	5.8|5.8	-0.0516|-0.0516	0.13826|0.13826	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.78168|0.78168	0.4241|0.4241	M|M	0.92122|0.92122	3.275|3.275	0.80722|0.80722	D|D	1|1	D|.	0.69078|.	0.997|.	D|.	0.69142|.	0.962|.	T|T	0.77800|0.77800	-0.2452|-0.2452	10|5	0.72032|.	D|.	0.01|.	-51.7627|-51.7627	10.2113|10.2113	0.43143|0.43143	0.3877:0.0:0.6123:0.0|0.3877:0.0:0.6123:0.0	.|.	452|.	Q96JF0|.	SIAT2_HUMAN|.	Q|S	452|18	ENSP00000355273:H452Q;ENSP00000386942:H452Q|.	ENSP00000355273:H452Q|.	H|R	-|-	3|1	2|0	ST6GAL2|ST6GAL2	106789800|106789800	0.985000|0.985000	0.35326|0.35326	0.972000|0.972000	0.41901|0.41901	0.537000|0.537000	0.34900|0.34900	0.176000|0.176000	0.16782|0.16782	-0.316000|-0.316000	0.08690|0.08690	-0.812000|-0.812000	0.03155|0.03155	CAC|CGT		0.498	ST6GAL2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330065.1	NM_032528		14	5	1	0	0.000308642	0.003163	0.000332384	14	5				
COL5A2	1290	broad.mit.edu	37	2	189906364	189906364	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr2:189906364C>G	ENST00000374866.3	-	50	3855	c.3581G>C	c.(3580-3582)gGg>gCg	p.G1194A		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	1194					axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)	p.G1194A(1)		NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			TCCAATTGGCCCAAGTGGCCC	0.458																																							uc002uqk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(3580-3582)GGG>GCG		alpha 2 type V collagen preproprotein							132.0	130.0	131.0					2																	189906364		2203	4300	6503	SO:0001583	missense	1290				axon guidance|collagen fibril organization|eye morphogenesis|skin development	collagen type V	extracellular matrix structural constituent	g.chr2:189906364C>G	Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.3581G>C	2.37:g.189906364C>G	ENSP00000364000:p.Gly1194Ala					COL5A2_uc010frx.2_Missense_Mutation_p.G770A	p.G1194A	NM_000393	NP_000384	P05997	CO5A2_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)		50	3856	-			1194					P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Missense_Mutation	SNP	ENST00000374866.3	37	c.3581G>C	CCDS33350.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.393482	0.83011	.	.	ENSG00000204262	ENST00000374866;ENST00000452536	D	0.99523	-6.08	5.56	5.56	0.83823	.	0.000000	0.50627	D	0.000102	D	0.99746	0.9899	H	0.96996	3.92	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.91635	0.999;0.999	D	0.97371	0.9976	10	0.87932	D	0	.	19.9019	0.96988	0.0:1.0:0.0:0.0	.	834;1194	Q5PR22;P05997	.;CO5A2_HUMAN	A	1194;834	ENSP00000364000:G1194A	ENSP00000364000:G1194A	G	-	2	0	COL5A2	189614609	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	7.776000	0.85560	2.781000	0.95711	0.650000	0.86243	GGG		0.458	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313523.1	NM_000393		35	27	0	0	0	0.005524	0	35	27				
GPR55	9290	broad.mit.edu	37	2	231774828	231774829	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr2:231774828_231774829CC>AA	ENST00000392040.1	-	2	1041_1042	c.849_850GG>TT	c.(847-852)ctGGat>ctTTat	p.D284Y	GPR55_ENST00000392039.2_Missense_Mutation_p.D284Y|AC012507.4_ENST00000454890.1_RNA	NM_005683.3	NP_005674.2	Q9Y2T6	GPR55_HUMAN	G protein-coupled receptor 55	284					activation of phospholipase C activity (GO:0007202)|bone resorption (GO:0045453)|cannabinoid signaling pathway (GO:0038171)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of osteoclast differentiation (GO:0045671)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rho protein signal transduction (GO:0035025)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)|G-protein coupled receptor activity (GO:0004930)	p.D284Y(1)		endometrium(1)|large_intestine(1)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Renal(207;0.0112)|all_lung(227;0.0741)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)|Lung NSC(271;0.204)		Epithelial(121;1.04e-11)|all cancers(144;4.22e-09)|LUSC - Lung squamous cell carcinoma(224;0.0119)|Lung(119;0.0145)		CAGAAAACATCCAGGCAGCAGT	0.51																																							uc002vrg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(847-852)CTGGAT>CTTTAT		G protein-coupled receptor 55																																				SO:0001583	missense	9290				activation of phospholipase C activity|bone resorption|negative regulation of osteoclast differentiation|positive regulation of ERK1 and ERK2 cascade|positive regulation of Rho protein signal transduction	integral to plasma membrane	cannabinoid receptor activity	g.chr2:231774828_231774829CC>AA	AF096786	CCDS2480.1	2q37	2012-08-21			ENSG00000135898	ENSG00000135898		"""GPCR / Class A : Orphans"""	4511	protein-coding gene	gene with protein product		604107				9931487	Standard	NM_005683		Approved		uc002vrg.3	Q9Y2T6	OTTHUMG00000133224	ENST00000392040.1:c.849_850delinsAA	2.37:g.231774828_231774829delinsAA	ENSP00000375894:p.Asp284Tyr					GPR55_uc002vrf.2_RNA|GPR55_uc010fxs.1_Missense_Mutation_p.D284Y	p.D284Y	NM_005683	NP_005674	Q9Y2T6	GPR55_HUMAN		Epithelial(121;1.04e-11)|all cancers(144;4.22e-09)|LUSC - Lung squamous cell carcinoma(224;0.0119)|Lung(119;0.0145)	2	1042_1043	-		Renal(207;0.0112)|all_lung(227;0.0741)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)|Lung NSC(271;0.204)	284			Helical; Name=7; (Potential).		Q8N580	Missense_Mutation	DNP	ENST00000392040.1	37	c.849_850GG>TT	CCDS2480.1																																																																																				0.510	GPR55-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332618.1	NM_005683		54	38	0	0	0	0.004672	0	54	38				
MLPH	79083	broad.mit.edu	37	2	238462217	238462217	+	Silent	SNP	G	G	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr2:238462217G>T	ENST00000264605.3	+	16	2079	c.1785G>T	c.(1783-1785)gtG>gtT	p.V595V	MLPH_ENST00000445024.2_3'UTR|MLPH_ENST00000410032.1_Silent_p.V452V|MLPH_ENST00000338530.4_Silent_p.V567V|MLPH_ENST00000409373.1_Silent_p.V475V	NM_024101.5	NP_077006.1	Q9BV36	MELPH_HUMAN	melanophilin	595					melanocyte differentiation (GO:0030318)|melanosome localization (GO:0032400)|protein targeting (GO:0006605)	cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|microtubule plus-end (GO:0035371)|stress fiber (GO:0001725)	metal ion binding (GO:0046872)	p.V595V(1)		NS(1)|breast(3)|cervix(1)|endometrium(3)|large_intestine(2)|lung(11)|ovary(1)|stomach(2)|upper_aerodigestive_tract(1)	25		Breast(86;0.000381)|Renal(207;0.000966)|Ovarian(221;0.0695)|all_hematologic(139;0.095)|all_lung(227;0.17)|Melanoma(123;0.203)		Epithelial(121;1.17e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.02e-10)|Kidney(56;4.23e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.15e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000439)|Lung(119;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0316)		AGAAACCTGTGGTGGCCCACC	0.502																																							uc002vwt.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1783-1785)GTG>GTT		melanophilin isoform 1							143.0	121.0	128.0					2																	238462217		2203	4300	6503	SO:0001819	synonymous_variant	79083						metal ion binding	g.chr2:238462217G>T	AY358857	CCDS2518.1, CCDS42836.1, CCDS63172.1, CCDS63173.1	2q37.2	2014-09-17			ENSG00000115648	ENSG00000115648			29643	protein-coding gene	gene with protein product		606526				11980908, 11504925	Standard	NM_024101		Approved	l1Rk3, l(1)-3Rk, Slac-2a, ln, exophilin-3	uc002vwt.3	Q9BV36	OTTHUMG00000133298	ENST00000264605.3:c.1785G>T	2.37:g.238462217G>T						MLPH_uc002vws.2_Silent_p.V452V|MLPH_uc002vwu.2_Silent_p.V567V|MLPH_uc002vwv.2_Silent_p.V475V|MLPH_uc002vww.2_Silent_p.V491V|MLPH_uc002vwx.2_Silent_p.V451V|MLPH_uc010fyu.2_Silent_p.V347V	p.V595V	NM_024101	NP_077006	Q9BV36	MELPH_HUMAN		Epithelial(121;1.17e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.02e-10)|Kidney(56;4.23e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.15e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000439)|Lung(119;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0316)	16	2012	+		Breast(86;0.000381)|Renal(207;0.000966)|Ovarian(221;0.0695)|all_hematologic(139;0.095)|all_lung(227;0.17)|Melanoma(123;0.203)	595					B3KSS2|B4DKW7|G5E9G5|Q9HA71	Silent	SNP	ENST00000264605.3	37	c.1785G>T	CCDS2518.1	.	.	.	.	.	.	.	.	.	.	G	0.182	-1.061747	0.01950	.	.	ENSG00000115648	ENST00000415753	.	.	.	3.64	1.75	0.24633	.	.	.	.	.	T	0.52108	0.1714	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38908	-0.9639	4	.	.	.	-22.2081	5.4896	0.16769	0.1191:0.205:0.676:0.0	.	.	.	.	C	231	.	.	G	+	1	0	MLPH	238126956	1.000000	0.71417	0.990000	0.47175	0.057000	0.15508	1.164000	0.31810	0.294000	0.22547	0.462000	0.41574	GGT		0.502	MLPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257083.2	NM_024101		20	13	1	0	4.35082e-09	0.010504	5.36327e-09	20	13				
ADNP	23394	broad.mit.edu	37	20	49510018	49510018	+	Silent	SNP	G	G	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr20:49510018G>A	ENST00000396029.3	-	5	1800	c.1233C>T	c.(1231-1233)tcC>tcT	p.S411S	ADNP_ENST00000371602.4_Silent_p.S411S|ADNP_ENST00000396032.3_Silent_p.S411S|ADNP_ENST00000349014.3_Silent_p.S411S	NM_001282531.1|NM_015339.2	NP_001269460.1|NP_056154.1	Q9H2P0	ADNP_HUMAN	activity-dependent neuroprotector homeobox	411					negative regulation of neuron apoptotic process (GO:0043524)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S411S(1)		NS(1)|breast(4)|endometrium(7)|kidney(1)|large_intestine(13)|lung(7)|ovary(2)|prostate(2)|skin(2)	39						ACTGAGAGAGGGAAGGAGACT	0.552																																							uc002xvt.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(1231-1233)TCC>TCT		activity-dependent neuroprotector							105.0	107.0	106.0					20																	49510018		2203	4300	6503	SO:0001819	synonymous_variant	23394					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr20:49510018G>A	AF250860	CCDS13433.1	20q13.13	2011-06-20	2007-07-17		ENSG00000101126	ENSG00000101126		"""Homeoboxes / ZF class"""	15766	protein-coding gene	gene with protein product	"""ADNP homeobox 1"""	611386	"""activity-dependent neuroprotector"""			9872452, 11013255	Standard	NM_015339		Approved	KIAA0784, ADNP1	uc002xvu.1	Q9H2P0	OTTHUMG00000032737	ENST00000396029.3:c.1233C>T	20.37:g.49510018G>A						ADNP_uc002xvu.1_Silent_p.S411S	p.S411S	NM_015339	NP_056154	Q9H2P0	ADNP_HUMAN			5	1578	-			411					E1P5Y2|O94881|Q5BKU2|Q9UG34	Silent	SNP	ENST00000396029.3	37	c.1233C>T	CCDS13433.1																																																																																				0.552	ADNP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079705.2	NM_181442		9	102	0	0	0	0.006214	0	9	102				
ADNP	23394	broad.mit.edu	37	20	49510304	49510304	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr20:49510304G>A	ENST00000396029.3	-	5	1514	c.947C>T	c.(946-948)tCt>tTt	p.S316F	ADNP_ENST00000371602.4_Missense_Mutation_p.S316F|ADNP_ENST00000396032.3_Missense_Mutation_p.S316F|ADNP_ENST00000349014.3_Missense_Mutation_p.S316F	NM_001282531.1|NM_015339.2	NP_001269460.1|NP_056154.1	Q9H2P0	ADNP_HUMAN	activity-dependent neuroprotector homeobox	316					negative regulation of neuron apoptotic process (GO:0043524)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S316F(1)		NS(1)|breast(4)|endometrium(7)|kidney(1)|large_intestine(13)|lung(7)|ovary(2)|prostate(2)|skin(2)	39						GACTCCTGTAGAATTTAAGTT	0.463																																							uc002xvt.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(946-948)TCT>TTT		activity-dependent neuroprotector							138.0	122.0	127.0					20																	49510304		2203	4300	6503	SO:0001583	missense	23394					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr20:49510304G>A	AF250860	CCDS13433.1	20q13.13	2011-06-20	2007-07-17		ENSG00000101126	ENSG00000101126		"""Homeoboxes / ZF class"""	15766	protein-coding gene	gene with protein product	"""ADNP homeobox 1"""	611386	"""activity-dependent neuroprotector"""			9872452, 11013255	Standard	NM_015339		Approved	KIAA0784, ADNP1	uc002xvu.1	Q9H2P0	OTTHUMG00000032737	ENST00000396029.3:c.947C>T	20.37:g.49510304G>A	ENSP00000379346:p.Ser316Phe					ADNP_uc002xvu.1_Missense_Mutation_p.S316F	p.S316F	NM_015339	NP_056154	Q9H2P0	ADNP_HUMAN			5	1292	-			316					E1P5Y2|O94881|Q5BKU2|Q9UG34	Missense_Mutation	SNP	ENST00000396029.3	37	c.947C>T	CCDS13433.1	.	.	.	.	.	.	.	.	.	.	G	19.03	3.747503	0.69533	.	.	ENSG00000101126	ENST00000371602;ENST00000349014;ENST00000396029;ENST00000396032	.	.	.	5.91	5.91	0.95273	.	0.160517	0.56097	D	0.000023	T	0.76779	0.4035	L	0.50333	1.59	0.80722	D	1	D	0.67145	0.996	D	0.80764	0.994	T	0.76672	-0.2873	9	0.72032	D	0.01	-11.4833	20.2963	0.98556	0.0:0.0:1.0:0.0	.	316	Q9H2P0	ADNP_HUMAN	F	316	.	ENSP00000342905:S316F	S	-	2	0	ADNP	48943711	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	7.407000	0.80029	2.813000	0.96785	0.655000	0.94253	TCT		0.463	ADNP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079705.2	NM_181442		5	79	0	0	0	0.014758	0	5	79				
LIPI	149998	broad.mit.edu	37	21	15538748	15538748	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr21:15538748C>T	ENST00000536861.1	-	5	667	c.668G>A	c.(667-669)gGa>gAa	p.G223E	LIPI_ENST00000344577.2_Missense_Mutation_p.G244E			Q6XZB0	LIPI_HUMAN	lipase, member I	223					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|phospholipase activity (GO:0004620)	p.G244E(1)		endometrium(1)|kidney(13)|large_intestine(9)|liver(3)|lung(24)|ovary(3)|urinary_tract(1)	54				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.0015)|Colorectal(24;0.00693)|Lung(58;0.166)		ATCTATATGTCCCAAGGGCTC	0.348																																							uc002yjm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(730-732)GGA>GAA		lipase, member I							116.0	115.0	116.0					21																	15538748		2203	4300	6503	SO:0001583	missense	149998				lipid catabolic process	extracellular region|extracellular space|membrane|plasma membrane	heparin binding|phospholipase activity	g.chr21:15538748C>T	BC028732	CCDS13564.1	21q11.2	2012-07-31			ENSG00000188992	ENSG00000188992			18821	protein-coding gene	gene with protein product	"""membrane-associated phospholipase A1 beta"", ""cancer/testis antigen 17"""	609252				12719377	Standard	XM_005260924		Approved	PRED5, LPDL, CT17, mPA-PLA1beta, PLA1C	uc002yjm.3	Q6XZB0	OTTHUMG00000074258	ENST00000536861.1:c.668G>A	21.37:g.15538748C>T	ENSP00000440381:p.Gly223Glu					LIPI_uc010gkw.1_Intron	p.G244E	NM_198996	NP_945347	Q6XZB0	LIPI_HUMAN		Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.0015)|Colorectal(24;0.00693)|Lung(58;0.166)	5	741	-			223					G1JSG3|G1JSG4|G1JSG5|G1JSG6|G1JSG7|G1JSG8|G1JSG9	Missense_Mutation	SNP	ENST00000536861.1	37	c.731G>A		.	.	.	.	.	.	.	.	.	.	C	21.7	4.192741	0.78902	.	.	ENSG00000188992	ENST00000344577;ENST00000536861	D;D	0.94457	-3.43;-3.43	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	D	0.98469	0.9490	H	0.98426	4.23	0.44780	D	0.997781	D	0.89917	1.0	D	0.97110	1.0	D	0.99482	1.0948	10	0.87932	D	0	.	16.4355	0.83873	0.0:1.0:0.0:0.0	.	244	Q6XZB0-2	.	E	244;223	ENSP00000343331:G244E;ENSP00000440381:G223E	ENSP00000343331:G244E	G	-	2	0	LIPI	14460619	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	5.203000	0.65174	2.686000	0.91538	0.585000	0.79938	GGA		0.348	LIPI-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_198996		39	51	0	0	0	0.006999	0	39	51				
USP25	29761	broad.mit.edu	37	21	17199412	17199412	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr21:17199412C>T	ENST00000285679.6	+	14	1952	c.1583C>T	c.(1582-1584)cCt>cTt	p.P528L	USP25_ENST00000351097.5_Intron|USP25_ENST00000285681.2_Missense_Mutation_p.P528L|USP25_ENST00000400183.2_Missense_Mutation_p.P528L	NM_013396.3	NP_037528.3	Q9UHP3	UBP25_HUMAN	ubiquitin specific peptidase 25	528	USP.				cellular protein modification process (GO:0006464)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|proteolysis (GO:0006508)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|SUMO binding (GO:0032183)|ubiquitin-specific protease activity (GO:0004843)	p.P528L(1)		breast(4)|endometrium(6)|kidney(2)|large_intestine(13)|liver(5)|lung(14)|ovary(4)|prostate(1)|skin(1)|urinary_tract(2)	52				Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)		TCCCGGATACCTCCAGATTTG	0.463																																							uc002yjy.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|liver(2)	5						c.(1582-1584)CCT>CTT		ubiquitin specific peptidase 25							148.0	128.0	135.0					21																	17199412		2203	4300	6503	SO:0001583	missense	29761				protein modification process|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr21:17199412C>T	AF170562	CCDS33515.1, CCDS63336.1, CCDS63337.1	21q11.2	2011-02-24	2005-08-08		ENSG00000155313	ENSG00000155313		"""Ubiquitin-specific peptidases"""	12624	protein-coding gene	gene with protein product		604736	"""ubiquitin specific protease 25"""			12838346, 10612803	Standard	NM_013396		Approved	USP21	uc002yjy.1	Q9UHP3	OTTHUMG00000074343	ENST00000285679.6:c.1583C>T	21.37:g.17199412C>T	ENSP00000285679:p.Pro528Leu					USP25_uc011aby.1_Missense_Mutation_p.P528L|USP25_uc002yjz.1_Missense_Mutation_p.P528L|USP25_uc010gla.1_Intron	p.P528L	NM_013396	NP_037528	Q9UHP3	UBP25_HUMAN		Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)	14	1800	+			528					C0LSZ0|Q6DHZ9|Q9H9W1	Missense_Mutation	SNP	ENST00000285679.6	37	c.1583C>T	CCDS33515.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.4|28.4	4.914478|4.914478	0.92178|0.92178	.|.	.|.	ENSG00000155313|ENSG00000155313	ENST00000453553|ENST00000285681;ENST00000285679;ENST00000400183	.|T;T;T	.|0.32988	.|1.52;1.43;1.63	4.6|4.6	4.6|4.6	0.57074|0.57074	.|Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.56426|0.56426	0.1984|0.1984	M|M	0.70275|0.70275	2.135|2.135	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|0.996;0.999;1.0	.|D;D;D	.|0.91635	.|0.958;0.982;0.999	T|T	0.59867|0.59867	-0.7373|-0.7373	5|10	.|0.56958	.|D	.|0.05	-9.3679|-9.3679	18.3081|18.3081	0.90189|0.90189	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|528;528;528	.|Q9UHP3-3;Q9UHP3-1;Q9UHP3	.|.;.;UBP25_HUMAN	F|L	57|528	.|ENSP00000285681:P528L;ENSP00000285679:P528L;ENSP00000383044:P528L	.|ENSP00000285679:P528L	L|P	+|+	1|2	0|0	USP25|USP25	16121283|16121283	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.445000|7.445000	0.80570|0.80570	2.478000|2.478000	0.83669|0.83669	0.557000|0.557000	0.71058|0.71058	CTC|CCT		0.463	USP25-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157964.1			20	36	0	0	0	0.016522	0	20	36				
POLR3H	171568	broad.mit.edu	37	22	41936719	41936719	+	Silent	SNP	G	G	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr22:41936719G>A	ENST00000355209.4	-	2	535	c.192C>T	c.(190-192)ggC>ggT	p.G64G	POLR3H_ENST00000420561.1_Intron|POLR3H_ENST00000337566.5_Silent_p.G64G|POLR3H_ENST00000396504.2_Silent_p.G64G|POLR3H_ENST00000407461.1_Silent_p.G64G	NM_001018050.2	NP_001018060.1	Q9Y535	RPC8_HUMAN	polymerase (RNA) III (DNA directed) polypeptide H (22.9kD)	64					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|nucleobase-containing compound metabolic process (GO:0006139)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase III promoter (GO:0006384)	centrosome (GO:0005813)|cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)	p.G64G(2)		breast(1)|lung(5)|skin(1)|urinary_tract(1)	8						TGTGTGATGCGCCATCCCCAG	0.502																																							uc003baf.2		NA																	2	Substitution - coding silent(2)		lung(2)	skin(1)	1						c.(190-192)GGC>GGT		polymerase (RNA) III (DNA directed) polypeptide							176.0	126.0	143.0					22																	41936719		2203	4300	6503	SO:0001819	synonymous_variant	171568				innate immune response|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	DNA-directed RNA polymerase III complex	DNA binding|DNA-directed RNA polymerase activity	g.chr22:41936719G>A	AB051452	CCDS14018.1, CCDS33651.1	22q13	2013-01-21			ENSG00000100413	ENSG00000100413		"""RNA polymerase subunits"""	30349	protein-coding gene	gene with protein product						11258795, 12391170	Standard	XR_244356		Approved	RPC8, KIAA1665	uc003baf.3	Q9Y535	OTTHUMG00000150971	ENST00000355209.4:c.192C>T	22.37:g.41936719G>A						POLR3H_uc003bae.2_RNA|POLR3H_uc003bag.2_Silent_p.G64G|POLR3H_uc003bai.2_Silent_p.G64G|POLR3H_uc003baj.1_Silent_p.G64G	p.G64G	NM_138338	NP_612211	Q9Y535	RPC8_HUMAN			3	252	-			64					B0QYH9|Q5M7Y8|Q96AE3|Q9BY95	Silent	SNP	ENST00000355209.4	37	c.192C>T	CCDS14018.1																																																																																				0.502	POLR3H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320701.1	NM_138338		3	58	0	0	0	0.004672	0	3	58				
MOV10L1	54456	broad.mit.edu	37	22	50555597	50555597	+	Missense_Mutation	SNP	G	G	A	rs532990542		TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr22:50555597G>A	ENST00000262794.5	+	9	1354	c.1271G>A	c.(1270-1272)cGc>cAc	p.R424H	MOV10L1_ENST00000540615.1_Missense_Mutation_p.R404H|MOV10L1_ENST00000395843.1_De_novo_Start_OutOfFrame|MOV10L1_ENST00000545383.1_Missense_Mutation_p.R424H|MOV10L1_ENST00000395858.3_Missense_Mutation_p.R424H	NM_018995.2	NP_061868.1	Q9BXT6	M10L1_HUMAN	Mov10 RISC complex RNA helicase like 1	424					ATP catabolic process (GO:0006200)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	intracellular (GO:0005622)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|magnesium ion binding (GO:0000287)|RNA binding (GO:0003723)	p.R424H(1)|p.R404H(1)		breast(2)|endometrium(2)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|prostate(1)|skin(9)|stomach(4)|urinary_tract(3)	67		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		AATCCTGGCCGCTGCAAGGAG	0.388													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16154	0.0		0.0	False		,,,				2504	0.0						uc003bjj.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|skin(1)	3						c.(1270-1272)CGC>CAC		MOV10-like 1 isoform 1							90.0	94.0	93.0					22																	50555597		2203	4300	6503	SO:0001583	missense	54456				germ cell development|multicellular organismal development|spermatogenesis		ATP binding|ATP-dependent RNA helicase activity|magnesium ion binding|RNA binding	g.chr22:50555597G>A	AF285604	CCDS14084.1, CCDS54541.1, CCDS54542.1, CCDS54543.1	22q13.33	2014-07-02	2014-07-02		ENSG00000073146	ENSG00000073146			7201	protein-coding gene	gene with protein product	"""cardiac helicase activated by MEF2C protein"""	605794	"""Mov10 (mouse)-like 1"", ""Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)"""			11279525	Standard	NM_018995		Approved	DJ402G11.8, DKFZp434B0717, CHAMP	uc003bjj.3	Q9BXT6	OTTHUMG00000044648	ENST00000262794.5:c.1271G>A	22.37:g.50555597G>A	ENSP00000262794:p.Arg424His					MOV10L1_uc003bjk.3_Missense_Mutation_p.R424H|MOV10L1_uc011arp.1_Missense_Mutation_p.R404H|MOV10L1_uc011arq.1_Missense_Mutation_p.R185H|MOV10L1_uc010hao.1_RNA	p.R424H	NM_018995	NP_061868	Q9BXT6	M10L1_HUMAN		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)	9	1354	+		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)	424					A7E211|A8MXC6|B7WPP1|B7Z7R1|F5H403|Q5TGD5|Q8NBD4|Q9NXW3|Q9UFB3|Q9UGX9	Missense_Mutation	SNP	ENST00000262794.5	37	c.1271G>A	CCDS14084.1	.	.	.	.	.	.	.	.	.	.	G	11.92	1.782458	0.31502	.	.	ENSG00000073146	ENST00000545383;ENST00000262794;ENST00000395858;ENST00000540615	D;D;T;D	0.85702	-1.83;-1.83;-1.42;-2.02	5.63	3.57	0.40892	.	0.159399	0.56097	D	0.000023	T	0.80539	0.4642	M	0.73598	2.24	0.80722	D	1	P;B;P;P	0.52170	0.951;0.311;0.564;0.564	B;B;B;B	0.39419	0.299;0.06;0.054;0.054	T	0.75903	-0.3153	10	0.15952	T	0.53	-22.0671	9.217	0.37353	0.2346:0.0:0.7654:0.0	.	185;404;424;424	B7Z893;F5H403;A8MXC6;Q9BXT6	.;.;.;M10L1_HUMAN	H	424;424;424;404	ENSP00000438978:R424H;ENSP00000262794:R424H;ENSP00000379199:R424H;ENSP00000438542:R404H	ENSP00000262794:R424H	R	+	2	0	MOV10L1	48897724	1.000000	0.71417	0.990000	0.47175	0.703000	0.40648	4.213000	0.58520	0.744000	0.32741	-0.259000	0.10710	CGC		0.388	MOV10L1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000075009.2	NM_018995		59	40	0	0	0	0.01441	0	59	40				
SRGAP3	9901	broad.mit.edu	37	3	9034680	9034680	+	Missense_Mutation	SNP	G	G	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr3:9034680G>T	ENST00000383836.3	-	20	2895	c.2468C>A	c.(2467-2469)cCa>cAa	p.P823Q	SRGAP3_ENST00000360413.3_Missense_Mutation_p.P799Q	NM_014850.3	NP_055665.1	O43295	SRGP3_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	823					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.P823Q(1)	SRGAP3/RAF1(6)	breast(1)|endometrium(2)|kidney(21)|large_intestine(7)|lung(13)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	54				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		ATCCAGCAATGGCCCACTGCT	0.592			T	RAF1	pilocytic astrocytoma																																		uc003brf.1		NA		Dom	yes		3	3p25.3	9901	T	SLIT-ROBO Rho GTPase activating protein 3			M	RAF1		pilocytic astrocytoma	SRGAP3/RAF1(4)	1	Substitution - Missense(1)		lung(1)	central_nervous_system(4)|skin(3)|urinary_tract(1)|breast(1)	9						c.(2467-2469)CCA>CAA		SLIT-ROBO Rho GTPase activating protein 3							80.0	67.0	72.0					3																	9034680		2203	4300	6503	SO:0001583	missense	9901				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding	g.chr3:9034680G>T	AB007871	CCDS2572.1, CCDS33689.1	3p25.3	2011-07-04	2004-11-12	2004-11-12	ENSG00000196220	ENSG00000196220		"""Rho GTPase activating proteins"""	19744	protein-coding gene	gene with protein product		606525	"""SLIT-ROBO Rho GTPase activating protein 2"""	SRGAP2		12195014	Standard	NM_014850		Approved	KIAA0411, MEGAP, WRP, ARHGAP14	uc003brf.2	O43295	OTTHUMG00000090589	ENST00000383836.3:c.2468C>A	3.37:g.9034680G>T	ENSP00000373347:p.Pro823Gln					SRGAP3_uc003brg.1_Missense_Mutation_p.P799Q	p.P823Q	NM_014850	NP_055665	O43295	SRGP2_HUMAN		OV - Ovarian serous cystadenocarcinoma(96;0.0563)	20	3144	-			823					Q8IX13|Q8IZV8	Missense_Mutation	SNP	ENST00000383836.3	37	c.2468C>A	CCDS2572.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.761728	0.89932	.	.	ENSG00000196220	ENST00000383836;ENST00000360413	T;T	0.26810	1.71;2.12	5.41	5.41	0.78517	Src homology-3 domain (1);	0.000000	0.85682	D	0.000000	T	0.45895	0.1365	L	0.59436	1.845	0.58432	D	0.999999	D;D	0.64830	0.994;0.99	P;P	0.59424	0.857;0.723	T	0.36553	-0.9743	10	0.59425	D	0.04	.	18.7906	0.91973	0.0:0.0:1.0:0.0	.	799;823	O43295-2;O43295	.;SRGP2_HUMAN	Q	823;799	ENSP00000373347:P823Q;ENSP00000353587:P799Q	ENSP00000353587:P799Q	P	-	2	0	SRGAP3	9009680	1.000000	0.71417	0.984000	0.44739	0.922000	0.55478	6.510000	0.73729	2.526000	0.85167	0.591000	0.81541	CCA		0.592	SRGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207137.3			7	30	1	0	0.00198382	0.001984	0.0020793	7	30				
PLSCR5	389158	broad.mit.edu	37	3	146311746	146311746	+	Silent	SNP	C	C	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr3:146311746C>T	ENST00000443512.1	-	4	1417	c.414G>A	c.(412-414)ttG>ttA	p.L138L	PLSCR5_ENST00000482567.1_Silent_p.L126L|PLSCR5_ENST00000492200.1_Silent_p.L138L	NM_001085420.1	NP_001078889.1	A0PG75	PLS5_HUMAN	phospholipid scramblase family, member 5	138								p.L138L(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|urinary_tract(1)	12						TGTTACATCTCAAGGGCCTGT	0.438																																							uc003ewb.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(412-414)TTG>TTA		phospholipid scramblase family, member 5							123.0	124.0	124.0					3																	146311746		1978	4162	6140	SO:0001819	synonymous_variant	389158							g.chr3:146311746C>T	AY436642	CCDS46931.1	3q24	2004-06-28			ENSG00000231213	ENSG00000231213			19952	protein-coding gene	gene with protein product							Standard	NM_001085420		Approved		uc010hvc.3	A0PG75	OTTHUMG00000159437	ENST00000443512.1:c.414G>A	3.37:g.146311746C>T						PLSCR5_uc010hvb.2_Silent_p.L126L|PLSCR5_uc010hvc.2_Silent_p.L138L	p.L138L	NM_001085420	NP_001078889	A0PG75	PLS5_HUMAN			4	1418	-			138					B2RXK5	Silent	SNP	ENST00000443512.1	37	c.414G>A	CCDS46931.1																																																																																				0.438	PLSCR5-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355365.1	XM_371670		15	49	0	0	0	0.003163	0	15	49				
TM4SF4	7104	broad.mit.edu	37	3	149205451	149205451	+	Nonsense_Mutation	SNP	G	G	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr3:149205451G>T	ENST00000305354.4	+	3	1214	c.310G>T	c.(310-312)Gga>Tga	p.G104*		NM_004617.3	NP_004608.1	P48230	T4S4_HUMAN	transmembrane 4 L six family member 4	104					tissue regeneration (GO:0042246)	integral component of membrane (GO:0016021)				large_intestine(3)|lung(4)|ovary(1)|prostate(1)	9			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			CTTGGGAGCTGGATACTCGTT	0.488																																							uc003exd.1		NA																	0					0						c.(310-312)GGA>TGA		transmembrane 4 superfamily member 4							174.0	166.0	169.0					3																	149205451		1951	4159	6110	SO:0001587	stop_gained	7104					integral to membrane		g.chr3:149205451G>T		CCDS46932.1	3q25	2005-03-21	2005-03-21		ENSG00000169903	ENSG00000169903			11856	protein-coding gene	gene with protein product		606567	"""transmembrane 4 superfamily member 4"""			7665614	Standard	NM_004617		Approved	il-TMP	uc003exd.2	P48230	OTTHUMG00000159619	ENST00000305354.4:c.310G>T	3.37:g.149205451G>T	ENSP00000305852:p.Gly104*						p.G104*	NM_004617	NP_004608	P48230	T4S4_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)		3	541	+			104			Helical; (Potential).		B2RDA4	Nonsense_Mutation	SNP	ENST00000305354.4	37	c.310G>T	CCDS46932.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.343194	0.82022	.	.	ENSG00000169903	ENST00000305354;ENST00000465758	.	.	.	5.7	4.74	0.60224	.	0.143290	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-19.297	16.2041	0.82108	0.0:0.0:0.8582:0.1418	.	.	.	.	X	104;74	.	ENSP00000305852:G104X	G	+	1	0	TM4SF4	150688141	1.000000	0.71417	0.997000	0.53966	0.892000	0.51952	4.887000	0.63156	2.683000	0.91414	0.655000	0.94253	GGA		0.488	TM4SF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356528.1			28	13	1	0	8.24728e-16	0.004656	1.21539e-15	28	13				
TNIK	23043	broad.mit.edu	37	3	170929013	170929013	+	Missense_Mutation	SNP	G	G	C			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr3:170929013G>C	ENST00000436636.2	-	4	542	c.198C>G	c.(196-198)atC>atG	p.I66M	TNIK_ENST00000369326.5_Missense_Mutation_p.I66M|TNIK_ENST00000475336.1_Missense_Mutation_p.I66M|TNIK_ENST00000284483.8_Missense_Mutation_p.I66M|TNIK_ENST00000357327.5_Missense_Mutation_p.I66M|TNIK_ENST00000538048.1_Missense_Mutation_p.I66M|TNIK_ENST00000470834.1_Missense_Mutation_p.I66M|TNIK_ENST00000341852.6_Missense_Mutation_p.I66M|TNIK_ENST00000460047.1_Missense_Mutation_p.I66M|TNIK_ENST00000488470.1_Missense_Mutation_p.I66M	NM_015028.2	NP_055843.1	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase	66	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|activation of JNKK activity (GO:0007256)|cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite morphogenesis (GO:0048814)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.I66M(2)		cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(22)|ovary(5)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)	62	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			TTTCTTGTTTGATTTCTTCCT	0.333																																							uc003fhh.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|large_intestine(1)	5						c.(196-198)ATC>ATG		TRAF2 and NCK interacting kinase isoform 1							124.0	120.0	121.0					3																	170929013		1818	4080	5898	SO:0001583	missense	23043				actin cytoskeleton reorganization|activation of JNKK activity|protein autophosphorylation|regulation of dendrite morphogenesis|Wnt receptor signaling pathway	cytoskeleton|nucleus|recycling endosome	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity	g.chr3:170929013G>C	AF172264	CCDS46956.1, CCDS54673.1, CCDS54674.1, CCDS54675.1, CCDS54676.1, CCDS54677.1, CCDS54678.1, CCDS54679.1	3q26.31	2008-01-23			ENSG00000154310	ENSG00000154310			30765	protein-coding gene	gene with protein product		610005				9628581, 10521462	Standard	NR_027767		Approved	KIAA0551	uc003fhh.2	Q9UKE5	OTTHUMG00000159036	ENST00000436636.2:c.198C>G	3.37:g.170929013G>C	ENSP00000399511:p.Ile66Met					TNIK_uc003fhi.2_Missense_Mutation_p.I66M|TNIK_uc003fhj.2_Missense_Mutation_p.I66M|TNIK_uc003fhk.2_Missense_Mutation_p.I66M|TNIK_uc003fhl.2_Missense_Mutation_p.I66M|TNIK_uc003fhm.2_Missense_Mutation_p.I66M|TNIK_uc003fhn.2_Missense_Mutation_p.I66M|TNIK_uc003fho.2_Missense_Mutation_p.I66M	p.I66M	NM_015028	NP_055843	Q9UKE5	TNIK_HUMAN	LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		4	543	-	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		66			Protein kinase.		A7E2A3|A8K4U1|D3DNQ6|O60298|Q8WUY7|Q9UKD8|Q9UKD9|Q9UKE0|Q9UKE1|Q9UKE2|Q9UKE3|Q9UKE4	Missense_Mutation	SNP	ENST00000436636.2	37	c.198C>G	CCDS46956.1	.	.	.	.	.	.	.	.	.	.	G	16.59	3.164436	0.57476	.	.	ENSG00000154310	ENST00000436636;ENST00000369326;ENST00000538048;ENST00000341852;ENST00000284483;ENST00000475336;ENST00000357327;ENST00000460047;ENST00000488470;ENST00000470834;ENST00000468757	T;T;T;T;T;T;T;T;T;T;T	0.26373	1.74;1.74;1.74;1.74;1.74;1.74;1.74;1.74;1.74;1.74;2.44	6.16	5.28	0.74379	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.47619	0.1455	M	0.66297	2.02	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	0.99;0.966;1.0;0.995;0.966;0.966;1.0;0.972	D;D;D;D;D;D;D;D	0.91635	0.963;0.976;0.999;0.989;0.976;0.976;0.999;0.986	T	0.49214	-0.8963	10	0.87932	D	0	.	10.9416	0.47276	0.0662:0.0:0.8024:0.1314	.	66;66;66;66;66;66;66;66	Q9UKE5-8;Q9UKE5-6;Q9UKE5-7;Q9UKE5-5;Q9UKE5-4;Q9UKE5-2;Q9UKE5-3;Q9UKE5	.;.;.;.;.;.;.;TNIK_HUMAN	M	66;66;66;66;66;66;66;66;66;66;40	ENSP00000399511:I66M;ENSP00000358332:I66M;ENSP00000443278:I66M;ENSP00000345352:I66M;ENSP00000284483:I66M;ENSP00000418156:I66M;ENSP00000349880:I66M;ENSP00000418916:I66M;ENSP00000418378:I66M;ENSP00000419990:I66M;ENSP00000417338:I40M	ENSP00000284483:I66M	I	-	3	3	TNIK	172411707	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.158000	0.42329	1.580000	0.49851	0.650000	0.86243	ATC		0.333	TNIK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352973.2	XM_039796		9	48	0	0	0	0.006214	0	9	48				
NOP14	8602	broad.mit.edu	37	4	2958508	2958508	+	Missense_Mutation	SNP	G	G	C			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr4:2958508G>C	ENST00000314262.6	-	3	409	c.361C>G	c.(361-363)Cta>Gta	p.L121V	NOP14-AS1_ENST00000503709.1_RNA|NOP14_ENST00000398071.4_Missense_Mutation_p.L121V|NOP14_ENST00000416614.2_Missense_Mutation_p.L121V|NOP14_ENST00000502735.1_Missense_Mutation_p.L121V	NM_003703.1	NP_003694.1	P78316	NOP14_HUMAN	NOP14 nucleolar protein	121					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000462)|ribosomal small subunit biogenesis (GO:0042274)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|membrane (GO:0016020)|mitochondrion (GO:0005739)|Noc4p-Nop14p complex (GO:0030692)|nucleolus (GO:0005730)|nucleus (GO:0005634)|small-subunit processome (GO:0032040)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)	p.L121V(1)		NS(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(12)|pancreas(1)|skin(1)|urinary_tract(1)	30						TCTTCATTTAGATTGTAGATG	0.378																																							uc003ggj.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(361-363)CTA>GTA		probable nucleolar complex protein 14							117.0	105.0	109.0					4																	2958508		2203	4300	6503	SO:0001583	missense	8602				endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)	mitochondrion|Noc4p-Nop14p complex|small-subunit processome	snoRNA binding	g.chr4:2958508G>C	AB000467	CCDS33945.1	4p16.3	2012-12-10	2012-12-10	2008-10-13	ENSG00000087269	ENSG00000087269			16821	protein-coding gene	gene with protein product	"""NOP14 homolog (S. cerevisiae)"""	611526	"""chromosome 4 open reading frame 9"", ""nucleolar protein 14"", ""nucleolar protein 14 homolog (yeast)"", ""NOP14 nucleolar protein homolog (yeast)"""	C4orf9, NOL14		9734812, 11694595	Standard	XR_241655		Approved	RES4-25, UTP2	uc003ggj.1	P78316	OTTHUMG00000159911	ENST00000314262.6:c.361C>G	4.37:g.2958508G>C	ENSP00000315674:p.Leu121Val					C4orf10_uc003ggi.1_Intron|NOP14_uc003ggk.3_Missense_Mutation_p.L121V|NOP14_uc003ggl.2_Missense_Mutation_p.L121V|NOP14_uc010icq.1_RNA	p.L121V	NM_003703	NP_003694	P78316	NOP14_HUMAN			3	433	-			121					D3DVR6|Q7LGI5|Q7Z6K0|Q8TBR6	Missense_Mutation	SNP	ENST00000314262.6	37	c.361C>G	CCDS33945.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.275557	0.80580	.	.	ENSG00000087269	ENST00000416614;ENST00000314262;ENST00000502735;ENST00000398071;ENST00000546137	T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23	5.41	5.41	0.78517	.	0.000000	0.64402	D	0.000001	D	0.86602	0.5972	M	0.93106	3.38	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.89669	0.3882	10	0.87932	D	0	-12.2227	18.8106	0.92056	0.0:0.0:1.0:0.0	.	121;121	E9PFK5;P78316	.;NOP14_HUMAN	V	121;121;121;121;20	ENSP00000405068:L121V;ENSP00000315674:L121V;ENSP00000427415:L121V;ENSP00000381146:L121V	ENSP00000315674:L121V	L	-	1	2	NOP14	2928306	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.403000	0.66338	2.535000	0.85469	0.655000	0.94253	CTA		0.378	NOP14-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000358135.2	NM_003703		9	53	0	0	0	0.004482	0	9	53				
SLIT2	9353	broad.mit.edu	37	4	20618729	20618729	+	Silent	SNP	C	C	T	rs267600125		TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr4:20618729C>T	ENST00000504154.1	+	35	4296	c.4044C>T	c.(4042-4044)ccC>ccT	p.P1348P	SLIT2_ENST00000273739.5_Silent_p.P1361P|SLIT2_ENST00000503823.1_Silent_p.P1340P|SLIT2_ENST00000503837.1_Silent_p.P1344P	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	1348	EGF-like 7. {ECO:0000255|PROSITE- ProRule:PRU00076}.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)	p.P1348P(1)		NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						CATGCCAGCCCAGCAGCCAGG	0.577																																							uc003gpr.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(4)|skin(4)|ovary(3)	11						c.(4042-4044)CCC>CCT		slit homolog 2 precursor							55.0	55.0	55.0					4																	20618729		2203	4300	6503	SO:0001819	synonymous_variant	9353				apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding	g.chr4:20618729C>T	AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.4044C>T	4.37:g.20618729C>T						SLIT2_uc003gps.1_Silent_p.P1340P	p.P1348P	NM_004787	NP_004778	O94813	SLIT2_HUMAN			35	4248	+			1348			EGF-like 7.		B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Silent	SNP	ENST00000504154.1	37	c.4044C>T	CCDS3426.1																																																																																				0.577	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250396.2			21	25	0	0	0	0.012319	0	21	25				
LRRC66	339977	broad.mit.edu	37	4	52861716	52861716	+	Missense_Mutation	SNP	C	C	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr4:52861716C>A	ENST00000343457.3	-	4	1478	c.1472G>T	c.(1471-1473)tGc>tTc	p.C491F		NM_001024611.1	NP_001019782.1	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	491						integral component of membrane (GO:0016021)		p.C491F(1)		central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(8)|lung(34)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	58						GTTGTCCCCGCACTGTCCTGG	0.552																																							uc003gzi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(1471-1473)TGC>TTC		leucine rich repeat containing 66							94.0	101.0	98.0					4																	52861716		2078	4205	6283	SO:0001583	missense	339977					integral to membrane		g.chr4:52861716C>A	BC040414	CCDS43229.1	4q12	2008-08-08			ENSG00000188993	ENSG00000188993			34299	protein-coding gene	gene with protein product							Standard	XM_005265739		Approved		uc003gzi.3	Q68CR7	OTTHUMG00000160623	ENST00000343457.3:c.1472G>T	4.37:g.52861716C>A	ENSP00000341944:p.Cys491Phe						p.C491F	NM_001024611	NP_001019782	Q68CR7	LRC66_HUMAN			4	1485	-			491						Missense_Mutation	SNP	ENST00000343457.3	37	c.1472G>T	CCDS43229.1	.	.	.	.	.	.	.	.	.	.	C	0.874	-0.731154	0.03135	.	.	ENSG00000188993	ENST00000343457	T	0.26810	1.71	3.94	-1.92	0.07618	.	2.604370	0.01229	N	0.008316	T	0.11281	0.0275	N	0.12182	0.205	0.09310	N	1	B	0.15141	0.012	B	0.08055	0.003	T	0.10314	-1.0635	10	0.10111	T	0.7	3.9219	1.0187	0.01513	0.4477:0.2176:0.1393:0.1954	.	491	Q68CR7	LRC66_HUMAN	F	491	ENSP00000341944:C491F	ENSP00000341944:C491F	C	-	2	0	LRRC66	52556473	0.000000	0.05858	0.000000	0.03702	0.075000	0.17131	-0.294000	0.08309	-0.197000	0.10350	0.467000	0.42956	TGC		0.552	LRRC66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361473.1	NM_001024611		19	62	1	0	3.32936e-07	0.006122	3.88425e-07	19	62				
LPHN3	23284	broad.mit.edu	37	4	62845485	62845485	+	Missense_Mutation	SNP	C	C	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr4:62845485C>A	ENST00000514591.1	+	17	3135	c.2806C>A	c.(2806-2808)Caa>Aaa	p.Q936K	LPHN3_ENST00000514157.1_Missense_Mutation_p.Q936K|LPHN3_ENST00000507625.1_Missense_Mutation_p.Q1004K|LPHN3_ENST00000506746.1_Missense_Mutation_p.Q1004K|LPHN3_ENST00000504896.1_Missense_Mutation_p.Q936K|LPHN3_ENST00000509896.1_Missense_Mutation_p.Q1004K|LPHN3_ENST00000511324.1_Missense_Mutation_p.Q1004K|LPHN3_ENST00000508693.1_Missense_Mutation_p.Q1004K|LPHN3_ENST00000512091.2_Missense_Mutation_p.Q936K|LPHN3_ENST00000506720.1_Missense_Mutation_p.Q1004K|LPHN3_ENST00000507164.1_Missense_Mutation_p.Q1004K|LPHN3_ENST00000508946.1_Missense_Mutation_p.Q936K|LPHN3_ENST00000514996.1_Missense_Mutation_p.Q936K|LPHN3_ENST00000545650.1_Missense_Mutation_p.Q936K|LPHN3_ENST00000506700.1_Missense_Mutation_p.Q936K			Q9HAR2	LPHN3_HUMAN	latrophilin 3	923					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)	p.Q936K(3)		breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						CCGAACTGACCAACCAGTAAG	0.443																																							uc010ihh.2		NA																	3	Substitution - Missense(3)		lung(3)	lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						c.(2806-2808)CAA>AAA		latrophilin 3 precursor							116.0	111.0	113.0					4																	62845485		1999	4199	6198	SO:0001583	missense	23284				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding	g.chr4:62845485C>A	AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.2806C>A	4.37:g.62845485C>A	ENSP00000422533:p.Gln936Lys					LPHN3_uc003hcq.3_Missense_Mutation_p.Q936K|LPHN3_uc003hct.2_Missense_Mutation_p.Q329K	p.Q936K	NM_015236	NP_056051	Q9HAR2	LPHN3_HUMAN			15	2979	+			923			Extracellular (Potential).		E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	ENST00000514591.1	37	c.2806C>A	CCDS54768.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.049|8.049	0.765495|0.765495	0.15914|0.15914	.|.	.|.	ENSG00000150471|ENSG00000150471	ENST00000502815|ENST00000512091;ENST00000514591;ENST00000509896;ENST00000511324;ENST00000506700;ENST00000545650;ENST00000295349;ENST00000280009;ENST00000507164;ENST00000508693;ENST00000507625;ENST00000514157;ENST00000504896;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996	.|T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	.|0.36520	.|1.25;1.25;1.25;1.25;1.25;1.25;1.25;1.25;1.25;1.25;1.25;1.25;1.25;1.25;1.25	5.5|5.5	5.5|5.5	0.81552|0.81552	.|GPCR, family 2-like (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.40862|0.40862	0.1134|0.1134	N|N	0.13299|0.13299	0.325|0.325	0.53005|0.53005	D|D	0.999962|0.999962	.|D;D;D	.|0.59357	.|0.985;0.985;0.982	.|D;D;D	.|0.73708	.|0.981;0.981;0.968	T|T	0.28004|0.28004	-1.0057|-1.0057	5|10	.|0.39692	.|T	.|0.17	.|.	12.3802|12.3802	0.55303|0.55303	0.0:0.9224:0.0:0.0776|0.0:0.9224:0.0:0.0776	.|.	.|936;923;936	.|E9PE04;Q9HAR2;Q9HAR2-2	.|.;LPHN3_HUMAN;.	Q|K	393|936;936;1004;1004;936;936;923;936;1004;1004;1004;936;936;936;1004;1004;936	.|ENSP00000423388:Q936K;ENSP00000422533:Q936K;ENSP00000423787:Q1004K;ENSP00000425033:Q1004K;ENSP00000424120:Q936K;ENSP00000439831:Q936K;ENSP00000421476:Q1004K;ENSP00000424030:Q1004K;ENSP00000421372:Q1004K;ENSP00000425201:Q936K;ENSP00000423434:Q936K;ENSP00000421627:Q936K;ENSP00000420931:Q1004K;ENSP00000425884:Q1004K;ENSP00000424258:Q936K	.|ENSP00000280009:Q936K	P|Q	+|+	2|1	0|0	LPHN3|LPHN3	62528080|62528080	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.349000|0.349000	0.29174|0.29174	4.046000|4.046000	0.57376|0.57376	2.580000|2.580000	0.87095|0.87095	0.467000|0.467000	0.42956|0.42956	CCA|CAA		0.443	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1			14	75	1	0	9.31168e-06	0.016723	1.0489e-05	14	75				
UBA6	55236	broad.mit.edu	37	4	68490853	68490853	+	Silent	SNP	T	T	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr4:68490853T>A	ENST00000322244.5	-	29	2630	c.2571A>T	c.(2569-2571)ggA>ggT	p.G857G		NM_018227.5	NP_060697.4	A0AVT1	UBA6_HUMAN	ubiquitin-like modifier activating enzyme 6	857					protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|FAT10 activating enzyme activity (GO:0019780)|ligase activity (GO:0016874)	p.G857G(1)		central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(6)|liver(1)|lung(23)|skin(2)|upper_aerodigestive_tract(2)	44						AATCTATGTGTCCATTATGAT	0.388																																							uc003hdg.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(2569-2571)GGA>GGT		ubiquitin-activating enzyme E1-like 2							152.0	142.0	145.0					4																	68490853		2203	4300	6503	SO:0001819	synonymous_variant	55236				protein ubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm	ATP binding|FAT10 activating enzyme activity|ligase activity|protein binding	g.chr4:68490853T>A	AK094164	CCDS3516.1	4q13.2	2008-02-05	2007-11-30	2007-11-30	ENSG00000033178	ENSG00000033178		"""Ubiquitin-like modifier activating enzymes"""	25581	protein-coding gene	gene with protein product	"""UBA6, ubiquitin-activating enzyme E1"""	611361	"""ubiquitin-activating enzyme E1-like 2"""	UBE1L2		17580310	Standard	NM_018227		Approved	FLJ10808	uc003hdg.4	A0AVT1	OTTHUMG00000129299	ENST00000322244.5:c.2571A>T	4.37:g.68490853T>A							p.G857G	NM_018227	NP_060697	A0AVT1	UBA6_HUMAN			29	2623	-			857					A6N8M7|B2RAV3|Q4W5K0|Q6UV21|Q86T78|Q86TC7|Q8N5T3|Q8N9E4|Q9H3T7|Q9NVC9	Silent	SNP	ENST00000322244.5	37	c.2571A>T	CCDS3516.1																																																																																				0.388	UBA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251429.2	NM_018227		22	57	0	0	0	0.016522	0	22	57				
SOWAHB	345079	broad.mit.edu	37	4	77817883	77817883	+	Missense_Mutation	SNP	C	C	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr4:77817883C>A	ENST00000334306.2	-	1	1119	c.1120G>T	c.(1120-1122)Gcg>Tcg	p.A374S		NM_001029870.1	NP_001025041.1	A6NEL2	SWAHB_HUMAN	sosondowah ankyrin repeat domain family member B	374								p.A374S(1)									GGGTTCCCCGCCCAGGATTCC	0.562																																							uc003hki.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1120-1122)GCG>TCG		ankyrin repeat domain 56							65.0	72.0	70.0					4																	77817883		2203	4300	6503	SO:0001583	missense	345079							g.chr4:77817883C>A		CCDS34017.1	4q21.1	2013-01-10	2012-01-12	2012-01-12	ENSG00000186212	ENSG00000186212		"""Ankyrin repeat domain containing"""	32958	protein-coding gene	gene with protein product			"""ankyrin repeat domain 56"""	ANKRD56		22234889	Standard	NM_001029870		Approved		uc003hki.3	A6NEL2	OTTHUMG00000160876	ENST00000334306.2:c.1120G>T	4.37:g.77817883C>A	ENSP00000334879:p.Ala374Ser						p.A374S	NM_001029870	NP_001025041	A6NEL2	ANR56_HUMAN			1	1120	-			374					B2RP29	Missense_Mutation	SNP	ENST00000334306.2	37	c.1120G>T	CCDS34017.1	.	.	.	.	.	.	.	.	.	.	C	6.834	0.523070	0.13066	.	.	ENSG00000186212	ENST00000334306	T	0.05081	3.5	3.55	-0.474	0.12108	.	.	.	.	.	T	0.03564	0.0102	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.41627	-0.9498	9	0.54805	T	0.06	0.1406	4.1109	0.10058	0.2498:0.392:0.3582:0.0	.	374	A6NEL2	ANR56_HUMAN	S	374	ENSP00000334879:A374S	ENSP00000334879:A374S	A	-	1	0	ANKRD56	78036907	0.000000	0.05858	0.002000	0.10522	0.003000	0.03518	-0.533000	0.06157	-0.129000	0.11620	-0.147000	0.13772	GCG		0.562	SOWAHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362762.1	NM_001029870		14	60	1	0	7.93312e-07	0.020292	9.04007e-07	14	60				
UNC5C	8633	broad.mit.edu	37	4	96256587	96256587	+	Missense_Mutation	SNP	A	A	G			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr4:96256587A>G	ENST00000453304.1	-	2	668	c.320T>C	c.(319-321)gTa>gCa	p.V107A	UNC5C_ENST00000506749.1_Missense_Mutation_p.V107A|UNC5C_ENST00000504962.1_Missense_Mutation_p.V107A	NM_003728.3	NP_003719.3	O95185	UNC5C_HUMAN	unc-5 homolog C (C. elegans)	107	Ig-like.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|brain development (GO:0007420)|positive regulation of apoptotic process (GO:0043065)|regulation of cell migration (GO:0030334)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)	p.V107A(1)		NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(14)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	55		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		TCTTTCATCTACTATGTGGTC	0.418																																							uc003htp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|pancreas(1)	4						c.(319-321)GTA>GCA		unc5C precursor							131.0	128.0	129.0					4																	96256587		2203	4299	6502	SO:0001583	missense	8633				apoptosis|axon guidance|brain development	integral to membrane	netrin receptor activity	g.chr4:96256587A>G	AF055634	CCDS3643.1	4q21-q23	2013-01-11	2001-11-28		ENSG00000182168	ENSG00000182168		"""Immunoglobulin superfamily / I-set domain containing"""	12569	protein-coding gene	gene with protein product		603610	"""unc5 (C.elegans homolog) c"""			9126742, 9782087	Standard	NM_003728		Approved		uc003hto.3	O95185	OTTHUMG00000130989	ENST00000453304.1:c.320T>C	4.37:g.96256587A>G	ENSP00000406022:p.Val107Ala					UNC5C_uc010ilc.1_Missense_Mutation_p.V107A|UNC5C_uc003htq.2_Missense_Mutation_p.V107A	p.V107A	NM_003728	NP_003719	O95185	UNC5C_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)	2	474	-		Hepatocellular(203;0.114)	107			Extracellular (Potential).|Ig-like.		Q8IUT0	Missense_Mutation	SNP	ENST00000453304.1	37	c.320T>C	CCDS3643.1	.	.	.	.	.	.	.	.	.	.	A	18.11	3.550247	0.65311	.	.	ENSG00000182168	ENST00000453304;ENST00000331502;ENST00000513796;ENST00000506749;ENST00000504962	T;T;T;T	0.39592	1.07;1.07;1.07;1.07	6.06	6.06	0.98353	Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.45696	0.1355	N	0.17082	0.46	0.50813	D	0.999898	B;D;P	0.62365	0.129;0.991;0.924	B;P;P	0.62298	0.028;0.82;0.9	T	0.35450	-0.9788	10	0.23302	T	0.38	.	16.6245	0.84952	1.0:0.0:0.0:0.0	.	107;107;107	A8K385;E0CX15;O95185	.;.;UNC5C_HUMAN	A	107;66;107;107;107	ENSP00000406022:V107A;ENSP00000426924:V107A;ENSP00000426153:V107A;ENSP00000425117:V107A	ENSP00000328673:V66A	V	-	2	0	UNC5C	96475610	1.000000	0.71417	0.986000	0.45419	0.973000	0.67179	7.188000	0.77739	2.323000	0.78572	0.528000	0.53228	GTA		0.418	UNC5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253607.1	NM_003728		7	29	0	0	0	0.001984	0	7	29				
NPY5R	4889	broad.mit.edu	37	4	164271827	164271827	+	Silent	SNP	A	A	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr4:164271827A>T	ENST00000515560.1	+	4	1924	c.402A>T	c.(400-402)tcA>tcT	p.S134S	NPY5R_ENST00000506953.1_Silent_p.S134S|NPY5R_ENST00000338566.3_Silent_p.S134S			Q15761	NPY5R_HUMAN	neuropeptide Y receptor Y5	134					cardiac left ventricle morphogenesis (GO:0003214)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|generation of ovulation cycle rhythm (GO:0060112)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neuropeptide signaling pathway (GO:0007218)|outflow tract morphogenesis (GO:0003151)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of smooth muscle cell proliferation (GO:0048661)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)|pancreatic polypeptide receptor activity (GO:0001602)|peptide YY receptor activity (GO:0001601)	p.S134S(1)|p.L130fs*9(1)		NS(2)|biliary_tract(1)|breast(1)|endometrium(3)|large_intestine(4)|lung(26)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	all_hematologic(180;0.166)	Prostate(90;0.109)				TTTTAATATCAATTGCCATTG	0.358																																					Melanoma(139;1287 1774 9781 19750 25599)	Melanoma(139;1287 1774 9781 19750 25599)	uc003iqn.2		NA																	2	Deletion - Frameshift(1)|Substitution - coding silent(1)		lung(1)|breast(1)	lung(6)|skin(1)	7						c.(400-402)TCA>TCT		neuropeptide Y receptor Y5							193.0	193.0	193.0					4																	164271827		2203	4300	6503	SO:0001819	synonymous_variant	4889				cardiac left ventricle morphogenesis|outflow tract morphogenesis	integral to plasma membrane		g.chr4:164271827A>T	BC042416	CCDS3804.1	4q31-q32	2012-08-08				ENSG00000164129		"""GPCR / Class A : Neuropeptide receptors : Y"""	7958	protein-coding gene	gene with protein product		602001				8700207, 9417917	Standard	NM_006174		Approved	NPYR5	uc003iqn.3	Q15761		ENST00000515560.1:c.402A>T	4.37:g.164271827A>T							p.S134S	NM_006174	NP_006165	Q15761	NPY5R_HUMAN			4	584	+	all_hematologic(180;0.166)	Prostate(90;0.109)	134			Helical; Name=3; (Potential).		Q6GTR7|Q92916	Silent	SNP	ENST00000515560.1	37	c.402A>T	CCDS3804.1																																																																																				0.358	NPY5R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364633.1	NM_006174		38	103	0	0	0	0.019004	0	38	103				
FASTKD3	79072	broad.mit.edu	37	5	7866983	7866983	+	Missense_Mutation	SNP	G	G	C			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr5:7866983G>C	ENST00000264669.5	-	2	1350	c.1214C>G	c.(1213-1215)cCt>cGt	p.P405R	MTRR_ENST00000341013.6_5'Flank|FASTKD3_ENST00000513658.1_Intron|MTRR_ENST00000502509.1_Intron|MTRR_ENST00000264668.2_5'Flank|MTRR_ENST00000440940.2_5'Flank	NM_024091.3	NP_076996.2	Q14CZ7	FAKD3_HUMAN	FAST kinase domains 3	405					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)	p.P405R(1)		breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(2)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						AATCTGACGAGGTGAAAATTT	0.403																																							uc003jeb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(1)|pancreas(1)	4						c.(1213-1215)CCT>CGT		FAST kinase domains 3							55.0	57.0	57.0					5																	7866983		2203	4300	6503	SO:0001583	missense	79072				apoptosis|cellular respiration	mitochondrion	ATP binding|protein kinase activity	g.chr5:7866983G>C	AK026927	CCDS3873.1	5p15.31	2008-02-05			ENSG00000124279	ENSG00000124279			28758	protein-coding gene	gene with protein product						12477932	Standard	NM_024091		Approved	MGC5297, FLJ23274	uc003jeb.3	Q14CZ7	OTTHUMG00000131029	ENST00000264669.5:c.1214C>G	5.37:g.7866983G>C	ENSP00000264669:p.Pro405Arg					FASTKD3_uc011cmp.1_Missense_Mutation_p.P107R|FASTKD3_uc003jec.2_Intron|MTRR_uc010itn.1_5'Flank|MTRR_uc003jee.3_5'Flank|MTRR_uc003jed.2_5'Flank|MTRR_uc003jef.3_5'Flank|MTRR_uc003jeg.3_5'Flank|MTRR_uc010ito.2_5'Flank	p.P405R	NM_024091	NP_076996	Q14CZ7	FAKD3_HUMAN			2	1351	-			405					Q9BVD3	Missense_Mutation	SNP	ENST00000264669.5	37	c.1214C>G	CCDS3873.1	.	.	.	.	.	.	.	.	.	.	G	16.61	3.171135	0.57584	.	.	ENSG00000124279	ENST00000264669	T	0.17054	2.3	4.95	4.08	0.47627	.	0.172632	0.49305	D	0.000146	T	0.35335	0.0928	M	0.67953	2.075	0.37566	D	0.919251	D	0.69078	0.997	D	0.66497	0.944	T	0.28744	-1.0034	10	0.25106	T	0.35	-12.6398	13.4989	0.61442	0.0753:0.0:0.9247:0.0	.	405	Q14CZ7	FAKD3_HUMAN	R	405	ENSP00000264669:P405R	ENSP00000264669:P405R	P	-	2	0	FASTKD3	7919983	1.000000	0.71417	0.221000	0.23827	0.585000	0.36419	5.865000	0.69583	1.295000	0.44724	0.655000	0.94253	CCT		0.403	FASTKD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253673.1	NM_024091		20	57	0	0	0	0.010504	0	20	57				
TAS2R1	50834	broad.mit.edu	37	5	9629408	9629408	+	Missense_Mutation	SNP	A	A	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr5:9629408A>T	ENST00000382492.2	-	1	1055	c.737T>A	c.(736-738)tTt>tAt	p.F246Y	CTD-2001E22.1_ENST00000504182.2_RNA	NM_019599.2	NP_062545.1	Q9NYW7	TA2R1_HUMAN	taste receptor, type 2, member 1	246					chemosensory behavior (GO:0007635)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)	p.F246Y(1)		breast(5)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(19)|ovary(3)|prostate(1)|skin(1)|stomach(1)	39						AGAAGAGAGAAAAACTTTTAT	0.458																																							uc003jem.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(736-738)TTT>TAT		taste receptor T2R1							78.0	84.0	82.0					5																	9629408		2203	4300	6503	SO:0001583	missense	50834				chemosensory behavior|sensory perception of taste	integral to membrane	taste receptor activity	g.chr5:9629408A>T	AF227129	CCDS3876.1	5p15	2012-08-22			ENSG00000169777	ENSG00000169777		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14909	protein-coding gene	gene with protein product		604796				10761934, 10766242	Standard	NM_019599		Approved	T2R1, TRB7	uc003jem.1	Q9NYW7	OTTHUMG00000090500	ENST00000382492.2:c.737T>A	5.37:g.9629408A>T	ENSP00000371932:p.Phe246Tyr						p.F246Y	NM_019599	NP_062545	Q9NYW7	TA2R1_HUMAN			1	1056	-			246			Extracellular (Potential).		Q646G8	Missense_Mutation	SNP	ENST00000382492.2	37	c.737T>A	CCDS3876.1	.	.	.	.	.	.	.	.	.	.	A	14.67	2.604808	0.46423	.	.	ENSG00000169777	ENST00000382492	T	0.00801	5.68	5.55	3.18	0.36537	.	0.467742	0.19181	N	0.120678	T	0.01627	0.0052	M	0.62723	1.935	0.09310	N	1	P	0.51933	0.949	B	0.42959	0.403	T	0.48801	-0.9003	9	.	.	.	.	10.92	0.47158	0.659:0.341:0.0:0.0	.	246	Q9NYW7	TA2R1_HUMAN	Y	246	ENSP00000371932:F246Y	.	F	-	2	0	TAS2R1	9682408	0.176000	0.23096	0.000000	0.03702	0.001000	0.01503	4.209000	0.58493	0.530000	0.28619	0.533000	0.62120	TTT		0.458	TAS2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206988.2			32	37	0	0	0	0.013726	0	32	37				
CDH9	1007	broad.mit.edu	37	5	26906151	26906151	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr5:26906151C>T	ENST00000231021.4	-	5	900	c.728G>A	c.(727-729)gGc>gAc	p.G243D		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	243	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G243D(1)		breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						TCCCATCTGGCCACCCATGTC	0.453																																					Melanoma(8;187 585 15745 40864 52829)	Melanoma(8;187 585 15745 40864 52829)	uc003jgs.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						c.(727-729)GGC>GAC		cadherin 9, type 2 preproprotein							233.0	210.0	218.0					5																	26906151		2203	4300	6503	SO:0001583	missense	1007				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:26906151C>T	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.728G>A	5.37:g.26906151C>T	ENSP00000231021:p.Gly243Asp					CDH9_uc010iug.2_Missense_Mutation_p.G243D	p.G243D	NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN			5	897	-			243			Extracellular (Potential).|Cadherin 2.		Q3B7I5	Missense_Mutation	SNP	ENST00000231021.4	37	c.728G>A	CCDS3893.1	.	.	.	.	.	.	.	.	.	.	C	33	5.252310	0.95336	.	.	ENSG00000113100	ENST00000231021	T	0.50277	0.75	5.6	5.6	0.85130	Cadherin (5);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.67059	0.2853	M	0.64676	1.99	0.80722	D	1	D	0.67145	0.996	D	0.76575	0.988	T	0.63871	-0.6539	9	.	.	.	.	18.5289	0.90984	0.0:1.0:0.0:0.0	.	243	Q9ULB4	CADH9_HUMAN	D	243	ENSP00000231021:G243D	.	G	-	2	0	CDH9	26941908	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	7.750000	0.85110	2.802000	0.96397	0.650000	0.86243	GGC		0.453	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279		35	88	0	0	0	0.019004	0	35	88				
DMXL1	1657	broad.mit.edu	37	5	118484728	118484728	+	Missense_Mutation	SNP	G	G	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr5:118484728G>T	ENST00000311085.8	+	18	3286	c.3206G>T	c.(3205-3207)aGa>aTa	p.R1069I	DMXL1_ENST00000539542.1_Missense_Mutation_p.R1069I	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	1069								p.R1069I(1)		breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		TCTAATAGTAGATCTTCCCAG	0.398																																							uc003ksd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(3205-3207)AGA>ATA		Dmx-like 1							153.0	154.0	154.0					5																	118484728		2202	4300	6502	SO:0001583	missense	1657							g.chr5:118484728G>T	AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.3206G>T	5.37:g.118484728G>T	ENSP00000309690:p.Arg1069Ile					DMXL1_uc010jcl.1_Missense_Mutation_p.R1069I	p.R1069I	NM_005509	NP_005500	Q9Y485	DMXL1_HUMAN		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)	18	3387	+		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)	1069						Missense_Mutation	SNP	ENST00000311085.8	37	c.3206G>T	CCDS4125.1	.	.	.	.	.	.	.	.	.	.	G	8.351	0.830958	0.16820	.	.	ENSG00000172869	ENST00000311085;ENST00000539542	T;T	0.32023	1.47;1.47	5.65	5.65	0.86999	.	0.413158	0.29486	N	0.012001	T	0.20577	0.0495	N	0.22421	0.69	0.49915	D	0.999839	B;B	0.28605	0.217;0.083	B;B	0.28991	0.097;0.045	T	0.05632	-1.0873	10	0.30078	T	0.28	-11.4216	10.235	0.43277	0.1517:0.0:0.8483:0.0	.	1069;1069	F5H269;Q9Y485	.;DMXL1_HUMAN	I	1069	ENSP00000309690:R1069I;ENSP00000439479:R1069I	ENSP00000309690:R1069I	R	+	2	0	DMXL1	118512627	0.018000	0.18449	0.993000	0.49108	0.996000	0.88848	0.418000	0.21230	2.824000	0.97209	0.655000	0.94253	AGA		0.398	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250862.1	NM_005509		32	125	1	0	9.65021e-13	0.010818	1.332e-12	32	125				
SEC24A	10802	broad.mit.edu	37	5	134056703	134056703	+	Missense_Mutation	SNP	G	G	C			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr5:134056703G>C	ENST00000398844.2	+	21	3274	c.2986G>C	c.(2986-2988)Gtt>Ctt	p.V996L		NM_021982.2	NP_068817.1	O95486	SC24A_HUMAN	SEC24 family member A	996					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of protein secretion (GO:0050714)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045714)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)	p.V996L(1)		NS(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	36			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GATGCTTTGGGTTGGAAAAAA	0.333																																							uc003kzs.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2986-2988)GTT>CTT		SEC24 related gene family, member A							85.0	80.0	82.0					5																	134056703		1804	4080	5884	SO:0001583	missense	10802				COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	zinc ion binding	g.chr5:134056703G>C	AJ131244	CCDS43363.1, CCDS58967.1	5q31.1	2013-10-21	2013-10-21		ENSG00000113615	ENSG00000113615			10703	protein-coding gene	gene with protein product		607183	"""SEC24 (S. cerevisiae) related gene family, member A"", ""SEC24 family, member A (S. cerevisiae)"""			10075675, 10329445	Standard	NM_021982		Approved		uc003kzs.3	O95486	OTTHUMG00000163064	ENST00000398844.2:c.2986G>C	5.37:g.134056703G>C	ENSP00000381823:p.Val996Leu					SEC24A_uc011cxu.1_Missense_Mutation_p.V760L	p.V996L	NM_021982	NP_068817	O95486	SC24A_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		21	3274	+			996					A8MVW3|Q8WUV2|Q96GP7	Missense_Mutation	SNP	ENST00000398844.2	37	c.2986G>C	CCDS43363.1	.	.	.	.	.	.	.	.	.	.	G	13.88	2.370319	0.42003	.	.	ENSG00000113615	ENST00000398844	T	0.55052	0.54	5.45	0.407	0.16371	Gelsolin domain (1);	0.453039	0.23118	N	0.051726	T	0.44138	0.1279	L	0.58969	1.84	0.80722	D	1	B;B	0.15141	0.012;0.001	B;B	0.22601	0.04;0.015	T	0.22138	-1.0225	10	0.18710	T	0.47	-2.2253	10.1627	0.42862	0.5348:0.0:0.4652:0.0	.	760;996	B4E205;O95486	.;SC24A_HUMAN	L	996	ENSP00000381823:V996L	ENSP00000381823:V996L	V	+	1	0	SEC24A	134084602	1.000000	0.71417	0.993000	0.49108	0.981000	0.71138	1.300000	0.33436	-0.236000	0.09753	-0.229000	0.12294	GTT		0.333	SEC24A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371563.1			7	46	0	0	0	0.006214	0	7	46				
ANKHD1	54882	broad.mit.edu	37	5	139907856	139907856	+	Silent	SNP	T	T	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr5:139907856T>A	ENST00000360839.2	+	29	5479	c.5325T>A	c.(5323-5325)ccT>ccA	p.P1775P	ANKHD1_ENST00000544120.1_Silent_p.P158P|ANKHD1-EIF4EBP3_ENST00000532219.1_Silent_p.P1775P|SNORD45_ENST00000363181.1_RNA|ANKHD1_ENST00000297183.6_Silent_p.P1775P	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	1775						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.P1775P(2)		breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACTTGATTCCTAAAAATCATA	0.403																																							uc003lfs.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(6)	6						c.(5323-5325)CCT>CCA		ANKHD1-EIF4EBP3 protein							102.0	99.0	100.0					5																	139907856		2203	4300	6503	SO:0001819	synonymous_variant	404734					cytoplasm|nucleus	RNA binding	g.chr5:139907856T>A	AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.5325T>A	5.37:g.139907856T>A						ANKHD1_uc003lfr.2_Silent_p.P1775P|ANKHD1-EIF4EBP3_uc011czh.1_Silent_p.P514P|ANKHD1_uc003lfw.2_Silent_p.P413P|ANKHD1_uc010jfl.2_Silent_p.P210P|ANKHD1-EIF4EBP3_uc003lfx.1_5'UTR	p.P1775P	NM_020690	NP_065741	Q8IWZ2	Q8IWZ2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		29	5449	+			1775					A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Silent	SNP	ENST00000360839.2	37	c.5325T>A	CCDS4225.1	.	.	.	.	.	.	.	.	.	.	T	4.181	0.032271	0.08101	.	.	ENSG00000131503	ENST00000435794;ENST00000432301	.	.	.	5.09	2.66	0.31614	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.2651	0.15595	0.2743:0.0738:0.0:0.6519	.	.	.	.	K	266;226	.	.	X	+	1	0	ANKHD1	139888040	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.665000	0.25083	0.395000	0.25257	0.533000	0.62120	TAA		0.403	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251672.1	NM_017747		3	78	0	0	0	0.004672	0	3	78				
PCDHGA3	56112	broad.mit.edu	37	5	140724004	140724004	+	Missense_Mutation	SNP	C	C	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr5:140724004C>A	ENST00000253812.6	+	1	404	c.404C>A	c.(403-405)aCa>aAa	p.T135K	PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	135	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T135K(1)		breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AATTTCCCAACAGAGGAATTG	0.333																																							uc003ljm.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(403-405)ACA>AAA		protocadherin gamma subfamily A, 3 isoform 1							32.0	31.0	31.0					5																	140724004		1810	4089	5899	SO:0001583	missense	56112				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140724004C>A	AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.404C>A	5.37:g.140724004C>A	ENSP00000253812:p.Thr135Lys					PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGA3_uc011dap.1_Missense_Mutation_p.T135K	p.T135K	NM_018916	NP_061739	Q9Y5H0	PCDG3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	404	+			135			Extracellular (Potential).|Cadherin 2.		Q9Y5D4	Missense_Mutation	SNP	ENST00000253812.6	37	c.404C>A	CCDS47290.1	.	.	.	.	.	.	.	.	.	.	.	0.011	-1.692910	0.00731	.	.	ENSG00000254245	ENST00000253812	T	0.19250	2.16	5.65	2.76	0.32466	Cadherin (2);Cadherin-like (1);	0.676146	0.11284	U	0.580051	T	0.06005	0.0156	N	0.02192	-0.645	0.09310	N	1	B;B	0.11235	0.004;0.002	B;B	0.15052	0.012;0.003	T	0.41662	-0.9496	10	0.02654	T	1	.	3.2641	0.06859	0.2086:0.534:0.1131:0.1443	.	135;135	Q9Y5H0-2;Q9Y5H0	.;PCDG3_HUMAN	K	135	ENSP00000253812:T135K	ENSP00000253812:T135K	T	+	2	0	PCDHGA3	140704188	0.000000	0.05858	0.686000	0.30086	0.806000	0.45545	-0.075000	0.11431	0.864000	0.35578	0.655000	0.94253	ACA		0.333	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377017.1	NM_018916		8	22	1	0	0.000274275	0.004482	0.000297005	8	22				
PCDHGA6	56109	broad.mit.edu	37	5	140753772	140753772	+	Missense_Mutation	SNP	A	A	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr5:140753772A>T	ENST00000517434.1	+	1	122	c.122A>T	c.(121-123)aAa>aTa	p.K41I	PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018919.2|NM_032086.1	NP_061742.1|NP_114475.1	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6	41	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.K41I(1)		breast(1)|large_intestine(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGCTGGAGAAAGGCTCCTTC	0.647																																							uc003ljy.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(121-123)AAA>ATA		protocadherin gamma subfamily A, 6 isoform 1							29.0	35.0	33.0					5																	140753772		2166	4293	6459	SO:0001583	missense	56109				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140753772A>T	AF152513	CCDS54926.1, CCDS75335.1	5q31	2010-01-26				ENSG00000253731		"""Cadherins / Protocadherins : Clustered"""	8704	other	protocadherin		606293				10380929	Standard	NM_018919		Approved	PCDH-GAMMA-A6		Q9Y5G7		ENST00000517434.1:c.122A>T	5.37:g.140753772A>T	ENSP00000429601:p.Lys41Ile					PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc011dau.1_Missense_Mutation_p.K41I	p.K41I	NM_018919	NP_061742	Q9Y5G7	PCDG6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	122	+			41			Cadherin 1.|Extracellular (Potential).		A6H8K7|B2RN55|Q9Y5D1	Missense_Mutation	SNP	ENST00000517434.1	37	c.122A>T	CCDS54926.1	.	.	.	.	.	.	.	.	.	.	.	18.13	3.555628	0.65425	.	.	ENSG00000253731	ENST00000517434	T	0.30182	1.54	5.1	5.1	0.69264	Cadherin, N-terminal (1);Cadherin (1);Cadherin-like (1);	0.000000	0.32416	U	0.006135	T	0.58047	0.2095	M	0.90705	3.14	0.25661	N	0.986002	D;D	0.55385	0.971;0.959	D;P	0.63703	0.917;0.883	T	0.58999	-0.7536	10	0.87932	D	0	.	10.3124	0.43716	0.9219:0.0:0.0781:0.0	.	41;41	Q9Y5G7-2;Q9Y5G7	.;PCDG6_HUMAN	I	41	ENSP00000429601:K41I	ENSP00000429601:K41I	K	+	2	0	PCDHGA6	140733956	0.226000	0.23696	1.000000	0.80357	0.957000	0.61999	2.318000	0.43779	2.274000	0.75844	0.477000	0.44152	AAA		0.647	PCDHGA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374743.1	NM_018919		5	30	0	0	0	0.014758	0	5	30				
PCDHGA8	9708	broad.mit.edu	37	5	140772574	140772574	+	Missense_Mutation	SNP	G	G	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr5:140772574G>T	ENST00000398604.2	+	1	194	c.194G>T	c.(193-195)cGt>cTt	p.R65L	PCDHGA3_ENST00000253812.6_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_032088.1	NP_114477.1	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8	65	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R65L(1)		endometrium(6)|kidney(6)|large_intestine(6)|lung(30)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CACGGAGTCCGTATCGTCTCC	0.617																																							uc003lkd.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(193-195)CGT>CTT		protocadherin gamma subfamily A, 8 isoform 1							44.0	54.0	50.0					5																	140772574		2193	4299	6492	SO:0001583	missense	9708				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140772574G>T	AF152515	CCDS47291.1, CCDS75338.1	5q31	2010-01-26			ENSG00000253767	ENSG00000253767		"""Cadherins / Protocadherins : Clustered"""	8706	other	protocadherin		606295				10380929	Standard	NM_014004		Approved	KIAA0327, PCDH-GAMMA-A8		Q9Y5G5	OTTHUMG00000164053	ENST00000398604.2:c.194G>T	5.37:g.140772574G>T	ENSP00000381605:p.Arg65Leu					PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkb.3_Missense_Mutation_p.R65L	p.R65L	NM_032088	NP_114477	Q9Y5G5	PCDG8_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1092	+			65			Cadherin 1.|Extracellular (Potential).		A7MCZ4|O15039	Missense_Mutation	SNP	ENST00000398604.2	37	c.194G>T	CCDS47291.1	.	.	.	.	.	.	.	.	.	.	.	19.05	3.751735	0.69533	.	.	ENSG00000253767	ENST00000398604	T	0.38401	1.14	5.26	3.45	0.39498	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	0.000000	0.31922	U	0.006850	T	0.65154	0.2664	H	0.99130	4.44	0.35148	D	0.76946	P;P	0.44877	0.737;0.845	P;P	0.48982	0.597;0.539	T	0.79322	-0.1851	10	0.87932	D	0	.	9.9609	0.41695	0.073:0.0:0.7892:0.1379	.	65;65	Q9Y5G5;Q9Y5G5-2	PCDG8_HUMAN;.	L	65	ENSP00000381605:R65L	ENSP00000381605:R65L	R	+	2	0	PCDHGA8	140752758	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	6.559000	0.73946	0.591000	0.29711	0.655000	0.94253	CGT		0.617	PCDHGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376972.1	NM_032088		14	46	1	0	3.41278e-10	0.00499	4.37193e-10	14	46				
ATP10B	23120	broad.mit.edu	37	5	160034041	160034041	+	Missense_Mutation	SNP	C	C	T	rs201819244		TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr5:160034041C>T	ENST00000327245.5	-	19	3737	c.2891G>A	c.(2890-2892)cGt>cAt	p.R964H		NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	964					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.R964H(1)		NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTGTAGTTCACGAAATTGCTT	0.438													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19566	0.0		0.0	False		,,,				2504	0.0						uc003lym.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(1)|pancreas(1)	5						c.(2890-2892)CGT>CAT		ATPase, class V, type 10B		C	HIS/ARG	1,3827		0,1,1913	97.0	90.0	93.0		2891	3.7	0.7	5		93	0,8230		0,0,4115	no	missense	ATP10B	NM_025153.2	29	0,1,6028	TT,TC,CC		0.0,0.0261,0.0083	benign	964/1462	160034041	1,12057	1914	4115	6029	SO:0001583	missense	23120				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr5:160034041C>T	AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.2891G>A	5.37:g.160034041C>T	ENSP00000313600:p.Arg964His					ATP10B_uc010jit.1_Missense_Mutation_p.R281H	p.R964H	NM_025153	NP_079429	O94823	AT10B_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		19	3738	-	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	964			Cytoplasmic (Potential).		Q9H725	Missense_Mutation	SNP	ENST00000327245.5	37	c.2891G>A	CCDS43394.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	3.409	-0.120569	0.06838	2.61E-4	0.0	ENSG00000118322	ENST00000327245	T	0.06142	3.34	4.86	3.69	0.42338	HAD-like domain (1);	0.454314	0.24156	N	0.041023	T	0.02727	0.0082	N	0.05078	-0.115	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46091	-0.9216	9	.	.	.	.	5.4295	0.16446	0.1523:0.083:0.0:0.7647	.	964	O94823	AT10B_HUMAN	H	964	ENSP00000313600:R964H	.	R	-	2	0	ATP10B	159966619	0.001000	0.12720	0.672000	0.29872	0.391000	0.30476	0.444000	0.21661	0.695000	0.31675	-0.414000	0.06135	CGT		0.438	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374127.1	NM_025153		16	60	0	0	0	0.003163	0	16	60				
GRM6	2916	broad.mit.edu	37	5	178418906	178418906	+	Missense_Mutation	SNP	C	C	G			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr5:178418906C>G	ENST00000517717.1	-	3	721	c.683G>C	c.(682-684)aGt>aCt	p.S228T	GRM6_ENST00000231188.5_Missense_Mutation_p.S228T|RP11-281O15.4_ENST00000519491.1_RNA			O15303	GRM6_HUMAN	glutamate receptor, metabotropic 6	228					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|detection of light stimulus involved in visual perception (GO:0050908)|detection of visible light (GO:0009584)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|locomotory behavior (GO:0007626)|positive regulation of calcium ion import (GO:0090280)|regulation of synaptic transmission, glutamatergic (GO:0051966)|retina development in camera-type eye (GO:0060041)|synaptic transmission (GO:0007268)	cell projection (GO:0042995)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|new growing cell tip (GO:0035841)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|protein homodimerization activity (GO:0042803)	p.S228T(1)		NS(2)|breast(4)|endometrium(9)|large_intestine(12)|lung(21)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	55	all_cancers(89;0.000828)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.0156)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.245)		CTCAACCCCACTTTCGCCATA	0.632																																							uc003mjr.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(4)|ovary(2)|breast(1)|pancreas(1)	8						c.(682-684)AGT>ACT		glutamate receptor, metabotropic 6 precursor							72.0	61.0	65.0					5																	178418906		2203	4300	6503	SO:0001583	missense	2916				detection of visible light|visual perception	integral to plasma membrane		g.chr5:178418906C>G	U82083	CCDS4442.1	5q35	2014-01-28						"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4598	protein-coding gene	gene with protein product		604096				9215706	Standard	NM_000843		Approved	GPRC1F, mGlu6, MGLUR6, CSNB1B	uc003mjr.3	O15303	OTTHUMG00000130889	ENST00000517717.1:c.683G>C	5.37:g.178418906C>G	ENSP00000430767:p.Ser228Thr					GRM6_uc010jla.1_5'Flank|GRM6_uc003mjs.1_5'Flank	p.S228T	NM_000843	NP_000834	O15303	GRM6_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.245)	2	862	-	all_cancers(89;0.000828)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.0156)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	228			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000517717.1	37	c.683G>C	CCDS4442.1	.	.	.	.	.	.	.	.	.	.	C	15.53	2.860167	0.51482	.	.	ENSG00000113262	ENST00000319065;ENST00000231188;ENST00000517717	D;D	0.83250	-1.7;-1.7	5.48	5.48	0.80851	Extracellular ligand-binding receptor (1);	.	.	.	.	D	0.83138	0.5189	L	0.45470	1.425	0.45150	D	0.998162	P	0.41102	0.738	P	0.48873	0.593	T	0.78054	-0.2354	9	0.14252	T	0.57	.	17.2396	0.87009	0.0:1.0:0.0:0.0	.	228	O15303	GRM6_HUMAN	T	176;228;228	ENSP00000231188:S228T;ENSP00000430767:S228T	ENSP00000231188:S228T	S	-	2	0	GRM6	178351512	1.000000	0.71417	0.997000	0.53966	0.734000	0.41952	5.932000	0.70121	2.746000	0.94184	0.655000	0.94253	AGT		0.632	GRM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253474.2			9	25	0	0	0	0.006214	0	9	25				
CYB5R4	51167	broad.mit.edu	37	6	84603269	84603269	+	Missense_Mutation	SNP	G	G	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr6:84603269G>T	ENST00000369681.5	+	3	398	c.258G>T	c.(256-258)atG>atT	p.M86I	CYB5R4_ENST00000369679.4_Missense_Mutation_p.M52I	NM_016230.3	NP_057314.2	Q7L1T6	NB5R4_HUMAN	cytochrome b5 reductase 4	86	Cytochrome b5 heme-binding. {ECO:0000255|PROSITE-ProRule:PRU00279}.				cell development (GO:0048468)|detection of oxygen (GO:0003032)|generation of precursor metabolites and energy (GO:0006091)|glucose homeostasis (GO:0042593)|insulin secretion (GO:0030073)|NADP metabolic process (GO:0006739)|oxidation-reduction process (GO:0055114)|response to antibiotic (GO:0046677)|superoxide metabolic process (GO:0006801)	endoplasmic reticulum (GO:0005783)|perinuclear region of cytoplasm (GO:0048471)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|NAD(P)H oxidase activity (GO:0016174)|NADPH-hemoprotein reductase activity (GO:0003958)|oxidoreductase activity, acting on NAD(P)H, heme protein as acceptor (GO:0016653)	p.M86I(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	23		all_cancers(76;7e-07)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00128)		BRCA - Breast invasive adenocarcinoma(397;0.0871)		GCCCTTATATGGAGTATCATC	0.338																																					Esophageal Squamous(86;1289 1332 25971 40349 52675)	Esophageal Squamous(86;1289 1332 25971 40349 52675)	uc003pkf.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)	2						c.(256-258)ATG>ATT		cytochrome b5 reductase 4							155.0	149.0	151.0					6																	84603269		2203	4300	6503	SO:0001583	missense	51167				cell development|detection of oxygen|generation of precursor metabolites and energy|glucose homeostasis|insulin secretion|response to antibiotic|superoxide metabolic process	endoplasmic reticulum|perinuclear region of cytoplasm	cytochrome-b5 reductase activity|heme binding|NAD(P)H oxidase activity	g.chr6:84603269G>T	AF169803	CCDS5000.2	6q14.2	2012-09-19		2005-07-13	ENSG00000065615	ENSG00000065615	1.6.2.2		20147	protein-coding gene	gene with protein product		608343	"""NADPH cytochrome B5 oxidoreductase"""	NCB5OR		10611283	Standard	NM_016230		Approved	b5+b5R, dJ676J13.1	uc003pkf.3	Q7L1T6	OTTHUMG00000015118	ENST00000369681.5:c.258G>T	6.37:g.84603269G>T	ENSP00000358695:p.Met86Ile						p.M86I	NM_016230	NP_057314	Q7L1T6	NB5R4_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.0871)	3	390	+		all_cancers(76;7e-07)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00128)	86			Cytochrome b5 heme-binding.		B1AEM2|Q5TGI9|Q9NUE4|Q9UHI9	Missense_Mutation	SNP	ENST00000369681.5	37	c.258G>T	CCDS5000.2	.	.	.	.	.	.	.	.	.	.	G	17.84	3.487155	0.63962	.	.	ENSG00000065615	ENST00000369681;ENST00000369679	T;T	0.79247	-1.25;-1.25	5.09	5.09	0.68999	Cytochrome b5 (5);	0.072360	0.85682	D	0.000000	T	0.55970	0.1954	N	0.19112	0.55	0.58432	D	0.999997	B	0.28026	0.198	B	0.28305	0.088	T	0.59478	-0.7447	10	0.44086	T	0.13	-21.7091	17.6207	0.88080	0.0:0.0:1.0:0.0	.	86	Q7L1T6	NB5R4_HUMAN	I	86;52	ENSP00000358695:M86I;ENSP00000358693:M52I	ENSP00000358693:M52I	M	+	3	0	CYB5R4	84659988	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	5.506000	0.66993	2.537000	0.85549	0.563000	0.77884	ATG		0.338	CYB5R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041362.4	NM_016230		36	29	1	0	9.62906e-15	0.00623	1.398e-14	36	29				
PTPRK	5796	broad.mit.edu	37	6	128319937	128319937	+	Missense_Mutation	SNP	C	C	A	rs541434752		TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr6:128319937C>A	ENST00000368215.3	-	16	2603	c.2604G>T	c.(2602-2604)agG>agT	p.R868S	PTPRK_ENST00000368207.3_Missense_Mutation_p.R895S|PTPRK_ENST00000524481.1_5'Flank|PTPRK_ENST00000368227.3_Missense_Mutation_p.R881S|PTPRK_ENST00000368213.5_Missense_Mutation_p.R869S|PTPRK_ENST00000368226.4_Missense_Mutation_p.R869S|PTPRK_ENST00000368210.3_Missense_Mutation_p.R881S|PTPRK_ENST00000532331.1_Missense_Mutation_p.R885S			Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	868					cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to reactive oxygen species (GO:0034614)|cellular response to UV (GO:0034644)|focal adhesion assembly (GO:0048041)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.R869>?(1)|p.R869S(1)	PTPRK/RSPO3(10)	autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(14)|lung(24)|ovary(3)|pancreas(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	72				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		AATCAGCTACCCTGATGGCTG	0.473																																							uc003qbk.2		NA																	2	Substitution - Missense(1)|Complex(1)		lung(2)	ovary(3)|skin(2)|pancreas(1)|kidney(1)|central_nervous_system(1)	8						c.(2602-2604)AGG>AGT		protein tyrosine phosphatase, receptor type, K							133.0	119.0	124.0					6																	128319937		2203	4300	6503	SO:0001583	missense	5796				cell migration|cellular response to reactive oxygen species|cellular response to UV|focal adhesion assembly|negative regulation of cell cycle|negative regulation of cell migration|negative regulation of keratinocyte proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transforming growth factor beta receptor signaling pathway	adherens junction|cell surface|cell-cell junction|integral to plasma membrane|leading edge membrane	beta-catenin binding|gamma-catenin binding|protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr6:128319937C>A	L77886	CCDS5137.1, CCDS47473.1, CCDS75517.1	6q22.2-q22.3	2013-02-11			ENSG00000152894	ENSG00000152894		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9674	protein-coding gene	gene with protein product		602545				9047348, 8663237	Standard	NM_002844		Approved	R-PTP-kappa	uc010kfc.3	Q15262	OTTHUMG00000015536	ENST00000368215.3:c.2604G>T	6.37:g.128319937C>A	ENSP00000357198:p.Arg868Ser					PTPRK_uc003qbj.2_Missense_Mutation_p.R869S|PTPRK_uc010kfc.2_Missense_Mutation_p.R869S|PTPRK_uc011ebu.1_Missense_Mutation_p.R885S|PTPRK_uc010kfd.1_Missense_Mutation_p.R94S	p.R868S	NM_002844	NP_002835	Q15262	PTPRK_HUMAN		all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)	16	2971	-			868			Cytoplasmic (Potential).		B2RTQ8|B7ZMG0|Q14763|Q5TG10|Q5TG11	Missense_Mutation	SNP	ENST00000368215.3	37	c.2604G>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.96|16.96	3.265202|3.265202	0.59431|0.59431	.|.	.|.	ENSG00000152894|ENSG00000152894	ENST00000415046|ENST00000368226;ENST00000368227;ENST00000532331;ENST00000368213;ENST00000368210;ENST00000368215;ENST00000368207;ENST00000415055	.|T;T;T;T;T;T;T;T	.|0.09817	.|3.1;3.02;3.01;3.09;3.02;3.09;3.0;2.94	5.65|5.65	2.83|2.83	0.33086|0.33086	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.14184|0.14184	0.0343|0.0343	M|M	0.76727|0.76727	2.345|2.345	0.52501|0.52501	D|D	0.999958|0.999958	.|D;D;D;D	.|0.89917	.|0.999;1.0;0.978;0.987	.|D;D;D;D	.|0.87578	.|0.996;0.998;0.916;0.961	T|T	0.16276|0.16276	-1.0408|-1.0408	5|10	.|0.15499	.|T	.|0.54	.|.	8.1923|8.1923	0.31376|0.31376	0.0:0.5567:0.0:0.4433|0.0:0.5567:0.0:0.4433	.|.	.|885;869;868;869	.|B7ZMG0;Q15262-3;Q15262;Q15262-2	.|.;.;PTPRK_HUMAN;.	V|S	162|869;881;885;869;881;868;895;128	.|ENSP00000357209:R869S;ENSP00000357210:R881S;ENSP00000432973:R885S;ENSP00000357196:R869S;ENSP00000357193:R881S;ENSP00000357198:R868S;ENSP00000357190:R895S;ENSP00000408180:R128S	.|ENSP00000357190:R895S	G|R	-|-	2|3	0|2	PTPRK|PTPRK	128361630|128361630	0.156000|0.156000	0.22821|0.22821	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	-0.462000|-0.462000	0.06704|0.06704	0.688000|0.688000	0.31529|0.31529	0.650000|0.650000	0.86243|0.86243	GGG|AGG		0.473	PTPRK-005	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000042163.1			27	20	1	0	2.65835e-16	0.007291	3.94724e-16	27	20				
PDE10A	10846	broad.mit.edu	37	6	165806181	165806181	+	Missense_Mutation	SNP	A	A	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr6:165806181A>T	ENST00000366882.1	-	17	1734	c.1580T>A	c.(1579-1581)aTg>aAg	p.M527K	PDE10A_ENST00000354448.4_Missense_Mutation_p.M527K|PDE10A_ENST00000539869.2_Missense_Mutation_p.M537K			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A	527					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)	p.M527K(1)		breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	TATGGCATACATGCAGTGTGC	0.443																																					Esophageal Squamous(22;308 615 5753 12038 40624)	Esophageal Squamous(22;308 615 5753 12038 40624)	uc003qun.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)	5						c.(1579-1581)ATG>AAG		phosphodiesterase 10A isoform 2	Dipyridamole(DB00975)						192.0	145.0	161.0					6																	165806181		2203	4300	6503	SO:0001583	missense	10846				platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cAMP binding|cGMP binding|metal ion binding	g.chr6:165806181A>T	AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000366882.1:c.1580T>A	6.37:g.165806181A>T	ENSP00000355847:p.Met527Lys					PDE10A_uc011egj.1_RNA|PDE10A_uc011egk.1_Missense_Mutation_p.M457K|PDE10A_uc003quo.2_Missense_Mutation_p.M537K	p.M527K	NM_006661	NP_006652	Q9Y233	PDE10_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	17	1821	-		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)	527					Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	Missense_Mutation	SNP	ENST00000366882.1	37	c.1580T>A		.	.	.	.	.	.	.	.	.	.	A	20.5	4.000644	0.74818	.	.	ENSG00000112541	ENST00000366882;ENST00000539869;ENST00000343842;ENST00000354448;ENST00000392126	T;T	0.78246	-1.16;-1.16	5.43	5.43	0.79202	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.036168	0.85682	D	0.000000	D	0.88157	0.6361	M	0.89968	3.075	0.80722	D	1	D;D	0.60160	0.978;0.987	D;D	0.70935	0.971;0.948	D	0.90856	0.4735	10	0.87932	D	0	.	15.5012	0.75700	1.0:0.0:0.0:0.0	.	537;527	Q9ULW9;Q9Y233	.;PDE10_HUMAN	K	527;555;537;527;526	ENSP00000355847:M527K;ENSP00000346435:M527K	ENSP00000341187:M537K	M	-	2	0	PDE10A	165726171	1.000000	0.71417	1.000000	0.80357	0.614000	0.37383	8.584000	0.90798	2.058000	0.61347	0.477000	0.44152	ATG		0.443	PDE10A-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000043031.1			8	29	0	0	0	0.008291	0	8	29				
MMD2	221938	broad.mit.edu	37	7	4949568	4949568	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr7:4949568C>T	ENST00000404774.3	-	6	747	c.553G>A	c.(553-555)Gag>Aag	p.E185K	MMD2_ENST00000406755.1_Missense_Mutation_p.E161K|MMD2_ENST00000401401.3_Missense_Mutation_p.E161K	NM_001100600.1	NP_001094070.1	Q8IY49	PAQRA_HUMAN	monocyte to macrophage differentiation-associated 2	185						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)		p.E161K(1)|p.E185K(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(11)	14		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.097)|OV - Ovarian serous cystadenocarcinoma(56;3.4e-14)		CAGAGAAGCTCCACAAGCTTG	0.577																																							uc003sno.3		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(1)	1						c.(553-555)GAG>AAG		monocyte to macrophage							67.0	73.0	71.0					7																	4949568		2039	4185	6224	SO:0001583	missense	221938					integral to membrane	receptor activity	g.chr7:4949568C>T	BC037881	CCDS47529.1, CCDS47530.1, CCDS59047.1	7p22	2004-06-23			ENSG00000136297	ENSG00000136297			30133	protein-coding gene	gene with protein product		614581				12477932	Standard	NM_198403		Approved	PAQR10	uc003sno.4	Q8IY49	OTTHUMG00000151844	ENST00000404774.3:c.553G>A	7.37:g.4949568C>T	ENSP00000384690:p.Glu185Lys					MMD2_uc003snl.1_RNA|MMD2_uc003snn.3_Missense_Mutation_p.E161K|MMD2_uc010ksq.2_Missense_Mutation_p.E161K	p.E185K	NM_001100600	NP_001094070	Q8IY49	PAQRA_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.097)|OV - Ovarian serous cystadenocarcinoma(56;3.4e-14)	6	749	-		Ovarian(82;0.0175)	185			Helical; (Potential).		B5MBW4|Q6NVU5|Q6TCH0	Missense_Mutation	SNP	ENST00000404774.3	37	c.553G>A	CCDS47529.1	.	.	.	.	.	.	.	.	.	.	C	36	5.662036	0.96734	.	.	ENSG00000136297	ENST00000404774;ENST00000406755;ENST00000401401	T;T;T	0.29655	1.56;1.56;1.56	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.62768	0.2455	M	0.87900	2.915	0.80722	D	1	P;D;D	0.67145	0.88;0.996;0.995	P;D;D	0.70016	0.843;0.967;0.944	T	0.68044	-0.5513	10	0.72032	D	0.01	-35.5854	18.9249	0.92540	0.0:1.0:0.0:0.0	.	161;185;161	B5MBW4;Q8IY49;Q8IY49-2	.;PAQRA_HUMAN;.	K	185;161;161	ENSP00000384690:E185K;ENSP00000385963:E161K;ENSP00000384141:E161K	ENSP00000384141:E161K	E	-	1	0	MMD2	4916094	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	7.686000	0.84128	2.704000	0.92352	0.644000	0.83932	GAG		0.577	MMD2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324136.1	NM_198403		20	20	0	0	0	0.012319	0	20	20				
HDAC9	9734	broad.mit.edu	37	7	18625111	18625111	+	Missense_Mutation	SNP	G	G	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr7:18625111G>T	ENST00000432645.2	+	2	230	c.230G>T	c.(229-231)cGg>cTg	p.R77L	HDAC9_ENST00000441542.2_Missense_Mutation_p.R77L|HDAC9_ENST00000524023.1_Missense_Mutation_p.R46L|HDAC9_ENST00000405010.3_Missense_Mutation_p.R77L|HDAC9_ENST00000456174.2_Missense_Mutation_p.R46L|HDAC9_ENST00000476135.1_3'UTR|HDAC9_ENST00000428307.2_Missense_Mutation_p.R77L|HDAC9_ENST00000406451.4_Missense_Mutation_p.R77L|HDAC9_ENST00000401921.1_Missense_Mutation_p.R77L|HDAC9_ENST00000417496.2_Missense_Mutation_p.R119L|HDAC9_ENST00000406072.1_Missense_Mutation_p.R105L	NM_058176.2	NP_478056.1	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9	77					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|regulation of skeletal muscle fiber development (GO:0048742)|regulation of striated muscle cell differentiation (GO:0051153)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|histone methyltransferase complex (GO:0035097)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.R77L(3)|p.R119L(1)		breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|liver(2)|lung(37)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	82	all_lung(11;0.187)				Valproic Acid(DB00313)	AACTTGACACGGCAGCACCAG	0.483																																							uc003suh.2		NA																	4	Substitution - Missense(4)		lung(4)	lung(2)|central_nervous_system(2)|kidney(1)	5						c.(229-231)CGG>CTG		histone deacetylase 9 isoform 1	Valproic Acid(DB00313)						47.0	49.0	48.0					7																	18625111		2098	4232	6330	SO:0001583	missense	9734				B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|transcription corepressor activity	g.chr7:18625111G>T	AF124924	CCDS47553.1, CCDS47554.1, CCDS47555.1, CCDS47557.1, CCDS56465.1, CCDS56466.1, CCDS56467.1, CCDS56468.1, CCDS75565.1	7p21.1	2008-05-15			ENSG00000048052	ENSG00000048052			14065	protein-coding gene	gene with protein product		606543				10523670, 10487760	Standard	NM_178425		Approved	KIAA0744, HDAC, MITR, HD7, HDAC7B	uc003sui.3	Q9UKV0	OTTHUMG00000152487	ENST00000432645.2:c.230G>T	7.37:g.18625111G>T	ENSP00000410337:p.Arg77Leu					HDAC9_uc003sue.2_Missense_Mutation_p.R77L|HDAC9_uc011jyd.1_Missense_Mutation_p.R77L|HDAC9_uc003sui.2_Missense_Mutation_p.R77L|HDAC9_uc003suj.2_Missense_Mutation_p.R77L|HDAC9_uc011jya.1_Missense_Mutation_p.R118L|HDAC9_uc003sua.1_Missense_Mutation_p.R96L|HDAC9_uc011jyb.1_Missense_Mutation_p.R77L|HDAC9_uc003sud.1_Missense_Mutation_p.R77L|HDAC9_uc011jyc.1_Missense_Mutation_p.R77L|HDAC9_uc003suf.1_Missense_Mutation_p.R105L|HDAC9_uc010kud.1_Missense_Mutation_p.R77L|HDAC9_uc011jye.1_Missense_Mutation_p.R46L|HDAC9_uc011jyf.1_Missense_Mutation_p.R46L	p.R77L	NM_058176	NP_478056	Q9UKV0	HDAC9_HUMAN			2	271	+	all_lung(11;0.187)		77					A7E2F3|B7Z4I4|B7Z917|B7Z928|B7Z940|C9JS87|E7EX34|F8W9E0|O94845|O95028|Q2M2R6|Q86SL1|Q86US3	Missense_Mutation	SNP	ENST00000432645.2	37	c.230G>T	CCDS47555.1	.	.	.	.	.	.	.	.	.	.	G	35	5.481910	0.96307	.	.	ENSG00000048052	ENST00000417496;ENST00000262069;ENST00000413509;ENST00000413380;ENST00000430454;ENST00000405010;ENST00000406451;ENST00000428307;ENST00000406072;ENST00000401921;ENST00000432645;ENST00000441542;ENST00000441986;ENST00000456174;ENST00000524023;ENST00000341009	T;T;T;T;T;T;T;T;T;T;T;T;T	0.61392	0.63;0.13;0.33;0.71;0.22;0.7;0.59;0.11;0.22;0.17;0.28;0.69;0.73	5.71	5.71	0.89125	Histone deacetylase, glutamine rich N-terminal domain (1);	0.000000	0.51477	D	0.000086	T	0.75532	0.3862	M	0.72894	2.215	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;0.997;1.0;1.0;1.0;0.999;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D	0.97110	0.998;0.999;0.998;1.0;0.998;0.995;0.998;0.998;0.999;0.997;0.998;0.998;0.999	T	0.69811	-0.5044	10	0.23891	T	0.37	-16.2672	19.8505	0.96738	0.0:0.0:1.0:0.0	.	46;46;77;105;119;77;77;77;77;46;77;77;96	E7EX34;C9JS87;Q9UKV0-4;B5MCF1;B7Z917;Q68D71;Q9UKV0-6;Q9UKV0-7;Q9UKV0;B7Z928;Q9UKV0-5;Q9UKV0-3;Q8N879	.;.;.;.;.;.;.;.;HDAC9_HUMAN;.;.;.;.	L	119;122;77;77;46;77;77;77;105;77;77;77;46;46;46;77	ENSP00000401669:R119L;ENSP00000412497:R77L;ENSP00000392564:R77L;ENSP00000384382:R77L;ENSP00000384657:R77L;ENSP00000395655:R77L;ENSP00000384017:R105L;ENSP00000383912:R77L;ENSP00000410337:R77L;ENSP00000408617:R77L;ENSP00000404763:R46L;ENSP00000388568:R46L;ENSP00000430036:R46L	ENSP00000262069:R122L	R	+	2	0	HDAC9	18591636	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.869000	0.99810	2.688000	0.91661	0.655000	0.94253	CGG		0.483	HDAC9-023	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376176.1			19	20	1	0	5.35267e-07	0.007413	6.17131e-07	19	20				
PKD1L1	168507	broad.mit.edu	37	7	47976473	47976473	+	Missense_Mutation	SNP	G	G	T	rs370336893		TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr7:47976473G>T	ENST00000289672.2	-	4	418	c.368C>A	c.(367-369)gCg>gAg	p.A123E		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	123					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.A123E(1)	BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						ATCCAGAGGCGCCTGTGTTTT	0.348																																							uc003tny.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|upper_aerodigestive_tract(2)|breast(1)	11						c.(367-369)GCG>GAG		polycystin-1L1							136.0	138.0	137.0					7																	47976473		2202	4300	6502	SO:0001583	missense	168507				cell-cell adhesion	integral to membrane		g.chr7:47976473G>T	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.368C>A	7.37:g.47976473G>T	ENSP00000289672:p.Ala123Glu						p.A123E	NM_138295	NP_612152	Q8TDX9	PK1L1_HUMAN			4	368	-			123			Extracellular (Potential).		Q6UWK1	Missense_Mutation	SNP	ENST00000289672.2	37	c.368C>A	CCDS34633.1	.	.	.	.	.	.	.	.	.	.	G	9.211	1.030856	0.19590	.	.	ENSG00000158683	ENST00000289672	T	0.24350	1.86	3.22	1.41	0.22369	.	.	.	.	.	T	0.12433	0.0302	N	0.08118	0	0.09310	N	1	P	0.46656	0.882	B	0.41412	0.356	T	0.11348	-1.0591	9	0.59425	D	0.04	-0.6164	5.5027	0.16836	0.2622:0.0:0.7378:0.0	.	123	Q8TDX9	PK1L1_HUMAN	E	123	ENSP00000289672:A123E	ENSP00000289672:A123E	A	-	2	0	PKD1L1	47942998	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.620000	0.02046	0.387000	0.25024	-0.252000	0.11476	GCG		0.348	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295		28	84	1	0	1.39806e-14	0.008361	2.01484e-14	28	84				
EGFR	1956	broad.mit.edu	37	7	55259441	55259441	+	Missense_Mutation	SNP	G	G	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr7:55259441G>T	ENST00000275493.2	+	21	2676	c.2499G>T	c.(2497-2499)ttG>ttT	p.L833F	EGFR-AS1_ENST00000442411.1_RNA|EGFR_ENST00000442591.1_Intron|EGFR_ENST00000455089.1_Missense_Mutation_p.L788F|EGFR_ENST00000454757.2_Missense_Mutation_p.L780F	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	833	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		L -> V (found in a lung cancer sample; more sensitive to gefitinib than wild- type). {ECO:0000269|PubMed:15623594, ECO:0000269|PubMed:16533793}.		activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)	p.L833F(2)		NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	ACCGTCGCTTGGTGCACCGCG	0.547		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																													uc003tqk.2		8	yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	A|O|Mis	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""			"""E, O"""		NSCLC	glioma|NSCLC		2	Substitution - Missense(2)	p.L833V(18)	lung(2)	lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571						c.(2497-2499)TTG>TTT		epidermal growth factor receptor isoform a	Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)						113.0	97.0	102.0					7																	55259441		2203	4300	6503	SO:0001583	missense	1956	Lung_Cancer_Familial_Clustering_of	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer	activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	g.chr7:55259441G>T		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.2499G>T	7.37:g.55259441G>T	ENSP00000275493:p.Leu833Phe	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)				EGFR_uc010kzg.1_Missense_Mutation_p.L788F|EGFR_uc011kco.1_Missense_Mutation_p.L780F|uc003tqo.2_5'Flank	p.L833F	NM_005228	NP_005219	P00533	EGFR_HUMAN	GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		21	2745	+	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		833		L -> V (found in a lung cancer sample).	Cytoplasmic (Potential).|Protein kinase.		O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Missense_Mutation	SNP	ENST00000275493.2	37	c.2499G>T	CCDS5514.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.437698	0.83885	.	.	ENSG00000146648	ENST00000455089;ENST00000395504;ENST00000275493;ENST00000454757	T;T;T	0.62788	0.0;0.0;0.0	5.82	5.82	0.92795	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.57562	0.2062	N	0.01289	-0.905	0.58432	D	0.999999	P;D	0.89917	0.903;1.0	B;D	0.87578	0.335;0.998	T	0.75628	-0.3252	10	0.87932	D	0	.	18.6604	0.91470	0.0:0.0:1.0:0.0	.	788;833	Q504U8;P00533	.;EGFR_HUMAN	F	788;703;833;780	ENSP00000415559:L788F;ENSP00000275493:L833F;ENSP00000395243:L780F	ENSP00000275493:L833F	L	+	3	2	EGFR	55226935	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.010000	0.57117	2.751000	0.94390	0.650000	0.86243	TTG		0.547	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228		17	49	1	0	1.5739e-10	0.004007	2.05656e-10	17	49				
EGFR	1956	broad.mit.edu	37	7	55259524	55259524	+	Missense_Mutation	SNP	T	T	A	rs121913444		TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr7:55259524T>A	ENST00000275493.2	+	21	2759	c.2582T>A	c.(2581-2583)cTg>cAg	p.L861Q	EGFR-AS1_ENST00000442411.1_RNA|EGFR_ENST00000442591.1_Intron|EGFR_ENST00000455089.1_Missense_Mutation_p.L816Q|EGFR_ENST00000454757.2_Missense_Mutation_p.L808Q	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	861	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		L -> Q (found in a lung cancer sample; constitutively activated kinase with higher levels of basal autophosphorylation; more sensitive to gefitinib than wild-type; dbSNP:rs121913444). {ECO:0000269|PubMed:15623594, ECO:0000269|PubMed:16533793}.		activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)	p.L861Q(53)|p.L861R(6)		NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	CTGGCCAAACTGCTGGGTGCG	0.557		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																													uc003tqk.2		8	yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	A|O|Mis	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""			"""E, O"""		NSCLC	glioma|NSCLC		59	Substitution - Missense(59)	p.L861Q(96)|p.L861R(10)|p.A859_L883>V(2)|p.L861F(1)|p.L861V(1)|p.L861P(1)	lung(57)|upper_aerodigestive_tract(1)|central_nervous_system(1)	lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571						c.(2581-2583)CTG>CAG		epidermal growth factor receptor isoform a	Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)						102.0	96.0	98.0					7																	55259524		2203	4300	6503	SO:0001583	missense	1956	Lung_Cancer_Familial_Clustering_of	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer	activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	g.chr7:55259524T>A		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.2582T>A	7.37:g.55259524T>A	ENSP00000275493:p.Leu861Gln	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)				EGFR_uc010kzg.1_Missense_Mutation_p.L816Q|EGFR_uc011kco.1_Missense_Mutation_p.L808Q|uc003tqo.2_5'Flank	p.L861Q	NM_005228	NP_005219	P00533	EGFR_HUMAN	GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		21	2828	+	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		861		L -> Q (found in a lung cancer sample).	Cytoplasmic (Potential).|Protein kinase.		O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Missense_Mutation	SNP	ENST00000275493.2	37	c.2582T>A	CCDS5514.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.955260	0.73902	.	.	ENSG00000146648	ENST00000455089;ENST00000395504;ENST00000275493;ENST00000454757	D;D;D	0.82255	-1.59;-1.59;-1.59	5.82	5.82	0.92795	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.85513	0.5714	N	0.25332	0.735	0.58432	D	0.999998	P;D	0.76494	0.481;0.999	B;D	0.71414	0.287;0.973	D	0.87493	0.2428	10	0.87932	D	0	.	15.0046	0.71501	0.0:0.0:0.0:1.0	.	816;861	Q504U8;P00533	.;EGFR_HUMAN	Q	816;731;861;808	ENSP00000415559:L816Q;ENSP00000275493:L861Q;ENSP00000395243:L808Q	ENSP00000275493:L861Q	L	+	2	0	EGFR	55227018	1.000000	0.71417	0.971000	0.41717	0.664000	0.39144	7.911000	0.87458	2.221000	0.72209	0.528000	0.53228	CTG		0.557	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228		16	54	0	0	0	0.00499	0	16	54				
FKBP9P1	360132	broad.mit.edu	37	7	55759185	55759185	+	RNA	SNP	G	G	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr7:55759185G>A	ENST00000455909.1	-	0	0					NR_027340.1|NR_027342.1		Q75LS8	FKB9L_HUMAN							protein folding (GO:0006457)		calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5						GCCAAGCTGGGGATATTCCCT	0.557																																							uc010kzl.2		NA																	0					0						c.(97-99)CCC>TCC		SubName: Full=cDNA, FLJ79189, highly similar to FK506-binding protein 9 (EC 5.2.1.8);																																						360132							g.chr7:55759185G>A																													7.37:g.55759185G>A						FKBP9L_uc003tqt.2_5'Flank|FKBP9L_uc011kcs.1_5'Flank	p.P33S	NR_003949						3	197	-								B2R7H1	Missense_Mutation	SNP	ENST00000455909.1	37	c.97C>T																																																																																					0.557	FKBP9L-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000251473.2			12	25	0	0	0	0.013537	0	12	25				
AUTS2	26053	broad.mit.edu	37	7	69364318	69364318	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr7:69364318C>T	ENST00000342771.4	+	2	677	c.356C>T	c.(355-357)aCg>aTg	p.T119M	AUTS2_ENST00000406775.2_Missense_Mutation_p.T119M|AUTS2_ENST00000403018.2_Missense_Mutation_p.T119M	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	119								p.T119M(1)		breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		AAACGCCAGACGCCCCTGACC	0.478																																							uc003tvw.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(355-357)ACG>ATG		autism susceptibility candidate 2 isoform 1							99.0	91.0	94.0					7																	69364318		2203	4300	6503	SO:0001583	missense	26053							g.chr7:69364318C>T	AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.356C>T	7.37:g.69364318C>T	ENSP00000344087:p.Thr119Met					AUTS2_uc003tvv.3_Missense_Mutation_p.T119M|AUTS2_uc003tvx.3_Missense_Mutation_p.T119M	p.T119M	NM_015570	NP_056385	Q8WXX7	AUTS2_HUMAN		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)	2	1099	+		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)	119					A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Missense_Mutation	SNP	ENST00000342771.4	37	c.356C>T	CCDS5539.1	.	.	.	.	.	.	.	.	.	.	C	17.17	3.322260	0.60634	.	.	ENSG00000158321	ENST00000406775;ENST00000342771;ENST00000403018	T;T	0.30981	1.51;1.51	5.65	3.7	0.42460	.	0.208514	0.33401	N	0.004947	T	0.28366	0.0701	N	0.08118	0	0.20764	N	0.999859	P;P;D	0.76494	0.851;0.851;0.999	P;P;P	0.59288	0.502;0.502;0.855	T	0.18241	-1.0343	9	.	.	.	-9.4281	13.891	0.63738	0.3535:0.6465:0.0:0.0	.	119;119;119	Q8WXX7-2;Q8WXX7;Q6PJU5	.;AUTS2_HUMAN;.	M	119	ENSP00000385263:T119M;ENSP00000344087:T119M	.	T	+	2	0	AUTS2	69002254	0.885000	0.30320	1.000000	0.80357	0.944000	0.59088	1.548000	0.36201	1.601000	0.50113	0.655000	0.94253	ACG		0.478	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251971.2			20	45	0	0	0	0.007413	0	20	45				
PCLO	27445	broad.mit.edu	37	7	82579138	82579138	+	Missense_Mutation	SNP	T	T	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr7:82579138T>A	ENST00000333891.9	-	6	11103	c.10766A>T	c.(10765-10767)gAc>gTc	p.D3589V	PCLO_ENST00000423517.2_Missense_Mutation_p.D3589V|PCLO_ENST00000437081.1_Missense_Mutation_p.D309V	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.D3589V(2)|p.D3520V(1)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						GCGTTTCTTGTCTTTGGGTGG	0.483																																							uc003uhx.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(7)	7						c.(10765-10767)GAC>GTC		piccolo isoform 1							146.0	144.0	144.0					7																	82579138		2078	4211	6289	SO:0001583	missense	27445				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity	g.chr7:82579138T>A	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.10766A>T	7.37:g.82579138T>A	ENSP00000334319:p.Asp3589Val					PCLO_uc003uhv.2_Missense_Mutation_p.D3589V|PCLO_uc010lec.2_Missense_Mutation_p.D554V	p.D3589V	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN			6	11055	-			3520						Missense_Mutation	SNP	ENST00000333891.9	37	c.10766A>T	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	T	16.14	3.039472	0.55003	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517;ENST00000437081	T;T	0.20332	2.08;2.08	5.71	5.71	0.89125	.	.	.	.	.	T	0.43831	0.1265	L	0.56769	1.78	0.80722	D	1	D;D;D	0.76494	0.997;0.999;0.999	D;D;D	0.73708	0.923;0.956;0.981	T	0.35051	-0.9804	9	0.87932	D	0	.	15.9908	0.80202	0.0:0.0:0.0:1.0	.	3520;3589;3589	Q9Y6V0;Q9Y6V0-5;Q9Y6V0-6	PCLO_HUMAN;.;.	V	3520;3589;3589;309	ENSP00000334319:D3589V;ENSP00000388393:D3589V	ENSP00000334319:D3589V	D	-	2	0	PCLO	82417074	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.797000	0.62503	2.179000	0.69175	0.528000	0.53228	GAC		0.483	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510		33	24	0	0	0	0.009535	0	33	24				
LAMB4	22798	broad.mit.edu	37	7	107710286	107710286	+	Missense_Mutation	SNP	G	G	C			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr7:107710286G>C	ENST00000388781.3	-	18	2252	c.2169C>G	c.(2167-2169)agC>agG	p.S723R	LAMB4_ENST00000205386.4_Missense_Mutation_p.S723R|LAMB4_ENST00000388780.3_Missense_Mutation_p.S723R	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	723	Laminin IV type B. {ECO:0000255|PROSITE- ProRule:PRU00462}.				cell adhesion (GO:0007155)	basement membrane (GO:0005604)		p.S723R(1)		NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						AGTCCTGCTTGCTGCAGAAAT	0.428																																							uc010ljo.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|breast(2)|large_intestine(1)|skin(1)	8						c.(2167-2169)AGC>AGG		laminin, beta 4 precursor							116.0	115.0	115.0					7																	107710286		2203	4300	6503	SO:0001583	missense	22798				cell adhesion	basement membrane		g.chr7:107710286G>C	AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.2169C>G	7.37:g.107710286G>C	ENSP00000373433:p.Ser723Arg					LAMB4_uc003vey.2_Missense_Mutation_p.S723R	p.S723R	NM_007356	NP_031382	A4D0S4	LAMB4_HUMAN			18	2253	-			723			Laminin IV type B.		A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Missense_Mutation	SNP	ENST00000388781.3	37	c.2169C>G	CCDS34732.1	.	.	.	.	.	.	.	.	.	.	G	15.54	2.862499	0.51482	.	.	ENSG00000091128	ENST00000205386;ENST00000388781;ENST00000388780	T;T;T	0.32272	1.46;1.46;1.48	4.93	3.97	0.46021	Laminin IV (1);	0.217733	0.32655	N	0.005812	T	0.36413	0.0966	L	0.57536	1.79	0.29849	N	0.828626	D	0.54397	0.966	P	0.48030	0.564	T	0.39820	-0.9595	10	0.66056	D	0.02	.	12.6953	0.56999	0.1364:0.0:0.8636:0.0	.	723	A4D0S4	LAMB4_HUMAN	R	723	ENSP00000205386:S723R;ENSP00000373433:S723R;ENSP00000373432:S723R	ENSP00000205386:S723R	S	-	3	2	LAMB4	107497522	0.077000	0.21312	0.985000	0.45067	0.793000	0.44817	-0.054000	0.11826	2.558000	0.86282	0.561000	0.74099	AGC		0.428	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337442.1	XM_209857		44	57	0	0	0	0.01441	0	44	57				
KEL	3792	broad.mit.edu	37	7	142649603	142649603	+	Missense_Mutation	SNP	G	G	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr7:142649603G>T	ENST00000355265.2	-	10	1670	c.1196C>A	c.(1195-1197)cCa>cAa	p.P399Q	KEL_ENST00000479768.2_5'UTR	NM_000420.2	NP_000411.1	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	399					vasoconstriction (GO:0042310)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.P399Q(1)		central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(34)|ovary(3)|prostate(2)|skin(1)	60	Melanoma(164;0.059)					CACCATGGGTGGTTGCTCTGT	0.542																																							uc003wcb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(1)	4						c.(1195-1197)CCA>CAA		Kell blood group, metallo-endopeptidase							138.0	118.0	125.0					7																	142649603		2203	4300	6503	SO:0001583	missense	3792				proteolysis|vasoconstriction	integral to membrane|plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding	g.chr7:142649603G>T	BC003135	CCDS34766.1	7q33	2014-07-19	2006-10-10		ENSG00000197993	ENSG00000197993		"""CD molecules"", ""Blood group antigens"""	6308	protein-coding gene	gene with protein product		613883	"""Kell blood group"", ""Kell blood group, metalloendopeptidase"""			1712490, 7683930	Standard	NM_000420		Approved	ECE3, CD238	uc003wcb.3	P23276	OTTHUMG00000157159	ENST00000355265.2:c.1196C>A	7.37:g.142649603G>T	ENSP00000347409:p.Pro399Gln						p.P399Q	NM_000420	NP_000411	P23276	KELL_HUMAN			10	1406	-	Melanoma(164;0.059)		399			Extracellular (Potential).		B2RBV4|Q96RS8|Q99885	Missense_Mutation	SNP	ENST00000355265.2	37	c.1196C>A	CCDS34766.1	.	.	.	.	.	.	.	.	.	.	G	18.53	3.643686	0.67244	.	.	ENSG00000197993	ENST00000355265	T	0.74002	-0.8	5.28	5.28	0.74379	Peptidase M13 (1);	0.504521	0.18493	N	0.139593	D	0.82701	0.5094	M	0.63428	1.95	0.21325	N	0.999726	D	0.69078	0.997	D	0.65874	0.939	T	0.74222	-0.3735	10	0.39692	T	0.17	-5.82	14.2962	0.66316	0.0:0.0:1.0:0.0	.	399	P23276	KELL_HUMAN	Q	399	ENSP00000347409:P399Q	ENSP00000347409:P399Q	P	-	2	0	KEL	142359725	0.515000	0.26210	0.399000	0.26333	0.972000	0.66771	1.880000	0.39628	2.746000	0.94184	0.655000	0.94253	CCA		0.542	KEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347671.2	NM_000420		21	53	1	0	4.59853e-10	0.005443	5.77764e-10	21	53				
CASP2	835	broad.mit.edu	37	7	143001797	143001797	+	Missense_Mutation	SNP	G	G	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr7:143001797G>T	ENST00000310447.5	+	10	1389	c.1148G>T	c.(1147-1149)gGt>gTt	p.G383V	CASP2_ENST00000493642.1_3'UTR	NM_032982.3|NM_032983.3	NP_116764.2|NP_116765.2	P42575	CASP2_HUMAN	caspase 2, apoptosis-related cysteine peptidase	383					aging (GO:0007568)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|brain development (GO:0007420)|cellular response to mechanical stimulus (GO:0071260)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|ectopic germ cell programmed cell death (GO:0035234)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|luteolysis (GO:0001554)|neural retina development (GO:0003407)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of neuron apoptotic process (GO:0043525)|protein processing (GO:0016485)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)	p.G383V(1)		endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)	21	Melanoma(164;0.059)					ACCAAACGAGGTTCCTGGTAC	0.547																																							uc003wco.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|ovary(1)	3						c.(1147-1149)GGT>GTT		caspase 2 isoform 1 preproprotein							182.0	155.0	164.0					7																	143001797		2203	4300	6503	SO:0001583	missense	835				apoptosis|cellular response to mechanical stimulus|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|protein maturation by peptide bond cleavage	cytosol	cysteine-type endopeptidase activity|enzyme binding|protein binding|protein domain specific binding	g.chr7:143001797G>T	AK096245, BC002427, BM998653, BX537669, CB988674, U13021	CCDS5879.1, CCDS47733.1	7q34-q35	2014-01-20	2008-08-01		ENSG00000106144	ENSG00000106144		"""Caspases"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1503	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 57"""	600639	"""neural precursor cell expressed, developmentally down-regulated 2"""	NEDD2		7789948, 8780721	Standard	NM_032982		Approved	ICH1, PPP1R57, MGC2181	uc003wco.3	P42575	OTTHUMG00000023641	ENST00000310447.5:c.1148G>T	7.37:g.143001797G>T	ENSP00000312664:p.Gly383Val					CASP2_uc003wcp.2_3'UTR|CASP2_uc011kta.1_Missense_Mutation_p.G267V|CASP2_uc003wcq.2_RNA|CASP2_uc011ktb.1_Missense_Mutation_p.G133V	p.G383V	NM_032982	NP_116764	P42575	CASP2_HUMAN			10	1295	+	Melanoma(164;0.059)		383					A8K5F9|D3DXD6|E9PDN0|P42576|Q59F21|Q7KZL6|Q86UJ3|Q9BUP7|Q9BZK9|Q9BZL0	Missense_Mutation	SNP	ENST00000310447.5	37	c.1148G>T	CCDS5879.1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.000468	0.93227	.	.	ENSG00000106144	ENST00000310447	T	0.40756	1.02	5.28	5.28	0.74379	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase non-catalytic subunit p10 (1);Peptidase C14, caspase precursor p45, core (2);	0.000000	0.85682	D	0.000000	T	0.77698	0.4169	H	0.96691	3.865	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85863	0.1411	10	0.87932	D	0	.	18.9691	0.92708	0.0:0.0:1.0:0.0	.	383	P42575	CASP2_HUMAN	V	383	ENSP00000312664:G383V	ENSP00000312664:G383V	G	+	2	0	CASP2	142711919	1.000000	0.71417	0.997000	0.53966	0.986000	0.74619	9.256000	0.95535	2.480000	0.83734	0.644000	0.83932	GGT		0.547	CASP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059962.3	NM_032982		58	71	1	0	2.89935e-36	0.01441	4.73561e-36	58	71				
OR2A14	135941	broad.mit.edu	37	7	143826473	143826473	+	Missense_Mutation	SNP	A	A	G			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr7:143826473A>G	ENST00000408899.2	+	1	323	c.268A>G	c.(268-270)Acc>Gcc	p.T90A		NM_001001659.1	NP_001001659.1	Q96R47	O2A14_HUMAN	olfactory receptor, family 2, subfamily A, member 14	90						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T90A(1)		large_intestine(4)|lung(17)|skin(1)	22	Melanoma(164;0.0783)					CCAGGAAAGCACCATCTCCTT	0.438																																							uc011kua.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(268-270)ACC>GCC		olfactory receptor, family 2, subfamily A,							304.0	284.0	291.0					7																	143826473		2102	4241	6343	SO:0001583	missense	135941				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:143826473A>G		CCDS43672.1	7q35	2013-09-20		2004-03-08	ENSG00000221938	ENSG00000221938		"""GPCR / Class A : Olfactory receptors"""	15084	protein-coding gene	gene with protein product				OR2A14P, OR2A6			Standard	NM_001001659		Approved	OST182	uc011kua.2	Q96R47	OTTHUMG00000158003	ENST00000408899.2:c.268A>G	7.37:g.143826473A>G	ENSP00000386137:p.Thr90Ala						p.T90A	NM_001001659	NP_001001659	Q96R47	O2A14_HUMAN			1	268	+	Melanoma(164;0.0783)		90			Extracellular (Potential).		Q6IF41|Q8NGT8	Missense_Mutation	SNP	ENST00000408899.2	37	c.268A>G	CCDS43672.1	.	.	.	.	.	.	.	.	.	.	A	2.304	-0.359463	0.05138	.	.	ENSG00000221938	ENST00000408899	T	0.00572	6.49	4.18	-1.48	0.08745	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00580	0.0019	L	0.43923	1.385	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.41378	-0.9512	9	0.52906	T	0.07	-13.4871	4.8605	0.13581	0.519:0.2972:0.1837:0.0	.	90	Q96R47	O2A14_HUMAN	A	90	ENSP00000386137:T90A	ENSP00000386137:T90A	T	+	1	0	OR2A14	143457406	0.000000	0.05858	0.236000	0.24074	0.018000	0.09664	-1.292000	0.02772	-0.039000	0.13602	-0.411000	0.06167	ACC		0.438	OR2A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349980.1			54	202	0	0	0	0.01441	0	54	202				
SSPO	23145	broad.mit.edu	37	7	149482801	149482801	+	RNA	SNP	G	G	C			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr7:149482801G>C	ENST00000378016.2	+	0	3217							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CGTGCGTCTGGAGGGCACTGT	0.622																																							uc010lpk.2		NA																	0					0						c.(3217-3219)GAG>CAG		SCO-spondin precursor							21.0	24.0	23.0					7																	149482801		2151	4245	6396			23145				cell adhesion	extracellular space	peptidase inhibitor activity	g.chr7:149482801G>C	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149482801G>C						SSPO_uc010lpl.1_Intron	p.E1073Q	NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00625)		22	3217	+	Melanoma(164;0.165)|Ovarian(565;0.177)		1073			VWFD 3.		Q76B61	Missense_Mutation	SNP	ENST00000378016.2	37	c.3217G>C																																																																																					0.622	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript				5	6	0	0	0	0.001168	0	5	6				
ABCB8	11194	broad.mit.edu	37	7	150739111	150739111	+	Missense_Mutation	SNP	G	G	A	rs144722322		TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr7:150739111G>A	ENST00000297504.6	+	15	1798	c.1732G>A	c.(1732-1734)Gat>Aat	p.D578N	ABCB8_ENST00000542328.1_Missense_Mutation_p.D473N|ABCB8_ENST00000358849.4_Missense_Mutation_p.D561N|ABCB8_ENST00000356058.4_3'UTR|ABCB8_ENST00000498578.1_Missense_Mutation_p.D561N			Q9NUT2	ABCB8_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 8	578	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)	p.D561N(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	26			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Doxorubicin(DB00997)	GGAAGCTTCCGATGAAGAGGT	0.577													G|||	1	0.000199681	0.0	0.0	5008	,	,		19175	0.0		0.001	False		,,,				2504	0.0						uc003wil.3		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)|upper_aerodigestive_tract(1)	3						c.(1732-1734)GAT>AAT		ATP-binding cassette, sub-family B, member 8		G	ASN/ASP	0,4406		0,0,2203	61.0	63.0	63.0		1681	4.0	0.3	7	dbSNP_134	63	6,8594	5.0+/-18.6	0,6,4294	yes	missense	ABCB8	NM_007188.3	23	0,6,6497	AA,AG,GG		0.0698,0.0,0.0461	possibly-damaging	561/719	150739111	6,13000	2203	4300	6503	SO:0001583	missense	11194					ATP-binding cassette (ABC) transporter complex|integral to membrane|membrane fraction|mitochondrial inner membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances	g.chr7:150739111G>A	AF047690	CCDS5913.1, CCDS64798.1, CCDS64799.1, CCDS64800.1	7q36.1	2012-05-16			ENSG00000197150	ENSG00000197150		"""ATP binding cassette transporters / subfamily B"""	49	protein-coding gene	gene with protein product	"""mitochondrial ABC protein"""	605464				8894702	Standard	NM_001282291		Approved	EST328128, M-ABC1, MABC1	uc003wik.4	Q9NUT2	OTTHUMG00000158686	ENST00000297504.6:c.1732G>A	7.37:g.150739111G>A	ENSP00000297504:p.Asp578Asn					ABCB8_uc010lpw.1_3'UTR|ABCB8_uc010lpx.2_Missense_Mutation_p.D561N|ABCB8_uc011kvd.1_Missense_Mutation_p.D473N|ABCB8_uc003wim.3_Missense_Mutation_p.D356N|ABCB8_uc003wik.3_Missense_Mutation_p.D561N	p.D578N	NM_007188	NP_009119	Q9NUT2	ABCB8_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	15	1825	+			578			ABC transporter.		A5D8W3|B2RBL8|B3KND2|B4DG02|G3XAP3|O95787|Q53GM0	Missense_Mutation	SNP	ENST00000297504.6	37	c.1732G>A		.	.	.	.	.	.	.	.	.	.	G	16.31	3.087583	0.55968	0.0	6.98E-4	ENSG00000197150	ENST00000358849;ENST00000360651;ENST00000297504;ENST00000542328;ENST00000498578	D;D;D;D	0.91124	-2.79;-2.79;-2.79;-2.79	4.86	3.97	0.46021	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.85682	D	0.000000	D	0.91355	0.7273	M	0.69463	2.115	0.80722	D	1	P;D;D;P	0.53312	0.759;0.959;0.959;0.949	B;P;P;P	0.51777	0.396;0.679;0.679;0.55	D	0.89791	0.3968	10	0.34782	T	0.22	-0.7636	12.273	0.54716	0.0:0.0:0.8293:0.1707	.	473;561;578;561	G3XAP3;A5D8W3;Q9NUT2;Q9NUT2-2	.;.;ABCB8_HUMAN;.	N	561;544;578;473;561	ENSP00000351717:D561N;ENSP00000297504:D578N;ENSP00000438776:D473N;ENSP00000418271:D561N	ENSP00000297504:D578N	D	+	1	0	ABCB8	150370044	1.000000	0.71417	0.270000	0.24601	0.003000	0.03518	6.489000	0.73641	1.253000	0.44018	-0.314000	0.08810	GAT		0.577	ABCB8-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351733.2	NM_007188		4	57	0	0	0	0.009096	0	4	57				
PDGFRL	5157	broad.mit.edu	37	8	17434764	17434764	+	Start_Codon_SNP	SNP	G	G	C			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr8:17434764G>C	ENST00000541323.1	+	2	448	c.3G>C	c.(1-3)atG>atC	p.M1I	PDGFRL_ENST00000251630.6_Start_Codon_SNP_p.M1I|PDGFRL_ENST00000398074.3_Start_Codon_SNP_p.M1I	NM_006207.2	NP_006198.1	Q15198	PGFRL_HUMAN	platelet-derived growth factor receptor-like	1					G-protein coupled receptor signaling pathway (GO:0007186)|platelet-derived growth factor receptor-beta signaling pathway (GO:0035791)	extracellular region (GO:0005576)	platelet activating factor receptor activity (GO:0004992)|platelet-derived growth factor beta-receptor activity (GO:0005019)	p.M1I(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(5)	9				Colorectal(111;0.0752)		TTCCCGAGATGAAGGTCTGGC	0.711											OREG0018579	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003wxr.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1-3)ATG>ATC		platelet-derived growth factor receptor-like							53.0	50.0	51.0					8																	17434764		2203	4300	6503	SO:0001582	initiator_codon_variant	5157					extracellular region	platelet activating factor receptor activity|platelet-derived growth factor beta-receptor activity	g.chr8:17434764G>C	D37965	CCDS6003.1	8p22-p21.3	2013-01-29			ENSG00000104213	ENSG00000104213		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8805	protein-coding gene	gene with protein product		604584					Standard	NM_006207		Approved	PRLTS	uc003wxr.3	Q15198	OTTHUMG00000130818	ENST00000541323.1:c.3G>C	8.37:g.17434764G>C	ENSP00000444211:p.Met1Ile		OREG0018579	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	718		p.M1I	NM_006207	NP_006198	Q15198	PGFRL_HUMAN		Colorectal(111;0.0752)	1	64	+			1					A8K085|Q6FH04	Missense_Mutation	SNP	ENST00000541323.1	37	c.3G>C	CCDS6003.1	.	.	.	.	.	.	.	.	.	.	G	13.06	2.124784	0.37533	.	.	ENSG00000104213	ENST00000251630;ENST00000541323;ENST00000398074	T;T;T	0.35789	1.29;1.29;1.29	3.59	3.59	0.41128	.	0.041188	0.85682	D	0.000000	T	0.29976	0.0750	.	.	.	0.80722	D	1	B	0.22276	0.067	B	0.18263	0.021	T	0.21075	-1.0256	9	0.59425	D	0.04	-27.5167	13.0205	0.58784	0.0:0.0:1.0:0.0	.	1	Q15198	PGFRL_HUMAN	I	1	ENSP00000251630:M1I;ENSP00000444211:M1I;ENSP00000381149:M1I	ENSP00000251630:M1I	M	+	3	0	PDGFRL	17479049	1.000000	0.71417	0.993000	0.49108	0.165000	0.22458	3.767000	0.55288	2.302000	0.77476	0.462000	0.41574	ATG		0.711	PDGFRL-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253366.3	NM_006207	Missense_Mutation	4	9	0	0	0	0.009096	0	4	9				
SLC25A37	51312	broad.mit.edu	37	8	23429084	23429084	+	Missense_Mutation	SNP	G	G	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr8:23429084G>T	ENST00000519973.1	+	4	931	c.733G>T	c.(733-735)Ggg>Tgg	p.G245W	FP15737_ENST00000399967.3_5'Flank	NM_016612.2	NP_057696.2	Q9NYZ2	MFRN1_HUMAN	solute carrier family 25 (mitochondrial iron transporter), member 37	245					iron ion homeostasis (GO:0055072)|mitochondrial iron ion transport (GO:0048250)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	iron ion transmembrane transporter activity (GO:0005381)	p.G245W(1)		NS(1)|endometrium(3)|large_intestine(2)|lung(8)|urinary_tract(1)	15		Prostate(55;0.114)		Colorectal(74;0.0198)|COAD - Colon adenocarcinoma(73;0.0751)		CGGGCTGGCCGGGGCCCTCGC	0.652																																							uc003xdo.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(733-735)GGG>TGG		solute carrier family 25, member 37							25.0	29.0	28.0					8																	23429084		1907	4113	6020	SO:0001583	missense	51312				ion transport|iron ion homeostasis	integral to membrane|mitochondrial inner membrane		g.chr8:23429084G>T	AF495725	CCDS47828.1	8p21.2	2013-05-22	2012-03-29		ENSG00000147454	ENSG00000147454		"""Solute carriers"""	29786	protein-coding gene	gene with protein product	"""mitoferrin"""	610387	"""solute carrier family 25, member 37"""			16511496	Standard	XM_006716352		Approved	MSCP, MFRN, MFRN1	uc003xdo.3	Q9NYZ2	OTTHUMG00000163865	ENST00000519973.1:c.733G>T	8.37:g.23429084G>T	ENSP00000429200:p.Gly245Trp					SLC25A37_uc003xdp.2_RNA|SLC25A37_uc010ltz.2_RNA|SLC25A37_uc003xdq.2_RNA|SLC25A37_uc003xdr.1_RNA|uc003xds.2_5'Flank	p.G245W	NM_016612	NP_057696	Q9NYZ2	MFRN1_HUMAN		Colorectal(74;0.0198)|COAD - Colon adenocarcinoma(73;0.0751)	4	886	+		Prostate(55;0.114)	245			Solcar 3.|Helical; Name=5; (Potential).		A2RU93|Q53FT7|Q69YJ8|Q969S1|Q9P0J2	Missense_Mutation	SNP	ENST00000519973.1	37	c.733G>T	CCDS47828.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.688600	0.88639	.	.	ENSG00000147454	ENST00000519973	D	0.85702	-2.02	5.8	5.8	0.92144	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.96175	0.8753	H	0.99336	4.52	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97729	1.0201	10	0.87932	D	0	-3.0931	18.6148	0.91299	0.0:0.0:1.0:0.0	.	245	Q9NYZ2	MFRN1_HUMAN	W	245	ENSP00000429200:G245W	ENSP00000429200:G245W	G	+	1	0	SLC25A37	23485029	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	9.460000	0.97641	2.740000	0.93945	0.650000	0.86243	GGG		0.652	SLC25A37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376039.1	NM_016612		6	8	1	0	1.06961e-07	0.00308	1.26292e-07	6	8				
NEFM	4741	broad.mit.edu	37	8	24775338	24775338	+	Missense_Mutation	SNP	C	C	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr8:24775338C>T	ENST00000221166.5	+	3	2752	c.1970C>T	c.(1969-1971)cCg>cTg	p.P657L	NEFM_ENST00000518131.1_Intron|NEFM_ENST00000433454.2_Missense_Mutation_p.P281L|NEFM_ENST00000521540.1_Intron|NEFM_ENST00000437366.2_Intron			P07197	NFM_HUMAN	neurofilament, medium polypeptide	657	6 X 13 AA approximate tandem repeats of K-S-P-V-[PS]-K-S-P-V-E-E-[KA]-[GAK].|Tail.				axon cargo transport (GO:0008088)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|regulation of axon diameter (GO:0031133)	axon (GO:0030424)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)|neuromuscular junction (GO:0031594)	microtubule binding (GO:0008017)|structural constituent of cytoskeleton (GO:0005200)	p.P657L(1)|p.P657Q(1)		breast(3)|endometrium(7)|kidney(4)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|urinary_tract(1)	36		Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)		TCTCCTGTGCCGAAATCACCA	0.507																																							uc003xed.3		NA																	2	Substitution - Missense(2)		lung(2)	breast(1)	1						c.(1969-1971)CCG>CTG		neurofilament, medium polypeptide 150kDa isoform							100.0	101.0	100.0					8																	24775338		2203	4300	6503	SO:0001583	missense	4741					neurofilament	protein binding|structural constituent of cytoskeleton	g.chr8:24775338C>T	BC002421	CCDS6046.1, CCDS47831.1	8p21	2013-01-16	2008-09-19	2006-11-20	ENSG00000104722	ENSG00000104722		"""Intermediate filaments type IV"""	7734	protein-coding gene	gene with protein product		162250	"""neurofilament, medium polypeptide 150kDa"""	NEF3		1348579	Standard	NM_001105541		Approved	NFM, NF-M	uc003xed.4	P07197	OTTHUMG00000131990	ENST00000221166.5:c.1970C>T	8.37:g.24775338C>T	ENSP00000221166:p.Pro657Leu					NEFM_uc011lac.1_Intron|NEFM_uc010lue.2_Missense_Mutation_p.P281L	p.P657L	NM_005382	NP_005373	P07197	NFM_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)	3	2003	+		Prostate(55;0.157)	657			4.|6 X 13 AA approximate tandem repeats of K-S-P-V-[PS]-K-S-P-V-E-E-[KA]-[GAK].|Tail.		B4DGN2|E9PBF7|Q4QRK6	Missense_Mutation	SNP	ENST00000221166.5	37	c.1970C>T	CCDS6046.1	.	.	.	.	.	.	.	.	.	.	c	0.215	-1.033173	0.02029	.	.	ENSG00000104722	ENST00000221166;ENST00000433454	D;D	0.94280	-1.74;-3.39	2.52	1.55	0.23275	.	.	.	.	.	D	0.86104	0.5853	N	0.22421	0.69	0.09310	N	0.999998	B	0.02656	0.0	B	0.01281	0.0	T	0.74922	-0.3499	9	0.54805	T	0.06	.	6.0346	0.19699	0.3062:0.6938:0.0:0.0	.	657	P07197	NFM_HUMAN	L	657;281	ENSP00000221166:P657L;ENSP00000412295:P281L	ENSP00000221166:P657L	P	+	2	0	NEFM	24831243	0.000000	0.05858	0.002000	0.10522	0.074000	0.17049	-0.429000	0.06982	-0.011000	0.14247	0.197000	0.17608	CCG		0.507	NEFM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254954.2	NM_005382		20	15	0	0	0	0.016522	0	20	15				
PRKDC	5591	broad.mit.edu	37	8	48711844	48711844	+	Silent	SNP	C	C	G			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr8:48711844C>G	ENST00000314191.2	-	73	10277	c.10221G>C	c.(10219-10221)ggG>ggC	p.G3407G	PRKDC_ENST00000523565.1_5'UTR|PRKDC_ENST00000338368.3_Silent_p.G3407G	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	3408	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)	p.G3407G(1)|p.G3408G(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	CATCAATCACCCCAGCTGCAG	0.552								Non-homologous end-joining																													Esophageal Squamous(79;1091 1253 12329 31680 40677)	Esophageal Squamous(79;1091 1253 12329 31680 40677)	uc003xqi.2		NA																	2	Substitution - coding silent(2)		lung(2)	lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34						c.(10222-10224)GGG>GGC	NHEJ	protein kinase, DNA-activated, catalytic							81.0	84.0	83.0					8																	48711844		2006	4181	6187	SO:0001819	synonymous_variant	5591				cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding	g.chr8:48711844C>G		CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.10221G>C	8.37:g.48711844C>G						PRKDC_uc003xqj.2_Silent_p.G3408G|PRKDC_uc011ldh.1_Intron	p.G3408G	NM_006904	NP_008835	P78527	PRKDC_HUMAN			73	10281	-		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)	3408			FAT.		P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Silent	SNP	ENST00000314191.2	37	c.10224G>C																																																																																					0.552	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001081640		33	23	0	0	0	0.009535	0	33	23				
STAU2	27067	broad.mit.edu	37	8	74585457	74585458	+	Nonsense_Mutation	DNP	CC	CC	AA			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr8:74585457_74585458CC>AA	ENST00000521419.1	-	5	486_487	c.180_181GG>TT	c.(178-183)gtGGaa>gtTTaa	p.E61*	STAU2_ENST00000521451.1_Intron|STAU2_ENST00000521727.1_Nonsense_Mutation_p.E79*|STAU2_ENST00000522695.1_Nonsense_Mutation_p.E67*|STAU2_ENST00000523558.1_Intron|STAU2_ENST00000355780.5_Nonsense_Mutation_p.E67*|STAU2_ENST00000524104.1_Nonsense_Mutation_p.E67*|STAU2_ENST00000521210.1_5'UTR|STAU2_ENST00000522509.1_Nonsense_Mutation_p.E67*|RP11-463D19.1_ENST00000533978.1_lincRNA|STAU2_ENST00000517542.1_Nonsense_Mutation_p.E61*|STAU2_ENST00000524300.1_Nonsense_Mutation_p.E99*|STAU2_ENST00000519961.1_Nonsense_Mutation_p.E99*|STAU2_ENST00000522962.1_5'UTR			Q9NUL3	STAU2_HUMAN	staufen double-stranded RNA binding protein 2	99	DRBM 1. {ECO:0000255|PROSITE- ProRule:PRU00266}.				transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)	p.E99*(1)|p.E67*(1)		breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(1)|lung(6)|ovary(1)	19	Breast(64;0.0138)		Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)			CCATTCAGTTCCACAGTTGGAG	0.381																																							uc003xzm.2		NA																	2	Substitution - Nonsense(2)		lung(2)		0						c.(292-297)GTGGAA>GTTTAA		staufen homolog 2 isoform e																																				SO:0001587	stop_gained	27067				transport	endoplasmic reticulum|microtubule|nucleolus	double-stranded RNA binding	g.chr8:74585457_74585458CC>AA	Y19062	CCDS6214.1, CCDS55244.1, CCDS55245.1, CCDS55246.1, CCDS55247.1, CCDS55248.1	8q21.11	2013-06-05	2013-06-05		ENSG00000040341	ENSG00000040341			11371	protein-coding gene	gene with protein product		605920	"""staufen (Drosophila, RNA-binding protein) homolog 2"", ""staufen, RNA binding protein, homolog 2 (Drosophila)"""			10585778	Standard	NM_014393		Approved	39K2	uc003xzm.3	Q9NUL3	OTTHUMG00000164499	ENST00000521419.1:c.180_181delinsAA	8.37:g.74585457_74585458delinsAA	ENSP00000428681:p.Glu61*					STAU2_uc011lfg.1_Intron|STAU2_uc003xzn.2_Nonsense_Mutation_p.E67*|STAU2_uc011lfh.1_5'UTR|STAU2_uc003xzo.2_Nonsense_Mutation_p.E99*|STAU2_uc003xzp.2_Nonsense_Mutation_p.E67*|STAU2_uc011lfi.1_Nonsense_Mutation_p.E61*|STAU2_uc003xzq.2_Intron|STAU2_uc010lzk.2_Nonsense_Mutation_p.E67*|STAU2_uc010lzl.1_Intron|STAU2_uc003xzs.2_Nonsense_Mutation_p.E67*|STAU2_uc003xzr.2_Nonsense_Mutation_p.E61*	p.E99*	NM_014393	NP_055208	Q9NUL3	STAU2_HUMAN	Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)		6	530_531	-	Breast(64;0.0138)		99			DRBM 2.		B7Z1I6|B7Z292|B7Z8B4|E7ER74|E9PEI3|E9PF26|E9PF50|Q6AHY7|Q96HM0|Q96HM1|Q9NVI5|Q9UGG6	Nonsense_Mutation	DNP	ENST00000521419.1	37	c.294_295GG>TT																																																																																					0.381	STAU2-013	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000379012.2	NM_001164380		46	16	0	0	0	0.004672	0	46	16				
FAM91A1	157769	broad.mit.edu	37	8	124824817	124824817	+	Missense_Mutation	SNP	A	A	G			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr8:124824817A>G	ENST00000334705.7	+	24	2636	c.2390A>G	c.(2389-2391)cAg>cGg	p.Q797R		NM_144963.2	NP_659400	Q658Y4	F91A1_HUMAN	family with sequence similarity 91, member A1	797								p.Q797R(1)		breast(4)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28	Lung NSC(37;8.76e-13)|Ovarian(258;0.00744)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00192)			TTGCTTTCACAGTCATCGTGT	0.383																																							uc003yqv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(2389-2391)CAG>CGG		hypothetical protein LOC157769							127.0	113.0	117.0					8																	124824817		1837	4081	5918	SO:0001583	missense	157769							g.chr8:124824817A>G	AK074370	CCDS6346.2	8q24.13	2005-10-04			ENSG00000176853	ENSG00000176853			26306	protein-coding gene	gene with protein product						12477932	Standard	XM_005250806		Approved	FLJ23790	uc003yqv.3	Q658Y4	OTTHUMG00000133021	ENST00000334705.7:c.2390A>G	8.37:g.124824817A>G	ENSP00000335082:p.Gln797Arg					FAM91A1_uc011lil.1_Missense_Mutation_p.Q555R	p.Q797R	NM_144963	NP_659400	Q658Y4	F91A1_HUMAN	STAD - Stomach adenocarcinoma(47;0.00192)		24	2451	+	Lung NSC(37;8.76e-13)|Ovarian(258;0.00744)|all_neural(195;0.0741)		797					B6YY23|Q658T5|Q8TE89	Missense_Mutation	SNP	ENST00000334705.7	37	c.2390A>G	CCDS6346.2	.	.	.	.	.	.	.	.	.	.	A	6.920	0.539369	0.13250	.	.	ENSG00000176853	ENST00000334705	T	0.31769	1.48	5.89	4.72	0.59763	.	0.096807	0.64402	D	0.000001	T	0.19327	0.0464	N	0.22421	0.69	0.80722	D	1	B	0.26195	0.144	B	0.21917	0.037	T	0.03587	-1.1022	10	0.10377	T	0.69	.	13.2288	0.59929	0.8671:0.1329:0.0:0.0	.	797	Q658Y4	F91A1_HUMAN	R	797	ENSP00000335082:Q797R	ENSP00000335082:Q797R	Q	+	2	0	FAM91A1	124893998	1.000000	0.71417	0.995000	0.50966	0.674000	0.39518	3.566000	0.53805	1.033000	0.39918	0.533000	0.62120	CAG		0.383	FAM91A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256607.1	NM_144963		52	29	0	0	0	0.01441	0	52	29				
BAI1	575	broad.mit.edu	37	8	143560728	143560728	+	Missense_Mutation	SNP	G	G	C	rs372607055		TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr8:143560728G>C	ENST00000517894.1	+	8	2500	c.1606G>C	c.(1606-1608)Gtc>Ctc	p.V536L	BAI1_ENST00000323289.5_Missense_Mutation_p.V536L			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	536	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.				axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.V536L(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					CAGTTGCAGCGTCACGTGTGG	0.692																																							uc003ywm.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|pancreas(1)	8						c.(1606-1608)GTC>CTC		brain-specific angiogenesis inhibitor 1							21.0	29.0	27.0					8																	143560728		2085	4205	6290	SO:0001583	missense	575				axonogenesis|cell adhesion|negative regulation of angiogenesis|negative regulation of cell proliferation|neuropeptide signaling pathway|peripheral nervous system development	cell-cell junction|integral to plasma membrane	G-protein coupled receptor activity|protein binding	g.chr8:143560728G>C	AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.1606G>C	8.37:g.143560728G>C	ENSP00000430945:p.Val536Leu						p.V536L	NM_001702	NP_001693	O14514	BAI1_HUMAN			7	1789	+	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)		536			Extracellular (Potential).|TSP type-1 5.			Missense_Mutation	SNP	ENST00000517894.1	37	c.1606G>C		.	.	.	.	.	.	.	.	.	.	g	13.22	2.171969	0.38315	.	.	ENSG00000181790	ENST00000517894;ENST00000323289	T;T	0.64438	-0.1;-0.1	5.19	4.17	0.49024	.	0.246650	0.32736	U	0.005718	T	0.59500	0.2198	M	0.65677	2.01	0.24548	N	0.994035	B	0.31859	0.343	B	0.35931	0.214	T	0.57613	-0.7781	10	0.56958	D	0.05	.	7.9207	0.29843	0.3092:0.0:0.6908:0.0	.	536	E9PBK0	.	L	536	ENSP00000430945:V536L;ENSP00000313046:V536L	ENSP00000313046:V536L	V	+	1	0	BAI1	143557730	0.867000	0.29959	0.501000	0.27601	0.498000	0.33706	3.499000	0.53310	1.117000	0.41842	0.457000	0.33378	GTC		0.692	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379963.3	NM_001702		12	3	0	0	0	0.020292	0	12	3				
TLN1	7094	broad.mit.edu	37	9	35712916	35712916	+	Silent	SNP	C	C	G			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr9:35712916C>G	ENST00000314888.9	-	27	3830	c.3477G>C	c.(3475-3477)ctG>ctC	p.L1159L	TLN1_ENST00000540444.1_Silent_p.L1159L	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	1159					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)	p.L1159L(1)		NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TGGCCTTGTCCAGCACATCAC	0.617																																							uc003zxt.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(7)|breast(3)|ovary(2)|central_nervous_system(1)	13						c.(3475-3477)CTG>CTC		talin 1							25.0	22.0	23.0					9																	35712916		2203	4299	6502	SO:0001819	synonymous_variant	7094				axon guidance|cell adhesion|cell-cell junction assembly|cellular component movement|cytoskeletal anchoring at plasma membrane|muscle contraction|platelet activation|platelet degranulation	actin cytoskeleton|centrosome|cytosol|extracellular region|focal adhesion|intracellular membrane-bounded organelle|ruffle membrane	actin binding|insulin receptor binding|LIM domain binding|structural constituent of cytoskeleton|vinculin binding	g.chr9:35712916C>G	AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.3477G>C	9.37:g.35712916C>G							p.L1159L	NM_006289	NP_006280	Q9Y490	TLN1_HUMAN	Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)		27	3831	-	all_epithelial(49;0.167)		1159					A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Silent	SNP	ENST00000314888.9	37	c.3477G>C	CCDS35009.1																																																																																				0.617	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052353.2	NM_006289		4	4	0	0	0	0.009096	0	4	4				
TLE1	7088	broad.mit.edu	37	9	84228380	84228380	+	Silent	SNP	G	G	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr9:84228380G>A	ENST00000376499.3	-	12	2039	c.975C>T	c.(973-975)gaC>gaT	p.D325D	TLE1_ENST00000376484.1_5'UTR|TLE1_ENST00000376472.1_5'UTR|TLE1_ENST00000464999.1_5'UTR	NM_005077.3	NP_005068.2	Q04724	TLE1_HUMAN	transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)	325	Pro/Ser-rich.				multicellular organismal development (GO:0007275)|negative regulation of anoikis (GO:2000811)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of gene expression (GO:0010628)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription factor binding (GO:0008134)	p.D325D(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	29						GCGTTGGCATGTCGCTCCGAG	0.537																																					NSCLC(155;1437 1995 30668 39354 45875)|Melanoma(16;266 781 14000 47728 51870)	NSCLC(155;1437 1995 30668 39354 45875)|Melanoma(16;266 781 14000 47728 51870)	uc004aly.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(973-975)GAC>GAT		transducin-like enhancer protein 1							124.0	126.0	125.0					9																	84228380		2203	4300	6503	SO:0001819	synonymous_variant	7088				negative regulation of Wnt receptor signaling pathway|organ morphogenesis|transcription, DNA-dependent|Wnt receptor signaling pathway		transcription factor binding	g.chr9:84228380G>A		CCDS6661.1	9q21.32	2013-01-10	2001-11-28		ENSG00000196781	ENSG00000196781		"""WD repeat domain containing"""	11837	protein-coding gene	gene with protein product	"""enhancer of split groucho 1"""	600189	"""transducin-like enhancer of split 1, homolog of Drosophila E(sp1)"""			8365415, 8808280	Standard	NM_005077		Approved	ESG1, GRG1, ESG	uc004aly.3	Q04724	OTTHUMG00000021008	ENST00000376499.3:c.975C>T	9.37:g.84228380G>A						TLE1_uc004alz.2_Silent_p.D335D|TLE1_uc011lsr.1_Silent_p.D325D|TLE1_uc004ama.1_Silent_p.D325D|TLE1_uc011lss.1_Silent_p.D251D	p.D325D	NM_005077	NP_005068	Q04724	TLE1_HUMAN			12	1416	-			325			Pro/Ser-rich.		A8K495|Q5T3G4|Q969V9	Silent	SNP	ENST00000376499.3	37	c.975C>T	CCDS6661.1																																																																																				0.537	TLE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055407.1	NM_005077		10	36	0	0	0	0.013537	0	10	36				
TMOD1	7111	broad.mit.edu	37	9	100353718	100353718	+	Splice_Site	SNP	G	G	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr9:100353718G>T	ENST00000259365.4	+	9	1228		c.e9+1		TMOD1_ENST00000395211.2_Splice_Site|TMOD1_ENST00000375175.1_Splice_Site	NM_003275.3	NP_003266.1	P28289	TMOD1_HUMAN	tropomodulin 1						adult locomotory behavior (GO:0008344)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)	cortical cytoskeleton (GO:0030863)|cytosol (GO:0005829)|membrane (GO:0016020)|myofibril (GO:0030016)		p.?(1)		breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(2)|urinary_tract(1)	11		Acute lymphoblastic leukemia(62;0.154)		STAD - Stomach adenocarcinoma(157;0.105)		AATGACCTTGGTGAGTAGAAA	0.502																																							uc004axk.1		NA																	1	Unknown(1)		lung(1)		0						c.e9+1		tropomodulin 1							98.0	96.0	97.0					9																	100353718		2203	4300	6503	SO:0001630	splice_region_variant	7111				muscle filament sliding	cytosol	actin binding	g.chr9:100353718G>T		CCDS6726.1	9q22	2008-07-21		2003-03-21	ENSG00000136842	ENSG00000136842			11871	protein-coding gene	gene with protein product		190930		D9S57E, TMOD		1370827, 8661028	Standard	NM_003275		Approved	ETMOD	uc004axl.2	P28289	OTTHUMG00000020325	ENST00000259365.4:c.1015+1G>T	9.37:g.100353718G>T						TMOD1_uc004axl.1_Splice_Site_p.V339_splice	p.V339_splice	NM_003275	NP_003266	P28289	TMOD1_HUMAN		STAD - Stomach adenocarcinoma(157;0.105)	9	1228	+		Acute lymphoblastic leukemia(62;0.154)						B2RB77|Q5T7W3|Q9BUF1	Splice_Site	SNP	ENST00000259365.4	37	c.1015_splice	CCDS6726.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.235281	0.79800	.	.	ENSG00000136842	ENST00000395211;ENST00000259365;ENST00000375175	.	.	.	4.93	4.93	0.64822	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.6207	0.91319	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TMOD1	99393539	1.000000	0.71417	1.000000	0.80357	0.833000	0.47200	9.476000	0.97823	2.680000	0.91292	0.467000	0.42956	.		0.502	TMOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053320.2	NM_003275	Intron	20	46	1	0	7.45023e-12	0.010504	1.01406e-11	20	46				
COL15A1	1306	broad.mit.edu	37	9	101798476	101798476	+	Missense_Mutation	SNP	C	C	T	rs535173191		TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr9:101798476C>T	ENST00000375001.3	+	20	2737	c.2314C>T	c.(2314-2316)Cgg>Tgg	p.R772W		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	772	Triple-helical region 3 (COL3).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)	p.R772W(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				GAAAGGAGACCGGGGACCCAA	0.478																																							uc004azb.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)	6						c.(2314-2316)CGG>TGG		alpha 1 type XV collagen precursor							69.0	88.0	82.0					9																	101798476		2203	4300	6503	SO:0001583	missense	1306				angiogenesis|cell differentiation|signal transduction	collagen type XV|extracellular space|integral to membrane	binding	g.chr9:101798476C>T	L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.2314C>T	9.37:g.101798476C>T	ENSP00000364140:p.Arg772Trp						p.R772W	NM_001855	NP_001846	P39059	COFA1_HUMAN			20	2520	+		Acute lymphoblastic leukemia(62;0.0562)	772			Triple-helical region 3 (COL3).		Q5T6J4|Q9UDC5|Q9Y4W4	Missense_Mutation	SNP	ENST00000375001.3	37	c.2314C>T	CCDS35081.1	.	.	.	.	.	.	.	.	.	.	C	15.01	2.707616	0.48412	.	.	ENSG00000204291	ENST00000375001	D	0.90385	-2.66	5.39	5.39	0.77823	.	0.712615	0.14112	N	0.340618	D	0.90566	0.7043	M	0.78801	2.425	0.23936	N	0.996416	D	0.60575	0.988	B	0.41299	0.353	D	0.86550	0.1834	10	0.66056	D	0.02	-0.0728	14.9982	0.71449	0.0:1.0:0.0:0.0	.	772	P39059	COFA1_HUMAN	W	772	ENSP00000364140:R772W	ENSP00000364140:R772W	R	+	1	2	COL15A1	100838297	0.929000	0.31497	0.895000	0.35142	0.847000	0.48162	2.253000	0.43205	2.676000	0.91093	0.655000	0.94253	CGG		0.478	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053386.3	NM_001855		20	45	0	0	0	0.010504	0	20	45				
MXRA5	25878	broad.mit.edu	37	X	3229355	3229355	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chrX:3229355G>A	ENST00000217939.6	-	7	7043	c.6889C>T	c.(6889-6891)Cgc>Tgc	p.R2297C		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	2297	Ig-like C2-type 7.					extracellular vesicular exosome (GO:0070062)		p.R2297C(2)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				CGCTTGGTGCGTCCACCGCTG	0.557																																							uc004crg.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8						c.(6889-6891)CGC>TGC		adlican precursor							141.0	106.0	118.0					X																	3229355		2203	4300	6503	SO:0001583	missense	25878					extracellular region		g.chrX:3229355G>A	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.6889C>T	X.37:g.3229355G>A	ENSP00000217939:p.Arg2297Cys						p.R2297C	NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN			7	7046	-		all_lung(23;0.00031)|Lung NSC(23;0.000946)	2297			Ig-like C2-type 7.		Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	ENST00000217939.6	37	c.6889C>T	CCDS14124.1	.	.	.	.	.	.	.	.	.	.	G	10.68	1.419124	0.25552	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.28666	1.6	4.28	3.33	0.38152	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.208446	0.23748	U	0.044956	T	0.53674	0.1811	M	0.82823	2.61	0.31823	N	0.625789	D	0.89917	1.0	D	0.87578	0.998	T	0.61973	-0.6952	10	0.59425	D	0.04	.	8.4891	0.33089	0.0:0.1633:0.6652:0.1714	.	2297	Q9NR99	MXRA5_HUMAN	C	2297	ENSP00000217939:R2297C	ENSP00000217939:R2297C	R	-	1	0	MXRA5	3239355	1.000000	0.71417	0.012000	0.15200	0.033000	0.12548	2.660000	0.46749	1.760000	0.52011	0.509000	0.49947	CGC		0.557	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419		13	42	0	0	0	0.013537	0	13	42				
PDK3	5165	broad.mit.edu	37	X	24537108	24537108	+	Silent	SNP	G	G	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chrX:24537108G>T	ENST00000379162.4	+	6	889	c.654G>T	c.(652-654)ctG>ctT	p.L218L	PDK3_ENST00000441463.2_Silent_p.L218L|AC004656.1_ENST00000580722.1_RNA	NM_005391.4	NP_005382.1	Q15120	PDK3_HUMAN	pyruvate dehydrogenase kinase, isozyme 3	218	Histidine kinase. {ECO:0000255|PROSITE- ProRule:PRU00107}.				cell death (GO:0008219)|cellular metabolic process (GO:0044237)|cellular response to fatty acid (GO:0071398)|cellular response to glucose stimulus (GO:0071333)|glucose metabolic process (GO:0006006)|hypoxia-inducible factor-1alpha signaling pathway (GO:0097411)|peptidyl-serine phosphorylation (GO:0018105)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of glucose metabolic process (GO:0010906)|regulation of reactive oxygen species metabolic process (GO:2000377)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|pyruvate dehydrogenase (acetyl-transferring) kinase activity (GO:0004740)	p.L218L(2)		NS(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23						CTCCAGAGCTGGAAGTTGAAG	0.358																																							uc004dbg.2		NA																	2	Substitution - coding silent(2)		lung(2)	lung(4)|upper_aerodigestive_tract(1)|ovary(1)	6						c.(652-654)CTG>CTT		pyruvate dehydrogenase kinase 3 isoform 2							81.0	72.0	75.0					X																	24537108		2203	4300	6503	SO:0001819	synonymous_variant	5165				glucose metabolic process|peptidyl-histidine phosphorylation|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	ATP binding|protein binding|pyruvate dehydrogenase (acetyl-transferring) kinase activity|two-component sensor activity	g.chrX:24537108G>T	L42452	CCDS14212.1, CCDS48088.1	Xp22.12	2008-02-05	2005-11-16		ENSG00000067992	ENSG00000067992			8811	protein-coding gene	gene with protein product		300906	"""pyruvate dehydrogenase kinase, isoenzyme 3"""			7499431	Standard	NM_001142386		Approved		uc004dbh.3	Q15120	OTTHUMG00000021269	ENST00000379162.4:c.654G>T	X.37:g.24537108G>T						PDK3_uc004dbh.2_Silent_p.L218L	p.L218L	NM_005391	NP_005382	Q15120	PDK3_HUMAN			6	883	+			218			Histidine kinase.		B4DXG6	Silent	SNP	ENST00000379162.4	37	c.654G>T	CCDS14212.1																																																																																				0.358	PDK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056097.1	NM_005391		32	9	1	0	4.3181e-19	0.013726	6.66415e-19	32	9				
CXorf36	79742	broad.mit.edu	37	X	45051168	45051168	+	Missense_Mutation	SNP	C	C	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chrX:45051168C>A	ENST00000398000.2	-	2	400	c.326G>T	c.(325-327)cGc>cTc	p.R109L	CXorf36_ENST00000477281.1_5'UTR|RP11-342D14.1_ENST00000438181.1_RNA|RP11-342D14.1_ENST00000450527.1_RNA|CXorf36_ENST00000377934.4_Missense_Mutation_p.R109L	NM_176819.3	NP_789789.2	Q9H7Y0	DIA1R_HUMAN	chromosome X open reading frame 36	109						extracellular region (GO:0005576)		p.R109L(2)		endometrium(1)|large_intestine(2)|lung(4)	7						CTCCACAGGGCGCCAGATTTT	0.488																																							uc004dgg.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(1)	1						c.(325-327)CGC>CTC		hypothetical protein LOC79742 isoform 1							76.0	73.0	74.0					X																	45051168		2203	4300	6503	SO:0001583	missense	79742					extracellular region		g.chrX:45051168C>A	AF289581	CCDS14266.1, CCDS48096.1	Xp11.3-p11.23	2012-08-03			ENSG00000147113	ENSG00000147113			25866	protein-coding gene	gene with protein product						11944989, 21283809	Standard	NM_176819		Approved	FLJ14103, DIA1R	uc004dgg.2	Q9H7Y0	OTTHUMG00000021403	ENST00000398000.2:c.326G>T	X.37:g.45051168C>A	ENSP00000381086:p.Arg109Leu					CXorf36_uc004dgi.3_Missense_Mutation_p.R109L	p.R109L	NM_176819	NP_789789	Q9H7Y0	CX036_HUMAN			2	401	-			109					A8MUU5|B2RPN7|Q6UWJ5	Missense_Mutation	SNP	ENST00000398000.2	37	c.326G>T	CCDS48096.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.228020	0.79576	.	.	ENSG00000147113	ENST00000398000;ENST00000377934	T;T	0.59772	1.1;0.24	5.63	4.77	0.60923	.	0.064498	0.56097	D	0.000021	T	0.74619	0.3740	M	0.78049	2.395	0.48511	D	0.999666	D;D	0.89917	1.0;0.997	D;D	0.73380	0.98;0.917	T	0.77523	-0.2556	10	0.87932	D	0	.	12.2625	0.54660	0.0:0.9192:0.0:0.0808	.	109;109	Q9H7Y0-2;Q9H7Y0	.;CX036_HUMAN	L	109	ENSP00000381086:R109L;ENSP00000367168:R109L	ENSP00000367168:R109L	R	-	2	0	CXorf36	44936112	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	5.732000	0.68563	1.143000	0.42306	-0.208000	0.12717	CGC		0.488	CXorf36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056333.2	NM_024689		22	11	1	0	3.62473e-10	0.012319	4.6133e-10	22	11				
STARD8	9754	broad.mit.edu	37	X	67937333	67937333	+	Missense_Mutation	SNP	C	C	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chrX:67937333C>A	ENST00000252336.6	+	5	709	c.337C>A	c.(337-339)Cag>Aag	p.Q113K	STARD8_ENST00000374599.3_Missense_Mutation_p.Q193K|STARD8_ENST00000374597.3_Missense_Mutation_p.Q113K	NM_014725.4	NP_055540.2	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain containing 8	113					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)	p.Q113K(2)|p.Q193K(1)		NS(2)|breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	50						CACCCAGGGCCAGGAGGGTCC	0.632																																							uc004dxa.2		NA																	3	Substitution - Missense(3)		lung(3)	breast(3)|ovary(2)|pancreas(1)	6						c.(337-339)CAG>AAG		StAR-related lipid transfer (START) domain							48.0	46.0	47.0					X																	67937333		2202	4299	6501	SO:0001583	missense	9754				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion	GTPase activator activity	g.chrX:67937333C>A	D80011	CCDS14390.1, CCDS48134.1	Xq13.1	2011-09-13	2007-08-16		ENSG00000130052	ENSG00000130052		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19161	protein-coding gene	gene with protein product		300689	"""START domain containing 8"""			8724849	Standard	NM_001142504		Approved	KIAA0189, ARHGAP38	uc004dxb.3	Q92502	OTTHUMG00000021748	ENST00000252336.6:c.337C>A	X.37:g.67937333C>A	ENSP00000252336:p.Gln113Lys					STARD8_uc004dxb.2_Missense_Mutation_p.Q193K|STARD8_uc004dxc.3_Missense_Mutation_p.Q113K	p.Q113K	NM_014725	NP_055540	Q92502	STAR8_HUMAN			5	709	+			113					A8K6T2|D3DVT9|Q5JST0|Q68DG7	Missense_Mutation	SNP	ENST00000252336.6	37	c.337C>A	CCDS14390.1	.	.	.	.	.	.	.	.	.	.	c	5.448	0.267723	0.10294	.	.	ENSG00000130052	ENST00000252336;ENST00000374599;ENST00000374597	T;T;T	0.06768	3.26;3.26;3.26	4.39	3.47	0.39725	.	0.618809	0.14872	N	0.293481	T	0.07234	0.0183	L	0.51422	1.61	0.09310	N	1	B;B	0.10296	0.003;0.002	B;B	0.06405	0.002;0.001	T	0.43893	-0.9363	10	0.05525	T	0.97	.	9.3109	0.37903	0.0:0.787:0.213:0.0	.	193;113	Q92502-2;Q92502	.;STAR8_HUMAN	K	113;193;113	ENSP00000252336:Q113K;ENSP00000363727:Q193K;ENSP00000363725:Q113K	ENSP00000252336:Q113K	Q	+	1	0	STARD8	67854058	0.000000	0.05858	0.037000	0.18230	0.638000	0.38207	0.892000	0.28322	2.020000	0.59435	0.597000	0.82753	CAG		0.632	STARD8-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057026.2	NM_014725		32	5	1	0	4.65686e-17	0.017118	6.96752e-17	32	5				
ZCCHC5	203430	broad.mit.edu	37	X	77912915	77912915	+	Missense_Mutation	SNP	C	C	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chrX:77912915C>A	ENST00000321110.1	-	2	1298	c.1003G>T	c.(1003-1005)Ggg>Tgg	p.G335W		NM_152694.2	NP_689907.1	Q8N8U3	ZCHC5_HUMAN	zinc finger, CCHC domain containing 5	335							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.G335W(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)|prostate(1)|skin(1)	37						TGACCCTCCCCTTGGCAGAGT	0.463																																							uc004edc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1003-1005)GGG>TGG		zinc finger, CCHC domain containing 5							76.0	63.0	67.0					X																	77912915		2203	4300	6503	SO:0001583	missense	203430						nucleic acid binding|zinc ion binding	g.chrX:77912915C>A	AK096184	CCDS14440.1	Xq13.3	2008-02-05			ENSG00000179300	ENSG00000179300		"""Zinc fingers, CCHC domain containing"""	22997	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_152694		Approved	FLJ38865, Mar3, Mart3, ZHC5	uc004edc.1	Q8N8U3	OTTHUMG00000021892	ENST00000321110.1:c.1003G>T	X.37:g.77912915C>A	ENSP00000316794:p.Gly335Trp						p.G335W	NM_152694	NP_689907	Q8N8U3	ZCHC5_HUMAN			2	1299	-			335					B2RMZ0|Q5JQE9	Missense_Mutation	SNP	ENST00000321110.1	37	c.1003G>T	CCDS14440.1	.	.	.	.	.	.	.	.	.	.	C	0.042	-1.281019	0.01398	.	.	ENSG00000179300	ENST00000321110	T	0.21734	1.99	3.2	0.315	0.15852	.	0.762784	0.09975	U	0.731770	T	0.16471	0.0396	L	0.54323	1.7	0.09310	N	0.999999	B	0.25007	0.116	B	0.21151	0.033	T	0.35025	-0.9805	10	0.52906	T	0.07	.	1.2947	0.02067	0.226:0.4191:0.2174:0.1376	.	335	Q8N8U3	ZCHC5_HUMAN	W	335	ENSP00000316794:G335W	ENSP00000316794:G335W	G	-	1	0	ZCCHC5	77799571	0.031000	0.19500	0.104000	0.21259	0.027000	0.11550	-0.230000	0.09083	-0.061000	0.13110	0.506000	0.49869	GGG		0.463	ZCCHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057319.1	NM_152694		18	6	1	0	2.35188e-11	0.006122	3.13584e-11	18	6				
HDX	139324	broad.mit.edu	37	X	83723704	83723704	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chrX:83723704G>A	ENST00000297977.5	-	3	1138	c.1027C>T	c.(1027-1029)Ccc>Tcc	p.P343S	HDX_ENST00000373177.2_Missense_Mutation_p.P343S|HDX_ENST00000506585.2_Missense_Mutation_p.P285S	NM_001177479.1|NM_144657.4	NP_001170950.1|NP_653258.2	Q7Z353	HDX_HUMAN	highly divergent homeobox	343						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.P343S(1)|p.P343T(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(12)|liver(1)|lung(19)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	48						CCTGGTCCGGGCAAGGTTGTA	0.423																																					Pancreas(53;231 1169 36156 43751 51139)	Pancreas(53;231 1169 36156 43751 51139)	uc004eek.1		NA																	2	Substitution - Missense(2)		lung(1)|endometrium(1)	upper_aerodigestive_tract(1)|ovary(1)	2						c.(1027-1029)CCC>TCC		highly divergent homeobox							103.0	85.0	91.0					X																	83723704		2203	4300	6503	SO:0001583	missense	139324					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chrX:83723704G>A	BX538112	CCDS35342.1, CCDS55456.1	Xq21.1	2012-03-09	2007-07-13	2007-07-13	ENSG00000165259	ENSG00000165259		"""Homeoboxes / POU class"""	26411	protein-coding gene	gene with protein product			"""chromosome X open reading frame 43"""	CXorf43			Standard	NM_144657		Approved	FLJ30678	uc004eek.2	Q7Z353	OTTHUMG00000021926	ENST00000297977.5:c.1027C>T	X.37:g.83723704G>A	ENSP00000297977:p.Pro343Ser					HDX_uc011mqv.1_Missense_Mutation_p.P343S|HDX_uc004eel.1_Missense_Mutation_p.P285S	p.P343S	NM_144657	NP_653258	Q7Z353	HDX_HUMAN			3	1136	-			343					A8K1Y5|B7ZL18|Q5JZB4|Q96NK7	Missense_Mutation	SNP	ENST00000297977.5	37	c.1027C>T	CCDS35342.1	.	.	.	.	.	.	.	.	.	.	G	3.187	-0.166668	0.06461	.	.	ENSG00000165259	ENST00000297977;ENST00000373177;ENST00000506585	T;T;T	0.30182	1.56;1.54;1.56	5.53	-0.352	0.12598	.	0.558339	0.19272	N	0.118363	T	0.15565	0.0375	N	0.12746	0.255	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.19289	-1.0310	10	0.30078	T	0.28	-20.1943	11.5249	0.50573	0.52:0.0:0.48:0.0	.	343	Q7Z353	HDX_HUMAN	S	343;285;343	ENSP00000297977:P343S;ENSP00000362272:P285S;ENSP00000423670:P343S	ENSP00000297977:P343S	P	-	1	0	HDX	83610360	0.711000	0.27906	0.001000	0.08648	0.621000	0.37620	-0.404000	0.07205	-0.232000	0.09811	0.422000	0.28245	CCC		0.423	HDX-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057379.2	NM_144657		3	47	0	0	0	0.004672	0	3	47				
KLHL4	56062	broad.mit.edu	37	X	86877364	86877364	+	Missense_Mutation	SNP	A	A	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chrX:86877364A>T	ENST00000373119.4	+	5	1223	c.1078A>T	c.(1078-1080)Agg>Tgg	p.R360W	KLHL4_ENST00000373114.4_Missense_Mutation_p.R360W	NM_019117.4	NP_061990.2	Q9C0H6	KLHL4_HUMAN	kelch-like family member 4	360						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.R360W(2)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(29)|ovary(2)|prostate(1)|skin(1)	67						TGTGCAGAATAGGCAAGGAGA	0.408																																							uc004efb.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						c.(1078-1080)AGG>TGG		kelch-like 4 isoform 1							165.0	137.0	146.0					X																	86877364		2203	4300	6503	SO:0001583	missense	56062					cytoplasm|microtubule cytoskeleton|nucleolus	actin binding	g.chrX:86877364A>T	AF284765	CCDS14456.1, CCDS14457.1	Xq21.3	2013-01-30	2013-01-30		ENSG00000102271	ENSG00000102271		"""Kelch-like"", ""BTB/POZ domain containing"""	6355	protein-coding gene	gene with protein product		300348	"""kelch (Drosophila)-like 4"", ""kelch-like 4 (Drosophila)"""			11401425	Standard	NM_019117		Approved	KIAA1687, DKELCHL, KHL4	uc004efa.2	Q9C0H6	OTTHUMG00000021946	ENST00000373119.4:c.1078A>T	X.37:g.86877364A>T	ENSP00000362211:p.Arg360Trp					KLHL4_uc004efa.2_Missense_Mutation_p.R360W	p.R360W	NM_019117	NP_061990	Q9C0H6	KLHL4_HUMAN			5	1260	+			360					B2RTW2|Q9Y3J5	Missense_Mutation	SNP	ENST00000373119.4	37	c.1078A>T	CCDS14457.1	.	.	.	.	.	.	.	.	.	.	A	18.65	3.669165	0.67814	.	.	ENSG00000102271	ENST00000373119;ENST00000373114	T;T	0.74209	-0.82;-0.82	5.38	5.38	0.77491	BTB/Kelch-associated (2);	0.000000	0.85682	D	0.000000	D	0.90635	0.7063	H	0.98466	4.24	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.92451	0.5970	10	0.87932	D	0	.	9.5975	0.39582	0.6899:0.3101:0.0:0.0	.	360;360	Q9C0H6;Q9C0H6-2	KLHL4_HUMAN;.	W	360	ENSP00000362211:R360W;ENSP00000362206:R360W	ENSP00000362206:R360W	R	+	1	2	KLHL4	86764020	0.978000	0.34361	0.996000	0.52242	0.533000	0.34776	2.609000	0.46317	1.784000	0.52394	0.417000	0.27973	AGG		0.408	KLHL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057413.1			40	14	0	0	0	0.013114	0	40	14				
RP1-274L7.1	0	broad.mit.edu	37	X	129629590	129629590	+	lincRNA	SNP	C	C	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chrX:129629590C>A	ENST00000458525.1	-	0	1015				FAM45B_ENST00000592932.1_RNA														p.A153D(1)									GCCCGAAAGGCCTACCCGGCT	0.413																																							uc010nrh.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(457-459)GCC>GAC		hypothetical protein LOC404636							117.0	109.0	112.0					X																	129629590		2203	4300	6503			55855							g.chrX:129629590C>A																													X.37:g.129629590C>A						uc004evu.2_Intron	p.A153D	NM_207009	NP_996892				all cancers(201;0.0293)	1	676	+									Missense_Mutation	SNP	ENST00000458525.1	37	c.458C>A																																																																																					0.413	RP1-274L7.1-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000058271.1			37	20	1	0	6.97489e-18	0.021022	1.06803e-17	37	20				
SAGE1	55511	broad.mit.edu	37	X	134988657	134988657	+	Missense_Mutation	SNP	G	G	A			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chrX:134988657G>A	ENST00000370709.3	+	6	683	c.683G>A	c.(682-684)cGg>cAg	p.R228Q	SAGE1_ENST00000537770.1_Intron|SAGE1_ENST00000324447.3_Missense_Mutation_p.R228Q|SAGE1_ENST00000535938.1_Missense_Mutation_p.R228Q			Q9NXZ1	SAGE1_HUMAN	sarcoma antigen 1	228						nucleus (GO:0005634)		p.R228Q(1)		breast(5)|endometrium(5)|large_intestine(10)|lung(23)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	55	Acute lymphoblastic leukemia(192;0.000127)					CTTCGACCACGGCGTATTAAT	0.418																																							uc004ezh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(682-684)CGG>CAG		sarcoma antigen 1							190.0	160.0	170.0					X																	134988657		2203	4300	6503	SO:0001583	missense	55511							g.chrX:134988657G>A	AJ278111	CCDS14652.1	Xq26	2009-03-25			ENSG00000181433	ENSG00000181433			30369	protein-coding gene	gene with protein product	"""cancer/testis antigen 14"""	300359				10919659	Standard	NM_018666		Approved	SAGE, CT14	uc004ezh.3	Q9NXZ1	OTTHUMG00000022496	ENST00000370709.3:c.683G>A	X.37:g.134988657G>A	ENSP00000359743:p.Arg228Gln					SAGE1_uc010nry.1_Missense_Mutation_p.R197Q|SAGE1_uc011mvv.1_Intron	p.R228Q	NM_018666	NP_061136	Q9NXZ1	SAGE1_HUMAN			7	850	+	Acute lymphoblastic leukemia(192;0.000127)		228					Q5JNW0	Missense_Mutation	SNP	ENST00000370709.3	37	c.683G>A	CCDS14652.1	.	.	.	.	.	.	.	.	.	.	G	5.516	0.280126	0.10458	.	.	ENSG00000181433	ENST00000324447;ENST00000535938;ENST00000370709	T;T;T	0.40476	1.03;1.03;1.03	1.18	-2.37	0.06643	.	.	.	.	.	T	0.13756	0.0333	N	0.08118	0	0.09310	N	1	P	0.35192	0.489	B	0.20767	0.031	T	0.20472	-1.0274	9	0.15952	T	0.53	.	4.3112	0.10971	0.5605:0.0:0.4395:0.0	.	228	Q9NXZ1	SAGE1_HUMAN	Q	228	ENSP00000323191:R228Q;ENSP00000445959:R228Q;ENSP00000359743:R228Q	ENSP00000323191:R228Q	R	+	2	0	SAGE1	134816323	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.063000	0.11655	-0.658000	0.05366	-1.346000	0.01242	CGG		0.418	SAGE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058448.1	NM_018666		73	110	0	0	0	0.01441	0	73	110				
IRS2	8660	broad.mit.edu	37	13	110435129	110435129	+	Frame_Shift_Del	DEL	G	G	-	rs533420684		TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr13:110435129delG	ENST00000375856.3	-	1	3786	c.3272delC	c.(3271-3273)ccgfs	p.P1091fs		NM_003749.2	NP_003740.2	Q9Y4H2	IRS2_HUMAN	insulin receptor substrate 2	1091					brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular response to glucose stimulus (GO:0071333)|cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid homeostasis (GO:0055088)|mammary gland development (GO:0030879)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of kinase activity (GO:0033673)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mesenchymal cell proliferation (GO:0002053)|regulation of lipid metabolic process (GO:0019216)|response to glucose (GO:0009749)|signal transduction (GO:0007165)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	19	all_cancers(4;7.57e-15)|all_epithelial(4;5.91e-09)|all_lung(23;7.64e-07)|Lung NSC(43;0.000183)|Colorectal(4;0.00159)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0155)	Breast(118;0.159)	all cancers(43;0.00815)|BRCA - Breast invasive adenocarcinoma(86;0.11)|Epithelial(84;0.127)|GBM - Glioblastoma multiforme(44;0.147)			TTCTGGCTTCGGGGGGGCCGC	0.682																																					Melanoma(100;613 2409 40847)	Melanoma(100;613 2409 40847)	uc001vqv.2		NA																	0				large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)|skin(1)|ovary(1)|kidney(1)	8						c.(3271-3273)CCGfs		insulin receptor substrate 2							6.0	7.0	7.0					13																	110435129		2031	4088	6119	SO:0001589	frameshift_variant	8660				fibroblast growth factor receptor signaling pathway|glucose metabolic process|insulin receptor signaling pathway|lipid homeostasis|negative regulation of B cell apoptosis|negative regulation of kinase activity|negative regulation of plasma membrane long-chain fatty acid transport|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of B cell proliferation|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of insulin secretion|response to glucose stimulus	cytosol|plasma membrane	insulin receptor binding|signal transducer activity	g.chr13:110435129delG	AB000732	CCDS9510.1	13q34	2013-01-10			ENSG00000185950	ENSG00000185950		"""Pleckstrin homology (PH) domain containing"""	6126	protein-coding gene	gene with protein product		600797				9312143	Standard	NM_003749		Approved		uc001vqv.3	Q9Y4H2	OTTHUMG00000017338	ENST00000375856.3:c.3272delC	13.37:g.110435129delG	ENSP00000365016:p.Pro1091fs						p.P1091fs	NM_003749	NP_003740	Q9Y4H2	IRS2_HUMAN	all cancers(43;0.00815)|BRCA - Breast invasive adenocarcinoma(86;0.11)|Epithelial(84;0.127)|GBM - Glioblastoma multiforme(44;0.147)		1	3786	-	all_cancers(4;7.57e-15)|all_epithelial(4;5.91e-09)|all_lung(23;7.64e-07)|Lung NSC(43;0.000183)|Colorectal(4;0.00159)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0155)	Breast(118;0.159)	1091					Q96RR2|Q9BZG0|Q9Y6I5	Frame_Shift_Del	DEL	ENST00000375856.3	37	c.3272delC	CCDS9510.1																																																																																				0.682	IRS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045755.1	NM_003749		2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
BIRC6	57448	broad.mit.edu	37	2	32658718	32658719	+	Frame_Shift_Ins	INS	-	-	T			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr2:32658718_32658719insT	ENST00000421745.2	+	13	3389_3390	c.3255_3256insT	c.(3256-3258)tggfs	p.W1086fs		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	1086					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					ACAGCAACAGCTGGGATGAACA	0.351																																					Pancreas(94;175 1509 16028 18060 45422)	Pancreas(94;175 1509 16028 18060 45422)	uc010ezu.2		NA																	0				ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14						c.(3253-3258)AGCTGGfs		baculoviral IAP repeat-containing 6																																				SO:0001589	frameshift_variant	57448				anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding	g.chr2:32658718_32658719insT	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.3256dupT	2.37:g.32658719_32658719dupT	ENSP00000393596:p.Trp1086fs						p.S1085fs	NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN			13	3389_3390	+	Acute lymphoblastic leukemia(172;0.155)		1085_1086					Q9ULD1	Frame_Shift_Ins	INS	ENST00000421745.2	37	c.3255_3256insT	CCDS33175.2																																																																																				0.351	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252		10	11	NA	NA	NA	NA	NA	10	11	---	---	---	---
SPDYE1	285955	broad.mit.edu	37	7	44042208	44042208	+	Frame_Shift_Del	DEL	C	C	-			TCGA-05-5423-01A-01D-1625-08	TCGA-05-5423-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	209d853d-6c50-4223-a572-a90d58aee51e	6452e130-5262-4556-b762-a7c3b4e53f74	g.chr7:44042208delC	ENST00000258704.3	+	2	416	c.279delC	c.(277-279)agcfs	p.S93fs	AC004951.6_ENST00000447643.1_lincRNA|RP5-1165K10.2_ENST00000454572.1_RNA|POLR2J4_ENST00000427076.1_RNA	NM_001099435.2|NM_175064.2	NP_001092905.2|NP_778234.2	Q8NFV5	SPDE1_HUMAN	speedy/RINGO cell cycle regulator family member E1	93										endometrium(1)|kidney(4)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)	11						TAGATCCCAGCCCCCCGCATA	0.572																																							uc003tjf.2		NA																	0				ovary(1)	1						c.(277-279)AGCfs		Williams Beuren syndrome chromosome region 19							16.0	16.0	16.0					7																	44042208		1330	2261	3591	SO:0001589	frameshift_variant	285955							g.chr7:44042208delC	AF412027	CCDS5475.1	7q11.23	2013-05-08	2013-05-08	2009-02-17	ENSG00000136206	ENSG00000136206		"""Speedy homologs"""	16408	protein-coding gene	gene with protein product	"""Speedy E"""		"""Williams Beuren syndrome chromosome region 19"", ""speedy homolog E1 (Xenopus laevis)"""	WBSCR19		12073013	Standard	NM_175064		Approved	Ringo1, SPDYE	uc003tjf.3	Q8NFV5	OTTHUMG00000128985	ENST00000258704.3:c.279delC	7.37:g.44042208delC	ENSP00000258704:p.Ser93fs					POLR2J4_uc003tjc.2_Intron|POLR2J4_uc003tjd.2_Intron|POLR2J4_uc010kxw.2_Intron|POLR2J4_uc003tje.3_Intron	p.S93fs	NM_175064	NP_778234	Q8NFV5	SPDE1_HUMAN			2	415	+			93					Q9NTH5	Frame_Shift_Del	DEL	ENST00000258704.3	37	c.279delC	CCDS5475.1																																																																																				0.572	SPDYE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250974.1	NM_175064		3	3	NA	NA	NA	NA	NA	3	3	---	---	---	---
